DOE Office of Scientific and Technical Information (OSTI.GOV)

None

Por encargo del Secretario Abraham, la Oficina de Eficiencia Energética y Energía Renovable suministra el liderazgo a nivel nacional para impulsar las tecnologías de eficiencia energética y energía renovables, para saltar por encima de las limitaciones del status quo, y para alcanzar beneficios ambientales notables. El Programa de Tecnologías Geotérmicas, parte crítica de nuestro esfuerzo conjunto, está avanzando a grandes zancadas para aumentar la viabilidad y el despliegue de electricidad ...

Manual de control de calidad del Inventario Forestal Nacional (IFN) [Quality control manual of the National Forest Inventory (NFI)

Treesearch

P. Barbosa; F. Herrera; S. Goeking; V. Nieto; M. Pena; S. Ortiz

2014-01-01

El Inventario Forestal Nacional de Colombia (IFN) incluye un programa de Aseguramiento de Calidad (AC) para garantizar la confiabilidad de todos los datos recogidos y generados en la etapa de muestreo. El objetivo de este programa; es proporcionar un marco que asegure que la información compilada acerca de los bosques es completa, exacta, imparcial y de calidad...

PROGRAMA PARA LA VERIFICACIN DE LA TECNOLOGIA AMBIENTAL/ENVIRONMENTAL TECHNOLOGY VERIFICATION PROGRAM (ETV) (EPA/600/F-98/015A)

EPA Science Inventory

A travs de su historia, la Agencia de Proteccin del Medio Ambiente estadounidense (U.S. Environmental Protection Agency, EPA) ha evaluado distintas tecnologas para determinar su efectividad en el monitoreo, la prevencin, el control, y la limpieza de la contaminacin ambiental. Sin...

Home Delivery Medicament Program: access, inactivity and cardiovascular risk.

PubMed

Araújo, Roque da Silva; Arcuri, Edna Apparecida Moura; Lopes, Victor Cauê

2016-10-10

to verify causes of inactivity in the Home Delivery Medicament Program, as referred by users from a Primary Health Care Service in São Paulo, comparing them to the causes registered in the program and analyzing them in the theoretical model Concept of Access to Health. cross-sectional study, interviewing 111 inactive users; and documentary study in the program records. half of the users did not know the condition of inactivity. Discrepancies were found between the user's and the program's information, observing different levels of agreement: Absence of physician and administrative staff member 0%; Transfer to other service 25%; Death 50%; Option to quit 50%; Address change 57% and Change in therapeutic schedule 80%. The users' feeling of accepting the program was observed. In the health access concept, inactivity can be explained in the information dimension, in the degree of asymmetry between the patient's and the health professional's knowledge, identified through the indicators: education, knowledge and information sources. due to the low education level, the user does not assimilate the information on the steps of the program flowchart, does not return for the assessment that guarantees its continuity. Consequently, (s)he stops receiving the medication and spends a long time without treatment, increasing the cardiovascular risk of hypertensive (92% of the sample), diabetic (44%) and dyslipidemic patients (31%). verificar causas de inatividade no Programa Remédio em Casa, referidas por usuários de Unidade Básica de Saúde de São Paulo, comparando-as às registradas pelo programa e analisando-as no modelo teórico Conceito de Acesso à Saúde. estudo transversal entrevistando 111 usuários inativos; e documental, nos registros do programa. metade dos usuários desconhecia a condição de inatividade. Constatadas discrepâncias nas informações usuário versus programa, observando-se diferentes níveis de concordância: Falta de médico e funcionário administrativo 0%; Transferência para outra unidade 25%; Óbito 50%; Opção desistir 50%; Mudança de endereço 57% e Mudança de esquema terapêutico 80%. Observados sentimentos de aceitação do programa pelos usuários. No conceito de acesso à saúde, a inatividade pode ser explicada na dimensão Informação, no grau de assimetria entre o conhecimento do paciente e do profissional de saúde, identificada pelos indicadores: escolaridade, conhecimento e fontes de informação. devido ao baixo nível de escolaridade, o usuário não assimila as informações sobre as etapas do fluxograma do programa, não retorna para a avaliação que garante sua continuidade. Consequentemente, para de receber medicamentos e permanece longo tempo sem tratamento, o que aumenta o risco cardiovascular dos hipertensos (92% da amostra), diabéticos (44%) e dislipidêmicos (31%). verificar causas de inactividad en el Programa Medicamento en Casa, referidas por usuarios de Unidad Básica de Salud de São Paulo, comparándolas a las registradas por el programa y analizándolas en el modelo teórico Concepto de Acceso a la Salud. estudio trasversal entrevistando 111 usuarios inactivos; y documental, en los registros del programa. la mitad de los usuario desconocía la condición de inactividad. Constatadas discrepancias en las informaciones usuario versus programa, observándose diferentes niveles de concordancia: Falta de médico y funcionario administrativo 0%; Trasferencia para otra unidad 25%; Óbito 50%; Opción desistir 50%; Cambio de dirección 57% y Cambio de esquema terapéutico 80%. Observados sentimientos de aceptación del programa por los usuarios. En el concepto de acceso a la salud, la inactividad puede ser explicada en la dimensión Información, en el grado de asimetría entre el conocimiento del paciente y del profesional de salud, identificada por los indicadores: escolaridad, conocimiento y fuentes de información. debido al bajo nivel de escolaridad, el usuario no asimila las informaciones sobre las etapas del diagrama de flujo del programa, no regresa para la evaluación que garantiza su continuidad. Consecuentemente, deja de recibir medicamentos y sigue largo tiempo sin tratamiento, lo que aumenta el riesgo cardiovascular de los hipertensivos (92% de la muestra), diabéticos (44%) y dislipidémicos (31%).

DEVELOPMENT OF METRICS FOR ARTICLES PUBLISHED IN PROFESSIONAL MASTER'S COURSE.

PubMed

Brito, Marcus Vinicius Henriques; Carneiro, Francisca Regina Oliveira

2015-01-01

Propose metric to qualify the production conveyed through articles published in Professional Master's Programs and, from there, to establish guidance for the evaluation of postgraduate programs of Medicine III. Analysis of the documents of 2013 area graduate programs strict sense concerning the application and measurement of score the articles published, and creation of proposal for metric of the theme with the quadrennial review of Medicine III. Were evaluated the medicines area documents I, II and III; Biological Sciences (I) and Interdisciplinary, as well as the 2013 reports of CAPES. All programs establish metrics for "Classification of Published Articles" within its bibliographic production although with different percentages respecting its specificities. With these data collected and correlating their relevance with the surgical areas, was drafted proposal for quantification of the quality of the published articles to "Professional Postgraduate Programs" at surgical area that have specific characteristics according to their guidelines, directing their scientific production to technique journals preferably. The metric suggested for published articles, that should be included in intellectual production of the Area Document, should be considered for the extract A1 = 100 points; A2 = 85 points; B1 = 80 points; B2 = 70 points; B3 = 60 points; B4 = 40 points and B5 = 20 points. Propor métrica para qualificar a produção veiculada através de artigos publicados em programas de mestrado profissional e, a partir daí, estabelecer orientação para a avaliação dos programas de pós-graduação da Medicina III. Análise dos documentos de área de 2013 dos programas de pós-graduação senso estrito no que concerne à aplicação e mensuração de pontuação a artigos publicados, e criação de proposta para métrica do tema com vistas à avaliação quadrienal da Medicina III. Foram avaliados os documentos de área das Medicinas I, II e III; Ciências Biológicas I e Interdisciplinar, assim como os relatórios de 2013 da CAPES. Todos os programas estabelecem métrica para "Classificação de Artigos Publicados" dentro de sua produção bibliográfica embora com percentuais diferentes respeitando suas especificidades. Com esses dados levantados e correlacionando-se sua pertinência com as áreas cirúrgicas, foi elaborada proposta de quantificação da qualidade dos artigos publicados para "Programas de Pós-graduação Profissionais" na área cirúrgica que possuem características próprias de acordo com suas diretrízes, direcionando assim sua produção científica preferencialmente para revistas técnicas. A métrica sugerida para artigos publicados, que deve ser incluída na produção intelectual do Documento de Área, deverá ser considerada para o extrato A1 = 100 pontos; A2 = 85 pontos; B1 = 80 pontos; B2 = 70 pontos; B3 = 60 pontos; B4 = 40 pontos e B5 = 20 pontos.

Efecto del Programa de Entrenamiento “Manejo del Dolor” en la Documentación de Enfermería en el Expediente Electrónico

PubMed Central

Monsiváis, María Guadalupe Moreno; Guzmán, Ma. Guadalupe Interial; Flores, Paz Francisco Sauceda; Arreola, Leticia Vázquez

2012-01-01

Resumen En el presente trabajo se muestra la importancia de entrenar al personal de enfermería para mejorar la documentación en el expediente electrónico. Se eligió el manejo del dolor por ser un área prioritaria; una alta proporción de pacientes en período post operatorio cursa con dolor, por lo tanto, la documentación debe ser útil para la toma de decisiones clínicas. Se implementó un programa de entrenamiento denominado “Manejo del Dolor” dirigido al personal de enfermería. Se utilizó la tecnología de la información como herramienta para fortalecer el conocimiento con base en la revisión sistemática de la literatura; el personal de enfermería participante seleccionó la mejor evidencia; posteriormente se trabajó en la transferencia de este conocimiento a la práctica a través del diseño de un protocolo para el manejo del dolor. Se concluye que el conocimiento del manejo del dolor es fundamental para que enfermería documente con mayor precisión sus intervenciones. PMID:24199106

Inmetro - Instituto Nacional de Metrologia, Qualidade e Tecnologia

Science.gov Websites

Consumidor Laboratórios Legislação Comunicação Social Programa de Monitoramento BPL Produtos analisados de selos Indique! Sugestão para o Programa de Análise de Produtos Licitações Material de Portal do Governo Brasileiro mdic Carta de Serviços Inmetro nos Estados Acre Alagoas AmapÃ

Measurement and evaluation of national family planning programs.

PubMed

Mauldin, W P

1967-03-01

RESUMEN: En los últimos quince años diez paises han inaugurado programas nacionales de planeamiento familiar: India, Pakistán, Corea del Sur, Taiwan, Turquía, Malasia, Ceilán, Túez, la República Arabe Unida, y Marruecos. Otros paises, incluyendo Tailandia, Hong Kong, Singapur, Kenya, Barbados, Trinidad y los Estados Unidos, apoyan y/o estimulan actividades de planeamiento familiar. En la mayor parte de los casos la razón fundamental del programa ha sido que si la tasa de crecimiento poblacional disminuyera, aumentaría la tasa de crecimiento económico.Las metas de largo alcance, expresadas típicamente en términos de reducir las tasa.de de natalidad o de crecimiento, tienen su ejemplo en el propósito de Pakistán de reducir su tasa de crecimiento a 26 para 1970; el de Corea de reducir su tasa de natalidad a 20 para 1971; y el de India de reducir su tasa de natalidad a 25 para 1973.Los objectivos intermedios, que cubren diversos aspectos del pro grama, incluyen metas específicas para un determinado mes a año, considerando personal, la adquisición de anticonceptivos, y el número de usarios por método. Las metas específicas anuales de aceptantes de dispositivos intrauterinos (IUD), para Taiwán, Corea, Túnez, Pakistán e India, son comunes, tanto por la naturaleza del artefacto, como por la facilidad de medición de los que continúan utilizándolos. El programa de evaluación en Taiwán, que trata de medir por diversos medios los efectos inmediatos, mediatos y de largo plazo del programa de planeamiento familiar sirve de modelo. El propósito de la evaiuación de un programa de planeamiento familiar es contribuir a la efectividad y eficiencia del programa, midiendo y analizando su progreso. Las áreas a medir pueden ser clasificadas como- (1) conocimiento acerca de; (2) actitudes hacia; (3) práctica de control de natalidad; y (4) nivel de fecundidad.Un buen sistema de evaluación debería incluir: A. Un buen conjunto de estadísticas de servicio presentadas en formularios estandarizados, en las siguienies formas: 1. Informes nensuales por áreas administrativas, sobre los actuales servicios de planeamiento familiar proporcionados en la actualidad, de carácter permanente o de larga duración (al presente, esterilización y IUD de acuerdo a las siguientes características del receptor: residencia, edad, paridad (número de hijos vivos por sexo), y donde se enteró del programa, si es posible "clase";(probablemente educación de la madre, pero posiblemente ocupación del esposo, ingreso, o equivalente); prácticas anticonceptivas anteriores; intervalo; y deseo de tener más hijos. En un programa grande estos datos pueden obtenerse en base a una muestra. 2. Informes mensuales sobre la distribución de suministros anticonceptivos (condones, píldoras, sustancias efervescentes, etc.), los primeros suministros deben ir acompañados de un registro de las características del recipiente, como anteriormente; los suministros subsecuentes se regietrarán sólo en volumen bruto. Esto también se aplicará al ritmo, donde éste método se enseñe a un número considerable de mujeres. 3. Informes regulares sobre las actividades de planeamiento familiar de médicos privados, como una estimación del efecto catalítico del programa del gobierno sobre ci sector privado. 4. Datos generates mensuales, ppr áreas admirtistrativas importantes, sabre: visitas domiciliarias, reuniones, cuñas radiates y televisadas, avisos en los periódicos y personal que trabaja. 5. Para propósitos de seguimiento una entrevi eta de campo cada 6 a 12 meses a cada N mujer de las listas para (1) y (2) arriba, en un total de 300 o 400, para conocer las tasas de continuación y las razones de abandono (ej: desea otro hijo, insatisfecha can ci método, otras). Las mue.stras podrían ser de 300 cada una, con una supuesta experiencia de 6, 12, 18 y 24 meses. B. Un buen conjunto de datos sobre costa (datos sobre cotos actulaes atribuíbles directamente al programa de planeamiento familiar) fraccionados par áreas principales y cinco a seis categorías de costos importantes tales coma: adminietración, personal de campo, publicidad, suministros, etc. C. Un buen conjunto de dates globales sobre la distribución de los suministros comerciales que puedan llegar tan cerca como sea posible del último consumidor, to cual significa probablemente obtener información de los mayoristas. D. Una encuesta de conocimientos, actitudes y prácticas (KAP) para una evaluación general cada dos años. Las preguntas básicas (además de las antes mencionadas y estatus marital y étnico cuando sea pertinente) son: actitud hacia e interés por la anticoncepción, número de niños por sexo, deseo de tener más hijos, prácticas anticonceptivas, experiencia sobre abortos, tal vez historia de embarazo (especialmente si esta producirá una tasa de fecundidad válida), aprobación del programa gubernamental (para uso politico), y si está actualmente embarazada (la única y mejor pregunta cuya respuesta habla del efecto sobre la tasa de natalidad). Administrativamente, la responsabilidad por la evalucion debe estar cerca al director, se debe tomar provisiones para obtener informes regulares (meneulaes) y especiales dirigidos a preguntar sobre política. El corolario es que el jefe de evaluación debe tener la confianza del director y debe estar al día en cuanto a las decisiones sabre la politics a seguir. Su trabajo consiste en extractar los aspectos principales que funcionan bien y los no operantes. En cuanto a costos, la evaluación debe hacerse sobre no más del 10 par ciento del costa del programa en paises pequeños (de menos de 30 milliones) y sabre no más del 5 per ciento en paises más grandes.Para medir en que forma el programa satisface el criterio final-la magnitud en que cambia la fecundidad-se debe realizar un trabajo más elaborado en el centro (Universidades, Consejos de población, etc.) para desarrollar una forma (a formas) segura de traducir las estadísticas de servicio en práticas y tal vez aún datos sobre suministro comercial en datos sabre tasas de natalidad. Esto incluye, par ejemplo, los esfuerzos para consolidar observaciones coma "cinco años-mujer de usa de IUD, a 400 condones equivalen a la prevención de un nacimiento," y esfuerzos como los de Pakistán de calcular tasas coma "años de protección de una pareja contra el embarazo."In the belief that a decrease in the rate of population growth will increase economic development, more than ten countries have inaugurated family planning programs in the past fifteen years. To provide a model for measuring the immediate, intermediate, and long-term effects of any such program, the authors use the Taiwan evaluation.The model suggests that a good system of evaluation should include monthly statistics on (1) participants, who are grouped by characteristics; (2) the distribution of supplies, reported at first by the characteristics of recipients, but after by gross volume only; (3) family planning activities of private physicians to measure the catalytic effect on the private sector; (4) new contacts and amount of advertising in mass media; (5) costs broken down by areas and by cost categories; and (6) distribution of commercial supplies. In addition, the program should conduct 300-400 interviews every 6-12 months to learn the rates of continuation and the rates and reasons for discontinuation. Finally, a KAP survey should be conducted every two years.The administration of the evaluation should be close to the director for policy decisions and for the ultimate work of evaluation-the finding of new ways to measure the main goal of change in fertility by the translation of statistics on Services provided and commercial supplies into birth rate data.

Primer registro para Peru del genero Nielsonia Young, 1977 (Hemiptera: Cicadellidae: Cicadellinae: Cicadellini)

USDA-ARS?s Scientific Manuscript database

En este articulo se reporta por primera vez para el Peru una especies del genero Nielsonia Young, 1977, de material procedente del Departamento de Tumbes. El genero ha sido reportada anteriormente de Ecuador, como unico registro para Sudamerica, y America Central. El unico especimen hembra encontra...

EL PROGRAMA CITI: UNA ALTERNATIVA PARA LA CAPACITACIÓN EN ÉTICA DE LA INVESTIGACIÓN EN AMÉRICA LATINA

PubMed Central

Litewka, Sergio; Goodman, Kenneth; Braunschweiger, y Paul

2011-01-01

El Programa CITI (Collaborative Institutional Training Initiative) es un curso basado en Internet y desarrollado por voluntarios, que brinda material educacional sobre protección de sujetos humanos en investigaciones biomédicas y de conducta, buenas prácticas clínicas, conducta responsable de la investigación y trato humanitario a animales de laboratorio. Es un esfuerzo conjunto del Fred Hutchinson Cancer Research Center y la Universidad de Miami. Con la colaboración de expertos locales, gran parte del contenido se ha adaptado para América Latina, se ha traducido al español y portugués y se han establecido acuerdos de colaboración con instituciones especializadas en bioética en Chile, Brasil, Costa Rica y Perú. Los autores presentan una metodología accesible para la capacitación en ética de la investigación y una justificación de su uso y difusión en América Latina PMID:21687817

Presentaciones escolares. Serie de programas para conmemorar acontecimientos de valor cultural para el mexico americano (School Assembly Presentations. Series of Programs to Commemorate Events of Cultural Value to the Mexican American).

ERIC Educational Resources Information Center

Villarreal, Abelardo; And Others

This material consists of a series of cultural presentations designed for elementary school assemblies or special programs. The activities are intended to strengthen Mexican-American children's awareness of their cultural heritage. Program scripts, poems, songs, historical narratives and skits are included to illustrate and celebrate Mexican and…

[An automated registry program for nosocomial infections].

PubMed

Castañón-González, Jorge Alberto; Polanco-González, Carlos; Samaniego-Mendoza, José Lino; Buhse, Thomas

2014-12-01

Las infecciones nosocomiales presentan un gran reto para la medicina hospitalaria, en general, y para las Unidades de Cuidados Intensivos, en particular. Su elevada prevalencia, la gran morbilidad y mortalidad asociadas, el incremento de la estancia hospitalaria y, en consecuencia, los costos de la atención médica han hecho que los programas de vigilancia, control y prevención de infecciones nosocomiales sean una parte toral de los protocolos de seguridad para el paciente y un indicador de calidad de la atención médica.

Radio Nutricion: A Program for Nutrition Education with the Hispanic Community. Service Provider's Guide = Radio Nutricion: Un Programa de Educacion para la Nutricion para la Comunidad Hispana. Guia del Proveeidor de Servicios.

ERIC Educational Resources Information Center

Association of Farmworker Opportunity Program, Arlington, VA.

The set of materials was designed to provide nutrition instruction to Spanish-speaking farm workers using radio broadcasts. It includes audiocassette tapes of four novellas (mini-dramas) on nutrition-related topics (diabetes, heart disease and high blood pressure, pregnancy, smart shopping), talk shows on the same topics, a public service…

Accessing Programs for Infants, Toddlers, and Preschoolers with Disabilities: A Parent's Guide = Programas para Infantes y Ninos Pre-escolares con Discapacidades: Guia para Padres de Familia. Update.

ERIC Educational Resources Information Center

Kupper, Lisa, Ed.

This parent's guide (presented in both English and Spanish) is intended to help families access services for young children with special needs. It is presented in the form of questions and answers arranged in three parts. Part I presents 12 questions and answers about early intervention services for infants and toddlers (ages birth through 2…

Indicators to assess the quality of programs to prevent occupational risk for tuberculosis: are they feasible?

PubMed

Santos, Talita Raquel Dos; Padoveze, Maria Clara; Nichiata, Lúcia Yasuko Izumi; Takahashi, Renata Ferreira; Ciosak, Suely Itsuko; Gryschek, Anna Luiza de Fátima Pinho Lins

2016-06-07

to analyze the feasibility of quality indicators for evaluation of hospital programs for preventing occupational tuberculosis. a descriptive cross-sectional study. We tested indicators for evaluating occupational tuberculosis prevention programs in six hospitals. The criterion to define feasibility was the time spent to calculate the indicators. time spent to evaluate the indicators ranged from 2h 52min to 15h11min 24sec. The indicator for structure evaluation required less time; the longest time was spent on process indicators, including the observation of healthcare workers' practices in relation to the use of N95 masks. There was an hindrance to test one of the indicators for tuberculosis outcomes in five situations, due to the lack of use of tuberculin skin test in these facilities. The time requires to calculate indicators in regarding to the outcomes for occupational tuberculosis largely depends upon the level of organizational administrative structure for gathering data. indicators to evaluate the structure for occupational tuberculosis prevention are highly feasible. Nevertheless, the feasibility of indicators for process and outcome is limited due to relevant variations in administrative issues at healthcare facilities. analisar a viabilidade de indicadores de qualidade para avaliação de programas hospitalares de prevenção de tuberculose ocupacional. estudo descritivo transversal. Testaram-se indicadores de avaliação de programas de prevenção de tuberculose ocupacional em seis hospitais. O critério para definir a viabilidade foi o tempo necessário para aplicar os indicadores. o tempo necessário para avaliar os indicadores variou de 02'52'' até 15h11'24''. O indicador para a avaliação da estrutura demandou menor tempo; o maior tempo foi utilizado com os indicadores de processo, incluindo a observação das práticas dos trabalhadores de saúde em relação ao uso de máscaras N95. Um dos indicadores de resultados de tuberculose deixou de ser testado em cinco situações devido à falta de uso do teste tuberculínico nessas instituições. O tempo necessário para aplicar indicadores em relação aos resultados de tuberculose ocupacional depende em grande parte do nível da organização da estrutura administrativa para a coleta de dados. os indicadores de avaliação da estrutura de prevenção de tuberculose ocupacional são altamente viáveis. No entanto, a viabilidade de aplicação dos indicadores de processo e de resultado é limitada devido a variações relevantes em questões administrativas nas instituições de saúde. analizar la viabilidad de los indicadores de calidad de la evaluación de los programas hospitalarios para la prevención de la tuberculosis en el trabajo. estudio descriptivo transversal. Se probaron los indicadores dirigidos a evaluar los programas para la prevención de la tuberculosis laboral en seis hospitales. El criterio para definir la viabilidad fue el tiempo para aplicar los indicadores. el tiempo empleado para la evaluación de los los indicadores varió desde 02'52 '' hasta 15h11'24 ''. El indicador para la evaluación de la estructura requiere menos tiempo; se invirtió más tiempo en los indicadores de proceso, lo que incluye la observación de las prácticas de los empleados del cuidado de salud en relación con el uso de máscaras N95. No se pudo probar uno de los indicadores de resultados de tuberculosis en cinco situaciones debido a la falta de uso de la prueba de la tuberculina en estas centros. El tiempo necesario para aplicar los indicadores en relación con los resultados por tuberculosis laboral depende en gran medida del nivel de organización de la estructura administrativa para la recopilación de datos. los indicadores para evaluar la estructura para la prevención de la tuberculosis laboral son altamente factibles. Sin embargo, la viabilidad de aplicación de los indicadores de proceso y el resultado es limitada debido a las variaciones relevantes en cuestiones administrativas en los centros sanitarios.

The Genus Ixodes (Acari: Ixodidae) in Mexico: Adult Identification Keys, Diagnoses, Hosts, and Distribution (El genero Ixodes (Acari: Ixodidae) en Mexico: claves de identificacion para adultos, diagnosis, huespedes y distribucion)

DTIC Science & Technology

2010-01-01

also from Estado de México (Hoffmann, 1969). Hosts in Mexico. Cricetidae and Hominidae ( Homo sapiens Linnaeus, 1758) (Mammalia) (Hoffmann, 1969...distribution El género Ixodes (Acari: Ixodidae) en México: claves de identifi cación para adultos, diagnosis, huéspedes y distribución Carmen Guzmán...postdoctoral scholarship under the Programa de Formación e Incorporación de Profesores de Carrera en Facultades y Escuelas para el Fortalecimiento de la

Environmental restoration and waste management: An introduction. Student edition; Restauracion ambiental y administracion de residuos nucleares: Introduccion; Edicion estudiantil (in Spanish)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

For more than 40 years, the United States has produced nuclear weapons. These production activities generated both radioactive and hazardous waste and often contaminated the environment. For many years, the public was unaware of the problem and unable to do anything about it. All of this has changed. In response to recent public outcry, the former Secretary of Energy, Retired Admiral James D. Watkins, established the Office of Environmental Restoration and Waste Management (EM) in November 1989. The creation of EM was the first step toward correcting contamination problems from the past 40 years In this booklet, we at DOE,more » through the efforts of the students at Oak Hills High School of Cincinnati, Ohio, will introduce you to EM and encourage your involvement in this major program within the Department of Energy. [Espanol] Durante mas de 40 anos, los Estados Unidos fabricaron armamentos nucleares. Esta produccion genero residuos radiactivos y peligrosos y, en muchos casos, contaminaron el medio ambiente. Durante mucho tiempo, el publico norteamericano no tenia conocimiento de este problema y no pudo hacer nada para solucionarlo. Todo esto ha cambiado. Respondiendo a crecientes protestas publicas, el ex Secretario de Energia Almirante James D. Watkins, establecio en noviembre de 1989 la Subsecretaria de Administracion Ambiental. La creacion de esta Subsecretaria fue el primer paso que dio el Departamento de Energia para corregir los problemas de contaminacion ambiental de los ultimos 40 anos. En esta publicacion, los que trabajamos en el Departamento de Energia con la ayuda de los estudiantes de la Escuela Secundaria de Oak Hills, Cincinnati, Ohio, te introduciermos a la administracion ambiental y alentamos tu participacion en este programa de fundamental importancia en el Departamento de Energia.« less

Pautas para Programas de Asesoramiento Gestional para Microempresas (Guidelines for Management Consulting Programs for Small-Scale Enterprise). Appropriate Technologies for Development. Peace Corps Information Collection & Exchange Manual Series No. M-27.

ERIC Educational Resources Information Center

Vaughan, Gary L.

Written in Spanish, this manual is designed to assist management consultants in working with small-scale entrepreneurs in developing countries. Addressed in an overview of the small-scale enterprise (SSE) are the role of the SSE in Third World development, problems of SSEs, and target firms. The second chapter deals with various forms of…

PROGRAMA PARA LA VERIFICACION DE LA TECNOLOGIA AMBIENTAL - CULTIVANDO ASOCIACIONES PARA EL INCREMENTO DE LAS SELECCIONES DE TECNOLOGIAS AMBIENTALES A LOS SECTORES PUBLICO Y PRIVADO EN LOS ESTADOS UNIDOS Y EN EL EXTERIOR (EPA/600/F-97/005A)

EPA Science Inventory

La meta del ETV es verificar, a travs de una
evaluacin de informacin objectiva y de calidad, las caracteristicas del desempeo de tecnologas
comerciales ambientales. As el ETV proporciona a
los compradores y los licenciadores potenciales una valoracin imparcial y creble d...

El Odio Se Cura: Un Programa Nacional para la Prevencion de los Crimenes de Odio para las Escuelas Intermedias (Healing the Hate: A National Crime Prevention Curriculum for Middle Schools).

ERIC Educational Resources Information Center

McLaughlin, Karen A.; Brilliant, Kelly J.

Designed for use in middle schools and youth organizations, this curriculum, in Spanish, deals with the extent of hate crime in the United States and presents strategies for reducing hate crimes among our youth. This flexible nine-unit curriculum is based on the principles that violence and prejudice are learned and therefore preventable, and that…

Development of quality control procedures for mass produced and released Bactrocera Philippinensis (Diptera: Tephritidae) for sterile insect technique programs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Resilva, S.; Obra, G.; Zamora, N.

Quality control procedures for Bactrocera philippinensis Drew and Hancock 1994 (Diptera: Tephritidae) used in sterile insect technique (SIT) programs were established in the mass rearing facility at the Philippine Nuclear Research Institute. Basic studies on pupal irradiation, holding/packaging systems, shipping procedures, longevity, sterility studies, and pupal eye color determination in relation to physiological development at different temperature regimes were investigated. These studies will provide baseline data for the development of quality control protocols for an expansion of B. philippinensis field programs with an SIT component in the future. (author) [Spanish] Los procedimientos de control de calidad para Bactrocera philippinensis Drewmore » y Hancock 1994 (Diptera: Tephritidae) usados en programas de la tecnica de insecto esteril (TIE) fueron establecidos en la facilidad de cria en masa del Instituto Filipino de Investigacion Nuclear. Estudios basicos sobre la irradiacion de las pupas, sistemas de almacenaje/empaque, procedimientos del envio, longevidad, estudios de esterilidad y la determinacion del color de ojo de la pupa en relacion con el desarrollo fisiologico en regimenes diferentes de temperatura fueron investigados. Estos estudios proveeran una linea de informacion basica para el desarrollo de protocolos de control de calidad para una expansion de los programas de campo para B. philippinensis con un componente de TIS en el futuro. (author)« less

[Not Available].

PubMed

Vizuet Vega, Norma Isela; Shamah Levy, Teresa; Gaona Pineda, Elsa Berenice; Cuevas Nasu, Lucía; Méndez Gómez-Humarán, Ignacio

2016-07-19

Introducción: la anemia es un factor de riesgo en la población infantil con consecuencias graves para su crecimiento y desarrollo. Los programas de ayuda alimentaria pueden contribuir a su prevención y control. Objetivo: estudiar la adherencia al consumo de suplementos y su relación con la prevalencia de anemia en niños menores de tres años de edad en San Luis Potosí, México beneficiarios del programa PROSPERA.Métodos: se realizó un análisis comparativo en niños de 12 a 36 meses que consumen diferentes suplementos alimenticios: 414 pertenecientes al grupo de intervención y 334 al de comparación. Se midió la hemoglobina (Hb) por Hemocue clasificando como anémicos a quienes tuvieron valores <110 g/l. Se aplicaron pruebas de t de Student y X2. Se estimaron efectos de intervención mediante el método de diferencias en diferencias y un puntaje de adherencia al consumo de suplementos.Resultados: al final del estudio la prevalencia de anemia disminuyó 11.2 pp en el grupo de intervención y 8.7 pp en el de comparación; la interacción del puntaje de adherencia por suplemento y etapa de observación mostró que la adherencia al consumo de Bebida láctea + Vitaniño reduce el riesgo de presentar anemia (p = 0,14). El consumo de Nutrisano + Vitaniño se asoció con menor riesgo (0,2), ambos con respecto al consumo de Nutrisano.Conclusiones: el programa PROSPERA tuvo efectos importantes en la disminución de las prevalencias de anemia. Se recomienda llevar a cabo acciones para mejorar la adherencia al consumo de suplementos alimenticios, a fIn de mejorar la efectividad de los programas.

Analisis del contenido curricular de los Documentos Normativos del Programa de Ciencias en el area de biologia para la escuela superior del sistema de educacion publica de Puerto Rico: 1993-2012

NASA Astrophysics Data System (ADS)

Davila Montanez, Melissa

Esta investigacion de naturaleza cualitativa se ocupo de realizar un analisis de contenido documental de los Documentos Normativos del Programa de Ciencias en el area de biologia de la escuela superior del sistema de educacion publica de Puerto Rico del periodo 1993-2012. Los documentos analizados fueron: Guia Curricular, 1995; Marco Curricular, 2003; Estandares de Excelencia, 1996, 2000 y Estandares de Contenido y Expectativas de Grado, 2007. Se indago si hubo cambios en significados en los Componentes Estructurales: Naturaleza de la ciencia, Paradigmas para la ensenanza de la ciencia, Funcion del curriculo formal, Mision de la ensenanza de la ciencia; Contenidos, destrezas y competencias, Estrategias de ensenanza y Evaluacion/Assessment del aprendizaje. El analisis sugiere que no hubo cambios sustanciales en los significados de los Componentes Estructurales. Los documentos estudiados muestran mayormente caracteristicas similares, aunque los documentos mas recientes eran mas descriptivos, explicativos y especificos.

¿Qué está haciendo la EPA para proteger a los arrecifes de coral?

EPA Pesticide Factsheets

La EPA protege a los arrecifes de coral mediante la implementación de programas de la Ley de Agua Limpia que protegen la calidad del agua en cuencas y zonas costeras de las áreas con arrecifes de coral.

ASSESSMENT FORM - NEW IMPROVEMENT OF ACTIONS: CONCENTRATION AND RESEARCH AREAS / CURRICULUM STRUCTURE / FUNDRAISING.

PubMed

Calderon, Iracema Mp

2015-01-01

This review aims to develop a critical and current analysis of the basic structure of a Postgraduate program for proposing improvement actions and new evaluation criteria. To examine the items that are areas of concentration (AC), research lines (LP), research projects (PP), curricular structure and fundraising were consulted the Area Document, the 2013 Evaluation Report and the Assessment Sheets of Medicine III programs, evaluated in the 2010-2012 period. Consistency is recommended especially among AC, LP and PP, with genuine link between activities and permanent teachers skills and based on structured curriculum in the education of the student. The Program Proposal interfere, and much, in qualifying a program. The curriculum should provide subsidy to the formation of the researcher, through the core subjects, and development of PP, being the concept of disciplines to support lines and research projects. Fundraise should be set out in research projects and in the CV-Lattes. The area recommended that at least 40-50% of permanent teachers present fundraising and the minimum 20-25% of these teachers to have productivity scholarship PQ / CNPq during the triennium. It is necessary to promote wide discussion and find a consensus denominator for these issues. The actions should contribute to the improvement of evaluation forms and certainly for the qualification of the programs but graduate. Essa revisão tem como objetivo elaborar uma análise crítica e atual da estrutura básica de um programa de Pós-Graduação para a proposição de ações de aperfeiçoamento e novos critérios de avaliação. Para analisarem-se os itens áreas de concentração (AC), linhas de pesquisa (LP), projetos de pesquisa (PP), estrutura curricular e captação de recursos/fomentos foram consultados o documento de área, o relatório de avaliação 2013 e as fichas de avaliação dos programas da Medicina III, avaliados no triênio 2010-2012. A coerência é recomendada especialmente entre AC, LP e PP, com substancial vínculo entre atividades e competências do corpo de docentes permanentes e embasamento da grade curricular na formação do aluno. A Proposta do Programa interfere, e muito, na qualificação de um programa. A estrutura curricular deverá dar subsídio à formação do pesquisador, por meio das disciplinas nucleares, e ao desenvolvimento dos PP, de competência das disciplinas de apoio às linhas e aos projetos de pesquisa. Os fomentos devem ser indicados nos projetos de pesquisa e no CV-Lattes dos beneficiados/responsáveis pelos projetos. A área recomenda que, no mínimo, 40 a 50% dos docentes permanentes apresentem captação de recursos e que o mínimo de 20 a 25% desses docentes tenham bolsa de produtividade PQ/CNPq durante o triênio. Há que se promover ampla discussão e encontrar um denominador de consenso para essas questões. As ações deverão contribuir para o aprimoramento das fichas de avaliação e, certamente, para a qualificação dos programas de pós-graduação.

Identificabilidade e estabilidade dos parâmetros no método Grade of Membership (GoM): considerações metodológicas e práticas

PubMed Central

Guedes, Gilvan Ramalho; Caetano, André Junqueira; Machado, Carla Jorge; Brondízio, Eduardo Sonewend

2011-01-01

O método Grade of Membership (GoM) tem sido cada vez mais utilizado por demógrafos brasileiros e tem a vantagem de possuir um parâmetro que mensura a heterogeneidade individual, com base nas correlações não-observáveis entre as categorias de resposta das variáveis de interesse, gerando um medida do grau de pertencimento de cada indivíduo a perfis extremos. Alguns autores, contudo, chamam atenção para questões importantes na calibragem dos modelos finais que utilizam o programa GoM versão 3.4, como o problema de identificabilidade – soluções múltiplas para parâmetros estimados. Neste artigo, é sugerido um procedimento capaz de identificar um modelo final com solução única que descreva os tipos puros mais fidedignos à base de dados, em uma tentativa de otimização. Para ilustrar esse processo, utilizou-se uma base de dados correspondente a um levantamento econômico e sociodemográfico de uma população de pequenos agricultores residentes ao longo da Rodovia Transamazônica, no Estado do Pará. Também identificou-se a existência de instabilidade nos parâmetros estimados pelo programa GoM 3.4, sendo proposto um método de estabilização de seus valores. Com esses procedimentos combinados, os usuários do programa GoM 3.4 poderão descrever sua base de dados de forma mais adequada e responder às críticas sobre questões de identificabilidade e estabilidade dos modelos resultantes. Essas soluções empíricas são relevantes por afetarem cálculos de prevalência e de incidência de eventos de interesse, além de trazerem consequências importantes sobre o ponto e o momento corretos para intervenções de políticas públicas ou de planejamento prospectivo em análises de projeção. PMID:21709732

METRICS DEVELOPMENT FOR PATENTS.

PubMed

Veiga, Daniela Francescato; Ferreira, Lydia Masako

2015-01-01

To develop a proposal for metrics for patents to be applied in assessing the postgraduate programs of Medicine III - Capes. From the reading and analysis of the 2013 area documents of all the 48 areas of Capes, a proposal for metrics for patents was developed to be applied in Medicine III programs. Except for the areas Biotechnology, Food Science, Biological Sciences III, Physical Education, Engineering I, III and IV and Interdisciplinary, most areas do not adopt a scoring system for patents. The proposal developed was based on the criteria of Biotechnology, with adaptations. In general, it will be valued, in ascending order, the deposit, the granting and licensing/production. It will also be assigned higher scores to patents registered abroad and whenever there is a participation of students. This proposal can be applied to the item Intellectual Production of the evaluation form, in subsection Technical Production/Patents. The percentage of 10% for academic programs and 40% for Masters Professionals should be maintained. The program will be scored as Very Good when it reaches 400 points or over; Good, between 200 and 399 points; Regular, between 71 and 199 points; Weak up to 70 points; Insufficient, no punctuation. Desenvolver uma proposta de métricas para patentes a serem aplicadas na avaliação dos Programas de Pós-Graduação da Área Medicina III - Capes. A partir da leitura e análise dos documentos de área de 2013 de todas as 48 Áreas da Capes, desenvolveu-se uma proposta de métricas para patentes, a ser aplicada na avaliação dos programas da área. Constatou-se que, com exceção das áreas Biotecnologia, Ciência de Alimentos, Ciências Biológicas III, Educação Física, Engenharias I, III e IV e Interdisciplinar, a maioria não adota sistema de pontuação para patentes. A proposta desenvolvida baseou-se nos critérios da Biotecnologia, com adaptações. De uma forma geral, foi valorizado, em ordem crescente, o depósito, a concessão e o licenciamento/produção. Também foi atribuída maior pontuação a patentes registradas no exterior e com participação de discentes. Esta proposta poderá ser aplicada ao item Produção Intelectual da ficha de avaliação, no subitem Produções Técnicas, patentes e outras produções consideradas relevantes. Deverá ser mantida, neste subitem, a porcentagem de 10% para os programas acadêmicos e 40% para os mestrados profissionais. Será considerado Muito Bom o programa que obtiver 400 pontos/triênio ou mais, Bom entre 200 e 399 pontos; Regular entre 71 e 199 pontos; Fraco até 70 pontos; e Deficiente sem pontuação.

Sterile insect technique: A model for dose optimisation for improved sterile insect quality

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parker, A.; Mehta, K.

The sterile insect technique (SIT) is an environment-friendly pest control technique with application in the area-wide integrated control of key pests, including the suppression or elimination of introduced populations and the exclusion of new introductions. Reproductive sterility is normally induced by ionizing radiation, a convenient and consistent method that maintains a reasonable degree of competitiveness in the released insects. The cost and effectiveness of a control program integrating the SIT depend on the balance between sterility and competitiveness, but it appears that current operational programs with an SIT component are not achieving an appropriate balance. In this paper we discussmore » optimization of the sterilization process and present a simple model and procedure for determining the optimum dose. (author) [Spanish] La tecnica de insecto esteril (TIE) es una tecnologia de control de plagas favorable para el medio ambiente con una aplicacion de un control integrado de plagas claves para toda la area, incluyendo la supresion o eliminacion de poblaciones introducidas y la exclusion de nuevas introducciones. La esterilidad reproductiva es normalmente inducida por radiacion ionizada, un metodo conveniente y consistente que mantiene un grado razonable para la capacidad de competencia en insectos liberados. El costo y la eficacia de un programa de control que incluye TIE dependen en tener un balance entre la esterilidad y la capacidad para competir, pero parece que los programas operacionales corrientes con TIS como un componente no estan logrando el tener un balance apropiado. En esta publicacion, nosotros discutimos la optimizacion del proceso de esterilizacion y presentamos un modelo y procedimiento sencillos para determinar la dosis optima. (author)« less

Mix-infection of S. Typhi and ParaTyphi A in Typhoid Fever and Chronic Typhoid Carriers: A Nested PCR Based Study in North India

PubMed Central

Pratap, Chandra Bhan; Kumar, Gopal; Patel, Saurabh Kumar; Shukla, Vijay K; Kumar, Kailash; Singh, Tej Bali

2014-01-01

Introduction: Enteric fever is a systemic disease caused by Salmonella organism such as serotypes Typhi and ParaTyphi A, B, C. Salmonella ParaTyphi A contributes more than 50% of all the enteric fever cases and it has recently been projected as an emerging pathogen. Materials and Methods: The present study was aimed to detect Salmonella Typhi and ParaTyphi A in urine, blood and stool specimens collected from cases of enteric fever (110), chronic typhoid carriers (46) and healthy controls (75) to explore the possibility of mixed infection by nested PCR. A new nested PCR primer was designed targeting putative fimbrial protein (stkG) gene which is one of the fimbrial gene families to Salmonella ParaTyphi A and for S. Typhi already reported primers targeting flagellin (fliC) gene. Results: Large volume of urine specimens (15 ml) was found to be the best for detection of Salmonella serotypes. The urine sample was found to have mixed-infection by both the serotypes in 40.9% of the cases but lower in blood (27.3%) and stool (13.6%). Conclusion: The present study concludes that occurrence of mixed infection may be quite frequent in typhoid and chronic typhoid carriers’ individuals, although the reported recent rise in ParaTyphi A incidence may not be real. PMID:25584217

Nutriendo la Promesa: Materiales Para la Aplicacion de las Normas de Ejecucion del Programa Head Start. Guia Para la Utilizacion de los Materiales [y] Transparencias (Nurturing the Promise: Set of Training Materials on the Head Start Program Performance Standards. User's Guide [and] Set of Transparencies).

ERIC Educational Resources Information Center

Educational Services, Inc., Washington, DC.

Since 1975, the Head Start Program Performance Standards have defined the services that local programs are required to provide to enrolled children and families. With revisions effective in 1998, the Program Performance Standards translate the Head Start vision into quality practices implemented at the local level. This document is comprised of a…

What Providers Should Know about Child Care Assistance for Families: A Targeted Effort to Reach Hispanic Families and Providers = Lo que Deben Saber los Proveedores Sobre el Programa de Ayuda de Cuidado Infantil para las Familias: Un Esfuerzo Especial para Alcanzar Familias y Proveedores Hispanos

ERIC Educational Resources Information Center

Child Care Bureau, 2004

2004-01-01

Federal and State governments can help families pay for child care. The families one serves may be eligible for this assistance, and one may receive this funding for services one provides, thus becoming a "participating provider." This paper provides answers to the following questions: (1) How can parents receive child care assistance?; (2) How do…

Binarias en cúmulos abiertos: ?`Qué hay de nuevo?

NASA Astrophysics Data System (ADS)

Levato, H.

Las herramientas modernas para detectar duplicidad han jugado un papel fundamental en el resurgimiento del estudio de la binaridad en cúmulos abiertos. El fracaso de las teorías de bifurcación para explicar la formación de estrellas dobles ha puesto en consideración los encuentros de estrellas en cúmulos para formar binarias. Existen muchas pruebas empíricas que pueden realizarse para verificar las creencias actuales. En esta revisión del tema se hace un breve resumen de la historia del problema y se analiza el conocimiento actual. Se proponen las investigaciones y programas que darían lugar a la comprobación de las predicciones que surgen de considerar que las binarias en cúmulos se forman por encuentros.

Quality management systems for fruit fly (Diptera: Tephritidae) sterile insect technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caceres, C.; Robinson, A.; McInnis, D.

The papers presented in this issue are focused on developing and validating procedures to improve the overall quality of sterile fruit flies for use in area-wide integrated pest management (AW-IPM) programs with a sterile insect technique (SIT) component. The group was coordinated and partially funded by the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Vienna, Austria, under a five-year Coordinated Research Project (CRP) on 'Quality Assurance in Mass-Reared and Released Fruit Flies for Use in SIT Programmes'. Participants in the CRP from 16 countries came from both basic and applied fields of expertisemore » to ensure that appropriate and relevant procedures were developed. A variety of studies was undertaken to develop protocols to assess strain compatibility and to improve colonization procedures and strain management. Specific studies addressed issues related to insect nutrition, irradiation protocols, field dispersal and survival, field cage behavior assessments, and enhancement of mating competitiveness. The main objective was to increase the efficiency of operational fruit fly programs using sterile insects and to reduce their cost. Many of the protocols developed or improved during the CRP will be incorporated into the international quality control manual for sterile tephritid fruit flies, standardizing key components of the production, sterilization, shipment, handling, and release of sterile insects. (author) [Spanish] Los articulos presentados en este numero se enfocan en el desarrollo y la validacion de procedimientos para mejorar la calidad total de moscas de las frutas esteriles para su uso en programas de manejo integrado de plagas en donde la tecnica del insecto esteril (TIE) es uno de los componentes clave. El grupo fue coordinado y parcialmente financiado por la Division Conjunta de Tecnicas Nucleares para la Alimentacion y la Agricultura de la FAO/OIEA, Viena, Austria, por un periodo de cinco anos bajo el proyecto de Investigacion Coordinada (PIC) sobre 'el Aseguramiento de la Calidad de Moscas de las Frutas Criadas y Liberadas para su Uso en Programas de TIE'. Los participantes en el PIC representan 16 paises con experiencia en campos de investigacion basica y aplicada. Para asegurar que los procedimientos desarrollados fueran apropiados y pertinentes, se realizaron una variedad de estudios para el desarrollo de protocolos para evaluar la compatibilidad y para mejorar los procedimientos de colonizacion y manejo de cepas salvajes. Estudios especificos trataron asuntos relacionados con la nutricion de insectos, los protocolos de irradiacion, la dispersion y supervivencia en el campo, evaluacion del comportamiento en jaulas de campo, y el mejoramiento de la competitividad sexual. Los objetivos fundamentales fueron el aumentar la eficiencia y reducir los costos de los programas operacionales de control de moscas de las frutas donde TIE es utilizada. Muchos de los protocolos desarrollados o mejorados durante el PIC seran incorporados en el Manual Internacional de Control de Calidad para Moscas Estriles de la familia Tephritidae, para estandarizar componentes claves como la produccion, esterilizacion, envio, manejo y liberacion de insectos esteriles. (author)« less

Continuing Vocational Training in Local Government in Portugal, 2000-05--What Has Changed?

ERIC Educational Resources Information Center

Cabrito, Belmiro Gil; Simao, Ana Margarida Veiga; Alves, Mariana Gaio; Almeida, Antonio

2009-01-01

Local government in Portugal had a good opportunity to modernise through the Programa de Formacao para as Autarquias Locais (Foral) [Training programme for local authorities], implemented between 2000 and 2005. Substantial financial resources were made available through the programme to retrain local government human resources in order to improve…

INTERVENCIÓN EDUCATIVA EFECTIVA EN VIH PARA MUJERES

PubMed Central

Miner, Sarah; Poupin, Lauren; Bernales, Margarita; Ferrer, Lilian; Cianelli, Rosina

2016-01-01

RESUMEN En Chile se estima que aproximadamente 38 mil personas viven con el Virus de Inmunodeficiencia Humana [VIH]. En el año 2001, 1.092 mujeres chilenas vivían con VIH, actualmente se cree que hay más de 7.600 mujeres con el virus. Frente a estas cifras surge la necesidad de crear estrategias de prevención dirigidas a mujeres chilenas. Objetivo analizar los estudios ya realizados en la prevención de VIH para determinar qué aspectos se deben incluir en programas exitosos de prevención de VIH en mujeres. Diseño y Método se realizó una revisión de la literatura utilizando la base de datos Proquest, CINAHL, Pubmed y Scielo. Los límites comprendieron: textos completos, de los últimos 10 años, de acceso gratuito y escrito en español o inglés. Se seleccionaron 15 artículos para la revisión. Resultados todos los artículos comprenden la evaluación del efecto de una intervención sobre conocimiento y conductas relacionadas con VIH/SIDA. Catorce muestran resultados significativos en cambios positivos de conducta o conocimientos relacionados con la prevención de VIH. Conclusiones los programas de prevención de VIH en mujeres pueden ser efectivos para lograr cambios de conducta y de conocimiento. Las intervenciones exitosas son aquellas basadas en teorías o modelos de prevención y en cambios de conductas, todas adaptadas a la cultura de la población estudiada. PMID:27667897

Efectos combinados de la ampliación de la atención primaria de salud y de las transferencias condicionadas de dinero en efectivo sobre la mortalidad infantil en Brasil, 1998–2010*

PubMed Central

Guanais, Frederico C.

2015-01-01

Objetivos. Examiné los efectos combinados del acceso a la atención primaria mediante el Programa de Salud Familiar (PSF) y las transferencias condicionadas de dinero en efectivo del Programa Bolsa Familia (PBF) sobre la mortalidad infantil posneonatal (MIPN) en Brasil. Métodos. Empleé un análisis ecológico longitudinal usando datos en panel de 4 583 municipios brasileños de 1998 al 2010, con 54 253 observaciones en total. Estimé modelos de regresión de efectos fijos por mínimos cuadrados ordinarios, con la tasa de MIPN como la variable dependiente y el PSF, el PBF y sus interacciones como las principales variables independientes de interés. Resultados. La asociación de una mayor cobertura del PSF con una menor tasa de MIPN se volvió más fuerte conforme aumentaba la cobertura del PBF. En los promedios de todas las demás variables, cuando la cobertura de PBF era 25%, la MIPN predicha fue 5,24 (intervalo de confianza [IC] de 95% = 4,95, 5,53) para una cobertura del PSF de 0%, y de 3,54 (IC de 95% = 2,77, 4,31) para una cobertura del PSF de 100%. Cuando la cobertura del PBF era de 60%, la MIPN predicha fue 4,65 (IC de 95% = 4,36, 4,94) para una cobertura del PSF de 0%, y de 1,38 (IC de 95% = 0,88, 1,89) para una cobertura del PSF de 100%. Conclusiones. El efecto del PSF depende de la ampliación del PBF. Para las poblaciones empobrecidas y subatendidas, la combinación de intervenciones tanto del lado de la oferta como del lado de la demanda podría ser necesaria para mejorar los resultados en salud.

[Barriers and Facilitators in the Recruitment and Retention of Heterosexual Couples for Preventive Interventions.

