Sample records for primer set specific

  1. PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

    PubMed Central

    Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

    2006-01-01

    PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

  2. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    NASA Astrophysics Data System (ADS)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  3. Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

    PubMed

    Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

    2007-01-01

    Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

  4. Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.

    PubMed

    Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo

    2017-05-28

    Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.

  5. Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

    PubMed

    Lee, Chang Soo; Lee, Jiyoung

    2010-09-01

    A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

  6. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  7. URPD: a specific product primer design tool.

    PubMed

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2012-06-19

    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  8. Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

    PubMed

    Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

    2017-08-01

    Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

  9. Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

    PubMed Central

    Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

    2011-01-01

    Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

  10. Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

    PubMed Central

    Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

    2007-01-01

    Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

  11. Molecular method for determining sex of walruses

    USGS Publications Warehouse

    Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

    2008-01-01

    We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

  12. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  13. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    PubMed

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  14. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    PubMed Central

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  15. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    PubMed

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  16. Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii

    PubMed Central

    Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon

    2005-01-01

    Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482

  17. Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

    PubMed

    Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

    2015-01-01

    This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  18. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  19. Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

    PubMed

    Gonzales, J L; Loza, A; Chacon, E

    2006-03-15

    There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

  20. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

    PubMed Central

    Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

    2016-01-01

    Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

  1. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  2. Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

    PubMed Central

    Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

    2005-01-01

    Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

  3. Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

    PubMed

    Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

    2018-01-01

    Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  4. Detection of fumonisin producing Fusarium verticillioides in paddy (Oryza sativa L.) using polymerase chain reaction (PCR)

    PubMed Central

    Maheshwar, P.K.; Moharram, S. Ahmed; Janardhana, G.R.

    2009-01-01

    The study reports the occurrence of fumonisin producing Fusarium verticillioides in 90 samples of stored paddy (Oryza sativa L.) collected from different geographical regions of Karnataka, India. Fumonisin producing F. verticillioides was identified based on micromorphological characteristics and PCR using two sets of primers. One set of primers was F. verticillioides species specific, which selectively amplified the intergenic space region of rDNA. The other set of primers was specific to fumonisin producing F. verticillioides. Eight paddy samples were positive for F. verticillioides. Eleven isolates obtained from these samples were capable of producing fumonisin. PMID:24031332

  5. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    PubMed

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  6. Multiplex primer prediction software for divergent targets

    PubMed Central

    Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

    2009-01-01

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

  7. Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

    USGS Publications Warehouse

    Ostberg, C.O.; Rodriguez, R.J.

    2004-01-01

    Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

  8. A PCR primer bank for quantitative gene expression analysis.

    PubMed

    Wang, Xiaowei; Seed, Brian

    2003-12-15

    Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

  9. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  10. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  11. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

    PubMed Central

    Bokulich, Nicholas A.

    2013-01-01

    Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

  12. Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

    PubMed

    Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

    2018-03-09

    Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, H.U.G.; Gray, J.W.

    1995-06-27

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

  14. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, Heinz-Ulrich G.; Gray, Joe W.

    1995-01-01

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

  15. Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

    PubMed

    Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

    2013-03-01

    Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  16. Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

    USDA-ARS?s Scientific Manuscript database

    TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

  17. Development of the polymerase chain reaction for diagnosis of chancroid.

    PubMed Central

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

    1993-01-01

    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  18. Assessing the performance of a Loop Mediated Isothermal Amplification (LAMP) assay for the detection and subtyping of high-risk suptypes of Human Papilloma Virus (HPV) for Oropharyngeal Squamous Cell Carcinoma (OPSCC) without DNA purification.

    PubMed

    Rohatensky, Mitchell G; Livingstone, Devon M; Mintchev, Paul; Barnes, Heather K; Nakoneshny, Steven C; Demetrick, Douglas J; Dort, Joseph C; van Marle, Guido

    2018-02-08

    Oropharyngeal Squamous Cell Carcinoma (OPSCC) is increasing in incidence despite a decline in traditional risk factors. Human Papilloma Virus (HPV), specifically subtypes 16, 18, 31 and 35, has been implicated as the high-risk etiologic agent. HPV positive cancers have a significantly better prognosis than HPV negative cancers of comparable stage, and may benefit from different treatment regimens. Currently, HPV related carcinogenesis is established indirectly through Immunohistochemistry (IHC) staining for p16, a tumour suppressor gene, or polymerase chain reaction (PCR) that directly tests for HPV DNA in biopsied tissue. Loop mediated isothermal amplification (LAMP) is more accurate than IHC, more rapid than PCR and is significantly less costly. In previous work we showed that a subtype specific HPV LAMP assay performed similar to PCR on purified DNA. In this study we examined the performance of this LAMP assay without DNA purification. We used LAMP assays using established primers for HPV 16 and 18, and new primers for HPV 31 and 35. LAMP reaction conditions were tested on serial dilutions of plasmid HPV DNA to confirm minimum viral copy number detection thresholds. LAMP was then performed directly on different human cell line samples without DNA purification. Our LAMP assays could detect 10 5 , 10 3 , 10 4 , and 10 5 copies of plasmid DNA for HPV 16, 18, 31, and 35, respectively. All primer sets were subtype specific, with no cross-amplification. Our LAMP assays also reliably amplified subtype specific HPV DNA from samples without requiring DNA isolation and purification. The high risk OPSCC HPV subtype specific LAMP primer sets demonstrated, excellent clinically relevant, minimum copy number detection thresholds with an easy readout system. Amplification directly from samples without purification illustrated the robust nature of the assay, and the primers used. This lends further support HPV type specific LAMP assays, and these specific primer sets and assays can be further developed to test for HPV in OPSCC in resource and lab limited settings, or even bedside testing.

  19. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

    USGS Publications Warehouse

    Taylor, P.W.; Winton, J.R.

    2002-01-01

    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  20. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    PubMed

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  1. A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.

    PubMed

    Murata, C; Ogura, G; Kuroiwa, A

    2011-03-01

    To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.

  2. Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

    PubMed

    Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

    2014-07-01

    In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

    PubMed

    Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

    2005-12-01

    Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

  4. Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

    PubMed

    Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

    2015-08-01

    Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

    PubMed

    Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

    2013-01-01

    Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

  6. Molecular Tools for the Detection of Nitrogen Cycling Archaea

    PubMed Central

    Rusch, Antje

    2013-01-01

    Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

  7. Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.

    PubMed

    Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam

    2013-01-01

    There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.

  8. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

    PubMed

    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

    2008-08-01

    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

  9. DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

    PubMed

    Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

    2009-01-01

    * At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

  10. Multiprimer PCR system for differential identification of mycobacteria in clinical samples.

    PubMed Central

    Del Portillo, P; Thomas, M C; Martínez, E; Marañón, C; Valladares, B; Patarroyo, M E; Carlos López, M

    1996-01-01

    A novel multiprimer PCR method with the potential to identify mycobacteria in clinical samples is presented. The assay relies on the simultaneous amplification of three bacterial DNA genomic fragments by using different sets of oligonucleotide primers. The first set of primers amplifies a 506-bp fragment from the gene for the 32-kDa antigen of Mycobacterium tuberculosis, which is present in most of the species belonging to the genus Mycobacterium. The second set of primers amplifies a 984-bp fragment from the IS6110 insertion sequence of the bacteria belonging to the M. tuberculosis complex. The third set of primers, derived from an M. tuberculosis species-specific sequence named MTP40, amplifies a 396-bp genomic fragment. Thus, while the multiprimer system would render three amplification fragments from the M. tuberculosis genome and two fragments from the Mycobacterium bovis genome, a unique amplification fragment would be obtained from nontuberculous mycobacteria. The results obtained, using reference mycobacterial strains and typed clinical isolates, show that the multiprimer PCR method may be a rapid, sensitive, and specific tool for the differential identification of various mycobacterial strains in a single-step assay. PMID:8789008

  11. Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

    PubMed Central

    Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

    2013-01-01

    Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

  12. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    PubMed

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  13. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    PubMed Central

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-01-01

    Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974

  14. Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers.

    PubMed

    Koester, Meike; Gergs, René

    2017-10-05

    Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

  15. Evaluation of the PCR method for identification of Bifidobacterium species.

    PubMed

    Youn, S Y; Seo, J M; Ji, G E

    2008-01-01

    Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

  16. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  17. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  18. De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

    PubMed Central

    Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

    2012-01-01

    Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

  19. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE PAGES

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

    2014-01-01

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  20. A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

    NASA Astrophysics Data System (ADS)

    Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

    2015-12-01

    Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

  1. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    PubMed

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  2. Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR

    PubMed Central

    Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam

    2013-01-01

    There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209

  3. Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.

    PubMed

    Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun

    2007-10-01

    Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.

  4. Validation and Application of a Real-time PCR Protocol for the Specific Detection and Quantification of Clavibacter michiganensis subsp. sepedonicus in Potato.

    PubMed

    Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk

    2015-06-01

    Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×10(2) copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10(-6) dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension.

  5. Validation and Application of a Real-time PCR Protocol for the Specific Detection and Quantification of Clavibacter michiganensis subsp. sepedonicus in Potato

    PubMed Central

    Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk

    2015-01-01

    Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×102 copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10−6 dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension. PMID:26060431

  6. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification

    PubMed Central

    Guo, Xu-Guang; Zhou, Shan

    2014-01-01

    Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360

  8. Improving qPCR methodology for detection of foaming bacteria by analysis of broad-spectrum primers and a highly specific probe for quantification of Nocardia spp. in activated sludge.

    PubMed

    Asvapathanagul, P; Olson, B H

    2017-01-01

    To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.

  9. Poliovirus serotype-specific VP1 sequencing primers.

    PubMed

    Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

    2011-06-01

    The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

  10. Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

    PubMed

    Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

    2014-01-01

    Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

  11. Identification of duck plague virus by polymerase chain reaction.

    PubMed

    Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

  12. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    PubMed

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Review of "A School Privatization Primer for Michigan School Officials, Media and Residents"

    ERIC Educational Resources Information Center

    Belfield, Clive

    2008-01-01

    Issued by the Mackinac Center for Public Policy, "A School Privatization Primer for Michigan School Officials, Media and Residents" examines the "contracting out" of public school support services--specifically food, transportation, and custodial services. The report describes the prevalence of contracting out and sets forth…

  14. Characterization of Biofilm Community Structure by Ribosomal RNA sequences

    DTIC Science & Technology

    1989-12-01

    for strains of Fibrobacter, 2) Desulfobacter genus-specific probe, 3) Desulfosarcina genus-specific probe, 4) archaebacterial kingdom -specific probes...and 5) eubacterial kingdom -specific probes 5) eukaryote kingdom -specific probe and 6) a general probe encompassing all characterized sulfate-reducing...sets have been fabricated. The group-specific primer sets selectively amplify either sulfate-reducing bacteria or archaebacteria . The SRB-specific

  15. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

    PubMed Central

    Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-01-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  16. Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.

    Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

  17. Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

    DOE PAGES

    Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...

    2016-07-15

    Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

  18. Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

    PubMed

    Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

    2013-11-01

    The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

  19. Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

    PubMed Central

    Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

    2013-01-01

    The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

  20. Multiplex real-time PCR assay for Legionella species.

    PubMed

    Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

    2015-12-01

    Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

    PubMed

    Panicker, Gitika; Bej, Asim K

    2005-10-01

    We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

  2. Influenza Risk Management: Lessons Learned from an A(H1N1) pdm09 Outbreak Investigation in an Operational Military Setting

    DTIC Science & Technology

    2013-07-10

    of the virus in Spain was detected during an outbreak investigation of influenza -like illness (ILI) in soldiers from an engineering military academy...SwInfA primer and probe set) and specific A(H1N1) pdm09 influenza A viruses using SwH1 primer and probe set developed by CDC, Atlanta (WHO...CY062374, CY062375 and CY062376. Viral culture Influenza viruses were isolated from clinical samples by infecting Madin Darby Canine Kidney (MDCK

  3. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

    DOE PAGES

    Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

    2018-03-27

    Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

  4. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

    Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

  5. Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

    USDA-ARS?s Scientific Manuscript database

    Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

  6. Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea

    PubMed Central

    Kurosaki, Yohei; Magassouba, N’Faly; Oloniniyi, Olamide K.; Cherif, Mahamoud S.; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro

    2016-01-01

    Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure. PMID:26900929

  7. Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea.

    PubMed

    Kurosaki, Yohei; Magassouba, N'Faly; Oloniniyi, Olamide K; Cherif, Mahamoud S; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro

    2016-02-01

    Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure.

  8. Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

    PubMed Central

    Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea

    2017-01-01

    Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

  9. Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

    PubMed

    Chen, Huaihai; Yu, Fangbo; Shi, Wei

    2016-12-01

    Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  10. Pathotypic characterization of Newcastle disease virus isolated from vaccinated chicken in West Java, Indonesia.

    PubMed

    Putri, Dwi Desmiyeni; Handharyani, Ekowati; Soejoedono, Retno Damajanti; Setiyono, Agus; Mayasari, Ni Luh Putu Ika; Poetri, Okti Nadia

    2017-04-01

    This research was conducted to differentiate and characterize eight Newcastle disease virus (NDV) isolates collected from vaccinated chicken at commercial flocks in West Java, Indonesia, in 2011, 2014 and 2015 by pathotype specific primers. A total of eight NDV isolates collected from clinical outbreaks among commercial vaccinated flocks in West Java, Indonesia, in 2011, 2014, and 2015 were used in this study. Reverse transcription-polymerase chain reaction was used to detect and differentiate virulence of NDV strains, using three sets of primers targeting their M and F gene. First primers were universal primers to detect NDV targeting matrix (M) gene. Other two sets of primers were specific for the fusion (F) gene cleavage site sequence of virulent and avirulent NDV strains. Our results showed that three isolates belong to NDV virulent strains, and other five isolates belong to NDV avirulent strains. The nucleotide sequence of the F protein cleavage site showed 112 K/R-R-Q/R-K-R/G-F 117 on NDV virulent strains and 112 G-K/R-Q-G-R-L 117 on NDV avirulent strain. Result from the current study suggested that NDV virulent strain were circulating among vaccinated chickens in West Java, Indonesia; this might possess a risk of causing ND outbreaks and causing economic losses within the poultry industry.

  11. Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

    PubMed Central

    Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

    1994-01-01

    Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

  12. Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

    PubMed Central

    Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

    2005-01-01

    Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

  13. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

    PubMed

    Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

    2011-05-01

    A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

  14. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    PubMed

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  15. Grapevine fleck virus-like viruses in Vitis.

    PubMed

    Sabanadzovic, S; Abou-Ghanem, N; Castellano, M A; Digiaro, M; Martelli, G P

    2000-01-01

    Two sets of degenerate primers for the specific amplification of 572-575 nt and 386 nt segments of the methyltransferase and RNA- dependent RNA polymerase cistrons of members of the genera Tymovirus and Marafivirus and of the unassigned virus Grapevine fleck virus (GFkV) were designed on the basis of available sequences. These primers were used for amplifying and subsequent cloning and sequencing part of the open reading frame 1 of the genome of GFkV, Grapevine asteroid mosaic-associated virus (GAMaV) and of another previously unreported virus, for which the name Grapevine red globe virus (GRGV) is proposed. Computer-assisted analysis of the amplified genome portions showed that the three grapevine viruses are phylogenetically related with one another and with sequenced tymoviruses and marafiviruses. The relationships with tymoviruses was confirmed by the type of ultrastructural modifications induced in the host cells. RdRp-specific degenerate primers were successfully used for the aspecific detection of the three viruses in crude grapevine sap extracts. Specific virus identification was obtained with RT-PCR using antisense virus-specific primers.

  16. Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

    PubMed

    Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

    2005-01-01

    PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

  17. FindGDPs: fast identification of primers for labeling microbial transcriptomes for DNA microarray analysis

    PubMed Central

    Blick, Robert J.; Revel, Andrew T.; Hansen, Eric J.

    2008-01-01

    Summary FindGDPs is a program that uses a greedy algorithm to quickly identify a set of genome-directed primers that specifically anneal to all of the open reading frames in a genome and that do not exhibit full-length complementarity to the members of another user-supplied set of nucleotide sequences. Availability The program code is distributed under the GNU General Public License at http://www8.utsouthwestern.edu/utsw/cda/dept131456/files/159331.html Contact eric.hansen@utsouthwestern.edu PMID:15593406

  18. A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

    PubMed

    Kemp, S J; Maillard, J C; Teale, A J

    1993-04-01

    A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

  19. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

    PubMed

    Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

    2012-01-01

    An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.

  20. A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

    PubMed

    Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

    2015-07-01

    Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Hindering the illegal trade in dog and cat furs through a DNA-based protocol for species identification.

    PubMed

    Garofalo, Luisa; Mariacher, Alessia; Fanelli, Rita; Fico, Rosario; Lorenzini, Rita

    2018-01-01

    In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.

  2. Development of loop-mediated isothermal amplification (LAMP) assays for the rapid detection of allergic peanut in processed food.

    PubMed

    Sheu, Shyang-Chwen; Tsou, Po-Chuan; Lien, Yi-Yang; Lee, Meng-Shiou

    2018-08-15

    Peanut is a widely and common used in many cuisines around the world. However, peanut is also one of the most important food allergen for causing anaphylactic reaction. To prevent allergic reaction, the best way is to avoid the food allergen or food containing allergic ingredient such as peanut before food consuming. Thus, to efficient and precisely detect the allergic ingredient, peanut or related product, is essential and required for maintain consumer's health or their interest. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of allergic peanut using specifically designed primer sets. Two sets of the specific LAMP primers respectively targeted the internal transcribed sequence 1 (ITS1) of nuclear ribosomal DNA sequence regions and the ara h1 gene sequence of Arachia hypogeae (peanut) were used to address the application of LAMP for detecting peanut in processed food or diet. The results demonstrated that the identification of peanut using the newly designed primers for ITS 1 sequence is more sensitive rather than primers for sequence of Ara h1 gene when performing LAMP assay. Besides, the sensitivity of LAMP for detecting peanut is also higher than the traditional PCR method. These LAMP primers sets showed high specificity for the identification of the peanut and had no cross-reaction to other species of nut including walnut, hazelnut, almonds, cashew and macadamia nut. Moreover, when minimal 0.1% peanuts were mixed with other nuts ingredients at different ratios, no any cross-reactivity was evident during performing LAMP. Finally, genomic DNAs extracted from boiled and steamed peanut were used as templates; the detection of peanut by LAMP was not affected and reproducible. As to this established LAMP herein, not only can peanut ingredients be detected but commercial foods containing peanut can also be identified. This assay will be useful and potential for the rapid detection of peanut in practical food markets. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Use of molecular techniques to evaluate the survival of a microorganism injected into an aquifer

    USGS Publications Warehouse

    Thiem, S.M.; Krumme, M.L.; Smith, R.L.; Tiedje, J.M.

    1994-01-01

    A PCR primer set and an internal probe that are specific for Pseudomonas sp. strain B13, a 3-chlorobenzoate-metabolizing strain, were developed. Using this primer set and probe, we were able to detect Pseudomonas sp. strain B13 DNA sequences in DNA extracted from aquifer samples 14.5 months after Pseudomonas sp. strain B13 had been injected into a sand and gravel aquifer. This primer set and probe were also used to analyze isolates from 3-chlorobenzoate enrichments of the aquifer samples by Southern blot analysis. Hybridization of Southern blots with the Pseudomonas sp. strain B13-specific probe and a catabolic probe in conjunction with restriction fragment length polymorphism (RFLP) analysis of ribosome genes was used to determine that viable Pseudomonas sp. strain B13 persisted in this environment. We isolated a new 3-chlorobenzoate-degrading strain from one of these enrichment cultures. The B13-specific probe does not hybridize to DNA from this isolate. The new strain could be the result of gene exchange between Pseudomonas sp. strain B13 and an indigenous bacterium. This speculation is based on an RFLP pattern of ribosome genes that differs from that of Pseudomonas sp. strain B13, the fact that identically sized restriction fragments hybridized to the catabolic gene probe, and the absence of any enrichable 3-chlorobenzoate-degrading strains in the aquifer prior to inoculation.

  4. Improved PCR assay for the species-specific identification and quantitation of Legionella pneumophila in water.

    PubMed

    Cho, Min Seok; Ahn, Tae-Young; Joh, Kiseong; Lee, Eui Seok; Park, Dong Suk

    2015-11-01

    Legionellosis outbreak is a major global health care problem. However, current Legionella risk assessments may be compromised by uncertainties in Legionella detection methods, infectious dose, and strain infectivity. These limitations may place public health at significant risk, leading to significant monetary losses in health care. However, there are still unmet needs for its rapid identification and monitoring of legionellae in water systems. Therefore, in the present study, a primer set was designed based on a LysR-type transcriptional regulator (LTTR) family protein gene of Legionella pneumophila subsp. pneumophila str. Philadelphia 1 because it was found that this gene is structurally diverse among species through BLAST searches. The specificity of the primer set was evaluated using genomic DNA from 6 strains of L. pneumophila, 5 type strains of other related Legionella species, and other 29 reference pathogenic bacteria. The primer set used in the PCR assay amplified a 264-bp product for only targeted six strains of L. pneumophila. The assay was also able to detect at least 1.39 × 10(3) copies/μl of cloned amplified target DNA using purified DNA or 7.4 × 10(0) colony-forming unit per reaction when using calibrated cell suspension. In addition, the sensitivity and specificity of this assay were confirmed by successful detection of Legionella pneumophila in environmental water samples.

  5. Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

    PubMed

    Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-10-01

    Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

  6. Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

    PubMed

    Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

    2009-12-01

    The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

  7. Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

    PubMed

    Kokosková, B; Mráz, I; Fousek, J

    2010-05-01

    Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

  8. Development of duplex PCR for simultaneous detection of Theileria spp. and Anaplasma spp. in sheep and goats.

    PubMed

    Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen

    2017-05-01

    Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3  ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

    PubMed Central

    2012-01-01

    Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

  10. Implementation of Novel Design Features for qPCR-Based eDNA Assessment

    PubMed Central

    Veldhoen, Nik; Hobbs, Jared; Ikonomou, Georgios; Hii, Michael; Lesperance, Mary; Helbing, Caren C.

    2016-01-01

    Environmental stewardship requires timely, accurate information related to the status of a given ecosystem and the species that occupy it. Recent advances in the application of the highly sensitive real-time quantitative polymerase chain reaction (qPCR) towards identification of constituents within environmental DNA (eDNA) now allow targeted detection of the presence of species-specific biological material within a localized geographic region. However, as with all molecular techniques predicated on the specificity and sensitivity of the PCR assay, careful validation of each eDNA qPCR assay in development must be performed both under controlled laboratory conditions and when challenged with field-derived eDNA samples. Such a step-wise approach forms the basis for incorporation of innovative qPCR design features that strengthen the implementation and interpretation of the eDNA assay. This includes empirical determination that the qPCR assay is refractory to the presence of human DNA and the use of a tripartite assay approach comprised of 1) a primer set targeting plant chloroplast that evaluates the presence of amplifiable DNA from field samples to increase confidence in a negative result, 2) an animal group primer set to increase confidence in the assay result, and 3) a species-specific primer set to assess presence of DNA from the target species. To demonstrate this methodology, we generated eDNA assays specific for the North American bullfrog (Lithobates (Rana) catesbeiana) and the Rocky Mountain tailed frog (Ascaphus montanus) and characterized each with respect to detection sensitivity and specificity with demonstrated performance in a field survey scenario. The qPCR design features presented herein address specific challenges of eDNA assays thereby increasing their interpretative power. PMID:27802293

  11. Alignment-Free Design of Highly Discriminatory Diagnostic Primer Sets for Escherichia coli O104:H4 Outbreak Strains

    PubMed Central

    Bielaszewska, Martina; Karch, Helge; Toth, Ian K.

    2012-01-01

    Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact. PMID:22496820

  12. Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

    PubMed

    Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

    2016-09-01

    Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

  13. Diagnosis and molecular characterization of Trichomonas vaginalis in sex workers in the Philippines

    PubMed Central

    Queza, Macario Ireneo P; Rivera, Windell L

    2013-01-01

    Trichomonas vaginalis is a pathogenic protozoon which causes the sexually transmitted infection, trichomoniasis. The absence or non-specificity of symptoms often leads to misdiagnosis of the infection. In this study, 969 samples consisting of vaginal swabs and urine were collected and screened from social hygiene clinics across the Philippines. Of the 969 samples, 216 were used for the comparative analysis of diagnostic tools such as wet mount microscopy, culture, and PCR utilizing universal trichomonad primers, TFR1/2 and species-specific primers, TVK3/7 and TV1/2. PCR demonstrated higher sensitivity of 100% compared to 77% of the wet mount. PCR primer set TVK3/7 and culture had the same and the best expected average performance [receiver-operating characteristic (ROC): 0.98]. Prevalence of infection in the sample population was 6.8%. PMID:23683368

  14. Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

    PubMed

    Cowan, Ashley F; Elkins, Kelly M

    2017-12-01

    Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

  15. Development of Fluorescent Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) using Quenching Probes for the Detection of the Middle East Respiratory Syndrome Coronavirus.