PubMed

Hernández-Hernández, Alberto L; Perez-Jimenez, David

2010-01-01

El Reclutamiento y la Retención (R&R) de participantes es fundamental para el éxito de estudios y para el desarrollo de intervenciones preventivas. El R&R de participantes determina la validez y efectividad de estos programas. En este trabajo examinamos algunos de los factores que facilitan y dificultan el R&R en los proyectos preventivos y ofrecemos algunas alternativas para mejorar los índices de R&R. Realizamos dos estudios, en el primero administramos el Instrumento de Informatión, Motivatión y Conductas-Español (IIMC-E) a un grupo de 26 parejas heterosexuales (52 participantes). En el segundo, entrevistamos a 5 parejas VIH discordantes (10 participantes). Encontramos que el 75% de los/las participantes indicó que su trabajo era una de las principales barreras que dificultan la asistencia a las actividades. Otras barreras son las responsabilidades laborales y familiares. Encontramos que la principal barrera fue el miedo a la revelación del estado serlógico. Los principales facilitadores del R&R son la coordinación adecuada y el seguimiento telefónico ofrecido por parte del personal del proyecto. Concluimos que en el desarrollo e implantación de programas de prevención el investigador/a debe tomar en cuenta la adaptación de aspectos logísticos como la disponibilidad y las necesidades particulares de los/las participantes.

Elastoplasticidad anisotropa de metales en grandes deformaciones

NASA Astrophysics Data System (ADS)

Caminero Torija, Miguel Angel

El objetivo de este trabajo es el desarrollo de modelos y algoritmos numericos que simulen el comportamiento del material bajo estas condiciones en el contexto de programas de elementos finitos, dando como resultado predicciones mas precisas de los procesos de conformado y deformacion plastica en general. Para lograr este objetivo se han desarrollado diversas tareas destinadas a mejorar las predicciones en tres aspectos fundamentales. El primer aspecto consiste en la mejora de la descripcion del endurecimiento cinematico anisotropo en pequenas deformaciones, lo cual se ha realizado a traves de modelos y algoritmos implicitos de superficies multiples. Ha sido estudiada la consistencia de este tipo de modelos tanto si estan basados en una regla implicita similar a la de Mroz o en la regla de Prager. Ademas se han simulado los ensayos de Lamba y Sidebottom, obteniendo, en contra de la creencia general, muy buenas predicciones con la regla de Prager. Dichos modelos podrian ser extendidos de forma relativamente facil para considerar grandes deformaciones a traves de procedimientos en deformaciones logaritmicas, similares a los desarrollados en esta tesis y detallados a continuacion. El segundo aspecto consiste en la descripcion de la anisotropia elastoplastica inicial. Esto se ha conseguido mediante el desarrollo de modelos y algoritmos para plasticidad anisotropa en grandes deformaciones, bien ignorando la posible anisotropia elastica, bien considerandola simultaneamente con la anisotropia plastica. Para ello ha sido necesario desarrollar primero un nuevo algoritmo de elastoplasticidad anisotropa en pequenas deformaciones consistentemente linealizado y sin despreciar ningun termino, de tal forma que se conserve la convergencia cuadratica de los metodos de Newton. Este algoritmo en pequenas deformaciones ha servido para realizar la correccion plastica de dos algoritmos en grandes deformaciones. El primero de estos algoritmos es una variacion del clasico algoritmo de Eterovic y Bathe para incluir la posibilidad de plasticidad anisotropa con endurecimiento mixto. Este primer algoritmo esta restringido a casos de isotropia elastica. La isotropia elastica es una hipotesis bastante habitual en plasticidad anisotropa y tiene la ventaja de que permite el uso de formulaciones mixtas u/p. El segundo algoritmo, mas complejo y general, incluye la posibilidad de elasticidad anisotropa, plasticidad anisotropa y endurecimiento mixto. Este algoritmo supone una contribucion importante ya que esta basado en hipotesis comunmente aceptadas y utilizadas en elastoplasticidad isotropa: descomposicion multiplicativa del gradiente de deformaciones en parte elastica y parte plastica, descripcion hiperelastica sencilla en funcion de deformaciones logaritmicas e integracion exponencial que conserva el volumen. Ademas, la estructura final del algoritmo es modular y relativamente sencilla, consistiendo en un pre- y un postprocesador geometrico y una correccion plastica realizada en pequenas deformaciones. El algoritmo esta consistentemente linealizado para conservar la convergencia cuadratica asintotica de los metodos de Newton y la forma final que toma dicha linealizacion es similar al caso de isotropia elastoplastica implementado; consiste en el modulo tangente algoritmico de pequenas deformaciones sobre el que se aplica una transformacion para convertirlo en el de grandes deformaciones. Todos estos modelos han sido implementados en un codigo propio de elementos finitos denominado DULCINEA, el cual tiene formulaciones lagrangianas totales y actualizadas para grandes deformaciones. Una de las tareas necesarias para poder realizar las simulaciones, ha sido el estudio e implementacion de diferentes elementos que no sufran el bloqueo volumetrico severo que se observa en formulaciones estandar basadas en desplazamientos. Este bloqueo se debe a la condicion de quasi-incompresibilidad que imponen los modelos de plasticidad desviadores y consiste en una respuesta exageradamente rigida de la solucion obtenida por el metodo de los elementos finitos estandar. Entre los elementos implementados cabe destacar el basado en la formulacion mixta u/p, que contiene una interpolacion adicional de grados de libertad de presion. Estos grados de libertad adicionales habitualmente son internos al elemento en mecanica de solidos. En este trabajo se ha desarrollado e implementado en DULCINEA una familia de elementos tridimensionales mixtos en grandes deformaciones que incluye el caso particular BMIX 27/27/4, basado en la formulacion u/p, constituido por 27 nudos, con 27 puntos de integracion estandar y 4 grados de libertad de presiones, y que pasa la condicion Inf-Sup o de Babuska-Brezzi. Sin embargo, se ha observado que la formulacion u/p presenta ciertas limitaciones bajo las hipotesis conjuntas de anisotropia elastica y anisotropia plastica. (Abstract shortened by UMI.)

Descripción de la zona de alta difusión en un modelo bidimensional para hojas de corriente

NASA Astrophysics Data System (ADS)

Montero, M. F.; Paola, C. A.; Platzeck, A. M.

Los modelos bidimensionales para describir hojas de corriente de alta simetría no suministran una descripción detallada de las regiones donde la difusión es considerablemente importante. Tal es el caso de los modelos desarrollados en la década del '60 por Sweet, Parker, Petschek y Sonnerup. En esta comunicación presentamos una solución de las ecuaciones MHD en el entorno del origen, construyendo series bidimensionales para todas las magnitudes físicas involucradas. Valiéndonos de la alta simetría y de las características del problema, logramos reducir el número de coeficientes a calcular. Utilizamos un programa autoconsistente para extender el cálculo a regiones vecinas con difusión moderada o despreciable.

Organizando Comites Consejeros de Padres Para Programas de Educacion Migrante (Organizing Parent Advisory Committees for Migrant Education Programs).

ERIC Educational Resources Information Center

Gonzalez, Ramon

In order to help parents and community members participate more effectively and better understand the importance of their involvement in the planning and administration of migrant education programs in Oregon, the English-Spanish booklet suggests general procedures for organizing, leading, and training Parent Advisory Committees (PACs), required…

Schoolwide Programs: Parents' Guide & Capacity-Building Materials = Programas Schoolwide: Una Guia para Padres y Materias de Capacitacion.

ERIC Educational Resources Information Center

WestEd, San Francisco, CA.

The reauthorization of Title I (Improving America's Schools Act--IASA) made the Schoolwide Program (Schoolwide) a major strategy for schools with high poverty rates and stressed the importance of parent involvement. This guide was developed to provide professional development and parent education on Schoolwide implementation in California. The…

Arte: Un Programa Creativo Para Ninos Pre-Escolares (Art: A Creative Curriculum for Early Childhood).

ERIC Educational Resources Information Center

Creative Associates, Inc., Washington, DC.

Written in Spanish and focusing on art activities for early childhood education, this manual provides guidelines for Spanish-speaking teachers of preschool and primary school children. The content of the manual is oriented to the learning styles and special interests of Spanish-speaking children. Part One defines artistic activity in the preschool…

PubMed

Serrano-Guzmán, María; Valenza-Peña, Carmen M; Serrano-Guzmán, Carmen; Aguilar-Ferrándiz, Encarnación; Olmedo-Alguacil, Milagrosa; Villaverde-Gutiérrez, Carmen

2016-11-29

Objetivo: este estudio tuvo como objetivo probar la eficacia de un programa de danzaterapia en la composición corporal y calidad de vida en mujeres mayores de 65 años, que no realizan ejercicio físico de forma habitual. Métodos: cincuenta y dos mujeres sedentarias (edad media de 69,27 ± 3,85 años) fueron asignadas al azar para realizar un programa de danzaterapia (n = 27) o formar parte del grupo control (n = 25). El grupo de danza, participó durante ocho semanas en un programa de danza, tres sesiones semanales de 50 minutos cada una, basado en danza popular española (sevillanas) y ballet. Ambos grupos reciben información sobre la importancia de la alimentación y del ejercicio físico al comienzo y mitad del estudio. La circunferencia de la cintura, la presión arterial, el índice de masa corporal y la calidad de vida se evaluaron al inicio y después del tratamiento en ambos grupos. El análisis estadístico se realizó con un 2 × 2 ANOVA.Resultados: las mujeres del grupo de danza mostraron reducción significativa de la circunferencia de la cintura (p = 0,001) en comparación con las del grupo control. Los cambios en el IMC y la calidad de vida, aunque mejoraron en el grupo de danza, no alcanzaron significación estadística. Conclusión: la danzaterapia española es una forma de ejercicio físico eficaz para reducir la grasa visceral y prevenir comorbilidades en mujeres mayores, contribuyendo a cambiar estilos de vida poco saludables.

Memorias del segundo simposio internacional sobre políticas, planificación y economía de los programas de protección contra incendios forestales: una visión global; 2004 Abril 19–22; Córdoba, España

Treesearch

Armando González-Cabán

2008-01-01

Estas memorias resumen el resultado de un simposio diseñado para discutir los problemas actuales que confrontan las agencias con responsabilidad para la protección contra incendios forestales a nivel federal y estadual en los EE.UU., al igual que agencias en la comunidad internacional. Los temas discutidos en el simposio incluyen economía del fuego, teoría y modelos...

Programa de lengua espanola: Guia para el profesor, 2 (Spanish Language Program: Teacher's Guide 2).

ERIC Educational Resources Information Center

Martinez, Emiliano; And Others

This teacher's guide is designed for use with "La Ciudad" and "Otros Amigos, Otras Culturas," two textbooks in the second part of the Spanish language series of readers. It contains lesson plans to enable the teacher to make better use of the texts and includes illustrations taken from each of the books themselves. (SK)

Breast Cancer Epidemiology in Puerto Rico

DTIC Science & Technology

2013-06-30

Universidad de Puerto Rico Recinto de Ciencias Medicas Escuela Graduada de Salud Publica Apartado postal 365067, San Juan, Puerto Rico 00936-5067... Ciencias Medicas. Este proyecto recibe fondos del Programa de Investigacion de Cancer de Mama, bajo el mecanismo de Donativo para Adiestramiento en...minimo. Una enfermera adiestrada del Consorcio de Investigacion Clinica y Traslacional del Recinto de Ciencias Medicas (PRCTRC) tomara estas muestras

Conexiones: Guia para Padres y Estudiantes. Directorio de Servicios y Programas de Educacion Especial de las Escuelas Publicas de Boston.

ERIC Educational Resources Information Center

Celuzza, Paul W., Ed.; Clayton, Shelley Bakst, Ed.

Intended for handicapped students and their parents, the booklet presents a guide in Spanish to special education services in the Boston public schools. Chapter 766, the Massachusetts law guaranteeing free appropriate public education to every child, is focused on. Section 1 discusses such evaluation aspects as early childhood screening, referral,…

Guia Legal para Ciudadanos Envejeciente: Leyes y Programas Afectando los Ciudadanos Envejeciente de Kansas. (Legal Guide for Senior Citizens: Laws and Programs Affecting Kansas Senior Citizens).

ERIC Educational Resources Information Center

Hollinger, Judith A.

This booklet, translated into Spanish, is intended to inform (not advise) older Kansans about eligibility requirements and benefits provided by state and federal programs. Financial assistance programs discussed are Social Security, railroad retirements, veterans' benefits, unrestricted general assistance, Employee Retirement Income Security Act,…

Registros del Cuco Hormiguero (Neomorphus geoffroyi) en la Reserva de Biosfera de Bosawas, Nicaragua

Treesearch

H.M. Herrera-Rosales; M. Tórrez; W.J. Arendt

2014-01-01

El cuco hormiguero, Neomorphus geoffroyi, se registró en la Reserva de Biósfera de Bosawás y representa el primer gráfico de la especie para el Norte y para el país. Esta especie es rara y es sensible a la deforestación, se observó en compañía de bandadas mixtas, con su comportamiento...

Barreras y Facilitadores en el Reclutamiento y la Retención de Parejas Heterosexuales en Intervenciones Preventivas en VIH/SIDA

PubMed Central

Hernández-Hernández, Alberto L.; Perez-Jimenez, David

2012-01-01

Compendio El Reclutamiento y la Retención (R&R) de participantes es fundamental para el éxito de estudios y para el desarrollo de intervenciones preventivas. El R&R de participantes determina la validez y efectividad de estos programas. En este trabajo examinamos algunos de los factores que facilitan y dificultan el R&R en los proyectos preventivos y ofrecemos algunas alternativas para mejorar los índices de R&R. Realizamos dos estudios, en el primero administramos el Instrumento de Informatión, Motivatión y Conductas-Español (IIMC-E) a un grupo de 26 parejas heterosexuales (52 participantes). En el segundo, entrevistamos a 5 parejas VIH discordantes (10 participantes). Encontramos que el 75% de los/las participantes indicó que su trabajo era una de las principales barreras que dificultan la asistencia a las actividades. Otras barreras son las responsabilidades laborales y familiares. Encontramos que la principal barrera fue el miedo a la revelación del estado serlógico. Los principales facilitadores del R&R son la coordinación adecuada y el seguimiento telefónico ofrecido por parte del personal del proyecto. Concluimos que en el desarrollo e implantación de programas de prevención el investigador/a debe tomar en cuenta la adaptación de aspectos logísticos como la disponibilidad y las necesidades particulares de los/las participantes. PMID:23264700

Experiencias sobre el impacto del Programa de Formación en Ética de la Investigación Biomédica y Psicosocial en el ámbito de la salud mental y la investigación conductual.

PubMed

Barrios, Liliana Mondragón

2012-01-01

El propósito de este trabajo es presentar el impacto y la integración que los conocimientos adquiridos en el Programa Internacional de Formación en Ética de la Investigación Biomédica y Psicosocial de la Universidad de Chile han tenido en mi experiencia profesional, en el ámbito de la investigación psicosocial en un Instituto de Salud de México. Para este objetivo, expondré tres áreas en las cuales se ha podido evidenciar tal impacto: trabajo en los comités de ética, desarrollo de programas de académicos en bioética e investigación y publicación sobre ética y bioética. El motivo que me llevó a incursionar en el Programa fue que su enseñanza vincula la investigación psicosocial con la ética y la bioética, lo cual me permitió dirigir este tipo de reflexión hacia problemas como violencia, suicidio, adicciones, depresión y salud mental, y a nuevos campos como los estudios comunitarios, con poblaciones en riesgo o vulnerables, en los cuales las diversas implicaciones son difíciles de indagar.

Experiencias sobre el impacto del Programa de Formación en Ética de la Investigación Biomédica y Psicosocial en el ámbito de la salud mental y la investigación conductual

PubMed Central

Barrios, Liliana Mondragón

2012-01-01

El propósito de este trabajo es presentar el impacto y la integración que los conocimientos adquiridos en el Programa Internacional de Formación en Ética de la Investigación Biomédica y Psicosocial de la Universidad de Chile han tenido en mi experiencia profesional, en el ámbito de la investigación psicosocial en un Instituto de Salud de México. Para este objetivo, expondré tres áreas en las cuales se ha podido evidenciar tal impacto: trabajo en los comités de ética, desarrollo de programas de académicos en bioética e investigación y publicación sobre ética y bioética. El motivo que me llevó a incursionar en el Programa fue que su enseñanza vincula la investigación psicosocial con la ética y la bioética, lo cual me permitió dirigir este tipo de reflexión hacia problemas como violencia, suicidio, adicciones, depresión y salud mental, y a nuevos campos como los estudios comunitarios, con poblaciones en riesgo o vulnerables, en los cuales las diversas implicaciones son difíciles de indagar. PMID:22754085

Introduccion a la hidraulica de aguas subterraneas : un texto programado para auto-ensenanza

USGS Publications Warehouse

Bennett, Gordon D.

1987-01-01

Este ' texto programado esta diseflado para ayudarle a comprender la teoria de la hidniulica de aguas subterraneas por medio de la auto-enseflanza. La instrucci6n programada es un enfoque a una materia, un metodo de aprender;que no elimina el esfuerzo mental del proceso de aprendizaje. Algunas secciones de este programa necesitan solamente ser leidas; otras tendrian que ser elaboradas con lapiz y papel. Algunas preguntas pueden ser contestadas directamente; otras requieren calculos. A medida que se avanza en el texto, tendra que consultar frecuentemente textos o referencias sobre matematicas, mecanica de fluidos e hidrologia. En cada una de las ocho partes del texto, inicie el programa de instrucci6n leyendo la Secci6n 1. Elija una respuesta a la pregunta al final de la secci6n y dirijase a la nueva secci6n indicada al lado de la respuesta escogida. Si su respuesta fue correcta, pase a la secci6n que contiene materia nueva y otra pregunta, y proceda tal como en la Secci6n 1. Si su respuesta no fue correcta, dirijase a la secci6n que contiene explicaciones adicionales sobre el tema anterior y que le indica volver a la pregunta inicial e intentar de nuevo. En este caso, valdra Ia pena repasar el material de la secci6n anterior. Continue de esta man era en el programa hasta que llegue a Ia secci6n que indica el final de la parte. Observe que aunque las secciones estan en orden numerico en cada una de las ocho partes, por lo general, usted no procedeni en secuencia numerica (Secci6n 1 ala Secci6n 2, etc.) de principia a fin.

Reseña del Programa de Certificación para Técnicos conforme a la Sección 608 de la Ley de Aire Limpio

EPA Pesticide Factsheets

Información sobre los requisitos de la EPA referente a la certificación de técnicos que manejen, reparen o desechen electrodomésticos que emiten refrigerantes a la atmósfera conforme a la Sección 608 de la Ley de Aire Limpio.

Identification of duck plague virus by polymerase chain reaction

USGS Publications Warehouse

Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

1999-01-01

A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto indefinido y al gen para la proteina de la DNA polimerasa en otros virus herpes. Se encontraron tres o cuatro grupos de iniciadores especificos para el virus vacunal y para el 100% (7/7) de los a??slamientos de campo, pero no amplificaron el DNA del virus de hepatitis por cuerpos de inclusi??n de grullas. Se analiz?? la especificidad de un primer juego de iniciadores con moldes del genoma de otros virus herpes aviares, incluyendo el ?!guila dorada, ?!guila de cabeza blanca, lechuza de cuernos grandes, lechuza blanca, halc??n peregrino, palomas, aves psit?!cidas y pollos (virus de laringotraqueitis infecciosa), pero no se produjeron los productos finales. Por lo tanto, esta prueba de reacci??n en cadena por la polimerasa es altamente especifica para el DNA del virus. Dos grupos de iniciadores fueron capaces de detectar un fragmento de DNA de la cepa vacunal equivalente a cinco copias del genoma. Adem?!s, se determin?? que la proporci??n de la dosis infecciosa en cultivo celular y copias del genoma del virus vacunal de c??lulas de embri??n de pato infectadas era de 10 a 100 respectivamente, haciendo la prueba de la reacci??n en cadena por la polimerasa 20 veces m?!s sensible que el cultivo celular para detectar el virus. La velocidad, sensibilidad y especificidad de la prueba de la reacci??n en cadena por la polimerasa suministra una herramienta de investigaci??n y de diagn??stico altamente mejorada para el estudio de la epizootiolog?-a del virus.

Social Representations of Gynecologic Cancer Screening Assessment a Qualitative research on Ecuadorian women.

PubMed

Godoy, Yolanda; Godoy, Clara; Reyes, Juan

2016-06-01

The purpose of this work was to explore: knowledge, attitudes, and beliefs regarding gynecologic cancer screening on Ecuadorian women users of primary care facilities, to identify the social representations that users of health services make about these programs and their influence on the decision to undergo a screening. An exploratory and qualitative research design was held using focus groups and in-depth interviews for data collection. A narrative content analysis of the results was conducted. Women's knowledge on gynecological cancer screening was confusing. Most frequent misconceptions related to the pap smear were: the belief that it could be useful for detecting pregnancy, ovarian cysts or infections. Most of the participants stated that the pap smear procedure is a traumatic and painful experience. Regarding to mammography women said it was used for sick woman and this procedure by itself may cause cancer. El propósito de esta investigación fue explorar los conocimientos, actitudes y creencias respecto a los programas de detección del cáncer ginecológico entre usuarias de centros de atención primaria de salud para identificar las representaciones sociales que las usuarias de los servicios de salud elaboran acerca de estos programas y de los diferentes procedimientos que comprenden. El diseño de la investigación fue exploratorio y cualitativo, mediante grupos focales y entrevistas a profundidad, con el respectivo análisis narrativo e interpretativo del contenido. Se encontró conocimiento confuso acerca de los programas de tamizaje de cáncer ginecológico y dificultades asociadas a la realización de los procedimientos. Los significados más frecuentes acerca de los programas fueron: el uso de la citología cérvico-vaginal para detectar embarazo, quistes ováricos o infecciones. La mayoría de los participantes asociaba este procedimiento con una experiencia dolorosa y traumática. Respecto al autoexamen de mamas, lo calificaron como un masaje preventivo-terapéutico y a la mamografía como peligrosa porque podría desarrollar cáncer.

[In Process Citation].

PubMed

Alarcón Hormazábal, Manuel; Delgado Floody, Pedro; Castillo Mariqueo, Lidia; Thuiller Lepelegy, Nicole; Bórquez Becerra, Pablo; Sepúlveda Mancilla, Carlos; Rebolledo Quezada, Sara

2016-03-25

Introducción: existe una alta prevalencia de sedentarismo, sobrepeso y obesidad en jóvenes universitarios. Objetivo: el propósito del estudio fue determinar los efectos de un programa de entrenamiento intervalado de alta intensidad (HIIT) sobre el perfil antropométrico, glicemia basal y VO 2 máx (consumo máximo de oxígeno) de jóvenes sedentarios con malnutrición por exceso. Material y métodos: 6 mujeres y 2 hombres (2 obesos y 6 con sobrepeso) se sometieron a un programa de entrenamiento de alta intensidad de 8 semanas de duración (3 sesiones/semana). Se evaluó en ayuno y posterior a 72 horas de la última intervención; peso, índice de masa corporal (IMC), contorno de cintura (CC), perímetro de cadera y glicemia de basal. El VO 2 máx fue evaluado en condiciones normales previo a la primera sesión. Resultados: las variables de estudio no presentaron cambios significativos (p > 0,05), pero reportaron disminuciones porcentuales. El peso disminuyó un 0,18%, el IMC un 0,27%, el CC 2,67%, el perímetro de cadera un 1,15%, y el VO 2 máx un 0,48%. La glicemia basal presentó la mayor disminución, pasó de 95,13 ± 23,91 a 89,88 ± 12,45 mg/dl (5,52%), estabilizando y mejorando sus niveles en cada uno de los participantes. Conclusiones: el programa de entrenamiento intervalado de alta intensidad fue factible de realizar sin resultados adversos para la salud de los participantes, la glicemia basal mostró la mayor variación, estabilizando sus valores en los participantes, lo que es un indicador positivo dentro del programa. Es necesario seguir investigando sobre esta metodología HIIT y aumentar los tiempos de estudio para ver los cambios que se pueden producir en distintos parámetros metabólicos, antropométricos y físicos en población con malnutrición por exceso.

Quality control method to measure predator evasion in wild and mass-reared Mediterranean fruit flies (Diptera: Tephritidae)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hendrichs, M.; Wornoayporn, V.; Hendrichs, J.

Sterile male insects, mass-reared and released as part of sterile insect technique (SIT) programs, must survive long enough in the field to mature sexually and compete effectively with wild males for wild females. An often reported problem in Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) SIT programs is that numbers of released sterile males decrease rapidly in the field for various reasons, including losses to different types of predators. This is a serious issue in view that most operational programs release sterile flies at an age when they are still immature. Previous field and field-cage tests have confirmed that fliesmore » of laboratory strains are less able to evade predators than wild flies. Such tests involve, however, considerable manipulation and observation of predators and are therefore not suitable for routine measurements of predator evasion. Here we describe a simple quality control method with aspirators to measure agility in medflies and show that this parameter is related to the capacity of flies to evade predators. Although further standardization of the test is necessary to allow more accurate inter-strain comparisons, results confirm the relevance of measuring predator evasion in mass-reared medfly strains. Besides being a measure of this sterile male quality parameter, the described method could be used for the systematic selection of strains with a higher capacity for predator evasion. (author) [Spanish] Insectos machos esteriles criados en forma masiva para ser liberados en programas que utilizan la tecnica del insecto esteril (TIE), tienen que tener la capacidad de sobrevivir en el campo el tiempo necesario para poder madurar sexualmente y competir efectivamente con los machos silvestres por hembras silvestres. Un problema frecuentemente reportado por dichos programas de la mosca del Mediterraneo, Ceratitis capitata (Wiedemann), es que el numero de machos esteriles de laboratorio liberados en el campo, decrecen rapidamente por varias razones, incluyendo perdidas debidas a diferentes tipos de depredadores. Estudios anteriores conducidos en el campo, y en jaulas de campo, han confirmado que las cepas de machos de laboratorio tienen menos capacidad de evadir depredadores que los machos silvestres. Estos estudios involucran, sin embargo, una considerable cantidad de manipulacion y observacion de depredadores, por lo que no son adecuados para ser usados como medidas rutinarias en los programas de cria masiva. Aqui describimos un metodo sencillo de control de calidad usando aspiradores para medir agilidad en la mosca del Mediterraneo y mostramos que este parametro esta relacionado a la capacidad de la moscas a evadir a depredadores. Aunque aun es necesario refinar la estandarizacion de este metodo para permitir la comparacion entre cepas, los resultados confirman la importancia de tener un metodo rutinario para medir la capacidad de evasion de depredadores en cepas de cria de laboratorio de la mosca del Mediterraneo. Ademas de medir este parametro de control de calidad de los machos esteriles, el metodo descrito podria tambien ser usado para la seleccion sistematica de cepas con una mayor capacidad de evasion de depredadores. (author)« less

Head Start Program Performance Standards on Services for Children with Disabilities (45-CFR 1308) [and] Normas de Ejecucion del Programa Head Start Sobre Servicios para Ninos con Discapacidades (45-CFR 1308).

ERIC Educational Resources Information Center

Administration for Children, Youth, and Families (DHHS), Washington, DC. Head Start Bureau.

This document consolidates, clarifies, and updates federal regulations on Head Start services for children with disabilities. The regulations are designed to complement the Head Start Program Performance Standards governing services to all enrolled children. Specifically, these regulations require Head Start programs to: (1) design comprehensive…

Escaparate. Programa de lectura y ensenanza del lenguaje, Unidad C. Guia Para El Maestro (Show Window. Reading and Language Learning Program, Unit C. Teacher's Guide).

ERIC Educational Resources Information Center

Dissemination and Assessment Center for Bilingual Education, Austin, TX.

Instructions for use of "Escaparate," the third of eight Spanish reading and language instruction units developed by Edgewood School District's Bilingual Program, San Antonio, Texas, are given in this teacher guide. Originally intended for grades four through six, the program may be used from fourth grade to secondary school in Spanish reading and…

Finding an Appropriate Preschool for Your Child with Special Needs = Como Encontrar un Programa Pre-escolar para su nino con desabilidades.

ERIC Educational Resources Information Center

Bernstein, Sandra; Wonderlick, Mary; Madden, Drina

This booklet, with English and Spanish versions, provides a step-by-step procedure to help families find an appropriate preschool program in the community for their child with disabilities. The booklet lists six steps for locating a program: (1) decide what kind of program is wanted for the child; (2) complete included form outlining child's needs…

Como preparar un programa de informacion sobre la asistencia economica (Planning a Financial Aid Awareness Program).

ERIC Educational Resources Information Center

Department of Education, Washington, DC.

This booklet, written in Spanish, is intended to be used with a set of slides as part of a presentation to students on "How To Apply for Federal Student Aid" ("Como Solicitar la Asistencia Economica Federal para Estudiantes"). The first part of the book is a script based on the slides. After the script is a guide to hosting a financial aid…

A Parent's Guide to Infant/Toddler Programs = Guia para los padres sobre los programas de cuidado infantil de 0-3 anos.

ERIC Educational Resources Information Center

Dodge, Diane Trister; Dombro, Amy Laura; Colker, Laura J.

Information on how warm and responsive care can help shape infants' and toddlers' development and their ability to learn can be reassuring for concerned parents. This guide, in English and Spanish versions, presents quality child care as a partnership between the child caregiver and the parents with the primary goal of benefiting the child. The…

Educación sobre sexualidad y prevención del VIH: un diagnóstico para América Latina y el Caribe

PubMed Central

DeMaria, Lisa M.; Galárraga, Omar; Campero, Lourdes; Walker, Dilys M.

2016-01-01

RESUMEN Objetivo Mostrar, a través de un diagnóstico en América Latina y el Caribe, el panorama legislativo y curricular sobre sexualidad y prevención contra el virus de inmunodeficiencia humana (VIH) en el ámbito escolar, contrastándolo con los comportamientos sexuales reportados en encuestas demográficas y de salud. Métodos En mayo de 2008 se realizó, con el apoyo del Fondo de Población de las Naciones Unidas (UNFPA), una encuesta a informantes clave en 34 países de la Región. El cuestionario autoaplicado solicitó información sustantiva de agentes de las diferentes partes interesadas, como ministerios de educación y de salud, sobre los programas de prevención contra el VIH/Sida que se están aplicando en las escuelas. Resultados Respondieron a la encuesta 27 países que representan 95,5% de la población objetivo (6 a 18 años de edad). La mayoría de los países informó tener al menos un libro de texto o un capítulo específico para enseñar los temas de educación sobre sexualidad y prevención del VIH. En la escuela secundaria se cubren la mayor parte de los temas pertinentes relevantes para la educación sobre sexualidad, pero no todos. Por ejemplo, el problema de la discriminación por orientación o preferencia sexual no se incluye en los programas escolares. Conclusiones El material educativo sobre sexualidad debe ser revisado y actualizado periódicamente de modo que refleje los avances en los temas y en la forma de tratar los contenidos. En cada país el currículo debe abordar el tema del respeto a la diversidad sobre orientación, preferencia e identidad sexuales, y en particular el manejo apropiado de la educación para prevenir infecciones de transmisión sexual (ITS) en hombres que tienen sexo con hombres. Los esfuerzos de evaluación de la efectividad de los programas deben contemplar desenlaces tales como marcadores biológicos (incidencia y prevalencia de ITS y embarazo) y no únicamente indicadores de conocimiento y comportamiento sexual auto-reportado. PMID:20107702

Autoguía para el telescopio 2,15 mts de CASLEO

NASA Astrophysics Data System (ADS)

Aballay, J. A.; Casagrande, A. R.; Pereyra, P. F.; Marún, A. H.

Se está desarrollando un sistema de autoguía para el telescopio de 2,15 mts. El mismo se realizará aprovechando el Offset Guider. Al ocular móvil de éste se vinculará alguna cámara digital (ST4-ST7-CH250) para lograr la visión del objeto. El funcionamiento del equipo será el siguiente: primero, dadas las coordenadas del objeto a observar, se tomarán las coordenadas del telescopio para que, a través de una base de datos, se determine un campo de objetos que sirvan para la cámara de visión, luego, la PC obtendrá el offset entre la estrella de observación y la estrella seleccionada como guía, este valor será trasladado a los motores que posicionarán en forma automática el ocular. Una vez que la estrella es visualizada en la cámara (monitor de PC ) se correrá el programa que guiará el telescopio automáticamente.

Abundancias químicas de las estrellas CP del grupo HgMn μ Leporis y 53 Tauri. II. Boro, Berilio, Carbono, Magnesio, Aluminio y Silicio

NASA Astrophysics Data System (ADS)

López García, Z.; Malaroda, S. M.; Faraggiana, R.

Se determinan las abundancias químicas de los elementos más livianos presentes en dos estrellas CP del grupo HgMn, μ Lep y 53 Tau, utilizando espectros IUE de alta resolución y técnicas de cálculo de espectros sintéticos. Para el cálculo de las líneas se utiliza la lista mas completa de datos atómicos disponible y el programa SYNTHE. Para el cálculo de la abundancia de un elemento se comparan, para cada imagen, los perfiles observados del mayor número de líneas presentes con los perfiles calculados obtenidos por variación de las abundancias iniciales, reteniendo la abundancia para la cual el acuerdo entre las líneas observadas y calculadas es considerado visualmente el mejor. Los resultados obtenidos son comparados con los estimados por la teoría de la difusión.

HOW TO ACHIEVE AND MAINTAIN NOTE 6: POSTGRADUATE PROGRAM IN TRANSLATIONAL SURGERY - UNIFESP.

PubMed

Sabino-Neto, Miguel; Ferreira, Lydia Masako

2015-01-01

To show the way to reach and stay in note 6 in the evaluation process of Medicine III of CAPES. Capes determinations were reviewed concerning this topic, grades 6 and 7, and also the difficulties and facilities of running a program that amounted to Note 6 after restructuring and being in compliance with regulations. The main points to achieve and maintain Note 6 were: 1) regular production of master's and doctoral theses with appropriate distribution among all teachers; 2) average time of appropriate titration, as well as strict selection of students who resets the withdrawals and cancellations; 3) production of scientific articles in high impact journals and with academic and student participation in most part; 4) progressive and substantial increase in fundraising and patent search; 5) progressive increase in international exchanges with joint production; 6) visibility through new bilingual website and updated weekly; 7) numerous solidarity activities in research, but also in health services for the population and even in basic education; 8) rigorous selection of students (through design analysis, curriculum and teacher training program); 9) maintenance of high levels teachers production; 10) preparing new teachers for guidance through participation as co-supervision and involvement in the program to fit the needs. The Postgraduate Program in Translational Surgery went through difficult times; was submitted to a series of measures, adjustments, cooperation and understanding of the teaching staff, that took the program from note 3 - and almost closing - to a level of excellence keeping note 6 for three consecutive three-year periods of evaluation. Mostrar o caminho para alcançar e se manter na nota 6 no processo de avaliação da Medicina III da Capes. Foram revisadas as determinações da Capes concernentes ao tema, conceitos 6 e 7, e também as dificuldades e facilidades próprias da execução de um programa que ascendeu à nota 6 após reestruturação e adequação às normas vigentes. Os pontos principais para alcançar e manter conceito 6 foram: : 1) produção regular de teses de mestrado e doutorado com distribuição adequada entre todos os orientadores; 2) tempo médio de titulação adequado, assim como rígida seleção do alunado que zera as desistências e cancelamentos; 3) produção de artigos científicos alta em revistas de impacto e com participação docente e discente na sua grande maioria; 4) aumento progressivo e substancial da captação de recursos e busca de patentes; 5) aumento progressivo dos intercâmbios internacionais com produção conjunta; 6) visibilidade através de novo site bilíngue e atualizado semanalmente; 7) inúmeras atividades de solidariedade em pesquisa, mas também em Serviços de Saúde para a população e mesmo no ensino básico; 8) rigorosa seleção dos alunos (através de análise de projeto, currículo e programa de estágio docente); 9) manutenção de índices elevados de produção dos docentes; 10) preparação de novos docentes para orientação através de participação como co-orientação e envolvimento no programa para se adequar às necessidades. O Programa de Pós-Graduação em Cirurgia Translacional passou por momentos difíceis e que através de uma série de medidas, ajustes e a colaboração e compreensão do seu corpo docente pode sair da nota 3 e quase fechamento, para um nível de excelência mantendo nota 6 em três triênios seguidos.

Costs of the Smoking Cessation Program in Brazil.

PubMed

Mendes, Andréa Cristina Rosa; Toscano, Cristiana Maria; Barcellos, Rosilene Marques de Souza; Ribeiro, Alvaro Luis Pereira; Ritzel, Jonas Bohn; Cunha, Valéria de Souza; Duncan, Bruce Bartholow

2016-11-10

To assess the costs of the Smoking Cessation Program in the Brazilian Unified Health System and estimate the cost of its full implementation in a Brazilian municipality. The intensive behavioral therapy and treatment for smoking cessation includes consultations, cognitive-behavioral group therapy sessions, and use of medicines. The costs of care and management of the program were estimated using micro-costing methods. The full implementation of the program in the municipality of Goiania, Goias was set as its expansion to meet the demand of all smokers motivated to quit in the municipality that would seek care at Brazilian Unified Health System. We considered direct medical and non-medical costs: human resources, medicines, consumables, general expenses, transport, travels, events, and capital costs. We included costs of federal, state, and municipal levels. The perspective of the analysis was that from the Brazilian Unified Health System. Sensitivity analysis was performed by varying parameters concerning the amount of activities and resources used. Data sources included a sample of primary care health units, municipal and state secretariats of health, and the Brazilian Ministry of Health. The costs were estimated in Brazilian Real (R$) for the year of 2010. The cost of the program in Goiania was R$429,079, with 78.0% regarding behavioral therapy and treatment of smoking. The cost per patient was R$534, and, per quitter, R$1,435. The full implementation of the program in the municipality of Goiania would generate a cost of R$20.28 million to attend 35,323 smokers. The Smoking Cessation Program has good performance in terms of cost per patient that quit smoking. In view of the burden of smoking in Brazil, the treatment for smoking cessation must be considered as a priority in allocating health resources. Analisar os custos do Programa de Tratamento do Tabagismo no Sistema Único de Saúde e estimar o custo de sua implementação plena em um município brasileiro. A abordagem intensiva e tratamento do tabagismo engloba consultas, sessões de terapia cognitivo-comportamental em grupo e uso de medicamentos. Os custos do atendimento e gerenciamento do programa foram estimados utilizando a metodologia do microcusteio. A implementação plena do programa no município de Goiânia, Goiás, foi definida como sua expansão para suprir a demanda de todos os fumantes motivados a parar de fumar no município que seriam atendidos pelo Sistema Único de Saúde. Foram considerados custos médicos e não médicos diretos: recursos humanos, medicamentos, material de consumo, despesas gerais, transporte, viagens, eventos e custos de capital. Foram incluídos custos dos níveis federal, estadual e municipal de gestão. A perspectiva da análise foi a do Sistema Único de Saúde. Análise de sensibilidade foi realizada variando parâmetros referentes à quantidade de atividades e aos recursos utilizados. As fontes de dados incluíram uma amostra de unidades de saúde da Atenção Primária, secretarias de saúde municipal e estadual e Ministério da Saúde. Os custos foram estimados em reais (R$) para o ano de 2010. O custo do programa em Goiânia foi de R$429.079, sendo 78,0% referentes à abordagem e tratamento do tabagismo. O custo por paciente foi de R$534 e, por paciente que deixou de fumar, de R$1.435. A implementação plena do programa no município de Goiânia geraria custo de R$20,28 milhões, para atender 35.323 fumantes. O Programa de Tratamento do Tabagismo tem bom desempenho em termos de custo por paciente que deixa de fumar. Tendo em vista a carga do tabagismo no Brasil, o tratamento para cessação de fumar deve ser considerado prioritário ao se programar a alocação de recursos de saúde.

John Tracy Clinic: Programa de Ensenanza por Correspondencia para Los Padres de Ninos Sordo-Ciegos de Edad Preescolar (John Tracy Clinic Correspondence Learning Program for Parents of Preschool Deaf-Blind Children).

ERIC Educational Resources Information Center

Thielman, Virginia B.; And Others

Written in Spanish, the document contains a correspondence learning program for parents of deaf blind preschoolers. An introductory section gives preliminary instructions, an introduction to sign language, and a list of resources for deaf blind children. Twelve lessons follow with information on: the parent's role in teaching the child, visual…

La investigacion sobre la calidad de los programas para ninos de hasta dos anos de edad (Research on Quality in Infant-Toddler Programs). ERIC Digest.

ERIC Educational Resources Information Center

Honig, Alice Sterling

Concern about the quality of infant-toddler care programs has grown recently in response to two factors. The first is the need of employed parents for such care, and the second is research emphasizing the importance of brain development in the early years. This Spanish-language Digest introduces some of the many issues related to the quality of…

Inauguração do Telescópio SOAR

NASA Astrophysics Data System (ADS)

Steiner, João

2004-04-01

A comunidade astronômica brasileira de há muito almeja ter a sua disposição um instrumento científico com o qual possa fazer pesquisa de vanguarda e manter a competitividade científica a nível internacional. Hoje este sonho se torna uma realidade. O Brasil tem tido uma política de pesquisa e de pós-graduação bem sucedida. Estamos formando 7000 doutores por ano e produzimos 1,5% da ciência mundial. Nosso desafio, hoje, é associar a esta capacidade de gerar conhecimento também a capacidade de usar o conhecimento em beneficio da sociedade. A Astronomia não é exceção. Temos 7 programas de pós-graduação em nível de doutorado e 11 em nível de mestrado. O telescópio SOAR será o principal instrumento que sustentará estes programas nas próximas décadas. A inauguração do telescópio SOAR simboliza de forma concreta e decidida o apoio do MCT, do CNPq e da FAPESP para o financiamento à pesquisa básica em nosso país. O Laboratório Nacional de Astrofísica, criado a cerca de 20 anos pelo CNPq, a par do Laboratório Nacional de Luz Sincrotron, são até hoje, os únicos laboratórios nacionais do Brasil e ambos voltados basicamente ao avanço do conhecimento. Os vinte anos de existência do LNA foram decisivos para a estruturação da comunidade astronômica no Brasil e para a construção das parcerias como o SOAR.

Los plaguicidas y la contaminacion del medio ambiente Venezolano

USGS Publications Warehouse

Stickel, L.F.; Stickel, W.H.

1972-01-01

RESUMEN DE RECOMENDACIONES Recomendaciones para el Programa de Investigacion: 1. Establecer un sistema de muestreo biologico para detectar los niveles tendencias de los productos quimicos toxicos en un peque?o numero de si tios representativos. 2. Mantener continua vigilancia de la contaminacion ambiental, mediante la seleccion acertadamente dirigida de las zonas afectadas y de las fuentes de contaminacion. 3. Realizar estudios acerca de las poblaciones de animales silvestres, y del exito de los procesos reproductivos de las especies o grupos clayes de animales que se consideran mas gravemente afectados. 4. Preparar recomendaciones para una accion gubernamental de proteccion al hombre, a la fauna silvestre y al medio ambiente. Recomendaciones para la Accion Administrativa: 1. Establecer limites a la tolerancia de los residuos de plaguicidas en los alimentos. Constituye una medida clave para disminuir la contaminacion ambiental. 2. Establecer normas de calidad del agua para las corrientes, represas, la gos y otros cuerpos. Es la segunda medida clave para reducir la contaminacion del ambiente 3. Exigir un tratamiento adecuado de los efluentes industriales, especialmente antes de que se construyan las nuevas plantas. 4. Exigir a los agricultores que en el uso de plaguicidas sigan los consejos tecnicos autorizados y negar a los vendedores el derecho a recomendar productos por su cuenta. 5. Tomar medidas para recoger y eliminar los recipientes y sobrantes de los plaguicidas.

Primer prueba de desafio controlado en tilapia del Nilo Para Resistencia a Streptococcus iniae

USDA-ARS?s Scientific Manuscript database

Intensification of tilapia production has resulted in disease outbreaks that negatively affect commercial fish farmers. One bacterial pathogen that commonly causes losses in tilapia production is Streptococcus iniae. Control and prevention of S. iniae can be difficult and requires an integrated fish...

PubMed

Ávila García, Manuel; Huertas Delgado, Francisco Javier Huertas Delgado; Tercedor Sánchez, Pablo

2016-11-29

Introducción: España es el tercer país europeo con mayor prevalencia de obesidad infantil, dando lugar a la aparición de programas de intervención destinados a fomentar hábitos alimentarios saludables y/o de actividad física (AF).Objetivo: el propósito de esta revisión sistemática fue conocer aquellos programas de intervención para la promoción de hábitos alimentarios y de AF desarrollados en escolares españoles de Educación Primaria (EP) y analizar la influencia que han tenido las intervenciones sobre la composición corporal, los hábitos alimentarios y la AF.Método: se revisaron los artículos publicados entre los años 2000 y 2015 en las siguientes bases de datos: Web of Science, Scopus, Dialnet, PubMed, Eric, Sportdiscus y Psycinfo por dos revisores independientes.Resultados: se contabilizaron un total de 813 artículos, de los cuales tras la eliminación de duplicados (192), lectura de títulos y resumen (587) y lectura del texto completo (17), tan solo 7 cumplieron con los criterios de inclusión.Conclusiones: los programas de intervención analizados mostraron cambios positivos en la mejora de la composición corporal en algo menos de la mitad de los estudios analizados; por otro lado, casi todos los programas de intervención analizados tuvieron un efecto positivo sobre conductas respecto a ciertos hábitos alimentarios, como la ingesta de frutas, y sobre el incremento del nivel de AF.

BSSDATA - um programa otimizado para filtragem de dados em radioastronomia solar

NASA Astrophysics Data System (ADS)

Martinon, A. R. F.; Sawant, H. S.; Fernandes, F. C. R.; Stephany, S.; Preto, A. J.; Dobrowolski, K. M.

2003-08-01

A partir de 1998, entrou em operação regular no INPE, em São José dos Campos, o Brazilian Solar Spectroscope (BSS). O BSS é dedicado às observações de explosões solares decimétricas com alta resolução temporal e espectral, com a principal finalidade de investigar fenômenos associados com a liberação de energia dos "flares" solares. Entre os anos de 1999 e 2002, foram catalogadas, aproximadamente 340 explosões solares classificadas em 8 tipos distintos, de acordo com suas características morfológicas. Na análise detalhada de cada tipo, ou grupo, de explosões solares deve-se considerar a variação do fluxo do sol calmo ("background"), em função da freqüência e a variação temporal, além da complexidade das explosões e estruturas finas registradas superpostas ao fundo variável. Com o intuito de realizar tal análise foi desenvolvido o programa BSSData. Este programa, desenvolvido em linguagem C++, é constituído de várias ferramentas que auxiliam no tratamento e análise dos dados registrados pelo BSS. Neste trabalho iremos abordar as ferramentas referentes à filtragem do ruído de fundo. As rotinas do BSSData para filtragem de ruído foram testadas nos diversos grupos de explosões solares ("dots", "fibra", "lace", "patch", "spikes", "tipo III" e "zebra") alcançando um bom resultado na diminuição do ruído de fundo e obtendo, em conseqüência, dados onde o sinal torna-se mais homogêneo ressaltando as áreas onde existem explosões solares e tornando mais precisas as determinações dos parâmetros observacionais de cada explosão. Estes resultados serão apresentados e discutidos.

Raza de Tesoros. Programa de Lectura y Ensenanza del Lenguaje, Unidad B. Guia para el Maestro (Race of Treasures. Reading and Language Learning Program, Unit B. Teacher's Guide).

ERIC Educational Resources Information Center

Dissemination and Assessment Center for Bilingual Education, Austin, TX.

This is the teacher's guide accompanying a reader and a workbook that are part of an ungraded language arts and reading program that can be used in classes from upper elementary through high school. The program is designed around reading selections which present aspects of history, culture, and present-day experiences of special relevance to the…

Our Roots Feed Our Future: 30th Anniversary Conference of the Cornell Migrant Program. Presentations (May 22, 2002) = Nuestras raices nutren nuestro futuro: Conferencia del 30mo aniversario del Programa para Emigrantes de Cornell. Presentaciones (22 mayo 2002).

ERIC Educational Resources Information Center

State Univ. of New York, Ithaca. Coll. of Human Ecology at Cornell Univ.

Presented in English and Spanish, this publication compiles 13 presentations at a conference celebrating the 30th anniversary of the Cornell Migrant Program. The entries examine experiences of migrant workers and children related to immigrating, finding work, enduring discrimination and police harassment, switching schools frequently, suffering…

Oral Testimony from the Hispanic Community of Greater Boston; Programa Para el Desarrollo de un Curriculo Universitario en Estudios Etnicos Puertorriquenos y Cubanos (Program for the Development of a University Curriculum in Puerto Rican and Cuban Ethnic Studies).

ERIC Educational Resources Information Center

Forbes, Robert J., Ed.

The oral testimony presented in this document was designed to supplement materials, strategies, and recommendations contained in "Guidelines for the Development of a Program in Puerto Rican and Cuban Ethnic Heritage Studies at the Post-Secondary Level" (Curry College, 1976). Part 1, "The Hispanic Media," consists of interviews…

Preparacion e Iniciacion de la Lectura en Espanol para Maestros de Programas Bilingues. Serie Tierra de Encanto (Preparation and Initiation of Reading in Spanish for Teachers of Bilingual Programs. Land of Enchantment Series).

ERIC Educational Resources Information Center

New Mexico Univ., Albuquerque.

Part of the "Land of Enchantment" series of instructional materials, this very detailed teaching manual is designed to help teachers in bilingual programs prepare students to read Spanish. It contains suggestions for developing reading readiness skills and ways to teach a basic 30-word reading vocabulary. The reading program follows five steps:…

War Without Borders: The Colombia-Ecuador Crisis of 2008

DTIC Science & Technology

2008-12-01

Quito: Programa de la Naciones Unidas Para el Desarrollo, 2004. 33. Catherine M. Conaghan, “Ecuador: Correa’s Plebiscitary President,” Journal of...jungle area of Ecuador known as Angostura.2 The target of the attack was long time FARC leader Raúl Reyes (nom de guerre for Luis Edgar Devia Silva...million to FARC. March 4 Uribe announces that Colombia will de - nounce Chávez for support to terrorism before the International Criminal Court. 4

Algunos Criterios para Evaluar Programas de Educacion Superior a Nivel de Posgrado: El Caso Particular de la Administracion Publica (Some Criteria to Evaluate Higher Education Programs at the Graduate Level: The Special Case of Public Administration).

ERIC Educational Resources Information Center

Valle, Victor M.

Intended as a contribution to a workshop discussion on program evaluation in higher education, the paper covers five major evaluation issues. First, it deals with evaluation concepts, explaining the purposes of evaluation; pertinent terms; and the sources of evaluation in public health procedures, the scientific method, the systems approach, and…

Memoria de la XXII Reunion Ordinaria de la Asamblea General de la ANUIES (Report of the 22nd Meeting of the General Assembly of the National Association of Universities and Institutions of Higher Education) (22nd, Manzanillo, Colima, Mexico, October 1986).

ERIC Educational Resources Information Center

Revista de la Educacion Superior, 1986

1986-01-01

This serial issue is entirely devoted to the proceedings of the 1986 meeting of the "Asociacion Nacional de Universidades e Institutos de Ensenanza Superior (ANUIES)." Major attention is given to the "Programa Integral Para el Desarrollo de la Educacion Superior (PROIDES)," i.e. a comprehensive program for the development of…

Contributions of a Social Justice Language Teacher Education Perspective to Professional Development Programs in Colombia (Contribuciones de una perspectiva de justicia social para la formación de docentes de lenguas a los programas de desarrollo profesional en Colombia)

ERIC Educational Resources Information Center

Sierra Piedrahita, Ana María

2016-01-01

In this article, the author discusses the social justice language teacher education perspective and how it can help language teachers to develop a political view of their work and effect change inside and outside their particular school contexts. To do this, she briefly analyzes various professional development programs for teachers of English in…

Para Candidatos en Programas de Centros de Cuidado y Educacion Infantil con Bebes y "Toddlers": Asociado en Desarrollo Infantil Sistema de Evaluacion y Normas de Competencia CDA (Infant/Toddler Caregivers in Center-Based Programs: The Child Development Associate Assessment System and Competency Standards).

ERIC Educational Resources Information Center

Council for Early Childhood Professional Recognition, Washington, DC.

This Spanish-language booklet outlines the requirements of the Child Development Associate (CDA) credential for caregivers working in center-based infant and toddler day care programs. Part 1 provides an overview of the CDA credentialing system and the various options, settings, standards, and stages of the CDA assessment system. Part 2 explains…

The Proposed U.S.-Colombia Free Trade Agreement: Economic and Political Implications

DTIC Science & Technology

2010-04-16

2008. 50 Ibid, p. 2. 51 Colombia’s Observatorio del Programa Presidencial de DDHH y DIH, Vicepresidencia de la República, April 2008. 52 See CRS...President Alvaro Uribe, “Se Hara Todo el Esfuerzo Para Que No Se Le Niegue el TLC a Colombia, Anuncia el Presidente de Colombia en Entrevista a Caracol...focus of U.S. trade policy as demonstrated by the passage of the North American Free Trade Agreement (NAFTA), the U.S.- Chile Free Trade Agreement, the

Digitalización de diapositivas del Sol en H α

NASA Astrophysics Data System (ADS)

Missio, H.; Montenegro, C.; Montenegro, R.

El objetivo de este trabajo ha sido el de obtener imágenes digitalizadas de las diapositivas tomadas del Sol en luz de hidrógeno de la línea correspondiente a Hα, y de esta manera llegar a convertir las mismas a un archivo digital para poder ser tratadas luego por computadora y poder contabilizar con exactitud, mediante un programa adecuado para tal fin, las zonas activas del Sol en la imagen digitalizada. En principio, para llegar a esto se pensó en la utilización de medios accesibles, y como detector se utilizó un fototransistor ubicado dentro de un soporte rectangular sobre dos ejes de desplazamiento X e Y. Se han obtenido con este procedimiento imágenes de buena calidad, construídas a partir de tres datos digitalizados en cada barrido que aportan la posición X e Y y la intensidad del pixel en ese punto indicada en 255 tonos de grises.

Projeto do sistema anti-ressonante da fiação dos transdutores para o detector Mario Schenberg

NASA Astrophysics Data System (ADS)

Vieira, S. J.., Jr.; Melo, J. L.

2003-08-01

O detector de ondas gravitacionais Mario Schenberg está sendo projetado e construído pelo grupo Gráviton. Sua construção está ocorrendo no Laboratório de Estado Sólido e Baixas Temperaturas (LESBT) da Universidade de São Paulo, na cidade de São Paulo. Esse detector possui uma massa ressonante esférica de cobre-alumínio, com 65 cm de diâmetro, pesando aproximadamente 1150 Kg, suspensa por um sistema de isolamento vibracional, que se encontra em fase de testes preliminares. A real eficácia desse sistema, entretanto, só poderá ser comprovada quando o detector estiver aparelhado com, pelo menos, um transdutor eletromecânico de altíssima sensibilidade acoplado à massa ressonante. Neste momento, não só este sistema de isolamento vibracional será posto em teste, como o do projeto da fiação que transporta os sinais de microondas até os transdutores e destes para a pré-amplificação. Apesar dessa fiação ter sido projetada para não apresentar nenhum contato com a superfície esférica da antena, de maneira a não haver nenhuma transmissão de ruído vibracional do laboratório para esta, deve-se minimizar o ruído microfônico produzido nessa fiação por oscilações mecânicas, uma vez que ela não utiliza nenhum sistema de isolamento vibracional. Com o intuito de resolver este problema, projetamos uma estrutura, formada por pequenos cilindros conectados por barras, a qual não terá nenhuma ressonância mecânica na faixa de freqüências de interesse para detecção (3000 - 3400 Hz). Desta forma, as vibrações nessa faixa não serão amplificadas. O projeto foi feito usando iterativamente, de maneira a otimizar os resultados obtidos, o programa de elementos finitos Msc/Nastran. Através de simulações feitas neste programa, determinamos os parâmetros geométricos ideais a serem utilizados, os quais proporcionam a maior região espectral de interesse livre de ressonâncias.

Tendências de teses e dissertações sobre ensino de astronomia no Brasil

NASA Astrophysics Data System (ADS)

Bretones, P. S.; Megid Neto, J.

2003-08-01

Neste trabalho são apresentados os resultados de uma pesquisa do tipo estado da arte sobre teses e dissertações defendidas no Brasil e relativas ao ensino de Astronomia. Teve por objetivo identificar essa produção e conhecer as principais tendências da pesquisa nesse campo. O procedimento inicial consistiu de um levantamento bibliográfico junto ao Centro de Documentação em Ensino de Ciências (CEDOC) da Faculdade de Educação da UNICAMP e ao Banco de Teses da CAPES disponível na Internet. Foram localizadas 13 dissertações de mestrado e 3 teses de doutorado, as quais foram estudadas em função dos seguintes aspectos: instituição, ano de defesa, nível escolar abrangido no estudo, foco temático do estudo e gênero de trabalho acadêmico. Deste conjunto de pesquisas, 13 (81,3%) delas foram defendidas a partir da segunda metade dos anos 90, indicando uma preocupação mais recente com temas relativos ao ensino de Astronomia no conjunto da produção acadêmica em programas de pós-graduação no Brasil. Verificou-se que 43,7% dos trabalhos foram produzidas na USP e 18,8% na UNICAMP. Quanto ao nível escolar abrangido nos estudos, predominaram os estudos direcionados ao Ensino Fundamental de 5a a 8a séries (62,5%). No que diz respeito ao foco temático das pesquisas, as principais tendências voltaram-se: 56,3% para Conteúdo e Método; 43,8% para Concepções do Professor; 37,5% para Currículo e Programas; 37,5% para Recursos Didáticos. Quanto ao gênero de trabalho acadêmico, verificou-se que 43,8% são de Pesquisa Experimental e 31,3% de Pesquisa de Análise de Conteúdo. Estudos de revisão bibliográfica como este visam colaborar com a divulgação ampla da produção acadêmica em determinada área, traçando algumas de suas tendências. Ao mesmo tempo possibilita, a partir de investigações decorrentes, apontar as suas contribuições para o ensino e sinalizar com necessidades a serem supridas por futuras pesquisas.

Astrossismologia e o satélite COROT

NASA Astrophysics Data System (ADS)

Andrade, L. B. P.; Janot Pacheco, E.

2003-08-01

Este trabalho centra-se em atividades na fase de pré-lançamento do satélite COROT, da agência espacial francesa (CNES), a ser lançado em 2005. O satélite será dedicado à sismologia estelar e à procura de exoplanetas. Nosso programa de trabalho centra-se em dois pontos principais: (1) efetuar uma procura detalhada nos campos COROT de alvos astrofísicos de especial interesse; (2) participar das análises espectroscópicas prévias de alvos selecionados para determinação de parâmetros físicos das estrelas com a maior precisão possível. Na presente etapa, priorizou-se o primeiro ponto do projeto. Foi feito um levantamento geral dos objetos astrofísicos encontrados nos dois campos de observação, centrados em 06H50M e 18H50M, com raios de 10 minutos. Concluiu-se que as estrelas B-Be deverão ser observadas no campo sismológico, enquanto que as anãs brancas deverão sê-lo no campo exoplanetário. Objetos a serem observados foram escolhidos de forma a estarem próximos de alvos principais dos programas centrais do satélite. Paralelamente, estudos e pesquisas bibliográficas foram feitos para compreender os assuntos de interesse principal, ou seja, as pulsações não-radiais de estrelas Ob-Be

Sistemas Correctores de Campo Para EL Telescopio Ritchey-Chretien UNAM212

NASA Astrophysics Data System (ADS)

Cobos, F. J.; Galan, M. J.

1987-05-01

El telescopio UNAM2l2 fue inaugurado hace siete años y concebido para trabajar en las razones focales: f/7.5, F/13.5, F/27 y F/98. El diseño Ritchey-Chretién corresponde a la razón focal F/7.5 y el foco primario (F/2.286) no se consideró como utilizable para fotografía directa. En el Instituto de Astronomía de la UNAM, se diseñó y construyó un sistema corrector de campo para la razón focal F/7.5, que actualmente está en funcionamiento. Dentro de un programa de colaboración en diseflo y evaluación de sistemas ópticos, entre el Instituto de Astrofísica de Canarias y el Instituto de Astronomía de la UNAM, decidimos intentar el diseño de una correctora de campo para el foco primario del tȩlescopio UNAM212 bajo la consideración de que no son insalvables los problemas que implicaría su instalación y de que es muy posible que, en un futuro relativamente cercano, podamom tener un detector bidimenmional tipo Mepsicrón cuya área sensible haga tentadora la idea de construir la cámara directa para foco primario

Impact of payments for environmental services and protected areas on local livelihoods and forest conservation in northern Cambodia

PubMed Central

Clements, Tom; Milner-Gulland, E J

2015-01-01

The potential impacts of payments for environmental services (PES) and protected areas (PAs) on environmental outcomes and local livelihoods in developing countries are contentious and have been widely debated. The available evidence is sparse, with few rigorous evaluations of the environmental and social impacts of PAs and particularly of PES. We measured the impacts on forests and human well-being of three different PES programs instituted within two PAs in northern Cambodia, using a panel of intervention villages and matched controls. Both PES and PAs delivered additional environmental outcomes relative to the counterfactual: reducing deforestation rates significantly relative to controls. PAs increased security of access to land and forest resources for local households, benefiting forest resource users but restricting households’ ability to expand and diversify their agriculture. The impacts of PES on household well-being were related to the magnitude of the payments provided. The two higher paying market-linked PES programs had significant positive impacts, whereas a lower paying program that targeted biodiversity protection had no detectable effect on livelihoods, despite its positive environmental outcomes. Households that signed up for the higher paying PES programs, however, typically needed more capital assets; hence, they were less poor and more food secure than other villagers. Therefore, whereas the impacts of PAs on household well-being were limited overall and varied between livelihood strategies, the PES programs had significant positive impacts on livelihoods for those that could afford to participate. Our results are consistent with theories that PES, when designed appropriately, can be a powerful new tool for delivering conservation goals whilst benefiting local people. El Impacto de los Pagos por Servicios Ambientales y Áreas Protegidas sobre la Subsistencia Local y la Conservación del Bosque en el Norte de Camboya Resumen Los impactos potenciales de los pagos por servicios ambientales (PSA) y áreas protegidas (APs) sobre los resultados ambientales y las subsistencias locales en los países en desarrollo son polémicos y se han debatido ampliamente. La evidencia disponible es escasa; ha habido pocas evaluaciones rigurosas de los impactos ambientales y sociales de las APs y particularmente los PSA. Medimos el impacto sobre los bosques y el bienestar humano en tres diferentes programas de PSA que se llevan a cabo dentro de dos APs en el norte de Camboya usando un panel de aldeas de intervención y controles emparejados. Tanto los PSA como las APs brindaron resultados ambientales adicionales en relación a los contrafácticos, esto quiere decir que redujeron las tasas de deforestación significativamente en relación a los controles. Las áreas protegidas incrementaron el acceso seguro a los recursos del suelo y el bosque para las viviendas locales, beneficiando a los usuarios de los recursos del bosque pero restringiendo la habilidad de las viviendas para expandirse y diversificar su agricultura. Los impactos de los pagos por servicios ambientales sobre el bienestar de las viviendas estuvieron relacionados con la magnitud de los pagos proporcionados. Los dos programas de PSA de mayor paga y con conexión al mercado tuvieron impactos positivos significativos, mientras que un programa de menor paga con el objetivo de proteger a la biodiversidad no tuvo un efecto detectable sobre las viviendas, a pesar de sus resultados ambientales positivos. Las viviendas que se inscribieron a los programas de PSA con mayor paga, sin embargo, necesitaban típicamente más bienes capitales, por lo que eran menos pobres y tenían mayor seguridad alimentaria que otros aldeanos. Por esto, mientras los impactos de las APs sobre el bienestar de las viviendas fueron limitados en general y variaron dependiendo de las estrategias de subsistencia, los programas de PSA tuvieron impactos positivos significativos sobre las viviendas para aquellos que podían costear participar. Nuestros resultados son congruentes con las teorías de que los PSA, cuando se designan apropiadamente, pueden ser una herramienta poderosa y novedosa para obtener objetivos de conservación mientras se beneficia a la gente local. PMID:25492724

Linking Indices for Biodiversity Monitoring to Extinction Risk Theory

PubMed Central

Mccarthy, Michael A; Moore, Alana L; Krauss, Jochen; Morgan, John W; Clements, Christopher F

2014-01-01

Biodiversity indices often combine data from different species when used in monitoring programs. Heuristic properties can suggest preferred indices, but we lack objective ways to discriminate between indices with similar heuristics. Biodiversity indices can be evaluated by determining how well they reflect management objectives that a monitoring program aims to support. For example, the Convention on Biological Diversity requires reporting about extinction rates, so simple indices that reflect extinction risk would be valuable. We developed 3 biodiversity indices that are based on simple models of population viability that relate extinction risk to abundance. We based the first index on the geometric mean abundance of species and the second on a more general power mean. In a third index, we integrated the geometric mean abundance and trend. These indices require the same data as previous indices, but they also relate directly to extinction risk. Field data for butterflies and woodland plants and experimental studies of protozoan communities show that the indices correlate with local extinction rates. Applying the index based on the geometric mean to global data on changes in avian abundance suggested that the average extinction probability of birds has increased approximately 1% from 1970 to 2009. Conectando Índices para el Monitoreo de la Biodiversidad con la Teoría de Riesgo de Extinción Resumen Los índices de biodiversidad combinan frecuentemente los datos de diferentes especies cuando se usan en los programas de monitoreo. Las propiedades heurísticas pueden sugerir índices preferidos, pero carecemos de medios objetivos para discriminar a los índices con propiedades heurísticas similares. Los índices de biodiversidad pueden evaluarse al determinar qué tan bien reflejan los objetivos de manejo que un programa de monitoreo busca apoyar. Por ejemplo, la Convención sobre la Diversidad Biológica requiere reportar las tasas de extinción, así que los índices que reflejan el riesgo de extinción serían valiosos. Desarrollamos 3 índices de biodiversidad que se basan en modelos sencillos de viabilidad de población y que relacionan el riesgo de extinción con la abundancia. Basamos el primer índice en la media geométrica de la abundancia de especies, y el segundo en una media de poder más general. En el tercer índice integramos la media geométrica y la tendencia. Estos índices requieren los mismos datos que índices previos, pero también se relacionan directamente con el riesgo de extinción. La información de campo sobre mariposas y plantas de bosque, y los estudios experimentales de comunidades protozoarias, muestran que los índices se correlacionan con las tasas locales de extinción. Al aplicar el índice basado en la media geométrica sobre los datos globales de los cambios en la abundancia de aves, sugirió que la probabilidad de extinción promedio de aves ha incrementado aproximadamente 1% desde 1970 hasta 2009. Palabras Clave Índice de biodiversidad, media geométrica, medida de la biodiversidad, riesgo de extinción PMID:24820139

"On Air": Participation in an Online Radio Show to Foster Speaking Confidence. A Cooperative Learning-Based Strategies Study ("Al aire": participación en un programa de radio en línea para fomentar la confianza al hablar. Un estudio basado en estrategias de aprendizaje cooperativo)

ERIC Educational Resources Information Center

Lemos Tello, Nubia Consuelo

2012-01-01

The daily observation of class sessions has enabled me to recognize that students possess a feeling of self-distrust in oral activities. For this reason, I designed a study carried out with a group of twelve eighth graders. This article illustrates an action research project conducted to enhance students' confidence when speaking on an online…

Gibraltar Experiment: A Plan for Dynamic and Kinematic Investigations of Strait Mixing, Exchange and Turbulence.

DTIC Science & Technology

1986-08-01

Iuz y clorofila; conl posible opcibn a determinar metales pesados en sedimentos, en el Estrecho de Gibral- tar y zonas adyacentes. Todo ello muy...Estrecho. El trabajo de campo acabara& en Abril y se podra’ disponer de un informe pr-eli- minar par-a despue’s del Verano. Este programa ha sido...pademas realizar una primera campar~a en Junio de 1985 la usari’amas coma campa de pruebas . Aparte de esta campah’a pensamos realizar otra en Octubre a

Designing Proficiency Tests to Accredit Previous Knowledge in American and British Literature in a Bilingual Education Program (Diseño de exámenes de suficiencia para acreditar el conocimiento previo en literatura americana y británica en un programa de educación bilingüe)

ERIC Educational Resources Information Center

León Chica, César Julio; D'Costa Martínez, Catalina; Franco Jácome, Gisela

2010-01-01

This article aims at identifying the kind of American and British literature tests that can be designed to allow students who enter a bilingual education program at a private university in Colombia to have their previous knowledge in these two subjects accredited through a proficiency test. Students' needs, opinions, beliefs, existing commercial…

Para Candidatos en Programas de Centros de Cuidado y Educacion Infantil con Ninos de Edad Pre-escolar: Asociado en Desarrollo Infantil Sistema de Evaluacion y Normas de Competencia CDA (Preschool Caregivers in Center-Based Programs: The Child Development Associate Assessment System and Competency Standards).

ERIC Educational Resources Information Center

Council for Early Childhood Professional Recognition, Washington, DC.

This Spanish-language booklet outlines the requirements of the Child Development Associate (CDA) credential for preschool teachers or caregivers who work in center-based preschool day care programs. Part 1 provides an overview of the CDA credentialing system and the various options, settings, standards, and stages of the CDA assessment system.…

Viviremos! On the Road to Healthy Living: A Bilingual Curriculum on AIDS and HIV Prevention for Migrant Students (Grades 6-12) = El Camino Hacia la Salud: Un Programa de Estudio Bilingue sobre la Prevencion del SIDA y del VIH para Estudiantes Migrantes (Grados 6-12).

ERIC Educational Resources Information Center

VAMOS (Villarreal Analytical Management and Organizational Services), San Marcos, TX.

This curriculum provides the basic information everyone needs to avoid HIV infection, but was specifically designed for Latino farmworker students in grades 6-7. The student materials are written in Spanish and English and may be used with older student or young adults, or in English-as-a-second-language courses. An introduction provides…

Artesanias Mexico - Americanas. Programa Piloto de Entrenamiento Para El Asociado Bilingue y Bicultural En El Desarrollo del Nino: Guia XIII [Arts and Crafts of Mexico and the Americas. Pilot Program for the Training of Bilingual and Bicultural Teachers for the Cognitive Development of the Child: Guide XIII].

ERIC Educational Resources Information Center

de Celis, Margarita

This Child Development Associate (CDA) training module, the thirteenth in a series of 16, provides creative experiences with arts and crafts for young children. Designed for preschool teachers and paraprofessional trainees, the Spanish text offers a variety of craft activities. A list of materials necessary, step-by-step directions and…

Erratum: Attenuation measurements show that the presence of a TachoSil surgical patch will not compromise target irradiation in intra-operative electron radiation therapy or high-dose-rate brachytherapy.

PubMed

Sarmento, Sandra; Costa, Filipa; Pereira, Alexandre; Lencart, Joana; Dias, Anabela; Cunha, Luís; Sousa, Olga; Silva, José Pedro; Santos, Lúcio

2015-12-15

After publication of this study [1], the authors noticed that the funding was incorrectly acknowledged. The correct Acknowledgements section can be found below: “This work was partly funded by Fundação para a Ciência e Tecnologia (FCT), in the framework of the project PTDC/SAU-ENB/117631/2010, which is cofinanced by FEDER, through Programa Operacional Fatores de Competitividade - COMPETE of QREN (reference FCOMP-01-0124-FEDER-021141).”

Juegos - Cuentos - Cantos - Y - Rimas. Programa Piloto de Entrenamiento Para El Asociado Bilinque y Bicultural En El Desarrollo del Nino: Guia XII [Games - Stories - Songs -And - Rhymes. Pilot Program for the Training of Bilingual and Bicultural Teachers for the Cognitive Development of the Child: Guide XII].

ERIC Educational Resources Information Center

de Celis, Margarita

This Child Development Associate (CDA) training module, the twelfth in a series of 16, is designed for preschool teachers and paraprofessional trainees and contains (in four separate sections) games, stories, songs and rhymes in Spanish that can be used in a bilingual, multicultural classroom setting. The module, written in Spanish, offers…

Bionomics of the Primary Malaria Vector, Anopheles pseudopunctipennis, in the Tapachula Foothill Area of Southern Mexico

DTIC Science & Technology

1992-02-04

GoozaJez 00. 1978. Programa de Emdicacion del Paludismo en Mexico y Nuevos Enfoques de su Estraltgia. Sal. Pub. Mex. XX(5):6I3-642. 51. Comision...Gutierrez, J, Neghme, A. 1949. Diez Anos de Lucha Antimalarica en Chile . Rev. Paras;IO!. Ch;le X(1): 5·24. 206. Nee J, Neghme, A. 1940...21): IOS-lI3. 211 . Paez R 1930. Indices Eptdemiologicos de Ia Malaria en el DeparwnenlO de Arica ( Chile ). Rev. InsL Bacterial., Chile 1:4148. 212

Primer for Perception: A Manual Designed to Help Professionals, Para-Professionals and Volunteers Help Children "Learn to Learn".

ERIC Educational Resources Information Center

Goldzer, Beatrice F.

This manual for use by professionals, paraprofessionals, and tutors provides 10 multi-level, multi-purpose units for teaching children with reading, writing, or speech problems. The units were designed for use with preschool through sixth-grade students and consist of games, exercises, drills, evaluation, and suggestions for activities. The manual…

Bases para el Curriculum del Primer Ciclo de las Escuelas de Nivel Intermedio (Bases for the First Term Curriculum in Intermediate Schools).

ERIC Educational Resources Information Center

Fermin Mignone, Emilio; And Others

This curriculum guide for intermediate schools in Argentina begins with a discussion of the historical development of such schools and of their place in the overall educational scheme. The section on the curriculum provides detailed information on objectives, content, and activities; philosophical, political, sociological, methodological, and…

Establishing the Empirical Relationship Between Non-Science Majoring Undergraduate Learners' Spatial Thinking Skills and Their Conceptual Astronomy Knowledge. (Spanish Title: Estableciendo Una Relación Empírica Entre el Razonamiento Espacial de los Estudiantes de Graduación de Carreras no Científicas y su Conocimento Conceptual de la Astronomía.) Estabelecendo Uma Relação Empírica Entre o RacioCínio Espacial dos Estudantes de Graduação EM Carreiras Não Científicas e Seu Conhecimento Conceitual da Astronomia

NASA Astrophysics Data System (ADS)

Heyer, Inge; Slater, Stephanie J.; Slater, Timothy F.

2013-12-01

The astronomy education community has tacitly assumed that learning astronomy is a conceptual domain resting upon spatial thinking skills. As a first step to formally identify an empirical relationship, undergraduate students in a non-major introductory astronomy survey class at a mediumsized, Ph.D. granting, mid-western US university were given pre- and post-astronomy conceptual diagnostics and spatial reasoning diagnostics, Instruments used were the "Test Of Astronomy Standards" and "What Do You Know?" Using only fully matched data for analysis, our sample consisted of 86 undergraduate non-science majors. Students' normalized gains for astronomy surveys were low at .26 and .13 respectively. Students' spatial thinking was measured using an instrument designed specifically for this study. Correlations between the astronomy instruments' pre- to post-course gain scores and the spatial assessment instrument show moderate to strong relationships suggesting the relationship between spatial reasoning and astronomy ability can explain about 25% of the variation in student achievement. La comunidad de educación en astronomía ha supuesto de forma tácita que el aprendizaje de la astronomía consiste en un dominio conceptual fundamentado en el razonamiento espacial. Como un primer paso para identificar formalmente una relación empírica entre estas dos cosas, utilizamos como muestra los estudantes de graduación de carreras no científicas de un curso experimental en una universidad norteamericana del medioeste de porte mediano con programa de Doctorado em curso, en el cual estos estudiantes se sometieron a un diagnóstico de razonamiento espacial y conceptos astronómicos antes e después del mismo. Las herramientas utilizadas fueron el Test Of Astronomy Standards (TOAST) y el cuestionario What do you know? Utilizando solo los datos completamente consistentes para este análisis, nuestra muestra consistió en 86 estudantes de graduación. Las mejoras, depués de normalizadas, en el desempeño de los estudiantes en estos dos asuntos foram pequenas, 0.26 e 0.13 respectivamente. El razonamiento espacial de los estudiantes fue medido utilizando un instrumento específico desarrollado para este trabaljo. Las correlaciones entre los resultados de los tests astronómicos y este instrumento específico, antes y después del curso mostraron una relación entre moderada y fuerte, sugiriendo que la relación entre el razonamiento espacial y el conocimiento astronómico puede explicar hasta un 25% de la variación em el desempeño de los estudiantes. A comunidade da educação em astronomia tem suposto de forma implícita que o aprendizado da astronomia consiste em um domínio conceitual fundamentado no raciocínio espacial. Como um primeiro passo para identificar formalmente uma relação empírica entre estas duas coisas, utilizamos como amostra os estudantes de graduação de carreiras não científicas de um curso exploratório em uma universidade norte-americana do meio-oeste de médio porte com programa de Doutorado em andamento, onde estes estudantes foram submetidos a um diagnóstico de raciocino espacial e conceitos astronômicos antes e depois do mesmo. As ferramentas utilizadas foram o Test Of Astronomy Standards (TOAST) e o questionário What do you know? Utilizando somente dados completamente consistentes para esta análise, nossa amostra consistiu de 86 estudantes de graduação. As melhoras, depois de normalizadas, do desempenho dos estudantes nos dois quesitos foram pequenas, 0.26 e 0.13 respectivamente. O raciocínio espacial dos estudantes foi medido utilizando um instrumento específico desenhado para este trabalho. As correlações entre os resultados dos testes astronômicos e este instrumento específico antes e depois do curso mostraram uma relação entre moderada e forte, sugerindo que a relação entre o raciocínio espacial e o conhecimento astronômico pode explicar até um 25% na variação no desempenho dos estudantes.

Impacto del Seguro Popular en el gasto catastrófico y de bolsillo en el México rural y urbano, 2005–2008

PubMed Central

Sosa-Rubí, Sandra G; Salinas-Rodríguez, Aarón; Galárraga, Omar

2016-01-01

Objetivo Estimar el efecto del Seguro Popular (SP) sobre la incidencia del gasto catastrófico en salud (GCS) y sobre el gasto de bolsillo en salud (GBS) en el mediano plazo. Material y métodos Con base en la Encuesta de Evaluación del Seguro Popular (2005–2008), se analizaron los resultados del efecto del SP en la cohorte rural para dos años de seguimiento (2006 y 2008) y en la cohorte urbana para un año (2008). Resultados A nivel conglomerado no se detectaron efectos del SP. A nivel hogar se encontró que el SP tiene un efecto protector en el GCS y en el GBS en consulta externa y hospitalización en zonas rurales; y efectos significativos en la reducción de GBS en consulta externa en zonas urbanas. Conclusiones El SP se muestra como un programa efectivo para proteger a los hogares contra gastos de bolsillo por motivos de salud en el mediano plazo. PMID:22282205

DEVELOPMENT OF METRICS FOR PROTOCOLS AND OTHER TECHNICAL PRODUCTS.

PubMed

Veiga, Daniela Francescato; Ferreira, Lydia Masako

2015-01-01

To develop a proposal for metrics for protocols and other technical products to be applied in assessing the Postgraduate Programs of Medicine III - Capes. The 2013 area documents of all the 48 Capes areas were read. From the analysis of the criteria used by the areas at the 2013's Triennal Assessment, a proposal for metrics for protocols and other technical products was developed to be applied in assessing the Postgraduate Programs of Medicine III. This proposal was based on the criteria of Biological Sciences I and Interdisciplinary areas. Only seven areas have described a scoring system for technical products. The products considered and the scoring varied widely. Due to the wide range of different technical products which could be considered relevant, and that would not be punctuated if they were not previously specified, it was developed, for the Medicine III, a proposal for metrics in which five specific criteria to be analyzed: Demand, Relevance/Impact, Scope, Complexity and Adherence to the Program. Based on these criteria, each product can receive 10 to 100 points. This proposal can be applied to the item Intellectual Production of the evaluation form, in subsection "Technical production, patents and other relevant production". The program will be scored as Very Good when it reaches mean ≥150 points/permanent professor/quadrennium; Good, mean between 100 and 149 points; Regular, mean between 60 and 99 points; Weak mean between 30 and 59 points; Insufficient, up to 29 points/permanent professor/quadrennium. Desenvolver proposta de métricas para protocolos e outras produções técnicas a serem aplicadas na avaliação dos Programas de Pós-Graduação da Área Medicina III da Capes. Foram lidos os documentos de área de 2013 de todas as 48 Áreas da Capes. A partir da análise dos critérios utilizados por elas na avaliação trienal 2013, foi desenvolvida uma proposta de métricas para protocolos e outras produções técnicas. Esta proposta foi baseada nos critérios adotados pelas Áreas Ciências Biológicas I e Interdisciplinar. Apenas sete áreas descreveram sistema de pontuação para produtos técnicos, e as produções consideradas e a pontuação variaram amplamente. Dada à imensa gama de produções técnicas diferentes que podem ser consideradas relevantes, e que não seriam contempladas em sistema de pontuação caso fossem especificadas, foi desenvolvida para a Medicina III uma proposta de métricas em que são analisados cinco critérios específicos para cada produção: Demanda, Relevância/Impacto, Abrangência, Complexidade e Aderência ao Programa. Com base nestes critérios, cada produção pode receber de 10 a 100 pontos. Esta proposta poderá ser aplicada ao item Produção Intelectual da Ficha de Avaliação, subitem "Produção técnica, patentes e outras produções consideradas relevantes". Será considerado Muito Bom o Programa que obtiver média ≥150 pontos/docente permanente/quadriênio; Bom, média entre 100 e 149 pontos; Regular, média entre 60 e 99 pontos; Fraco, média entre 30 e 59 pontos; e Deficiente média ≤29 pontos/docente permanente/quadriênio.

Aceptabilidad del diagnóstico rápido casero para HIV entre hombres gay y otros hombres que tienen sexo con hombres (G&HSH) de la Ciudad de Buenos Aires

PubMed Central

Balán, Iván C.; Carballo-Diéguez, Alex; Marone, Rubén O.; Pando, María A.; Barreda, Victoria; Ávila, María M.

2011-01-01

Resumen El uso del diagnóstico rápido para HIV en Argentina, así como otros países de Latinoamérica, ha sido limitado hasta el momento. Este trabajo reporta los resultados provenientes de un estudio cualitativo realizado entre hombres gays y otros hombres que tienen sexo con hombres (G&HSH) de la Ciudad de Buenos Aires, Argentina. El objetivo principal del mismo fue conocer las ventajas y desventajas que los hombres G&HSH perciben en relación al diagnóstico rápido casero para HIV. Se realizaron ocho grupos focales con 73 participantes en los cuales se discutió acerca de las ventajas y desventajas del uso de los diagnósticos rápidos. Las respuestas fueron codificadas utilizando un programa para análisis de datos cualitativos (NVivo) y analizadas temáticamente. Los participantes describieron numerosas ventajas sobre el uso del diagnóstico rápido casero, aunque algunos reportaron importantes preocupaciones dentro de las cuales se destaca la posibilidad de impulsos suicidas si alguien recibe un resultado positivo estando solo. En términos generales se observó una gran aceptabilidad para el uso del diagnóstico rápido si el mismo es realizado por personal de salud en lugares acondicionados para este fin. PMID:25284951

Aceptabilidad del diagnóstico rápido casero para HIV entre hombres gay y otros hombres que tienen sexo con hombres (G&HSH) de la Ciudad de Buenos Aires.

PubMed

Balán, Iván C; Carballo-Diéguez, Alex; Marone, Rubén O; Pando, María A; Barreda, Victoria; Avila, María M

2011-03-01

El uso del diagnóstico rápido para HIV en Argentina, así como otros países de Latinoamérica, ha sido limitado hasta el momento. Este trabajo reporta los resultados provenientes de un estudio cualitativo realizado entre hombres gays y otros hombres que tienen sexo con hombres (G&HSH) de la Ciudad de Buenos Aires, Argentina. El objetivo principal del mismo fue conocer las ventajas y desventajas que los hombres G&HSH perciben en relación al diagnóstico rápido casero para HIV. Se realizaron ocho grupos focales con 73 participantes en los cuales se discutió acerca de las ventajas y desventajas del uso de los diagnósticos rápidos. Las respuestas fueron codificadas utilizando un programa para análisis de datos cualitativos (NVivo) y analizadas temáticamente. Los participantes describieron numerosas ventajas sobre el uso del diagnóstico rápido casero, aunque algunos reportaron importantes preocupaciones dentro de las cuales se destaca la posibilidad de impulsos suicidas si alguien recibe un resultado positivo estando solo. En términos generales se observó una gran aceptabilidad para el uso del diagnóstico rápido si el mismo es realizado por personal de salud en lugares acondicionados para este fin.

Nuestro Trabajo: Primaria para Adultos. Segunda Parte. Edicion Experimental (Our Work: Primer for Adults. Part Two. Experimental Edition).

ERIC Educational Resources Information Center

Instituto Nacional para la Educacion de los Adultos, Mexico City (Mexico).

This workbook is part of a Mexican series of instructional materials designed for Spanish speaking adults who are in the process of becoming literate or have recently become literate in their native language. This workbook is designed to orient people who are only recently literate to the world of work and business. Topics covered include worker…

Nuestra Comunidad: Primaria para Adultos. Segunda Parte. Edicion Experimental (Our Community: Primer for Adults. Part Two. Experimental Edition).

ERIC Educational Resources Information Center

Instituto Nacional para la Educacion de los Adultos, Mexico City (Mexico).

This textbook is part of a Mexican series of instructional materials designed for Spanish speaking adults who are in the process of becoming literate or have recently become literate in their native language. It is designed to teach people with developing literacy skills to participate in a meaningful way in the life of their community. Topics…

Sistema Planeta-Satélite. Simulación orbital y potenciales gravitatorios

NASA Astrophysics Data System (ADS)

Medina, C.; Carrillo, M.

Se presenta un programa (desarrollado en Quick Basic 4.5) que simula, en tres dimensiones, el movimiento orbital de un satélite (o luna) alrededor de un planeta, al tiempo que calcula y grafica, en un plano, el potencial gravitatorio del sistema en función de la distancia al planeta. Para la simulación orbital, se emplea la matriz de transformación entre el sistema del planeta y el plano orbital. Para el cálculo y graficación del potencial se aplica un desarrollo en serie hasta el segundo orden, que da cuenta del efecto de achatamiento de los polos, en caso de que éste exista. Las longitudes de los ejes del planeta, la masa de éste y del satélite, sus tamaños aparentes, y los parámetros orbitales son introducidos por el usuario.

PubMed

Litewka, Sergio; Goodman, Kenneth; Braunschweiger, Y Paul

2008-01-01

El Programa CITI (Collaborative Institutional Training Initiative) es un curso basado en Internet y desarrollado por voluntarios, que brinda material educacional sobre protección de sujetos humanos en investigaciones biomédicas y de conducta, buenas prácticas clínicas, conducta responsable de la investigación y trato humanitario a animales de laboratorio. Es un esfuerzo conjunto del Fred Hutchinson Cancer Research Center y la Universidad de Miami.Con la colaboración de expertos locales, gran parte del contenido se ha adaptado para América Latina, se ha traducido al español y portugués y se han establecido acuerdos de colaboración con instituciones especializadas en bioética en Chile, Brasil, Costa Rica y Perú. Los autores presentan una metodología accesible para la capacitación en ética de la investigación y una justificación de su uso y difusión en América Latina.

Detection and Species Determination of Malaria Parasites by PCR: Comparison with Microscopy and with ParaSight-F and ICT Malaria Pf Tests in a Clinical Environment

PubMed Central

Tham, Jill M.; Lee, Szu Hee; Tan, Theresa M. C.; Ting, Robert C. Y.; Kara, Ursula A. K.

1999-01-01

A rapid procedure for the diagnosis of malaria infections directly from dried blood spots by PCR amplification was evaluated with samples from 52 patients. Plasmodium infections were identified with a genus-specific primer set, and species differentiation between Plasmodium falciparum and Plasmodium vivax was analyzed by multiplex PCR. The PCR test with any of the three primer sets was able to detect as few as four parasites per microliter by gel electrophoresis or by nonisotopic paper hybridization chromatography. The diagnoses obtained by PCR correlated closely with those obtained by Giemsa staining except for two samples observed to have mixed P. falciparum-P. vivax infections. These were initially missed by microscopic analysis. In comparison with antigen-capture assays for P. falciparum, the PCR assays were able to detect three infections that were missed by the ParaSight-F test. The PCR test was negative for nine ParaSight-F-positive samples and one ICT Malaria Pf-positive sample, and these were confirmed to be false-positive results. The PCR thus gave no false-negative or false-positive results. Patients undergoing antimalarial therapy were also monitored by the PCR assay. Four of seven patients who were PCR positive for P. vivax at the time of discharge were later readmitted to the hospital with a recurrence of P. vivax infection. We would like to propose that PCR is a sensitive and easy method that can serve as a useful addition to microscopy for the diagnosis and the clinical monitoring of treatment of malaria. PMID:10203469

Estudio participativo para el desarrolllo de un instrumento de observación de violencia escolar

PubMed Central

Medina Santiago, Nilda G.; Rivera, Tania Cruz; Rodríguez, Maryanes Trenche; Báez Ávila, Loggina S.

2018-01-01

La violencia en las escuelas es reconocida como un problema de salud pública a nivel mundial que impacta negativamente el proceso de enseñanza-aprendizaje. Sin embargo, en Puerto Rico las estadísticas oficiales y los medios de comunicación generalmente se enfocan en hechos aislados de violencia extrema donde se utilizan armas o se destruye propiedad y no recogen formas de violencia más comunes que suelen ocurrir a diario en las escuelas. En este estudio se utilizó el Instrumento de Observación de Violencia Escolar (INOVE), preparado con el insumo de las comunidades escolares participantes del Proyecto VIAS (Violence and Asthma Health Disparity Network) de la Universidad del Este (UNE), para recopilar información acerca de las características de la violencia en dos escuelas puertorriqueñas. Entre los hallazgos del estudio se destacan diferencias por sexo en cuanto a categorías de violencia observadas y la observación de agresividad en juegos e interacciones entre estudiantes. Los datos recopilados han servido de base para la toma de decisiones en cuanto a la prevención de la violencia en las escuelas participantes y tienen implicaciones para el desarrollo de estrategias y programas de prevención. PMID:29643972

Alternative Fuels Data Center: Recursos en español

Science.gov Websites

colaboración entre el gobierno y la industria patrocinada por el Programa de Tecnologías de Vehículos del enchufables Recursos en la web Use estas recursos para obtener información sobre: Economía de combustible y huella de carbono de su vehículo Cómo aumentar la economía de combustible Importancia de la economía

La implantacion del enfoque constructivista en el aula de ciencia: Estudio de caso multiple

NASA Astrophysics Data System (ADS)

Arroyo Betancourt, Luz I.

Esta investigacion estudia la implantacion del enfoque constructivista en tres aulas de ciencia del contexto puertorriqueno. Se auscultaron las practicas educativas que utilizan maestras consideradas constructivistas y la correspondencia de sus practicas educativas con los elementos esenciales de la didactica que proponen los teoricos de los planteamientos constructivistas. Se ausculto, ademas, a que vision del enfoque constructivista responden las expresiones de las maestras acerca de su practica educativa y como compara con su quehacer, a la luz de los elementos esenciales de las visiones constructivistas piagetiana, social y radical. Se utilizo el diseno de estudio descriptivo de caso multiple. El estudio se baso en entrevistas a profundidad, revision de documentos y observacion no participativa a la sala de clases. El contexto fueron tres escuelas publicas de la Region Educativa de San Juan, una elemental, una intermedia y una superior. Los resultados confirmaron que la transicion hacia el enfoque constructivista es un proceso que toma tiempo, dedicacion y la participacion en adiestramientos y readiestramientos acerca del nuevo enfoque. Las maestras coinciden en la mayoria de las practicas educativas que utilizan para implantar el enfoque constructivista de ensenanza y difieren en algunas debido, probablemente, a que han tenido que adaptarlas a los correspondientes niveles de ensenanza: elemental, intermedio y superior. Dos de las maestras planifican por conceptos generadores, mientras que una de ellas planifica siguiendo la guia que recibe del Departamento de Educacion. Difieren ademas, en el enfasis que confieren al inquirir cientifico. Con relacion a la correspondencia entre la vision manifestada por las maestras a la luz de las visiones piagetiana, social y radical, aparentemente, las preguntas del protocolo de entrevistas no lograron evocar la informacion con suficiente profundidad, por lo que la investigadora tuvo que inferir las visiones de las participantes basado en lo que estas manifestaron en su practica didactica. Dos maestras coinciden en una vision constructivista social de la construccion del conocimiento, del aprendizaje y de los metodos didacticos. La otra manifesto una vision constructivista piagetiana en el aprendizaje, los metodos didacticos y en la construccion del conocimiento. Se espera que este trabajo, ademas de promover los estudios de caso sobre el enfoque constructivista de ensenanza en el contexto puertorriqueno, sirva para que los maestros, que estan transformando su enfoque educativo de uno tradicional a uno constructivista, tengan una vision mas clara de la implantacion de este enfoque. Se espera ademas que sirva para que el Departamento de Educacion y sus programas de adiestramiento y readiestramiento en servicio, asi como las universidades y sus programas de preparacion de maestros, tomen en cuenta los resultados y recomendaciones de este estudio al revisar sus programas.

Evaluation of the performance of actions and outcomes in primary health care.

PubMed

Miclos, Paula Vitali; Calvo, Maria Cristina Marino; Colussi, Claudia Flemming

2017-01-01

The objective of this study has been to evaluate the performance of the primary care of Brazilian municipalities in relation to health actions and outcomes. This is an evaluative, cross-sectional research, with a quantitative approach, aimed at the identification of the efficiency frontier of the primary care in health actions and outcomes in Brazilian municipalities. Secondary data have been collected from the Programa Nacional de Melhoria do Acesso e da Qualidade da Atenção Básica (National Program for Improving Access and Quality of Primary Care) and the Department of Informatics of the Brazilian Unified Health System, in 2012. The data envelopment analysis tool has been used for variable returns to scale with product orientation. Municipalities have been analyzed by population size, and small municipalities have presented a high percentage of inefficiency for both models. The analysis of efficiency has indicated the existence of a higher percentage of effective municipalities in the model of health actions than in the model of health outcomes. Avaliar o desempenho da atenção básica dos municípios brasileiros quanto a ações e resultados em saúde. Pesquisa avaliativa, transversal, com abordagem quantitativa, para identificar a fronteira de eficiência da atenção básica em ações e resultados em saúde nos municípios brasileiros. Foi realizada coleta de dados secundários a partir do Programa Nacional de Melhoria do Acesso e da qualidade da Atenção Básica e do Departamento de Informática do Sistema Único de Saúde, no ano de 2012. Utilizou-se a ferramenta análise envoltória de dados para retornos variáveis de escala com orientação para produto. Os municípios foram analisados por porte populacional e verificou-se que para ambos os modelos, os municípios de pequeno porte apresentaram alto percentual de ineficiência. A análise da eficiência indicou a existência de um percentual maior de municípios eficientes no modelo de ações em saúde do que no modelo de resultados em saúde.

Ideas, Creencias, Actitudes. Primer Modulo de una Serie para Maestros de Escuela Elemental (Ideas, Beliefs, Attitudes. First Module of a Series for Elementary Teachers).

ERIC Educational Resources Information Center

Molina, Carmen Eneida, Ed.; And Others

This guide for teachers, in English and Spanish, examines the role of stereotypes within the context of contemporary beliefs, ideas, and attitudes. A pre-test and post-test are included to measure the user's awareness of stereotypes. Object lessons cover the following topics: (1) definition of stereotypes; (2) racial and ethnic stereotypes; (3)…

La Palabra es Nuestra: Primaria para Adultos. Primera Parte, Volumen 1-2. Edicion Experimental. (The Language Is Ours: Primer for Adults. Part One, Volumes 1-2. Experimental Edition).

ERIC Educational Resources Information Center

Instituto Nacional para la Educacion de los Adultos, Mexico City (Mexico).

These workbooks are part of a Mexican series of instructional materials designed for Spanish speaking adults who are in the process of becoming literate or have recently become literate in their native language. These workbooks, designed to continue developing literacy skills, include pictures, dialogues, crossword puzzles, and fill-in-the blank…

EVALUATION OF POSTGRADUATES STRICTO SENSU: MONITORING POLICY FOR INTERNATIONAL GRADUATES.

PubMed

Lima, Wilma Terezinha Anselmo

2015-01-01

Search for references in relationship to international alumni on the website of the postgraduate programs of all postgraduate courses at Ribeirão Preto Medical School - FMRP. Verify with more attention to the ones with 5, 6 and 7 notes, and also the same search on the website of courses with notes 5, 6 and 7 of CAPES - Medicine III. Of the 22 programs of FMRP only three had any information on the site about the destiny of the postgraduates; they were: Surgical Clinics, Genetics, and Basic and Applied Immunology. Programs in the area of ​​Medicine III, notes 5, 6 and 7, only Ophthalmology and Visual Programs and Translational Sciences Surgery, both of UNIFESP, presented such information. It is urgent: to create project and funding evaluation mechanisms that are approved by different sources; to stimulate more efficient controls in relation to teachers and their students who participate in these projects; and to stimulate the interaction of teachers and students with the institution and the program. Verificar a existência de referências aos egressos internacionais nos sites dos programas de pós-graduação de todos os cursos de pós-graduação da Faculdade de Medicina de Ribeirão Preto - FMRP. Verificar com mais atenção aos cursos notas 5, 6 e 7, e também a mesma busca nos sites dos cursos com notas 5, 6 e 7 da Medicina III da CAPES. Dos 22 programas da FMRP apenas três tinham no site alguma informação sobre o destino dos egressos, foram eles: Clínica Cirúrgica, Genética e Imunologia Básica e Aplicada. Dos programas da área de Medicina III, notas 5, 6 e 7 apenas os programas de Oftalmologia e Ciências Visuais e Cirurgia Translacional, ambos da UNIFESP, apresentavam informações sobre o destino dos seus egressos. É urgente criar mecanismos de avaliação para os projetos de incentivo e fomento à pesquisa dos diferentes órgãos; estimular controles mais eficientes e atualizados em relação aos docentes e seus respectivos discentes que participam desses projetos; e estimular a interação dos docentes e discentes com a instituição e o programa.

Identificación de Intervenciones para el Desarrollo Positivo de la Juventud

PubMed Central

Sardiñas, Lili M.; Padilla, Viviana; Aponte, Mari; Boscio, Ana Morales; Pedrogo, Coralee Pérez; Santiago, Betzaida; Morales, Ángela Pérez; Dávila, Paloma Torres; Cesáreo, Marizaida Sánchez

2017-01-01

Resumen En el mundo hay más personas en la etapa de la juventud que en cualquier otra etapa del desarrollo. La juventud en Puerto Rico enfrenta muchas situaciones que inciden en su desarrollo y preparación para la adultez. Por lo tanto, es imperante identificar intervenciones para el desarrollo positivo de la juventud que han demostrado ser basadas en la evidencia. Además, a partir de dicha identificación, desarrollar prácticas que ayuden a los jóvenes a desarrollarse para prevenir situaciones adversas, promover experiencias positivas y propiciar que los niños y jóvenes estén involucrados y comprometidos. Se identificaron 147 intervenciones a través de una revisión tradicional de la literatura científica estadounidense. Los resultados reflejan que las intervenciones atienden la reducción de factores de riesgo y el incremento de factores de protección. Sin embargo, ninguna intervención propicia que los niños y jóvenes estén involucrados y comprometidos con su desarrollo óptimo y con sus comunidades. No obstante, todas brindan herramientas que podrían ser de utilidad para fomentar dichas prácticas en el contexto de Puerto Rico. De las 147 intervenciones identificadas seis están diseñadas para la población puertorriqueña residente en la Isla. Con el propósito de hacer la información accesible a los profesionales y la comunidad se expandió la colección del Archivo de Programas y Prácticas Basadas en Evidencia para la Prevención. PMID:28919943

Nuestras cuentas diarias: Matematicas. Primaria para adultos, Segunda parte, Volumens 1 y 2. Edicion Experimental (Our Daily Accounting: Mathematics. Primer for Adults, Part Two, Volumes 1 and 2. Experimental Edition).

ERIC Educational Resources Information Center

Instituto Nacional para la Educacion de los Adultos, Mexico City (Mexico).

These workbooks are part of a Mexican series of instructional materials designed for Spanish speaking adults who are in the process of becoming literate or have recently become literate in their native language. The workbooks are designed to teach skills needed to manage ordinary financial transactions and daily tasks requiring a knowledge of…

Nuestras cuentas diarias: Matematicas. Primaria para adultos, Primera parte, Volumens 1 y 2. Edicion Experimental (Our Daily Accounting: Mathematics. Primer for Adults, Part One, Volumes 1 and 2. Experimental Edition).

ERIC Educational Resources Information Center

Instituto Nacional para la Educacion de los Adultos, Mexico City (Mexico).

These workbooks are part of a Mexican series of instructional materials designed for Spanish speaking adults who are in the process of becoming literate or have recently become literate in their native language. The workbooks, divided in two volumes, are designed to teach skills required in managing ordinary financial transactions and daily tasks…

La Palabra es Nuestra: Primaria para Adultos. Segunda Parte, Volumen 1-2. Edicion Experimental (The Language Is Ours: Primer for Adults. Part Two, Volumes 1-2. Experimental Edition).

ERIC Educational Resources Information Center

Instituto Nacional para la Educacion de los Adultos, Mexico City (Mexico).

These workbooks are part of a Mexican series of instructional materials designed for Spanish speaking adults who are in the process becoming literate or have recently become literate in their native language. They provide readings and exercises for developing literacy skills. Pictures and fill-in-the blank exercises appear frequently. Volume 1…

Peligros de deslizamientos [Landslide Hazards

USGS Publications Warehouse

,

2000-01-01

Deslizamientos, flujos de escombrera y desastres geológicos similares provenientes de volcanes ocurren alrededor del mundo. Cada año estos desastres causan billones de dólares en pérdidas y un sinnúmero de fatalidades y heridos. El primer paso para reducir los efectos dañinos causados por estos desastres es el conocimiento y educación acerca de ellos. El Servicio Geológico de los Estados Unidos se dedica a educar una gran cantidad de personas a través de información e investigaciones acerca de peligros geológicos. Este documento está publicado en inglés y español y puede ser reproducido de cualquier forma para fomentar su distribución.