    PubMed

    Shirato, Kazuya; Semba, Shohei; El-Kafrawy, Sherif A; Hassan, Ahmed M; Tolah, Ahmed M; Takayama, Ikuyo; Kageyama, Tsutomu; Notomi, Tsugunori; Kamitani, Wataru; Matsuyama, Shutoku; Azhar, Esam Ibraheem

    2018-05-12

    Clinical detection of Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV) in patients is achieved using genetic diagnostic methods, such as real-time RT-PCR assay. Previously, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of MERS-CoV [Virol J. 2014. 11:139]. Generally, amplification of RT-LAMP is monitored by the turbidity induced by precipitation of magnesium pyrophosphate with newly synthesized DNA. However, this mechanism cannot completely exclude the possibility of unexpected reactions. Therefore, in this study, fluorescent RT-LAMP assays using quenching probes (QProbes) were developed specifically to monitor only primer-derived signals. Two primer sets (targeting nucleocapsid and ORF1a sequences) were constructed to confirm MERS cases by RT-LAMP assay only. Our data indicate that both primer sets were capable of detecting MERS-CoV RNA to the same level as existing genetic diagnostic methods, and that both were highly specific with no cross-reactivity observed with other respiratory viruses. These primer sets were highly efficient in amplifying target sequences derived from different MERS-CoV strains, including camel MERS-CoV. In addition, the detection efficacy of QProbe RT-LAMP was comparable to that of real-time RT-PCR assay using clinical specimens from patients in Saudi Arabia. Altogether, these results indicate that QProbe RT-LAMP assays described here can be used as powerful diagnostic tools for rapid detection and surveillance of MERS-CoV infections. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Use of a Hierarchical Oligonucleotide Primer Extension Approach for Multiplexed Relative Abundance Analysis of Methanogens in Anaerobic Digestion Systems

    PubMed Central

    Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu

    2013-01-01

    In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716

  17. Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes.

    PubMed

    Treder, Krzysztof; Chołuj, Joanna; Zacharzewska, Bogumiła; Babujee, Lavanya; Mielczarek, Mateusz; Burzyński, Adam; Rakotondrafara, Aurélie M

    2018-02-01

    Potato virus Y (PVY) infection has been a global challenge for potato production and the leading cause of downgrading and rejection of seed crops for certification. Accurate and timely diagnosis is a key for effective disease control. Here, we have optimized a reverse transcription loop-mediated amplification (RT-LAMP) assay to differentiate the PVY O and N serotypes. The RT-LAMP assay is based on isothermal autocyclic strand displacement during DNA synthesis. The high specificity of this method relies heavily on the primer sets designed for the amplification of the targeted regions. We designed specific primer sets targeting a region within the coat protein gene that contains nucleotide signatures typical for O and N coat protein types, and these primers differ in their annealing temperature. Combining this assay with total RNA extraction by magnetic capture, we have established a highly sensitive, simplified and shortened RT-LAMP procedure as an alternative to conventional nucleic acid assays for diagnosis. This optimized procedure for virus detection may be used as a preliminary test for identifying the viral serotype prior to investing time and effort in multiplex RT-PCR tests when a specific strain is needed.

  18. Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

    PubMed Central

    2014-01-01

    Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

  19. Specific Detection of Clavibacter michiganensis subsp. sepedonicus by Amplification of Three Unique DNA Sequences Isolated by Subtraction Hybridization.

    PubMed

    Mills, D; Russell, B W; Hanus, J W

    1997-08-01

    ABSTRACT Three single-copy, unique DNA fragments, designated Cms50, Cms72, and Cms85, were isolated from strain CS3 of Clavibacter michiganensis subsp. sepedonicus by subtraction hybridization using driver DNA from C. michiganensis subsp. insidiosus, C. michiganensis subsp. michiganensis, and Rhodococcus facians. Radio-labeled probes made of these fragments and used in Southern blot analysis revealed each to be absolutely specific to all North American C. michiganensis subsp. sepedonicus strains tested, including plasmidless and nonmucoid strains. The probes have no homology with genomic DNA from related C. michiganensis subspecies insidiosus, michiganensis, and tessellarius, nor with DNA from 11 additional bacterial species and three unidentified strains, some of which have been previously reported to display cross-reactivity with C. michiganensis subsp. sepedonicus-specific antisera. The three fragments shared no homology, and they appeared to be separated from each other by at least 20 kbp in the CS3 genome. Internal primer sets permitted amplification of each fragment by the polymerase chain reaction (PCR) only from C. michiganensis subsp. sepedonicus DNA. In a PCR-based sensitivity assay using a primer set that amplifies Cms85, the lowest level of detection of C. michiganensis subsp. sepedonicus was 100 CFU per milliliter when cells were added to potato core fluid. Erroneous results that may arise from PCR artifacts and mutational events are, therefore, minimized by the redundancy of the primer sets, and the products should be verifiable with unique capture probes in sequence-based detection systems.

  20. Electrochemical genosensing of Salmonella, Listeria and Escherichia coli on silica magnetic particles.

    PubMed

    Liébana, Susana; Brandão, Delfina; Cortés, Pilar; Campoy, Susana; Alegret, Salvador; Pividori, María Isabel

    2016-01-21

    A magneto-genosensing approach for the detection of the three most common pathogenic bacteria in food safety, such as Salmonella, Listeria and Escherichia coli is presented. The methodology is based on the detection of the tagged amplified DNA obtained by single-tagging PCR with a set of specific primers for each pathogen, followed by electrochemical magneto-genosensing on silica magnetic particles. A set of primers were selected for the amplification of the invA (278 bp), prfA (217 bp) and eaeA (151 bp) being one of the primers for each set tagged with fluorescein, biotin and digoxigenin coding for Salmonella enterica, Listeria monocytogenes and E. coli, respectively. The single-tagged amplicons were then immobilized on silica MPs based on the nucleic acid-binding properties of silica particles in the presence of the chaotropic agent as guanidinium thiocyanate. The assessment of the silica MPs as a platform for electrochemical magneto-genosensing is described, including the main parameters to selectively attach longer dsDNA fragments instead of shorter ssDNA primers based on their negative charge density of the sugar-phosphate backbone. This approach resulted to be a promising detection tool with sensing features of rapidity and sensitivity very suitable to be implemented on DNA biosensors and microfluidic platforms. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

    PubMed Central

    Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

    2010-01-01

    A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

  2. Event-specific plasmid standards and real-time PCR methods for transgenic Bt11, Bt176, and GA21 maize and transgenic GT73 canola.

    PubMed

    Taverniers, Isabel; Windels, Pieter; Vaïtilingom, Marc; Milcamps, Anne; Van Bockstaele, Erik; Van den Eede, Guy; De Loose, Marc

    2005-04-20

    Since the 18th of April 2004, two new regulations, EC/1829/2003 on genetically modified food and feed products and EC/1830/2003 on traceability and labeling of GMOs, are in force in the EU. This new, comprehensive regulatory framework emphasizes the need of an adequate tracing system. Unique identifiers, such as the transgene genome junction region or a specific rearrangement within the transgene DNA, should form the basis of such a tracing system. In this study, we describe the development of event-specific tracing systems for transgenic maize lines Bt11, Bt176, and GA21 and for canola event GT73. Molecular characterization of the transgene loci enabled us to clone an event-specific sequence into a plasmid vector, to be used as a marker, and to develop line-specific primers. Primer specificity was tested through qualitative PCRs and dissociation curve analysis in SYBR Green I real-time PCRs. The primers were then combined with event-specific TaqMan probes in quantitative real-time PCRs. Calibration curves were set up both with genomic DNA samples and the newly synthesized plasmid DNA markers. It is shown that cloned plasmid GMO target sequences are perfectly suitable as unique identifiers and quantitative calibrators. Together with an event-specific primer pair and a highly specific TaqMan probe, the plasmid markers form crucial components of a unique and straighforward tracing system for Bt11, Bt176, and GA21 maize and GT73 canola events.

  3. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    PubMed

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. SPECIES-SPECIFIC DETECTION OF THREE HUMAN-PATHOGENIC MICROSPORIDIAL SPECIES FROM THE GENUS ENCEPHALITOZOON VIA FLUOROGENIC 5' NUCLEASE PCR ASSAYS

    EPA Science Inventory

    This describes fluorogenic 5' nuclease PCR assays suitable for rapid, sensitive, quantitative, high-throughput detection of the human-pathogenic microsporidial species Encephalitozoon hellem, E. cunicli and E. intestinalis. The assays utilize species-specific primer sets and a g...

  5. A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

    PubMed

    Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

    2017-02-01

    Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Nodavirus infections in Israeli mariculture.

    PubMed

    Ucko, M; Colorni, A; Diamant, A

    2004-08-01

    Viral encephalopathy and retinopathy (VER) infections were diagnosed in five fish species: Epinephelus aeneus, Dicentrarchus labrax, Sciaenops ocellatus, Lates calcarifer and Mugil cephalus cultured on both the Red Sea and Mediterranean coasts of Israel during 1998-2002. Spongiform vacuolation of nervous tissue was observed in histological sections of all examined species. With transmission electron microscopy, paracrystalline arrays and pieces of membrane-associated non-enveloped virions measuring approximately 30 nm in diameter were observed in the brain and retina of all species. At the molecular level, the nodavirus was detected by using a primer set that amplified the T4 region of the coat protein gene. When the same set of primers was used to search for VER in an additional fish species, Sparus aurata, it was found to produce non-specific amplicons, giving rise to false-positive results. This problem was overcome by using a different primer set (F1/VR3), designed on a highly conserved region of the virus gene, which amplified a fragment of 254 bp, and confirmed that S. aurata was nodavirus-free. This set was validated on all five species of infected fish, as well as clinically healthy fish. Comparison of the coat protein genes from the Israeli isolated sequences indicated that more than one viral strain was involved. No strict host-specificity was evident. Red Sea and Mediterranean isolated sequences grouped in distinct clusters, together with several foreign isolates from the Mediterranean area and the Far East, as phylogenetically close to the Epinephelus akaara RGNNV type.

  7. Primer design for a prokaryotic differential display RT-PCR.

    PubMed Central

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-01-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

  8. Primer design for a prokaryotic differential display RT-PCR.

    PubMed

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  9. Molecular diagnosis of group B coltiviruses infections.

    PubMed

    Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X

    1999-08-01

    The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.

  10. Development of loop-mediated isothermal amplification with Plasmodium falciparum unique genes for molecular diagnosis of human malaria.

    PubMed

    Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian

    2017-07-01

    In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a promising tool for diagnosis of P. falciparum infection.

  11. Development and Validation of Broad-Range Qualitative and Clade-Specific Quantitative Molecular Probes for Assessing Mercury Methylation in the Environment.

    PubMed

    Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A

    2016-10-01

    Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.

  12. Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR

    PubMed Central

    Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam

    2017-01-01

    Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824

  13. Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR.

    PubMed

    Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W

    2017-01-01

    Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.

  14. Enhanced Reliability and Accuracy for Field Deployable Bioforensic Detection and Discrimination of Xylella fastidiosa subsp. pauca, Causal Agent of Citrus Variegated Chlorosis Using Razor Ex Technology and TaqMan Quantitative PCR

    PubMed Central

    Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

    2013-01-01

    A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333

  15. Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated chlorosis using razor ex technology and TaqMan quantitative PCR.

    PubMed

    Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

    2013-01-01

    A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.

  16. Development of loop-mediated isothermal amplification assay for specific and rapid detection of differential goat pox virus and sheep pox virus.

    PubMed

    Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang

    2014-01-17

    Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.

  17. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  18. Development of primer sets for loop-mediated isothermal amplification that enables rapid and specific detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    USDA-ARS?s Scientific Manuscript database

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three ...

  19. The development of loop-mediated isothermal amplification (LAMP) assays for the rapid authentication of five forbidden vegetables in strict vegetarian diets

    PubMed Central

    Lee, Meng-Shiou; Su, Ting-Ying; Lien, Yi-Yang; Sheu, Shyang-Chwen

    2017-01-01

    Plant-based food ingredients such as garlic, Chinese leek, Chinese onion, green onion and onion are widely used in many cuisines around the world. However, these ingredients known as the “five forbidden vegetables” (FFVs) are not allowed in some vegetarian diets. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of FFVs using five respective LAMP primer sets. The specific primers targeted the ITS1-5.8S-ITS2 nuclear ribosomal DNA sequence regions among the five vegetables. The results demonstrated that the identification of FFVs using the newly developed LAMP assay is more sensitive than the traditional PCR method. Using pepper, basil, parsley, chili and ginger as references, established LAMP primer sets showed high specificity for the identification of the FFV species. Moreover, when FFVs were mixed with other plant ingredients at different ratios (100:0, 50:50, 20:80, 10:90, 5:95, 2:98, and 1:99), no cross-reactivity was evident using LAMP. Finally, genomic DNAs extracted from boiled and steamed FFVs in processed foods were used as templates; the performance of the LAMP reaction was not influenced using validated LAMP primers. Not only can FFV ingredients be identified but commercial foods containing FFVs can also be authenticated. This LAMP method will be useful for the authentication of FFVs in practical food markets in the future. PMID:28290475

  20. The development of loop-mediated isothermal amplification (LAMP) assays for the rapid authentication of five forbidden vegetables in strict vegetarian diets.

    PubMed

    Lee, Meng-Shiou; Su, Ting-Ying; Lien, Yi-Yang; Sheu, Shyang-Chwen

    2017-03-14

    Plant-based food ingredients such as garlic, Chinese leek, Chinese onion, green onion and onion are widely used in many cuisines around the world. However, these ingredients known as the "five forbidden vegetables" (FFVs) are not allowed in some vegetarian diets. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of FFVs using five respective LAMP primer sets. The specific primers targeted the ITS1-5.8S-ITS2 nuclear ribosomal DNA sequence regions among the five vegetables. The results demonstrated that the identification of FFVs using the newly developed LAMP assay is more sensitive than the traditional PCR method. Using pepper, basil, parsley, chili and ginger as references, established LAMP primer sets showed high specificity for the identification of the FFV species. Moreover, when FFVs were mixed with other plant ingredients at different ratios (100:0, 50:50, 20:80, 10:90, 5:95, 2:98, and 1:99), no cross-reactivity was evident using LAMP. Finally, genomic DNAs extracted from boiled and steamed FFVs in processed foods were used as templates; the performance of the LAMP reaction was not influenced using validated LAMP primers. Not only can FFV ingredients be identified but commercial foods containing FFVs can also be authenticated. This LAMP method will be useful for the authentication of FFVs in practical food markets in the future.

  1. A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

    PubMed

    Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

    2012-06-01

    The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

  2. [A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

    PubMed

    Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

    2013-10-18

    To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

  3. Simultaneous, specific and real-time detection of biothreat and frequently encountered food-borne pathogens

    PubMed Central

    Woubit, Abdela Salah; Yehualaeshet, Teshome; Habtemariam, Tsegaye; Samuel, Temesgen

    2012-01-01

    The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia and Francisella include important food safety and biothreat agents causing food-related and other human illnesses worldwide. We aimed to develop rapid methods with the capability to simultaneously and differentially detect all six pathogens in one run. Our initial experiments to use previously reported sets of primers revealed non-specificity of some of the sequences when tested against a broader array of pathogens, or proved not optimal for simultaneous detection parameters. By extensive mining of the whole genome and protein databases of diverse closely and distantly related bacterial species and strains, we have identified unique genome regions, which we utilized to develop a detection platform. Twelve of the specific genomic targets we have identified to design the primers in F. tularensis ssp. tularensis, F. tularensis ssp. novicida, S. dysentriae, S. typhimurium, V. cholera, Y. pestis, and Y. pseudotuberculosis contained either hypothetical or putative proteins, the functions of which have not been clearly defined. Corresponding primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in-silico PCR against whole genome sequences of different species, sub-species, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (E.coli O157:H7 strain EDL 933, Shigella dysentriae, Salmonella typhi, Francisella tularensis ssp. tularensis, Vibrio cholera, and Yersinia pestis) and six foodborne pathogens (Salmonella typhimurium, Salmonella saintpaul, Shigella sonnei, Francisella novicida, Vibrio parahemolytica and Yersinia pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed using purified DNA showed the lowest detection limit of 640 fg DNA/µl for F. tularensis. A preliminary test done to detect Shigella organisms in a milk matrix showed that 6–60 colony forming units of the bacterium per milliliter of milk could be detected in about an hour. Therefore, we have developed a platform to simultaneously detect foodborne pathogen and biothreat agents specifically and in real-time. Such a platform could enable rapid detection or confirmation of contamination by these agents. PMID:22488053

  4. Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

    PubMed

    Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

    2015-08-14

    In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.

  5. swga: a primer design toolkit for selective whole genome amplification.

    PubMed

    Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

    2017-07-15

    Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  6. Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

    PubMed

    Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

    2014-06-03

    Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

  7. Priming cases disturb visual search patterns in screening mammography

    NASA Astrophysics Data System (ADS)

    Lewis, Sarah J.; Reed, Warren M.; Tan, Alvin N. K.; Brennan, Patrick C.; Lee, Warwick; Mello-Thoms, Claudia

    2015-03-01

    Rationale and Objectives: To investigate the effect of inserting obvious cancers into a screening set of mammograms on the visual search of radiologists. Previous research presents conflicting evidence as to the impact of priming in scenarios where prevalence is naturally low, such as in screening mammography. Materials and Methods: An observer performance and eye position analysis study was performed. Four expert breast radiologists were asked to interpret two sets of 40 screening mammograms. The Control Set contained 36 normal and 4 malignant cases (located at case # 9, 14, 25 and 37). The Primed Set contained the same 34 normal and 4 malignant cases (in the same location) plus 2 "primer" malignant cases replacing 2 normal cases (located at positions #20 and 34). Primer cases were defined as lower difficulty cases containing salient malignant features inserted before cases of greater difficulty. Results: Wilcoxon Signed Rank Test indicated no significant differences in sensitivity or specificity between the two sets (P > 0.05). The fixation count in the malignant cases (#25, 37) in the Primed Set after viewing the primer cases (#20, 34) decreased significantly (Z = -2.330, P = 0.020). False-Negatives errors were mostly due to sampling in the Primed Set (75%) in contrast to in the Control Set (25%). Conclusion: The overall performance of radiologists is not affected by the inclusion of obvious cancer cases. However, changes in visual search behavior, as measured by eye-position recording, suggests visual disturbance by the inclusion of priming cases in screening mammography.

  8. Multiplexing Short Primers for Viral Family PCR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S N; Hiddessen, A L; Hara, C A

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

  9. Comparison of Ribotyping, Randomly Amplified Polymorphic DNA Analysis, and Pulsed-Field Gel Electrophoresis in Typing of Lactobacillus rhamnosus and L. casei Strains

    PubMed Central

    Tynkkynen, Soile; Satokari, Reetta; Saarela, Maria; Mattila-Sandholm, Tiina; Saxelin, Maija

    1999-01-01

    A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 334, respectively, but did not give any signal with the recently revived species L. zeae, which contains the type strain ATCC 15820 and the strain ATCC 393, which was previously classified as L. casei. Our results are in accordance with the suggested new classification of the L. casei group. Altogether, 21 of the 24 strains studied were identified with the species-specific primers. In strain typing, PFGE was the most discriminatory method, revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD analysis yielded 15 and 12 genotypes, respectively. PMID:10473394

  10. Comparison of ribotyping, randomly amplified polymorphic DNA analysis, and pulsed-field gel electrophoresis in typing of Lactobacillus rhamnosus and L. casei strains.

    PubMed

    Tynkkynen, S; Satokari, R; Saarela, M; Mattila-Sandholm, T; Saxelin, M

    1999-09-01

    A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 334, respectively, but did not give any signal with the recently revived species L. zeae, which contains the type strain ATCC 15820 and the strain ATCC 393, which was previously classified as L. casei. Our results are in accordance with the suggested new classification of the L. casei group. Altogether, 21 of the 24 strains studied were identified with the species-specific primers. In strain typing, PFGE was the most discriminatory method, revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD analysis yielded 15 and 12 genotypes, respectively.

  11. A novel non-sequencing approach for rapid authentication of Testudinis Carapax et Plastrum and Trionycis Carapax by species-specific primers

    PubMed Central

    Yu, Pingtian; Lu, Yi; Jiao, Zhaoqun; Chen, Liqun; Zhou, Ying; Shen, Yuping; Jia, Xiaobin

    2018-01-01

    A novel non-sequencing approach was developed to detect short DNA fragments (ca 100 bp) for rapid authentication of two natural products, namely Testudinis Carapax et Plastrum and Trionycis Carapax, based on the difference in mitochondrial genome. Five specifically designed primer reactions were established to target species for reliable identification of their commercial products. They were confirmed to have a high level of inter-species-specificity and good intra-species stability. The limit of detection was estimated to be 1 ng of genomes for all of five assays. Also, the validation results demonstrated that the raw materials and processed products in addition to some of the highly processed products can be conveniently authenticated with good sensitivity and precision by this newly proposed approach. Especially, when reference sample mixtures were assayed, these primer sets have still performed well but not the prevailing COI barcoding technology. These could assist in the discrimination and identification of other animal-derived medicines for their form of raw material, the pulverized and the complex. PMID:29765667

  12. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    PubMed Central

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  13. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    PubMed

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  14. Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

    PubMed Central

    2014-01-01

    Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

  15. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    PubMed

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We found that a number of variables, including the virus type examined, primers and probe efficiency and stability, and assay conditions, including thermocycler platform, can affect the data obtained from qRT-PCR assays. These results indicate that qRT-PCR assays can be used to detect IBV challenge virus, but each assay, including the assay conditions and thermocycler, should be individually evaluated if those data are expected to be comparable to virus detection in embryonated eggs.

  16. Species identification and sex determination of the genus Nepenthes (Nepenthaceae).

    PubMed

    Mokkamul, Piya; Chaveerach, Arunrat; Sudmoon, Runglawan; Tanee, Tawatchai

    2007-02-15

    Nepenthes species are well known for their ornamentally attractive pitchers. The species diversity was randomly surveyed in some conservation areas of Thailand and three species were found, namely N. gracilis Korth., N. mirabilis Druce. and N. smilesii Hemsl. Young plants as unknown species from Chatuchak market were added in plant sampled set. Thirty two Inter Simple Sequence Repeat (ISSR) primers were screened and 13 successful primers were used to produce DNA banding patterns for constructing a dendrogram. The dendrogram is potentially power tool to identify unknown species from Chatuchak market, differentiate species population, population by geographical areas and sex determination. The geographical area of N. mirabilis was specified to Southern and Northeastern regions and finally, subdivided into exact areas according to province. Male and female plants of N. gracilis at Phu Wua Wildlife Sanctuary and N. mirabilis at Bung Khonglong non-hunting area were determined. Two unknown species from Chatuchak market were analyzed to be N. mirabilis with the genetic similarities (S) 77.2 to 84.7. Be more sex specific in all sample studied, 37 Random Amplified Polymorphic DNA (RAPD) primers were investigated. The result shows that only one RAPD primer show high resolution results at about 750 bp specific male-related marker.

  17. A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

    PubMed Central

    Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

    2015-01-01

    High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

  18. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  19. Design of primers and probes for quantitative real-time PCR methods.

    PubMed

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  20. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food.

    PubMed

    Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K

    2015-09-08

    The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.

  1. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

    PubMed Central

    Kim, Kwang-Pyo; Singh, Atul K.; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K.

    2015-01-01

    The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL. PMID:26371000

  2. Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

    PubMed

    Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

    2015-07-01

    Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

  3. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

    PubMed Central

    Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

    1996-01-01

    In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

  4. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    PubMed Central

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  5. Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae subsp. dysgalactiae isolated from farmed fish.

    PubMed

    Nomoto, R; Kagawa, H; Yoshida, T

    2008-01-01

    To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.

  6. Development of a loop-mediated isothermal amplification (LAMP) assay for rapid and specific detection of common genetically modified organisms (GMOs).

    PubMed

    Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu

    2015-03-01

    Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.

  7. A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

    PubMed

    Nishitani, Goh; Yoshida, Masaki

    2018-06-01

    This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

  8. Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

    USGS Publications Warehouse

    Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

    1999-01-01

    We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

  9. [Genotyping of the Chinese isolates of coltivirus].