Cómo aumentar la actividad física de los niños durante el período del recreo en las escuelas

PubMed Central

Ludwig, David

2014-01-01

Objetivos. Analizamos si la participación de las escuelas en el Programa de Mejoramiento del Recreo (PMR) en la primavera del año 2011 estuvo asociada a tasas más altas de actividad física intensa en los niños. Métodos. En el PMR, un coordinador dirige a los niños para que practiquen juegos adecuados para la edad a fin de aumentar su nivel de actividad física. Durante el recreo en 25 escuelas primarias públicas de la ciudad de Nueva York (15 participantes en el PMR, 10 no participantes en el PMR) los investigadores observaron algunas áreas predeterminadas (n = 1 339 observaciones) y registraron el número de niños que estaban sedentarios, caminando o muy activos. Resultados. Tras el análisis estadístico con múltiples variables se encontró que la participación en el PMR era una variable predictiva significativa (P = 0,027) de la tasa de actividad física intensa (porcentaje de niños muy activos en las áreas de observación) cuyas medias de los mínimos cuadrados fueron de 41% en las escuelas participantes en el PMR y de 27% en escuelas no participantes en el PMR. En las escuelas participantes en el PMR se siguió registrando una tasa significativamente superior incluso cuando el coordinador de juegos no estaba en el área de observación, lo que sugiere un cambio en la cultura del recreo en las escuelas que participan en este programa. Conclusiones. La tasa de actividad física intensa en las escuelas participantes en el PMR fue 14 puntos porcentuales (o 52%) superior a la tasa registrada en las escuelas no participantes en el PMR. Esta intervención de bajo costo podría ser un agregado valioso a las herramientas para combatir la obesidad infantil y podría valer la pena reproducirla en otros sitios. PMID:24899455

Matematicas Para El Primer Ciclo Secundario, Volumen II (Parte 2). Traduccion Preliminar de la Edicion en Ingles Revisada. (Mathematics for Junior High School, Volume II, Part 2. Preliminary Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Anderson, R. D.; And Others

This is part two of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system as a progressing development, and metric and non-metric relations in geometry. Chapter topics include real numbers, similar triangles, variation, polyhedrons,…

Matematicas Para El Primer Ciclo Secundario, Volumen I (Parte 2). Traduccion Preliminar de la Edicion Inglesa Revisada. (Mathematics for Junior High School, Volume I, Part 2. Preliminary Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Anderson, R. D.; And Others

This is part two of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system, and metric and non-metric relations in geometry. Included are chapters on the rational number system; parallels, parallelograms, triangles, and right prisms;…

Estudio epidemiológico de sucesos traumáticos, trastorno de estrés post-traumático y otros trastornos psiquiátricos en una muestra representativa de Chile

PubMed Central

Pérez Benítez, Carlos I.; Vicente, Benjamin; Zlotnick, Caron; Kohn, Robert; Johnson, Jennifer; Valdivia, Sandra; Rioseco, Pedro

2010-01-01

RESUMEN Durante la década de 1990 en los Estados Unidos (EU), el conocimiento sobre el trastorno de estrés post-traumático (TEPT) evolucionó de estudios específicos en un principio, sobre veteranos de guerra y sobre víctimas de desastres, a estudios epidemiológicos más tarde, sin embargo, la epidemiología del TEPT en países en desarrollo ha sido un área poco estudiada hasta ahora. Los expertos en el área de trauma han propuesto que los sucesos traumáticos que ocurren en la niñez son más perjudiciales para la salud mental que aquellos que ocurren más tarde en la vida. Este trabajo revisa los resultados de un estudio epidemiológico llevado a cabo en Chile. Específicamente, se revisan los resultados sobre las tasas de prevalencia del TEPT, traumas asociados más frecuentemente con él, así como la comorbilidad de este trastorno con otros trastornos psiquiátricos a lo largo de la vida. Igualmente se analizaron las diferencias del TEPT en cada sexo, así como la exposición a traumas en una muestra representativa de chilenos. Además se comparó la prevalencia de trastornos psiquiátricos en personas que sufrieron su primer trauma durante la niñez, durante la edad adulta, o que no reportaron traumas durante su vida. En estos estudios epidemiológicos se usaron módulos del TEPT y trastorno de personalidad antisocial (TPA) de la entrevista diagnóstica siguiendo los criterios del DSM-III-R (DIS–III-R). Para evaluar el resto de los trastornos psiquiátricos se usó la Entrevista Diagnóstica Internacional Compuesta (CIDI). Estos instrumentos fueron administrados en tres ciudades chilenas a 2390 personas mayores de 15 años. Para estimar los errores estándares (EE) debido al diseño de la muestra y a la necesidad de ajuste se usó el método Taylor de linearización seriada. También se usó un análisis de regresión logística para examinar la relación entre el TEPT, los factores demográficos de riesgo y el tipo de trauma. Además se utilizó la regresión logística multivariada para evaluar si la relación entre el TEPT y el sexo pudiera ser explicada por medio de otros factores de riesgo, así como para calcular las tasas y la oportunidad relativa (razón de productos cruzados) de trastornos psiquiátricos a lo largo de la vida. El primer análisis arrojó que la prevalencia de TEPT a lo largo de la vida fue de 4.4% (2.5% para hombres y 6.2% para mujeres). De los hechos traumáticos reportados, la violación sexual tuvo una correlación más alta con el TEPT que los demás hechos traumáticos. Las mujeres tuvieron más probabilidades de experimentar TEPT que los hombres, después de controlar la variable asalto violento. El segundo análisis evidenció que los que habían sufrido traumas a lo largo de la vida tuvieron mayor probabilidad de tener un trastorno psiquiátrico en comparación con aquellos que no reportaron traumas. También se encontró que los que sufrieron su primer trauma durante la infancia tuvieron más probabilidad de desarrollar trastornos de pánico a lo largo de la vida que aquellos que sufrieron su primer trauma en la edad adulta, independientemente del número de traumas que sufrieron y de las diferencias demográficas. Aunque Chile tiene un contexto histórico-cultural y una economía diferente a otros países en los que se ha estudiado anteriormente la epidemiología del TEPT, el presente estudio reflejó tendencias similares a las reportadas en estudios previos. Los hallazgos expuestos enfatizan la importancia de investigar la prevalencia del TEPT, los patrones de comorbilidad del TEPT y las diferencias de sexo en la prevalencia del TEPT en diferentes países. También estos resultados sugieren que los sucesos traumáticos en la infancia (y no en la adultez) pueden estar relacionados con la ocurrencia de trastornos psiquiátricos específicos. PMID:21113425

Factors associated with the implementation of programs for drug abuse prevention in schools.

PubMed

Pereira, Ana Paula Dias; Paes, Ângela Tavares; Sanchez, Zila M

2016-08-04

To analyze if characteristics of managers, schools, and curriculum are associated with the implementation of programs for drug abuse prevention in elementary and high schools. Cross-sectional study, with random sample of 263 school managers. Data were collected between 2012 and 2013 by a program that sends forms via internet. A closed self-filling questionnaire was applied online. Statistical analysis included Chi-square tests and logistic regression models. The outcome variable was the presence of program for drug abuse prevention inserted in the daily life and educational program of the school. The explanatory variables were divided into: demographic data of the manager; characteristics of the school and of the curriculum; health education; and drug use in the school. We found that 42.5% (95%CI 36.1-49.1) of the evaluated schools had programs for drug abuse prevention. With the multiple logistic regression model, we observed that the more time the manager has worked with education, the chance of the school having a program increased at about 4.0%. Experimenting with innovative teaching techniques also increased at about six times the chance of the school developing a program for drug abuse prevention. The difficulties in the implementation of the programs were more present in state and municipal schools, when compared with private schools, due to, for instance: lack of teaching materials, lack of money, and competing demands for teaching other subjects. The implementation of programs for drug abuse prevention in the city of Sao Paulo is associated with the experience of the manager in education and with the teaching strategies of the school. Analisar se características dos dirigentes, das escolas e do currículo escolar estão associadas à implantação de programas de prevenção ao uso de drogas nas escolas do ciclo fundamental II e médio. Estudo transversal, com amostra aleatória sistemática de 263 dirigentes escolares. Os dados foram coletados nos anos de 2012 e 2013 por meio de um programa de envio de formulários pela internet. Aplicou-se questionário fechado, de autopreenchimento on-line. A análise estatística incluiu testes Qui-quadrado e modelos de regressão logística. A variável desfecho foi a presença de programa de prevenção ao uso de drogas inserido no cotidiano e no programa pedagógico da escola. As variáveis explicativas foram divididas em: dados demográficos do dirigente; características da escola e do currículo; educação em saúde; e consumo de drogas na escola. Constatou-se que 42,5% (IC95% 36,1-49,1) das escolas avaliadas possuíam programa de prevenção ao uso de drogas. Com o modelo de regressão logística múltipla, observou-se que, a cada ano de atuação do dirigente na educação, a chance de a escola ter um programa aumentava em aproximadamente 4,0%. O fato de experimentar técnicas de ensino inovadoras também aumentou em cerca de seis vezes a chance de a escola desenvolver um programa de prevenção ao uso de drogas. As dificuldades na implantação dos programas foram mais presentes nas redes estadual e municipal, quando comparadas à rede privada, destacando-se: a falta de material didático, a falta de dinheiro e as demandas concorrentes para ensino de outras disciplinas. A implantação de programas de prevenção ao uso de drogas no município de São Paulo está associada à experiência do dirigente escolar na educação e nas estratégias de ensino da escola.

The good pharmacy practice on Einstein Program at Paraisópolis Community.

PubMed

Oliveira, Lara Tânia de Assumpção Domingues Gonçalves de; Silva, Camila Pontes da; Guedes, Maria das Vitorias; Sousa, Ana Célia de Oliveira; Sarno, Flávio

2016-01-01

To describe indicators and processes developed and implemented for pharmaceutical assistance at the Einstein Program at Paraisópolis Community pharmacy. This was a descriptive study of retrospective data from January 2012 to December 2015. Data were obtained from spreadsheets developed for monitoring the productivity and care quality provided at the pharmacy. The evaluated variables were pharmaceutical assistance to prescription, pharmaceutical intervention, orientation (standard and pharmaceutical) and pharmaceutical orientation rate. The pharmacy assisted, on average, 2,308 prescriptions monthly, dispensing 4,871 items, including medications, materials and food supplements. Since March 2015, virtually, the pharmacist analyzed all prescriptions, prior to dispensing. In the analyzed period, there was an increase in monthly pharmaceutical interventions from 7 to 32 on average, and, although there was a decrease in the number of standard orientation, the pharmaceutical orientation had an increase, causing a rise of pharmaceutical orientation rate from 4 to 11%. The processes developed and implemented at the program pharmacy sought to follow the good pharmacy practice, and help patients to make the best use of their medications. Descrever os indicadores e os processos desenvolvidos e implantados para assistência farmacêutica na farmácia do Programa Einstein na Comunidade de Paraisópolis. Tratase de um estudo descritivo de dados retrospectivos de janeiro de 2012 a dezembro de 2015. Os dados foram obtidos de planilhas desenvolvidas para acompanhamento da produtividade e da qualidade de assistência prestada na farmácia. As variáveis avaliadas foram: atenção farmacêutica à prescrição, intervenção farmacêutica, orientação (padrão e farmacêutica) e taxa de orientação farmacêutica. A farmácia atendeu, em média, 2.308 prescrições ao mês, dispensando 4.871 itens, incluindo medicamentos, materiais e suplementos alimentares. Desde março de 2015, praticamente todas as prescrições foram analisadas pelo farmacêutico antes da dispensação. Houve incremento nas intervenções farmacêuticas mensais, de 7 para 32 em média e, apesar de ter havido diminuição no número de orientações padrão, a orientação farmacêutica aumentou, fazendo com que a taxa de orientação subisse de 4 para 11%. Os indicadores e os processos desenvolvidos e implantados na farmácia do programa procuraram seguir as boas práticas de farmácia e ajudar os pacientes a fazerem melhor uso de seus medicamentos.

STRATEGIES IN SEARCHING HOMOGENEITY IN A FACULTY OF A POSTGRADUATE PROGRAM.

PubMed

Cecatti, José G; Fernandes, Karayna G; Souza, Renato T; Silveira, Carla; Surita, Fernanda G

2015-01-01

The professor plays a fundamental role in a graduate program, considering he/she is who plans and performs a great part of the tasks, and he/she is also responsible for spreading knowledge among students. The professor should use didactical resources for his/her continuous qualification, being responsible for situations favoring the development of students who should learn according to the best and easier way. The homogeneity in the postgraduate program consists of having subgroups of research corresponding to the Areas of Concentration, where each subgroup works with some distinct topics of research. It is desirable that the staff of postgraduate program has a significant and high quality scientific production, homogeneously distributed among them. The professors must systematically search for resources for research in agencies supporting research, not only for sponsoring the studies, but also for adding value to the researchers involved in the whole activities. The postgraduate programs need to support the professional qualification of their staff who should improve their knowledge on epidemiology for clinical studies, ethics in research and teaching skills. Two characteristics of the postgraduate system in Brazil are the nucleation and solidarity, based on the capacity and/or interest of those more structured programs to help those beginners, cooperating with their activities. The Capes (the national governmental agency responsible for coordinating and evaluating all postgraduate programs in Brazil) valorizes the social insertion in the context of postgraduate programs´ activities. It includes the recognition of activities with technological, cultural, educational and social impact as criteria for evaluation of the programs. Does exist an ideal model of postgraduate program? We think that there is no a mathematical formulae nor an ideal model for a postgraduate program. Each institution should make adaptations and search for improvements of their faculty and students´ teams. O docente tem importância fundamental no programa de pós-graduação, pois é quem planeja e executa grande parte das tarefas, sendo também o responsável por difundir conhecimentos aos alunos. O professor deve utilizar recursos didáticos que o qualifiquem continuamente, criando condições favoráveis para que o aluno se desenvolva e aprenda da melhor maneira e com mais facilidade. A homogeneidade no grupo de pós-graduação consiste da presença de subgrupos de pesquisa correspondentes às Áreas de Concentração, onde cada subgrupo trabalhe com algumas linhas de pesquisas diversificadas. É desejável que o corpo docente tenha significativa produção científica, de qualidade e distribuída homogeneamente entre os docentes. Estes devem sistematicamente buscar recursos em agências de fomento para pesquisa, tanto para o custeio dos estudos, quanto para a valorização dos pesquisadores envolvidos em todas as atividades. Os programas de pós-graduação precisam investir na formação de seus docentes, os quais devem aprimorar seus conhecimentos em epidemiologia de estudos clínicos, ética em pesquisa e em didática. Duas das características do sistema de pós-graduação no Brasil são a nucleação e a solidariedade, embasadas na capacidade e/ou interesse dos mais estruturados se solidarizarem com os programas iniciantes, cooperando com as suas atividades. A Capes valoriza a inserção social no contexto das atividades dos programas de pós-graduação, prevendo nos critérios de avaliação o reconhecimento de atividades com impacto tecnológico, cultural, educacional e social. Existe um modelo ideal de pós-graduação? Partimos do pressuposto de que não há uma fórmula matemática ou modelo ideal de pós-graduação e sim que cada instituição deve se adequar e buscar aperfeiçoar seu corpo docente e discente.

Matematica Para La Escuela Secundaria, Primer Curso de Algebra (Parte 1). Traduccion Preliminar de la Edicion Inglesa Revisada. (Mathematics for High School, First Course in Algebra, Part 1. Preliminary Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Allen, Frank B.; And Others

This is the student text for part one of a three-part SMSG algebra course for high school students. The principal objective of the text is to help the student develop an understanding and appreciation of some of the algebraic structure as a basis for the techniques of algebra. Chapter topics include congruence; numbers and variables; operations;…

Matematicas Para El Primer Ciclo Secundario, Volumen I (Parte 1). Traduccion Preliminar de la Edicion Inglesa Revisada. (Mathematics for Junior High School, Volume I, Part 1, Preliminary Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Anderson, R. D.; And Others

This is part one of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system, and metric and non-metric relations in geometry. Topics included are numbers; cardinal numbers; geometry of lines, points, and planes; geometry of angles,…

Matematica Para La Escuela Secundaria, Primer Curso de Algebra (Parte 1), Comentario. Traduccion Preliminar de la Edicion en Ingles Revisada. (Mathematics for High School, First Course in Algebra, Part 1, Teacher's Commentary. Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Allen, Frank B.; And Others

This is the teacher's commentary for part one of a three-part SMSG algebra text for high school students. The principal objective of the text is to help the student develop an understanding and appreciation of some of the algebraic structure as a basis for the techniques of algebra. Chapter topics include congruence; numbers and variables;…

Matematica Para La Escuela Secundaria, Primer Curso de Algebra (Parte 2). Traduccion Preliminar de la Edicion Inglesa Revisada. (Mathematics for High School, First Course in Algebra, Part 2. Preliminary Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Allen, Frank B.; And Others

This is part two of a three-part SMSG algebra text for high school students. The principal objective of the text is to help the student develop an understanding and appreciation of some of the algebraic structure as a basis for the techniques of algebra. Chapter topics include addition and multiplication of real numbers, subtraction and division…

Matematicas Para El Primer Ciclo Secundario, Volumen II (Parte 1). Traduccion Preliminar de la Edicion en Ingles Revisada. (Mathematics for Junior High School, Volume II, Part 1. Preliminary Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Anderson, R. D.; And Others

This is part one of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system as a progressing development, and metric and non-metric relations in geometry. Chapter topics include number line and coordinates, equations, scientific notation,…

METRICS DEVELOPMENT FOR THE QUALIS OF SOFTWARE TECHNICAL PRODUCTION.

PubMed

Scarpi, Marinho Jorge

2015-01-01

To recommend metrics to qualify software production and to propose guidelines for the CAPES quadrennial evaluation of the Post-Graduation Programs of Medicine III about this issue. Identification of the development process quality features, of the product attributes and of the software use, determined by Brazilian Association of Technical Standards (ABNT), International Organization Standardization (ISO) and International Electrotechnical (IEC), important in the perspective of the CAPES Medicine III Area correlate users, basing the creation proposal of metrics aiming to be used on four-year evaluation of Medicine III. The in use software quality perception by the user results from the provided effectiveness, productivity, security and satisfaction that originate from its characteristics of functionality, reliability, usability, efficiency, maintainability and portability (in use metrics quality). This perception depends on the specific use scenario. The software metrics should be included in the intellectual production of the program, considering the system behavior measurements results obtained by users' performance evaluation through out the favorable responses punctuation sum for the six in use metrics quality (27 sub-items, 0 to 2 points each) and for quality perception proof (four items, 0 to 10 points each). It will be considered as very good (VG) 85 to 94 points; good (G) 75 to 84 points; regular (R) 65 to 74 points; weak (W) 55 to 64 points; poor (P) <55 points. Recomendar métrica para qualificar a produção de software propondo diretrizes para a avaliação dos Programas de Pós-Graduação da Medicina III. Identificação das características de qualidade para o processo de desenvolvimento, para os atributos do produto e para o uso de software, determinadas pela Associação Brasileira de Normas Técnicas (ABNT), International Organization Standardization (ISO) e International Electrotechnical (IEC), importantes na perspectiva dos usuários correlatos da Área Medicina III da CAPES, embasando a criação de proposta para métrica do tema, com vistas à avaliação quadrienal dos cursos de pós-graduação. A percepção de qualidade em uso do software pelo usuário resulta da efetividade, produtividade, segurança e satisfação proporcionada, que têm origem nas suas características de funcionalidade, confiabilidade, usabilidade, eficiência, manutenibilidade e portabilidade (métricas de qualidade em uso). Tal percepção depende do cenário de uso específico. A métrica de software deve ser incluída na produção intelectual do Documento de Área do programa, ponderando os resultados nas medidas de comportamento do sistema em avaliação de desempenho por usuários, considerando a somatória da pontuação favorável para as seis métricas de qualidade em uso (27 sub-itens, de 0 a 2 pontos cada) e a comprovação da percepção de qualidade (quatro itens, de 0 a 10 pontos cada). Será considerado muito bom (MB) de 85 a 94 pontos; bom (B) de 75 a 84 pontos; Regular (R) de 65 a 74 pontos; fraco (F) de 55 a 64 pontos; deficiente (D) < 55.

Questões mais freqüentes na área de astronomia

NASA Astrophysics Data System (ADS)

Segundo, H. A. S.; Garcia, G. C.; Caretta, C. A.; Lima, F. P.

2003-08-01

É amplamente reconhecido que as pessoas em geral têm grande fascínio e interesse pela Astronomia. Por outro lado, o conteúdo dessa área incluído no ensino formal está longe de ser abrangente e suficiente para suprir a demanda. Esse interesse permite otimizar a divulgação e o ensino não formal de Astronomia aliando a adequação do conteúdo à expectativa das pessoas. Nesse intuito, nosso trabalho busca mapear que assuntos da Astronomia despertam mais a atenção e o interesse das pessoas e o quanto disso é estimulado pela mídia, que freqüentemente aproveita-se desse interesse de forma sensacionalista, trazendo contribuições positivas e negativas. Para esta avaliação, utilizamos as pesquisas específicas e de caracterização do público que freqüentou o MAst nos anos de 2001 a 2003, pesquisa das matérias de Astronomia veiculadas na mídia escrita da cidade do Rio de Janeiro no mesmo período, além da base de dados do programa Pergunte a um astrônomo, realizado no Observatório Nacional nos anos de 1997 a 1999. Para a análise dos dados, dividimos as perguntas em dez categorias, cada uma com suas subcategorias, tomando como referência as divisões, comissões e grupos de trabalho da IAU. Apresentamos neste trabalho os resultados dessa pesquisa, que incluem, entre outros, a predominância de questões nas categorias Observação do Céu e Sistemas Planetários enquanto nos jornais dominam as notícias de Sistemas Planetários e Espaço & Astronáutica. Outro resultado interessante indicou que as dúvidas de crianças do ensino fundamental se concentram em algumas categorias enquanto as questões de adultos são mais distribuídas por todas as categorias. Os resultados dessa pesquisa serão aplicados diretamente no aperfeiçoamento das atividades do Programa de Observação de Céu, bem como na elaboração de novos projetos e eventos realizados no MAst.

Implementación de un modelo de capacitación multimedial para brindar orientación alimentaria a los beneficiarios de un programa de ayuda social en México.

PubMed

Amaya-Castellanos, Maritza Alejandra; Morales-Ruan, María Del Carmen; Uribe-Carvajal, Rebeca; Jiménez-Aguilar, Alejandra; Salazar-Coronel, Araceli Apolonia; Martínez-Tapia, Brenda; Shamah-Levy, Teresa

2018-03-01

Introducción: Se implementó un modelo de capacitación en orientación alimentaria para la población beneficiaria y el personal operativo del Programa de Abasto Rural (PAR) de Diconsa, el cual es una iniciativa social de ayuda alimentaria que abastece productos básicos y complementarios, además de brindar capacitación en localidades de alta marginación en México. Objetivo: Documentar la utilización de la Metodología de Capacitación Multimedial (MCM) en el desarrollo de un esquema de capacitación sobre orientación alimentaria y su implementación en la población beneficiaria del PAR, a través de la propia estructura operativa del PAR. Metodología: El modelo se fundamenta en la MCM, integrada por cuatro elementos didácticos e indivisibles que conforman el paquete pedagógico multimedial (PPM), compuesto a su vez por tres videos y rotafolios, material impreso, prácticas y las relaciones interpersonales. Los ejes temáticos fueron: alimentación correcta para una vida saludable, alimentación materno-infantil, elecciones saludables y gasto familiar. El modelo fue replicado en cascada en los tres niveles operativos del PAR (responsables de capacitación, supervisores operativos y beneficiarios del PAR), con un componente de multiplicación horizontal, e implementado como piloto en cuatro estados de México. Resultados: Se observó un cambio positivo sobre los conocimientos en alimentación correcta en todos los niveles de capacitación, principalmente en los beneficiarios del PAR. La evaluación del proceso mostró conocimientos previos de los responsables de capacitación en los temas, buen desempeño como facilitadores, y habilidades de presentación y manejo del grupo de los supervisores operativos. A partir de las evaluaciones y del acompañamiento en la prueba piloto, fueron modificados las actividades, las estrategias y los materiales educativos del PPM. Conclusiones: La capacitación multimedial y la educación nutricional promueven procesos de cambio y desarrollo comunitario, posibles a través de la toma de conciencia y la puesta en práctica de acciones que favorecen la salud.

Inclusion of Visually Impaired in the School Programme Scheduled Visit of the Museu de Astronomia e Ciências Afins (MAST). (Breton Title: Inclusão de Deficientes Visuais no Programa de Visita Escolar Programada do Museu de Astronomia e Ciências Afins (MAST).) Inclusión de Discapacitados Visuales en el Programa Escolar Programado del Museo de Astronomía y Ciencias Afines (MAST)

NASA Astrophysics Data System (ADS)

de Oliveira Gonçalves, Carla; da Conceição Barbosa-Lima, Maria

2013-07-01

Inclusive Education in Brazil, contemplated in the 1988 Constitution and in the Law of Guidelines and Bases of National Education (9.394/96) highlights the importance and urgency of promoting inclusive education as a formative element of nationality. Inclusive Education refers to all people who are struggling in school. Inclusion should be in all educational institutions (formal and informal). Our goal in the graduation final task was to report the experience of mediation to visually impaired students of the Instituto Benjamin Constant (IBC) at the Museu de Astronomia e Ciências Afins (MAST), and also suggest some modifications and present new proposals for the School Visit Program (VEP) through a specially constructed apparatus, where the sky can be sensed near the latitude of Rio de Janeiro. A educação inclusiva no Brasil, contemplada na Constituição de 1988 e a Lei de Diretrizes e Bases da Educação Nacional (9.394/96), destaca a importância e urgência de se promover a inclusão escolar como elemento formador da nacionalidade. A educação inclusiva diz respeito a todas as pessoas que enfrentam dificuldades na escola. A inclusão deve estar em todas as instituições educacionais (formais e não formais). Nosso objetivo, no trabalho de final de curso de licenciatura, foi apresentar o relato de experiência de mediação aos alunos deficientes visuais do Instituto Benjamin Constant (IBC) no Museu de Astronomia e Ciências Afins (MAST), as modificações e novas propostas para o Programa de Visita Escolar Programada (VEP) através de um aparelho especialmente construído onde se pode perceber o céu na latitude próxima a do Rio de Janeiro. La educación inclusiva en el Brasil, contemplada en la Constitución de 1988 y en la Ley de Directrices y Bases de la Educación Nacional (9.394/96), destaca la importancia y la urgencia de promover la inclusión escolar como elemento formador de la nacionalidad. La educación inclusiva se refiere a todas las personas que enfrentan dificultades en la escuela. La inclusión debe estar en todas las instituciones educacionales (formales o no). Nuestro objetivo en el trabajo de final de curso de licenciatura, fue el de presentar un relato de la experiencia de mediación a los alumnos con deficiencias visuales del Instituto Benjamin Constant (IBC) en el Museo de Astronomía y Ciencias Afines (MAST) y las modificaciones y nuevas propuestas para el Programa de Visita Escolar Programada (VEP) a través de un aparato especialmente construido con el cual se puede percibir el cielo en una latitud próxima a la de Rio de Janeiro.

La salud en personas con discapacidad intelectual en España: estudio europeo POMONA-II

PubMed Central

Martínez-Leal, Rafael; Salvador-Carulla, Luis; Gutiérrez-Colosía, Mencía Ruiz; Nadal, Margarida; Novell-Alsina, Ramón; Martorell, Almudena; González-Gordón, Rodrigo G.; Mérida-Gutiérrez, M. Reyes; Ángel, Silvia; Milagrosa-Tejonero, Luisa; Rodríguez, Alicia; García-Gutiérrez, Juan C.; Pérez-Vicente, Amado; García-Ibáñez, José; Aguilera-Inés, Francisco

2011-01-01

Introducción Estudios internacionales demuestran que existe un patrón diferenciado de salud y una disparidad en la atención sanitaria entre personas con discapacidad intelectual (DI) y población general. Objetivo Obtener datos sobre el estado de salud de las personas con DI y compararlos con datos de población general. Pacientes y métodos Se utilizó el conjunto de indicadores de salud P15 en una muestra de 111 sujetos con DI. Los datos de salud encontrados se compararon según el tipo de residencia de los sujetos y se utilizó la Encuesta Nacional de Salud 2006 para comparar estos datos con los de la población general. Resultados La muestra con DI presentó 25 veces más casos de epilepsia y el doble de obesidad. Un 20% presentó dolor bucal, y existió una alta presencia de problemas sensoriales, de movilidad y psicosis. Sin embargo, encontramos una baja presencia de patologías como la diabetes, la hipertensión, la osteoartritis y la osteoporosis. También presentaron una menor participación en programas de prevención y promoción de la salud, un mayor número de ingresos hospitalarios y un uso menor de los servicios de urgencia. Conclusiones El patrón de salud de las personas con DI difiere del de la población general, y éstas realizan un uso distinto de los servicios sanitarios. Es importante el desarrollo de programas de promoción de salud y de formación profesional específicamente diseñados para la atención de personas con DI, así como la implementación de encuestas de salud que incluyan datos sobre esta población. PMID:21948011

PubMed

Valero Gaspar, Teresa; Del Pozo de la Calle, Susana; Ruiz Moreno, Emma; Ávila Torres, Osé Manuel; Varela-Moreiras, Gregorio; Cuadrado Vives, Carmen

2016-11-29

Introducción: a finales del siglo xx, no se conocía con precisión si la comida del comedor escolar contribuía adecuadamente a la dieta de la población infantil. Además, este servicio complementario no se contemplaba en el proyecto educativo del centro pese a considerarse fundamental en todas sus dimensiones.Objetivo: describir el origen y desarrollo del programa de comedores escolares de la Comunidad de Madrid (CM) en 15 años desde su implantación.Métodos: se elaboró una normativa a cumplir por las empresas de restauración, y que contemplaba aspectos nutricionales y de composición y variedad de los menús, que se utilizó en los concursos para acceder a la prestación del servicio de comedor escolar, publicados en los años 2001, 2002, 2005, 2009 y 2013. Además se realizaron visitas acreditadas a los centros sin previo aviso para verifi car el cumplimiento de la documentación aportada durante el concurso.Resultados: los criterios más actuales sobre programación y elaboración de menús escolares se recogen en el Pliego de Prescripciones Técnicas del año 2013 (C-504/001-2013). Un 92% de las empresas de restauración superaron los cinco concursos habidos en los 15 años de funcionamiento. Hasta el año 2014, se han realizado 755 visitas, revisándose un total de 574 centros.Conclusiones: el programa de comedores escolares de la CM, desde su implementación pionera en España, ha contribuido a la mejora del servicio complementario de comedor. En estos años se han ido incluyendo nuevos requisitos dietéticos y nutricionales que han logrado menús cada vez más ajustados a las recomendaciones de la población escolar.

Acceptability of an Embodied Conversational Agent-based Computer Application for Hispanic Women

PubMed Central

Wells, Kristen J.; Vázquez-Otero, Coralia; Bredice, Marissa; Meade, Cathy D.; Chaet, Alexis; Rivera, Maria I.; Arroyo, Gloria; Proctor, Sara K.; Barnes, Laura E.

2015-01-01

There are few Spanish language interactive, technology-driven health education programs. Objectives of this feasibility study were to: 1) learn more about computer and technology usage among Hispanic women living in a rural community; and 2) evaluate acceptability of the concept of using an embodied conversational agent (ECA) computer application among this population. A survey about computer usage history and interest in computers was administered to a convenience sample of 26 women. A sample video prototype of a hospital discharge ECA was administered followed by questions to gauge opinion about the ECA. Data indicate women exhibited both a high level of computer experience and enthusiasm for the ECA. Feedback from community is essential to ensure equity in state of the art dissemination of health information. Hay algunos programas interactivos en español que usan la tecnología para educar sobre la salud. Los objetivos de este estudio fueron: 1) aprender más sobre el uso de computadoras y tecnología entre mujeres Hispanas que viven en comunidades rurales y 2) evaluar la aceptabilidad del concepto de usar un programa de computadora utilizando un agente de conversación encarnado (ECA) en esta población. Se administro una encuesta sobre el historial de uso y del interés de aprender sobre computadoras fue a 26 mujeres por muestreo de conveniencia. Un ejemplo del prototipo ECA en forma de video de un alta hospitalaria fue administrado y fue seguido por preguntas sobre la opinión que tenían del ECA. Los datos indican que las mujeres mostraron un alto nivel de experiencia con las computadoras y un alto nivel de entusiasmo sobre el ECA. La retroalimentación de la comunidad es esencial para asegurar equidad en la diseminación de información sobre la salud con tecnología de punta. PMID:26671558

Accidentes laborales asociados al desánimo de médicos SERUMS para laborar en el primer nivel de atención de Lima, Perú

PubMed Central

Mejia, Christian R.; Valladares-Garrido, Mario J.; Romero, Brian M.; Valladares-Garrido, Danai; Linares-Reyes, Edgardo

2018-01-01

Introducción la retención laboral es un tema de suma importancia, porque se requiere de profesionales en el primer nivel de atención (PNA). El objetivo fue determinar si los accidentes laborales se asociaron al desánimo de los médicos para trabajar en el PNA de Lima, Perú. Métodos estudio transversal analítico de datos secundarios de una base de datos generada de una encuesta a médicos que realizaron su Servicio Rural y Urbano-Marginal en Salud (SERUMS). Se incluyó solo a los médicos que manifestaron al inicio del SERUMS que podían trabajar en el PNA de Lima. Se definió como cambio de intención de trabajo en el PNA a los que finalizando el SERUMS refirieron que ya no deseaban laborar en Lima. Esto se asoció según si tuvieron un accidente laboral y se ajustó por otras variables. Resultados de los 124 médicos el 63% fueron hombres (78). La mediana de edad fue de 26 años (rango intercuartílico: 25-27 años). Después de su SERUMS, el 12% (15) manifestó que cambió su interés y que deseaba trabajar en la capital. En el análisis multivariado, haber tenido un accidente laboral disminuyó la frecuencia del cambio de intención de trabajo en el PNA (RPa: 0.28, IC 95%: 0.14-0.54, p < 0,001), ajustado por ocho variables. Conclusiones en un estudio previo los accidentes laborales disminuyeron la frecuencia de trabajar en provincias, pero nuestro estudio dice lo contrario, posiblemente por la percepción de que un trabajo en la capital del país permite estar más cerca de los servicios para ser atendido en caso de cualquier emergencia. PMID:29190859

QuEST: Qualifying Environmentally Sustainable Technologies. Volume 4

NASA Technical Reports Server (NTRS)

Lewis, Pattie L.

2009-01-01

In 2004, in one of their first collaborative efforts, Centro Para Prevencao da Poluicao (Portuguese Center for Pollution Prevention or C3P). teamed with Technology Evaluation for Environmental Risk Mitigation Principal Center (TEERM) and two Portuguese entities, TAP Portugal (Portuguese National Airline) and OGMA Indtistria Aeron utica de Portugal (Portuguese Aeronautics Industry), to target the reduction of hexavalent chromium, cadmium, and volatile organic compounds (VOCs) in aircraft maintenance operations. This project focused on two coating systems that utilize non-chrome pretreatments and low-VOC primers and topcoats.

Matematica Para La Escuela Secundaria, Primer Curso de Algebra (Parte 2), Comentario. Traduccion Preliminar de la Edicion en Ingles Revisada. (Mathematics for High School, First Course in Algebra, Part 2, Teacher's Commentary. Preliminary Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Allen, Frank B.; And Others

This is the teacher's commentary for part two of a three-part SMSG algebra text for high school students. The principal objective of the text is to help the student develop an understanding and appreciation of some of the algebraic structure as a basis for the techniques of algebra. Chapter topics include addition and multiplication of real…

Analyzing the Effect of Technology-Based Intervention in Language Laboratory to Improve Listening Skills of First Year Engineering Students (El uso de la tecnología en el laboratorio de idiomas para el mejoramiento de las habilidades de escucha de estudiantes de ingeniería de primer año)

ERIC Educational Resources Information Center

Pasupathi, Madhumathi

2013-01-01

First year students pursuing engineering education face problems with their listening skills. Most of the Indian schools use a bilingual method for teaching subjects from primary school through high school. Nonetheless, students entering university education develop anxiety in listening to classroom lectures in English. This article reports an…

Accuracy of a pediatric early warning score in the recognition of clinical deterioration.

PubMed

Miranda, Juliana de Oliveira Freitas; Camargo, Climene Laura de; Nascimento, Carlito Lopes; Portela, Daniel Sales; Monaghan, Alan

2017-07-10

to evaluate the accuracy of the version of the Brighton Pediatric Early Warning Score translated and adapted for the Brazilian context, in the recognition of clinical deterioration. a diagnostic test study to measure the accuracy of the Brighton Pediatric Early Warning Score for the Brazilian context, in relation to a reference standard. The sample consisted of 271 children, aged 0 to 10 years, blindly evaluated by a nurse and a physician, specialists in pediatrics, with interval of 5 to 10 minutes between the evaluations, for the application of the Brighton Pediatric Early Warning Score for the Brazilian context and of the reference standard. The data were processed and analyzed using the Statistical Package for the Social Sciences and VassarStats.net programs. The performance of the Brighton Pediatric Early Warning Score for the Brazilian context was evaluated through the indicators of sensitivity, specificity, predictive values, area under the ROC curve, likelihood ratios and post-test probability. the Brighton Pediatric Early Warning Score for the Brazilian context showed sensitivity of 73.9%, specificity of 95.5%, positive predictive value of 73.3%, negative predictive value of 94.7%, area under Receiver Operating Characteristic Curve of 91.9% and the positive post-test probability was 80%. the Brighton Pediatric Early Warning Score for the Brazilian context, presented good performance, considered valid for the recognition of clinical deterioration warning signs of the children studied. avaliar a acurácia da versão traduzida e adaptada do Brighton Paediatric Early Warning Score para o contexto brasileiro, no reconhecimento da deterioração clínica. estudo de teste diagnóstico para medir a acurácia do Brighton Paediatric Early Warning Score, para o contexto brasileiro, em relação a um padrão de referência. A amostra foi composta por 271 crianças de 0 a 10 anos, avaliadas de forma cega por uma enfermeira e um médico, especialistas em pediatria, com intervalo de 5 a 10 minutos entre as avaliações, para aplicação do Brighton Paediatric Early Warning Score, para o contexto brasileiro e do padrão de referência. Os dados foram processados e analisados nos programas Statistical Package for the Social Sciences e VassarStats.net. O desempenho do Brighton Paediatric Early Warning Score para o contexto brasileiro foi avaliado por meio dos indicadores de sensibilidade, especificidade, valores preditivos, área sob a curva ROC, razões de probabilidades e probabilidade pós-teste. o Brighton Paediatric Early Warning Score para o contexto brasileiro apresentou sensibilidade de 73,9%, especificidade de 95,5%, valor preditivo positivo de 73,3%, valor preditivo negativo de 94,7%, área sob a Receiver Operating Characteristic Curve de 91,9% e a probabilidade pós-teste positivo foi de 80%. o Brighton Paediatric Early Warning Score, para o contexto brasileiro, apresentou bom desempenho, considerado válido para o reconhecimento de sinais de alerta de deterioração clínica das crianças estudadas. evaluar la precisión de la versión traducida y adaptada del Brighton Paediatric Early Warning Score para el contexto brasileño, en el reconocimiento de la deterioración clínica. estudio de test diagnóstico para medir la precisión del Brighton Paediatric Early Warning Score para el contexto brasileño, en relación a un estándar de referencia. La muestra estuvo compuesta por 271 niños de 0 a 10 años, evaluadas de forma ciega por especialistas en pediatría, una enfermera y un médico, con intervalo de 5 a 10 minutos entre las evaluaciones, para aplicación del Brighton Paediatric Early Warning Score para el contexto brasileño. Los datos fueron procesados y analizados en los programas Statistical Package for the Social Sciences y VassarStats.net. El desempeño del Brighton Paediatric Early Warning Score para el contexto brasileño fue evaluado por medio de los indicadores de sensibilidad, especificidad, valores predictivos, área debajo de la curva ROC, razones de probabilidades y probabilidad postest. el Brighton Paediatric Early Warning Score para el contexto brasileño presentó sensibilidad de 73,9%, especificidad de 95,5%, valor predictivo positivo de 73,3%, valor predictivo negativo de 94,7%, área bajo la Receiver Operating Characteristic Curve de 91,9% y la probabilidad postest positivo fue de 80%. el Brighton Paediatric Early Warning Score para el contexto brasileño, presentó buen desempeño, considerado válido para el reconocimiento de señales de alerta de deterioración clínica de los niños estudiados.

Evaluation of a Campylobacter fetus subspecies venerealis real-time quantitative polymerase chain reaction for direct analysis of bovine preputial samples

PubMed Central

Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.

2012-01-01

The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694

Comprension de los conceptos de los enlaces ionico y covalente en estudiantes universitarios del primer curso de quimica general

NASA Astrophysics Data System (ADS)

Ballesteros Benavides, Maria Elvira

Para este trabajo utilizamos el estudio de casos cualitativo que se llevo a cabo en una universidad privada de Puerto Rico. Empleamos como unidad de analisis el concepto de enlace quimico, ionico y covalente. Los participantes fueron los estudiantes de la seccion nocturna del curso de Quimica General I. La investigacion se desarrollo por medio de dos entrevistas de persona a persona, observaciones de las expresiones no verbales y la hoja de identificacion de conceptos. Para la triangulacion tomamos en consideracion las preconcepciones erroneas, las concepciones alternativas y el mapa de conceptos de cada participante. Preparamos un mapa de conceptos para el enlace quimico validado por un comite de expertos. Tambien, elaboramos los mapas de conceptos de los participantes que sirvieron para varios propositos: conocer la estructura conceptual, expresar los logros, hacer comparaciones e identificar la presencia de concepciones alternativas. Entre los hallazgos encontramos que todos los participantes poseen conocimiento previo de los enlaces quimicos ionico y covalente y dentro de ese conocimiento existen preconcepciones erroneas mas numerosas para el enlace ionico. Al principio del semestre el 50% de los participantes demostraron tener "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente. Al finalizar el semestre encontramos en el 40% de los participantes concepciones alternativas tanto para el enlace ionico como para el covalente y el 90% no lograron distinguir un enlace del otro. Nuestras conclusiones fueron que los participantes sin distincion del aprovechamiento academico demostraron tener la tendencia de "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente, presentaron dificultad al integrar los conceptos de los enlaces quimicos ionico y covalente que se pusieron de manifiesto al dar los ejemplos. Las preconcepciones erroneas contribuyen en el desarrollo de las concepciones alternativas. Ademas, los participantes no lograron diferenciar los dos enlaces quimicos. Esto implica que reflexionemos sobre la necesidad de revisar tanto las competencias cognoscitivas como la forma de ensenar quimica en el salon de clase. Recomendamos indagar y dar importancia al conocimiento previo de los estudiantes, enfatizar la ensenanza de los conceptos y propiciar el aprendizaje con significado.

Care coordination in PMAQ-AB: an Item Response Theory-based analysis.

PubMed

Souza, Miriam Francisco de; Santos, Alaneir de Fatima Dos; Reis, Ilka Afonso; Santos, Marcos Antônio da Cunha; Jorge, Alzira de Oliveira; Machado, Antônio Tomaz Gonzaga da Matta; Andrade, Eli Iola Gurgel; Cherchiglia, Mariangela Leal

2017-01-01

Analyze the quality of the National Program for Primary Care Access and Quality Improvement variables to evaluate the coordination of primary care. A cross-sectional study based on data from 17,202 primary care teams that participated in the National Program for Primary Care Access and Quality Improvement in 2012. Based on the Item Response Theory, Samejima's Gradual Response Model was used to estimate the score related to the level of coordination. The Cronbach's alpha and Spearman' coefficients and the point-biserial correlation were used to analyze the internal consistency and the correlation between the items and between the items and the total score. We evaluated the assumptions of unidimensionality and local independence of the items. Cloud-type word charts aided in the interpretation of coordination levels. The Program items with the greatest discrimination in coordination level were: telephone/Internet existence, institutional communication flows, and matrix support actions. The specialists' contact frequency with the primary care and integrated electronic medical record required a greater level of coordination among the teams. The Cronbach' alpha was 0.8018. The institutional communication flows and telephone/Internet items had a higher correlation with the total score. Coordination scores ranged from -2.67 (minimum) to 2.83 (maximum). More communication, information exchange, matrix support, health care in the territory and the domicile had a significant influence on the levels of coordination. The ability to provide information and the frequency of contact among professionals are important elements for a comprehensive, continuous and high-quality care. Analisar a qualidade das variáveis do Programa de Melhoria do Acesso e da Qualidade da Atenção Básica para avaliar a coordenação na atenção básica do cuidado. Estudo transversal baseado em dados de 17.202 equipes de atenção básica que participaram do Programa de Melhoria do Acesso e da Qualidade da Atenção Básica em 2012. Baseado na Teoria de Resposta ao Item, o Modelo de Resposta Gradual de Samejima foi utilizado para estimação do escore relacionado ao nível de coordenação. Os coeficientes alfa de Cronbach, Spearman e ponto bisserial foram utilizados para análise da consistência interna e da correlação entre os itens e de itens com o escore total. Foram avaliadas as suposições de unidimensionalidade e de independência local dos itens. Gráficos do tipo nuvem de palavras auxiliaram na interpretação dos níveis de coordenação. Os itens do Programa com maior discriminação do nível de coordenação foram: existência de telefone/internet, fluxos institucionais de comunicação e ações de apoio matricial. A frequência de contato de especialistas com a atenção básica e prontuário eletrônico integrado exigiram maior nível de coordenação das equipes. O coeficiente alfa de Cronbach total 0,8018. Os itens fluxos institucional de comunicação e telefone/internet tiveram maior correlação com o escore total. Os escores de coordenação variaram entre -2,67 (mínimo) e 2,83 (máximo). Maior grau de comunicação, troca de informações, apoio matricial, cuidado no território e domicílio tiveram peso relevante nos níveis de coordenação. A capacidade de disponibilizar a informação e a frequência de contato entre os profissionais são elementos importantes para o cuidado abrangente, contínuo e de qualidade.

Earth and Heavens: Two Separate Universes? (Spanish Title: Tierra y Cielos: ¿Dos Universos Separados?) Terra e Céus: Dois Universos Separados?

NASA Astrophysics Data System (ADS)

Carrascosa, Jaime; Gil-Pérez, Daniel; Solbes, Jordi; Vilches, Amparo

2005-12-01

The study of gravitation constitutes an exceptional occasion to show the richness and complexity of science and technology, contemplating, among other things: the problematic situations which are at the heart of the scientific knowledge, the difficulties encountered in the construction of knowledge and, especially, the necessity of overcoming "common-sense evidence" that proclaimed the existence of an insurmountable barrier between Earth and Heavens, hindering scientific development during many centuries. In this paper we present a program of activities to orient the study of Gravitation atUpperHigh School, favoring students' participation in the reconstruction of this first scientific revolution and giving them the opportunity to see the importance of Astronomy both in the history of science and today. El estudio de la gravitación constituye una ocasión excepcional para mostrar la ciencia y la tecnología en toda su riqueza y complejidad, considerando, entre otros aspectos:

Democratic Security and Defense Policy: A Successful Counterinsurgency Model

DTIC Science & Technology

2012-06-08

Nueva Colombia, “ Programa Agrario de los Guerrilleros de las FARC,” Mbolivariano.blogspot.com, http://mbolivariano.blogspot. com/2007/12/ programa ...Conferencias de FARC.” Archivo Chile . http://www. Archivochile. Com/america_latina/doc_paises_al/co/farc/ al_farc0003. Pdf (accessed 24 September 2011... Programa Agrario de los Guerrilleros de las FARC.” Mbolivariano.blogspot.com, http://mbolivariano.blogspot. com/2007/12/ programa -agrario- de -los

Permanent genetic resources added to Molecular Ecology Resources Database 1 August 2011-30 September 2011.

PubMed

A'Hara, S W; Amouroux, P; Argo, Emily E; Avand-Faghih, A; Barat, Ashoktaru; Barbieri, Luiz; Bert, Theresa M; Blatrix, R; Blin, Aurélie; Bouktila, D; Broome, A; Burban, C; Capdevielle-Dulac, C; Casse, N; Chandra, Suresh; Cho, Kyung Jin; Cottrell, J E; Crawford, Charles R; Davis, Michelle C; Delatte, H; Desneux, Nicolas; Djieto-Lordon, C; Dubois, M P; El-Mergawy, R A A M; Gallardo-Escárate, C; Garcia, M; Gardiner, Mary M; Guillemaud, Thomas; Haye, P A; Hellemans, B; Hinrichsen, P; Jeon, Ji Hyun; Kerdelhué, C; Kharrat, I; Kim, Ki Hwan; Kim, Yong Yul; Kwan, Ye-Seul; Labbe, Ellen M; LaHood, Eric; Lee, Kyung Mi; Lee, Wan-Ok; Lee, Yat-Hung; Legoff, Isabelle; Li, H; Lin, Chung-Ping; Liu, S S; Liu, Y G; Long, D; Maes, G E; Magnoux, E; Mahanta, Prabin Chandra; Makni, H; Makni, M; Malausa, Thibaut; Matura, Rakesh; McKey, D; McMillen-Jackson, Anne L; Méndez, M A; Mezghani-Khemakhem, M; Michel, Andy P; Paul, Moran; Muriel-Cunha, Janice; Nibouche, S; Normand, F; Palkovacs, Eric P; Pande, Veena; Parmentier, K; Peccoud, J; Piatscheck, F; Puchulutegui, Cecilia; Ramos, R; Ravest, G; Richner, Heinz; Robbens, J; Rochat, D; Rousselet, J; Saladin, Verena; Sauve, M; Schlei, Ora; Schultz, Thomas F; Scobie, A R; Segovia, N I; Seyoum, Seifu; Silvain, J-F; Tabone, Elisabeth; Van Houdt, J K J; Vandamme, S G; Volckaert, F A M; Wenburg, John; Willis, Theodore V; Won, Yong-Jin; Ye, N H; Zhang, W; Zhang, Y X

2012-01-01

This article documents the addition of 299 microsatellite marker loci and nine pairs of single-nucleotide polymorphism (SNP) EPIC primers to the Molecular Ecology Resources (MER) Database. Loci were developed for the following species: Alosa pseudoharengus, Alosa aestivalis, Aphis spiraecola, Argopecten purpuratus, Coreoleuciscus splendidus, Garra gotyla, Hippodamia convergens, Linnaea borealis, Menippe mercenaria, Menippe adina, Parus major, Pinus densiflora, Portunus trituberculatus, Procontarinia mangiferae, Rhynchophorus ferrugineus, Schizothorax richardsonii, Scophthalmus rhombus, Tetraponera aethiops, Thaumetopoea pityocampa, Tuta absoluta and Ugni molinae. These loci were cross-tested on the following species: Barilius bendelisis, Chiromantes haematocheir, Eriocheir sinensis, Eucalyptus camaldulensis, Eucalyptus cladocalix, Eucalyptus globulus, Garra litaninsis vishwanath, Garra para lissorhynchus, Guindilla trinervis, Hemigrapsus sanguineus, Luma chequen. Guayaba, Myrceugenia colchagüensis, Myrceugenia correifolia, Myrceugenia exsucca, Parasesarma plicatum, Parus major, Portunus pelagicus, Psidium guayaba, Schizothorax richardsonii, Scophthalmus maximus, Tetraponera latifrons, Thaumetopoea bonjeani, Thaumetopoea ispartensis, Thaumetopoea libanotica, Thaumetopoea pinivora, Thaumetopoea pityocampa ena clade, Thaumetopoea solitaria, Thaumetopoea wilkinsoni and Tor putitora. This article also documents the addition of nine EPIC primer pairs for Euphaea decorata, Euphaea formosa, Euphaea ornata and Euphaea yayeyamana. © 2011 Blackwell Publishing Ltd.

The situation of nursing education in Latin America and the Caribbean towards universal health.

PubMed

Cassiani, Silvia Helena De Bortoli; Wilson, Lynda Law; Mikael, Sabrina de Souza Elias; Peña, Laura Morán; Grajales, Rosa Amarilis Zarate; McCreary, Linda L; Theus, Lisa; Agudelo, Maria Del Carmen Gutierrez; Felix, Adriana da Silva; Uriza, Jacqueline Molina de; Gutierrez, Nathaly Rozo

2017-05-11

to assess the situation of nursing education and to analyze the extent to which baccalaureate level nursing education programs in Latin America and the Caribbean are preparing graduates to contribute to the achievement of Universal Health. quantitative, descriptive/exploratory, cross-sectional study carried out in 25 countries. a total of 246 nursing schools participated in the study. Faculty with doctoral level degrees totaled 31.3%, without Brazil this is reduced to 8.3%. The ratio of clinical experiences in primary health care services to hospital-based services was 0.63, indicating that students receive more clinical experiences in hospital settings. The results suggested a need for improvement in internet access; information technology; accessibility for the disabled; program, faculty and student evaluation; and teaching/learning methods. there is heterogeneity in nursing education in Latin America and the Caribbean. The nursing curricula generally includes the principles and values of Universal Health and primary health care, as well as those principles underpinning transformative education modalities such as critical and complex thinking development, problem-solving, evidence-based clinical decision-making, and lifelong learning. However, there is a need to promote a paradigm shift in nursing education to include more training in primary health care. avaliar a situação da educação em enfermagem e analisar o quanto os programas de educação em enfermagem, no nível de Bacharelado na América Latina e no Caribe, estão preparando graduados a contribuir para o alcance da Saúde Universal. estudo quantitativo, descritivo/exploratório, transversal, realizado em 25 países. um total de 246 escolas de enfermagem participaram do estudo. O corpo docente com nível de Doutorado totalizou 31,3%; sem o Brasil o número fica reduzido a 8,3%. A razão entre experiências clínicas nos serviços de atenção primária à saúde e nos serviços hospitalares foi de 0,63, indicando que os estudantes têm mais experiências clínicas nos cenários hospitalares. Os resultados sugeriram necessidade de aprimoramento relacionada ao acesso à Internet; tecnologia da informação; acesso para portadores de deficiências; avaliação do programa, do corpo docente e dos estudantes; e aos métodos de ensino/aprendizagem. há heterogeneidade na educação em enfermagem na América Latina e no Caribe. Os currículos de enfermagem incluem, geralmente, os princípios e valores da Saúde Universal e da atenção primária à saúde, bem como aqueles princípios subjacentes às modalidades de educação transformativa, como o desenvolvimento de pensamento crítico e complexo, a solução de problemas, a tomada de decisão clínica baseada em evidências, e aprendizagem contínua. No entanto, é preciso promover uma mudança de paradigma na educação em enfermagem que inclua mais treinamento na atenção primária à saúde. evaluar la situación de la educación en enfermería y analizar en qué grado los programas de educación de enfermería a nivel de grado en América Latina y el Caribe están preparando a los graduados para contribuir al logro de la Salud Universal. se llevó a cabo un estudio transversal, cuantitativo, descriptivo y exploratorio en 25 países. participaron en el estudio 246 escuelas de enfermería. El porcentaje de profesores con títulos de doctorado fue de 31,3%; pero, si se excluye a Brasil esta cifra se reduce a 8,3%. La proporción de la experiencia clínica adquirida en los servicios de atención primaria de salud en relación con la adquirida en servicios hospitalarios fue de 0,63, lo que indica que los estudiantes adquieren la mayor parte de su experiencia clínica en entornos hospitalarios. Los resultados mostraron una necesidad de mejorar el acceso a internet; la tecnología de la información; la accesibilidad para las personas discapacitadas; la evaluación de los programas, de los profesores y de los estudiantes; y los métodos de enseñanza y aprendizaje. hay heterogeneidad en la educación en enfermería en América Latina y el Caribe. En general, los programas de estudios de enfermería han adoptado los principios y los valores de la Salud Universal y la atención primaria de salud, así como los principios que sustentan las modalidades de educación transformadora, como son el desarrollo del pensamiento crítico y complejo, la solución de problemas, la toma de decisiones clínicas basadas en la evidencia y el aprendizaje a lo largo de toda la vida. Sin embargo, hay necesidad de promover un cambio en el paradigma de la educación en enfermería, a fin de que abarque más capacitación en la atención primaria de salud.

Controle orbital de satélites artificiais com propulsão e uso de gravidade lunar

NASA Astrophysics Data System (ADS)

Torres, K. S.; de Almeida Prado, A. F. B.

2003-08-01

A redução do custo de combustível de uma manobra é atualmente a grande prioridade de todos os programas espaciais existentes no mundo. As manobras assistidas pela gravidade são uma ótima forma de se contornar o problema pois proporcionam economias com vasto impacto no custo final da missão. Neste trabalho é feito um estudo particular do controle orbital de um satélite artificial da Terra usando a gravidade da Lua. O objetivo é estudar uma técnica econômica para uma mudança de plano de um satélite que está em órbita em volta da Terra. A idéia principal desta abordagem é enviar primeiramente o veículo espacial em direção à Lua usando uma manobra mono-impulsiva para que assim o campo gravitacional da Lua possa fazer a mudança de plano desejada (sem custo de combustível) e só então retornar o veículo aos valores iniciais de semi-eixo e excentricidade usando uma manobra bi-impulsiva tipo Hohmann. Para tanto, é assumido que a espaçonave inicia em uma órbita circular coplanar à órbita da lua em torno da Terra e a meta é colocá-la em uma órbita similar que difere da órbita inicial somente pela inclinação. São usadas equações analíticas baseadas na abordagem Patched Conics para se calcular a variação na velocidade, momento angular, energia e inclinação do veículo espacial que realiza esta manobra. Várias simulações são feitas para se avaliar as economias de combustível envolvidas.

STRATEGIES IN SEARCH FOR INTERNATIONAL PARTNERSHIPS.

PubMed

Freitas, Denise de

2015-01-01

Internationalization is the process which integrates universal, intercultural or global dimension in a program, in this case, postgraduate. It can be understood as the process of increasing participation in international operations. To offer design and motivational logistics on how to run a process of international scientific relationship. It is necessary to develop several different aspects to be reached internationalization: to know the fundamentals of internationalization; to have international vision; to promote strategy for internationalization; to know the characteristics of an institutional center of internationalization; and to understand the institutional advantages of internationalization. Internationalization is essential to aerate the Brazilian postgraduate and not mischaracterize or weakens the process. On the contrary, it contributes to increase its vitality and capacity for innovation. Today is not possible to imagine science without internationalization. A internacionalização é o processo no qual se integra dimensão universal, intercultural ou global em um programa, no caso, de pós-graduação. Ela pode ser compreendida como o processo de participação crescente em operações internacionais. Apresentar concepção logística e motivacional de como executar um processo de relações científicas internacionais. É necessário o desenvolvimento de vários e diferentes aspectos para ser alcançada a internacionalização: conhecer os grandes eixos da internacionalização; ter visão internacional; promover estratégia para a internacionalização; saber das características de um centro institucional de internacionalização; e conhecer as vantagens institucionais da internacionalização. A internacionalização é imprescindível para arejar a pós-graduação brasileira e não a descaracteriza, menospreza ou enfraquece. Ao contrário, contribui para aumentar sua vitalidade e capacidade de inovação. Na atualidade não dá para imaginar a ciência sem internacionalização.

Determinação da massa de júpiter a partir das órbitas de seus satélites: um experimento didático

NASA Astrophysics Data System (ADS)

Schlickmann, M. S.; Saito, R. K.; Becker, D. A.; Rezende, M. F., Jr.; Cid Fernandes, R.

2003-08-01

Este trabalho apresenta o roteiro piloto de uma prática observacional em astronomia, junto com os primeiros resultados obtidos nesta fase de implementacão. O projeto, que será executado em duas etapas, visa introduzir noções de Astronomia a alunos do Ensino Médio e iniciantes nos cursos de Física. O experimento consiste em medir as órbitas dos satélites Galileanos e, a partir da análise dos dados coletados, verificar a validade da Lei das órbitas de Kepler, determinando a massa do planeta Júpiter. Em uma primeira etapa, as observações serão feitas utilizando um telescópio Meade LX200 10" e câmera CCD para obter uma seqüência de imagens do planeta, que possibilitará medir o movimento de seus satélites. A segunda etapa terá início a partir do funcionamento do telescópio em modo robótico, com a possibilidade de observações via internet por instituições de ensino. Para o desenvolvimento deste experimento foram inicialmente coletadas várias imagens de Júpiter obtidas com os instrumentos citados acima. Estas imagens serviram como base para confecção dos roteiros para a experiência no nível médio e superior. Os roteiros serão inicialmente apresentados em uma home-page. Nela também se buscará uma contextualização histórica da experiência bem como o estabelecimento de relações com professores e alunos, propostas metodológicas e a disponibilização dos programas computacionais necessários para a utilização "on-line" pelos usuários. O projeto conta com apoio da Fundação VITAE.

Precisión de las velocidades radiales obtenidas con el REOSC

NASA Astrophysics Data System (ADS)

González, J. F.; Lapasset, E.

Complementando una línea de trabajo iniciada con anterioridad discutimos la estabilidad del espectrógrafo REOSC de CASLEO en DC para la medición de velocidades radiales en base al análisis de observaciones realizadas en enero y abril de 1997. En esas oportunidades obtuvimos 26 espectros de estrellas patrones y 27 espectros de 3 estrellas usadas como estrellas de referencia en nuestro programa de cúmulos abiertos. Además tomamos 26 espectros de crepúsculo con el telescopio en posiciones cubriendo el rango H=-4,+4 y δ =-90,+30. Mediante correlaciones cruzadas derivamos la velocidad de 19 órdenes en cada uno de estos espectros. En base a un análisis estadístico de los datos obtenidos discutimos la contribución de los distintos factores que afectan a la dispersión de lectura observada. En particular, la flexión del instrumento no introduciría errores significativos cuando se observa con masas de aire menores que 2.0. La dispersión de los valores de velocidad medidos para espectros de alta relación S/N de una misma estrella resultó del orden de 0.5 km/s. La comparación con los valores de velocidad publicados por distintos autores para las estrellas patrones no permite distinguir ninguna diferencia sistemática apreciable de las velocidades de CASLEO, siendo la media cuadrática de los residuos del orden de 1.0 km/s.

Patient safety: knowledge between multiprofessional residents.

PubMed

Oliveira, João Lucas Campos de; Silva, Simone Viana da; Santos, Pamela Regina Dos; Matsuda, Laura Misue; Tonini, Nelsi Salete; Nicola, Anair Lazzari

2017-01-01

To assess the knowledge of multiprofesional residents in health about the security of the patient theme. Cross-sectional study, quantitative, developed with graduate courses/residence specialties of health in a public university of Paraná, Brazil. Participants (n=78) answered a questionnaire containing nine objective questions related to patient safety. Data were analyzed using descriptive statistics, in proportion measures. The minimum 75% of correct answers was considered the cutoff for positive evaluation. The sample was predominantly composed of young people from medical programs. Almost half of the items evaluated (n=5) achieved the established positive pattern, especially those who dealt with the hand hygiene moments (98.8%) and goal of the Patient Safety National Program (92.3%). The identification of the patient was the worst rated item (37.7%). In the analysis by professional areas, only the Nursing reached the standard of hits established. Knowledge of the residents was threshold. Verificar o conhecimento de residentes multiprofissionais na área da saúde sobre o tema segurança do paciente. Estudo transversal, quantitativo, desenvolvido com pós-graduandos dos cursos/especialidades de residência da área da saúde de uma universidade pública do Paraná. Os participantes (n=78) responderam um questionário contendo nove questões objetivas relacionadas com a segurança do paciente. Os dados foram analisados por estatística descritiva, em medidas de proporção. O mínimo de 75% de acertos foi considerado ponto de corte para avaliação positiva. A amostra foi composta por profissionais predominantemente jovens, oriundos de programas médicos. Quase metade dos itens avaliados (n=5) alcançou o padrão de positividade estabelecido, com destaque para os que trataram dos momentos de higienização das mãos (98,8%) e o objetivo do Programa Nacional de Segurança do Paciente (92,3%). A identificação do paciente foi o pior item avaliado (37,7%). Na análise por áreas profissionais, somente a Enfermagem alcançou o padrão de acertos estabelecido. O conhecimento dos residentes foi limiar.

Pincharse sin infectarse: estrategias para prevenir la infección por el VIH y el VHC entre usuarios de drogas inyectables

PubMed Central

MATEU-GELABERT, P.; FRIEDMAN, S.; SANDOVAL, M.

2011-01-01

Resumen Objetivo Desde principios de los noventa, en la ciudad de Nueva York se han implementado con éxito programas para reducir la incidencia del virus de la inmunodeficiencia humana (VIH) y, en menor medida, del virus de la hepatitis C (VHC). A pesar de ello, aproximadamente el 70% de los usuario de drogas inyectables (UDI) están infectados por el VHC. Queremos investigar cómo el 30% restante se las ha arreglado para no infectarse. El Staying safe (nombre original del estudio) explora los comportamientos y mecanismos que ayudan a evitar la infección por el VHC y el VIH a largo plazo. Material y métodos Hemos utilizado el concepto de «desviación positiva» aplicado en otros campos de salud pública. Estudiamos las estrategias, prácticas y tácticas de prevención de aquellos UDI que, viviendo en contextos de alta prevalencia, se mantienen sin infectar por VIH y el VHC, a pesar de haberse inyectado heroína durante años. Los resultados preliminares presentados en este artículo incluyen el análisis de las entrevistas realizadas a 25 UDI (17 doble negativos, 3 doble positivos y 5 con infección por el VHC y sin infección por el VIH). Se usaron entrevistas semiestructuradas que exploraban con detalle la historia de vida de los sujetos, incluyendo su consumo de drogas, redes sociales, contacto con instituciones, relaciones sexuales y estrategias de protección y vigilancia. Resultados La intencionalidad es importante para no infectarse, especialmente durante períodos de involución (períodos donde hay un deterioro económico y/o social que llevan al que se inyecta a situaciones de mayor riesgo). Presentamos tres dimensiones independientes de intencionalidad que conllevan comportamientos que pueden ayudar a prevenir la infección: a) evitar «el mono» (síntomas de abstención) asegurando el acceso a la droga; b) «llevarlo bien» para no convertirse en un junkie y así evitar la «muerte social» y la falta de acceso a los recursos, y c) seguir sin infectarse por el VIH (sólo un doble negativo tuvo un amplio conocimiento sobre la hepatitis C). Estas intencionalidades no son mutuamente excluyentes. La presencia de varias refuerza la puesta en práctica a diario de comportamientos que pueden ayudar al que se inyecta a mantenerse libre de infecciones durante años. Algunas prácticas que hemos identificado se implementan en grupo y se comunican de UDI a UDI, de esta manera se extienden entre algunas redes sociales de UDI. Conclusiones Los UDI que permanecen sin infectarse planean e implementan estrategias de prevención en circunstancias donde otros UDI aplican prácticas de riesgo. El mantenimiento de la no infección no es, por lo tanto, un resultado del azar, sino más bien el resultado del esfuerzo (agencia) de los UDI. Investigar y extender estas estrategias y tácticas a través de programas de prevención podría contribuir a la prevención del VIH y el VHC. PMID:21915175

Astronomia para/com crianças carentes em Limeira

NASA Astrophysics Data System (ADS)

Bretones, P. S.; Oliveira, V. C.

2003-08-01

Em 2001, o Instituto Superior de Ciências Aplicadas (ISCA Faculdades de Limeira) iniciou um projeto pelo qual o Observatório do Morro Azul empreendeu uma parceria com o Centro de Promoção Social Municipal (CEPROSOM), instituição mantida pela Prefeitura Municipal de Limeira para atender crianças e adolescentes carentes. O CEPROSOM contava com dois projetos: Projeto Centro de Convivência Infantil (CCI) e Programa Criança e Adolescente (PCA), que atendiam crianças e adolescentes em Centros Comunitários de diversas áreas da cidade. Esses projetos têm como prioridades estabelecer atividades prazerosas para as crianças no sentido de retirá-las das ruas. Assim sendo, as crianças passaram a ter mais um tipo de atividade - as visitas ao observatório. Este painel descreve as várias fases do projeto, que envolveu: reuniões de planejamento, curso de Astronomia para as orientadoras dos CCIs e PCAs, atividades relacionadas a visitas das crianças ao Observatório, proposta de construção de gnômons e relógios de Sol nos diversos Centros Comunitários de Limeira e divulgação do projeto na imprensa. O painel inclui discussões sobre a aprendizagem de crianças carentes, relatos que mostram a postura das orientadoras sobre a pertinência do ensino de Astronomia, relatos do monitor que fez o atendimento no Observatório e o que o número de crianças atendidas representou para as atividades da instituição desde o início de suas atividades e, em particular, em 2001. Os resultados são baseados na análise de relatos das orientadoras e do monitor do Observatório, registros de visitas e matérias da imprensa local. Conclui com uma avaliação do que tal projeto representou para as Instituições participantes. Para o Observatório, em particular, foi feita uma análise com relação às outras modalidades de atendimentos que envolvem alunos de escolas e público em geral. Também é abordada a questão do compromisso social do Observatório na educação do público em questão.

Difficulties of First Years Elementary School Teachers with the Teaching of Astronomy. (Breton Title: Dificuldades de Professores dos Anos Iniciais do Ensino Fundamental em Relação ao Ensino da Astronomia. ) Dificultades de LOS Profesores de los Primeros Años de la Escuela Primaria en Relación a la Enseñanza de la Astronomía

NASA Astrophysics Data System (ADS)

Langhi, Rodolfo; Nardi, Roberto

2005-12-01

This paper reports Primary School teachers' discourses analysis about their difficulties related to the teaching of Astronomy. It reports partial data of a master's level research carried out in the last two years, named "An exploratory study for inserting Astronomy in primary school teachers' education" (LANGHI, 2004). The study took into consideration students' and teachers' common sense conceptions about astronomical phenomena, conceptual mistakes in textbooks, and Astronomy's suggestions given by the PCN (Parâmetros Curriculares Nacionais - The Brazilian National Curriculum Standards). The paper aims to characterize teachers' difficulties, in order to provide subsides to the implementation of an initial or continuing education program. This study is justified by the fact that courses plans like these only will be adapted to the teacher's (and students') reality, if there is a primary investigation about what the teachers really need to know about Astronomy. This fact was possible here by the enunciations interpretation of a teachers' sample using semi-structured interviews, according to discourse analysis procedures. The research outcomes show difficulties related to factors like: those of personal order, methodological, on teacher's formation, educational infrastructure and other related to information sources for educators. Este artigo, que relata as dificuldades de professores em relação ao ensino da Astronomia, faz parte de um estudo exploratório para a inserção da Astronomia na formação de professores dos anos iniciais do Ensino Fundamental. Esse estudo leva em consideração as concepções alternativas de alunos e professores sobre fenômenos astronômicos, os erros conceituais em livros didáticos e as sugestões de conteúdos de Astronomia constantes nos PCN (Parâmetros Curriculares Nacionais). Caracterizar as dificuldades dos professores é a questão central deste texto, apontando para o objetivo de contribuir com subsídios para um futuro programa de formação continuada neste tema. O estudo se justifica mediante o fato de que planejamentos de cursos como estes só se adequarão à realidade do professor (e do aluno) se houver uma investigação antecipada sobre o que os docentes precisam saber e saber fazer a respeito da Astronomia, o que se concretizou em nosso caso pela interpretação dos discursos de uma amostra de professores coletados através de entrevistas semi-estruturadas, utilizando para interpretação os princípios e métodos da análise do discurso em sua linha francesa. Os resultados da pesquisa indicaram dificuldades de ordem pessoal, metodológica, de formação, de infra-estrutura e outras relacionadas às fontes de informações para docentes. Este artículo que relata las dificultades de los profesores en relación a la enseñanza da laAstronomía es parte de un estudio preliminar para la implantación dela Astrnomía enla formación de profesores de ls primeros años del ciclo primario.El estudio considera las concepciones alternativas de alumnos y profesores respecto a los fenómenos astronómicos, los errores conceptuales en los libros didácticos y las sugerencias de contenidos de Astronomía que constan en los Parámetros Curriculares Nacionales del Brasil. Caracterizar las dificultades de los profesores constituye la cuestión central de este texto, apuntando para el objetivo de contribuir para un futuro programa de educación contínua en este tema. El estudio se justifica mediante el hecho que la planificación de cursos de este tipo solo se adecuarán a la realidade del profesor (y del alumno) si existe una investigación anterior a respecto de lo que los docentes precisan saber y saber realizar en Astronomía, lo cual se concretó en nuestro caso por medio de la interpretación de los discursos de una muestra de profesores obtenidos através de entrevistas semiestructuradas, utilizand para esta interpretación los principios y métodos de análisis del discurso en su línea francesa. Los resultados mostraron dificultades de orden personal, metodológica, formativa, de infraestructura y otras relacionadas a las fuentes de información para los docentes.

[Not Available].

PubMed

Sellés, Sergio; Fernández-Sáez, José; López-Lluch, Guillermo; Cejuela, Roberto

2016-02-16

El proceso de formación de futuros deportistas debe ser un trabajo estructurado y planificado para poder alcanzar el máximo nivel deportivo. Es fundamental en este periodo tener presentes los ritmos de desarrollo y maduración de los jóvenes deportistas para así adecuar las cargas de entrenamientos a sus estados evolutivos. El objetivo del estudio fue determinar y analizar la edad morfológica en nadadores y triatletas adolescentes, estableciendo diferencias entre su edad cronológica, grupos y género. A través del método antropométrico se determinó el estado de maduración biológica en un grupo de 37 deportistas jóvenes tecnificados. Los resultados muestran que la mayoría de la muestra (70,8%) se encuentra en un estado avanzado de desarrollo con respecto a su edad cronológica, siendo más notorio en el caso de los nadadores este estado de madurez avanzado. Tener una edad morfológica más avanzada respecto a su edad cronológica podría favorecer a los deportistas adolescentes a la hora de conseguir mejores marcas y resultados en las competiciones y de esta manera acceder con más facilidad a los programas de tecnificación. El índice de desarrollo corporal modificado (IDCm) se presenta como un método validado, fiable y no invasivo para tener presente el grado de desarrollo y maduración en la selección de talentos deportivos y adecuar las cargas de entrenamiento al estado evolutivo de los deportistas.

Detección automática de NEOs en imágenes CCD utilizando la transformada de Hough

NASA Astrophysics Data System (ADS)

Ruétalo, M.; Tancredi, G.

El interés y la dedicación por los objetos que se acercan a la órbita de la Tierra (NEOs) ha aumentado considerablemente en los últimos años, tanto que se han iniciado varias campañas de búsqueda sistemática para aumentar la población identificada de éstos. El uso de placas fotográficas e identificación visual está siendo sustituído, progresivamente, por el uso de cámaras CCD y paquetes de detección automática de los objetos en las imágenes digitales. Una parte muy importante para la implementación exitosa de un programa automatizado de detección de este tipo es el desarrollo de algoritmos capaces de identificar objetos de baja relación señal-ruido y con requerimientos computacionales no elevados. En el presente trabajo proponemos la utilización de la transformada de Hough (utilizada en algunas áreas de visión artificial) para detectar automáticamente trazas, aproximadamente rectilíneas y de baja relación señal-ruido, en imágenes CCD. Desarrollamos una primera implementación de un algoritmo basado en ésta y lo probamos con una serie de imágenes reales conteniendo trazas con picos de señales de entre ~1 σ y ~3 σ por encima del nivel del ruido de fondo. El algoritmo detecta, sin inconvenientes, la mayoría de los casos y en tiempos razonablemente adecuados.

Projeto observatórios virtuais: educação através de telescópios robóticos

NASA Astrophysics Data System (ADS)

Santana, P. H. S.; Shida, R. Y.

2003-08-01

O principal objetivo do projeto Observatórios Virtuais é o ensino na área de ciências através de atividades práticas desenvolvidas em colaboração entre instituições de pesquisa em astronomia e escolas de ensino médio e fundamental. Este ano deverá ser concluída a implantação do programa piloto de estudos, pesquisas e observação astronômica direta, com utilização em tempo real de telescópios robóticos, que assim funcionarão como "observatórios virtuais". O objetivo pedagógico das atividades práticas baseadas nas imagens atronômicas é desenvolver as habilidades e competências dos alunos no uso do método científico. Para isso, serão realizados projetos interdisciplinares, a partir de observações astronômicas, já que a astronomia é uma área interdisciplinar por excelência. Essas atividades terão níveis diferenciados de complexidade, que podem ser adequados aos vários graus do ensino e realidades regionais. Será dada ênfase ao desenvolvimento e aplicação em São Paulo, onde atua a equipe do IAG/USP. Como resultados apresentados no presente trabalho, temos a criação de um software em português para o processamento de imagens obtidas através de CCDs e a elaboração de material para as atividades educacionais relacionadas.

Advanced practice nursing in Latin America and the Caribbean: regulation, education and practice.

PubMed

Zug, Keri Elizabeth; Cassiani, Silvia Helena De Bortoli; Pulcini, Joyce; Garcia, Alessandra Bassalobre; Aguirre-Boza, Francisca; Park, Jeongyoung

2016-08-08

to identify the current state of advanced practice nursing regulation, education and practice in Latin America and the Caribbean and the perception of nursing leaders in the region toward an advanced practice nursing role in primary health care to support Universal Access to Health and Universal Health Coverage initiatives. a descriptive cross-sectional design utilizing a web-based survey of 173 nursing leaders about their perceptions of the state of nursing practice and potential development of advanced practice nursing in their countries, including definition, work environment, regulation, education, nursing practice, nursing culture, and perceived receptiveness to an expanded role in primary health care. the participants were largely familiar with the advanced practice nursing role, but most were unaware of or reported no current existing legislation for the advanced practice nursing role in their countries. Participants reported the need for increased faculty preparation and promotion of curricula reforms to emphasize primary health care programs to train advanced practice nurses. The vast majority of participants believed their countries' populations could benefit from an advanced practice nursing role in primary health care. strong legislative support and a solid educational framework are critical to the successful development of advanced practice nursing programs and practitioners to support Universal Access to Health and Universal Health Coverage initiatives. identificar o estado atual da regulação, educação e prática do enfermeiro de prática avançada na América Latina e no Caribe e a percepção de líderes de enfermagem na região quanto ao papel da enfermagem de prática avançada na atenção primaria à saúde em apoio às iniciativas de Acesso Universal à Saúde e Cobertura Universal de Saúde. o estudo descritivo transversal utilizou um survey online com 173 líderes de enfermagem questionando suas percepções sobre o estado atual da prática de enfermagem e o potencial desenvolvimento da enfermagem de prática avançada em seus países, incluindo a definição do termo, o ambiente de trabalho, a regulação, educação, prática, cultura de enfermagem e receptividade percebida de um papel mais amplo deste profissional na atenção primaria à saúde. os participantes referiram estar familiarizados com o papel do enfermeiro de prática avançada, mas a maioria não sabia ou não relatou a legislação vigente para o papel da prática avançada em seus países. Os participantes relataram a necessidade de aumentar a preparação do corpo docente e promover reformas curriculares com enfase na atenção primária à saúde para formar enfermeiros de prática avançada. A grande maioria dos participantes acredita que as populações de seus países se beneficiará com o papel do enfermeiro de prática avançada na atenção primária à saúde. forte apoio em termos de legislação e uma estrutura educacional sólida de formação contínua são fundamentais para o êxito do desenvolvimento de programas de enfermagem de prática avançada em apoio às iniciativas de Acesso Universal à Saúde e Cobertura Universal de Saúde. identificar el estado actual de la regulación, educación y práctica de la enfermera de práctica avanzada en Latinoamérica y el Caribe y la percepción de los líderes de enfermería en la región hacia un rol de práctica avanzada de enfermería dentro de la atención primaria de salud para apoyar las iniciativas de Acceso Universal a la Salud y la Cobertura Universal de Salud. un diseño transversal descriptivo que utilizó una encuesta basada en la web a 173 líderes de enfermería acerca de sus percepciones sobre el estado de la enfermería y el desarrollo potencial de la práctica avanzada de enfermería en sus países, incluyendo definición, ambiente laboral, regulación, educación, práctica de enfermería, cultura de enfermería y la receptividad percibida a un papel más amplio en atención primaria de salud. los participantes estaban ampliamente familiarizados con el rol de la enfermera de práctica avanzada, pero la mayoría desconocía la legislación o reportaba no existencia actual de legislación para el rol de práctica avanzada en sus países. Los participantes reportaron la necesidad de aumentar la preparación docente y reformas curriculares para apoyar programas de atención primaria de salud para capacitar las enfermeras de práctica avanzada. La gran mayoría de los participantes creían que las poblaciones de sus países se podrían beneficiar de un rol de práctica avanzada de enfermería en atención primaria de salud. un fuerte apoyo legislativo y un marco educacional sólido que continúen informándose entre sí, son críticos para el desarrollo exitoso de programas de práctica avanzada y de nurse practitioners para apoyar las iniciativas de Acceso Universal a la Salud y Cobertura Universal de Salud.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuda, J.P.; Dunford, J.C.; Leavengood, J.M. Jr.

Torpedograss, Panicum repens L., is an adventive, rhizomatous grass species that has become an invasive weed of terrestrial, wetland, and aquatic environments in tropical and subtropical regions worldwide. Until recently, strategies for controlling torpedograss in the USA have focused almost exclusively on mechanical and chemical methods, either alone or in combination, with varied results. A survey of the arthropods and nematodes currently associated with the plant in Lake Okeechobee, Florida, was conducted as part of a feasibility study to determine whether torpedograss is an appropriate target for a classical biological control program. Overall, approximately 4,000 arthropods and 400 nematode specimensmore » were collected. Sweep, clipped vegetation, and soil core samples were dominated by representatives of the arthropod orders Hemiptera, Hymenoptera, Diptera, and Acari. Lesion nematodes of the genus Pratylenchus were commonly associated with the roots of torpedograss. None of the organisms collected were torpedograss specialists. Although classical biological control of torpedograss is feasible based on the extent of the infestation, economic losses, resistance to conventional controls, and the report of a potentially host specific natural enemy in India, the botanical position of this grass weed will require a formal risk assessment before proceeding with a classical biological control program. (author) [Spanish] La conota, Panicum repens L., es una especie foranea de pasto que produce rizomas que ha convertido en ser una maleza invasora de ambientes terrestres, pantanosos y acuaticos en regiones tropicales y subtropicales en todo el mundo. Hasta hace un tiempo reciente, las estrategias para controlar conota en los EEUU eran enfocadas casi exclusivamente en los metodos mecanicos y quimicos, solos o en combinacion, con resultados variables. Un muestreo de los artropodos y nematodos asociados corrientemente con esta planta en el Lago de Okeechobee, Florida, fue realizado como parte de un estudio de factibilidad para determinar si conota es una candidata apropiada para un programa de control biologico clasico. En general, especimenes de aproximadamente unos 4,000 artropodos y unos 400 nematodos fueron recolectados. Muestras recolectadas pasando una red sobre vegetacion mezclada, cortando la vegetacion y tomando centros del suelo fueron dominados por representantes de artropodos de los ordenes de Hemiptera, Hymenoptera, Diptera, y Acari. Nematodos en el genero Pratylenchus, que causan lesiones sobre tejido, fueron asociados regularmente con las raices de conota. Ninguno de los organismos recolectados eran especialistas sobre conota. Aunque el control biologico clasico de la conota es factible basado sobre la magnitud de la infestacion, las perdidas economicas, la resistencia hacia los metodos de control convencionales y el informe en la India de un posible enemigo natural especifico a esta planta, la posicion botanica de este pasto maleza requiere una evaluacion de riesgo economico formal antes de continuar con un programa de control biologico clasico. (author)« less

Evidence-based measures to prevent central line-associated bloodstream infections: a systematic review.

PubMed

Perin, Daniele Cristina; Erdmann, Alacoque Lorenzini; Higashi, Giovana Dorneles Callegaro; Sasso, Grace Teresinha Marcon Dal

2016-09-01

to identify evidence-based care to prevent CLABSI among adult patients hospitalized in ICUs. systematic review conducted in the following databases: PubMed, Scopus, Cinahl, Web of Science, Lilacs, Bdenf and Cochrane Studies addressing care and maintenance of central venous catheters, published from January 2011 to July 2014 were searched. The 34 studies identified were organized in an instrument and assessed by using the classification provided by the Joanna Briggs Institute. the studies presented care bundles including elements such as hand hygiene and maximal barrier precautions; multidimensional programs and strategies such as impregnated catheters and bandages and the involvement of facilities in and commitment of staff to preventing infections. care bundles coupled with education and the commitment of both staff and institutions is a strategy that can contribute to decreased rates of central line-associated bloodstream infections among adult patients hospitalized in intensive care units. identificar evidências de cuidados para prevenção de infecção de corrente sanguínea relacionada a cateter venoso central em pacientes adultos em Unidades de Terapia Intensiva. revisão Sistemática realizada por meio de busca nas bases de dados Pubmed, Scopus, Cinahl, Web of Science, Lilacs, Bdenf e Cochrane. Foram buscadas pesquisas com cuidados com a cateterização e manutenção do cateter venoso central, publicados de janeiro de 2011 a julho de 2014. Os 34 estudos incluídos foram organizados em um instrumento e avaliados por meio da classificação do The Joanna Briggs Institute. os estudos apresentaram bundles de cuidados com elementos como a higiene das mãos e precauções máximas de barreira; programas multidimensionais e estratégias como cateteres e curativos impregnados e o envolvimento da instituição e engajamento da equipe nos esforços para prevenção de infecção. os cuidados no formato de bundles aliados com a educação e engajamento da equipe e da instituição são estratégias que poderão contribuir para a redução das taxas de infecção de corrente sanguínea relacionada a cateter venoso central em pacientes adultos em unidades de terapia intensiva. identificar evidencias de cuidados para prevención de infección de la corriente sanguínea relacionada al catéter venoso central, en pacientes adultos en Unidades de Terapia Intensiva. revisión sistemática realizada por medio de búsqueda en las bases de datos Pubmed, Scopus, Cinahl, Web of Science, Lilacs, Bdenf y Cochrane. Fueron buscadas investigaciones de cuidados con la cateterización y manutención del catéter venoso central, publicados de enero de 2011 a julio de 2014. Los 34 estudios incluidos fueron organizados en un instrumento y evaluados por medio de la clasificación del The Joanna Briggs Institute. los estudios presentaron bundles de cuidados con elementos como: higiene de las manos y precauciones máximas de barrera; programas multidimensionales y estrategias como catéteres y curativos impregnados y, participación de la institución y compromiso del equipo en los esfuerzos para prevención de la infección. los cuidados en el formato de bundles aliados con la educación y compromiso del equipo y de la institución, son estrategias que podrán contribuir para la reducción de las tasas de infección de la corriente sanguínea relacionadas al catéter venoso central, en pacientes adultos en unidades de terapia intensiva.

Dialectics of a medical provision policy in priority areas in Brazil.

PubMed

Weber, César Augusto Trinta

2017-03-01

The people living in vulnerable areas that are difficult to access in Brazil represent a portion of the population that has proven very sensitive to lack of medical and health services. The government, seeking to solve the situation urgently, implemented the More Doctors Program [Programa Mais Médicos, in the Portuguese original] in 2013. To discuss the More Doctors Program, with the purpose of contributing to the debate on the provision of medical policies in Brazil. Study based on the review of official documents: Programa Mais Médicos - dois anos: mais saúde para os brasileiros, 2015 [More Doctors Program - two years: more health for Brazilians, 2015]; Operational Audit Report, TC Nº 005391/2014-8, the Court of Auditors of Brazil; and Medical Demography in Brazil 2015. The import of exchange physicians without diploma revalidation has cast a shadow on the technical quality of services offered to the population. In terms of infrastructure, the reduction of resources paralyzed works and made the care network maintenance projects impossible. The creation of new medical schools has created uncertainty about the possibility of quality education being offered, with minimum and sufficient structure including laboratories, clinics and teaching hospitals indispensable to medical training. The regional inequalities of concentration and dispersion of physicians, showed by studies on medical demography in Brazil, stem from several factors, including the lack of a career path and working conditions. There is no point in having physicians if they do not have safe and ethical conditions to establish the diagnosis and a treatment plan, as well as to monitor the rehabilitation of the patient.

Determinación de temperatura efectiva y gravedad superficial de estrellas B y A de secuencia principal

NASA Astrophysics Data System (ADS)

Nieva, M. F.; Pintado, O. I.; Adelman, S.; Rayle, K. E.; Sanders, S. E., Jr.

Las temperaturas efectivas (Teff) y gravedades superficiales (log g) de un grupo de estrellas de tipo B y A de Secuencia Principal se determinaron en varias etapas. En una primera aproximación se usaron los índices fotométricos de Strömgren para realizar el cálculo con el programa de Napiwotski et al.(1993). Luego se hizo un ajuste comparando datos espectrofotométricos con flujos obtenidos con el modelo ATLAS9 en la región visible. Y a continuación se hizo un mejor ajuste comparando los perfiles de la línea Hγ con espectros sintéticos calculados con SYNTHE. Además, se analizó el efecto de usar el modelo de Canuto y Mazzitelli (1991), donde se considera The Mixing Length Theory, en modelos de atmósferas de estrellas.

Astronomía para ciegos y amblíopes. Proyecto de construcción de un planetario especial en la ciudad de Mar del Plata

NASA Astrophysics Data System (ADS)

Musso, S.

?`Qué es la Astronomía para Ciegos?. El trabajo es una adaptación en base a la escala de magnitudes de Hipparco que cambia el concepto de luz por una adaptación sonora, donde las estrellas de magnitud 6 se escuchan en 10 dB, más o menos lo que consideramos el umbral de la audición humana. Quienes no escuchan muy bien no pueden escuchar las magnitudes 6, de la misma manera que muchos de nosotros, que no poseemos una visión perfecta, no podemos observar esas mismas estrellas en el cielo (más allá de la polución). A los astros de magnitud 5 vamos a relacionarlos a un sonido en 20 dB. Y así sucesivamente. También los colores estarán representados en una convención de graves a agudos y lo mismo algunas características del cielo. Por ejemplo, la Vía Láctea se mostrará como un ``ruido", como bien nos lo hicieron ver nuestros futuros destinatarios. En Mar del Plata nos encontramos ya trabajando en un proyecto que tiene como objetivo final la construcción del Primer Planetario Acústico del Mundo, una herramienta para la enseñanza de la astronomía, un espacio para la lucha contra la discriminación del discapacitado y una posibilidad de ``ver el cielo de un modo diferente".

The Brazilian Aerospace Industry: A Cast Study of the Technological Impact of Offset Agreements in a Recipient Industry

DTIC Science & Technology

1989-12-01

Special Export Programs, Comissco de Beneficios Fiscais e Programas Especiais de Exportagdo - BEFIEX. This program allows the rebate of tariff and...development became a specific policy objective. The 1968-69 Development Plan, Programa Estrat6gico de Desenvolvimento (PED), defined an explicit...Comunicagdo de Programa de Aquisigdo - CPA) containing: object, quantity, delivery time, value, nature, and other basic elements of contracting. To comply

The Astronomy Club of Araranguá: Educating Science Teachers as Science Communicators. (Breton Title: Clube de Astronomia de AraranguÁ: a Formação de Professores de Ciências Como Divulgadores Científicos. ) Club de Astronomía de Araranguá: la Formación del Profesorado Como Comunicadores de la Ciencia

NASA Astrophysics Data System (ADS)

Damasio, Felipe; Allain, Olivier; Antunes Rodrigues, Adriano

2013-07-01

The study reported in this work takes place since 2009 at the Federal Institute of Education, Science and Technology of Santa Catarina, Campus Araranguá. Our main goal is to help form teachers, training undergraduate students in Natural Sciences with specialization in Physics as science communicators, as well as to promote actions of broader scientific popularization in the region of the town of Araranguá through an Astronomy Club called CA2. Among the actions of scientific popularization that the students promote are: video production, radio broadcasts, lectures, nightly observations, preparation and exhibition of posters, physics teaching for children, continuing education activities for teachers and regular physics teaching using Astronomy as a theme. The Club's teacher education and scientific dissemination work is based on the Theory of Meaningful Learning, always trying to reach the student's predisposition to learn and produce potentially meaningful material, the two essential conditions for meaningful learning to occur. O estudo que este trabalho relata ocorre desde 2009 no Instituto Federal de Educação, Ciência e Tecnologia de Santa Catarina, campus Araranguá. Nele procura-se formar divulgadores científicos durante a formação inicial de docentes do curso de Licenciatura em Ciências da Natureza com habilitação em Física, além de promover ações de divulgação científica para o público geral da região da cidade de Araranguá por meio de um Clube de Astronomia chamado CA² (Clube de Astronomia de Araranguá). Entre as ações de divulgação científica que os licenciandos promovem estão: produção de vídeos, programas de rádio, palestras, observações noturnas, confecção e exposição de pôsteres, ensino de física para crianças, formação continuada de professores em atividades e ensino de Física regular utilizando a Astronomia como tema gerador. O trabalho de formação docente e divulgação científica do Clube fundamenta-se na Teoria da Aprendizagem Significativa, sempre procurando alcançar a pré-disposição em aprender e produzir material potencialmente significativo, as duas condições necessárias para que a aprendizagem significativa ocorra. El estudio relatado en este trabajo se lleva a cabo desde 2009 en el Instituto Federal de Educação, Ciência e Tecnología de Santa Catarina, campus Araranguá. En él se busca formar a comunicadores de la ciencia durante la formación inicial de los docentes Licenciatura en Ciencias Naturales con especialidad en Física, y también promover acciones de divulgación científica para el público en general en la región de Araranguá a través de un club de astronomía llamado CA2 (Clube de Astronomia Araranguá). Entres las acciones de los estudiantes que se promueven están: producción de videos, programas de radio, conferencias, observaciones nocturnas, la preparación y exposición de carteles, la educación en física para los niños, actividades de formación permanente del profesorado y enseñanza de la física de con el tema generador Astronomía. El trabajo de la formación del profesorado y la difusión de club científico se basa en la teoría del aprendizaje significativo, buscando siempre la predisposición para aprender y producir material potencialmente significativo, las dos condiciones necesarias para que ocurra el aprendizaje significativo.

Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

PubMed Central

2012-01-01

Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

Capacitación-acción participativa: una experiencia de 24 años en las comunidades rurales de Oaxaca, México.

PubMed

Ysunza, Alberto M; Diez-Urdanivia, Silvia; Pérez-Gil, Sara E

2017-12-01

Resumen: En este artículo presentamos el proyecto de capacitación llevado a cabo en comunidades de la sierra y costa de Oaxaca, México, desde 1991, por el Centro de Capacitación Integral para Promotores Comunitarios (CECIPROC). La decisión de hacer este trabajo en Oaxaca responde a que ese estado ocupa uno de los primeros lugares de marginación y de desnutrición en menores de 5 años. El objetivo es describir un modelo de capacitación y compartir parte de las experiencias derivadas, tanto del modelo como del trabajo realizado en las distintas áreas (nutrición y alimentación, salud comunitaria, ecología y etnobotánica, y educación y organización), por promotores mujeres y hombres en sus comunidades. La experiencia obtenida en 24 años muestra la factibilidad técnica y social del proyecto en el ámbito de la salud, el reconocimiento social del proyecto del CECIPROC como un organismo civil que ha aportado alternativas como solución a la problemática de salud, el hacer suyo el proyecto por algunos promotores y los diferentes obstáculos a los que se ha enfrentado. Enfatizamos el hecho de que la situación socioeconómica y política prevaleciente en el estado de Oaxaca es una limitante para el buen desarrollo de los programas colectivos de salud, e insistimos en la necesidad de compartir nuestras experiencias para que puedan ser utilizadas en la planificación y ejecución de otros proyectos.

Conceptuaciones de los estudiantes de las facultades de educacion y ciencias naturales de la Universidad de Puerto Rico, recinto de Rio Piedras, acerca de la ciencia y la pseudociencia

NASA Astrophysics Data System (ADS)

Reyes Medina, Hector A.

Esta investigacion describe las conceptuaciones de los estudiantes de tercer ano o mas a nivel de bachillerato de los programas de Educacion en Ciencia y Ciencias Naturales de la Universidad de Puerto Rico, Recinto de Rio Piedras, acerca de lo establecido en la literatura para distinguir el conocimiento cientifico de las creencias pseudocientificas. Este estudio se guio por un diseno tipo encuesta transversal que permitio conocer de manera consistente las conceptuaciones de los estudiantes encuestados acerca de la Ciencia y la Pseudociencia. Ademas, permitio desarrollar inferencias estadisticas relacionadas a la poblacion de estudio, sus conceptuaciones y su inclinacion teorica en torno al Realismo y al Racionalismo cientifico moderados. El instrumento utilizado fue el Cuestionario acerca de las concepciones de la ciencia y la pseudocienca en estudiantes universitarios, Reyes (2015). Este cuestionario fue validado mediante la recopilacion de diversas fuentes de evidencias, entre estas se encuentran las evidencias basadas en el contenido, el proceso de respuesta, la estructura interna y de constructo. Tambien, se calculo el Alfa de Crombach para la escala total y para cada componente y se realizo un analisis de factores que demostro la presencia de seis componentes claramente definidos de acuerdo a lo esperado sobre las caracteristicas originales del instrumento. Las estadisticas utilizadas fueron descriptivas. Participaron 302 alumnos, de las facultades de educacion y ciencias naturales. Se encontro que las conceptuaciones de los estudiantes de ambas facultades se inclinan en un 66.2% a favor con lo establecido en el modelo teorico en torno al Realismo y al Racionalismo cientifico moderados. Sin embargo, aun hay un 33.8% de los estudiantes de ambas facultades que poseen conceptuaciones distintas al modelo teorico propuesto.

On Ensino de Astronomia: Desafios para Implantação

NASA Astrophysics Data System (ADS)

Faria, R. Z.; Voelzke, M. R.

2008-09-01

Em 2002 o ensino de Astronomia foi proposto como um dos temas estruturadores pelos Parâmetros Curriculares Nacionais e sugerido como facilitador para que o aluno compreendesse a Física como construção humana e parte do seu mundo vivencial, mas raramente seus conceitos foram ensinados. A presente pesquisa discute dois aspectos relacionados à abordagem de Astronomia. O primeiro aspecto é se ela está sendo abordada pelos professores do Ensino Médio e o segundo, aborda a maneira como ela está sendo ensinada. Optou-se pela aplicação de um questionário a partir do 2° semestre de 2006 e durante o ano de 2007 com professores que ministram a disciplina de Física, os quais trabalham em escolas estaduais em Rio Grande da Serra, Ribeirão Pires e Mauá no estado São Paulo. Dos 66,2% dos professores que responderam ao questionário nos municípios de Rio Grande da Serra, Ribeirão Pires e Mauá, 57,4% não aplicaram nenhum tópico de astronomia, 70,2% não utilizaram laboratório, 89,4% não utilizaram qualquer tipo de programa computacional, 83,0% nunca fizeram visitas com alunos a museus e planetários e 38,3% não indicaram qualquer tipo de livro ou revista referente à astronomia aos seus alunos. Mesmo considerando a Astronomia um conteúdo potencialmente significativo, esta não fez parte dos planejamentos escolares. Portanto são necessárias propostas que visem estratégias para a educação continuada dos professores como, por exemplo, cursos específicos sobre o ensino em Astronomia.

JOURNAL ANALYSIS ON OPHTHALMOLOGY AND OTHERS.

PubMed

Freitas, Denise de

2015-01-01

To update knowledge and methods to access and view the journals included in Qualis of CAPES Medicine III, and how to measure the impact factor. Document review on the attempt to verify the way Qualis uses for ranking journals cited by the post-graduate programs of Medicine III in their evaluation periods, and the impact factors obtained by journals indexing base. The classification is annual and are ranking in strata ranging from A1, the highest, and A2; B1; B2; B3; B4; B5; C. The latter has zero evaluation weight. These strata take as reference the impact factor of the journals listed by the programs. The same journal can be classified into different Qualis in other areas, and this is no inconsistency, but expressed the assigned value, in each area, at that particular journal. The Impact Factor is measured using the Journal of Citation Report in Web of Knowledge website. Using the criteria established by WebQualis for stratification of journals there is a quality guidance of what is produced by the program and, based on it, can be made scientific comparison of program performance. Consulting the JCR is recommended because it defines exactly what is the journal's impact factor; Qualis stratifies numerical intervals and not individual journal specificity. Atualização do conhecimento dos meios e métodos de acessar e visualizar os periódicos do Qualis da Medicina III da CAPES e a mensuração do Fator de Impacto. Buscou-se verificar a forma utilizada pelo Qualis para classificar os periódicos referidos pelos programas de pós-graduação da Medicina III em seus períodos de avaliação e os fatores de impacto obtidos pelas revistas em base indexadora. A classificação é anual e são enquadrados em estratos que variam de A1, o mais elevado, a A2; B1; B2; B3; B4; B5; C. Este último tem peso zero. Esses estratos levam como referência o Fator de Impacto dos periódicos referidos pelos programas. Um mesmo periódico pode ter classificação em Qualis diferentes em outras áreas, e isto não constitui inconsistência, mas expressa o valor atribuído, em cada área, àquela determinada revista científica. O Fator de Impacto é mensurado navegando-se no site do Journal of Citation Report da Web of Knowledge. A utilização dos critérios estabelecidos pelo WebQualis para estratificação dos periódicos é norteadora da qualidade do que se produz nos programas e, com base nela, pode-se fazer comparações de desempenho científico. Já a consulta ao JCR é complementarmente adequada de ser feita porque define com exatidão qual é o fator de impacto da revista, em função de que o Qualis estratifica faixas numéricas e não especificidade individual do periódico.

PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

DOE PAGES

Yoon, Hyejin; Leitner, Thomas

2014-12-17

Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

PubMed Central

2009-01-01

Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

PubMed

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

PubMed Central

2012-01-01

Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

PrimerZ: streamlined primer design for promoters, exons and human SNPs.

PubMed

Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

2007-07-01

PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

Combustión turbulenta de materia nuclear en materia extraña

NASA Astrophysics Data System (ADS)

Vucetich, H.

La simulación numérica de supernovas tipo II muestra que los mecanismos físicos convencionales no son suficientes como para producir la explosión. La detonación de materia nuclear en materia extraña es un mecanismo físico capaz de proveer la energía faltante en las simulaciones. En esta comunicación se muestra que la turbulencia en el corazón compacto de una supernova, después del primer choque, es capaz de transformar una combustión lenta en una detonación. Se concluye que, si la materia extraña existe, todas las ``estrellas de neutrones'' son, en realidad, ``estrellas extrañas''.

[Not Available].

PubMed

Díaz, Toni; Ficapal-Cusí, Pilar; Aguilar-Martínez, Alicia

2016-07-19

Introducción: a pesar de la relevancia nutricional del desayuno para el desarrollo y su asociación a un mejor aprendizaje y rendimiento escolar, numerosos estudios ponen en evidencia que en muchos casos se omite o se hace mal.Objetivo: determinar la calidad del desayuno de estudiantes de entre 10 y 16 años con intención de determinar en qué momento sería conveniente realizar programas educativos sobre la importancia de esta comida y cómo mejorar su calidad.Método: estudio observacional, descriptivo y transversal a partir de un cuestionario con preguntas cerradas acerca de los hábitos de alimentación en el desayuno en estudiantes de educación primaria y secundaria.Resultados y conclusión: solo el 18,5% de los estudiantes realiza un desayuno de buena calidad y su mala calidad va aumentando progresivamente con los cursos y se asocia al hecho de desayunar solo. En ambos niveles educativos los alimentos más consumidos en casa pertenecen al grupo de los lácteos y los cereales, mientras que en el centro escolar, el bocadillo resulta el desayuno más habitual; no obstante se observan diferencias entre primaria y secundaria en cuanto al consumo de fruta y bebidas azucaradas, entre otros.Conclusión: sería interesante valorar la instauración de programas de desayuno escolar incluyendo en ellos no solo a estudiantes de primaria, sino también, y especialmente, a adolescentes pues son estos quienes omiten esta comida en mayor proporción. Las intervenciones deberían orientarse a corregir las desviaciones más habituales observadas en cada uno de los niveles educativos.

PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

PubMed Central

Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

2006-01-01

PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

Primer3_masker: integrating masking of template sequence with primer design software.

PubMed

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

[Injecting without getting infected: injectors' strategies to prevent HIV and HCV.