    PubMed

    Xu, Li-hong; Tao, San-ju; Cao, Yu-xi; Wang, Huan-qin; Yang, Dong-rong; He, Ying; Liu, Qin-zhi; Chen, Bo-quan

    2003-12-01

    To classify the Chinese isolates of Coltiviruses. Three sets of primers were selected among them two were specific to the 9th and 12th segments of subgroup B2, and one was for the 12th segment of subgroup B1-All the Chinese isolates of Coltivirus selected in the experiment were classified according to the lengths of different amplicons of the reverse transcriptase-polymerase Chain reaction (RT-PCR). The homogenicity of the nucleic acids of the isolates BJ95-75 and YN-6 was also compared with other Coltivirus strains belonging to subgroup B2. With the primers 12-854-S/12-B2-R, which were specific to the 12th segment of Coltivirus subgroup B2-850 bp amplicons were obtained from Beijing isolate BJ95-75 and all the Yunnan isolates such as YN-6, -67-1, -68-1, -69, -70-1, -70-2, -90, -92-2, -93 of Coltivirus 492 bp DNA fragments were also amplified from all of them with the segment 9th specific primers 9-JKT-S/9-JKT-R. However no positive results were obtained from Northeast isolates NE97-12, NE97-31 and control viruses YN-99(Orbivirus),YN-151-1(JEV) with the same two sets of primers. With 12-B1-S/12-B1R primers specific to the 12th segment of subgroup B1, no amplicons of right length were obtained from any of the Chinese isolates of Coltivirus and the control viruses. When compared the nucleic acid sequences of BJ95-75 and YN-6 with other Coltivirus strains such as Bannavirus, JKT6423, JKT6969, JKT7043, the amplicons from segment 12th of these two strains had more than 89.4% homology with the other strains, especially to the earlier Chinese isolate Bannavirus, the homolog was more then 98.9%. Nearly 96.5% and 99.2% of the nucleic acids of the amplicons from segment 9th of the two strains were being homologous to Bannavirus and about 84.0% to JKT6423, which had been classified into type B2a. But the maximal homogenicity was about 53% when compared with the other two coltivirus strains. JKT6969 and JKT7043 which had been classified into type B2b. Genotyping the recent Chinese isolates of coltivirus for the first time in our country. Most of the Chinese isolates belong to subgroup B2, more exactly type B2a. The Northeast isolates NE97-12 and NE97-31 were not correctly grouped with the available primers.

  10. A novel monoclonal Perkinsus chesapeaki in vitro isolate from an Australian cockle, Anadara trapezia.

    PubMed

    Reece, Kimberly S; Scott, Gail P; Dang, Cécile; Dungan, Christopher F

    2017-09-01

    A monoclonal Perkinsus chesapeaki isolate was established from 1 of 10 infected Australian Anadara trapezia cockles. Morphological features were similar to those of described P. chesapeaki isolates, and also included a unique vermiform schizont cell-type. Perkinsus olseni-specific PCR primers amplified DNAs from all 10 cockles. Perkinsus chesapeaki-specific primers also amplified DNAs from 4/10 cockles, including DNA from the isolate source cockle. Three different sets of DNA sequences from the monoclonal isolate grouped with the homologous, previously deposited, P. chesapeaki sequences in phylogenetic analyses. In situ hybridization assays detected both P. chesapeaki and P. olseni cells in histological sections from the source cockle for monoclonal isolate ATCC PRA-425. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Detection and Heterogeneity of Herpesviruses Causing Pacheco's Disease in Parrots

    PubMed Central

    Tomaszewski, Elizabeth; Wilson, Van G.; Wigle, William L.; Phalen, David N.

    2001-01-01

    Pacheco's disease (PD) is a common, often fatal, disease of parrots. We cloned a virus isolate from a parrot that had characteristic lesions of PD. Three viral clones were partially sequenced, demonstrating that this virus was an alphaherpesvirus most closely related to the gallid herpesvirus 1. Five primer sets were developed from these sequences. The primer sets were used with PCR to screen tissues or tissue culture media suspected to contain viruses from 54 outbreaks of PD. The primer sets amplified DNA from all but one sample. Ten amplification patterns were detected, indicating that PD is caused by a genetically heterogeneous population of viruses. A single genetic variant (psittacid herpesvirus variant 1) amplified with all primer sets and was the most common virus variant (62.7%). A single primer set (23F) amplified DNA from all of the positive samples, suggesting that PCR could be used as a rapid postmortem assay for these viruses. PCR was found to be significantly more sensitive than tissue culture for the detection of psittacid herpesviruses. PMID:11158102

  12. Method for rapid detection and identification of chaetomium and evaluation of resistance to peracetic acid.

    PubMed

    Nakayama, Motokazu; Hosoya, Kouichi; Tomiyama, Daisuke; Tsugukuni, Takashi; Matsuzawa, Tetsuhiro; Imanishi, Yumi; Yaguchi, Takashi

    2013-06-01

    In the beverage industry, peracetic acid has been increasingly used as a disinfectant for the filling machinery and environment due to merits of leaving no residue, it is safe for humans, and its antiseptic effect against fungi and endospores of bacteria. Recently, Chaetomium globosum and Chaetomium funicola were reported resistant to peracetic acid; however, little is known concerning the detail of peracetic acid resistance. Therefore, we assessed the peracetic acid resistance of the species of Chaetomium and related genera under identical conditions and made a thorough observation of the microstructure of their ascospores by transmission electron microscopy. The results of analyses revealed that C. globosum and C. funicola showed the high resistance to peracetic acid (a 1-D antiseptic effect after 900 s and 3-D antiseptic effect after 900 s) and had thick cell walls of ascospores that can impede the action mechanism of peracetic acid. We also developed specific primers to detect the C. globosum clade and identify C. funicola by using PCR to amplify the β-tubulin gene. PCR with the primer sets designed for C. globosum (Chae 4F/4R) and C. funicola (Cfu 2F/2R) amplified PCR products specific for the C. globosum clade and C. funicola, respectively. PCR with these two primer sets did not detect other fungi involved in food spoilage and environmental contamination. This detection and identification method is rapid and simple, with extremely high specificity.

  13. Microsatellite markers for Vellozia gigantea (Velloziaceae), a narrowly endemic species to the Brazilian campos rupestres.

    PubMed

    Martins, Ana Paula V; Proite, Karina; Kalapothakis, Evanguedes; Santos, Fabrício R; Chaves, Anderson V; Borba, Eduardo L

    2012-07-01

    Microsatellite primers were developed for the first time in Velloziaceae, in the endangered species Vellozia gigantea. Using two different protocols, seven primer sets were characterized in three populations of V. gigantea. The primers amplified di- and trinucleotide repeats with six to 12 alleles per locus. These revealed high levels of genetic variation, presenting an average observed heterozygosity of 0.508 in V. gigantea. The seven primers were tested for cross-amplification in three Vellozia species. All primers successfully amplified in V. auriculata. Six primers amplified in V. compacta and three in V. hirsuta. The new marker set described here will be useful for studies of population genetics of V. gigantea. The cross-amplification results indicate the utility of primers for studies in other Vellozia species.

  14. DNA-based identification of Brassica vegetable species for the juice industry.

    PubMed

    Etoh, Kazumi; Niijima, Noritaka; Yokoshita, Masahiko; Fukuoka, Shin-Ichi

    2003-10-01

    Since kale (Brassica oleracea var. acephala), a cruciferous vegetable with a high level of vitamins and functional compounds beneficial to health and wellness, has become widely used in the juice industry, a precise method for quality control of vegetable species is necessary. We describe here a DNA-based identification method to distinguish kale from cabbage (Brassica oleracea var. capitata), a closely related species, which can be inadvertently mixed with kale during the manufacturing process. Using genomic DNA from these vegetables and combinatory sets of nucleotide primers, we screened for random amplified polymorphic DNA (RAPD) fragments and found three cabbage-specific fragments. These RAPD fragments, with lengths of 1.4, 0.5, and 1.5 kb, were purified, subcloned, and sequenced. Based on sequence-tagged sites (STS), we designed sets of primers to detect cabbage-specific identification (CAI) DNA markers. Utilizing the CAI markers, we successfully distinguished more than 10 different local cabbage accessions from 20 kale accessions, and identified kale juices experimentally spiked with different amounts of cabbage.

  15. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  16. Primer Modification Improves Rapid and Sensitive In Vitro and Field-Deployable Assays for Detection of High Plains Virus Variants

    PubMed Central

    Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.

    2014-01-01

    A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574

  17. Application of the multiplex PCR method for discrimination of Artemisia iwayomogi from other Artemisia herbs.

    PubMed

    Lee, Mi Young; Doh, Eui Jeong; Kim, Eung Soo; Kim, Young Wha; Ko, Byong Seob; Oh, Seung-Eun

    2008-04-01

    Some plants classified in the genus Artemisia are used for medicinal purposes. In particular, A. iwayomogi, which is referred to as 'Haninjin,' is used as an important medicinal material in traditional Korean medicine. However, A. capillaris, and both A. argyi and A. princeps, referred to as 'Injinho' and 'Aeyup,' respectively, are used for purposes other than those for which 'Haninjin' is utilized. However, it is occasionally difficult to differentiate 'Haninjin' from 'Injinho' and/or 'Aeyup' on the basis of their morphological features, particularly when in the dried and/or sliced form. Therefore, the development of a reliable method by which to discriminate 'Haninjin' from other Artemisia herbs, especially 'Injinho' and 'Aeyup,' is clearly necessary. We recently determined that the RAPD (random amplified polymorphic DNA) technique can be used to discriminate efficiently between some Artemisia herbs. In particular, when applied to RAPD, the non-specific UBC primer 391 (5'-GCG AAC CTC G-3') was demonstrated to amplify PCR products specific to A. iwayomogi. Based on the nucleotide sequences of the PCR product, we designed a 2F1 (5'-ACC TCG GAC CTA AAT ACA-3')/ 2F3 (5'-TTA TGA TTC ATG TTC AAT TC-3') primer set to amplify a SCAR (sequence-characterized amplified region) marker of A. iwayomogi. Employing this primer set, along with two other primer sets amplifying SCAR markers of 'Aeyup' (A. argyi and A. princeps) and both 'Injinho' (A. capillaris) and A. japonica, which are classified into the same subgroup in a phenogram constructed from RAPD analysis, we developed a multiplex PCR method by which A. iwayomogi could be discriminated with certainty from other Artemisia herbs. Via this method, we determined not only whether the tested Artemisia herb was A. iwayomogi, but also which Artemisia herbs were tested concurrently with A. iwayomogi.

  18. Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

    PubMed

    Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

    2009-08-01

    Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

  19. Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay

    PubMed Central

    Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

    2016-01-01

    For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. PMID:27044566

  20. The significance of gtf genes in caries expression: a rapid identification of Streptococcus mutans from dental plaque of child patients.

    PubMed

    Mishra, Apurva; Pandey, Ramesh K; Manickam, Natesan

    2015-01-01

    Rapid phylogenetic and functional gene (gtfB) identification of S. mutans from the dental plaque derived from children. Dental plaque collected from fifteen patients of age group 7-12 underwent centrifugation followed by genomic DNA extraction for S. mutans. Genomic DNA was processed with S. mutans specific primers in suitable PCR condtions for phylogenetic and functional gene (gtfB) identification. The yield and results were confirmed by agarose gel electrophoresis. 1% agarose gel electrophoresis depicts the positive PCR amplification at 1,485 bp when compared with standard 1 kbp indicating the presence of S. mutans in the test sample. Another PCR reaction was set using gtfB primers specific for S. mutans for functional gene identification. 1.2% agarose gel electrophoresis was done and a positive amplication was observed at 192 bp when compared to 100 bp standards. With the advancement in molecular biology techniques, PCR based identification and quantification of the bacterial load can be done within hours using species-specific primers and DNA probes. Thus, this technique may reduce the laboratory time spend in conventional culture methods, reduces the possibility of colony identification errors and is more sensitive to culture techniques.

  1. Molecular diagnosis of symptomatic toxoplasmosis: a 9-year retrospective and prospective study in a referral laboratory in São Paulo, Brazil.

    PubMed

    Camilo, Lilian Muniz; Pereira-Chioccola, Vera Lucia; Gava, Ricardo; Meira-Strejevitch, Cristina da Silva; Vidal, Jose Ernesto; Brandão de Mattos, Cinara Cássia; Frederico, Fábio Batista; De Mattos, Luiz Carlos; Spegiorin, Lígia Cosentino Junqueira Franco

    Symptomatic forms of toxoplasmosis are a serious public health problem and occur in around 10-20% of the infected people. Aiming to improve the molecular diagnosis of symptomatic toxoplasmosis in Brazilian patients, this study evaluated the performance of real time PCR testing two primer sets (B1 and REP-529) in detecting Toxoplasma gondii DNA. The methodology was assayed in 807 clinical samples with known clinical diagnosis, ELISA, and conventional PCR results in a 9-year period. All samples were from patients with clinical suspicion of several features of toxoplasmosis. According to the minimum detection limit curve (in C T ), REP-529 had greater sensitivity to detect T. gondii DNA than B1. Both primer sets were retrospectively evaluated using 515 DNA from different clinical samples. The 122 patients without toxoplasmosis provided high specificity (REP-529, 99.2% and B1, 100%). From the 393 samples with positive ELISA, 146 had clinical diagnosis of toxoplasmosis and positive conventional PCR. REP-529 and B1 sensitivities were 95.9% and 83.6%, respectively. Comparison of REP-529 and B1 performances was further analyzed prospectively in 292 samples. Thus, from a total of 807 DNA analyzed, 217 (26.89%) had positive PCR with, at least one primer set and symptomatic toxoplasmosis confirmed by clinical diagnosis. REP-529 was positive in 97.23%, whereas B1 amplified only 78.80%. After comparing several samples in a Brazilian referral laboratory, this study concluded that REP-529 primer set had better performance than B1 one. These observations were based after using cases with defined clinical diagnosis, ELISA, and conventional PCR. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  2. Detection of Helicobacter pylori DNA in inflamed dental pulp specimens from Japanese children and adolescents.

    PubMed

    Ogaya, Yuko; Nomura, Ryota; Watanabe, Yoshiyuki; Nakano, Kazuhiko

    2015-01-01

    The oral cavity has been implicated as a source of Helicobacter pylori infection in childhood. Various PCR methods have been used to detect H. pylori DNA in oral specimens with various detection rates reported. Such disparity in detection rates complicates the estimation of the true infection rate of H. pylori in the oral cavity. In the present study, we constructed a novel PCR system for H. pylori detection and used it to analyse oral specimens. Firstly, the nucleotide alignments of genes commonly used for H. pylori detection were compared using the complete genome information for 48 strains registered in the GenBank database. Candidate primer sets with an estimated amplification size of approximately 300-400 bp were selected, and the specificity and sensitivity of the detection system using each primer set were evaluated. Five sets of primers targeting ureA were considered appropriate, of which a single primer set was chosen for inclusion in the PCR system. The sensitivity of the system was considered appropriate and its detection limit established as one to ten cells per reaction. The novel PCR system was used to examine H. pylori distribution in oral specimens (40 inflamed pulp tissues, 40 saliva samples) collected from Japanese children, adolescents and young adults. PCR analysis revealed that the detection rate of H. pylori in inflamed pulp was 15 %, whereas no positive reaction was found in any of the saliva specimens. Taken together, our novel PCR system was found to be reliable for detecting H. pylori. The results obtained showed that H. pylori was detected in inflamed pulp but not saliva specimens, indicating that an infected root canal may be a reservoir for H. pylori. © 2015 The Authors.

  3. Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

    PubMed

    Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

    2016-04-15

    In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Three new sensitive and specific heat-shock protein 70 PCRs for global Leishmania species identification.

    PubMed

    Montalvo, A M; Fraga, J; Maes, I; Dujardin, J-C; Van der Auwera, G

    2012-07-01

    The heat-shock protein 70 gene (hsp70) has been exploited for Leishmania species identification in the New and Old World, using PCR followed by restriction fragment length polymorphism (RFLP) analysis. Current PCR presents limitations in terms of sensitivity, which hampers its use for analyzing clinical and biological samples, and specificity, which makes it inappropriate to discriminate between Leishmania and other trypanosomatids. The aim of the study was to improve the sensitivity and specificity of a previously reported hsp70 PCR using alternative PCR primers and RFLPs. Following in silico analysis of available sequences, three new PCR primer sets and restriction digest schemes were tested on a globally representative panel of 114 Leishmania strains, various other infectious agents, and clinical samples. The largest new PCR fragment retained the discriminatory power from RFLP, while two smaller fragments discriminated less species. The detection limit of the new PCRs was between 0.05 and 0.5 parasite genomes, they amplified clinical samples more efficiently, and were Leishmania specific. We succeeded in significantly improving the specificity and sensitivity of the PCRs for hsp70 Leishmania species typing. The improved PCR-RFLP assays can impact diagnosis, treatment, and epidemiological studies of leishmaniasis in any setting worldwide.

  5. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

    PubMed Central

    Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

    2018-01-01

    One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

  6. Forensic strategy to ensure the quality of sequencing data of mitochondrial DNA in highly degraded samples.

    PubMed

    Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki

    2014-01-01

    Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  7. Novel ITS1 Fungal Primers for Characterization of the Mycobiome

    PubMed Central

    Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

    2017-01-01

    ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

  8. Molecular detection of native and invasive marine invertebrate larvae present in ballast and open water environmental samples collected in Puget Sound

    USGS Publications Warehouse

    Harvey, J.B.J.; Hoy, M.S.; Rodriguez, R.J.

    2009-01-01

    Non-native marine species have been and continue to be introduced into Puget Sound via several vectors including ship's ballast water. Some non-native species become invasive and negatively impact native species or near shore habitats. We present a new methodology for the development and testing of taxon specific PCR primers designed to assess environmental samples of ocean water for the presence of native and non-native bivalves, crustaceans and algae. The intergenic spacer regions (IGS; ITS1, ITS2 and 5.8S) of the ribosomal DNA were sequenced for adult samples of each taxon studied. We used these data along with those available in Genbank to design taxon and group specific primers and tested their stringency against artificial populations of plasmid constructs containing the entire IGS region for each of the 25 taxa in our study, respectively. Taxon and group specific primer sets were then used to detect the presence or absence of native and non-native planktonic life-history stages (propagules) from environmental samples of ballast water and plankton tow net samples collected in Puget Sound. This methodology provides an inexpensive and efficient way to test the discriminatory ability of taxon specific oligonucleotides (PCR primers) before creating molecular probes or beacons for use in molecular ecological applications such as probe hybridizations or microarray analyses. This work addresses the current need to develop molecular tools capable of diagnosing the presence of planktonic life-history stages from non-native marine species (potential invaders) in ballast water and other environmental samples. ?? 2008 Elsevier B.V.

  9. Characterization of a Methanogenic Community within an Algal Fed Anaerobic Digester

    PubMed Central

    Ellis, Joshua T.; Tramp, Cody; Sims, Ronald C.; Miller, Charles D.

    2012-01-01

    The microbial diversity and metabolic potential of a methanogenic consortium residing in a 3785-liter anaerobic digester, fed with wastewater algae, was analyzed using 454 pyrosequencing technology. DNA was extracted from anaerobic sludge material and used in metagenomic analysis through PCR amplification of the methyl-coenzyme M reductase α subunit (mcrA) gene using primer sets ML, MCR, and ME. The majority of annotated mcrA sequences were assigned taxonomically to the genera Methanosaeta in the order Methanosarcinales. Methanogens from the genus Methanosaeta are obligate acetotrophs, suggesting this genus plays a dominant role in methane production from the analyzed fermentation sample. Numerous analyzed sequences within the algae fed anaerobic digester were unclassified and could not be assigned taxonomically. Relative amplicon frequencies were determined for each primer set to determine the utility of each in pyrosequencing. Primer sets ML and MCR performed better quantitatively (representing the large majority of analyzed sequences) than primer set ME. However, each of these primer sets was shown to provide a quantitatively unique community structure, and thus they are of equal importance in mcrA metagenomic analysis. PMID:23724331

  10. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae)

    PubMed Central

    2010-01-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499

  11. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

    PubMed

    Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

    2010-04-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  12. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  13. Detection of Naegleria Species in Environmental Samples from Peninsular Malaysia

    PubMed Central

    Ithoi, Init; Ahmad, Arine Fadzlun; Nissapatorn, Veeranoot; Lau, Yee Ling; Mahmud, Rohela; Mak, Joon Wah

    2011-01-01

    Background In Malaysia, researchers and medical practitioners are unfamiliar with Naegleria infections. Thus little is known about the existence of pathogenic Naegleria fowleri, and the resultant primary amoebic meningoencephalitis (PAM) is seldom included in the differential diagnosis of central nervous system infections. This study was conducted to detect the presence of Naegleria species in various environmental samples. Methods/Findings A total of 41 Naegleria-like isolates were isolated from water and dust samples. All these isolates were subjected to PCR using two primer sets designed from the ITS1-ITS2 regions. The N. fowleri species-specific primer set failed to produce the expected amplicon. The Naegleria genus-specific primers produced amplicons of 408 bp (35), 450 bp (2), 457 bp (2) or 381 bp (2) from all 41 isolates isolated from aquatic (33) and dust (8) samples. Analysis of the sequences from 10 representative isolates revealed that amplicons with fragments 408, 450 and 457 bp showed homology with non-pathogenic Naegleria species, and 381 bp showed homology with Vahlkampfia species. These results concurred with the morphological observation that all 39 isolates which exhibited flagella were Naegleria, while 2 isolates (AC7, JN034055 and AC8, JN034056) that did not exhibit flagella were Vahlkampfia species. Conclusion To date, pathogenic species of N. fowleri have not been isolated from Malaysia. All 39 isolates that produced amplicons (408, 450 and 457 bp) from the genus-specific primers were identified as being similar to nonpathogenic Naegleria. Amplicon 408 bp from 5 representative isolates showed 100% and 99.7% identity to Naegleria philippinensis isolate RJTM (AM167890) and is thus believed to be the most common species in our environment. Amplicons 450 bp and 457 bp were respectively believed to be from 2 new species of Naegleria, since representative isolates showed lower homology and had a longer base pair length when compared to the reference species in the Genbank, Naegleria schusteri (AJ566626) and Naegleria laresi (AJ566630), respectively. PMID:21915311

  14. PCR detection of psychrophilic Clostridium spp. causing 'blown pack' spoilage of vacuum-packed chilled meats.

    PubMed

    Broda, D M; Boerema, J A; Bell, R G

    2003-01-01

    To develop a practical molecular procedure that directly, without isolation, and specifically detects the presence of clostridia which cause 'blown pack' spoilage of vacuum-packed meat. Primer sets and PCR amplification procedures were developed that detect the presence of 16S rDNA gene and/or 16S-23S rDNA internal transcribed spacer fragments of 'blown pack' causing clostridia in meat. The specificity of the developed procedures was evaluated with DNA obtained from close phylogenetic neighbours of 'blown pack' causing clostridia, food clostridia and common meat spoilage microorganisms. The sensitivity of detection was assessed in non-enriched and low-temperature-enriched beef mince inoculated with serially diluted pure cultures of Clostridium estertheticum DSMZ 8809T and Cl. gasigenes DB1AT. The efficacy of detection procedures was evaluated for naturally contaminated vacuum-packed meat samples. Three primer sets, 16SE, 16SDB and EISR, produced amplicons of the expected size with DNA templates from target clostridia, but failed to yield PCR products with DNAs from any other microorganisms tested. With 16SE and 16SDB primers, minimum levels of detection were 104 CFU g(-1) for non-enriched, and 102 CFU g(-1) for enriched meat samples. Based on the established specificity of these primers, as well as DNA sequencing of amplicons, Cl. gasigenes was confirmed as the causative agent of 'blown pack' spoilage in two packs, and Cl. estertheticum as the causative agent in the third. The developed method can be used for rapid detection of 'blown pack' causing clostridia in commercial blown packs, or following low temperature enrichment, for detection of these microorganisms in meat containing as few as 100 clostridial cells per gram. The paper reports practical procedures that can be used for rapid confirmation of the causative agents of clostridial 'blown pack' spoilage in commercial spoiled packs, or for detection of psychrophilic clostridia in epidemiological trace back of 'blown pack' spoilage incidents in meat processing plants.

  15. Sebacinales are associates of the leafy liverwort Lophozia excisa in the southern maritime Antarctic.

    PubMed

    Newsham, Kevin K; Bridge, Paul D

    2010-06-01

    The leafy liverwort Lophozia excisa, which is colonised by basidiomycete fungi in other biomes and which evidence suggests may be colonised by mycorrhizal fungi in Antarctica, was sampled from Léonie Island in the southern maritime Antarctic (67 degrees 36' S, 68 degrees 21' W). Microscopic examination of plants indicated that fungal hyphae colonised 78% of the rhizoids of the liverwort, apparently by entering the tips of rhizoids prior to growing into their bases, where they formed hyphal coils. Extensive colonisation of stem medullary cells by hyphae was also observed. DNA was extracted from surface-sterilised liverwort tissues and sequenced following nested PCR, using the primer set ITS1F/TW14, followed by a second round of amplification using the ITSSeb3/TW13 primer set. Neighbour-joining analyses showed that the sequences obtained nested in Sebacinales clade B as a 100% supported sister group to Sebacinales sequences from the leafy liverworts Lophozia sudetica, L. incisa and Calypogeia muelleriana sampled from Europe. Direct PCR using the fungal specific primer set ITS1F/ITS4 similarly identified fungi belonging to Sebacinales clade B as the principal colonists of L. excisa tissues. These observations indicate the presence of a second mycothallus in Antarctica and support the previous suggestion that the Sebacinales has a wide geographical distribution.

  16. Designing specific chloroplast markers for black walnut from a set of universal primers

    Treesearch

    Erin Victory; Rodney L. Robichaud; Keith Woeste

    2003-01-01

    Chloroplasts are a valuable source of genetic information because their sequence is highly conserved, they undergo little or no recombination, and they are uniparentally inherited. Chloroplast polymorphisms are powerful genetic tools for identifying matrilineal family groups, studying gene flow from seed versus pollen movement, reconstructing phylogeographic...

  17. A tool for design of primers for microRNA-specific quantitative RT-qPCR.

    PubMed

    Busk, Peter K

    2014-01-28

    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  18. Assay Design Affects the Interpretation of T-Cell Receptor Gamma Gene Rearrangements

    PubMed Central

    Cushman-Vokoun, Allison M.; Connealy, Solomon; Greiner, Timothy C.

    2010-01-01

    Interpretation of capillary electrophoresis results derived from multiplexed fluorochrome-labeled primer sets can be complicated by small peaks, which may be incorrectly interpreted as clonal T-cell receptor-γ gene rearrangements. In this report, different assay designs were used to illustrate how design may adversely affect specificity. Ten clinical cases, with subclonal peaks containing one of the two infrequently used joining genes, were identified with a tri-color, one-tube assay. The DNA was amplified with the same NED fluorochrome on all three joining primers, first combined (one-color assay) and then amplified separately using a single NED-labeled joining primer. The single primer assay design shows how insignificant peaks could easily be wrongly interpreted as clonal T-cell receptor-γ gene rearrangements. Next, the performance of the one-tube assay was compared with the two-tube BIOMED-2-based TCRG Gene Clonality Assay in a series of 44 cases. Whereas sensitivity was similar between the two methods (92.9% vs. 96.4%; P = 0.55), specificity was significantly less in the BIOMED-2 assay (87.5% vs. 56.3%; P = 0.049) when a 2× ratio was used to define clonality. Specificity was improved to 81.3% by the use of a 5× peak height ratio (P = 0.626). These findings illustrate how extra caution is needed in interpreting a design with multiple, separate distributions, which is more difficult to interpret than a single distribution assay. PMID:20959612

  19. Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

    PubMed

    Vela, J; Vitorica, J; Ruano, D

    2001-12-01

    We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

  20. PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

    PubMed

    Janczarek, Monika; Palusińska-Szysz, Marta

    2016-05-01

    Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

  1. Novel genomic tools for specific and real-time detection of biothreat and frequently encountered foodborne pathogens.

    PubMed

    Woubit, Abdela; Yehualaeshet, Teshome; Habtemariam, Tsegaye; Samuel, Temesgen

    2012-04-01

    The bacterial genera Escherichia, Salmonella, Shigella, Vibrio, Yersinia, and Francisella include important food safety and biothreat agents. By extensive mining of the whole genome and protein databases of diverse, closely and distantly related bacterial species and strains, we have identified novel genome regions, which we utilized to develop a rapid detection platform for these pathogens. The specific genomic targets we have identified to design the primers in Francisella tularensis subsp. tularensis, F. tularensis subsp. novicida, Shigella dysenteriae, Salmonella enterica serovar Typhimurium, Vibrio cholerae, Yersinia pestis, and Yersinia pseudotuberculosis contained either known genes or putative proteins. Primer sets were designed from the target regions for use in real-time PCR assays to detect specific biothreat pathogens at species or strain levels. The primer sets were first tested by in silico PCR against whole-genome sequences of different species, subspecies, or strains and then by in vitro PCR against genomic DNA preparations from 23 strains representing six biothreat agents (Escherichia coli O157:H7 strain EDL 933, Shigella dysenteriae, S. enterica serovar Typhi, F. tularensis subsp. tularensis, V. cholerae, and Y. pestis) and six foodborne pathogens (Salmonella Typhimurium, Salmonella Saintpaul, Shigella sonnei, F. tularensis subsp. novicida, Vibrio parahaemolyticus, and Y. pseudotuberculosis). Each pathogen was specifically identifiable at the genus and species levels. Sensitivity assays performed with purified DNA showed the lowest detection limit of 128 fg of DNA/μl for F. tularensis subsp. tularensis. A preliminary test to detect Shigella organisms in a milk matrix also enabled the detection of 6 to 60 CFU/ml. These new tools could ultimately be used to develop platforms to simultaneously detect these pathogens.

  2. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

    PubMed

    Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

  3. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

    PubMed Central

    Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  4. In-planta detection and monitorization of endophytic colonization by a Beauveria bassiana strain using a new-developed nested and quantitative PCR-based assay and confocal laser scanning microscopy.

    PubMed

    Landa, B B; López-Díaz, C; Jiménez-Fernández, D; Montes-Borrego, M; Muñoz-Ledesma, F J; Ortiz-Urquiza, A; Quesada-Moraga, E

    2013-10-01

    Beauveria bassiana strain 04/01-Tip obtained from larvae of the opium poppy stem gall Iraella luteipes endophytically colonizes opium poppy plants and protect it against this pest. Development of a specific, rapid and sensitive technique that allows accurately determining the process and factors leading to the establishment of this strain in opium poppy plants would be essential to achieve its efficient control in a large field scale. For that purpose in the present study, species-specific primers that can be used in conventional or quantitative PCR protocols were developed for specifically identification and detection of B. bassiana in plant tissues. The combination of the designed BB.fw/BB.rv primer set with the universal ITS1-F/ITS4 primer set in a two-step nested-PCR approach, has allowed the amplification of up to 10fg of B. bassiana. This represented an increase in sensitivity of 10000- and 1000-fold of detection than when using the BB.fw/BB.rv primers in a single or single-tube semi-nested PCR approaches, respectively. The BB.fw and BB.rv primer set were subsequently optimized to be used in real time quantitative PCR assays and allowed to accurately quantify B. bassiana DNA in different plant DNA backgrounds (leaves and seeds) without losing accuracy and efficiency. The qPCR protocol was used to monitor the endophytic colonization of opium poppy leaves byB. bassiana after inoculation with the strain EABb 04/01-Tip, detecting as low as 26fg of target DNA in leaves and a decrease in fungal biomass over time. PCR quantification data were supported in parallel with CLMS by the monitoring of spatial and temporal patterns of leaf and stem colonization using a GFP-tagged transformant of the B. bassiana EABb 04/01-Tip strain, which enabled to demonstrate that B. bassiana effectively colonizes aerial tissues of opium poppy plants mainly through intercellular spaces and even leaf trichomes. A decline in endophytic colonization was also observed by the last sampling times, i.e. from 10 to 15days after inoculation, although fungal structures still remained present in the leaf tissues. These newly developed molecular protocols should facilitate the detection, quantification and monitoring of endophytic B. bassiana strains in different tissues and host plants and would help to unravel the factors and process governing the specific endophytic association between opium poppy and strain EABb 04/01-Tip providing key insights to formulate a sustainable strategy for I. luteipes management in the host. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Isolation of a sex-linked DNA sequence in cranes.

    PubMed

    Duan, W; Fuerst, P A

    2001-01-01

    A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

  6. Development of a rapid assay to detect the jellyfish Cyanea nozakii using a loop-mediated isothermal amplification method.

    PubMed

    Liu, Zhongyuan; Dong, Zhijun; Liu, Dongyan

    2016-07-01

    Blooms of the harmful jellyfish Cyanea nozakii, which are a severe nuisance to fisheries and tourisms, frequently occur in the northern East China Sea, Yellow Sea, and Bohai Sea. To provide early warning of this species, a simple and effective molecular method for identifying C. nozakii was developed using the loop-mediated isothermal amplification method (LAMP). The LAMP assay is highly specific and uses a set of four primers that target six different regions on the mitochondrial cytochrome c oxidase subunit I (COI) gene of C. nozakii. The amplification conditions, including the dNTP and betaine concentrations, the inner primer to outer primer concentration ratio, reaction time and temperature, were optimized. The LAMP assay amplified DNA extracted from tissue samples of C. nozakii but did not amplify DNA from other common scyphozoans and hydrozoans collected in the same region. In addition, the LAMP assay was more sensitive than conventional PCR. Therefore, the established LAMP assay is a sensitive, specific, fast, and easily performed method for detection of C. nozakii at different stages in their life cycle.

  7. Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

    DOEpatents

    McKinney, Nancy

    2002-01-01

    PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

  8. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    NASA Astrophysics Data System (ADS)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  9. High-throughput detection of human papillomavirus-18 L1 gene methylation, a candidate biomarker for the progression of cervical neoplasia.

    PubMed

    Turan, Tolga; Kalantari, Mina; Cuschieri, Kate; Cubie, Heather A; Skomedal, Hanne; Bernard, Hans-Ulrich

    2007-04-25

    The L1 gene of human papillomavirus-18 (HPV-18) is consistently hypermethylated in cervical carcinomas, but frequently hypo- or unmethylated in exfoliated cells from asymptomatic patients. In precancerous lesions, L1 is sporadically hypermethylated, correlating with the severity of the neoplasia. In order to explore the potential of using L1 methylation as a workable biomarker for carcinogenic progression of HPV-18 infections in routinely taken samples, our aim was to develop methylation-detection techniques that were sensitive and rapid without being overly complex technically. Therein, we developed a methylation-specific PCR (MSP) through the design of primer sets that specifically amplify either methylated or unmethylated HPV-18 L1 DNA within bisulfite-modified sample DNA. Amplification of unmethylated and in vitro methylated HPV-18 DNA by MSP resulted in 2500 copies of either of the two L1 DNA species being detected, a satisfactory sensitivity considering that bisulfite treatment leads to the fragmentation of about 99% of sample DNA. The primers proved specific and did not generate false positive results at concentrations exceeding the lowest limit of detection by a factor of 400. DNA from carcinomas yielded PCR signals only with the methylation-specific primers, and not with primers specific for unmethylated L1 genes. The inverse result was obtained with DNA from precursor lesions that contained only hypomethylated DNA. High-grade precursor lesions and carcinomas that contained hyper- as well as hypomethylated L1 DNA yielded PCR signals with both primers. By developing a fluorescence based real-time PCR, we quantitatively analyzed samples with in vitro methylated and unmethylated L1 DNA, and could distinguish clinical samples with hyper- and hypomethylated DNA or mixtures of both DNAs. The methylation-specific and real-time PCR techniques permitted efficient HPV-18 L1 methylation analyses and open the door for larger-scale clinical studies where the utility of methylation status to predict the progression of HPV-18 infection and HPV-18 associated lesions is assessed.

  10. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

  11. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    PubMed

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  12. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

    PubMed Central

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

  13. GSP: A web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  14. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    PubMed

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies result in inaccurate estimates of community structure. The extent to which amplification bias affects community representation and the accuracy with which different gene targets represent community structure are not known. As a result, there is no consensus on which region provides the most suitable representation of diversity for eukaryotes. This study determined the accuracy with which commonly used 18S rRNA gene primer sets represent community structure and identified particular biases related to PCR amplification and Illumina MiSeq sequencing in order to more accurately study eukaryotic microbial communities. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Rapid and sensitive identification of the herbal tea ingredient Taraxacum formosanum using loop-mediated isothermal amplification.

    PubMed

    Lai, Guan-Hua; Chao, Jung; Lin, Ming-Kuem; Chang, Wen-Te; Peng, Wen-Huang; Sun, Fang-Chun; Lee, Meng-Shiunn; Lee, Meng-Shiou

    2015-01-09

    Taraxacum formosanum (TF) is a medicinal plant used as an important component of health drinks in Taiwan. In this study, a rapid, sensitive and specific loop-mediated isothermal amplification (LAMP) assay for authenticating TF was established. A set of four specific LAMP primers was designed based on the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA (nrDNA) of TF. LAMP amplicons were successfully amplified and detected when purified genomic DNA of TF was added in the LAMP reaction under isothermal condition (65 °C) within 45 min. These specific LAMP primers have high specificity and can accurately discriminate Taraxacum formosanum from other adulterant plants; 1 pg of genomic DNA was determined to be the detection limit of the LAMP assay. In conclusion, using this novel approach, TF and its misused plant samples obtained from herbal tea markets were easily identified and discriminated by LAMP assay for quality control.

  16. Rapid and Sensitive Identification of the Herbal Tea Ingredient Taraxacum formosanum Using Loop-Mediated Isothermal Amplification

    PubMed Central

    Lai, Guan-Hua; Chao, Jung; Lin, Ming-Kuem; Chang, Wen-Te; Peng, Wen-Huang; Sun, Fang-Chun; Lee, Meng-Shiunn; Lee, Meng-Shiou

    2015-01-01

    Taraxacum formosanum (TF) is a medicinal plant used as an important component of health drinks in Taiwan. In this study, a rapid, sensitive and specific loop-mediated isothermal amplification (LAMP) assay for authenticating TF was established. A set of four specific LAMP primers was designed based on the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA (nrDNA) of TF. LAMP amplicons were successfully amplified and detected when purified genomic DNA of TF was added in the LAMP reaction under isothermal condition (65 °C) within 45 min. These specific LAMP primers have high specificity and can accurately discriminate Taraxacum formosanum from other adulterant plants; 1 pg of genomic DNA was determined to be the detection limit of the LAMP assay. In conclusion, using this novel approach, TF and its misused plant samples obtained from herbal tea markets were easily identified and discriminated by LAMP assay for quality control. PMID:25584616

  17. Comparison of three PCR primer sets for identification of vanB gene carriage in feces and correlation with carriage of vancomycin-resistant enterococci: interference by vanB-containing anaerobic bacilli.

    PubMed

    Ballard, S A; Grabsch, E A; Johnson, P D R; Grayson, M L

    2005-01-01

    We assessed the sensitivities and specificities of three previously described PCR primers on enrichment broth cultures of feces for the accurate detection of fecal carriage of vancomycin-resistant enterococci (VRE). In addition, we investigated specimens that were vanB PCR positive but VRE culture negative for the presence of other vanB-containing pathogens. Feces from 59 patients (12 patients carrying vanB Enterococcus faecium strains and 47 patients negative for VRE carriage) were cultured for 36 h in aerobic brain heart infusion (BHI) broth, anaerobic BHI (AnO(2)BHI) broth, or aerobic Enterococcosel (EC) broth. DNA was extracted from the cultures and tested for the presence of vanB by using the PCR primers of Dutka-Malen et al. (S. Dutka-Malen, S. Evers, and P. Courvalin, J. Clin. Microbiol. 33:24-27, 1995), Bell et al. (J. M. Bell, J. C. Paton, and J. Turnidge, J. Clin. Microbiol. 36:2187-2190, 1998), and Stinear et al. (T. P. Stinear, D. C. Olden, P. D. R. Johnson, J. K. Davies, and M. L. Grayson, Lancet 357:855-856, 2001). The sensitivity (specificity) of PCR compared with the results of culture on BHI, AnO(2)BHI, and EC broths were 67% (96%), 50% (94%), and 17% (100%), respectively, with the primers of Dutka-Malen et al.; 92% (60%), 92% (45%), and 92% (83%), respectively, with the primers of Bell et al.; and 92% (49%), 92% (43%), and 100% (51%) respectively, with the primers of Stinear et al. The primers of both Bell et al. and Stinear et al. were significantly more sensitive than those of Dutka-Malen et al. in EC broth (P = 0.001 and P < 0.001, respectively). The poor specificities for all primer pairs were due in part to the isolation and identification of six anaerobic gram-positive bacilli, Clostridium hathewayi (n = 3), a Clostridium innocuum-like organism (n = 1), Clostridium bolteae (n = 1), and Ruminococcus lactaris-like (n = 1), from five fecal specimens that were vanB positive but VRE culture negative. All six organisms were demonstrated to contain a vanB gene identical to that of VRE. VanB-containing bowel anaerobes may result in false-positive interpretation of PCR-positive fecal enrichment cultures as VRE, regardless of the primers and protocols used.

  18. Real-time Detection and Monitoring of Loop Mediated Amplification (LAMP) Reaction Using Self-quenching and De-quenching Fluorogenic Probes.

    PubMed

    Gadkar, Vijay J; Goldfarb, David M; Gantt, Soren; Tilley, Peter A G

    2018-04-03

    Loop-mediated isothermal amplification (LAMP) is an isothermal nucleic acid amplification (iNAAT) technique known for its simplicity, sensitivity and speed. Its low-cost feature has resulted in its wide scale application, especially in low resource settings. The major disadvantage of LAMP is its heavy reliance on indirect detection methods like turbidity and non-specific dyes, which often leads to the detection of false positive results. In the present work, we have developed a direct detection approach, whereby a labelled loop probe quenched in its unbound state, fluoresces only when bound to its target (amplicon). Henceforth, referred to as Fluorescence of Loop Primer Upon Self Dequenching-LAMP (FLOS-LAMP), it allows for the sequence-specific detection of LAMP amplicons. The FLOS-LAMP concept was validated for rapid detection of the human pathogen, Varicella-zoster virus, from clinical samples. The FLOS-LAMP had a limit of detection of 500 copies of the target with a clinical sensitivity and specificity of 96.8% and 100%, respectively. The high level of specificity is a major advance and solves one of the main shortcomings of the LAMP technology, i.e. false positives. Self-quenching/de-quenching probes were further used with other LAMP primer sets and different fluorophores, thereby demonstrating its versatility and adaptability.

  19. Novel priming and crosslinking systems for use with isocyanatomethacrylate dental adhesives.

    PubMed

    Chappelow, C C; Power, M D; Bowles, C Q; Miller, R G; Pinzino, C S; Eick, J D

    2000-11-01

    (a) to design, formulate and evaluate prototype primers and a crosslinking agent for use with isocyanatomethacrylate-based comonomer adhesives and (b) to establish correlations between bond strength and solubility parameter differences between the adhesives and etched dentin, and the permeability coefficients of the adhesives. Equimolar mixtures of 2-isocyanatoethyl methacrylate (IEM) and a methacrylate comonomer were formulated with tri-n-butyl borane oxide (TBBO) as the free radical initiator to have cure times of 6-10 min. Shear bond strengths to dentin were determined for each adhesive mixture (n = 7) using standard testing protocols. Shear bond strengths for the three systems were also determined after application of "reactive primers" to the dentin surface. The "reactive primers" contained 10-20 parts by weight of the respective comonomer mixture and 3.5 parts by weight TBBO in acetone. Solubility parameters difference values (delta delta) and permeability coefficients (P) were approximated for each adhesive system and correlated with shear bond strength values. Additionally, a crosslinking agent was prepared by bulk reaction of an equimolar mixture containing IEM and a methacrylate comonomer. The effects of crosslinker addition on: (a) the setting time of IEM; and (b) the setting times and initiator requirements of selected IEM/comonomer mixtures were determined. Shear bond strength values (MPa): IEM/HEMA 13.6 +/- 2.0 (no primer), 20.1 +/- 2.0 (with primer); IEM/HETMA 9.3 +/- 3.3 (no primer), 20.8 +/- 8.1 (with primer); IEM/AAEMA 13.6 +/- 1.9 (no primer), 17.3 +/- 3.2 (with primer). Also, approximated permeability coefficients showed a significant correlation (r = +0.867, p < 0.001) with shear bond strength values. Crosslinker addition studies with IEM/4-META: (a) at 5-9 mol% reduced the setting time of IEM polymerization by 79%; and (b) at 6 mol% reduced initiator level requirements 60-70% to achieve a comparable setting time, and decreased setting times by ca. 75% for a given initiator level with selected IEM/methacrylate adhesive systems. The shear bond strengths of isocyanatomethacrylate-based dental adhesives can be enhanced by using reactive primers; their setting times and initiator requirements can be improved using a dimethacrylate crosslinker. Approximated permeability coefficients may be useful as indicators of bonding performance for dentin adhesive systems.

  20. Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

    PubMed

    Campos, Maria Jorge; Quesada, Alberto

    2017-01-01

    PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

  1. A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

    PubMed

    Bisset, S A; Knight, J S; Bouchet, C L G

    2014-02-24

    A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. High-throughput gender identification of penguin species using melting curve analysis.

    PubMed

    Tseng, Chao-Neng; Chang, Yung-Ting; Chiu, Hui-Tzu; Chou, Yii-Cheng; Huang, Hurng-Wern; Cheng, Chien-Chung; Liao, Ming-Hui; Chang, Hsueh-Wei

    2014-04-03

    Most species of penguins are sexual monomorphic and therefore it is difficult to visually identify their genders for monitoring population stability in terms of sex ratio analysis. In this study, we evaluated the suitability using melting curve analysis (MCA) for high-throughput gender identification of penguins. Preliminary test indicated that the Griffiths's P2/P8 primers were not suitable for MCA analysis. Based on sequence alignment of Chromo-Helicase-DNA binding protein (CHD)-W and CHD-Z genes from four species of penguins (Pygoscelis papua, Aptenodytes patagonicus, Spheniscus magellanicus, and Eudyptes chrysocome), we redesigned forward primers for the CHD-W/CHD-Z-common region (PGU-ZW2) and the CHD-W-specific region (PGU-W2) to be used in combination with the reverse Griffiths's P2 primer. When tested with P. papua samples, PCR using P2/PGU-ZW2 and P2/PGU-W2 primer sets generated two amplicons of 148- and 356-bp, respectively, which were easily resolved in 1.5% agarose gels. MCA analysis indicated the melting temperature (Tm) values for P2/PGU-ZW2 and P2/PGU-W2 amplicons of P. papua samples were 79.75°C-80.5°C and 81.0°C-81.5°C, respectively. Females displayed both ZW-common and W-specific Tm peaks, whereas male was positive only for ZW-common peak. Taken together, our redesigned primers coupled with MCA analysis allows precise high throughput gender identification for P. papua, and potentially for other penguin species such as A. patagonicus, S. magellanicus, and E. chrysocome as well.

  3. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    PubMed

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

  4. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    PubMed

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  5. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

    PubMed Central

    2009-01-01

    Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

  6. Comparison of Conventional PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Arcobacter Species

    PubMed Central

    Wang, Xiaoyu; Seo, Dong Joo; Lee, Min Hwa

    2014-01-01

    This study aimed to develop a loop-mediated isothermal amplification (LAMP) method for the rapid detection of Arcobacter species. Specific primers targeting the 23S ribosomal RNA gene were used to detect Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii. The specificity of the LAMP primer set was assessed using DNA samples from a panel of Arcobacter and Campylobacter species, and the sensitivity was determined using serial dilutions of Arcobacter species cultures. LAMP showed a 10- to 1,000-fold-higher sensitivity than multiplex PCR, with a detection limit of 2 to 20 CFU per reaction in vitro. Whereas multiplex PCR showed cross-reactivity with Campylobacter species, the LAMP method developed in this study was more sensitive and reliable than conventional PCR or multiplex PCR for the detection of Arcobacter species. PMID:24478488

  7. miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

    PubMed Central

    Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

    2018-01-01

    MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

  8. Exploring target-specific primer extension in combination with a bead-based suspension array for multiplexed detection and typing using Streptococcus suis as a model pathogen

    PubMed Central

    van der Wal, Fimme J.; Achterberg, René P.; van Solt-Smits, Conny; Bergervoet, Jan H. W.; de Weerdt, Marjanne; Wisselink, Henk J.

    2017-01-01

    We investigated the feasibility of an assay based on target-specific primer extension, combined with a suspension array, for the multiplexed detection and typing of a veterinary pathogen in animal samples, using Streptococcus suis as a model pathogen. A procedure was established for simultaneous detection of 6 S. suis targets in pig tonsil samples (i.e., 4 genes associated with serotype 1, 2, 7, or 9, the generic S. suis glutamate dehydrogenase gene [gdh], and the gene encoding the extracellular protein factor [epf]). The procedure was set up as a combination of protocols: DNA isolation from porcine tonsils, a multiplex PCR, a multiplex target-specific primer extension, and finally a suspension array as the readout. The resulting assay was compared with a panel of conventional PCR assays. The proposed multiplex assay can correctly identify the serotype of isolates and is capable of simultaneous detection of multiple targets in porcine tonsillar samples. The assay is not as sensitive as the current conventional PCR assays, but with the correct sampling strategy, the assay can be useful for screening pig herds to establish which S. suis serotypes are circulating in a pig population. PMID:28980519

  9. Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay.