PubMed

Mateu-Gelabert, P; Friedman, S; Sandoval, M

2007-10-01

OBJETIVO: Desde principios de los noventa, en la ciudad de Nueva York se han implementado con éxito programas para reducir la incidencia del virus de la inmunodeficiencia humana (VIH) y, en menor medida, del virus de la hepatitis C (VHC). A pesar de ello, aproximadamente el 70% de los usuario de drogas inyectables (UDI) están infectados por el VHC. Queremos investigar cómo el 30% restante se las ha arreglado para no infectarse. El Staying safe (nombre original del estudio) explora los comportamientos y mecanismos que ayudan a evitar la infección por el VHC y el VIH a largo plazo. MATERIAL Y M#ENTITYSTARTX000E9;TODOS: Hemos utilizado el concepto de «desviación positiva» aplicado en otros campos de salud pública. Estudiamos las estrategias, prácticas y tácticas de prevención de aquellos UDI que, viviendo en contextos de alta prevalencia, se mantienen sin infectar por VIH y el VHC, a pesar de haberse inyectado heroína durante años. Los resultados preliminares presentados en este artículo incluyen el análisis de las entrevistas realizadas a 25 UDI (17 doble negativos, 3 doble positivos y 5 con infección por el VHC y sin infección por el VIH). Se usaron entrevistas semiestructuradas que exploraban con detalle la historia de vida de los sujetos, incluyendo su consumo de drogas, redes sociales, contacto con instituciones, relaciones sexuales y estrategias de protección y vigilancia. RESULTADOS: La intencionalidad es importante para no infectarse, especialmente durante períodos de involución (períodos donde hay un deterioro económico y/o social que llevan al que se inyecta a situaciones de mayor riesgo). Presentamos tres dimensiones independientes de intencionalidad que conllevan comportamientos que pueden ayudar a prevenir la infección: a) evitar «el mono» (síntomas de abstención) asegurando el acceso a la droga; b) «llevarlo bien» para no convertirse en un junkie y así evitar la «muerte social» y la falta de acceso a los recursos, y c) seguir sin infectarse por el VIH (sólo un doble negativo tuvo un amplio conocimiento sobre la hepatitis C). Estas intencionalidades no son mutuamente excluyentes. La presencia de varias refuerza la puesta en práctica a diario de comportamientos que pueden ayudar al que se inyecta a mantenerse libre de infecciones durante años. Algunas prácticas que hemos identificado se implementan en grupo y se comunican de UDI a UDI, de esta manera se extienden entre algunas redes sociales de UDI. CONCLUSIONES: Los UDI que permanecen sin infectarse planean e implementan estrategias de prevención en circunstancias donde otros UDI aplican prácticas de riesgo. El mantenimiento de la no infección no es, por lo tanto, un resultado del azar, sino más bien el resultado del esfuerzo (agencia) de los UDI. Investigar y extender estas estrategias y tácticas a través de programas de prevención podría contribuir a la prevención del VIH y el VHC.

Concepciones Alternativas de "Fotosintesis" en estudiantes Universitarios del curso basico de Biologia y posibles correcciones con el Modelo Educativo MODEF

NASA Astrophysics Data System (ADS)

De Jesus Roman, Sandra

Concepciones Alternativas de Fotosíntesis en estudiantes Universitariosdel curso básico de Biología y posibles correcciones con el Modelo Educativo MODEF El modelo educativo para la enseñanza de Fotosíntesis (MODEF) se implantó para trabajar el problema de las concepciones alternativas (CA) en un curso de Biología General. Se evaluaron los resultados en cuanto al logro del aprendizaje significativo. La pregunta central de la investigación fue: ¿Cómo aporta el modelo educativo en la didáctica y comprensión del tema de fotosíntesis? Se efectuó una investigación acción con una fase cuantitativa y una cualitativa. Para la fase cuantitativa se elaboró una prueba para determinar las concepciones alternativas, se validó y se sometió a los estudiantes que participaron en el estudio antes y después de ofrecer la unidad de metabolismo celular. Los participantes eran estudiantes de primer año de la Universidad de Puerto Rico en Bayamón (UPRB). Se llevó a cabo un análisis de consistencia interna de la prueba mediante el método Alfa de Cronbach. Se analizaron las contestaciones a cada pregunta mediante la prueba de Ji cuadrado de contingencia, se efectuó la prueba de t y el coeficiente r de Pearson. La fase cualitativa incluyó la observación participativa de la investigadora- profesora, las reflexiones de los estudiantes y la información de las entrevistas semi-estructuradas que se realizaron a tres estudiantes del curso. El análisis se llevó a cabo mediante el Modelo de Wolcott. Se trabajaron diez CA de las cuales siete fueron corregidas mediante el Modelo MODEF. Las actividades más importantes para el proceso de aprendizaje incluyeron el trabajo de investigación o búsqueda de información para hacer una presentación digital, la elaboración de tablas, los mapas de conceptos, el uso de visuales o videos y las analogías para explicar conceptos o procesos. En conclusión: se recomienda el uso del Modelo MODEF para la discusión del tema de Fotosíntesis a base de los resultados cuantitativos y cualitativos de esta investigación. El Comité Institucional para la Protección de los Seres Humanos en la Investigación (CIPSHI) autorizó el estudio.

PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

PubMed

Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

2017-01-24

The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

PubMed Central

Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

2015-01-01

The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and template are possible. PMID:25996930

miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

PubMed Central

Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

2018-01-01

MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

NORD's Patient Assistance Programs

MedlinePlus

... 486-8462 *learn more about this program* *aprender más sobre este programa* Chronic Non-Infectious Uveitis | Closed ... 486-8033 *learn more about this program* *aprender más sobre este programa* Cystinuria | Temporarily at Capacity Co- ...

MethPrimer: designing primers for methylation PCRs.

PubMed

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Foco Nasmyth para el telescopio 2,15mts. de CASLEO

NASA Astrophysics Data System (ADS)

Casagrande, A. R.

En principio, este proyecto intenta lograr el mayor aprovechamiento posible del instrumental que se dispone, buscando la manera de optimizar y hacer más eficiente el servicio que brinda el CASLEO a la comunidad astronómica. El mismo consiste en utilizar dispositivos ya existentes en el telescopio, y darle una utilidad. Tal es el caso del camino óptico destinado al foco Coude. Si tenemos en cuenta que disponemos de un tercer espejo Coude, con todos sus mecanismos automatizados, (actualmente sin uso), una distancia apropiada del plano focal, el espacio y el lugar físico necesario para instalar un periférico, es posible la habilitación de un foco Nasmyth en el telescopio 2,15mts. El hecho de contar con este nuevo foco, redundará en importantes beneficios. En primer lugar, posibilitará la observación, casi simultánea, con dos instrumentos. Otro aspecto a tener en cuenta, es que disminuirá el frecuente cambio del instrumental periférico, motivo este que degrada su ideal puesta a punto. Por último, también de interés, es de destacar su escaso costo de ejecución.

PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

PubMed Central

O’Halloran, Damien M.

2016-01-01

Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

PubMed Central

Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

2012-01-01

We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

El círculo meridiano automático de San Fernando - San Juan. Sus primeros pasos en el hemisferio sur

NASA Astrophysics Data System (ADS)

Mallamaci, C. C.; Muiños, J. L.; Gallego, M.; Pérez, J. A.; Marmolejo, L.; Navarro, J. L.; Sedeño, J.; Vallejos, M.; Belizón, F.

Se informa sobre el estado actual del Círculo Meridiano Automático de San Fernando-San Juan. El instrumento (Grubb-Parson, de 178mm de abertura y 2665 mm de distancia focal) es gemelo del que se encuentra en las Islas Canarias, y fue instalado durante los meses de julio y agosto de 1996 en la estación astronómica ``Dr. C.U.Cesco" (El Leoncito, Barreal), a unos 200 km de distancia de la ciudad de San Juan, merced a un Convenio de Cooperación Científica, firmado en 1994 entre el ROA (España) y el OAFA (Argentina). En la actualidad se está llevando a cabo un programa de prueba cuyos resultados preliminares muestran que el telescopio está en buenas condiciones para observar estrellas de hasta magnitud aproximada 14.5, con buenos errores de observación (<0.12" en ascensión recta y declinación).

Simulação de ejeções de massa coronal

NASA Astrophysics Data System (ADS)

Corsini, M. A.; Silva, A. V. R.

2003-08-01

Ejeções de massa coronal (EMC) são bolhas gigantes de gás permeadas por campos magnéticos que são ejetadas do Sol durante um período de várias horas. Caso estas ejeções atinjam a Terra, geralmente, causam uma série de distúrbios às comunicações de longa distância e navegação, além de danos a satélites e transformadores. Portanto, é desejável que sejamos capazes de prever quando estas ejeções atingirão a Terra. Para tanto, é necessário um bom entendimento dos mecanismos causadores das ejeções e, principalmente, de como se dá a propagação das EMC e sua interação com o vento solar que permeia o meio interplanetário. Nesse sentido foi desenvolvido um programa computacional para resolver as equações MHD (Magneto-Hidro-Dinâmica) que regem a evolução das EMC. Primeiramente foram estabelecidas as condições necessárias para descrever o vento solar, no estado estacionário, que permeia todo o meio interplanetário. Num primeiro momento, resolveu-se o sistema de equações para o caso do vento isotérmico, conhecida como a solução de Parker, a fim de testarmos o modelo. Então, foi considerado o caso do vento solar com temperatura variável no meio interplanetário. Este resultado foi utilizado como a base de nosso sistema em seu instante inicial. Posteriormente foram feitas as considerações necessárias para descrever a propagação da Ejeção de Massa Coronal. As EMC foram simuladas como um aumento de densidade e temperatura local na coroa solar. A órbita e a posição da Terra foram incluídas no sistema. Os dados gerados possibilitaram uma análise da evolução da EMC pelo meio interplanetário até encontrar-se com a Terra. Os perfis de densidade e temperatura a 1 Unidade Astronômica são comparados com os dados de satélites reportados na literatura.

Código para imageamento indireto de estrelas em sistemas binarios: simulação de variações elipsoidais e do perfil das linhas

NASA Astrophysics Data System (ADS)

Souza, T. R.; Baptista, R.

2003-08-01

As estrelas secundárias em variáveis cataclí smicas (VCs) e binárias-x de baixa massa (BXBMs) são cruciais para o entendimento da origem, evolução e comportamento destas binárias interagentes. Elas são estrelas magneticamente ativas submetidas a condições ambientais extremas [e.g., estão muito próximas de uma fonte quente e irradiante; têm rotação extremamente rápida e forma distorcida; estão perdendo massa a taxas de 10-8-10-10 M¤/ano] que contribuem para que suas propriedades sejam distintas das de estrelas de mesma massa na seqüência principal. Por outro lado, o padrão de irradiação na face da secundária fornece informação sobre a geometria das estruturas de acréscimo em torno da estrela primária. Assim, a obtenção de imagens da superfície destas estrelas é de grande interesse astrofísico. A Tomografia Roche usa as variações no perfil das linhas de emissão/absorção da estrela secundária em função da fase orbital para mapear a distribuição de brilho em sua superfície. Neste trabalho apresentamos os resultados iniciais do desenvolvimento de um programa para o mapeamento da distribuição de brilho na superfí cie das estrelas secundárias em VCs e BXBMs com técnicas de astro-tomografia. Presentemente temos em operação um código que simula as variações no perfil das linhas em conseqüência de efeito Doppler resultante da combinação de rotação e translação de uma estrela em forma de lobo de Roche em torno do centro de massa da binária, em função da distribuição de brilho na superfície desta estrela. O código igualmente produz a curva de luz resultante das variações de aspecto da estrela em função da fase orbital (variações elipsoidais).

Concepciones y concepciones alternativas de estudiantes universitarios/as de biologia y futuros maestros/as de Ciencia de escuela secundaria sobre la teoria de evolucion biologica por seleccion natural

NASA Astrophysics Data System (ADS)

Morales Ramos, Egda M.

La teoria de evolucion biologica (TEB) por seleccion natural es uno de los conceptos unificadores mas importantes del curriculo de Biologia. En Puerto Rico se han hecho pocas investigaciones que abunden sobre las concepciones y concepciones alternativas (CA) que tienen los estudiantes universitarios/as de Biologia y los maestros/as de Ciencia del nivel secundario sobre esta teoria. La politica publica educativa actual establece mediante documentos normativos como los Estandares de contenido y Expectativas de grado del Programa de Ciencias [Puerto Rico Core Standards] la ensenanza de esta teoria. Sin embargo, no se encontraron preguntas sobre la seleccion natural en los ejercicios de practica provistos por el Departamento de Educacion para las pruebas estandarizadas lo cual puede influir para que no se ensene adecuadamente. Las preguntas de investigacion fueron 1. ¿Cuales son las concepciones y concepciones alternativas de estudiantes universitarios/as y de los futuros maestros y maestras de Ciencia sobre la TEB? 2. ¿Cuales conceptos que seleccionan los estudiantes universitarios/as y los futuros maestros y maestras de Ciencia sobre la TEB coinciden con lo aceptado como valido por la comunidad cientifica? y 3. ¿Como comparan las respuestas de la prueba original. v. Entendiendo el cambio biologico que mide concepciones y CA sobre la TEB por seleccion natural, con las de la traducida al idioma espanol? Se utilizo el metodo cuantitativo con un diseno de investigacion transversal por encuesta. La tecnica principal para recopilar los datos fue una prueba con doce items, que formo parte de un instrumento para el cual se recopilaron diversas fuentes de evidencia acerca de su validez. Las muestras estuvieron formadas por 69 estudiantes de Ciencias Naturales y por 16 estudiantes futuros maestros y maestras del nivel secundario de la UPR-RP. Se utilizaron estadisticas descriptivas, analisis de Ji cuadrado y se calcularon los coeficientes alfa de Cronbach y de Spearman. Estos demostraron que la prueba es confiable para medir las concepciones y CA de la TEB por seleccion natural. Aunque los estudiantes escogieron conceptos relacionados con esta teoria, mantienen en sus procesos de razonamiento CA sobre la seleccion natural que no se limitan a la lamarckiana y a la teleologica.

Detecção inesperada de efeitos de lentes fracas em grupos de galáxias pouco luminosos em raios-X

NASA Astrophysics Data System (ADS)

Carrasco, R.; Mendes de Oliveira, C.; Sodré, L., Jr.; Lima Neto, G. B.; Cypriano, E. S.; Lengruber, L. L.; Cuevas, H.; Ramirez, A.

2003-08-01

Obtivemos, como parte do programa de verificação científica do GMOS Sul, imagens profundas de três grupos de galáxias: G97 e G102 (z~0,4) e G124 (z = 0,17). Esses alvos foram selecionados a partir do catálogo de fontes extensas de Vikhlinin (1998), por terem luminosidades em raios X menores que 3´1043 ergs s-1, valor cerca de uma ou duas ordens de grandeza inferior ao de aglomerados de galáxias. O objetivo primário dessas observações é o estudo da evolução de galáxias em grupos. Grupos são ambientes menos densos que aglomerados, contêm a grande maioria das galáxias do Universo mas que, até o momento, foram estudados detalhadamente apenas no Universo local (z~0). Com esses dados efetuamos uma análise estatística da distorção na forma das galáxias de fundo (lentes gravitacionais fracas) como forma de inferir o conteúdo e a distribuição de massa nesses grupos apesar de que, em princípio, esse efeito não deveria ser detectado uma vez que os critérios de seleção adotados previlegiam sistemas de baixa massa. De fato, para G124 obtivemos apenas um limite superior para sua massa que é compatível com sua luminosidade em raios X. De modo contrário e surpreendente, os objetos G102 e G097, aparentam ter massas que resultariam em dispersões de velocidade maiores que 1000 km s-1, muito maiores do que se espera para grupos de galáxias. Com efeito, para G097 obtivemos, a partir de dados do satélite XMM, uma estimativa para a temperatura do gás intragrupo de kT = 2,6 keV, que é tipica de sistemas com dispersões de velocidade de ~ 600 km s-1, bem característica de grupos. Essas contradições aparentes entre lentes fracas e raios X podem ser explicadas de dois modos: i) a massa obtida por lentes estaria sobreestimada devido à superposição de estruturas massivas ao longo da linha de visada ou ii) a temperatura do gás do meio intra-grupo reflete o potencial gravitacional de estruturas menores que estariam se fundindo para formar uma estrutura maior.

A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

PubMed Central

Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

2016-01-01

Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

PubMed

Pauthenier, Cyrille; Faulon, Jean-Loup

2014-07-01

PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Design of primers and probes for quantitative real-time PCR methods.

PubMed

Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

2015-01-01

Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

Innovation in nursing health care practice: expansion of access in primary health care.

PubMed

Lowen, Ingrid Margareth Voth; Peres, Aida Maris; Ros, Carla da; Poli, Paulo; Faoro, Nilza Teresinha

2017-01-01

analyze the reorganization of the health care practice of nurses as an innovative strategy for expansion of access in primary care. qualitative and quantitative study, which interviewed 32 management and care nurses and collected documentary data from public reports of production of nursing consultations from 2010 to 2014, in a municipality in southern Brazil. Data processing for textual analysis was performed by IRAMUTEQ software; for simple descriptive statistical analysis, the program Excel 2013 was used. in the innovative care practice  class, associated with awareness of change, related to implementation of the FHS, its challenges and advantages, the following subclasses were identified: reorganization of schedules, nursing consultation, physical restructuring of BHUs, and shared consultation. the need to expand access to and valorization of care practice encourages the development of innovative strategies. The protagonism of care needs to be discussed in the various spaces so that each professional carry out the respective role with competence and efficacy. analisar a reorganização da prática assistencial do enfermeiro como estratégia inovadora para ampliação do acesso na atenção primária. estudo qualiquantitativo, tendo sido entrevistados 32 enfermeiros gerenciais e assistenciais e coletados dados documentais de relatórios públicos de produção de consultas dos enfermeiros de 2010 a 2014, num município sul-brasileiro. O processamento dos dados para análise textual foi realizado pelo software IRAMUTEQ; para análise estatística descritiva simples, o programa Excel 2013. na classe prática assistencial inovadora, associada à sensibilização para a mudança, relacionada à implantação da ESF, seus desafios e fortalezas, foram identificadas as subclasses: reorganização das agendas, consulta do enfermeiro, reestruturação física das UBS e consulta compartilhada. a necessidade de ampliar o acesso e valorização da prática assistencial incentiva o desenvolvimento de estratégias inovadoras. O protagonismo do cuidado precisa ser discutido nos diversos espaços a fim de que cada profissional desempenhe seu papel com competência e resolutividade.

Estimativa de imagens solares soho através de redes neurais artificiais

NASA Astrophysics Data System (ADS)

Andrade, M. C.; Fernandes, F. C. R.; Cecatto, J. R.; Rios Neto, A.; Rosa, R. R.; Sawant, H. S.

2003-08-01

A Rede Neural Artificial (RNA), no âmbito da teoria computacional, constitui uma teoria emergente que, por possuir habilidade em aprender a partir de dados de entrada, encontra diferentes aplicações em diferentes áreas. Um exemplo é a utilização de RNA na caracterização de padrões associados à dinâmica de processos espaço-temporais relacionados a fenômenos físicos não-lineares. Para obter informações sobre o comportamento destes fenômenos físicos utiliza-se, em diversos casos, seqüências de imagens digitalizadas, onde a caracterização de alguns fenômenos espaço-temporais é o procedimento mais viável para descrever a dinâmica das regiões ativas do Sol. Com base em imagens observadas por telescópios a bordo de satélites, estudos de previsão de eventos solares podem ser programados, permitindo prever possíveis efeitos posteriores nas regiões mais próximas da Terra (tempestades geomagnéticas e irregularidades ionosféricas). Neste trabalho avaliamos o desempenho da RNA para estimar padrões espaço-temporais, ou seja, imagens solares em ultravioleta, obtidas através do telescópio a bordo do satélite SOHO. Os resultados mostraram que as RNA conseguem generalizar os padrões de maneira satisfatória sem perder de forma significativa os principais aspectos da configuração global da atmosfera solar, comprovando a eficácia da RNA como ferramenta para esse tipo de aplicação. Portanto, este trabalho comprova a viabilidade de uso desta ferramenta em projetos voltados ao estudo do comportamento solar, em trabalhos do grupo de Física do Meio Interplanetário (FMI) na DAS e em programas desenvolvidos pelo Núcleo de Simulação e Análise de Sistemas Complexos (NUSASC) do Laboratório Associado de Computação e Matemática Aplicada (LAC) do INPE.

SURGERY AND CARDIOVASCULAR SURGERY JOURNALS ANALYSIS.

PubMed

Schanaider, Alberto

2015-01-01

To analyze critically the effectiveness and value of bibliometric indicators in journals of Surgery or Cardiovacular Surgery in the context of the postgraduate programs of CAPES Medicine III. A sampling with 16 academic programs and one professional master of Medicine III, encompassing the General and Digestive System Surgery, Cardiovascular Surgery and Multidisciplinary courses with such contents, was evaluated. Thomson Reuters/ISI (JCR), Elsevier/Scopus (SJR), and also Scielo databases were used. Only in seven programs, the teachers had an average of Qualis A1 articles greater than the others strata. Eleven journals in the surgical area are in stratum A1 (5%) and it reaches 25% in Cardiovascular Surgery. Among the six journals with the largest number of publications Qualis A1 in area Medicine III, five are from non-specific areas. The Acta Cirúrgica Brasileira represented 58% of the publications in the stratum A2. There are some obstacles in the Qualis classification with little uniformity among the Medicine areas I, II and III. A permanent committee should be set to update the Qualis, composed by the three medical areas. It should be considered using other index databases and the unification of the Qualis criteria for journals in medicine. Rating criteria of multi and transdisciplinary journals need to be reviewed. It is essential an institutional financial support for national journals chosen by peers aiming to provide a full computerization process and a professional reviewer of the English language, in order to increase the impact factor. Analisar criticamente a eficácia e valor de indicadores bibliométricos dos periódicos da Cirurgia e Cirurgia Cardiovascular no contexto dos Programas de Pós-Graduação da área Medicina III da CAPES. Foi avaliada uma amostragem com 16 programas acadêmicos e um mestrado profissional da área de Medicina III, compreendendo a Cirurgia Geral e do Aparelho Digestivo, a Cirurgia Cardiovascular e Cursos Multidisciplinares com estes conteúdos. Utilizaram-se as bases de dados Thomson Reuters/ISI (JCR), Elsevier/Scopus (SJR), além do Scielo. Somente nos programas 7, os docentes têm média de artigos Qualis A1 maior ou igual que os demais estratos. Apenas 11 periódicos da área de Cirurgia estão no estrato A1 (5%) e na Cirurgia Cardiovascular são 25%. Dos seis periódicos com o maior número de publicações na área Medicina III, Qualis A1, cinco não são específicos da área. A Acta Cirúrgica Brasileira representou 58% das publicações no estrato A2. Há alguns óbices na classificação Qualis com pouca uniformidade entre as Medicinas I, II e III. Se impõe a criação de um comitê permanente para atualização do Qualis, composto pelas três áreas da Medicina. Deve-se ponderar a utilização de outras bases de indexação e a unificação dos critérios Qualis para as revistas das áreas de medicina. Critérios de classificação dos periódicos multi e transdisciplinares precisam ser revistos. É imprescindível suporte financeiro institucional aos periódicos nacionais escolhidos pelos pares visando informatização completa e prover revisão profissional da língua inglesa, tendo como meta a elevação do fator de impacto.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

PubMed

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

PubMed

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Mirror Coronograph for Argentina (MICA). Primera Luz

NASA Astrophysics Data System (ADS)

Stenborg, G.; Epple, A.; Schwenn, R.; Francile, C.; Rovira, M.

En Julio de 1997 se terminó con la primera parte de la instalación del ``Coronógrafo de Espejo para la Argentina'' en la estación de altura Carlos U. Cesco (El Leoncito), gracias al esfuerzo de la gente del Max Planck Institut für Aeronomie (Alemania), del OAFA y del IAFE. Dicho coronógrafo forma parte de un programa de ciencia bilateral entre Alemania y Argentina. El propósito del mismo, en conjunción con otros telescopios solares y terrestres, es contribuir a un mejor entendimiento de cuestiones fundamentales de la física solar. Para ello, ya está observando la corona de emisión en el verde (Fe XIV), rojo (Fe X) y Hα entre 1.05 y 2 radios solares aproximadamente. El diseño del instrumento, el cual fuera ya presentado en esta misma reunión en La Plata en 1996, es esencialmente similar al del telescopio LASCO-C1 a bordo del Solar Heliospheric Observatory (SOHO). La adquisición de datos se realiza con un CCD de 1280x1024 pixels, codificando en 12 bits, pudiendo ser el mismo operado en forma remota. En esta reunión presentaremos algunas de las observaciones realizadas durante la puesta a punto del instrumento en el período julio-setiembre de 1997. Asimismo expondremos cómo y por qué sus resultados complementarán a los de su par en el espacio.

Observações no âmbito dos "additional programs" do satélite COROT

NASA Astrophysics Data System (ADS)

Janot Pacheco, E.

2003-08-01

O satélite Fraco-europeu COROT fará fotometria de altissima precisão (pretende-se atingir uma parte em um milhão), grande campo (3x3 graus) e por longos períodos, de duas regiões pré-determinadas do céu, com 10 graus de raio. Suas finalidades básicas serão estudos em sismologia estelar e a procura de exoplanetas. A comunidade astronômica brasileira participará dessa missão espacial, com direitos iguais aos dos parceiros europeus. Isso se deve a que o satélite utilizará a estação de recepção de dados de Natal (INPE), 5 a 6 brasileiros participarão das equipes de software e cientistas do país atuarão na fase de pré-lançamento. Apresentamos nesta comunicação sugestões para a preparação de propostas de observações com COROT, no âmbito dos Programas Adicionais, que contemplam outros projetos que não de sismologia ou exoplanetas. As últimas definições técnicas e decisões tomadas na 4th Corot Week de junho último serão igualmente apresentadas, em particular quanto às regiões de observação escolhidas e quanto aos procedimentos a seguir para se propor observações.

Weathering resistance of thin plasma polymer films on pre-coated steel =

NASA Astrophysics Data System (ADS)

Serra, Ricardo Gil Henriques

O trabalho apresentado teve origem no projecto de investigacao “Tailored Thin Plasma Polymers Films for Surface Engineering of Coil Coated Steel”, financiado pelo Programa Europeu ECSC Steel Research. Sistemas de aco galvanizado pre-pintado em banda a base de poliester e poliuretano foram submetidos a um processo de polimerizacao por plasma onde um filme fino foi depositado de modo a modificar as propriedades de superficie. Foram usados reactores de catodo oco, microondas e radio frequencia para a deposicao do polimero fino. Os sistemas preparados foram analisados de modo a verificar a influencia do processo de polimerizacao por plasma na alteracao das propriedades barreira dos sistemas pre-pintados em banda. Foi estudado o efeito dos diferentes passos do processo de polimerizacao por plasma, bem como o efeito de diferentes variaveis operatorias. A mistura precursora foi variada de modo a modificar as propriedades da superficie de modo a poder vir a obter maior hidrofobicidade, maior resistencia a marcas digitais, bem como maior facilidade de limpeza. Os testes foram conduzidos em solucao de NaCl 0,5 M. Para o trabalho foram usadas tecnicas de analise da morfologia da superficie como Microscopia de Forca Atomica e Microscopia Electronica de Varrimento. As propriedades electroquimicas dos sistemas foram estudadas por Espectroscopia de Impedancia Electroquimica. A estrutura dos filmes gerados no processo de polimerizacao por plasma foi caracterizada por Microscopia de Transmissao Electronica. A modificacao das propriedades opticas devido ao processo de polimerizacao por plasma foi tambem obtida.

Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

PubMed Central

Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

2014-01-01

Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.

PubMed

Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya

2012-01-01

This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.

Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

PubMed Central

Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

2013-01-01

We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

Sex Stereotyping in Mexican Reading Primers.

ERIC Educational Resources Information Center

Heathcote, Olivia

A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

PubMed

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Stages of change of behavior in women on a multi-professional program for treatment of obesity.

PubMed

Bevilaqua, Cheila Aparecida; Pelloso, Sandra Marisa; Marcon, Sonia Silva

2016-10-10

to ascertain the effectiveness of an intervention program in relation to anthropometric measurements and stage of readiness for behavioral change in women with excess weight. the intervention group (IG) was made up of 13 women, and the control group (CG), by 20. The intervention lasted 16 weeks, and included the practice of guided physical activity three times a week, and health education once a week. The application of the questionnaire on stage of readiness for behavioral change, and the anthropometric evaluations, were undertaken at two points - before and after the period of intervention. The statistical analysis involved tests of comparison and association. in general, at the first point, the participants in the two groups were predisposed to make changes in what they ate and in their physical activity. However, significant difference was only observed in relation to weight, body mass index (BMI), waist circumference and waist-hip ratio and readiness for change among the members of the intervention group. the intervention programmed was effective in weight loss, reduction of waist circumference and waist-hip ratio, and in changing behaviors related to the practicing of physical exercise and eating habits. verificar a efetividade de um programa de intervenção sobre medidas antropométricas e o estágio de prontidão para mudança de comportamento em mulheres com excesso de peso. o grupo intervenção (GI) foi constituído por 13 mulheres e o grupo controle por 20. A intervenção teve duração de 16 semanas e incluiu prática de atividade física orientada três vezes na semana e educação em saúde uma vez na semana. A aplicação do questionário de estágio de prontidão para mudança de comportamento e as avaliações antropométricas foram realizadas em dois momentos, antes e após o período de intervenção. A análise estatística envolveu testes de comparação e associação. em geral, no momento inicial, as participantes dos dois grupos estavam pré dispostas a realizarem mudanças na alimentação e na atividade física. No entanto, só foi observada diferença significativa em relação ao peso, índice de massa corporal (IMC), circunferência da cintura e relação cintura-quadril e prontidão para mudança entre as integrantes do grupo intervenção. a intervenção programada foi efetiva na perda de peso, diminuição da circunferência da cintura e relação cintura-quadril e na mudança de comportamentos relacionados à prática de exercícios físicos e alimentar. verificar la efectividad de un programa de intervención sobre medidas antropométricas y de la fase de preparación para cambio de comportamiento, en mujeres con exceso de peso. el grupo intervención (GI) estuvo constituido por 13 mujeres y el grupo control por 20. La intervención tuvo duración de 16 semanas e incluyó práctica orientada de actividad física tres veces en la semana y educación en salud una vez por semana. La aplicación del cuestionario de fase de preparación para cambio de comportamiento y para las evaluaciones antropométricas fueron realizadas en dos momentos, antes y después del período de intervención. El análisis estadístico se realizó con pruebas de comparación y asociación. en general, en el momento inicial, las participantes de los dos grupos estaban predispuestas a realizar cambios en la alimentación y en la actividad física. Sin embargo, solamente entre las integrantes del grupo intervención fue observada diferencia significativa en relación: al peso; al índice de masa corporal (IMC); a la circunferencia de la cintura y relación cintura-cadera; y, a la preparación para el cambio. la intervención programada fue efectiva en: pérdida de peso, disminución de la circunferencia de la cintura y relación cintura-cadera, y en el cambio de comportamiento relacionado a la práctica de ejercicios físicos y de alimentación.

Assessment and management of pain in newborns hospitalized in a Neonatal Intensive Care Unit: a cross-sectional study.

PubMed

Sposito, Natália Pinheiro Braga; Rossato, Lisabelle Mariano; Bueno, Mariana; Kimura, Amélia Fumiko; Costa, Taine; Guedes, Danila Maria Batista

2017-09-12

to determine the frequency of pain, to verify the measures adopted for pain relief during the first seven days of hospitalization in the Neonatal Intensive Care Unit and to identify the type and frequency of invasive procedures to which newborns are submitted. cross-sectional retrospective study. Out of the 188 hospitalizations occurred during the 12-month period, 171 were included in the study. The data were collected from the charts and the presence of pain was analyzed based on the Neonatal Infant Pain Scale and on nursing notes suggestions of pain. For statistical analysis, the Statistical Package for the Social Sciences was used, and the significance level was set at 5%. there was at least one record of pain in 50.3% of the hospitalizations, according to the pain scale adopted or nursing note. The newborns underwent a mean of 6.6 invasive procedures per day. Only 32.5% of the pain records resulted in the adoption of pharmacological or non-pharmacological intervention for pain relief. newborns are frequently exposed to pain and the low frequency of pharmacological or non-pharmacological interventions reinforces the undertreatment of this condition. determinar a frequência de dor e verificar as medidas realizadas para seu alívio durante os sete primeiros dias de internação na Unidade de Terapia Intensiva Neonatal, bem como identificar o tipo e frequência de procedimentos invasivos aos quais os recém-nascidos foram submetidos. estudo retrospectivo transversal. Das 188 internações ocorridas no período estipulado de 12 meses, 171 foram incluídas na pesquisa. Os dados foram coletados a partir dos prontuários e a presença de dor foi analisada tanto com base na escala de dor Neonatal Infant Pain Scale quanto mediante anotação de enfermagem sugestiva de dor. Para análise estatística, utilizou-se o programa Statistical Package for the Social Sciences, adotando-se nível de significância de 5%. em 50,3% das internações houve ao menos um registro de dor, conforme escala de dor adotada ou anotação de enfermagem. Os recém-nascidos foram submetidos à média de 6,6 procedimentos invasivos por dia. Apenas 32,5% dos registros de dor resultaram na adoção de condutas farmacológicas ou não farmacológicas para seu alívio. observa-se que os recém-nascidos são frequentemente expostos à dor e a baixa frequência de intervenções farmacológicas ou não farmacológicas reforça o subtratamento dessa condição. determinar la frecuencia del dolor, comprobar las medidas tomadas para su alivio durante los siete primeros días de internación en una Unidad de Terapia Intensiva Neonatal e identificar el tipo de procedimientos invasivos y la frecuencia a que se sometieron los recién nacidos. estudio retrospectivo transversal. De las 188 internaciones realizadas en el período estipulado de 12 meses, se incluyeron 171 en la investigación. Los datos se recolectaron a partir de los prontuarios; la presencia de dolor se analizó según la Escala de Valorización del Dolor en el Neonato (Neonatal Infant Pain Scale) y las notas de enfermería sobre el dolor. Para el análisis estadístico, se utilizó el programa 'Paquete estadístico para las ciencias sociales' (Statistical Package for the Social Sciences), adoptándose el nivel de significación del 5%. en el 50,3% de las internaciones hubo al menos un registro de dolor, según la escala de dolor adoptada o las notas de la enfermería. Se sometió a los recién nacidos a un promedio de 6,6 procedimientos invasivos por día. Sólo el 32,5% de los registros de dolor resultaron en la adopción de conductas farmacológicas o no farmacológicas para su alivio. se observa que los recién nacidos a menudo están expuestos al dolor, y la frecuencia baja de intervenciones farmacológicas o de las no farmacológicas refuerza el subtratamiento de dicha condición.

PRISE2: software for designing sequence-selective PCR primers and probes.

PubMed

Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

2014-09-25

PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

Sistemas de transporte inteligentes en cruces fronterizos internacionales : un estudio abarcador : facilitando el comercio y mejorando la seguridad en el transporte

DOT National Transportation Integrated Search

2001-04-01

El Programa de Permisosen Fronteras Internacionales (IBC por sus siglas en ingls) fue iniciado bajo la previsin del Acta de Eficiencia de Transporte Terrestre Intermodal (ISTEA por sus siglas en ingls) en 1991. El programa fue concebido origina...

Programa De Educacion Interamericana.

ERIC Educational Resources Information Center

Texas A and M Univ., College Station.

PROGRAMA DE EDUCACION INTERAMERICANA is a project of Texas A&M University in liaison with the Bryan Independent School District. The objectives of the program are to improve the knowledge and understanding of Texas teachers and students about other American cultures. Study teams of educators research and, in midsummer, travel to selected…

Social determinants of leprosy in a hyperendemic State in North Brazil.

PubMed

Monteiro, Lorena Dias; Mota, Rosa Maria Salani; Martins-Melo, Francisco Rogerlândio; Alencar, Carlos Henrique; Heukelbach, Jorg

2017-07-20

To identify the socioeconomic, demographic, operational, and health service-related factors associated with the occurrence of leprosy in a hyperendemic State in North Brazil. This is an ecological study based on secondary data from the Sistema de Informações de Agravos de Notificação in municipalities of the State of Tocantins from 2001 to 2012. Units of analysis were the 139 municipalities of the State. Negative binomial log linear regression models were used to estimate incidence rate ratios. In bivariate analysis, the incidence rate ratios were significantly higher for municipalities with higher income ratio of the poorest 20.0% (1.47; 95%CI 1.19-1.81) and better Municipal Human Development Index (1.53; 95%CI 1.14-2.06). In multivariate analysis, the incidence rate ratios were significantly higher in municipalities with higher proportion of immigrants (1.31; 95%CI 1.11-1.55) and higher proportion of households with waste collection (1.37; 95%CI 1.11-1.69). There was a significant reduction in the incidence rate ratio with increased coverage of the Bolsa Família Program (0.98; 95%CI 0.96-0.99). Control programs need to focus on activities in municipalities of greater social vulnerability with intersectoral investment for the improvement of the living conditions of the population. Identificar fatores socioeconômicos, demográficos, operacionais e de serviços de saúde associados à ocorrência da hanseníase em um estado hiperendêmico do norte do Brasil. Estudo ecológico com dados secundários do Sistema de Informações de Agravos de Notificação em municípios do estado do Tocantins de 2001 a 2012. As unidades de análise foram os 139 municípios do estado. Modelos de regressão log linear binomial negativa foram utilizados para estimar as razões de taxas de incidência. Na análise bivariada, a razão de taxa de incidência foi significativamente maior para os municípios com maior razão de renda dos 20,0% mais pobres (1,47; IC95% 1,19-1,81) e melhor Índice de Desenvolvimento Humano Municipal (1,53; IC95% 1,14-2,06). Na múltipla, a razão de taxa de incidência foi significativamente superior em municípios com maior concentração de imigrantes (1,31; IC95% 1,11-1,55) e proporção de domicílios com coleta de lixo (1,37; IC95% 1,11-1,69). Houve redução significativa da razão de taxa de incidência com o aumento da cobertura do programa bolsa família (0,98; IC95% 0,96-0,99). Os programas de controle precisam focar as atividades em municípios de maior vulnerabilidade social com investimentos intersetoriais para a melhoria das condições de vida da população.

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

PubMed

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

PubMed Central

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-01-01

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

[Not Available].

PubMed

Giner, Manel; Culebras, Jesús M; Meguid, Michael M

2016-03-01

En agosto de 1976, un joven llamado LeRoy cayó desde una cornisa fracturándose el fémur. Se sospechó una hemorragia interna importante. Durante una laparotomía se comprobó que todos los órganos internos estaban intactos y los cirujanos ortopédicos arreglaron la fractura. Treintadías después, LeRoy murió. Había comido poco; diariamente, tan solo había recibido tres litros de la glucosa, el equivalente a 510 calorías, por vía intravenosa. La glucosa fue insuficiente para satisfacer sus necesidades nutricionales, perdiendo más del 20% de su peso corporaldurante su estancia en el hospital. La causa de la muerte se debió a "desnutrición médicamente inducida". Mientras tanto, un artículo científico documentó que la prevalencia de desnutrición en los hospitales de Boston era del 44% y que la desnutrición en sí era un predictor de altas tasas de complicaciones y muerte.Como resultado, los médicos sensibilizados formaron una sociedad que creó programas de formación y alentó la formación de equipos de nutrición en los hospitales. La industria comercializó fórmulas de nutrición y catéteres. Las complicaciones en enfermos hospitalizados cayeron en picado, mientras que las tasas de supervivencia aumentaron. California aprobó una legislación para regular el soporte nutricional. Aunque la industria de la atención sanitaria reconoce la importancia de la nutrición en los cuidados al paciente, el Congreso no proporcionó apoyo fiscal para los equipos de nutrición. Como resultado, los hospitales disolvieron sus equipos de nutrición de reciente creación. La educación y las habilidades en nutrición disminuyeron, y las complicaciones hospitalarias y las tasas de mortalidad aumentaron de nuevo.

Implementacion de modulos constructivistas que atiendan "misconceptions" y lagunas conceptuales en temas de la fisica en estudiantes universitarios

NASA Astrophysics Data System (ADS)

Santacruz Sarmiento, Neida M.

Este estudio se enfoco en los "misconception" y lagunas conceptuales en temas fundamentales de Fisica como son Equilibrio Termodinamico y Estatica de fluidos. En primer lugar se trabajo con la identificacion de "misconceptions" y lagunas conceptuales y se analizo en detalle la forma en que los estudiantes construyen sus propias teorias de fenomenos relacionados con los temas. Debido a la complejidad en la que los estudiantes asimilan los conceptos fisicos, se utilizo el metodo de investigacion mixto de tipo secuencial explicativo en dos etapas, una cuantitativa y otra cualitativa. La primera etapa comprendio cuatro fases: (1) Aplicacion de una prueba diagnostica para identificar el conocimiento previo y lagunas conceptuales. (2) Identificacion de "misconceptions" y lagunas del concepto a partir del conocimiento previo. (3) Implementacion de la intervencion por medio de modulos en el topico de Equilibrio Termodinamico y Estatica de Fluidos. (4) Y la realizacion de la pos prueba para analizar el impacto y la efectividad de la intervencion constructivista. En la segunda etapa se utilizo el metodo de investigacion cualitativo, por medio de una entrevista semiestructurada que partio de la elaboracion de un mapa conceptual y se finalizo con un analisis de datos conjuntamente. El desarrollo de este estudio permitio encontrar "misconceptions" y lagunas conceptuales a partir del conocimiento previo de los estudiantes participantes en los temas trabajados, que fueron atendidos en el desarrollo de las distintas actividades inquisitivas que se presentaron en el modulo constructivista. Se encontro marcadas diferencias entre la pre y pos prueba en los temas, esto se debio al requerimiento de habilidades abstractas para el tema de Estatica de Fluidos y al desarrollo intuitivo para el tema de Equilibrio Termodinamico, teniendo mejores respuestas en el segundo. Los participantes demostraron una marcada evolucion y/o cambio en sus estructuras de pensamiento, las pruebas estadisticas de t-pareada fueron significativas para ambos modulos a pesar que en la pos prueba no todos llegaron a la respuesta correcta. El analisis cualitativo de las respuestas de los participantes confirmo la dificultad de remover "misconception" y lagunas conceptuales.

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

PubMed Central

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

2006-01-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

PubMed

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

2006-07-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

PubMed Central

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

Code of Federal Regulations, 2011 CFR

2011-07-01

... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...

40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

Code of Federal Regulations, 2010 CFR

2010-07-01

... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...

Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

PubMed Central

Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

2005-01-01

Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

Adaptación al español y validación de criterio de una escala para la tamización de problemas emocionales y del comportamiento en la primera infancia.

PubMed

Cano, Luz Helena; Acosta, María Natalia; Pulido, Adriana

2018-05-01

Introducción. La detección temprana del riesgo de problemas emocionales y del comportamiento en niños puede contribuir al desarrollo de estrategias que promuevan la salud mental desde la primera infancia. En Colombia no existe una herramienta validada para dicha detección.Objetivos. Seleccionar, adaptar y establecer la validez de criterio de una escala de tamización de problemas emocionales y del comportamiento en niños menores de seis años.Materiales y métodos. A partir de una revisión de la literatura y un consenso de expertos, se seleccionó la herramienta Early Childhood Screening Assessment (ECSA). Posteriormente, se llevó a cabo su adaptación lingüística y se determinó la validez de criterio mediante una curva de características de recibidor-operador (Receiver Operating Characteristic, ROC), y se la comparó con el cuestionario Child Behavior Checklist (CBCL 1,5-5). En el estudio participaron 206 cuidadores de niños entre el año y medio y los seis años de edad de la ciudad de Tunja y el municipio de Sopó.Resultados. La puntuación del ECSA presentó una buena correlación con la puntuación t total del CBCL 1,5-5 (ro de Spearman=0,75; p<0,01). La escala ECSA tuvo una sensibilidad de 86 % y una especificidad de 82 % al establecer un punto de corte de 24 para la población estudiada.Conclusión. En este primer estudio de adaptación y validación de la versión en español de la escala ECSA, se detectaron buenos valores de sensibilidad y especificidad para la tamización de problemas emocionales y del comportamiento en la primera infancia.

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

PubMed

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system

PubMed Central

2018-01-01

Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-01-01

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

PubMed

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-11-16

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A 22-mer primer enhances discriminatory power of AP-PCR fingerprinting technique in characterization of leptospires.

PubMed

Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C

2004-11-01

To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.

Output testing of small-arms primers

NASA Technical Reports Server (NTRS)

Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.

1991-01-01

The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

PubMed

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Value for money assessment for public-private partnerships : a primer.

DOT National Transportation Integrated Search

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of primers.

Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

PubMed Central

Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

1996-01-01

In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

PubMed Central

2013-01-01

Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

Research on large area VUV-sensitive gaseous photomultipliers for cryogenic applications

NASA Astrophysics Data System (ADS)

Coimbra, Artur Emanuel Cardoso

Desde cedo que a comunidade cientifica compreendeu que gases nobres em liquido sao excelentes meios de deteccao de radiacao, combinando a sua elevada densidade, elevado grau de homogeneidade e de elevado rendimento de cintilacao. Para alem destas caracteristicas inerentes, estes tem a potencialidade de fornecer ambos sinais de ionizacao - criando electroes livres - e cintilacao em resposta a interaccao com radiacao ionizante e, tendo em vista a sua aplicacao em experiencias de eventos raros relacionados com fisica de neutrinos ou materia-escura, a capacidade de autoblindagem garante a exclusao de eventos induzidos por radiacao de fundo. O facto de nao absorverem a sua propria luz, emergente dos eventos de cintilacao, permite a expansao deste tipo de detectores ate grandes volumes, sendo que as colaboracoes mais recentes propoem detectores com dezenas de toneladas de xenon em estado liquido. As experiencias actuais que usam gases nobres em estado liquido empregam xenon ou argon numa so fase (estado liquido) ou em dupla-fase (estado liquido + gasoso) e as suas aplicacoes abrangem desde as ja referidas experiencias de procura de eventos raros, passando por imagiologia medica tais como detectores de radiacao gama para PET ou câmaras Compton "3-gamma" em combinacao com PET, passando tambem por aplicacoes de seguranca como sistemas de inspeccao para deteccao de material fissil e, finalmente, em câmaras Compton para aplicacoes de astrofisica. Em ambas as configuracoes a leitura dos sinais de cintilacao e geralmente feita atraves de um grande numero de dispendiosos fotomultiplicadores de vacuo agrupados. A presente tese de doutoramento e dedicada aos fotomultiplicadores gasosos de grande area para aplicacoes criogenicas desenvolvidos no contexto do programa doutoral, tendo em vista a sua eventual aplicacao como um dispositivo complementar aos metodos existentes de deteccao de cintilacao, para aplicacao em futuras experiencias de grande escala. Esta pesquisa foi direccionada tendo em vista o desenvolvimento de eficientes fotomultiplicadores gasosos de grande area, potencialmente mais economicos por unidade de area, baseados em "Thick Gas-Electron Multipliers" (THGEMs). Combinando fotocatodos de alta eficiencia com multiplicadores gasosos de electroes capazes de atingir elevado ganho em carga obteve-se assim um dispositivo com elevada sensibilidade para a deteccao de fotoes unicos, com a possibilidade de discriminacao em posicao com resolucao espacial inferior a um milimetro e com resolucao temporal da ordem de poucos nano segundos. Contrariamente ao que sucede com a tecnologia de vacuo actualmente, com este dispositivo a localizacao em posicao de fotoes em grandes areas e feita num unico dispositivo integrando electronica habitualmente utilizada em experiencias de rastreamento de particulas. Neste trabalho o fotomultiplicador gasoso desenvolvido consiste numa cadeia de THGEMs combinados com um fotocatodo de iodeto de cesio (CsI) sensivel ao ultravioleta enquanto que os testes criogenicos foram realizados na Time Projection Chamber (TPC) de dupla fase de xenon liquido recentemente desenvolvida no Weizmann Institute of Science (WILiX). (Abstract shortened by ProQuest.).

Atomic layer deposition of metal oxide by non-aqueous sol-gel chemistry =

NASA Astrophysics Data System (ADS)

Marichy, Catherine

O trabalho apresentado neste manuscrito foi desenvolvido no ambito do programa doutoral intitulado “Deposicao de Camadas Atomicas (ALD) de oxido de metais por sol-gel nao-aquoso”. O objectivo deste trabalho foi a preparacao de hetero-estruturas funcionais por ALD e a sua caracterizacao. Foi desenvolvido um novo processo de deposicao de oxido de estanho a temperatura baixa-moderada, utilizando um metodo ALD nao-aquoso, o qual foi aplicado com sucesso ao revestimento controlado das paredes internas e externas de nanotubos de carbono. Uma vez que a preparacao de nanomateriais funcionais requer uma elevada exatidao do processo de deposicao, foi demonstrada a deposicao precisa de filmes que se adaptem a forma do substrato ou de filmes nano-estruturados constituidos por particulas em varios substratos. Alem disso, foram depositados com grande exatidao varios oxidos de metal em nanotubos de carbono e demonstrou-se a possibilidade de ajustar o revestimento feito por ALD atraves do controlo da funcionalizacao da superficie do substrato nano-estruturado de carbono. As hetero-estruturas obtidas foram posteriormente aplicadas como sensores de gases. O melhoramento verificado na sensibilidade foi atribuido a formacao de heterojuncoes p-n entre o filme de oxido de metais e o suporte. O trabalho desenvolvido tendo como objetivo o controlo do revestimento por ALD atraves da funcionalizacao da superficie do suporte e certamente de interesse para o design de hetero-estruturas funcionais baseadas em substratos de carbono. De facto, durante o ultimo periodo do programa de doutoramento, este conceito foi alargado a funcionalizacao e revestimento com oxidos de metal de fibras de carbono preparadas por “electrospinning”, de forma a melhorar a estabilidade e a atividade eletrocatalitica de catalisadores a base de Pt. Este trabalho foi realizado maioritariamente na Universidade de Aveiro mas tambem na Universidade Nacional de Seul e beneficiou de varias colaboracoes internacionais devido a natureza multidisciplinar da area de investigacao em que esta inserido.

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

PubMed

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-07-08

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Production and quality assurance in the SIT Africa Mediterranean fruit fly (Diptera: Tephritidae) rearing facility in South Africa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnes, B.; Rosenberg, S.; Arnolds, L.

A mass-rearing facility for Mediterranean fruit fly Ceratitis capitata (Wiedemann) was commissioned in Stellenbosch in 1999 to produce sterile male fruit flies for a sterile insect technique (SIT) project in commercial fruit orchards and vineyards in the Western Cape province of South Africa. The mass-rearing procedure was largely based on systems developed by the FAO/IAEA Agriculture and Biotechnology Laboratory, Seibersdorf, Austria. A number of genetic sexing strains were used to produce only males for release. Initial cramped rearing and quality management conditions were alleviated in 2001 with the construction of a new adult rearing room and quality control laboratory. Inmore » 2002 a comprehensive Quality Management System was implemented, and in 2003 an improved genetic sexing strain, VIENNA 8, was supplied by the FAO/IAEA Laboratory in Seibersdorf. For most of the first 3 years the facility was unable to supply the required number of sterile male Mediterranean fruit flies for the SIT program without importing sterile male pupae from another facility. From mid-2002, after the quality management system was implemented, both production and quality improved but remained below optimum. After the introduction of the VIENNA 8 genetic sexing strain, and together with an improvement in the climate control equipment, production stability, and quality assurance parameters improved substantially. The critical factors influencing production and quality were an inadequate rearing infrastructure, problems with the quality of the larval diet, and the initial absence of a quality management system. The results highlight the importance of effective quality management, the value of a stable and productive genetic sexing strain, and the necessity for a sound funding base for the mass-rearing facility. (author) [Spanish] La facilidad para criar en masa la mosca mediterranea de la fruta, Ceratitis capitata (Wiedemann) fue comisionada en Stellenbosch en 1999 para producir machos esteriles de moscas para el proyecto de la tecnica del insecto esteril (TIE) en huertos de frutos y vinas comerciales en la provincia del Cabo Occidental del Sudafrica. El procedimiento de criar en masa fue en su mayor parte basado en los sistemas desarrollados por el Laboratorio de Agricultura y Biotecnologia de la FAO/IAEA, Seibersdorf, Austria. Un numero de razas que separara los sexos geneticamente fueron utilizadas para producir solo machos para la liberacion. La congestionada condicion inicial para criar las moscas y su manejo de calidad fueron aliviadas en 2001 con la construccion de un nuevo cuarto de cria para adultos y un laboratorio de control de calidad. En 2002, un Sistema de Manejo de Calidad comprensivo fue implementado, y en 2003 una raza mejorada que separa los sexos geneticamente, VIENNA 8, fue proveido por el Laboratorio de la FAO/IAEA en Seibersdorf. En la mayor parte de los primeros 3 anos la facilidad no pudo suplir el numero requerido de machos esteriles de la mosca mediterranea de la fruta para el programa de TIE sin la necesidad para importar machos esteriles de otra facilidad. Desde medio del ano de 2002, despues que el sistema de manejo de calidad fue implementado, la produccion y la calidad mejoraron pero aun quedaron por debajo del nivel optimo. Despues de la introduccion de la raza VIENNA 8 que separa los sexos geneticamente, y junto con el equipo mejorado de control de clima, la estabilidad y los parametros de seguridad de calidad mejoraron substancialmente. Los factores criticos que influyeron en la produccion y la calidad fueron la infraestructura inadecuada para criar las moscas, problemas con la calidad de la dieta para las larvas y la ausencia inicial de un sistema de manejo de calidad. Los resultados muestran claramente la importancia de un manejo efectivo de la calidad, el valor de una raza productiva que separa los sexos geneticamente y la necesidad de contar con una base solida de financimiento para la infraestructura de una cria en masa. (author)« less

Microsatellite markers for Vellozia gigantea (Velloziaceae), a narrowly endemic species to the Brazilian campos rupestres.