    PubMed

    Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

    2016-06-01

    For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. © The American Society of Tropical Medicine and Hygiene.

  10. Design and validation of a real-time RT-PCR for the simultaneous detection of enteroviruses and parechoviruses in clinical samples.

    PubMed

    Cabrerizo, María; Calvo, Cristina; Rabella, Nuria; Muñoz-Almagro, Carmen; del Amo, Eva; Pérez-Ruiz, Mercedes; Sanbonmatsu-Gámez, Sara; Moreno-Docón, Antonio; Otero, Almudena; Trallero, Gloria

    2014-11-01

    Human enteroviruses (EVs) and parechoviruses (HPeVs) are important etiological agents causing infections such as meningitis, encephalitis and sepsis-like disease in neonates and young children. We have developed a real-time RT-PCR for simultaneous detection of EV and HPeV in clinical samples. Primers and probe sets were designed from the conserved 5'-noncoding region of the genomes. The sensitivity, specificity and reproducibility of the technique were measured using a set of 25 EV and 6 HPeV types. All EVs but no HPeVs were detected with the EV primers-probe set. The HPeV primers-probe set detected only the 6 HPeV types. The lower detection limit was found to be 4 and 40CCID50/ml for HPeV and EV respectively, demonstrating high sensitivity of the technique for both viruses. The threshold cycle values were highly reproducible on repeat testing of positive controls among assay runs. The assay was evaluated in 53 clinical samples of suspected meningitis, sepsis or febrile syndromes from children under 3 years. In 11 of these (21%) EVs were detected, while 4, i.e. 7.5%, were HPeV positive. Molecular typing was carried out for 73% of the viruses. In summary, the RT-PCR method developed demonstrated effectively both EV and HPeV detection, which can cause similar clinical symptoms in infants. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

    PubMed Central

    Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

    2013-01-01

    The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

  12. A new visually improved and sensitive loop mediated isothermal amplification (LAMP) for diagnosis of symptomatic falciparum malaria.

    PubMed

    Mohon, Abu Naser; Elahi, Rubayet; Khan, Wasif A; Haque, Rashidul; Sullivan, David J; Alam, Mohammad Shafiul

    2014-06-01

    Molecular diagnosis of malaria by nucleotide amplification requires sophisticated and expensive instruments, typically found only in well-established laboratories. Loop-mediated isothermal amplification (LAMP) has provided a new platform for an easily adaptable molecular technique for molecular diagnosis of malaria without the use of expensive instruments. A new primer set has been designed targeting the 18S rRNA gene for the detection of Plasmodium falciparum in whole blood samples. The efficacy of LAMP using the new primer set was assessed in this study in comparison to that of a previously described set of LAMP primers as well as with microscopy and real-time PCR as reference methods for detecting P. falciparum. Pre-addition of hydroxy napthol blue (HNB) in the LAMP reaction caused a distinct color change, thereby improving the visual detection system. The new LAMP assay was found to be 99.1% sensitive compared to microscopy and 98.1% when compared to real-time PCR. Meanwhile, its specificity was 99% and 100% in contrast to microscopy and real-time PCR, respectively. Moreover, the LAMP method was in very good agreement with microscopy and real-time PCR (0.94 and 0.98, respectively). This new LAMP method can detect at least 5parasites/μL of infected blood within 35min, while the other LAMP method tested in this study, could detect a minimum of 100parasites/μL of human blood after 60min of amplification. Thus, the new method is sensitive and specific, can be carried out in a very short time, and can substitute PCR in healthcare clinics and standard laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Comparative analysis of Edwardsiella isolates from fish in the eastern United States identifies two distinct genetic taxa amongst organisms phenotypically classified as E. tarda

    USGS Publications Warehouse

    Griffin, Matt J.; Quiniou, Sylvie M.; Cody, Theresa; Tabuchi, Maki; Ware, Cynthia; Cipriano, Rocco C.; Mauel, Michael J.; Soto, Esteban

    2013-01-01

    Edwardsiella tarda, a Gram-negative member of the family Enterobacteriaceae, has been implicated in significant losses in aquaculture facilities worldwide. Here, we assessed the intra-specific variability of E. tarda isolates from 4 different fish species in the eastern United States. Repetitive sequence mediated PCR (rep-PCR) using 4 different primer sets (ERIC I & II, ERIC II, BOX, and GTG5) and multi-locus sequence analysis of 16S SSU rDNA, groEl, gyrA, gyrB, pho, pgi, pgm, and rpoA gene fragments identified two distinct genotypes of E. tarda (DNA group I; DNA group II). Isolates that fell into DNA group II demonstrated more similarity to E. ictaluri than DNA group I, which contained the reference E. tarda strain (ATCC #15947). Conventional PCR analysis using published E. tarda-specific primer sets yielded variable results, with several primer sets producing no observable amplification of target DNA from some isolates. Fluorometric determination of G + C content demonstrated 56.4% G + C content for DNA group I, 60.2% for DNA group II, and 58.4% for E. ictaluri. Surprisingly, these isolates were indistinguishable using conventional biochemical techniques, with all isolates demonstrating phenotypic characteristics consistent with E. tarda. Analysis using two commercial test kits identified multiple phenotypes, although no single metabolic characteristic could reliably discriminate between genetic groups. Additionally, anti-microbial susceptibility and fatty acid profiles did not demonstrate remarkable differences between groups. The significant genetic variation (<90% similarity at gyrA, gyrB, pho, phi and pgm; <40% similarity by rep-PCR) between these groups suggests organisms from DNA group II may represent an unrecognized, genetically distinct taxa of Edwardsiella that is phenotypically indistinguishable from E. tarda.

  14. Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

    PubMed

    Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

    2015-03-01

    A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Sequetyping: Serotyping Streptococcus pneumoniae by a Single PCR Sequencing Strategy

    PubMed Central

    Leung, Marcus H.; Bryson, Kevin; Freystatter, Kathrin; Pichon, Bruno; Edwards, Giles; Gillespie, Stephen H.

    2012-01-01

    The introduction of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to assess vaccine efficacy and replacement serotypes. Conventional serological methods are costly, labor-intensive, and prone to misidentification, while current DNA-based methods have limited serotype coverage requiring multiple PCR primers. In this study, a computer algorithm was developed to interrogate the capsulation locus (cps) of vaccine serotypes to locate primer pairs in conserved regions that border variable regions and could differentiate between serotypes. In silico analysis of cps from 92 serotypes indicated that a primer pair spanning the regulatory gene cpsB could putatively amplify 84 serotypes and differentiate 46. This primer set was specific to Streptococcus pneumoniae, with no amplification observed for other species, including S. mitis, S. oralis, and S. pseudopneumoniae. One hundred thirty-eight pneumococcal strains covering 48 serotypes were tested. Of 23 vaccine serotypes included in the study, most (19/22, 86%) were identified correctly at least to the serogroup level, including all of the 13-valent conjugate vaccine and other replacement serotypes. Reproducibility was demonstrated by the correct sequetyping of different strains of a serotype. This novel sequence-based method employing a single PCR primer pair is cost-effective and simple. Furthermore, it has the potential to identify new serotypes that may evolve in the future. PMID:22553238

  16. Detection of Fungi from an Indoor Environment using Loop-mediated Isothermal Amplification (LAMP) Method.

    PubMed

    Nakayama, Takako; Yamazaki, Takashi; Yo, Ayaka; Tone, Kazuya; Mahdi Alshahni, Mohamed; Fujisaki, Ryuichi; Makimura, Koichi

    2017-01-01

     Loop-mediated isothermal amplification (LAMP) is a useful DNA detection method with high specificity and sensitivity. The LAMP reaction is carried out within a short time at a constant temperature without the need for thermal cycling. We developed a LAMP primer set for detecting a wide range of fungi by aligning the sequences of the large subunit ribosomal RNA gene of Candida albicans (Ascomycota), Cryptococcus neoformans (Basidiomycota), and Mucor racemosus (Mucorales). The threshold of C. albicans rDNA as template with our LAMP primer set was in the range of 10-100 copies per a reaction. In this study, we evaluated the correlation between colony forming units (CFU) and LAMP detection rate using the LAMP method for environmental fungi. The LAMP method should be a useful means of detecting fungi in indoor environments, disaster areas, or even in confined manned spacecraft to prevent allergies or infections caused by fungi.

  17. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    PubMed

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  18. Collecting in collections: a PCR strategy and primer set for DNA barcoding of decades-old dried museum specimens.

    PubMed

    Mitchell, Andrew

    2015-09-01

    Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past. © 2015 John Wiley & Sons Ltd.

  19. Establishment of a sensitive system for analysis of human vaginal microbiota on the basis of rRNA-targeted reverse transcription-quantitative PCR.

    PubMed

    Kurakawa, Takashi; Ogata, Kiyohito; Tsuji, Hirokazu; Kado, Yukiko; Takahashi, Takuya; Kida, Yumi; Ito, Masahiro; Okada, Nobuhiko; Nomoto, Koji

    2015-04-01

    Ten specific primer sets, for Lactobacillus gasseri, Lactobacillus crispatus, Atopobium vaginae, Gardnerella vaginalis, Mobiluncus curtisii, Chlamydia trachomatis/muridarum, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Bifidobacterium adolescentis, and Bifidobacterium angulatum, were developed for quantitative analysis of vaginal microbiota. rRNA-targeted reverse transcription-quantitative PCR (RT-qPCR) analysis of the vaginal samples from 12 healthy Japanese volunteers using the new primer sets together with 25 existing primer sets revealed the diversity of their vaginal microbiota: Lactobacilli such as L. crispatus, L. gasseri, Lactobacillus jensenii, Lactobacillus iners, and Lactobacillus vaginalis, as the major populations at 10(7) cells/ml vaginal fluid, were followed by facultative anaerobes such as Streptococcus and strict anaerobes at lower population levels of 10(4) cells/ml or less. Certain bacterial vaginosis (BV)-related bacteria, such as G. vaginalis, A. vaginae, M. curtisii, and Prevotella, were also detected in some subjects. Especially in one subject, both G. vaginalis and A. vaginae were detected at high population levels of 10(8.8) and 10(8.9) cells/ml vaginal fluid, suggesting that she is an asymptomatic BV patient. These results suggest that the RT-qPCR system is effective for accurate analysis of major vaginal commensals and diagnosis of several vaginal infections. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. A simplified strategy for sensitive detection of Rose rosette virus compatible with three RT-PCR chemistries.

    PubMed

    Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M

    2016-06-01

    Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. High resolution melting (HRM) analysis as a new tool for rapid identification of Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum.

    PubMed

    Ren, Xingxing; Fu, Ying; Xu, Chenggang; Feng, Zhou; Li, Miao; Zhang, Lina; Zhang, Jianmin; Liao, Ming

    2017-05-01

    Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum represent the most common causative agents of chicken salmonellosis, which result in high mortality and morbidity throughout the world. It is difficult and laborious to discriminate these diseases based on biochemical or phenotypic methods. Herein, we report the development of a single nucleotide polymorphism (SNP) PCR-high resolution melt (PCR-HRM) assay for the detection and discrimination of both S. Pullorum and S. Gallinarun. The gene rfbS, which encodes a factor involved in the biosynthesis of ADP paratose in serogroup D of Salmonella, has been identified as a robust genetic marker for the identification of S. Pullorum and S. Gallinarun based on polymorphisms at positions 237 and 598. Therefore, PCR-HRM analyses were used to characterize this gene. A total of 15 reference and 33 clinical isolates of Salmonella and related Gram-negative bacteria were detected using 2 sets of primers. Our PCR-HRM assay could distinguish S. Pullorum from S. Gallinarun and other strains using the primer pair SP-237F/237R. Similarly, S. Gallinarun could be distinguished from S. Pullorum and other strains using primer set SG-598F/598R. These 2 assays showed high specificity (100%) for both S. Pullorum and S. Gallinarun; the sensitivity of these 2 assays was at least 100-fold greater than that of the allele-specific PCR assay. This present study demonstrated that HRM analysis represents a potent, simple, and economic tool for the rapid, specific, and sensitive detection of S. Pullorum and S. Gallinarun. Our approach also may aid efforts for purification of Avian Salmonella disease. © 2016 Poultry Science Association Inc.

  2. Detection of different South American hantaviruses.

    PubMed

    Guterres, Alexandro; de Oliveira, Renata Carvalho; Fernandes, Jorlan; Schrago, Carlos Guerra; de Lemos, Elba Regina Sampaio

    2015-12-02

    Hantaviruses are the etiologic agents of Hemorrhagic Fever with Renal Syndrome (HFRS) in Old World, and Hantavirus Pulmonary Syndrome (HPS)/Hantavirus Cardiopulmonary Syndrome (HCPS), in the New World. Serological methods are the most common approach used for laboratory diagnosis of HCPS, however theses methods do not allow the characterization of viral genotypes. The polymerase chain reaction (PCR) has been extensively used for diagnosis of viral infections, including those caused by hantaviruses, enabling detection of few target sequence copies in the sample. However, most studies proposed methods of PCR with species-specific primers. This study developed a simple and reliable diagnostic system by RT-PCR for different hantavirus detection. Using new primers set, we evaluated human and rodent hantavirus positive samples of various regions from Brazil. Besides, we performed computational analyzes to evaluate the detection of other South American hantaviruses. The diagnostic system by PCR proved to be a sensible and simple assay, allowing amplification of Juquitiba virus, Araraquara virus, Laguna Negra virus, Rio Mamore virus and Jabora virus, beyond of the possibility of the detecting Andes, Anajatuba, Bermejo, Choclo, Cano Delgadito, Lechiguanas, Maciel, Oran, Pergamino and Rio Mearim viruses. The primers sets designed in this study can detect hantaviruses from almost all known genetics lineages in Brazil and from others South America countries and also increases the possibility to detect new hantaviruses. These primers could easily be used both in diagnosis of suspected hantavirus infections in humans and also in studies with animals reservoirs. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    PubMed

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.

  4. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  5. Detection of a Novel Porcine Parvovirus in Chinese Swine Herds

    USDA-ARS?s Scientific Manuscript database

    To determine whether the recently reported novel porcine parvovirus type 4 (PPV4) is prevalent in China, a set of PPV4 specific primers were designed and used for the molecular survey of PPV4 among clinical samples. The results indicated a positive detection for PPV4 in Chinese swine herds of 1.84% ...

  6. Microbial community structure and abundance in the rhizosphere and bulk soil of a tomato cropping system that includes cover crops

    USDA-ARS?s Scientific Manuscript database

    In this report we use Terminal Restriction Fragment Length Polymorphisms (TRFLP) in a tomato production system to “finger printing” the soil microbial community structure with Phylum specific primer sets. Factors influencing the soil microbes are a cover crop of Hairy Vetch (Vicia villosa) or Rye (...

  7. A Phylogenomic Approach Based on PCR Target Enrichment and High Throughput Sequencing: Resolving the Diversity within the South American Species of Bartsia L. (Orobanchaceae)

    PubMed Central

    Tank, David C.

    2016-01-01

    Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929

  8. A TaqMan real-time PCR-based assay for the identification of Fasciola spp.

    PubMed

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-30

    Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Improved Performance of Loop-Mediated Isothermal Amplification Assays via Swarm Priming.

    PubMed

    Martineau, Rhett L; Murray, Sarah A; Ci, Shufang; Gao, Weimin; Chao, Shih-Hui; Meldrum, Deirdre R

    2017-01-03

    This work describes an enhancement to the loop-mediated isothermal amplification (LAMP) reaction which results in improved performance. Enhancement is achieved by adding a new set of primers to conventional LAMP reactions. These primers are termed "swarm primers" based on their relatively high concentration and their ability to create new amplicons despite the theoretical lack of single-stranded annealing sites. The primers target a region upstream of the FIP/BIP primer recognition sequences on opposite strands, substantially overlapping F1/B1 sites. Thus, despite the addition of a new primer set to an already complex assay, no significant increase in assay complexity is incurred. Swarm priming is presented for three DNA templates: Lambda phage, Synechocystis sp. PCC 6803 rbcL gene, and human HFE. The results of adding swarm primers to conventional LAMP reactions include increased amplification speed, increased indicator contrast, and increased reaction products. For at least one template, minor improvements in assay repeatability are also shown. In addition, swarm priming is shown to be effective at increasing the reaction speed for RNA amplification via RT-LAMP. Collectively, these results suggest that the addition of swarm primers will likely benefit most if not all existing LAMP assays based on state-of-the-art, six-primer reactions.

  10. Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

    USGS Publications Warehouse

    Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

    2010-01-01

    A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

  11. Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

    PubMed

    Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

    2011-12-01

    Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

  12. Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

    PubMed

    Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

    2016-07-01

    This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step.

  13. Molecular identification tools for sibling species of Scedosporium and Pseudallescheria.

    PubMed

    Lackner, M; Klaassen, C H; Meis, J F; van den Ende, A H G Gerrits; de Hoog, G S

    2012-07-01

    The aim of this study was to develop molecular identification tools for currently recognized species of Pseudallescheria and Scedosporium through the use of species-specific primers and RFLP, so as to enhance rapid differentiation of clinically relevant species. The variability of species was established in a set of 681 Internal Transcribed Spacer (ITS) and 349 ß-tubulin (BT2) sequences. Amplified Fragment Length Polymorphism profile clustering matched with BT2 results, whereas ITS grouping was less detailed. ITS was sufficient for the differentiation of most haplotypes of clinically relevant species (P. apiosperma, P. boydii, S. aurantiacum, S. dehoogii, and S. prolificans) and of environmental species (P. minutispora and Lophotrichus fimeti) when Restriction Fragment Length Polymorphism (RFLP) were applied. For the identification of P. apiosperma and P. boydii species-specific BT2 primers were needed. Pseudallescheria fusoidea, P. ellipsoidea and P. angusta remained difficult to distinguish from P. boydii.

  14. WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

    PubMed Central

    Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

    2007-01-01

    Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

  15. Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology.

    PubMed

    Daher, Rana K; Stewart, Gale; Boissinot, Maurice; Boudreau, Dominique K; Bergeron, Michel G

    2015-04-01

    Recombinase polymerase amplification (RPA) technology relies on three major proteins, recombinase proteins, single-strand binding proteins, and polymerases, to specifically amplify nucleic acid sequences in an isothermal format. The performance of RPA with respect to sequence mismatches of closely-related non-target molecules is not well documented and the influence of the number and distribution of mismatches in DNA sequences on RPA amplification reaction is not well understood. We investigated the specificity of RPA by testing closely-related species bearing naturally occurring mismatches for the tuf gene sequence of Pseudomonas aeruginosa and/or Mycobacterium tuberculosis and for the cfb gene sequence of Streptococcus agalactiae. In addition, the impact of the number and distribution of mismatches on RPA efficiency was assessed by synthetically generating 14 types of mismatched forward primers for detecting five bacterial species of high diagnostic relevance such as Clostridium difficile, Staphylococcus aureus, S. agalactiae, P. aeruginosa, and M. tuberculosis as well as Bacillus atropheus subsp. globigii for which we use the spores as internal control in diagnostic assays. A total of 87 mismatched primers were tested in this study. We observed that target specific RPA primers with mismatches (n > 1) at their 3'extrimity hampered RPA reaction. In addition, 3 mismatches covering both extremities and the center of the primer sequence negatively affected RPA yield. We demonstrated that the specificity of RPA was multifactorial. Therefore its application in clinical settings must be selected and validated a priori. We recommend that the selection of a target gene must consider the presence of closely-related non-target genes. It is advisable to choose target regions with a high number of mismatches (≥36%, relative to the size of amplicon) with respect to closely-related species and the best case scenario would be by choosing a unique target gene. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Evaluation of different PCR primers for denaturing gradient gel electrophoresis (DGGE) analysis of fungal community structure in traditional fermentation starters used for Hong Qu glutinous rice wine.

    PubMed

    Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li

    2017-08-16

    Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and principal component analysis. The statistical analysis results based on the band intensities of fungal DGGE profile showed that Saccharomyces cerevisiae, Saccharomycopsis fibuligera, Rhizopus oryzae, Monascus purpureus and Aspergillus niger were the dominant fungal species. In conclusion, the comparison of several primer sets for fungal PCR-DGGE would be useful to enrich our knowledge of the fungal community structures associated with traditional fermentation starters, which may facilitate the development of better starter cultures for manufacturing Chinese Hong Qu glutinous rice wine. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

    PubMed

    Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

    2017-10-01

    ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  18. Detection of spring viraemia of carp virus (SVCV) by loop-mediated isothermal amplification (LAMP) in koi carp, Cyprinus carpio L

    USGS Publications Warehouse

    Shivappa, R.B.; Savan, R.; Kono, T.; Sakai, M.; Emmenegger, E.; Kurath, G.; Levine, Jay F.

    2008-01-01

    Spring viraemia of carp virus (SVCV) is a rhabdovirus associated with systemic illness and mortality in cyprinids. Several diagnostic tests are available for detection of SVCV. However, most of these tests are time consuming and are not well adapted for field-based diagnostics. In this study, a diagnostic tool for SVCV detection based on reverse transcription loop-mediated isothermal amplification (RT-LAMP) has been developed. Based on the nucleotide sequence of the glycoprotein (G) gene of SVCV North Carolina (NC) isolate, four sets (each set containing two outer and two inner) of primers were designed. Temperature and time conditions were optimized to 65 ??C and 60 min, respectively, for LAMP and RT-LAMP using one primer set. In vitro specificity was evaluated using four different strains of fish rhabdoviruses and RT-LAMP was found to be specific to SVCV. Serial dilutions of SVCV NC isolate was used to evaluate the in vitro sensitivity of RT-LAMP. Sensitivity of the assays was similar to RT-PCR and detected SVCV even at the lowest dilution of 10 1 TCID50 mL-1. The ability of RT-LAMP to detect SVCV from infected carp was also tested and the assay detected SVCV from all infected fish. The isothermal temperature requirements, high specificity and sensitivity, and short incubation time of the RT-LAMP assay make it an excellent choice as a field diagnostic test for SVCV. ?? 2008 The Authors.

  19. Prevalence and diversity of Hepatozoon canis in naturally infected dogs in Japanese islands and peninsulas.

    PubMed

    El-Dakhly, Khaled Mohamed; Goto, Minami; Noishiki, Kaori; El-Nahass, El-Shaymaa; Hirata, Akihiro; Sakai, Hiroki; Takashima, Yasuhiro; El-Morsey, Ahmed; Yanai, Tokuma

    2013-09-01

    Canine hepatozoonosis is a worldwide protozoal disease caused by Hepatozoon canis and Hepatozoon americanum and is transmitted by ixodid ticks, Rhipicephalus and Amblyomma spp., respectively. H. canis infection is widespread in Africa, Europe, South America, and Asia, including Japan. The objective of this study was to study the distribution pattern and diversity of H. canis in naturally infected dogs in nine Japanese islands and peninsulas. Therefore, 196 hunting dogs were randomly sampled during the period from March to September 2011 and the ages and sexes were identified. Direct microscopy using Giemsa-stained blood smears revealed H. canis gametocytes in the peripheral blood of 45 (23.6%) dogs. Polymerase chain reaction (PCR) was performed on EDTA-anticoagulated blood, initially with the common primer set (B18S-F and B18S-R) amplifying the 1,665-bp portion of the 18S rRNA gene, and then with the specific primer set (HepF and HepR) amplifying about 660 bp fragments of the same gene. Based on PCR, 84 (42.9%) dogs were positive using the common primer and 81 (41.3%) were positive using the specific primer. The current investigation indicated that all screened areas, except for Sado Island and Atsumi Peninsula, were infected. Yaku Island had the highest infection rate (84.6% in males and 100.0% in females), while Ishigaki Island showed the lowest infection rates (8.3% in males and 17.7% in females). Both sexes were infected with no significant difference. However, diversity of infection among the surveyed islands and peninsulas was significantly different (P < 0.05). Although H. canis has previously been reported in dogs in Japan, the higher infection rate described in the current study and the diversity of infection in a wide range of islands strongly encourage prospective studies dealing with the prevention and treatment of the infection in dogs, as well as control of ticks.

  20. Quenching of Unincorporated Amplification Signal Reporters in Reverse-Transcription Loop-Mediated Isothermal Amplification Enabling Bright, Single-Step, Closed-Tube, and Multiplexed Detection of RNA Viruses.

    PubMed

    Ball, Cameron S; Light, Yooli K; Koh, Chung-Yan; Wheeler, Sarah S; Coffey, Lark L; Meagher, Robert J

    2016-04-05

    Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of the reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read "quasar"), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). Furthermore, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.

  1. TipMT: Identification of PCR-based taxon-specific markers.

    PubMed

    Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C

    2017-02-11

    Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .

  2. The development and mapping of functional markers in Fragaria and their transferability and potential for mapping in other genera.

    PubMed

    Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R

    2007-01-01

    We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.

  3. Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

    PubMed Central

    Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

    2006-01-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

  4. Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

    PubMed

    Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

    2006-12-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

  5. Array of Synthetic Oligonucleotides to Generate Unique Multi-Target Artificial Positive Controls and Molecular Probe-Based Discrimination of Liposcelis Species

    PubMed Central

    Arif, Mohammad; Opit, George; Mendoza-Yerbafría, Abigail; Dobhal, Shefali; Li, Zhihong; Kučerová, Zuzana; Ochoa-Corona, Francisco M.

    2015-01-01

    Several species of the genus Liposcelis are common insect pests that cause serious qualitative and quantitative losses to various stored grains and processed grain products. They also can contaminate foods, transmit pathogenic microorganisms and cause allergies in humans. The common occurrence of multi-species infestations and the fact that it is difficult to identify and discriminate Liposcelis spp. make accurate, rapid detection and discriminatory tools absolutely necessary for confirmation of their identity. In this study, PCR primers and probes specific to different Liposcelis spp. were designed based on nucleotide sequences of the cytochrome oxidase 1 (CO1) gene. Primer sets ObsCo13F/13R, PeaCo15F/14R, BosCO7F/7R, BruCo5F/5R, and DecCo11F/11R were used to specifically detect Liposcelis obscura Broadhead, Liposcelis pearmani Lienhard, Liposcelis bostrychophila Badonnel, Liposcelis brunnea Motschulsky and Liposcelis decolor (Pearman) in multiplex endpoint PCRs, which amplified products of 438-, 351-, 191-, 140-, and 87-bp, respectively. In multiplex TaqMan qPCR assays, orange, yellow, red, crimson and green channels corresponding to reporter dyes 6-ROXN, HEX, Cy5, Quasar705 and 6-FAM specifically detected L. obscura, L. brunnea, L. bostrychophila, L. pearmani and L. decolor, respectively. All developed primer and probe sets allowed specific amplification of corresponding targeted Liposcelis species. The development of multiplex endpoint PCR and multiplex TaqMan qPCR will greatly facilitate psocid identification and their management. The use of APCs will streamline and standardize PCR assays. APC will also provide the opportunity to have all positive controls in a single tube, which reduces maintenance cost and labor, but increases the accuracy and reliability of the assays. These novel methods from our study will have applications in pest management, biosecurity, quarantine, food safety, and routine diagnostics. PMID:26086728

  6. Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

    PubMed Central

    Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meagher, Robert J.; Ball, Cameron Scott; Langevin, Stanley A.

    In this study, collection of mosquitoes and testing for vector-borne viruses is a key surveillance activity that directly influences the vector control efforts of public health agencies, including determining when and where to apply insecticides. Vector control districts in California routinely monitor for three human pathogenic viruses including West Nile virus (WNV), Western equine encephalitis virus (WEEV), and St. Louis encephalitis virus (SLEV). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) offers highly sensitive and specific detection of these three viruses in a single multiplex reaction, but this technique requires costly, specialized equipment that is generally only available in centralized publicmore » health laboratories. We report the use of reverse transcription loop-mediated isothermal amplification (RT-LAMP) to detect WNV, WEEV, and SLEV RNA extracted from pooled mosquito samples collected in California, including novel primer sets for specific detection of WEEV and SLEV, targeting the nonstructural protein 4 (nsP4) gene of WEEV and the 3’ untranslated region (3’-UTR) of SLEV. Our WEEV and SLEV RT-LAMP primers allowed detection of <0.1 PFU/reaction of their respective targets in <30 minutes, and exhibited high specificity without cross reactivity when tested against a panel of alphaviruses and flaviviruses. Furthermore, the SLEV primers do not cross-react with WNV, despite both viruses being closely related members of the Japanese encephalitis virus complex. The SLEV and WEEV primers can also be combined in a single RT-LAMP reaction, with discrimination between amplicons by melt curve analysis. Although RT-qPCR is approximately one order of magnitude more sensitive than RT-LAMP for all three targets, the RT-LAMP technique is less instrumentally intensive than RT-qPCR and provides a more cost-effective method of vector-borne virus surveillance.« less

  8. Surveillance for Western Equine Encephalitis, St. Louis Encephalitis, and West Nile Viruses Using Reverse Transcription Loop-Mediated Isothermal Amplification

    PubMed Central

    Wheeler, Sarah S.; Ball, Cameron S.; Langevin, Stanley A.; Fang, Ying; Coffey, Lark L.; Meagher, Robert J.

    2016-01-01

    Collection of mosquitoes and testing for vector-borne viruses is a key surveillance activity that directly influences the vector control efforts of public health agencies, including determining when and where to apply insecticides. Vector control districts in California routinely monitor for three human pathogenic viruses including West Nile virus (WNV), Western equine encephalitis virus (WEEV), and St. Louis encephalitis virus (SLEV). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) offers highly sensitive and specific detection of these three viruses in a single multiplex reaction, but this technique requires costly, specialized equipment that is generally only available in centralized public health laboratories. We report the use of reverse transcription loop-mediated isothermal amplification (RT-LAMP) to detect WNV, WEEV, and SLEV RNA extracted from pooled mosquito samples collected in California, including novel primer sets for specific detection of WEEV and SLEV, targeting the nonstructural protein 4 (nsP4) gene of WEEV and the 3’ untranslated region (3’-UTR) of SLEV. Our WEEV and SLEV RT-LAMP primers allowed detection of <0.1 PFU/reaction of their respective targets in <30 minutes, and exhibited high specificity without cross reactivity when tested against a panel of alphaviruses and flaviviruses. Furthermore, the SLEV primers do not cross-react with WNV, despite both viruses being closely related members of the Japanese encephalitis virus complex. The SLEV and WEEV primers can also be combined in a single RT-LAMP reaction, with discrimination between amplicons by melt curve analysis. Although RT-qPCR is approximately one order of magnitude more sensitive than RT-LAMP for all three targets, the RT-LAMP technique is less instrumentally intensive than RT-qPCR and provides a more cost-effective method of vector-borne virus surveillance. PMID:26807734

  9. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP) for Rapid Detection and Differentiation of Listeria monocytogenes.

    PubMed

    Wang, Yi; Wang, Yan; Ma, Aijing; Li, Dongxun; Luo, Lijuan; Liu, Dongxin; Hu, Shoukui; Jin, Dong; Liu, Kai; Ye, Changyun

    2015-12-03

    Here, a novel model of loop-mediated isothermal amplification (LAMP), termed multiple inner primers-LAMP (MIP-LAMP), was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD) of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD), or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  10. Development of SCAR markers for sex determination in the dioecious shrub Aucuba japonica (Cornaceae).

    PubMed

    Maki, Masayuki

    2009-03-01

    Two sex-linked fragments were identified by RAPD analyses in the dioecious diploid shrub Aucuba japonica var. ovoidea and were converted into markers of male-specific sequence characterized amplified region (SCAR) markers. PCRs using the primers designed in this study correctly discriminated 24 flowering males and 24 flowering females at higher annealing temperatures (SCAR markers OPA10-424 at 55 degrees C and OPN11-1095 at 65 degrees C), although at relatively low annealing temperatures, the fragments were amplified in both males and females. These SCAR primers were also tested to see whether they were applicable to sex identification in the conspecific tetraploid Aucuba japonica var. japonica. One set pf SCAR primers could be used for sex identification even in this tetraploid variety, although the other failed. The SCAR markers developed in this study will provide a powerful tool in identifying the sex of immature plants of dioecious A. japonica, which is a commercially valuable shrub due to its conspicuous fruits.

  11. Pentaplex PCR as screening assay for jellyfish species identification in food products.

    PubMed

    Armani, Andrea; Giusti, Alice; Castigliego, Lorenzo; Rossi, Aurelio; Tinacci, Lara; Gianfaldoni, Daniela; Guidi, Alessandra

    2014-12-17

    Salted jellyfish, a traditional food in Asian Countries, is nowadays spreading on the Western markets. In this work, we developed a Pentaplex PCR for the identification of five edible species (Nemopilema nomurai, Rhopilema esculentum, Rhizostoma pulmo, Pelagia noctiluca, and Cotylorhiza tuberculata), which cannot be identified by a mere visual inspection in jellyfish products sold as food. A common degenerated forward primer and five specie-specific reverse primers were designed to amplify COI gene regions of different lengths. Another primer pair targeted the 28SrRNA gene and was intended as common positive reaction control. Considering the high level of degradation in the DNA extracted from acidified and salted products, the maximum length of the amplicons was set at 200 bp. The PCR was developed using 66 reference DNA samples. It gave successful amplifications in 85.4% of 48 ready to eat products (REs) and in 60% of 30 classical salted products (CPs) collected on the market.

  12. RUCS: rapid identification of PCR primers for unique core sequences.

    PubMed

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

    2017-12-15

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  13. Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.

    PubMed

    Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R

    2001-04-01

    A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.

  14. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification.

    PubMed

    Murinda, Shelton E; Ibekwe, A Mark; Zulkaffly, Syaizul; Cruz, Andrew; Park, Stanley; Razak, Nur; Paudzai, Farah Md; Ab Samad, Liana; Baquir, Khairul; Muthaiyah, Kokilah; Santiago, Brenna; Rusli, Amirul; Balkcom, Sean

    2014-07-01

    Shiga toxin-producing Escherichia coli (STEC) are a major family of foodborne pathogens of public health, zoonotic, and economic significance in the United States and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal of this study was to assess the potential application of RPA in detection of STEC. This study focused on designing and evaluating RPA primers and fluorescent probes for isothermal (39°C) detection of STEC. Compatible sets of candidate primers and probes were designed for detection of Shiga toxin 1 and 2 (Stx1 and 2), respectively. The sets were evaluated for specificity and sensitivity against STEC (n=12) of various stx genotypes (stx1/stx2, stx1, or stx2, respectively), including non-Stx-producing E. coli (n=28) and other genera (n=7). The primers and probes that were designed targeted amplification of the subunit A moiety of stx1 and stx2. The assay detected STEC in real time (within 5-10 min at 39°C) with high sensitivity (93.5% vs. 90%; stx1 vs. stx2), specificity (99.1% vs. 100%; stx1 vs. stx2), and predictive value (97.9% for both stx1 vs. stx2). Limits of detection of ∼ 5-50 colony-forming units/mL were achieved in serially diluted cultures grown in brain heart infusion broth. This study successfully demonstrated for the first time that RPA can be used for isothermal real-time detection of STEC.

  15. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    PubMed

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    PubMed

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  17. Specificity of a Bacteroides thetaiotaomicron marker for human feces

    USGS Publications Warehouse

    Carson, C.A.; Christiansen, J.M.; Yampara-Iquise, H.; Benson, V.W.; Baffaut, C.; Davis, J.V.; Broz, R.R.; Kurtz, W.B.; Rogers, W.M.; Fales, W.H.

    2005-01-01

    A bacterial primer set, known to produce a 542-bp amplicon specific for Bacteroides thetaiotaomicron, generated this product in PCR with 1 ng of extracted DNA from 92% of 25 human fecal samples, 100% of 20 sewage samples, and 16% of 31 dog fecal samples. The marker was not detected in 1 ng of fecal DNA from 61 cows, 35 horses, 44 pigs, 24 chickens, 29 turkeys, and 17 geese. Copyright ?? 2005, American Society for Microbiology. All Rights Reserved.

  18. Quantification of Endospore-Forming Firmicutes by Quantitative PCR with the Functional Gene spo0A

    PubMed Central

    Bueche, Matthieu; Wunderlin, Tina; Roussel-Delif, Ludovic; Junier, Thomas; Sauvain, Loic; Jeanneret, Nicole

    2013-01-01

    Bacterial endospores are highly specialized cellular forms that allow endospore-forming Firmicutes (EFF) to tolerate harsh environmental conditions. EFF are considered ubiquitous in natural environments, in particular, those subjected to stress conditions. In addition to natural habitats, EFF are often the cause of contamination problems in anthropogenic environments, such as industrial production plants or hospitals. It is therefore desirable to assess their prevalence in environmental and industrial fields. To this end, a high-sensitivity detection method is still needed. The aim of this study was to develop and evaluate an approach based on quantitative PCR (qPCR). For this, the suitability of functional genes specific for and common to all EFF were evaluated. Seven genes were considered, but only spo0A was retained to identify conserved regions for qPCR primer design. An approach based on multivariate analysis was developed for primer design. Two primer sets were obtained and evaluated with 16 pure cultures, including representatives of the genera Bacillus, Paenibacillus, Brevibacillus, Geobacillus, Alicyclobacillus, Sulfobacillus, Clostridium, and Desulfotomaculum, as well as with environmental samples. The primer sets developed gave a reliable quantification when tested on laboratory strains, with the exception of Sulfobacillus and Desulfotomaculum. A test using sediment samples with a diverse EFF community also gave a reliable quantification compared to 16S rRNA gene pyrosequencing. A detection limit of about 104 cells (or spores) per gram of initial material was calculated, indicating this method has a promising potential for the detection of EFF over a wide range of applications. PMID:23811505

  19. Characterization of polymorphic microsatellites for the invasive grass Microstegium vimineum (Poaceae).

    PubMed

    Novy, Ari; Flory, S Luke; Honig, Joshua A; Bonos, Stacy; Hartman, Jean Marie

    2012-02-01

    Microsatellite markers were developed for the invasive plant Microstegium vimineum (Poaceae) to assess its population structure and to facilitate tracking of invasion expansion. Using 454 sequencing, 11 polymorphic and six monomorphic microsatellite primer sets were developed for M. vimineum. The primer sets were tested on individuals sampled from six populations in the United States and China. The polymorphic primers amplified di-, tri-, and tetranucleotide repeats with three to 10 alleles per locus. These markers will be useful for a variety of applications including tracking of invasion dynamics and population genetics studies.

  20. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Identification of Lactobacillus alimentarius and Lactobacillus farciminis with 16S-23S rDNA intergenic spacer region polymorphism and PCR amplification using species-specific oligonucleotide.

    PubMed

    Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X

    2003-01-01

    The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.

  2. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

    PubMed Central

    David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

    2017-01-01

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

  3. Development of Species-Specific Primers for Agronomical Thrips and Multiplex Assay for Quarantine Identification of Western Flower Thrips.

    PubMed

    Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

    2014-10-01

    While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.

  4. S-genotype identification based on allele-specific PCR in Japanese pear

    PubMed Central

    Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya

    2015-01-01

    Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617

  5. Detection of Bovine and Porcine Adenoviruses for Tracing the Source of Fecal Contamination

    PubMed Central

    Maluquer de Motes, Carlos; Clemente-Casares, Pilar; Hundesa, Ayalkibet; Martín, Margarita; Girones, Rosina

    2004-01-01

    In this study, a molecular procedure for the detection of adenoviruses of animal origin was developed to evaluate the level of excretion of these viruses by swine and cattle and to design a test to facilitate the tracing of specific sources of environmental viral contamination. Two sets of oligonucleotides were designed, one to detect porcine adenoviruses and the other to detect bovine and ovine adenoviruses. The specificity of the assays was assessed in 31 fecal samples and 12 sewage samples that were collected monthly during a 1-year period. The data also provided information on the environmental prevalence of animal adenoviruses. Porcine adenoviruses were detected in 17 of 24 (70%) pools of swine samples studied, with most isolates being closely related to serotype 3. Bovine adenoviruses were present in 6 of 8 (75%) pools studied, with strains belonging to the genera Mastadenovirus and Atadenovirus and being similar to bovine adenoviruses of types 2, 4, and 7. These sets of primers produced negative results in nested PCR assays when human adenovirus controls and urban-sewage samples were tested. Likewise, the sets of primers previously designed for detection of human adenovirus also produced negative results with animal adenoviruses. These results indicate the importance of further studies to evaluate the usefulness of these tests to trace the source of fecal contamination in water and food and for environmental studies. PMID:15006765

  6. Detection of bovine and porcine adenoviruses for tracing the source of fecal contamination.

    PubMed

    Maluquer de Motes, Carlos; Clemente-Casares, Pilar; Hundesa, Ayalkibet; Martín, Margarita; Girones, Rosina

    2004-03-01

    In this study, a molecular procedure for the detection of adenoviruses of animal origin was developed to evaluate the level of excretion of these viruses by swine and cattle and to design a test to facilitate the tracing of specific sources of environmental viral contamination. Two sets of oligonucleotides were designed, one to detect porcine adenoviruses and the other to detect bovine and ovine adenoviruses. The specificity of the assays was assessed in 31 fecal samples and 12 sewage samples that were collected monthly during a 1-year period. The data also provided information on the environmental prevalence of animal adenoviruses. Porcine adenoviruses were detected in 17 of 24 (70%) pools of swine samples studied, with most isolates being closely related to serotype 3. Bovine adenoviruses were present in 6 of 8 (75%) pools studied, with strains belonging to the genera Mastadenovirus and Atadenovirus and being similar to bovine adenoviruses of types 2, 4, and 7. These sets of primers produced negative results in nested PCR assays when human adenovirus controls and urban-sewage samples were tested. Likewise, the sets of primers previously designed for detection of human adenovirus also produced negative results with animal adenoviruses. These results indicate the importance of further studies to evaluate the usefulness of these tests to trace the source of fecal contamination in water and food and for environmental studies.

  7. A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

    PubMed

    van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

    2008-09-01

    To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

  8. An innovative SNP genotyping method adapting to multiple platforms and throughputs.

    PubMed

    Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

    2017-03-01

    An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

  9. Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

    PubMed

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2018-02-28

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  10. The largest subunit of RNA polymerase II as a new marker gene to study assemblages of arbuscular mycorrhizal fungi in the field.

    PubMed

    Stockinger, Herbert; Peyret-Guzzon, Marine; Koegel, Sally; Bouffaud, Marie-Lara; Redecker, Dirk

    2014-01-01

    Due to the potential of arbuscular mycorrhizal fungi (AMF, Glomeromycota) to improve plant growth and soil quality, the influence of agricultural practice on their diversity continues to be an important research question. Up to now studies of community diversity in AMF have exclusively been based on nuclear ribosomal gene regions, which in AMF show high intra-organism polymorphism, seriously complicating interpretation of these data. We designed specific PCR primers for 454 sequencing of a region of the largest subunit of RNA polymerase II gene, and established a new reference dataset comprising all major AMF lineages. This gene is known to be monomorphic within fungal isolates but shows an excellent barcode gap between species. We designed a primer set to amplify all known lineages of AMF and demonstrated its applicability in combination with high-throughput sequencing in a long-term tillage experiment. The PCR primers showed a specificity of 99.94% for glomeromycotan sequences. We found evidence of significant shifts of the AMF communities caused by soil management and showed that tillage effects on different AMF taxa are clearly more complex than previously thought. The high resolving power of high-throughput sequencing highlights the need for quantitative measurements to efficiently detect these effects.

  11. A Real-Time PCR Assay to Identify and Discriminate Among Wild-Type and Vaccine Strains of Varicella-Zoster Virus and Herpes Simplex Virus in Clinical Specimens, and Comparison With the Clinical Diagnoses

    PubMed Central

    Harbecke, Ruth; Oxman, Michael N.; Arnold, Beth A.; Ip, Charlotte; Johnson, Gary R.; Levin, Myron J.; Gelb, Lawrence D.; Schmader, Kenneth E.; Straus, Stephen E.; Wang, Hui; Wright, Peter F.; Pachucki, Constance T.; Gershon, Anne A.; Arbeit, Robert D.; Davis, Larry E.; Simberkoff, Michael S.; Weinberg, Adriana; Williams, Heather M.; Cheney, Carol; Petrukhin, Luba; Abraham, Katalin G.; Shaw, Alan; Manoff, Susan; Antonello, Joseph M.; Green, Tina; Wang, Yue; Tan, Charles; Keller, Paul M.

    2014-01-01

    A real-time PCR assay was developed to identify varicella-zoster virus (VZV) and herpes simplex virus (HSV) DNA in clinical specimens from subjects with suspected herpes zoster (HZ; shingles). Three sets of primers and probes were used in separate PCR reactions to detect and discriminate among wild-type VZV (VZV-WT), Oka vaccine strain VZV (VZV-Oka), and HSV DNA, and the reaction for each virus DNA was multiplexed with primers and probe specific for the human β-globin gene to assess specimen adequacy. Discrimination of all VZV-WT strains, including Japanese isolates and the Oka parent strain, from VZV-Oka was based upon a single nucleotide polymorphism at position 106262 in ORF 62, resulting in preferential amplification by the homologous primer pair. The assay was highly sensitive and specific for the target virus DNA, and no cross-reactions were detected with any other infectious agent. With the PCR assay as the gold standard, the sensitivity of virus culture was 53% for VZV and 77% for HSV. There was 92% agreement between the clinical diagnosis of HZ by the Clinical Evaluation Committee and the PCR assay results. PMID:19475609

  12. Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

    PubMed

    Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

    1997-05-02

    Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

    ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

  14. A Hamiltonian approach to the planar optimization of mid-course corrections

    NASA Astrophysics Data System (ADS)

    Iorfida, E.; Palmer, P. L.; Roberts, M.

    2016-04-01

    Lawden's primer vector theory gives a set of necessary conditions that characterize the optimality of a transfer orbit, defined accordingly to the possibility of adding mid-course corrections. In this paper a novel approach is proposed where, through a polar coordinates transformation, the primer vector components decouple. Furthermore, the case when transfer, departure and arrival orbits are coplanar is analyzed using a Hamiltonian approach. This procedure leads to approximate analytic solutions for the in-plane components of the primer vector. Moreover, the solution for the circular transfer case is proven to be the Hill's solution. The novel procedure reduces the mathematical and computational complexity of the original case study. It is shown that the primer vector is independent of the semi-major axis of the transfer orbit. The case with a fixed transfer trajectory and variable initial and final thrust impulses is studied. The acquired related optimality maps are presented and analyzed and they express the likelihood of a set of trajectories to be optimal. Furthermore, it is presented which kind of requirements have to be fulfilled by a set of departure and arrival orbits to have the same profile of primer vector.

  15. Combination Antiangiogenic and Immunomodulatory Gene Therapy for Breast Cancer

    DTIC Science & Technology

    2002-06-01

    Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a positive control. The samples were run on a...cultured cells and specific primers for Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a...positive control. Arrows indicate the 500 bp, 410 bp and 109 bp amplified products of Flk-1, endoglin and G3PDH , respectively. Fig 3. Viral replication

  16. An immunomagnetic separation-real-time PCR system for the detection of Alicyclobacillus acidoterrestris in fruit products.

    PubMed

    Wang, Zhouli; Cai, Rui; Yuan, Yahong; Niu, Chen; Hu, Zhongqiu; Yue, Tianli

    2014-04-03

    Alicyclobacillus acidoterrestris is the most important spoilage species within the Alicyclobacillus genus and has become a major issue in the pasteurized fruit juice industry. The aim of this study was to develop a method combining immunomagnetic separation (IMS) with real-time PCR system (IMS-PCR) for rapid and specific detection of A. acidoterrestris in fruit products. A real-time PCR with the TaqMan system was designed to target the 16S rDNA genes with specific primer and probe set. The specificity of the assay was confirmed using 9 A. acidoterrestris strains and 21 non-A. acidoterrestris strains. The results indicated that no combination of the designed primers and probe was found in any Alicyclobacillus genus except A. acidoterrestris. The detection limit of the established IMS-PCR was less than 10CFU/mL and the testing process was accomplished in 2-3h. For the three types of samples (sterile water, apple juice and kiwi juice), the correlation coefficient of standard curves was greater than 0.991, and the calculated PCR efficiencies were from 108% to 109%. As compared with the standard culture method performed concurrently on the same set of samples, the sensitivity, specificity and accuracy of IMS-PCR for 196 naturally contaminated fruit products were 90.0%, 98.3% and 97.5%, respectively. The results exhibited that the proposed IMS-PCR method was effective for the rapid detection of A. acidoterrestris in fruit products. Copyright © 2014. Published by Elsevier B.V.

  17. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    PubMed

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

  18. Rapid and reliable diagnostic method to detect Zika virus by real-time fluorescence reverse transcription loop-mediated isothermal amplification.

    PubMed

    Guo, Xu-Guang; Zhou, Yong-Zhuo; Li, Qin; Wang, Wei; Wen, Jin-Zhou; Zheng, Lei; Wang, Qian

    2018-04-18

    To detect Zika virus more rapidly and accurately, we developed a novel method that utilized a real-time fluorescence reverse transcription loop-mediated isothermal amplification (LAMP) technique. The NS5 gene was amplified by a set of six specific primers that recognized six distinct sequences. The amplification process, including 60 min of thermostatic reaction with Bst DNA polymerase following real-time fluorescence reverse transcriptase using genomic Zika virus standard strain (MR766), was conducted through fluorescent signaling. Among the six pairs of primers that we designate here, NS5 was the most efficient with a high sensitivity of up to 3.3 ng/μl and reproducible specificity on eight pathogen samples that were used as negative controls. The real-time fluorescence reverse transcription LAMP detection process can be completed within 35 min. Our study demonstrated that real-time fluorescence reverse transcription LAMP could be highly beneficial and convenient clinical application to detect Zika virus due to its high specificity and stability.