PubMed

Martins, Ana Paula V; Proite, Karina; Kalapothakis, Evanguedes; Santos, Fabrício R; Chaves, Anderson V; Borba, Eduardo L

2012-07-01

Microsatellite primers were developed for the first time in Velloziaceae, in the endangered species Vellozia gigantea. Using two different protocols, seven primer sets were characterized in three populations of V. gigantea. The primers amplified di- and trinucleotide repeats with six to 12 alleles per locus. These revealed high levels of genetic variation, presenting an average observed heterozygosity of 0.508 in V. gigantea. The seven primers were tested for cross-amplification in three Vellozia species. All primers successfully amplified in V. auriculata. Six primers amplified in V. compacta and three in V. hirsuta. The new marker set described here will be useful for studies of population genetics of V. gigantea. The cross-amplification results indicate the utility of primers for studies in other Vellozia species.

FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

A tool for design of primers for microRNA-specific quantitative RT-qPCR.

PubMed

Busk, Peter K

2014-01-28

MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

URPD: a specific product primer design tool

PubMed Central

2012-01-01

Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

The removal of RNA primers from DNA synthesized by the reverse transcriptase of the retrotransposon Tf1 is stimulated by Tf1 integrase.

PubMed

Herzig, Eytan; Voronin, Nickolay; Hizi, Amnon

2012-06-01

The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process.

The Removal of RNA Primers from DNA Synthesized by the Reverse Transcriptase of the Retrotransposon Tf1 Is Stimulated by Tf1 Integrase

PubMed Central

Herzig, Eytan; Voronin, Nickolay

2012-01-01

The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process. PMID:22491446

URPD: a specific product primer design tool.

PubMed

Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

2012-06-19

Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

Hybrid Materials for Thermal Management in Thin Films and Bulk Composites

DTIC Science & Technology

2012-02-01

enamel  that  cures  via  oxidative...polymerization   in   air  ( Enamel ),  a  waterborne  flat   latex  that  cures  by  coalescing  while  air  drying  (Flat...Wood   Bare   Primer   Primer   +  KPF6     Bare   Primer   Primer   +  KPF6     Bare   Primer   Enamel  

PubMed

Silva, Cristiane Gonçalves da; Santos, Alessandro Oliveira; Licciardi, Daniele Carli; Paiva, Vera; Parker, Richard

2008-01-01

Esse artigo descreve como jovens religiosos e autoridades religiosas de sua comunidade compreendem a sexualidade, considerando suas experiências pessoais e como membros de comunidades religiosas. A análise pretende contribuir para que políticas públicas dedicadas à promoção da saúde sexual da juventude considerem a religiosidade, no contexto de um estado laico e da promoção do direito à prevenção. Foram realizadas 26 entrevistas abertas e semidirigidas em diferentes comunidades da região metropolitana da cidade de São Paulo (comunidades católicas, da umbanda, do candomblé e de diferentes denominações evangélicas) sobre iniciação sexual, casamento, gravidez, contracepção e prevenção das DST/Aids, homossexualidade, aborto e direitos humanos. Observou-se como jovens e autoridades religiosas convivem com a tensão entre tradição e modernidade e os distintos discursos sobre a sexualidade. Como sujeitos religiosos (do discurso religioso) e sujeitos sexuais (de discursos sobre sexualidade), devem ser incorporados pelos programas como sujeitos de direito nos termos de sua religiosidade.

Mapping the Rural Adolescent Girls' Participation in Residential Non-Formal Education Program--A Study in Lunkaransar Block, Rajasthan, India

ERIC Educational Resources Information Center

Sharma, Shilpa

2002-01-01

The present study, "Mapping Rural Adolescent Girl's Participation in Residential Non- Formal Education Program--A Study in Lunkaransar Block, Rajasthan", was an attempt to understand the dimensions of rural adolescent girls' participation in the "Balika Shivir" Program. It is a six month residential non-formal education program…

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

PubMed

Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

2008-08-01

A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

30 CFR 56.6304 - Primer protection.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Antimicrobial and physical characteristics of orthodontic primers containing antimicrobial agents.

PubMed

Chung, Shin-Hye; Cho, Soha; Kim, Kyungsun; Lim, Bum-Soon; Ahn, Sug-Joon

2017-03-01

To compare the antimicrobial and physical properties of experimental primers containing chlorhexidine (CHX) or ursolic acid (UA) with a commercial primer. Two antibacterial agents, 3 mg each of CHX and UA were incorporated respectively into 1 ml of Transbond XT primer (TX) to form antibacterial primers, TX-CHX and TX-UA. The antimicrobial activity of the three primers (TX, TX-CHX, and TX-UA) against Streptococcus mutans in both planktonic and biofilm phases was analyzed by determining minimum inhibitory and bactericidal concentrations and by performing growth and biofilm assays. Growth and biofilm assays were performed in both the absence and presence of thermocycling in a water tank to analyze the effects of water aging on the antimicrobial activities of primers. After bonding brackets onto bovine incisors using the primers, shear bond strength and mode of fracture were analyzed to compare physical properties. TX-CHX had stronger antimicrobial activity against S. mutans in the planktonic and biofilm phases than did TX or TX-UA. When applied, TX-CHX completely inhibited the growth and biofilm formation of S. mutans . In addition, the antimicrobial activity of TX-CHX was maintained after thermocycling. However, TX-UA did not show significant antimicrobial activity compared with TX. There was no significant difference in either shear bond strength or bond failure interface among the primers. Incorporation of CHX into an orthodontic primer may help prevent enamel demineralization around surfaces without compromising its physical properties.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE PAGES

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

2018-03-27

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.

1995-01-01

The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

Limited-life cartridge primers

DOEpatents

Makowiecki, Daniel M.; Rosen, Robert S.

1998-01-01

A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

Limited-life cartridge primers

DOEpatents

Makowiecki, Daniel M.; Rosen, Robert S.

2005-04-19

A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

PubMed

Villard, Pierre; Malausa, Thibaut

2013-07-01

SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

Direct role for the RNA polymerase domain of T7 primase in primer delivery

PubMed Central

Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.

2010-01-01

Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755

Perfil farmacoterapêutico de pacientes obesos no pós-operatório de cirurgia bariátrica

PubMed Central

Kovaleski, Elenara Simoni; Schroeder, Helena; Krause, Mauricio; Dani, Caroline; Bock, Patrícia Martins

2016-01-01

Resumo Contexto A obesidade pode estar relacionada a doenças como diabetes, hipertensão arterial e dislipidemia. A cirurgia bariátrica é um dos tratamentos mais eficazes, levando à diminuição de peso e comorbidades. Objetivo Avaliar o perfil metabólico e farmacoterapêutico de pacientes obesos após cirurgia bariátrica. Métodos Trata-se de um estudo observacional transversal retrospectivo, realizado em um hospital localizado na cidade de Porto Alegre, RS, Brasil. Foram avaliados 70 prontuários de pacientes que realizaram cirurgia bariátrica, nos períodos de antes de 2 meses e mais de 6 meses após a cirurgia bariátrica. A análise estatística foi realizada no programa SPSS 17.0®. Resultados A pressão arterial inicial foi de 130/85 mmHg, passando para 120/80 mmHg (p < 0,01). Com relação ao perfil metabólico antes de dois meses, o HDL foi de 34 mg/dL, o colesterol total foi de 195,07 ± 40,17 mg/dL, o LDL foi de 118,22 ± 41,28 mg/dL, os triglicerídeos foram de 141,09 ± 43,39 mg/dL, e a glicemia de jejum foi de 90 mg/dL. Após 6 meses de cirurgia, os valores passaram para 43 mg/dL, 133,67 ± 28,14 mg/dL, 65,53 ± 24,3 mg/dL, 104,41 ± 29,6 mg/dL, e 77 mg/dL, respectivamente (p < 0,01). Com relação ao uso de medicamentos, 41% utilizaram anti-hipertensivos, 39% utilizaram hipolipemiantes, 10% utilizaram hipoglicemiantes orais e 97% utilizaram suplementos antes dos 2 meses de cirurgia. Após os 6 meses, os percentuais foram alterados para 21%, 19%, 9% e 99%, respectivamente. Conclusões O estudo mostra o sucesso da cirurgia bariátrica em pacientes obesos com comorbidades, revelando melhora no perfil metabólico e redução na utilização de medicamentos para tratamento de comorbidades. PMID:29930588

The Science Teachers and Their way of Thinking about Astronomy. (Spanish Title: Los Profesores de Ciencias y Sus Formas de Pensar la Astronomía.) Os Professores de Ciências e Suas Formas de Pensar a Astronomia

NASA Astrophysics Data System (ADS)

Leite, Cristina; Hosoume, Yassuko

2007-12-01

The research presented in this article is about the way science teachers from Elementary School think about astronomical elements. Its methodology is based on semi-structured interviews, which were video recorded. The research is centered in a three-dimensional perspective of astronomical Earth, the Sun, the Moon, the planets and the stars, and also the conceptions about sky and Universe. The esults indicate a Universe that contains: Sun, stars, planets and Moon; where the Solar System is a little part of the whole. Sometimes they think that the Solar System is the Universe. The objects are in the sky or in the Universe, which, for many of them, is only the space above the Earth. The flat shape of astronomical objects and the spatial structure of the Universe are striking features. Many of them think that Sun and stars are different: the Sun is a hot object and the stars are cold ones. These results worry us and they certainly indicate how urgent it is to plan Professional Development in Astronomy for teachers, after all the PCN's emphasize that this subject is important to be taught. El objeto de investigación de este artículo es la manera de pensar sobre los elementos de la Astronomía de los profesores de Ciencias en la enseñanza fundamental. La metodología consiste en entrevistas semi-estructuradas, filmadas en video y centradas en la tridimensionalidad de los elementos astronómicos, para posibilitar un mapeamiento de las concepciones sobre las formas y dimensiones de la Tierra, del Sol, de la Luna, de los planetas y de las estrellas, como también de la concepción de cielo y de Universo en su totalidad. Los resultados indican un Universo conteniendo: Sol, estrellas, planetas y Luna, donde el Sistema Solar se ubica como parte. Algunas veces, el Universo es concebido como el propio Sistema Solar. Los objetos están en el cielo o en el Universo, que, para muchos, se restringe al espacio que está arriba de la Tierra. La forma plana de los objetos astronómicos y la estructura espacial del montaje del Universo son características fundamentales. Muchos indican Sol y estrellas como cosas distintas: el Sol es un objeto caliente y las estrellas son frías. Esos resultados nos preocupan y ciertamente señalan una urgencia de programas de formación continuada para profesores en el contenido de astronomía, pues los PCN's (Parámetros Curriculares Nacionales) recomiendan con énfasis la enseñanza de este contenido. O modo de pensar dos professores de Ciências do ensino fundamental sobre os elementos da Astronomia é o objeto de pesquisa presente neste artigo, cuja metodologia consiste em entrevistas semiestruturadas, filmadas em vídeo e centradas numa perspectiva tridimensional dos elementos astronômicos, possibilitando um mapeamento das concepções das formas e das dimensões da Terra, do Sol, da Lua, dos planetas e das estrelas, bem como da concepção de céu e de Universo como um todo. Os resultados indicam um Universo contendo: Sol, estrelas, planetas e Lua, onde o Sistema Solar é parte do todo. Algumas vezes o Universo é concebido como o próprio Sistema Solar. Os objetos estão no céu ou no Universo o qual, para muitos, se restringe ao espaço que está acima da Terra. A forma plana dos objetos astronômicos e a estrutura espacial da montagem do Universo são características marcantes. Muitos indicam Sol e estrelas como coisas diferentes: Sol é um objeto quente e as estrelas são frias. Esses resultados nos preocupam e certamente sinalizam uma urgência de programas de formação continuada para professores no conteúdo de astronomia, uma vez que os PCN's indicam fortemente o ensino desse conteúdo.

Tuberculosis control in people living with HIV/AIDS.

PubMed

Magnabosco, Gabriela Tavares; Lopes, Lívia Maria; Andrade, Rubia Laine de Paula; Brunello, Maria Eugênia Firmino; Monroe, Aline Aparecida; Villa, Tereza Cristina Scatena

2016-09-09

to analyze the offering of health actions and services for the control of tuberculosis for people living with HIV/AIDS being followed up in the Specialized Care Services for HIV/AIDS in Ribeirão Preto, SP, Brazil. quantitative, exploratory survey study. Participated 253 people living with HIV/AIDS followed up by this service, considering as inclusion criteria: individuals older than 18 years living in the city and not inmates. Data collection was conducted from January 2012 to May 2013 through interviews with the support of a specific instrument. Data were analyzed using indicators and a composite index. the offering of services for the control of tuberculosis in people living with HIV/AIDS by municipal services was considered as intermediate, reinforcing the need for better planning for comprehensive assistance, coordination of professionals in teams and among the services network, in addition to professional training and continuing education. it is necessary to implement strategies that promote shared actions between TB and HIV / AIDS programs and between different services in order to strengthen the local care network, aimed at producing an individualized care, comprehensive and responsive. analisar a oferta das ações e serviços de saúde para o controle da tuberculose nas pessoas vivendo com HIV/aids em seguimento pelos Serviços de Atenção Especializada ao HIV/aids de Ribeirão Preto, SP, Brasil. estudo quantitativo, exploratório, do tipo inquérito. Participaram 253 pessoas vivendo com HIV/aids em seguimento nos serviços, considerando os critérios de inclusão: indivíduos maiores de 18 anos, residentes no município e não pertencentes ao sistema prisional. A coleta de dados foi realizada no período de janeiro/2012 a maio/2013, por meio de entrevistas com apoio de um instrumento específico. Os dados foram analisados mediante indicadores e índice composto. a oferta de ações e serviços para o controle da tuberculose nas pessoas vivendo com HIV/aids pelos serviços do município foi considerada regular, reforçando a necessidade de melhor planejamento da assistência de forma integral, articulação dos profissionais nas equipes e entre os serviços da rede, além da formação profissional e educação permanente. faz-se necessário a implementação de estratégias que favoreçam ações compartilhadas entre os programas de tuberculose e HIV/aids e entre os diferentes serviços, com o intuito de fortalecer a rede local de atenção objetivando a produção de um cuidado singular, integral e resolutivo. analizar la oferta de acciones y servicios de salud para el control de la tuberculosis en las personas viviendo con VIH-SIDA acompañadas por los Servicios de Atención Especializada al VIH-SIDA de Ribeirao Preto, SP, Brasil. estudio cuantitativo, exploratorio, de tipo encuesta. Participaron 253 personas viviendo con VIH-SIDA seguidas por estos servicios, considerando como criterios de inclusión: individuos mayores de 18 años, residentes en el municipio y no ser del sistema de prisiones. La recolección de datos fue realizada en el periodo de enero de 2012 a mayo de 2013, por medio de entrevistas guiadas por un instrumento especifico. Los datos fueron analizados mediante indicadores y un índice compuesto. la oferta de acciones y servicios para el control de la tuberculosis en personas viviendo con VIH-SIDA fue considerada intermedia, reforzando la necesidad de mejorar la planificación de la asistencia en forma integral, la articulación de los profesionales en los equipos y entre los servicios de la red, además de la formación profesional y la educación permanente. se hace necesaria la implementación de estrategias que favorezcan las acciones compartidas entre los programas de tuberculosis y VIH-SIDA y entre los diferentes servicios, con el fin de fortalecer la red local de atención para producir un cuidado personalizado, integral y resolutivo.

[Not Available].

PubMed

Sendrós Madroño, José M

2016-06-03

La atención nutricional en el paciente oncohematológico debe formar parte del tratamiento global del paciente. Las alteraciones debidas a la localización de la neoplasia y los efectos secundarios del tratamiento oncoespecífico muchas veces dificultan o impiden la alimentación oral. Esto puede dar lugar a una desnutrición y es de gran importancia su detección, valoración e intervención temprana. El primer paso en la intervención nutricional es el consejo dietético. Este artículo muestra qué aspectos deben tenerse en cuenta para poder elaborar un consejo dietético y la importancia de que este sea individualizado. Se describen como ejemplo cuatro situaciones especiales, donde es necesario trasladar las recomendaciones nutricionales a un plan dietético. También se incide en el uso de los probióticos en pacientes inmunocomprometidos.

Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

USGS Publications Warehouse

Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

2010-01-01

A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

Limited-life cartridge primers

DOEpatents

Makowiecki, D.M.; Rosen, R.S.

1998-06-30

A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

Astronomy in Science Textbooks: An Analysis of Pnld 2008. (Spanish Title: Astronomía en los Libros de Ciencia: un Análisis del Pnld 2008.) Astronomia Nos Livros Didáticos de Ciências: Uma Análise do Pnld 2008

NASA Astrophysics Data System (ADS)

Amaral, Patrícia; Quintanilha Vaz de Oliveira, Carlos Eduardo

2011-12-01

The importance of the textbooks in classrooms is revealed when studies are pointing that these pedagogical sources are, most of the times, the only source used by the elementary school teachers when preparing their Science lessons. When we analyzed the Astronomy contents in the textbooks approved by the Brazilian Textbook Program 2008 and which, in theory, are the best available in the Brazilian editorial market, we examined some categories in the 2008 Textbook Guide. This research characterizes the frequency of Astronomical contents appearing in the texts, in the pictures, and in the hands-on activities. Additionally, it describes some misconceptions and presents additional information on the collections. La importancia de los libros de texto en las aulas se pone de manifiesto cuando los estudios indican que este recurso educativo es a menudo la única fuente de consulta utilizada por el profesor de ciencias de la escuela primaria para preparar sus lecciones. Cuando analizamos el contenido presente en los libros de texto de astronomía aprobados por el Programa Nacional de Libros de Texto de 2008 y que, en teoría, son los mejores libros disponibles en el mercado editorial brasileño, buscamos examinar algunas categorías que figuran en los libros de texto de la Guía de Libros Didácticos de 2008. El estudio caracteriza la frecuencia del contenido de Astronomía en el texto, en las figuras, y en las actividades de experimentación. También describe algunos errores conceptuales y presenta un conjunto de información adicional sobre las colecciones. A importância dos livros didáticos nas salas de aula revela-se quando estudos apontam que este recurso pedagógico é, muitas vezes, a única fonte de consulta utilizada pelo professor de Ciências do ensino fundamental para a preparação de suas aulas. Quando analisamos os conteúdos de Astronomia presentes nos livros didáticos aprovados no Programa Nacional do Livro Didático de 2008 e que, teoricamente, são os melhores livros disponíveis no mercado editorial brasileiro, buscamos esquadrinhar algumas categorias constantes no Guia de Livros Didáticos de 2008. A pesquisa caracteriza a freqüência do conteúdo de Astronomia no texto, nas figuras e nas atividades de experimentação. Além disso, descreve alguns erros conceituais e apresenta um conjunto de informações adicionais sobre as coleções.

Plastid primers for angiosperm phylogenetics and phylogeography.

PubMed

Prince, Linda M

2015-06-01

PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

PubMed

Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

2017-03-22

Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

PubMed Central

Bokulich, Nicholas A.

2013-01-01

Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

PubMed

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Improved Performance of Loop-Mediated Isothermal Amplification Assays via Swarm Priming.

PubMed

Martineau, Rhett L; Murray, Sarah A; Ci, Shufang; Gao, Weimin; Chao, Shih-Hui; Meldrum, Deirdre R

2017-01-03

This work describes an enhancement to the loop-mediated isothermal amplification (LAMP) reaction which results in improved performance. Enhancement is achieved by adding a new set of primers to conventional LAMP reactions. These primers are termed "swarm primers" based on their relatively high concentration and their ability to create new amplicons despite the theoretical lack of single-stranded annealing sites. The primers target a region upstream of the FIP/BIP primer recognition sequences on opposite strands, substantially overlapping F1/B1 sites. Thus, despite the addition of a new primer set to an already complex assay, no significant increase in assay complexity is incurred. Swarm priming is presented for three DNA templates: Lambda phage, Synechocystis sp. PCC 6803 rbcL gene, and human HFE. The results of adding swarm primers to conventional LAMP reactions include increased amplification speed, increased indicator contrast, and increased reaction products. For at least one template, minor improvements in assay repeatability are also shown. In addition, swarm priming is shown to be effective at increasing the reaction speed for RNA amplification via RT-LAMP. Collectively, these results suggest that the addition of swarm primers will likely benefit most if not all existing LAMP assays based on state-of-the-art, six-primer reactions.

Bond strength of self-etch adhesives after saliva contamination at different application steps.

PubMed

Cobanoglu, N; Unlu, N; Ozer, F F; Blatz, M B

2013-01-01

This study evaluated and compared the effect of saliva contamination and possible decontamination methods on bond strengths of two self-etching adhesive systems (Clearfil SE Bond [CSE], Optibond Solo Plus SE [OSE]). Flat occlusal dentin surfaces were created on 180 extracted human molar teeth. The two bonding systems and corresponding composite resins (Clearfil AP-X, Kerr Point 4) were bonded to the dentin under six surface conditions (n=15/group): group 1 (control): primer/bonding/composite; group 2: saliva/drying/primer/bonding/composite; group 3: primer/saliva/rinsing/drying/primer/bonding/composite; group 4: primer/saliva/rinsing/drying/bonding/composite; group 5: primer/bonding (cured)/saliva/rinsing/drying/primer/bonding/composite; group 6: primer/bonding (cured)/saliva/removing contaminated layer with a bur/rinsing/drying/primer/bonding/composite. Shear bond strength was tested after specimens were stored in distilled water at 37°C for 24 hours. One-way analysis of variance and Tukey post hoc tests were used for statistical analyses. For CSE, groups 2, 3, and 4 and for OSE, groups 6, 2, and 4 showed significantly lower bond strengths than the control group (p<0.05). CSE groups 5 and 6 and OSE groups 3 and 5 revealed bond strengths similar to the control. When saliva contamination occurred after light polymerization of the bonding agent, repeating the bonding procedure recovered the bonding capacity of both self-etch adhesives. However, saliva contamination before or after primer application negatively affected their bond strength.

Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

PubMed

Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

2018-03-09

Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

PubMed

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

PubMed

Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

2016-07-01

To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

Novel ITS1 Fungal Primers for Characterization of the Mycobiome

PubMed Central

Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

2017-01-01

ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

Domestic violence on children: development and validation of an instrument to evaluate knowledge of health professionals.

PubMed

Oliveira, Lanuza Borges; Soares, Fernanda Amaral; Silveira, Marise Fagundes; Pinho, Lucinéia de; Caldeira, Antônio Prates; Leite, Maísa Tavares de Souza

2016-08-18

to develop and validate an instrument to evaluate the knowledge of health professionals about domestic violence on children. this was a study conducted with 194 physicians, nurses and dentists. A literature review was performed for preparation of the items and identification of the dimensions. Apparent and content validation was performed using analysis of three experts and 27 professors of the pediatric health discipline. For construct validation, Cronbach's alpha was used, and the Kappa test was applied to verify reproducibility. The criterion validation was conducted using the Student's t-test. the final instrument included 56 items; the Cronbach alpha was 0.734, the Kappa test showed a correlation greater than 0.6 for most items, and the Student t-test showed a statistically significant value to the level of 5% for the two selected variables: years of education and using the Family Health Strategy. the instrument is valid and can be used as a promising tool to develop or direct actions in public health and evaluate knowledge about domestic violence on children. elaborar e validar um instrumento para avaliação do conhecimento dos profissionais de saúde sobre a violência doméstica contra a criança. estudo realizado com 194 profissionais médicos, enfermeiros e cirurgiões dentistas. Para elaboração dos itens e identificação das dimensões, realizou-se a revisão da literatura. A validação aparente e de conteúdo foram realizadas por meio da análise de três especialistas e de 27 professores universitários da área de saúde da criança. Para a validação de construto, avaliou-se o coeficiente alfa de Cronbach, e o teste Kappa foi usado para verificar a reprodutibilidade. A validação de critério foi conduzida com uso do teste t-student. o instrumento final apresentou 56 itens, o alfa Cronbach foi de 0,734, o teste Kappa revelou concordância superior a 0,6 para a maioria dos itens, e o teste t-student apresentou valor estatisticamente significante até o nível de 5% para as duas variáveis selecionadas, tempo de formação e tempo na Estratégia Saúde da Família. o instrumento apresentou-se válido e, deste modo , pode ser usado como ferramenta promissora para desenvolver ou direcionar as ações em saúde pública e avaliação do conhecimento sobre a violência doméstica contra a criança. elaborar y validar un instrumento para evaluación del conocimiento de los profesionales de la salud sobre la violencia doméstica ejercida contra el niño. estudio realizado con 194 profesionales: médicos, enfermeros y cirujanos dentistas. Para elaboración de los ítems e identificación de las dimensiones, se realizó una revisión de la literatura. La validación aparente y de contenido fueron realizadas por medio del análisis de tres especialistas y de 27 profesores universitarios del área de la salud del niño. Para la validación de constructo, se evaluó el coeficiente alfa de Cronbach, y la prueba Kappa fue usada para verificar la reproductibilidad. La validación de criterio fue realizada con uso de la prueba t de Student. el instrumento final presentó 56 ítems, el alfa Cronbach fue de 0,734, la prueba Kappa reveló concordancia superior a 0,6 para la mayoría de los ítems, y la prueba t de Student presentó valor estadísticamente significativo hasta el nivel de 5% para las dos variables seleccionadas: tiempo de graduación y tiempo en el programa Estrategia Salud de la Familia. el instrumento se presentó válido y, de ese modo, puede ser usado como herramienta promisora para desarrollar o dirigir acciones de salud pública y evaluar el conocimiento sobre la violencia doméstica contra el niño.

Chemical and mechanical aspects of HMR primer in relationship to wood bonding

Treesearch

Alfred W. Christiansen

2005-01-01

The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...

Polyacid macromolecule primers

DOEpatents

Sugama, Toshifumi

1989-01-01

Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

Progress in the Development of a Multiphase Turbulent Model of the Gas/Particle Flow in a Small-Caliber Ammunition Primer

DTIC Science & Technology

2006-08-01

Maneuver Ammunition Systems is acknowledged for continued support of this effort. This research was performed while the first author held a National...the ignition system (i.e., the primer in small-caliber guns, the primer and flashtube in medium-caliber guns, and the primer and igniter-tube in large...primer model that is compatible with the ARL- NGEN3 IB code is the subject of this report. The conventional ignition system for a large-caliber (120 mm

Healthy Start Programa Madrina: A Promotora Home Visiting Outreach and Education Program to Improve Perinatal Health among Latina Pregnant Women

ERIC Educational Resources Information Center

Bill, Debra E.; Hock-Long, Linda; Mesure, Maryann; Bryer, Pamela; Zambrano, Neydary

2009-01-01

The purpose of this article is to describe the development, implementation, and evaluation of Healthy Start Programa Madrina (HSPM), a home visiting promotora outreach and education program for Latina pregnant women and to present the 10-year findings of the program (1996-2005). Perinatal health disparities continue to persist among low-income…

A Counter Insurgency Study: An Analysis of Local Defenses

DTIC Science & Technology

2004-09-01

Derrota de Sendero Luminoso; Programa Institucional de Investigación y Proyeccion en el Area de Gobernabilidad y Politica Publica, IEP ediciones...Corporation, Santa Monica CA. Kruijt, D. (1996), Sociedad de Terror: Guerrillas y Contrainsurgencia en Guatemala y El Peru; Cuadcien, Programa ... en El Salvador (1981 – 1992); Centro de Paz, El Latinoamericano; Retrieved on 7/16/2004 from http://www.stormpages.com/marting/laguerrasalvador.htm

Development of a sharp interface model that simulates coastal aquifer flow with the coupled use of GIS

NASA Astrophysics Data System (ADS)

Gemitzi, Alexandra; Tolikas, Demetrios

A simulation program, which works seamlessly with GIS and simulates flows in coastal aquifers, is presented in the present paper. The model is based on the Galerkin finite element discretization scheme and it simulates both steady and transient freshwater and saltwater flow, assuming that the two fluids are separated by a sharp interface. The model has been verified in simple cases where analytical solutions exist. The simulation program works as a tool of the GIS program, which is the main database that stores and manages all the necessary data. The combined use of the simulation and the GIS program forms an integrated management tool offering a simpler way of simulating and studying saline intrusion in coastal aquifers. Application of the model to the Yermasogia aquifer illustrates the coupled use of modeling and GIS techniques for the examination of regional coastal aquifer systems. Pour étudier un système aquifère côtier, nous avons développé un modèle aux éléments finis en quasi 3-D qui simule les écoulements d'eau douce et d'eau salée en régime aussi bien permanent que transitoire. Les équations qui les régissent sont discrétisées par un schéma de discrétisation de Garlekin aux éléments finis. Le modèle a été vérifié dans des cas simples où il existe des solutions analytiques. Toutes les données nécessaires sont introduites et gérées grâce à un logiciel de gestion de SIG. Le programme de simulation est utilisé comme un outil du logiciel de SIG, constituant ainsi un outil de gestion intégrée dont le but est de simuler et d'étudier l'intrusion saline dans les aquifères côtiers. L'application du modèle à l'aquifère de Yermasogia illustre l'utilisation couplée de la modélisation et des techniques de SIG pour l'étude des systèmes aquifères côtiers régionaux. Se ha desarrollado un modelo casi tridimensional de elementos finitos para simular el flujo de agua dulce y salada, tanto en régimen estacionario como en transitorio, en sistemas acuíferos costeros, bajo la hipótesis de separación por medio de una interfaz abrupta. Las ecuaciones del modelo han sido discretizadas mediante un esquema de Galerkin de discretización en elementos finitos. El modelo ha sido verificado en casos sencillos para los que existe solución analítica. Todos los datos necesarios se introducen y gestionan con un Sistema de Información Geográfica [SIG] por ordenador. El programa de simulación forma parte del programa de SIG, constituyendo una herramienta integrada de gestión para estudiar la intrusión salina en acuíferos costeros. La aplicación del modelo al acuífero de Yermasogia ilustra el uso acoplado de las técnicas de modelación y de SIG con el fin de examinar sistemas acuíferos costeros a escala regional.

An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

NASA Technical Reports Server (NTRS)

Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.

1997-01-01

To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

PubMed

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

PubMed

Chen, Huaihai; Yu, Fangbo; Shi, Wei

2016-12-01

Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Comparison of PCR primer-based strategies for characterization of ammonia oxidizer communities in environmental samples.

PubMed

Mahmood, Shahid; Freitag, Thomas E; Prosser, James I

2006-06-01

PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.

Factors associated to clinical learning in nursing students in primary health care: an analytical cross-sectional study.

PubMed

Serrano-Gallardo, Pilar; Martínez-Marcos, Mercedes; Espejo-Matorrales, Flora; Arakawa, Tiemi; Magnabosco, Gabriela Tavares; Pinto, Ione Carvalho

2016-09-09

to identify the students' perception about the quality of clinical placements and asses the influence of the different tutoring processes in clinical learning. analytical cross-sectional study on second and third year nursing students (n=122) about clinical learning in primary health care. The Clinical Placement Evaluation Tool and a synthetic index of attitudes and skills were computed to give scores to the clinical learning (scale 0-10). Univariate, bivariate and multivariate (multiple linear regression) analyses were performed. the response rate was 91.8%. The most commonly identified tutoring process was "preceptor-professor" (45.2%). The clinical placement was assessed as "optimal" by 55.1%, relationship with team-preceptor was considered good by 80.4% of the cases and the average grade for clinical learning was 7.89. The multiple linear regression model with more explanatory capacity included the variables "Academic year" (beta coefficient = 1.042 for third-year students), "Primary Health Care Area (PHC)" (beta coefficient = 0.308 for Area B) and "Clinical placement perception" (beta coefficient = - 0.204 for a suboptimal perception). timeframe within the academic program, location and clinical placement perception were associated with students' clinical learning. Students' perceptions of setting quality were positive and a good team-preceptor relationship is a matter of relevance. identificar a percepção dos estudantes de enfermagem sobre a qualidade das Práticas Clínicas em Atenção Primária à Saúde e avaliar a influência dos diferentes processos de tutoria na aprendizagem clínica. um estudo analítico transversal realizado com alunos do segundo e do terceiro ano de enfermagem (n = 122) na aprendizagem clínica nos serviços de Atenção Primária à Saúde. A Ferramenta de Avaliação de Práticas Clínicas (Clinical Placement Evaluation Tool) e um índice sintético de atitudes e habilidades (escala de 0 a 10) foram calculados para marcar a aprendizagem clínica. Foram realizadas análises univariadas, bivariadas e multivariadas (regressão linear múltipla). a taxa de resposta foi de 91,8%. O processo de tutoria mais indicado foi o de "preceptor-professor" (45,2%). As Práticas Clínicas foram avaliadas como "ótimas" por 55,1%, o relacionamento com a equipe-preceptor foi considerado bom por 80,4% dos casos e a classificação média para a aprendizagem clínica foi de 7,89. O modelo de regressão linear múltipla, com mais capacidade explicativa incluiu as variáveis "ano acadêmico" (coeficiente de beta = 1.042 para alunos do terceiro ano), "área de cuidados de saúde primários" (coeficiente de beta = 0,308 para a Área B) e "percepção de práticas clínicas" (beta coeficiente = - 0,204 para uma percepção menos que ótima). O momento dentro do programa acadêmico, a localização e percepção das Práticas Clínicas foram associados com a aprendizagem clínica dos alunos. A percepção dos alunos sobre a qualidade do lugar das Práticas Clínicas foi positiva e um bom relacionamento da equipe-preceptor é uma questão de relevância. identificar la percepción del alumnado de enfermería sobre la calidad de las Prácticas Clínicas y evaluar la influencia de los diferentes procesos de tutoría en el aprendizaje clínico. estudio analítico transversal realizado con estudiantes de segundo y tercer año de enfermería (n = 122) en el aprendizaje clínico en los servicios de atención primaria de salud. La Herramienta de Evaluación de Prácticas Clínicas (Clinical Placement Evaluation Tool) y un índice sintético de las actitudes y habilidades (escala de 0 a 10) se calcularon para puntuar el aprendizaje clínico. Se realizaron análisis univariados, bivariados, multivariados (regresión lineal múltiple). la tasa de respuesta fue del 91,8%. El proceso de tutoría más comúnmente identificado fue "preceptor-profesor" (45,2%). Las Prácticas Clínicas se evaluaron como "óptimas" en un 55,1%, la relación equipo-preceptor fue considerada buena por el 80,4% de los casos y la calificación media para el aprendizaje clínico fue de 7.89. El modelo de regresión lineal múltiple con mayor capacidad explicativa incluyó las variables "año académico" (coeficiente beta = 1.042 para los estudiantes de tercer año), "Área de Atención Primaria de la Salud" (coeficiente beta = 0,308 para el Área B) y la "percepción de las Prácticas Clínicas" (coeficiente beta = - 0,204 para una percepción subóptima). el momento dentro del programa académico, la ubicación y la percepción de las Prácticas Clínicac se asociaron con el aprendizaje clínico de los estudiantes. La percepción de los estudiantes de la calidad del lugar de las Prácticas Clínicas fue positiva y la buena relación equipo-preceptor es una cuestión de relevancia.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

PubMed

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

PubMed Central

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

PubMed

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

PubMed

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

PubMed Central

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Polyacid macromolecule primers

DOEpatents

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

Effect of surface preparation on service life of top-coats applied to weathered primer paint

Treesearch

R. Sam Williams; Mark Knaebe; Peter Sotos

2008-01-01

Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

Simple sequence repeat marker loci discovery using SSR primer.

PubMed

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Nucleic acid amplification using modular branched primers

DOEpatents

Ulanovsky, Levy; Raja, Mugasimangalam C.

2001-01-01

Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

Telescópio de pequeno porte como suporte ao ensino em cidades com intensa poluição luminosa II

NASA Astrophysics Data System (ADS)

Pereira, P. C. R.; Santos-Júnior, J. M.; Cruz, W. S.

2003-08-01

Para a maioria dos estudantes, sua passagem pelo ensino formal fundamental envolve a transmissão de fatos que devem ser guardados para um exame, a habilidade para lembrar fórmulas e, eventualmente, a repetição de experimentos que devem produzir resultados exigidos pelo professor. O resultado deste modelo de ensino, ao longo dos anos, é conhecido por todos: desconhecimento e descontentamento, por parte dos estudantes, de temas relativos ao papel e aos processos da ciência. Acreditamos que a Astronomia, pelo seu caráter observacional, é uma das áreas do conhecimento que pode contribuir neste cenário. A Fundação Planetário da Cidade do Rio de Janeiro possui um telescópio Meade LX-200 (25cm) que, juntamente com as câmeras CCD ST-7E e ST8E, tem sido utilizado em projetos voltados aos estudantes do ensino médio desde o ano 2000. Tais projetos envolvem a condução de um projeto de pesquisa observacional num nível apropriado, e possibilitam o contato com técnicas e novas tecnologias: computador, software para manipulação de dados e gráficos, programas de tratamento e redução de dados, uso de equipamentos óptico-eletrônicos (telescópio e CCD), bem como o processo de aquisição de conhecimento. Dentro da proposta dos anos anteriores, priorizamos projetos de uma noite, ou seja, procuramos trabalhar com fenômenos que apresentem variabilidade com intervalo de recorrência relativamente curto. Em todos os casos, optamos pela fotometria diferencial, que tem se mostrado bastante eficiente para o céu luminoso como o da cidade do Rio de Janeiro. Neste painel, apresentamos alguns dos projetos desenvolvidos no último ano, com 25 estudantes. Apresentamos os resultados da observação da variável pulsante AI Vel (V = 6,6) e da variável cataclísmica FO Aqr (V = 13,5), e do monitoramento do trânsito da lua de Júpiter, Europa, ocorrido em 30 de abril de 2003. As curvas de luz produzidas para as primeiras estão concordantes com as da literatura, assim como os respectivos períodos encontrados (1h20min e 4h48min). No caso do FO Aqr, ficou evidente, também, a modulação decorrente da rotação da anã branca receptora (21min). O erro estimado é de 0,01 magnitude. Propomos uma maior utilização de telescópios de pequeno porte, como suporte ao ensino (médio e superior) em cidades com poluição luminosa. Escolas e Planetários seriam ambientes propícios para a localização do telescópio. Os critérios adotados na escolha dos objetos e o método observacional empregado são também apresentados.

Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

PubMed Central

Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

2006-01-01

Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

Plan for a groundwater monitoring network in Taiwan

NASA Astrophysics Data System (ADS)

Hsu, Shiang-Kueen

In Taiwan, rapid economic growth, rising standards of living, and an altered societal structure have in recent years put severe demands on water supplies. Because of its stable quantity and quality, groundwater has long been a reliable source of water for domestic, agricultural, and industrial users, but the establishment of a management program that integrates groundwater and surface-water use has been hampered by the lack of groundwater data. In 1992, the Department of Water Resources (DWR) initiated a program entitled "Groundwater Monitoring Network Plan in Taiwan." Under this program, basic groundwater data, including water-level and water-quality data, are being collected, and a reliable database is being established for the purpose of managing total water resources. This paper introduces the goals, implementation stages, and scope of that plan. The plan calls for constructing 517 hydrogeologic survey stations and 990 groundwater monitoring wells within 17 years. Under this program, water-level fluctuations are continuously monitored, whereas water-quality samples are taken for analysis only at the initial drilling stage and, subsequently, at the time when a monitoring well is being serviced. In 1996, the DWR and the Water Resources Planning Commission were merged to form today's Water Resources Bureau. Résumé A Taïwan, l'expansion économique rapide, l'amélioration des conditions de vie et la transformation de la structure sociale ont provoqué, ces dernières années, une très forte demande en eau. Du fait de sa constance en qualité et en quantité, l'eau souterraine a longtemps été considérée comme une ressource en eau sûre pour les usages domestiques, agricoles et industriels. Mais la mise en place d'un programme de gestion intégrant les utilisations d'eaux souterraines et de surface a été gênée par l'absence de données sur les eaux souterraines. En 1992, le Département des Ressources en Eau a lancé le programme "Plan pour un réseau de suivi des eaux souterraines à Taïwan". D'après ce programme, les données de base concernant les eaux souterraines, comprenant les mesures de niveau et les données de qualité, ont été acquises ; une base de données sûre est en cours d'élaboration, dans le but de gérer l'ensemble des ressources en eau. Cet article présente les buts, les stades de développement et une vue d'ensemble de ce plan. Le plan impose la mise en place de 517 stations de mesures hydrogéologiques et de 990 piézomètres en 17 ans. Selon ce programme, les variations du niveau des nappes doivent être suivies en continu, tandis que des échantillons pour la qualité de l'eau seront prélevés pour analyses uniquement au cours de la phase de foration, puis au moment de la mise en service des piézomètres. En 1996, le Département des Ressources en Eau et la Commission de Planification des Ressources en Eau ont été réunis pour former l'actuel Bureau des Ressources en Eau. Resumen En Taiwan, el rápido crecimiento económico, el aumento en el nivel de vida y los cambios sociales en los últimos años han resultado en un aumento en la demanda de agua. Por su estabilidad en términos de cantidad y calidad, las aguas subterráneas han sido durante años la fuente de agua para usos domésticos, agrícolas e industriales. En los últimos años, sin embargo, el establecimiento de un programa de gestión conjunta de aguas superficiales y subterráneas se ha visto comprometido por la falta de datos correspondientes a estas últimas. En 1992, el Departamento de Recursos de Agua (DWR) inició un programa titulado "Plan de Red de Control de Aguas Subterráneas en Taiwan". Bajo este programa, se están recogiendo datos básicos, incluyendo niveles piezométricos y datos de calidad, y se está construyendo una base de datos con el propósito de gestionar los recursos de agua totales. Este artículo presenta el marco, los objetivos y el estado de implantación del plan, que pretende la construcción de 517 estaciones de medida hidrogeológicas y 990 pozos de observación durante un periodo de 17 años. Bajo este programa, los niveles de agua se miden continuamente, mientras que las muestras para análisis de calidad se toman sólo durante la perforación y cuando el pozo está en servicio. En 1996, el DWR y la Comisión de Planificación de los Recursos de Agua se unieron para formar la actual Oficina de Recursos de Agua.5

Present and Future of the United States-Bolivia Relations

DTIC Science & Technology

2009-12-11

Programa de Gobierno-MAS-IPSP,” Archivo Chile , http://www.archivochile.com/Portada/bol_elecciones05/bolelecciones0009.pdf (accessed May 2, 2009...accessed November 9, 2009). Movimiento al Socialismo. “ Programa de Gobierno-MAS-IPSP.” Archivo Chile . http://www.archivochile.com/Portada/bol_elecciones05...partidos en Bolivia,” Futuros Revista Trimestral Latinoamericana y Caribeña de Desarrollo Sustentable, http://www.revistafuturos.info/ futuros_9

A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

NASA Astrophysics Data System (ADS)

Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

2017-08-01

The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

PubMed

Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

2016-01-01

The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

PubMed

Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

2014-06-03

Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.

PubMed

Tirumalai, R S; Modak, M J

1991-07-02

We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.

Development of internal COI primers to improve and extend barcoding of fruit flies (Diptera: Tephritidae: Dacini).

PubMed

Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K

2018-06-06

Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Lee, H.K.; Flanders, D.J.

The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

PubMed

Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

2009-08-01

Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.

PubMed

Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan

2015-09-01

The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.

[Effect of a chemical primer on the bond strength of a zirconia ceramic with self-adhesive resin cement].

PubMed

Zhang, Hong; Jing, Ye; Nie, Rongrong; Meng, Xiangfeng

2015-10-01

To evaluate the bond strength and durability of a self-adhesive resin cement with a zirconia ceramic pretreated by a zirconia primer. Zirconia ceramic (Vita Inceram YZ) plates with a thickness of 2.5 mm were fired, polished, and then cleaned. Half of the polished ceramic plates were sandblasted with 50 μm alumina particles at 0.3 MPa for 20 s. The surface compound weight ratios were measured via X-ray fluorescence microscopy. The polished and sandblasted ceramic plates were directly bonded with self-adhesive resin cement (Biscem) or were pretreated by a zirconia primer (Z Primer Plus) before bonding with Biscem. The specimens of each test group were divided into two subgroups (n=10) and subjected to the shear test after 0 and 10,000 thermal cycles. The data were analyzed via three-way ANOVA. After air abrasion, 8.27% weight ratio of alumina attached to the zirconia surface. Compared with air abrasion, primer treatment more significantly improved the primary resin bond strength of the zirconia ceramic. The primary resin bond strength of the zirconia ceramic with no primer treatment was not affected by thermocycling (P>0.05). However, the primary resin bond strength of the zirconia ceramic with primer treatment was significantly decreased by thermocycling (P<0.05). Primer treatment can improve the primary resin bond strengths of zirconia ceramics. However, the bond interface of the primer is not stable and rapidly degraded during thermocycling.

Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Wiesner, G.; Laken, S.

The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

ACTITUDES HACIA LA COMUNICACIÓN SEXUAL ENTRE PADRES/MADRES Y ADOLESCENTES EN PUERTO RICO*

PubMed Central

Fernández, Ana Michelle; McFarlane, Melvin Negrón; González, Ricardo; Díaz, Leslie; Betancourt-Díaz, Elba; Cintrón-Bou, Francheska; Varas-Díaz, Nelson; Villarruel, Antonia

2017-01-01

RESUMEN La comunicación sobre sexualidad entre padres/madres y adolescentes enfrenta dificultades particulares producto de factores socioculturales. Este estudio tuvo como objetivo documentar las actitudes de padres/madres y adolescentes hacia la comunicación sobre temas de sexualidad. Los resultados emanan de la medición inicial del Proyecto Cuídalos. Los datos de este estudio forman parte de un estudio amplio que evaluó un módulo interactivo basado en la web para mejorar comunicación sobre temas de salud entre padres/madres y adolescentes entre 13–17 años. En este artículo, reportamos datos basales que contestaron los/as participantes sobre comodidad al hablar sobre temas de salud sexual. La muestra, de los datos aquí expuestos, estuvo compuesta por 458 diadas de madres/padres y sus hijos/as adolescentes (n=916). Se realizó análisis de frecuencias y medidas de tendencia central con los datos obtenidos inicialmente. La edad promedio de los adolescentes fue de 15 años, de los que un 15% se encontraban activos sexualmente. Los/as adolescentes tienen mejor disposición que los/as padres/madres para hablar sobre sexualidad. Sin embargo, los/as padres/madres entienden que comparten suficiente información sobre temas relacionados a la sexualidad. Los/as padres/madres y adolescentes reportaron algún grado de dificultad e incomodidad al hablar sobre métodos específicos de prevención. Los resultados destacan la necesidad de incorporar a los/as padres/madres en intervenciones con adolescentes sobre temas de salud sexual. En Puerto Rico es necesario desarrollar programas dirigidos a minimizar las conductas sexuales de alto riesgo en jóvenes. PMID:28736599

Estudio de mutaciones en los genes IDH1 e IDH2 en una muestra de gliomas de población colombiana.

PubMed

Ricaurte, Orlando; Neita, Karina; Valero, Danyela; Ortega-Rojas, Jenny; Arboleda-Bustos, Carlos E; Zubieta, Camilo; Penagos, José; Arboleda, Gonzalo

2018-05-01

Introducción. Los gliomas son los tumores primarios más comunes del sistema nervioso central y se clasifican de I a IV según su grado de malignidad. En recientes investigaciones se ha encontrado que su aparición está relacionada con mutaciones en el exón 4 de los genes que codifican las deshidrogenasas de isocitrato 1 y 2 (IDH1: codón 132; IDH2: codón 172).Objetivo. Determinar la frecuencia de mutaciones en los genes IDH1 e IDH2 en una muestra de gliomas de pacientes colombianos.Materiales y métodos. La extracción de ADN se hizo a partir de tejido tumoral. El exón 4 de los genes IDH1 e IDH2 se amplificó mediante PCR utilizando iniciadores específicos y, posteriormente, se secuenciaron. Para la determinación de las mutaciones, se emplearon los programas 4Peaks y MAFFT.Resultados. Se determinó la presencia de mutaciones en el gen IDH1 en el 34 % de las muestras, con predominio de la mutación no sinónima R132H. En el 7,5 % de los casos se detectaron mutaciones en el gen IDH2, principalmente las mutaciones no sinónimas R172K y R172W.Conclusiones. La frecuencia de mutaciones en los genes IDH1 e IDH2 en la muestra fue similar a la reportada en otros estudios. El análisis de estas mutaciones puede ser importante como factor pronóstico y para su uso como potenciales blancos terapéuticos en gliomas.

Incorporando a variabilidade no processo de identificação do modelo de máximo global no Grade of Membership (GoM): considerações metodológicas

PubMed Central

Guedes, Gilvan Ramalho; Siviero, Pamila Cristina Lima; Caetano, André Junqueira; Machado, Carla Jorge; Brondízio, Eduardo

2012-01-01

A disponibilidade de bases de dados cada vez mais complexas e multidimensionais é um dos principais motivadores para o aumento do número de estudos que utilizam análises multivariadas baseadas em lógica de conjuntos nebulosos. Apesar da disseminação do método Grade of Membership nos trabalhos empíricos brasileiros da área de ciências sociais e saúde, questões relativas à identificabilidade e estabilidade dos parâmetros finais estimados pelo programa GoM 3.4 não foram suficientemente aprofundadas. Dada a relevância de se obterem parâmetros únicos e estáveis, Guedes et al. (2010) propuseram um procedimento empírico para localizar um modelo de máximo global (MG) com parâmetros estáveis. Entretanto, seu localizador de MG não incorpora qualquer medida de variabilidade. Neste artigo, tal limitação é contornada por meio da utilização de uma estatística de ponderação – Máximo Global Ponderado (MGP) – semelhante ao coeficiente de variação. Esse indicador busca não penalizar de forma desproporcional situações nas quais os desvios médios, apesar de diferentes de zero, são muito pequenos. Apresentam-se evidências de que o localizador MGP reduz a distância do modelo identificado à real estrutura latente dos dados em análise, quando comparados ao modelo identificado pelo localizador não ponderado, MG. PMID:23293402

Use of technologies in intravenous therapy: contributions to a safer practice.

PubMed

Moreira, Ana Paula Amorim; Escudeiro, Cristina Lavoyer; Christovam, Bárbara Pompeu; Silvino, Zenith Rosa; Carvalho, Márglory Fraga de; Silva, Roberto Carlos Lyra da

2017-01-01

To identify what are the difficulties of the nursing staff in the management of technologies during intravenous therapy (IVT) and discuss the difficulties identified under the perspective of patient's safety. Descriptive study of qualitative approach with data collected by semi-structured interview and analyzed by the Alceste software. The greatest difficulty of cognitive and technical emphasis was the lack of training; and regarding administrative emphasis, the greatest difficulty was the lack of material and human resources. Infusion pumps and their proper use were highlighted as the technological resource that most contributed to patient safety. The lack of training is presented as the greatest difficulty of nursing professionals and permeates safety issues of both patient and professional when using the hard technologies in IVT. Training is essential to the development of techniques, considered nursing tools. Identificar quais são as dificuldades da equipe de Enfermagem no manejo das tecnologias durante a terapia intravenosa (TIV) e discutir as dificuldades identificadas sob a perspectiva da segurança do paciente. abordagem qualitativa, do tipo descritivo com dados coletados por entrevista semiestruturada e analisados pelo programa Alceste. A maior dificuldade de ênfase cognitiva e técnica foi a falta de treinamento; e de ênfase administrativa, foi a falta de recursos materiais e humanos. As bombas de infusão e sua utilização adequada foram destacadas como o recurso tecnológico que mais contribuiu para a segurança do paciente. A falta de treinamento é apresentada como a maior dificuldade dos profissionais de Enfermagem e permeia as questões de segurança do paciente e do profissional ao utilizar as tecnologias duras na TIV. O treinamento é imprescindível para o desenvolvimento das técnicas, consideradas como ferramentas do fazer da Enfermagem.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

USGS Publications Warehouse

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification

PubMed Central

Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo

2018-01-01

Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604

MRPrimerV: a database of PCR primers for RNA virus detection

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

2017-01-01

Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Identification of the gene encoding the major capsid protein of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Darai, G

1993-10-01

The gene encoding the major capsid protein (MCP) of fish lymphocystis disease virus (flounder isolate; FLCDV-f) has been identified by PCR using oligonucleotide primers corresponding to different regions of the MCP of Tipula iridescent virus (TIV), iridescent virus 22 (IV22) and Chilo iridescent virus (CIV). DNA fragments of 0.4 kbp, 0.5 kbp and 0.27 kbp in size were amplified using oligonucleotide primers corresponding to amino acids (aa) 146 to 153 (primer 1) and 274 to 268 (primer 6), or aa 146 to 153 (primer 1) and 313 to 304 (primer 8), or aa 304 to 312 (primer 7) and 385 to 381 (primer 9) of the MCP of TIV, respectively. The PCR products were used as hybridization probes for screening the gene library of FLCDV-f. The MCP gene of FLCDV-f(1377 bp; 459 aa; 51.4K) was identified within the DNA sequence of the EcoRI FLCDV-f DNA fragment C (11.2 kbp; 0.611 to 0.718 map units). A high degree of aa sequence identity/similarity was detected between the MCP of FLCDV-f and TIV (50.3%/33.8%), IV22 (49.1%/34.2%). CIV (53%/29.5%) and African swine fever virus (16%/38.1%).