  19. A Next-Generation Sequencing Primer—How Does It Work and What Can It Do?

    PubMed Central

    Alekseyev, Yuriy O.; Fazeli, Roghayeh; Yang, Shi; Basran, Raveen; Miller, Nancy S.

    2018-01-01

    Next-generation sequencing refers to a high-throughput technology that determines the nucleic acid sequences and identifies variants in a sample. The technology has been introduced into clinical laboratory testing and produces test results for precision medicine. Since next-generation sequencing is relatively new, graduate students, medical students, pathology residents, and other physicians may benefit from a primer to provide a foundation about basic next-generation sequencing methods and applications, as well as specific examples where it has had diagnostic and prognostic utility. Next-generation sequencing technology grew out of advances in multiple fields to produce a sophisticated laboratory test with tremendous potential. Next-generation sequencing may be used in the clinical setting to look for specific genetic alterations in patients with cancer, diagnose inherited conditions such as cystic fibrosis, and detect and profile microbial organisms. This primer will review DNA sequencing technology, the commercialization of next-generation sequencing, and clinical uses of next-generation sequencing. Specific applications where next-generation sequencing has demonstrated utility in oncology are provided. PMID:29761157

  20. The Fungal Frontier: A Comparative Analysis of Methods Used in the Study of the Human Gut Mycobiome.

    PubMed

    Huseyin, Chloe E; Rubio, Raul Cabrera; O'Sullivan, Orla; Cotter, Paul D; Scanlan, Pauline D

    2017-01-01

    The human gut is host to a diverse range of fungal species, collectively referred to as the gut "mycobiome". The gut mycobiome is emerging as an area of considerable research interest due to the potential roles of these fungi in human health and disease. However, there is no consensus as to what the best or most suitable methodologies available are with respect to characterizing the human gut mycobiome. The aim of this study is to provide a comparative analysis of several previously published mycobiome-specific culture-dependent and -independent methodologies, including choice of culture media, incubation conditions (aerobic versus anaerobic), DNA extraction method, primer set and freezing of fecal samples to assess their relative merits and suitability for gut mycobiome analysis. There was no significant effect of media type or aeration on culture-dependent results. However, freezing was found to have a significant effect on fungal viability, with significantly lower fungal numbers recovered from frozen samples. DNA extraction method had a significant effect on DNA yield and quality. However, freezing and extraction method did not have any impact on either α or β diversity. There was also considerable variation in the ability of different fungal-specific primer sets to generate PCR products for subsequent sequence analysis. Through this investigation two DNA extraction methods and one primer set was identified which facilitated the analysis of the mycobiome for all samples in this study. Ultimately, a diverse range of fungal species were recovered using both approaches, with Candida and Saccharomyces identified as the most common fungal species recovered using culture-dependent and culture-independent methods, respectively. As has been apparent from ecological surveys of the bacterial fraction of the gut microbiota, the use of different methodologies can also impact on our understanding of gut mycobiome composition and therefore requires careful consideration. Future research into the gut mycobiome needs to adopt a common strategy to minimize potentially confounding effects of methodological choice and to facilitate comparative analysis of datasets.

  1. Quenching of unincorporated amplification signal reporters in reverse-transcription loop-mediated isothermal amplification enabling bright, single-step, closed-tube, and multiplexed detection of RNA viruses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ball, Cameron S.; Light, Yooli K.; Koh, Chung -Yan

    Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of themore » reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read “quasar”), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). As a result, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.« less

  2. Quenching of unincorporated amplification signal reporters in reverse-transcription loop-mediated isothermal amplification enabling bright, single-step, closed-tube, and multiplexed detection of RNA viruses

    DOE PAGES

    Ball, Cameron S.; Light, Yooli K.; Koh, Chung -Yan; ...

    2016-03-16

    Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of themore » reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read “quasar”), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). As a result, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.« less

  3. Identification of root rot fungi in nursery seedlings by nested multiplex PCR.

    PubMed Central

    Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M

    1996-01-01

    The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993

  4. A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the LightCycler.

    PubMed

    Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg

    2002-12-01

    The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.

  5. Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

    PubMed

    Robertson, Amber L; Phillips, Allison R

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

  6. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    PubMed Central

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  7. Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

    USDA-ARS?s Scientific Manuscript database

    Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

  8. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

  9. Rapid detection of all known ebolavirus species by reverse transcription-loop-mediated isothermal amplification (RT-LAMP).

    PubMed

    Oloniniyi, Olamide K; Kurosaki, Yohei; Miyamoto, Hiroko; Takada, Ayato; Yasuda, Jiro

    2017-08-01

    Ebola virus disease (EVD), a highly virulent infectious disease caused by ebolaviruses, has a fatality rate of 25-90%. Without a licensed chemotherapeutic agent or vaccine for the treatment and prevention of EVD, control of outbreaks requires accurate and rapid diagnosis of cases. In this study, five sets of six oligonucleotide primers targeting the nucleoprotein gene were designed for specific identification of each of the five ebolavirus species using reverse transcription-loop mediated isothermal amplification (RT-LAMP) assay. The detection limits of the ebolavirus species-specific primer sets were evaluated using in vitro transcribed RNAs. The detection limit of species-specific RT-LAMP assays for Zaire ebolavirus, Sudan ebolavirus, Taï Forest ebolavirus, and Bundibugyo ebolavirus was 256 copies/reaction, while the detection limit for Reston ebolavirus was 64 copies/reaction, and the detection time for each of the RT-LAMP assays was 13.3±3.0, 19.8±4.6, 14.3±0.6, 16.1±4.7, and 19.8±2.4min (mean±SD), respectively. The sensitivity of the species-specific RT-LAMP assays were similar to that of the established RT-PCR and quantitative RT-PCR assays for diagnosis of EVD and are suitable for field or point-of-care diagnosis. The RT-LAMP assays were specific for the detection of the respective species of ebolavirus with no cross reaction with other species of ebolavirus and other viral hemorrhagic fever viruses such as Marburg virus, Lassa fever virus, and Dengue virus. The species-specific RT-LAMP assays developed in this study are rapid, sensitive, and specific and could be useful in case of an EVD outbreak. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

    PubMed

    David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

    2017-01-04

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Standardized molecular diagnostic tool for the identification of cryptic species within the Bemisia tabaci complex.

    PubMed

    Elfekih, Samia; Tay, Wee Tek; Gordon, Karl; Court, Leon N; De Barro, Paul J

    2018-01-01

    The whitefly Bemisia tabaci complex harbours over 40 cryptic species that have been placed in 11 phylogenetically distinct clades based on the molecular characterization of partial mitochondrial DNA COI (mtCOI) gene region. Four cryptic species are currently within the invasive clade, i.e. MED, MEAM1, MEAM2 and IO. Correct identification of these species is a critical step towards implementing reliable measures for plant biosecurity and border protection; however, no standardized B. tabaci-specific primers are currently available which has caused inconsistencies in the species identification processes. We report three sets of polymerase chain reaction (PCR) primers developed to amplify the mtCOI region which can be used for genotyping MED, MEAM1 and IO species, and tested these primers on 91 MED, 35 MEAM1 and five IO individuals. PCR and sequencing of amplicons identified a total of 21, six and one haplotypes in MED, MEAM1 and IO respectively, of which six haplotypes were new to the B. tabaci database. These primer pairs enabled standardization and robust molecular species identification via mtCOI screening of the targeted invasive cryptic species and will improve quarantine decisions. Use of this diagnostic tool could be extended to other species within the complex. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    PubMed

    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

  13. Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

    PubMed

    Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

    2017-07-01

    Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

  14. Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification.

    PubMed

    Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun

    2015-07-08

    We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.

  15. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

  16. Detection of influenza virus types A and B and type A subtypes (H1, H3, and H5) by multiplex polymerase chain reaction.

    PubMed

    Boonsuk, Pitirat; Payungporn, Sunchai; Chieochansin, Thaweesak; Samransamruajkit, Rujipat; Amonsin, Alongkorn; Songserm, Thaweesak; Chaisingh, Arunee; Chamnanpood, Pornchai; Chutinimitkul, Salin; Theamboonlers, Apiradee; Poovorawan, Yong

    2008-07-01

    Infections with influenza virus type A and B present serious public health problems on a global scale. However, only influenza A virus has been reported to cause fatal pandemic in many species. To provide suitable clinical management and prevent further virus transmission, efficient and effective clinical diagnosis is essential. Therefore, we developed multiplex PCR assays for detecting influenza types A and B and the subtypes of influenza A virus (H1, H3 and H5). Upon performing multiplex PCR assays with type-specific primer sets, the clearly distinguishable products representing influenza A and B virus were separated by agarose gel electrophoresis. In addition, the subtypes of influenza A virus (H1, H3 and H5), which are most common in humans, can be readily distinguished by PCR with subtype-specific primer sets, yielding PCR products of different sizes depending on which subtype has been amplified. This method was tested on 46 influenza virus positive specimens of avian and mammalian (dog and human) origins collected between 2006 and 2008. The sensitivity of this method, tested against known concentrations of each type and subtype specific plasmid, was established to detect 10(3) copies/microl. The method's specificity was determined by testing against other subtypes of influenza A virus (H2, H4 and H6-H15) and respiratory pathogens commonly found in humans. None of them could be amplified, thus excluding cross reactivity. In conclusion, the multiplex PCR assays developed are advantageous as to rapidity, specificity, and cost effectiveness.

  17. A novel archaeal group in the phylum Crenarchaeota found unexpectedly in an eukaryotic survey in the Cariaco Basin.

    PubMed

    Jeon, Sun-Ok; Ahn, Tae-Seok; Hong, Sun-Hee

    2008-02-01

    Archaea have been found in many more diverse habitats than previously believed due in part to modern molecular approaches to discovering microbial diversity. We report here an unexpected expansion of the habitat diversity of the Archaea in the Cariaco Basin we found using a primer set designed for 18S eukaryotic rDNA sequence analysis. The results presented here expand the originally identified 9 archaeal clones reported in this environment using bacterial/archaeal primers to 152 archaeal clones: 67 (18 OTU) of these clones were found at a depth of 900 m of station A while 71 (9 OTU) of them were at a depth of between 300 approximately 335 m of station B&C depending upon which location the samples were taken. We used three phylogenetic analysis methods and detected 20 phylotypes belonging to a single previously unreported group distantly related to the Crenarchaeota. Also, we determined that the original nine sequences did not fall into any of the known phyla of the Archaea suggesting that they may represent a novel group within the Kingdom Archaea. Thus, from these two studies, we suggest that Archaea in the Cariaco Basin could be unique; however, further studies using archaeal-specific primers and the design of new primers as well as the systematic use of several different primer combinations may improve the chances of understanding the archeal diversity in the Cariaco Basin.

  18. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

    PubMed

    Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

    2009-01-01

    A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

  19. A novel qPCR protocol for the specific detection and quantification of the fuel-deteriorating fungus Hormoconis resinae.

    PubMed

    Martin-Sanchez, Pedro M; Gorbushina, Anna A; Kunte, Hans-Jörg; Toepel, Jörg

    2016-07-01

    A wide variety of fungi and bacteria are known to contaminate fuels and fuel systems. These microbial contaminants have been linked to fuel system fouling and corrosion. The fungus Hormoconis resinae, a common jet fuel contaminant, is used in this study as a model for developing innovative risk assessment methods. A novel qPCR protocol to detect and quantify H. resinae in, and together with, total fungal contamination of fuel systems is reported. Two primer sets, targeting the markers RPB2 and ITS, were selected for their remarkable specificity and sensitivity. These primers were successfully applied on fungal cultures and diesel samples demonstrating the validity and reliability of the established qPCR protocol. This novel tool allows clarification of the current role of H. resinae in fuel contamination cases, as well as providing a technique to detect fungal outbreaks in fuel systems. This tool can be expanded to other well-known fuel-deteriorating microorganisms.

  20. Helicobacter-negative gastritis: polymerase chain reaction for Helicobacter DNA is a valuable tool to elucidate the diagnosis.

    PubMed

    Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G

    2016-04-01

    Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P < 0.05). No Helicobacter DNA was found in control biopsies of 48 patients with neither primer set (P < 0.0001). In 274 patients with an endoscopic description, detection of H. pylori DNA was associated with ulcers and erosions (P < 0.01). Over all, in 339 histologically-negative gastric biopsies, Helicobacter DNA was detected in 169 (49.9%) samples with at least one primer set. Molecular testing offers a sensitive and specific diagnosis to a selected group of patients, in whom adequate searches for bacteria by conventional histology have resulted in the unsatisfactory diagnosis of H. pylori-negative gastritis. © 2016 John Wiley & Sons Ltd.

  1. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    NASA Astrophysics Data System (ADS)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  2. Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oetting, W.S.; Lee, H.K.; Flanders, D.J.

    The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

  3. A New Single-Step PCR Assay for the Detection of the Zoonotic Malaria Parasite Plasmodium knowlesi

    PubMed Central

    Lucchi, Naomi W.; Poorak, Mitra; Oberstaller, Jenna; DeBarry, Jeremy; Srinivasamoorthy, Ganesh; Goldman, Ira; Xayavong, Maniphet; da Silva, Alexandre J.; Peterson, David S.; Barnwell, John W.; Kissinger, Jessica; Udhayakumar, Venkatachalam

    2012-01-01

    Background Recent studies in Southeast Asia have demonstrated substantial zoonotic transmission of Plasmodium knowlesi to humans. Microscopically, P. knowlesi exhibits several stage-dependent morphological similarities to P. malariae and P. falciparum. These similarities often lead to misdiagnosis of P. knowlesi as either P. malariae or P. falciparum and PCR-based molecular diagnostic tests are required to accurately detect P. knowlesi in humans. The most commonly used PCR test has been found to give false positive results, especially with a proportion of P. vivax isolates. To address the need for more sensitive and specific diagnostic tests for the accurate diagnosis of P. knowlesi, we report development of a new single-step PCR assay that uses novel genomic targets to accurately detect this infection. Methodology and Significant Findings We have developed a bioinformatics approach to search the available malaria parasite genome database for the identification of suitable DNA sequences relevant for molecular diagnostic tests. Using this approach, we have identified multi-copy DNA sequences distributed in the P. knowlesi genome. We designed and tested several novel primers specific to new target sequences in a single-tube, non-nested PCR assay and identified one set of primers that accurately detects P. knowlesi. We show that this primer set has 100% specificity for the detection of P. knowlesi using three different strains (Nuri, H, and Hackeri), and one human case of malaria caused by P. knowlesi. This test did not show cross reactivity with any of the four human malaria parasite species including 11 different strains of P. vivax as well as 5 additional species of simian malaria parasites. Conclusions The new PCR assay based on novel P. knowlesi genomic sequence targets was able to accurately detect P. knowlesi. Additional laboratory and field-based testing of this assay will be necessary to further validate its utility for clinical diagnosis of P. knowlesi. PMID:22363751

  4. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    NASA Astrophysics Data System (ADS)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  5. New primer for specific amplification of the CAG repeat in Huntington disease alleles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bond, C.E.; Hodes, M.E.

    1994-09-01

    Huntington disease is an autosomal dominant neurodegenerative disorder caused by an expansion of a CAG trinucleotide repeat near the 5{prime} end of the gene for Huntington disease (IT15). The CAG repeat is flanked by a variable-length CCG repeat that is included in the amplification product obtained with most currently used primer sets and PCR protocols. Inclusion of this adjacent CCG repeat complicates the accurate assessment of CAG repeat length and interferes with the genotype determination of those individuals carrying alleles in the intermediate range between normal and expanded sized. Due to the GC-rich nature of this region, attempts at designingmore » a protocol for amplification of only the CAG repeat have proved unreliable and difficult to execute. We report here the development of a compatible primer set and PCR protocol that yields consistent amplification of the CAG-repeat region. PCR products can be visualized in ethidium bromide-stained agarose gels for rapid screening or in 6% polyacrylamide gels for determination of exact repeat length. This assay produces bands that can be sized accurately, while eliminating most nonspecific products. Fifty-five specimens examined showed consistency with another well-known method, but one that amplifies the CCG repeats as well. The results we obtained also matched the known carrier status of the donors.« less

  6. Cytochrome cd1-containing nitrite reductase encoding gene nirS as a new functional biomarker for detection of anaerobic ammonium oxidizing (Anammox) bacteria.

    PubMed

    Li, Meng; Ford, Tim; Li, Xiaoyan; Gu, Ji-Dong

    2011-04-15

    A newly designed primer set (AnnirS), together with a previously published primer set (ScnirS), was used to detect anammox bacterial nirS genes from sediments collected from three marine environments. Phylogenetic analysis demonstrated that all retrieved sequences were clearly different from typical denitrifiers' nirS, but do group together with the known anammox bacterial nirS. Sequences targeted by ScnirS are closely related to Scalindua nirS genes recovered from the Peruvian oxygen minimum zone (OMZ), whereas sequences targeted by AnnirS are more closely affiliated with the nirS of Candidatus 'Kuenenia stuttgartiensis' and even form a new phylogenetic nirS clade, which might be related to other genera of the anammox bacteria. Analysis demonstrated that retrieved sequences had higher sequence identities (>60%) with known anammox bacterial nirS genes than with denitrifiers' nirS, on both nucleotide and amino acid levels. Compared to the 16S rRNA and hydrazine oxidoreductase (hzo) genes, the anammox bacterial nirS not only showed consistent phylogenetic relationships but also demonstrated more reliable quantification of anammox bacteria because of the single copy of the nirS gene in the anammox bacterial genome and the specificity of PCR primers for different genera of anammox bacteria, thus providing a suitable functional biomarker for investigation of anammox bacteria.

  7. Detection of Cucurbit chlorotic yellows virus from Bemisia tabaci captured on sticky traps using reverse transcription loop-mediated isothermal amplification (RT-LAMP) and simple template preparation.

    PubMed

    Okuda, Mitsuru; Okuda, Shiori; Iwai, Hisashi

    2015-09-01

    Cucurbit chlorotic yellows virus (CCYV) of the genus Crinivirus within the family Closteroviridae is an emerging infectious agent of cucurbits leading to severe disease and significant economic losses. Effective detection and identification methods for this virus are urgently required. In this study, a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed to detect CCYV from its vector Bemisia tabaci. LAMP primer sets to detect CCYV were evaluated for their sensitivity and specificity, and a primer set designed from the HSP70h gene with corresponding loop primers were selected. The RT-LAMP assay was applied to detect CCYV from viruliferous B. tabaci trapped on sticky traps. A simple extraction procedure using RNAsecure™ was developed for template preparation. CCYV was detected in all of the B. tabaci 0, 1, 7 and 14 days after they were trapped. Although the rise of turbidity was delayed in reactions using RNA from B. tabaci trapped for 7 and 14 days compared with those from 0 and 1 day, the DNA amplification was sufficient to detect CCYV in all of the samples. These findings therefore present a simple template preparation method and an effective RT-LAMP assay, which can be easily and rapidly performed to monitor CCYV-viruliferous B. tabaci in the field. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

    PubMed

    Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

    2017-01-01

    This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

  9. Is the simian virus SV40 associated with idiopathic focal segmental glomerulosclerosis in humans?

    PubMed

    Galdenzi, Gabriella; Lupo, Antonio; Anglani, Franca; Perini, Marino; Galeazzi, Luciano; Giunta, Sergio; Marcantoni, Carmelita; Del Prete, Dorella; Graziotto, Romina; D'angelo, Angela; Maschio, Giuseppe; Gambaro, Giovanni

    2003-01-01

    Glomerulosclerosis was reported in mice transgenic for the simian polyomavirus SV40 early region that contains the transforming sequences encoding the SV40 large T-antigen (TAG). This was discovered when an SV40 epidemic occurred following the use of contaminated polio vaccines during 1955-1963, and led to investigations that showed an association between SV40 infection and tumors in humans. We investigated the possible association of SV40 infection and idiopathic focal segmental glomerulosclerosis (FSGS). The study was performed in 17 Bouin-fixed, paraffin-embedded renal biopsies from FSGS patients and 10 matched biopsies from patients with IgA glomerulonephritis; all patients had undergone polio vaccination in the early 1960s. Extracted DNA was polymerase chain reaction (PCR) amplified using SV.for3/SV.rev primers and GabE1/GabE2 primers; both sets of primers map in the region of SV40 TAG sequences, and amplify a fragment of respectively 105-bp and 135-bp. The biopsies considered were those in which the DNA was sufficiently intact to allow amplification of a fragment of 102-bp of the ApoE gene. Three FSGS and none of the IgA biopsies were positive for the SV.for3/SV.rev fragment. Conversely, amplification with GabE1/GabE2 primers did not lead to any specific product in either the IgA or FSGS biopsies. Restriction fragment length polymorphism and sequencing analyses revealed that the positive results obtained with the SV.for3/SV.rev primers were due to amplicons generated by multiple dimerization of forward and reverse primers. With the limited number of patients investigated, this study excludes the hypothesis that SV40 is associated with idiopathic FSGS.

  10. BchY-based degenerate primers target all types of anoxygenic photosynthetic bacteria in a single PCR.

    PubMed

    Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded

    2009-12-01

    To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.

  11. Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of micro-organisms.

    PubMed

    Wong, Y-P; Othman, S; Lau, Y-L; Radu, S; Chee, H-Y

    2018-03-01

    Loop-mediated isothermal amplification (LAMP) amplifies DNA with high specificity, efficiency and rapidity under isothermal conditions by using a DNA polymerase with high displacement strand activity and a set of specifically designed primers to amplify targeted DNA strands. Following its first discovery by Notomi et al. ( Nucleic Acids Res 28: E63), LAMP was further developed over the years which involved the combination of this technique with other molecular approaches, such as reverse transcription and multiplex amplification for the detection of infectious diseases caused by micro-organisms in humans, livestock and plants. In this review, available types of LAMP techniques will be discussed together with their applications in detection of various micro-organisms. Up to date, there are varieties of LAMP detection methods available including colorimetric and fluorescent detection, real-time monitoring using turbidity metre and detection using lateral flow device which will also be highlighted in this review. Apart from that, commercialization of LAMP technique had also been reported such as lyophilized form of LAMP reagents kit and LAMP primer sets for detection of pathogenic micro-organisms. On top of that, advantages and limitations of this molecular detection method are also described together with its future potential as a diagnostic method for infectious disease. © 2017 The Society for Applied Microbiology.

  12. A PCR-Based Diagnostic System for Differentiating Two Weevil Species (Coleoptera: Curculionidae) of Economic Importance to the Chilean Citrus Industry.

    PubMed

    Aguirre, C; Olivares, N; Luppichini, P; Hinrichsen, P

    2015-02-01

    A PCR-based method was developed to identify Naupactus cervinus (Boheman) and Naupactus xanthographus (Germar), two curculionids affecting the citrus industry in Chile. The quarantine status of these two species depends on the country to which fruits are exported. This identification method was developed because it is not possible to discriminate between these two species at the egg stage. The method is based on the species-specific amplification of sequences of internal transcribed spacers, for which we cloned and sequenced these genome fragments from each species. We designed an identification system based on two duplex-PCR reactions. Each one contains the species-specific primer set and a second generic primer set that amplify a short 18S region common to coleopterans, to avoid false negatives. The marker system is able to differentiate each Naupactus species at any life stage, and with a diagnostic sensitivity to 0.045 ng of genomic DNA. This PCR kit was validated by samples collected from different citrus production areas throughout Chile and showed 100% accuracy in differentiating the two Naupactus species. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Detection of Canine Distemper Virus Nucleoprotein RNA by Reverse Transcription-PCR Using Serum, Whole Blood, and Cerebrospinal Fluid from Dogs with Distemper

    PubMed Central

    Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.

    1999-01-01

    Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566

  14. Detection of Bacillus spores using PCR and FTA filters.

    PubMed

    Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

    2004-05-01

    Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

  15. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  16. Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

    PubMed

    Smielewska-Loś, E

    2003-01-01

    Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

  17. Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

    PubMed

    Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

    2014-11-01

    To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  18. Development of PCR protocols for specific identification of Clostridium spiroforme and detection of sas and sbs genes.

    PubMed

    Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio

    2008-10-15

    Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.

  19. Gemi: PCR Primers Prediction from Multiple Alignments

    PubMed Central

    Sobhy, Haitham; Colson, Philippe

    2012-01-01

    Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

  20. SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana).

    PubMed

    Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T

    2016-09-01

    To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.