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

PubMed

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Immunological properties of the primer-independent glucosyltransferase of Streptococcus mutans serotypes d and g.

PubMed

Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T

1988-05-01

Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.

Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

PubMed

Gonzales, J L; Loza, A; Chacon, E

2006-03-15

There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

PubMed Central

Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

2003-01-01

We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

UniPrime2: a web service providing easier Universal Primer design.

PubMed

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.

PubMed

Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca

2017-11-23

DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.

Effect of acclimation to outdoor condition on the sexual performance of mass-produced Medflies (Diptera: Tephritidae)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pereira, R.; Silva, N.; Quintal, C.

Application of the sterile insect technique (SIT) as part of integrated area-wide programs to control the Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) require that the released males attract wild females and transfer sterile sperm. However, knowledge about male sexual performance after they are released is scarce. We conducted a study to evaluate male sexual performance in field cage tests, according to standard quality control procedures. Mass-reared 5-d-old sterile males from the genetic sexing strain VIENNA 7mix2000 were acclimated for 0, 1, and 3 d to outdoor conditions before competing with wild males for wild females. Although the proportion ofmore » mating (PM) in the test was satisfactory, the resulting relative sterility index (RSI) data showed no significant differences among the treatments. The data indicate that pre-conditioning males to outdoor conditions in Madeira did not confer an advantage in field cage sexual performance. (author) [Spanish] La aplicacion de la tecnica del insecto esteril (TIE) como parte de un programa integrado de amplio efecto para el control de la mosca mediterranea de la fruta Ceratitis capitata (Wiedemann) requiere que los machos liberados atraigan las hembras naturales y transfieran su esperma. Sin embargo, el conocimiento del desempeno sexual de los machos despues de ser liberados es muy escaso. Nosotros realizamos un estudio para evaluar el desempeno sexual de los machos en pruebas usando jaulas del campo, segun los procedimientos estandardizados de calidad. Machos esteriles de 5 dias de edad de la raza que separa los sexos geneticamente VIENNA 7mix2000 criados en masa fueron aclimatados por 0, 1 y 3 dias en condiciones de campo antes de competir con machos naturales para las hembras naturales. Aunque la proporcion del apareamiento en la prueba fue satisfactorio, el indice relativo de esterilidad (IRS) resultante no mostro ninguna diferencia significativa entre los tratamientos. Los datos indicaron que al condicionar los machos anteriormente a las condiciones de campo en Madeira no conferio ventaja alguna en el desempeno sexual en la jaula de campo. (author)« less

Prevalence and factors associated with minor psychiatric disorders in hospital housekeeping workers.

PubMed

Marconato, Cintia da Silva; Magnago, Ana Carolina de Souza; Magnago, Tânia Solange Bosi de Souza; Dalmolin, Graziele de Lima; Andolhe, Rafaela; Tavares, Juliana Petri

2017-06-12

Investigating the prevalence and factors associated with minor psychiatric disorders (MPDs) in Hospital housekeeping workers. A cross-sectional study carried out in 2013 with workers from the cleaning service of a public university hospital in Rio Grande do Sul, Brazil. Data were collected through a form containing sociodemographic, occupational, habits and health variables. The Self-Reporting Questionnaire-20 was used in order to evaluate MPDs. The study population consisted of 161 workers. The overall prevalence of suspected MPD was 29.3%. The chances of suspected MPDs were higher in workers with Effort-Reward Imbalance, those who did not have time or who occasionally had time for leisure activities, and those taking medications. The prevalence of MPDs was similar to that found in the literature for health workers. Therefore, we consider it important to include these workers in institutional programs for continuing health education. Investigar a prevalência e os fatores associados aos Distúrbios Psíquicos Menores (DPMs) em trabalhadores do Serviço Hospitalar de Limpeza. Estudo transversal, realizado em 2013, com trabalhadores do serviço de limpeza de um hospital universitário público do Rio Grande do Sul, Brasil. Os dados foram coletados por meio de um formulário contendo variáveis sociodemográficas, laborais, hábitos e saúde. Para avaliação dos DPMs utilizou-se do Self-Reporting Questionnaire-20. A população do estudo foi composta pelos 161 trabalhadores. A prevalência global para suspeição de DPM foi de 29,3%. As chances de suspeição de DPMs foram maiores nos trabalhadores em Desequilíbrio Esforço-Recompensa, nos que não tinham ou às vezes tinham tempo para o lazer e naqueles que faziam uso de medicação. A prevalência de DPMs assemelhou-se à encontrada na literatura em trabalhadores da área saúde. Portanto, considera-se importante a inclusão desses trabalhadores em programas institucionais de educação permanente em saúde.

Descripción del coronógrafo a ser instalado en Argentina (MICA)

NASA Astrophysics Data System (ADS)

Stenborg, G.; Francile, C.; Schwenn, R.; Epple, A.; Rovira, M.

El ``Coronógrafo de espejo para Argentina'' es un telescopio solar terrestre a ser colocado en el Observatorio Astronómico Félix Aguilar (El Leoncito), antes de finalizar 1996, como parte de un programa de ciencia bilateral entre Alemania y Argentina. Eclipses fotográficos de alta resolución han revelado que la corona solar es altamente estructurada y variable. De hecho, está contínuamente deformada y moldeada por los movimientos convectivos de los extremos de los arcos magnéticos en la fotosfera, estando, en muchas oportunidades, afectada por explosivas liberaciones de energía. MICA, en conjunción con otros telescopios solares espaciales y terrestres, tratará de contribuir al entendimiento de cuestiones fundamentales de la física solar. Entre ellas: cómo la corona está siendo calentada, dónde y cómo el viento solar es acelerado, qué causa los transitorios coronales, etc. Para ello investigará la distribución de los parámetros del plasma y su evolución con el tiempo, la estructura espacial de la corona en fina y gran escala, procesos que ocurren en los transitorios coronales y factores que los disparan, etc. Para responder a estas cuestiones MICA observará la atmósfera solar por sobre el limbo entre 1.1 y 2 radios solares aproximadamente, usando un nuevo tipo de sistema coronográfico que permite suprimir el brillo del disco solar suficientemente bien, tomando las imágenes con una cámara CCD de 1024x1024 pixels, codificada en 12 bits, pudiendo el mismo ser operado en forma remota. En la presente exposición describiremos las características del instrumento, cómo será controlado y qué esperamos observar basados en las imágenes obtenidas por los telescopios de similares características LASCO C1 a bordo del SOHO y PICO (ubicado en el Observatorio de Pic du Midi, Francia).

Study of the Generation of Intense Pulsed Electron Beams Using Glow Discharges

DTIC Science & Technology

1988-02-01

de Investigaciones Opticas, Rep. Argentina. (2) On leave from PROFET (UNCPBA) Programa de Fisica Experimental Tandil, Rep. Argentina. (3) Edwards... de Investigaciones Opticas, (CIC-BA) Rep. Argentina. Section III-D. Measurements of the plasma density andB. T. Szapiro is on leave from Programa de ...discussed. The radial profiles Szapiro was supported by a fellowship from the Universidad Nacional de show the presence of a high-current-density

White primer permits a corrosion-resistant coating of minimum weight

NASA Technical Reports Server (NTRS)

Albrecht, R. H.; Jensen, D. P.; Schnake, P.

1966-01-01

White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

Economics : pricing, demand, and economic efficiency : a primer.

DOT National Transportation Integrated Search

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

DOEpatents

McKinney, Nancy

2002-01-01

PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

Uncoupling primer and releaser responses to pheromone in honey bees

NASA Astrophysics Data System (ADS)

Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

2007-05-01

Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

PubMed

Campos, Maria Jorge; Quesada, Alberto

2017-01-01

PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae)

PubMed Central

2010-01-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

PubMed

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

Molecular method for determining sex of walruses

USGS Publications Warehouse

Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

2008-01-01

We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

PubMed Central

Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

1984-01-01

Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

PubMed

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Low-copy nuclear primers and ycf1 primers in Cactaceae.

PubMed

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Electro-Deposited Primer Development and Low-Polluting Primer Evaluation

DTIC Science & Technology

1989-08-01

in the use of spray-applied primers are nonuniform corrosion protection, poor control of primer thickness, and variable strength of the adhesive bond...AL=)r- U’) LA C) .LAV) . L" () - C:’. L L :0 3c’. ) %D r- LAIr - LA I r-.%D ’D( o oD𔃺t- LA Ln DLI m to r- 0 0l- I cn M - in C.0 CD I (n m~ : c) = I V

Design of a Percussion and Electric Primer Gun Firing Power Supply

DTIC Science & Technology

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

PubMed

Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

2017-10-01

ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

PubMed

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Religiosidade, juventude e sexualidade: entre a autonomia e a rigidez1

PubMed Central

Silva, Cristiane Gonçalves da; Santos, Alessandro Oliveira; Licciardi, Daniele Carli; Paiva, Vera; Parker, Richard

2009-01-01

Esse artigo descreve como jovens religiosos e autoridades religiosas de sua comunidade compreendem a sexualidade, considerando suas experiências pessoais e como membros de comunidades religiosas. A análise pretende contribuir para que políticas públicas dedicadas à promoção da saúde sexual da juventude considerem a religiosidade, no contexto de um estado laico e da promoção do direito à prevenção. Foram realizadas 26 entrevistas abertas e semidirigidas em diferentes comunidades da região metropolitana da cidade de São Paulo (comunidades católicas, da umbanda, do candomblé e de diferentes denominações evangélicas) sobre iniciação sexual, casamento, gravidez, contracepção e prevenção das DST/Aids, homossexualidade, aborto e direitos humanos. Observou-se como jovens e autoridades religiosas convivem com a tensão entre tradição e modernidade e os distintos discursos sobre a sexualidade. Como sujeitos religiosos (do discurso religioso) e sujeitos sexuais (de discursos sobre sexualidade), devem ser incorporados pelos programas como sujeitos de direito nos termos de sua religiosidade. PMID:21886456

[Identification of Positive Youth Development Interventions].

PubMed

Sardiñas, Lili M; Padilla, Viviana; Aponte, Mari; Boscio, Ana Morales; Pedrogo, Coralee Pérez; Santiago, Betzaida; Morales, Ángela Pérez; Dávila, Paloma Torres; Cesáreo, Marizaida Sánchez

2017-01-01

There are more people in the world in the youth stage of development than in any other stage of development. The youth in Puerto Rico faces many situations that affect their development and readiness for adulthood. Therefore, it's imperative to identify evidence-based positive youth development interventions to develop practices that help young people prevent adverse situations, promote positive experiences and encourage children and young people to be involved and committed. One hundred and forty seven interventions were identified through a traditional scientific literature review. The results reflect that the interventions mainly focused on reducing risk factors and increasing of protection factors. However, no intervention focus on fully engaging children and young people to be involved and committed to their optimal development and to their communities. Nevertheless, all identified interventions providDe tools that could be useful to foster such practices in the context of Puerto Rico. Of the 147 interventions identified, six are designed for the Puerto Rican population residing on the island. In order to make information accessible to professionals and the community, the collection of the Archivo de Programas y Prácticas Basadas en Evidencia para la Prevención has been expanded.

CRITERIA FOR CONSULTANT AND ADVISOR IN THE BRAZILIAN POSTGRADUATE SYSTEM.

PubMed

Petroianu, Andy

2015-01-01

To review the rules, resolutions and existing documents relating to consultant and advisor to better target the actions of those who exercise these roles. The following documents were consulted: Statute of CAPES, through Decree No. 7692 of March 2, 2012; Ordinance No. 47 of 17/10/1995; Opinion 977 1965 Newton Sucupira; Area Document of Medicine III; Interministerial Ordinance 251 of 2012, based on Decree No. 7642 of 2011 of the Ministry of Science and Technology; CAPES Regiment. The Brazilian Postgraduate system is divided in two different fields, according to its aspects: the "lato sensu" postgraduate, defined as all professional studies performed after the high school graduation; and the "stricto sensu" postgraduate that includes the master degree and the doctorate, both of them different from what is known as MSc or MS and PhD. The Brazilian doctorate is recognized as academic because its purposes include to improve the scientific and the teaching levels of university docents. The master degree has two different objectives one is to be academic and similar to the doctorate; the other is to upgrade professionals to a higher level than specialist or MBA and is denominated professional master degree. The master degrees and the doctorate are designated as courses and may be put together in a structure known as stricto sensu postgraduate program. The complexity of these courses and programs in all the areas of the superior human knowledge requires a large number of professional directly involved with this system and other professionals that attend them, called consultants and advisors. The consultants are counselors, and the advisors are assistants, both of them legally established with the incumbency to aid the postgraduate staff in all their duties. Nothing prevents a person from being a consultant on the situation and advisor on another, even in the same institution. Have knowledge about what being a consultant and advisor is required to exercise the function within the limits and dimension that the wingspan of the professional allows. Revisar as normas, resoluções e documentos vigentes relativos ao tema consultoria e assessoria para melhor orientar as atuações de quem exerce esses papéis. Foram consultados os seguintes documentos: Estatuto da CAPES, por meio do Decreto Nº 7.692, de 02 de março de 2012; Portaria nº 47 de 17/10/1995; Parecer 977 de 1965 de Newton Sucupira; Documento de Área da Medicina III; Portaria Interministerial 251 de 2012, com base no Decreto nº 7642 de 2011 do Ministério de Ciência e Tecnologia; e Regimento da CAPES. O gerenciamento dos programas de pós-graduação stricto sensu requer estrutura multiprofissional diversificada em todos os seus níveis, constituída por corpo próprio da instituição e por componentes agregados, incluindo os consultores e assessores. O consultor é pessoa independente, sem vínculo com quem o convida e, nesse sentido, espera-se dele isenção na execução das tarefas solicitadas, nas quais se pressupõe domínio cultural, científico e humanístico. No Documento de Área da Medicina III, a consultoria é valorizada como atributo importante do Corpo Docente e está mencionada na Proposta dos Programas de Pós-graduação em seu item 2.1. Por outro lado, o assessor está vinculado ao solicitante em relação de dependência funcional. Dentro de sua área do conhecimento, o assessor é considerado adjunto do solicitante e pode substituí-lo ou representá-lo. No Documento de Área da Medicina III, o desempenho de assessoria pelo Corpo Docente está mencionado na Proposta dos Programas de Pós-graduação em seu item 5.2. Ter conhecimento sobre o que significa ser consultor e assessor é necessário para exercer a função dentro dos limites que lhe compete e na dimensão que a envergadura do profissional permite. Nada impede que uma pessoa seja consultora em situação e assessora em outra, até na mesma instituição. Ter conhecimento sobre o que significa ser consultor e assessor é necessário para poder exercer a função dentro dos limites que lhe compete e na dimensão que a envergadura do profissional permite.

Aluminum Rich Epoxy Primer for Ground and Air Vehicles

DTIC Science & Technology

2017-03-01

UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements

A primer on safety performance measures for the transportation planning process

DOT National Transportation Integrated Search

2009-09-01

This Primer is a tool to help State and local practitioners, transportation planners, and decision-makers identify, select, and use safety performance measures as a part of the transportation planning process. The Primer draws from current literature...

Primer on consumer marketing research : procedures, methods, and tools

DOT National Transportation Integrated Search

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Antibacterial Effect and Tensile Bond Strength of Self-etching Adhesive Resins with and without Methacryloyloxydodecylpyridinium Bromide: An in vitro Study.

PubMed

Krishnamurthy, Madhuram; Kumar, V Naveen; Leburu, Ashok; Dhanavel, Chakravarthy; Selvendran, Kasiswamy E; Praveen, Nehrudhas

2018-04-01

Aim: The aim of the present study was to compare the antibacterial activity of a self-etching primer containing antibacterial monomer methacryloyloxydodecylpyridinium bromide (MDPB) (Clearfil protect bond) with a conventional self-etching primer without MDPB (Clearfil SE bond) against Streptococcus mutans and the effect of incorporation of MDPB on the tensile bond strength of the experimental self-etching primer (Clearfil protect bond). Materials and methods: The antibacterial activity of the self-etching primers was assessed using agar disk diffusion method and the diameters of the zones of inhibition were measured and ranked. For tensile bond strength testing, 20 noncarious human molars were selected and randomly divided into two groups comprising 10 teeth in each group. Group I specimens were treated with Clearfil SE bond (without MDPB). Group II specimens were treated with Clearfil protect bond (with MDPB). Composite material was placed incrementally and cured for 40 seconds in all the specimens. Tensile bond strength was estimated using the Instron Universal testing machine at a crosshead speed of 1 mm/min. Results: The addition of MDPB into a self-etching primer exerts potential antibacterial effect against S. mutans. The tensile bond strength of MDPB containing self-etching primer was slightly lower than that of the conventional self-etching Clearfil protect bond primer, but the difference was not statistically significant. Conclusion: Thus, a self-etching primer containing MDPB will be a boon to adhesive dentistry as it has bactericidal property with adequate tensile bond strength. Clinical significance: The concept of prevention of extension in adhesive dentistry would result in micro/nanoleakage due to the presence of residual bacteria in the cavity. Self-etching primers with MDPB would improve the longevity of such restorations by providing adequate antibacterial activity without compromising the bond strength. Keywords: Antibacterial property, Methacryloyloxydodecy-lpyridinium bromide, Self-etching primers, Tensile bond strength.

Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

PubMed

Lee, Chang Soo; Lee, Jiyoung

2010-09-01

A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

PubMed

Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

2006-01-01

A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

Considerations for high occupancy vehicle (HOV) to high occupancy toll (HOT) lanes conversions primer.

DOT National Transportation Integrated Search

2007-09-01

This primer presents key issues and challenges related to the conversion of high occupancy vehicle (HOV) lanes to high occupancy toll (HOT) lanes. The primer is intended for community leaders, administrators, : the public, and other stakeholders resp...

Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

NASA Technical Reports Server (NTRS)

Mikes, F.; Mowrey, C.; Reis, E.

1985-01-01

Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.

Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

PubMed Central

Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

2007-01-01

Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

A method for predicting service life of zinc rich primers on carbon steel

NASA Technical Reports Server (NTRS)

Hoppesch, C. W.

1986-01-01

The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.

PubMed

Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore

2018-01-01

To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

PubMed Central

Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

2014-01-01

For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

PubMed

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

PubMed

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

The self primer of the long terminal repeat retrotransposon Tf1 is not removed during reverse transcription.

PubMed

Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L

2006-08-01

The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.

Initialization of Formation Flying Using Primer Vector Theory

NASA Technical Reports Server (NTRS)

Mailhe, Laurie; Schiff, Conrad; Folta, David

2002-01-01

In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Multiplex primer prediction software for divergent targets

PubMed Central

Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

2009-01-01

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

PubMed

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Shear bond strengths of an indirect composite layering material to a tribochemically silica-coated zirconia framework material.

PubMed

Iwasaki, Taro; Komine, Futoshi; Fushiki, Ryosuke; Kubochi, Kei; Shinohara, Mitsuyo; Matsumura, Hideo

2016-01-01

This study evaluated shear bond strengths of a layering indirect composite material to a zirconia framework material treated with tribochemical silica coating. Zirconia disks were divided into two groups: ZR-PRE (airborne-particle abrasion) and ZR-PLU (tribochemical silica coating). Indirect composite was bonded to zirconia treated with one of the following primers: Clearfil Ceramic Primer (CCP), Clearfil Mega Bond Primer with Clearfil Porcelain Bond Activator (MGP+Act), ESPE-Sil (SIL), Estenia Opaque Primer, MR. Bond, Super-Bond PZ Primer Liquid A with Liquid B (PZA+PZB), and Super-Bond PZ Primer Liquid B (PZB), or no treatment. Shear bond testing was performed at 0 and 20,000 thermocycles. Post-thermocycling shear bond strengths of ZR-PLU were higher than those of ZR-PRE in CCP, MGP+Act, SIL, PZA+PZB, and PZB groups. Application of silane yielded better durable bond strengths of a layering indirect composite material to a tribochemically silica-coated zirconia framework material.

Do we need primer for orthodontic bonding? A randomized controlled trial.

PubMed

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice. Also this study was powered to ascertain if there was no difference between the 2 groups up to 5%, however orthodontists may consider a change in the bracket failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown statistically to be non-inferior to bonding with primer (P =0.08). There was no significant difference in bond-up times. Bond failure was more likely to happen at the composite-enamel interface when bonded without a primer. No conflict of interest for all authors. No funding sources were used. Study was not registered on external databases. © The Author 2014. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Educational topics for school from the perspective of professionals in the Mobile Emergency Service.

PubMed

Mota, Larissa Larie; Andrade, Selma Regina de

2016-06-01

To systematize, with professionals from the Mobile Emergency Care Service of Santa Catarina municipality, the main issues for the development of an educational tool of attention to the emergency room, dedicated to the school-age population. Qualitative study, conducted through meetings in the focus group format, with 19 professionals who develop their activities in the city Emergency Mobile Emergency Service. Data were categorized and analyzed using thematic analysis technique. The contents discussed at the meetings were grouped into four thematic categories: The Mobile Emergency Service and the school: education and health promotion for children; As the Mobile Emergency Care Service works: What is important to know ?; Something's wrong, what now? and; We are nearly finished, give your opinion. The specific issues arising from the meetings contributed to the production of an educational tool on the activities of the Mobile Emergency Service, which may be used by the School Health Program to promote health education in the care area to the emergency room with the population schoolchildren. Sistematizar, junto aos profissionais do Serviço de Atendimento Móvel de Urgência de um município catarinense, os principais temas para a elaboração de um instrumento educativo sobre atenção às urgências, dedicado à população em idade escolar. Estudo qualitativo, realizado por meio de encontros no formato de grupo focal, com 19 profissionais que desenvolvem suas atividades no Serviço de Atendimento Móvel de Urgência municipal. Os dados foram categorizados e analisados com a técnica de análise temática. Os conteúdos debatidos nos encontros foram agrupados em quatro categorias temáticas: O Serviço de Atendimento Móvel de Urgência e a escola: educação e promoção da saúde para as crianças; Como o Serviço de Atendimento Móvel de Urgência funciona: o que é importante saber?; Tem algo errado, e agora? e; Estamos quase concluindo, dê sua opinião. Os temas específicos resultantes dos encontros contribuíram para a produção de um instrumento educacional sobre as atividades do Serviço de Atendimento Móvel de Urgência, que poderá ser utilizado pelo Programa Saúde na Escola para promover educação em saúde na área de atenção às urgências junto à população em idade escolar.

Nurses in post-operative heart surgery: professional competencies and organization strategies.

PubMed

Santos, Ana Paula Azevedo; Camelo, Silvia Helena Henriques; Santos, Fabiana Cristina Dos; Leal, Laura Andrian; Silva, Beatriz Regina da

2016-01-01

To analyze nurses' competencies with regard to their work in post-operative heart surgery and the strategies implemented to mobilize these competencies. This was an exploratory study with a qualitative approach and a methodological design of collective case study. It was carried out in three post-operative heart surgery units, consisting of 18 nurses. Direct observation and semi-structured interviews were employed to collect data. Data were construed through thematic analysis. nine competencies were found, as follows: theoretical-practical knowledge; high-complexity nursing care; nursing supervision; leadership in nursing; decision making; conflict management; personnel management; material and financial resources management; and on-job continued education. Organizational and individual strategies were employed to develop and improve competencies such as regular offerings of courses and lectures, in addition to the individual pursuit for knowledge and improvement. the study is expected to lead future nurses and training centers to evaluate the need for furthur training required to work in cardiac units, and also the need for implementing programs aimed at developing the competencies of these professionals. Analisar as competências dos enfermeiros para atuarem no pós-operatório de cirurgia cardíaca e estratégias implementadas para a mobilização dessas competências. Estudo exploratório, com abordagem qualitativa e desenho metodológico estudo de caso coletivo. Foi realizado em três unidades pós-operatórias de cirurgias cardíacas, com 18 enfermeiros. Na coleta de dados utilizou-se observação direta e entrevista semiestruturada. Para interpretação dos dados optou-se pela análise temática. Foram identificadas nove competências, sendo: conhecimento teórico-prático, cuidados de enfermagem de alta complexidade, supervisão e liderança em enfermagem, tomada de decisão, gerenciamento de conflitos, de recursos humanos, materiais, financeiros e educação continuada em serviço. Estratégias organizacionais e individuais são realizadas a fim de desenvolver e aprimorar competências, tais como: oferecimento de cursos e palestras periodicamente, além da busca individual por conhecimento e aperfeiçoamento. O estudo deve provocar a reflexão de futuros enfermeiros e dos centros formadores quanto à formação necessária para atuar em unidades cardíacas e sobre a necessidade de implementação de programas que visam desenvolver competências nestes profissionais.

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

USGS Publications Warehouse

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Innovations in bonding to zirconia-based materials. Part II: Focusing on chemical interactions.

PubMed

Aboushelib, Moustafa N; Mirmohamadi, Hesam; Matinlinna, Jukka P; Kukk, Edwin; Ounsi, Hani F; Salameh, Ziad

2009-08-01

The zirconia-resin bond strength was enhanced using novel engineered zirconia primers in combination with selective infiltration etching as a surface pre-treatment. The aim of this study was to evaluate the effect of artificial aging on the chemical stability of the established bond and to understand the activation mechanism of the used primers. Selective infiltration etched zirconia discs (Procera; NobelBiocare) were coated with one of four novel engineered zirconia primers containing reactive monomers and were bonded to resin-composite discs (Panavia F2.0). Fourier transform infrared spectroscopy (FT-IR) was carried out to examine the chemical activation of zirconia primers from mixing time and up to 60min. The bilayered specimens were cut into microbars (1mm(2) in cross-section area) and zirconia-resin microtensile bond strength (MTBS) was evaluated immediately and after 90 days of water storage at 37 degrees C. Scanning electron microscopy (SEM) was used to analyze the fracture surface. There was a significant drop in MTBS values after 90 days of water storage for all tested zirconia primers from ca. 28-41MPa to ca. 15-18MPa after completion of artificial aging. SEM revealed increase in percentage of interfacial failure after water storage. FTIR spectra suggested adequate activation of the experimental zirconia primers within 1h of mixing time. The novel engineered zirconia primers produced initially high bond strength values which were significantly reduced after water storage. Long-term bond stability requires developing more stable primers.

PD5: a general purpose library for primer design software.

PubMed

Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

2013-01-01

Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

Shop primer as part of the corrosion protective coating for submerged steel structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bjordal, M.; Steinsmo, U.

In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough ifmore » the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.« less

Building Trust and Capacity: Disarmament, Demobilization, and Reintegration to Transition Pro-Government Non-State Armed Groups

DTIC Science & Technology

2009-05-11

de Pau. “Cambodia.” Escola de Cultura de Pau, http://www.escolapau.org/img/ programas /desarme/mapa/camboyai.pdf (accessed March 20, 2009). 69...Escola de Cultura de Pau. “Eritrea.” Escola de Cultura de Pau, http://www.escolapau.org/img/ programas /desarme/mapa/eritreai.pdf (accessed March 20...government authorized the formation and support of “rondas” or Comites de auto defensa (Committees of Self Defense) as the government fought the

Relative Militarization and Its Impact on Public Policy Budgetary Shifts in Argentina, 1963-1982

DTIC Science & Technology

1988-07-01

and Z.T. de Quinteros (1981), "El programa de es- tabilizaci6n economica y las politicas de salud y bienestar social 1976- 1980." Cuadernos Medico...Canitrot, A. (1980), "La disciplina como objetivo de la politica ec6nomica. Un ensayo sobre el programa econ6mico del gobierno Argentino desde 1976...Politicas Estatales en America Latina: Hacia una estrategia de investigaci6n." Buenos Aires: Documento CEDES/G. E. CLACSO/N .4. ’ Oszlak, 0. (1977

The International Symposium on Equatorial Aeronomy (10th) Held in Antalya, Turkey on May 17-23, 2000

DTIC Science & Technology

2000-10-23

Paulo - FAPESP, and the Programa de Nicleos de Excelencia - PRONEX. Nu- merical values for the model tides were taken from the GSWM homepage at http...FAPESP, and the Programa de Nilcleos de Excel~ncia-PRONEX. References Batista, P. P., B. R. Clemesha, I. S. Batista and D. M. Simonich, Characteristics...based on M. J. Taylor, H. Takahashi, D. Gobbi, and A. Chemical and Dynamical Processes, Tarun Kumar F. de Medeiros. Pant and R. SRIDHARAN. 13. 17:30-17

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2013 CFR

2013-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2012 CFR

2012-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2011 CFR

2011-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2014 CFR

2014-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2010 CFR

2010-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

EPA Science Inventory

EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

A Primer on Sampling for Statewide Assessment.

ERIC Educational Resources Information Center

Jaeger, Richard M.

This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…

GSP: A web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

30 CFR 57.6304 - Primer protection.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S. N.

2013-08-08

Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

NASA Technical Reports Server (NTRS)

Mikes, F.

1985-01-01

Fourier transform infrared spectroscopy is currently the best technique for observing hydrolytic changes in DC 1200 silane the primers caused by moisture in the atmosphere. To further prove that FTIR can be used as a criterion test for acceptance of silane primer lots, intensities of the FTIR OH- band are being compared with primer adhesive bond strength using a mechanical test suggested by NASA. Results of tests for shear strength and Oh-absorption are tabulated and compared with FTIR absorption intensities in the OH-region.

Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

PubMed Central

Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

2006-01-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

The Self Primer of the Long Terminal Repeat Retrotransposon Tf1 Is Not Removed during Reverse Transcription

PubMed Central

Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.

2006-01-01

The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283

Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

PubMed

Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

2006-12-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

Application of microsatellite primers developed for Polistes in the independent-founding wasp Polists satan Bequaert (Hymenoptera: Vespidae).

PubMed

Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K

2012-06-01

Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals.

Multiplexing Short Primers for Viral Family PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S N; Hiddessen, A L; Hara, C A

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

swga: a primer design toolkit for selective whole genome amplification.

PubMed

Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

2017-07-15

Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

Comparison of the antibacterial activity of different self-etching primers and adhesives.

PubMed

Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray

2008-11-01

The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other adhesive systems, Clearfil Protect Bond Primer (containing MDPB) showed a high antibacterial effect against all microorganizms tested. Two-step, self-etching primer/adhesive system Clearfil Protect Bond might be a suitable choice under minimally invasive restorations. The recently developed one-step, self-etching system Clearfil Tri S Bond showed no antibacterial effect against microorgazims tested.

Bonding to new CAD/CAM resin composites: influence of air abrasion and conditioning agents as pretreatment strategy.

PubMed

Reymus, Marcel; Roos, Malgorzata; Eichberger, Marlis; Edelhoff, Daniel; Hickel, Reinhard; Stawarczyk, Bogna

2018-04-27

Because of their industrially standardized process of manufacturing, CAD/CAM resin composites show a high degree of conversion, making a reliable bond difficult to achieve. The purpose of this experiment was to investigate the tensile bond strength (TBS) of luting composite to CAD/CAM resin composite materials as influenced by air abrasion and pretreatment strategies. The treatment factors of the present study were (1) brand of the CAD/CAM resin composite (Brilliant Crios [Coltene/Whaledent], Cerasmart [GC Europe], Shofu Block HC [Shofu], and Lava Ultimate [3M]); (2) air abrasion vs. no air abrasion; and (3) pretreatment using a silane primer (Clearfil Ceramic Primer, Kuraray) vs. a resin primer (One Coat 7 Universal, Coltene/Whaledent). Subsequently, luting composite (DuoCem, Coltene/Whaledent) was polymerized onto the substrate surface using a mold. For each combination of the levels of the three treatment factors (4 (materials) × 2 (air abrasion vs. no air abrasion; resin) × 2 (primer vs. silane primer)), n = 15, specimens were prepared. After 24 h of water storage at 37 °C and 5000 thermo-cycles (5/55 °C), TBS was measured and failure types were examined. The resulting data was analyzed using Kaplan-Meier estimates of the cumulative failure distribution function with Breslow-Gehan tests and non-parametric ANOVA (Kruskal-Wallis test) followed by the multiple pairwise Mann-Whitney U test with α-error adjustment using the Benjamini-Hochberg procedure and chi-square test (p < 0.05). The additional air abrasion step increased TBS values and lowered failure rates. Specimens pretreated using a resin primer showed significantly higher TBS and lower failure rates than those pretreated using a silane primer. The highest failure rates were observed for groups pretreated with a silane primer. Within the Shofu Block HC group, all specimens without air abrasion and pretreatment with a silane primer debonded during the aging procedure. Before fixation of CAD/CAM resin composites, the restorations should be air abraded and pretreated using a resin primer containing methyl-methacrylate to successfully bond to the luting composite. The pretreatment of the CAD/CAM resin composite using merely a silane primer results in deficient adhesion. For a reliable bond of CAD/CAM resin composites to the luting composite, air abrasion and a special pretreatment strategy are necessary in order to achieve promising long-term results.

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowman, Stephen M

2008-09-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

PubMed

Contreras, Kateir; Vargas, María José; García, Paola; González, Camilo A; Rodríguez, Patricia; Castañeda-Cardona, Camilo; Otálora-Esteban, Margarita; Rosselli, Diego

2018-03-15

Introducción. El citomegalovirus es la causa más frecuente de infección en pacientes con trasplante renal. Existen dos estrategias de similar efectividad para prevenirlo: la profilaxis universal con valganciclovir durante 90 días o el tratamiento anticipado verificando la carga viral semanal y aplicándolo solo si esta es positiva.Objetivo. Determinar cuál de estas dos estrategias sería más costo-efectiva en pacientes de riesgo intermedio en Colombia.Materiales y métodos. Se diseñó un árbol de decisiones bajo la perspectiva del tercer pagador considerando únicamente los costos médicos directos en pesos colombianos (COP) del 2014 durante un periodo de un año en una población de pacientes con riesgo intermedio para citomegalovirus (donante positivo y receptor positivo, o donante negativo y receptor positivo). Las probabilidades de transición se extrajeron de los estudios clínicos y se validaron con expertos mediante el método Delphi.Los costos de los procedimientos se basaron en el manual tarifario ISS 2001, con un incremento del 33 % a partir del índice de precios al consumidor (IPC) en salud de 2014, en tanto que los de los medicamentos se extrajeron de las circulares del Ministerio de Salud y del Sistema de Información de Medicamentos (Sismed).Resultados. La profilaxis universal con valganciclovir resultó ser menos costosa y se asoció con una menor probabilidad de infección. El costo promedio del primer año de tratamiento anticipado sería de COP$ 30'961.290, mientras que el universal sería de COP$ 29'967.834, es decir, un costo 'incremental' de COP$ 993.456.Conclusiones. Para los pacientes de riesgo intermedio con trasplante renal en Colombia, la profilaxis universal es la mejor estrategia por ser menos costosa y reducir el riesgo de infección.

Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

PubMed Central

Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

2003-01-01

A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes - EPA 910-C-12-001

EPA Science Inventory

This primer provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entities in implementing the E...

Charter School Primer. Peter Lang Primer. Volume 34

ERIC Educational Resources Information Center

Tryjankowski, Anne Marie

2012-01-01

The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

Reading Assessment: A Primer for Teachers and Tutors.

ERIC Educational Resources Information Center

Caldwell, JoAnne Schudt

This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…

Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

USDA-ARS?s Scientific Manuscript database

Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

40 CFR 63.3091 - What emission limits must I meet for an existing affected source?

Code of Federal Regulations, 2010 CFR

2010-07-01

... bonding primer, and glass bonding adhesive operations plus all coatings and thinners, except for deadener materials and for adhesive and sealer materials that are not components of glass bonding systems, used in... from primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive...

Murrinh Nganki (Our Language), 1.

ERIC Educational Resources Information Center

Street, Chester; And Others

This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…

A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

ERIC Educational Resources Information Center

Pine, Daniel S.

2006-01-01

This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

PubMed

Robertson, Amber L; Phillips, Allison R

2008-01-01

Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

PubMed Central

Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

2012-01-01

In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

Real-time PCR (qPCR) primer design using free online software.

PubMed

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

Identification of cultivars and validation of genetic relationships in Mangifera indica L. using RAPD markers.

PubMed

Schnell, R J; Ronning, C M; Knight, R J

1995-02-01

Twenty-five accessions of mango were examined for random amplified polymorphic DNA (RAPD) genetic markers with 80 10-mer random primers. Of the 80 primers screened, 33 did not amplify, 19 were monomorphic, and 28 gave reproducible, polymorphic DNA amplification patterns. Eleven primers were selected from the 28 for the study. The number of bands generated was primer- and genotype-dependent, and ranged from 1 to 10. No primer gave unique banding patterns for each of the 25 accessions; however, ten different combinations of 2 primer banding patterns produced unique fingerprints for each accession. A maternal half-sib (MHS) family was included among the 25 accessions to see if genetic relationships could be detected. RAPD data were used to generate simple matching coefficients, which were analyzed phenetically and by means of principal coordinate analysis (PCA). The MHS clustered together in both the phenetic and the PCA while the randomly selected accessions were scattered with no apparent pattern. The uses of RAPD analysis for Mangifera germ plasm classification and clonal identification are discussed.

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

PubMed

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

PubMed Central

Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea

2017-01-01

Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

Rapid identification of red-flesh loquat cultivars using EST-SSR markers based on manual cultivar identification diagram strategy.

PubMed

Li, X Y; Xu, H X; Chen, J W

2014-04-29

Manual cultivar identification diagram is a new strategy for plant cultivar identification based on DNA markers, providing information to efficiently separate cultivars. We tested 25 pairs of apple EST-SSR primers for amplification of PCR products from loquat cultivars. These EST-SSR primers provided clear amplification products from the loquat cultivars, with a relatively high transferability rate of 84% to loquat; 11 pairs of primers amplified polymorphic products. After analysis of 24 red-fleshed loquat accessions, we found that only 7 pairs of primers could clearly separate all of them. A cultivar identification diagram of the 24 cultivars was constructed using polymorphic bands from the DNA fingerprints and EST-SSR primers. Any two of the 24 cultivars could be rapidly separated from each other, according to the polymorphic bands from the cultivars; the corresponding primers were marked in the correct position on the cultivar identification diagram. This red-flesh loquat cultivar identification diagram can separate the 24 red-flesh loquat cultivars, which is of benefit for loquat cultivar identification for germplasm management and breeding programs.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

PubMed Central

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-01-01

Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974

Effect of thione primers on adhesive bonding between an indirect composite material and Ag-Pd-Cu-Au alloy.

PubMed

Imai, Hideyuki; Koizumi, Hiroyasu; Shimoe, Saiji; Hirata, Isao; Matsumura, Hideo; Nikawa, Hiroki

2014-01-01

The current study evaluated the effect of primers on the shear bond strength of an indirect composite material joined to a silverpalladium-copper-gold (Ag-Pd-Cu-Au) alloy (Castwell). Disk specimens were cast from the alloy and were air-abraded with alumina. Eight metal primers were applied to the alloy surface. A light-polymerized indirect composite material (Solidex) was bonded to the alloy. Shear bond strength was determined both before and after the application of thermocycling. Two groups primed with Metaltite (thione) and M. L. Primer (sulfide) showed the greatest post-thermocycling bond strength (8.8 and 6.5 MPa). The results of the X-ray photoelectron spectroscopic (XPS) analysis suggested that the thione monomer (MTU-6) in the Metaltite primer was strongly adsorbed onto the Ag-Pd-Cu-Au alloy surface even after repeated cleaning with acetone. The application of either the thione (MTU-6) or sulfide primer is effective for enhancing the bonding between a composite material and Ag-Pd-Cu-Au alloy.

Comparison of the Chromium Distribution in New Super Koropon Primer to 30 Year Old Super Koropon Using Focused Ion Beam/Scanning Electron Microscopy

NASA Technical Reports Server (NTRS)

Lomness, Janice K.; Calle, Luz Marina

2006-01-01

Super Koropon primer (MB0125-055) plays a significant role in the corrosion protection of areas throughout the Orbiter. Because the Shuttle Program relies so heavily upon the performance of the Koropon primer, it is necessary to fully understand all aspects of the behavior of the coating. One area where little understanding of the Koropon primer still exists is the level of risk associated with age related degradation. Recently, efforts were undertaken to better understand the age life of the Koropon primer and to gain some insight into the aging process of this coating. In that study, an aluminum access panel from the Orbiter Enterprise was used to investigate the performance of the old Koropon film. A control panel was also used to study the performance of new Koropon coating. Preliminary investigations into the performance of aged Super Koropon primer indicated a significant decrease in corrosion protection. This investigation serves as an example of how Focused Ion Beam/Scanning Microscopy can be used to characterize the changes that occur as coatings age.

Use of tannin anticorrosive reaction primer to improve traditional coating systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matamala, G.; Droguett, G.; Smeltzer, W.

1994-04-01

Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less

The Choice of PCR Primers Has Great Impact on Assessments of Bacterial Community Diversity and Dynamics in a Wastewater Treatment Plant

PubMed Central

Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie

2013-01-01

Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498

Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

PubMed

Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

2014-11-01

In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

PubMed

Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

2015-06-01

Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

PubMed

Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

1997-05-02

Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

PubMed

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

PubMed Central

Raji, S. Hamid; Ghorbanipour, Reza; Majdzade, Fateme

2011-01-01

Background: The aim of this study was to evaluate the shear bond strength of an antimicrobial and fluoride-releasing self-etch primer (clearfil protect bond) and compare it with transbond plus self-etch primer and conventional acid etching and priming system. Materials and Methods: Forty-eight extracted human premolars were divided randomly to three groups. In group 1, the teeth were bonded with conventional acid etching and priming method. In group 2, the teeth were bonded with clearfil protect bond self-etch primer, and transbond plus self-etch primer was used to bond the teeth in group 3. The samples were stored in 37°C distilled water and thermocycled. Then, the SBS of the sample was evaluated with Zwick testing machine. Descriptive statistics and the analysis of variances (ANOVA) and Tukey's test and Kruskal-Wallis were used to analyze the data. Results: The results of the ANOVA showed that the mean of group 3 was significantly lower than that of other groups. Most of the sample showed a pattern of failure within the adhesive resin. Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel. PMID:23372605

Vygotsky on Education Primer. Peter Lang Primer. Volume 30

ERIC Educational Resources Information Center

Lake, Robert

2012-01-01

The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

ERIC Educational Resources Information Center

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Nanotechnology: A Policy Primer

DTIC Science & Technology

2010-03-12

clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

Nanotechnology: A Policy Primer

DTIC Science & Technology

2010-01-04

clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

Protective Coats For Zinc-Rich Primers

NASA Technical Reports Server (NTRS)

Macdowell, Louis G, III

1993-01-01

Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Treesearch

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Newly developed primers for complete YCF1 amplification in Pinus (Pinaceae) chloroplasts with possible family-wide utility

Treesearch

Matthew Parks; Aaron Liston; Rich Cronn

2011-01-01

Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...

The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

ERIC Educational Resources Information Center

Schubert, Sandra; Zelinsky, Benjamin

Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

Culture-bound syndromes in migratory contexts: the case of Bolivian immigrants.

PubMed

Roldán-Chicano, María Teresa; Fernández-Rufete, José; Hueso-Montoro, César; García-López, María Del Mar; Rodríguez-Tello, Javier; Flores-Bienert, María Dolores

2017-07-10

to describe the culture-bound syndromes maintained by Bolivian immigrants in the new migratory context and analyze the care processes of these health problems. qualitative research with an ethnographic methodological approach. Sample: 27 Bolivian immigrants. In-depth interviews and participatory observation were the strategies used for data collection. Data were classified and categorized into logical schemes manually and using the ATLAS-ti program v.5. susto, "wayras", amartelo, pasmo de sol, pasmo de luna and pasmo de sereno are some of the folk illnesses that affect the Bolivian immigrants and that they have to treat in the new migratory context. in the new environment, the group under study preserves culture-bound syndromes that are common in their country of origin. The care strategies used for these health problems are adapted to the resources of the new context and based on interactions with the domestic environment, biomedicine and traditional medicine. It was observed the need for the health professionals to realize that the efficacy of certain therapies occurs within the scope of cultural beliefs and not in that of the scientific evidence. descrever as síndromes vinculadas à cultura mantidas pelos imigrantes bolivianos no novo contexto migratório e analisar os processos de cuidado para esses problemas de saúde. projeto de pesquisa de natureza qualitativa e com abordagem metodológica etnográfica. Amostra: 27 imigrantes bolivianos. As estratégias para a coleta de dados foram as entrevistas em profundidade e a observação participativa. Os dados foram classificados e categorizados em esquemas lógicos manualmente e por meio do programa ATLAS-ti v.5. o susto, os "wayras", o amartelo (tristeza), o pasmo de sol, o pasmo de lua e o pasmo de sereno são algumas das síndromes de caráter popular que acometem os imigrantes bolivianos, e que eles tratam no novo contexto migratório. no novo ambiente, as síndromes vinculadas à cultura, comuns em seu país de origem, são mantidas pelo grupo estudado. As formas de cuidado para esses problemas de saúde são adaptadas aos recursos do novo contexto e baseadas em interações com o ambiente doméstico, a biomedicina e a medicina tradicional. Foi constatada a necessidade de que os profissionais de saúde reconheçam que a eficácia de determinadas terapias se dá no âmbito das crenças culturais e não no âmbito da comprovação científica. describir los síndromes de filiación cultural que mantienen los inmigrantes bolivianos en el nuevo contexto migratorio y analizar los procesos de atención de estos padecimientos. diseño de investigación de carácter cualitativo con enfoque metodológico etnográfico. Muestra: 27 inmigrantes bolivianos. Las estrategias para recoger datos fueron las entrevistas en profundidad y la observación participante. Los datos se categorizaron y ordenaron en esquemas lógicos manualmente y a través del programa ATLAS-ti v.5. el susto, los "wayras", el amartelo, el pasmo de sol, el pasmo de luna y el pasmo de sereno son algunos de los síndromes de carácter folk que los inmigrantes bolivianos padecen y tratan en el nuevo contexto migratorio. en el nuevo entorno, el colectivo estudiado mantiene síndromes de filiación cultural comunes en su país de origen. Las formas de atención de éstos padecimientos se adaptan a los recursos del nuevo contexto y se basan en transacciones con el ámbito doméstico, la biomedicina y la medicina tradicional. Se constata la necesidad de que el profesional sanitario reconozca que la efectividad percibida de ciertas terapias opera dentro del ámbito de las creencias culturales y no en el de la evidencia científica.

Nursing interventions for rehabilitation in Parkinson's disease: cross mapping of terms.

PubMed

Tosin, Michelle Hyczy de Siqueira; Campos, Débora Moraes; Andrade, Leonardo Tadeu de; Oliveira, Beatriz Guitton Renaud Baptista de; Santana, Rosimere Ferreira

2016-08-08

to perform a cross-term mapping of nursing language in the patient record with the Nursing Interventions Classification system, in rehabilitation patients with Parkinson's disease. a documentary research study to perform cross mapping. A probabilistic, simple random sample composed of 67 records of patients with Parkinson's disease who participated in a rehabilitation program, between March of 2009 and April of 2013. The research was conducted in three stages, in which the nursing terms were mapped to natural language and crossed with the Nursing Interventions Classification. a total of 1,077 standard interventions that, after crossing with the taxonomy and refinement performed by the experts, resulted in 32 interventions equivalent to the Nursing Interventions Classification (NIC) system. The NICs, "Education: The process of the disease.", "Contract with the patient", and "Facilitation of Learning" were present in 100% of the records. For these interventions, 40 activities were described, representing 13 activities by intervention. the cross mapping allowed for the identification of corresponding terms with the nursing interventions used every day in rehabilitation nursing, and compared them to the Nursing Interventions Classification. realizar o mapeamento cruzado de termos da linguagem de Enfermagem, com o sistema de Classificação das Intervenções de Enfermagem, em prontuários de pacientes com doença de Parkinson em reabilitação. estudo de pesquisa documental, para realização de mapeamento cruzado. Amostra probabilística, do tipo aleatória simples, composta por 67 prontuários de pacientes com doença de Parkinson que participaram de programa de reabilitação, entre março de 2009 e abril de 2013. Pesquisa realizada em três etapas onde foram mapeados os termos de Enfermagem em linguagem livre e cruzados com o sistema de Classificação das Intervenções de Enfermagem. foram identificadas 1.077 intervenções normalizadas que, após o cruzamento com a taxonomia e o refinamento feito pelos especialistas, resultaram em 32 intervenções equivalentes ao sistema de Classificação das Intervenções de Enfermagem. "Ensino: Processo da doença", "Contrato com o Paciente" e "Facilitação da Aprendizagem" estiveram presentes em 100% dos prontuários. Para essas, foram descritas 40 atividades, representando 13 atividades por intervenção prescrita. o mapeamento cruzado permitiu levantar os termos correspondentes às Intervenções de Enfermagem utilizados no cotidiano dos enfermeiros de reabilitação e compará-los ao sistema de Classificação das Intervenções de Enfermagem. realizar el mapeo cruzado de términos del lenguaje de Enfermería con el Sistema de Clasificación de las Intervenciones de Enfermería en historias clínicas de pacientes con enfermedad de Parkinson en rehabilitación. estudio de investigación documental para realización de mapeo cruzado. Muestra probabilística de tipo aleatoria simple, compuesta por 67 historias clínicas de pacientes con enfermedad de Parkinson que participaron del programa de rehabilitación entre marzo de 2009 y abril de 2013. Investigación realizada en tres etapas donde fueron mapeados los términos de Enfermería en lenguaje libre y cruzados con el sistemas de Clasificación de Intervenciones de Enfermería. se identificaron 1077 intervenciones normalizadas que, después del cruzamiento con la taxonomía y el refinamiento hecho por los especialistas, resultaron en 32 intervenciones equivalentes al sistema de Clasificación de Intervenciones de Enfermería. "Enseñanza: Proceso de la enfermedad", "Contrato con el paciente" y "Facilitación del aprendizaje" estuvieron presentes en 100% de las historias clínicas. Para éstas, se describieron 40 actividades, representando 13 actividades por cada intervención prescripta. el mapeo cruzado permitió encontrar los términos correspondientes a las Intervenciones en Enfermería utilizados en el día a día de los enfermeros de rehabilitación y compararlos con el sistema de Clasificación de Intervenciones de Enfermería.

Primer ID Validates Template Sampling Depth and Greatly Reduces the Error Rate of Next-Generation Sequencing of HIV-1 Genomic RNA Populations

PubMed Central

Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr

2015-01-01

ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299

Effects of dual antibacterial agents MDPB and nano-silver in primer on microcosm biofilm, cytotoxicity and dentin bond properties

PubMed Central

Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.

2013-01-01

Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889

Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

PubMed Central

Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

2013-01-01

Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

PubMed

Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

2016-09-29

The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Beam shaping for laser initiated optical primers

NASA Astrophysics Data System (ADS)

Lizotte, Todd E.

2008-08-01

Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.