  1. MethPrimer: designing primers for methylation PCRs.

    PubMed

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  2. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  3. Specific Detection and Identification of American Mulberry-Infecting and Italian Olive-Associated Strains of Xylella fastidiosa by Polymerase Chain Reaction

    PubMed Central

    Guan, Wei; Shao, Jonathan; Elbeaino, Toufic; Davis, Robert E.; Zhao, Tingchang; Huang, Qi

    2015-01-01

    Xylella fastidiosa causes bacterial leaf scorch in many landscape trees including elm, oak, sycamore and mulberry, but methods for specific identification of a particular tree host species-limited strain or differentiation of tree-specific strains are lacking. It is also unknown whether a particular landscape tree-infecting X. fastidiosa strain is capable of infecting multiple landscape tree species in an urban environment. We developed two PCR primers specific for mulberry-infecting strains of X. fastidiosa based on the nucleotide sequence of a unique open reading frame identified only in mulberry-infecting strains among all the North and South American strains of X. fastidiosa sequenced to date. PCR using the primers allowed for detection and identification of mulberry-infecting X. fastidiosa strains in cultures and in samples collected from naturally infected mulberry trees. In addition, no mixed infections with or non-specific detections of the mulberry-infecting strains of X. fastidiosa were found in naturally X. fastidiosa-infected oak, elm and sycamore trees growing in the same region where naturally infected mulberry trees were grown. This genotype-specific PCR assay will be valuable for disease diagnosis, studies of strain-specific infections in insects and plant hosts, and management of diseases caused by X. fastidiosa. Unexpectedly but interestingly, the unique open reading frame conserved in the mulberry-infecting strains in the U. S. was also identified in the recently sequenced olive-associated strain CoDiRO isolated in Italy. When the primer set was tested against naturally infected olive plant samples collected in Italy, it allowed for detection of olive-associated strains of X. fastidiosa in Italy. This PCR assay, therefore, will also be useful for detection and identification of the Italian group of X. fastidiosa strains to aid understanding of the occurrence, evolution and biology of this new group of X. fastidiosa strains. PMID:26061051

  4. Specific Detection and Identification of American Mulberry-Infecting and Italian Olive-Associated Strains of Xylella fastidiosa by Polymerase Chain Reaction.

    PubMed

    Guan, Wei; Shao, Jonathan; Elbeaino, Toufic; Davis, Robert E; Zhao, Tingchang; Huang, Qi

    2015-01-01

    Xylella fastidiosa causes bacterial leaf scorch in many landscape trees including elm, oak, sycamore and mulberry, but methods for specific identification of a particular tree host species-limited strain or differentiation of tree-specific strains are lacking. It is also unknown whether a particular landscape tree-infecting X. fastidiosa strain is capable of infecting multiple landscape tree species in an urban environment. We developed two PCR primers specific for mulberry-infecting strains of X. fastidiosa based on the nucleotide sequence of a unique open reading frame identified only in mulberry-infecting strains among all the North and South American strains of X. fastidiosa sequenced to date. PCR using the primers allowed for detection and identification of mulberry-infecting X. fastidiosa strains in cultures and in samples collected from naturally infected mulberry trees. In addition, no mixed infections with or non-specific detections of the mulberry-infecting strains of X. fastidiosa were found in naturally X. fastidiosa-infected oak, elm and sycamore trees growing in the same region where naturally infected mulberry trees were grown. This genotype-specific PCR assay will be valuable for disease diagnosis, studies of strain-specific infections in insects and plant hosts, and management of diseases caused by X. fastidiosa. Unexpectedly but interestingly, the unique open reading frame conserved in the mulberry-infecting strains in the U. S. was also identified in the recently sequenced olive-associated strain CoDiRO isolated in Italy. When the primer set was tested against naturally infected olive plant samples collected in Italy, it allowed for detection of olive-associated strains of X. fastidiosa in Italy. This PCR assay, therefore, will also be useful for detection and identification of the Italian group of X. fastidiosa strains to aid understanding of the occurrence, evolution and biology of this new group of X. fastidiosa strains.

  5. Surveillance for Western equine encephalitis St. Louis encephalitis and West Nile viruses using reverse transcription loop-mediated isothermal amplification

    DOE PAGES

    Meagher, Robert J.; Ball, Cameron Scott; Langevin, Stanley A.; ...

    2016-01-25

    In this study, collection of mosquitoes and testing for vector-borne viruses is a key surveillance activity that directly influences the vector control efforts of public health agencies, including determining when and where to apply insecticides. Vector control districts in California routinely monitor for three human pathogenic viruses including West Nile virus (WNV), Western equine encephalitis virus (WEEV), and St. Louis encephalitis virus (SLEV). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) offers highly sensitive and specific detection of these three viruses in a single multiplex reaction, but this technique requires costly, specialized equipment that is generally only available in centralized publicmore » health laboratories. We report the use of reverse transcription loop-mediated isothermal amplification (RT-LAMP) to detect WNV, WEEV, and SLEV RNA extracted from pooled mosquito samples collected in California, including novel primer sets for specific detection of WEEV and SLEV, targeting the nonstructural protein 4 (nsP4) gene of WEEV and the 3’ untranslated region (3’-UTR) of SLEV. Our WEEV and SLEV RT-LAMP primers allowed detection of <0.1 PFU/reaction of their respective targets in <30 minutes, and exhibited high specificity without cross reactivity when tested against a panel of alphaviruses and flaviviruses. Furthermore, the SLEV primers do not cross-react with WNV, despite both viruses being closely related members of the Japanese encephalitis virus complex. The SLEV and WEEV primers can also be combined in a single RT-LAMP reaction, with discrimination between amplicons by melt curve analysis. Although RT-qPCR is approximately one order of magnitude more sensitive than RT-LAMP for all three targets, the RT-LAMP technique is less instrumentally intensive than RT-qPCR and provides a more cost-effective method of vector-borne virus surveillance.« less

  6. Development and validation of four one-step real-time RT-LAMP assays for specific detection of each dengue virus serotype

    PubMed Central

    Bekaert, Michaël; Bakheit, Mohammed; Frischmann, Sieghard; Patel, Pranav; Simon-Loriere, Etienne; Lambrechts, Louis; Duong, Veasna; Dussart, Philippe; Harold, Graham; Fall, Cheikh; Faye, Oumar; Sall, Amadou Alpha; Weidmann, Manfred

    2018-01-01

    Background 4 one-step, real-time, reverse transcription loop-mediated isothermal amplification (RT-LAMP) assays were developed for the detection of dengue virus (DENV) serotypes by considering 2,056 full genome DENV sequences. DENV1 and DENV2 RT-LAMP assays were validated with 31 blood and 11 serum samples from Tanzania, Senegal, Sudan and Mauritania. DENV3 and DENV4 RT-LAMP assays were validated with 25 serum samples from Cambodia Methodology/Principal findings 4 final reaction primer mixes were obtained by using a combination of Principal Component Analysis of the full DENV genome sequences, and LAMP primer design based on sequence alignments using the LAVA software. These mixes contained 14 (DENV1), 12 (DENV2), 8 (DENV3) and 3 (DENV4) LAMP primer sets. The assays were evaluated with an External Quality Assessment panel from Quality Control for Molecular Diagnostics. The assays were serotype-specific and did not cross-detect with other flaviviruses. The limits of detection, with 95% probability, were 22 (DENV1), 542 (DENV2), 197 (DENV3) and 641 (DENV4) RNA molecules, and 100% reproducibility in the assays was obtained with up to 102 (DENV1) and 103 RNA molecules (DENV2, DENV3 and DENV4). Validation of the DENV2 assay with blood samples from Tanzania resulted in 23 samples detected by RT-LAMP, demonstrating that the assay is 100% specific and 95.8% sensitive (positive predictive value of 100% and a negative predictive value of 85.7%). All serum samples from Senegal, Sudan and Mauritania were detected and 3 untyped as DENV1. The sensitivity of RT-LAMP for DENV4 samples from Cambodia did not quite match qRT-PCR. Conclusions/Significance We have shown a novel approach to design LAMP primers that makes use of fast growing sequence databases. The DENV1 and DENV2 assays were validated with viral RNA extracted clinical samples, showing very good performance parameters. PMID:29813062

  7. Development of Cross-Assembly Phage PCR-Based Methods ...

    EPA Pesticide Factsheets

    Technologies that can characterize human fecal pollution in environmental waters offer many advantages over traditional general indicator approaches. However, many human-associated methods cross-react with non-human animal sources and lack suitable sensitivity for fecal source identification applications. The genome of a newly discovered bacteriophage (~97 kbp), the Cross-Assembly phage or “crAssphage”, assembled from a human gut metagenome DNA sequence library is predicted to be both highly abundant and predominately occur in human feces suggesting that this double stranded DNA virus may be an ideal human fecal pollution indicator. We report the development of two human-associated crAssphage endpoint PCR methods (crAss056 and crAss064). A shotgun strategy was employed where 384 candidate primers were designed to cover ~41 kbp of the crAssphage genome deemed favorable for method development based on a series of bioinformatics analyses. Candidate primers were subjected to three rounds of testing to evaluate assay optimization, specificity, limit of detection (LOD95), geographic variability, and performance in environmental water samples. The top two performing candidate primer sets exhibited 100% specificity (n = 70 individual samples from 8 different animal species), >90% sensitivity (n = 10 raw sewage samples from different geographic locations), LOD95 of 0.01 ng/µL of total DNA per reaction, and successfully detected human fecal pollution in impaired envi

  8. Genetic heterogeneity of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in Belgium.

    PubMed

    Misonne, M C; Van Impe, G; Hoet, P P

    1998-11-01

    Borrelia burgdorferi sensu lato (s.l.), the etiological agent of Lyme disease, is transmitted by the bite of Ixodes ricinus. Four hundred eighty-nine ticks, collected in four locations of a region of southern Belgium where Lyme disease is endemic, were examined for the presence of the spirochete. In a PCR test with primers that recognize a chromosomal gene of all strains, 23% of the ticks were found to be infected. The species B. burgdorferi s.l. comprises at least three pathogenic genomospecies, B. burgdorferi sensu stricto (s.s.), Borrelia garinii, and Borrelia afzelii, which could be distinguished in PCR tests with species-specific primers that correspond to distinct plasmid sequences. B. garinii was most prevalent (53% of infected ticks), followed by B. burgdorferi s.s. (38%) and B. afzelii (9%). Of the infected ticks, 40% were infected with a single species, 40% were infected with two species, and 5% were infected with all three species. For 15% of the ticks, the infecting species could not be identified. No difference in rates of prevalence was observed among the four locations, which had similar ground covers, even though they belonged to distinct biogeographic regions. A greater heterogeneity of spirochetal DNA in ticks than in cultured reference DNA was suggested by a comparison of the results of PCRs with two different sets of species-specific primer sequences.

  9. Development of SCAR marker for discrimination of Artemisia princeps and A. argyi from other Artemisia herbs.

    PubMed

    Lee, Mi Young; Doh, Eui Jeong; Park, Chae Haeng; Kim, Young Hwa; Kim, Eung Soo; Ko, Byong Seob; Oh, Seung-Eun

    2006-04-01

    Some Artemisia herbs are used for medicinal purposes. In particular, A. princeps and A. argyi are classified as 'Aeyup' and are used as important medicinal material in traditional Korean medicine. On the other hand, A. capillaris and A. iwayomogi, which are classified as 'Injinho' and 'Haninjin', respectively, are used for other purposes distinct from those of 'Aeyup'. However, sometimes 'Aeyup' is not clearly discriminated from 'Injinho' and/or 'Haninjin'. Furthermore, Artemisia capillaris and/or A. iwayomogi have been used in place of A. princeps and A. argyi. In this study, we developed an efficient method to discriminate A. argyi and A. princeps from other Artemisia plants. The RAPD (random amplified polymorphic DNA) method efficiently discriminated various Artemisia herbs. In particular, non-specific primer 329 (5'-GCG AAC CTC C-3'), which shows polymorphism among Artemisia herbs, amplified 838 bp products, which are specific to A. princeps and A. argyi only. Based on nucleotide sequence of the primer 329 product, we designed a Fb (5'-CAT CAA CCA TGG CTT ATC CT-3') and R7 (5'-GCG AAC CTC CCC ATT CCA-3') primer-set to amplify a 254 bp sized SCAR (sequence characterized amplified regions) marker, through which A. princeps and A. argyi can be efficiently discriminated from other Artemisia herbs, particularly, A. capillaris and A. iwayomogi.

  10. Development of a quantitative fluorescence single primer isothermal amplification-based method for the detection of Salmonella.

    PubMed

    Wang, Jianchang; Li, Rui; Hu, Lianxia; Sun, Xiaoxia; Wang, Jinfeng; Li, Jing

    2016-02-16

    Food-borne disease caused by Salmonella has long been, and continues to be, an important global public health problem, necessitating rapid and accurate detection of Salmonella in food. Real time PCR is the most recently developed approach for Salmonella detection. Single primer isothermal amplification (SPIA), a novel gene amplification technique, has emerged as an attractive microbiological testing method. SPIA is performed under a constant temperature, eliminating the need for an expensive thermo-cycler. In addition, SPIA reactions can be accomplished in 30 min, faster than real time PCR that usually takes over 2h. We developed a quantitative fluorescence SPIA-based method for the detection of Salmonella. Using Salmonella Typhimurium genomic DNA as template and a primer targeting Salmonella invA gene, we showed the detection limit of SPIA was 2.0 × 10(1)fg DNA. Its successful amplification of different serotypic Salmonella genomic DNA but not non-Salmonella bacterial DNA demonstrated the specificity of SPIA. Furthermore, this method was validated with artificially contaminated beef. In conclusion, we showed high sensitivity and specificity of SPIA in the detection of Salmonella, comparable to real time PCR. In addition, SPIA is faster and more cost-effective (non-use of expensive cyclers), making it a potential alternative for field detection of Salmonella in resource-limited settings that are commonly encountered in developing countries. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Quantification of intestinal bacterial populations by real-time PCR with a universal primer set and minor groove binder probes: a global approach to the enteric flora.

    PubMed

    Ott, Stephan J; Musfeldt, Meike; Ullmann, Uwe; Hampe, Jochen; Schreiber, Stefan

    2004-06-01

    The composition of the human intestinal flora is important for the health status of the host. The global composition and the presence of specific pathogens are relevant to the effects of the flora. Therefore, accurate quantification of all major bacterial populations of the enteric flora is needed. A TaqMan real-time PCR-based method for the quantification of 20 dominant bacterial species and groups of the intestinal flora has been established on the basis of 16S ribosomal DNA taxonomy. A PCR with conserved primers was used for all reactions. In each real-time PCR, a universal probe for quantification of total bacteria and a specific probe for the species in question were included. PCR with conserved primers and the universal probe for total bacteria allowed relative and absolute quantification. Minor groove binder probes increased the sensitivity of the assays 10- to 100-fold. The method was evaluated by cross-reaction experiments and quantification of bacteria in complex clinical samples from healthy patients. A sensitivity of 10(1) to 10(3) bacterial cells per sample was achieved. No significant cross-reaction was observed. The real-time PCR assays presented may facilitate understanding of the intestinal bacterial flora through a normalized global estimation of the major contributing species.

  12. Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of lymphocystis disease virus.

    PubMed

    Li, Qiong; Yue, Zhiqin; Liu, Hong; Liang, Chengzhu; Zheng, Xiaolong; Zhao, Yuran; Chen, Xiao; Xiao, Xizhi; Chen, Changfu

    2010-02-01

    A loop-mediated isothermal amplification (LAMP) assay was developed for the detection of lymphocystis disease virus (LCDV). A set of five specific primers, two inner and two outer primers and a loop primer, were designed on the basis of the major capsid protein gene of LCDV. The reaction time and temperatures were optimized for 60 min at 63 degrees C, respectively. LAMP amplification products were detected by a ladder-like appearance on agarose gel electrophoresis or a naked-eye inspection of a color change in the reaction tube by addition of SYBR Green I. The assay was specific for LCDV, and there was no cross-reactivity with white spot syndrome virus (WSSV) or six other Iridoviridae viruses (epizootic hematopoietic necrosis virus, EHNV; tiger frog virus, TFV; Bohle iridovirus, BIV; soft-shelled turtle iridovirus, STIV; infectious spleen and kidney necrosis virus, ISKNV; red sea bream iridovirus, RSIV). The detection limit of the LAMP assay was 15 fg, which was similar to that of real-time quantitative polymerase chain reaction (PCR) and 10-fold higher than the conventional PCR. The LAMP assay was evaluated using 109 clinical samples, and the results indicated the suitability and simplicity of the test as a rapid, field diagnostic tool for detection of LCDV. The LCDV LAMP assay has potential for early diagnosis of LCDV infection. 2009 Elsevier B.V. All rights reserved.

  13. Detection and Identification of Decay Fungi in Spruce Wood by Restriction Fragment Length Polymorphism Analysis of Amplified Genes Encoding rRNA†

    PubMed Central

    Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody

    2000-01-01

    We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916

  14. Population diversity of ammonium oxidizers investigated by specific PCR amplification

    USGS Publications Warehouse

    Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

    1997-01-01

    The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

  15. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

    PubMed Central

    Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

    2014-01-01

    For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

  16. Evaluation of Faecalibacterium 16S rDNA genetic markers for accurate identification of swine faecal waste by quantitative PCR.

    PubMed

    Duan, Chuanren; Cui, Yamin; Zhao, Yi; Zhai, Jun; Zhang, Baoyun; Zhang, Kun; Sun, Da; Chen, Hang

    2016-10-01

    A genetic marker within the 16S rRNA gene of Faecalibacterium was identified for use in a quantitative PCR (qPCR) assay to detect swine faecal contamination in water. A total of 146,038 bacterial sequences were obtained using 454 pyrosequencing. By comparative bioinformatics analysis of Faecalibacterium sequences with those of numerous swine and other animal species, swine-specific Faecalibacterium 16S rRNA gene sequences were identified and Polymerase Chain Okabe (PCR) primer sets designed and tested against faecal DNA samples from swine and non-swine sources. Two PCR primer sets, PFB-1 and PFB-2, showed the highest specificity to swine faecal waste and had no cross-reaction with other animal samples. PFB-1 and PFB-2 amplified 16S rRNA gene sequences from 50 samples of swine with positive ratios of 86 and 90%, respectively. We compared swine-specific Faecalibacterium qPCR assays for the purpose of quantifying the newly identified markers. The quantification limits (LOQs) of PFB-1 and PFB-2 markers in environmental water were 6.5 and 2.9 copies per 100 ml, respectively. Of the swine-associated assays tested, PFB-2 was more sensitive in detecting the swine faecal waste and quantifying the microbial load. Furthermore, the microbial abundance and diversity of the microbiomes of swine and other animal faeces were estimated using operational taxonomic units (OTUs). The species specificity was demonstrated for the microbial populations present in various animal faeces. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Molecular tools for the identification of Tuber melanosporum in agroindustry.

    PubMed

    Séjalon-Delmas, N; Roux, C; Martins, M; Kulifaj, M; Bécard, G; Dargent, R

    2000-06-01

    Tuber melanosporum Vitt., Tuber magnatum Pico, and Tuber uncinatum Chat. can be differentiated by their morphological characters. Fraud problems have arisen recently with the importation to Europe of truffles from China. T. melanosporum is morphologically very close, but distinct from the Chinese species [Tuber indicum (Cooke and Massee) and T. himalayense BC (Zhang and Winter)]. We have optimized molecular tools to unequivocally identify T. melanosporum. DNA extraction from ascocarps of black truffles is not straightforward. Problems to obtain pure DNA are due to high contents of phenolic compounds, melanine, and various polymers (proteins, polysaccharides, etc). These compounds coprecipitate with the DNA during extraction and strongly inhibit the PCR reaction. We have developed an efficient and reliable protocol for DNA extraction from truffle ascocarps. It was used successfully for DNA extraction from mycorrhizal root tips as well as from canned preparations of T. melanosporum. Several approaches to identify T. melanosporum by PCR were developed. Two specific primers for T. melanosporum were designed after comparison of the ITS region of this species with those of three Chinese fungi. They proved to be efficient to specifically detect the presence of T. melanosporum by PCR. The mycorrhizal status of trees inoculated with T. melanosporum but unable to produce truffles was confirmed in a single-step PCR reaction. A multiplex PCR approach was also developed with three sets of primers (including a specific one for Chinese truffles) to detect, in one PCR reaction, the presence of any other Tuber species mixed with T. melanosporum ascocarps. This optimized protocol, in association with the specific primers we designed, is applicable to quality control in the truffle industry from the production stages to final commercial products.

  18. MRPrimerV: a database of PCR primers for RNA virus detection

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  19. High-throughput avian molecular sexing by SYBR green-based real-time PCR combined with melting curve analysis.

    PubMed

    Chang, Hsueh-Wei; Cheng, Chun-An; Gu, De-Leung; Chang, Chia-Che; Su, San-Hua; Wen, Cheng-Hao; Chou, Yii-Cheng; Chou, Ta-Ching; Yao, Cheng-Te; Tsai, Chi-Li; Cheng, Chien-Chung

    2008-02-12

    Combination of CHD (chromo-helicase-DNA binding protein)-specific polymerase chain reaction (PCR) with electrophoresis (PCR/electrophoresis) is the most common avian molecular sexing technique but it is lab-intensive and gel-required. Gender determination often fails when the difference in length between the PCR products of CHD-Z and CHD-W genes is too short to be resolved. Here, we are the first to introduce a PCR-melting curve analysis (PCR/MCA) to identify the gender of birds by genomic DNA, which is gel-free, quick, and inexpensive. Spilornis cheela hoya (S. c. hoya) and Pycnonotus sinensis (P. sinensis) were used to illustrate this novel molecular sexing technique. The difference in the length of CHD genes in S. c. hoya and P. sinensis is 13-, and 52-bp, respectively. Using Griffiths' P2/P8 primers, molecular sexing failed both in PCR/electrophoresis of S. c. hoya and in PCR/MCA of S. c. hoya and P. sinensis. In contrast, we redesigned sex-specific primers to yield 185- and 112-bp PCR products for the CHD-Z and CHD-W genes of S. c. hoya, respectively, using PCR/MCA. Using this specific primer set, at least 13 samples of S. c. hoya were examined simultaneously and the Tm peaks of CHD-Z and CHD-W PCR products were distinguished. In this study, we introduced a high-throughput avian molecular sexing technique and successfully applied it to two species. This new method holds a great potential for use in high throughput sexing of other avian species, as well.

  20. Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

    PubMed

    Gell, I; Cubero, J; Melgarejo, P

    2007-12-01

    To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

  1. Simultaneous detection of wheat dwarf virus, northern cereal mosaic virus, barley yellow striate mosaic virus and rice black-streaked dwarf virus in wheat by multiplex RT-PCR.

    PubMed

    Zhang, Peipei; Liu, Yan; Liu, Wenwen; Massart, Sebastien; Wang, Xifeng

    2017-11-01

    Wheat dwarf virus (WDV), barley yellow striate mosaic virus (BYSMV), rice black-streaked dwarf virus (RBSDV) and northern cereal mosaic virus (NCMV) are four viruses infecting wheat and causing similar symptoms. In this paper, a multiplex reverse transcription polymerase chain reaction (m-RT-PCR) method has been developed for the simultaneous detection and discrimination of these viruses. The protocol uses specific primer set for each virus and produces four distinct fragments (273, 565, 783 and 1296bp), detecting the presence of RBSDV, BYSMV, WDV and NCMV, respectively. Annealing temperature, concentrations of dNTP, Taq polymerase and Mg 2+ were optimized for the m-RT-PCR. The detection limit of the assay was up to 10 -2 dilution. The amplification specificity of these primers was tested against a range of field samples from different regions of China, where RBSDV, BYSMV, WDV have been detected. This study fulfills the need for a rapid and specific wheat virus detection that also has the potential for investigating the epidemiology of these new viral diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene.

    PubMed

    Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee

    2007-01-01

    Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.

  3. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  4. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  5. Development of Real-Time PCR to Monitor Groundwater Contaminated by Fecal Sources and Leachate from the Carcass

    NASA Astrophysics Data System (ADS)

    Park, S.; Kim, H.; Kim, M.; Lee, Y.; Han, J.

    2011-12-01

    The 2010 outbreak of foot and mouth disease (FMD) in South Korea caused about 4,054 carcass burial sites to dispose the carcasses. Potential environmental impacts by leachate of carcass on groundwater have been issued and it still needs to be studied. Therefore, we tried to develop robust and sensitive tool to immediately determine a groundwater contamination by the leachate from carcass burial. For tracking both an agricultural fecal contamination source and the leachate in groundwater, competitive real-time PCR and PCR method were developed using various PCR primer sets designed to detect E. Coli uidA gene and mtDNA(cytochrome B, cytB) of the animal species such as ovine, porcine, caprine, and bovine. The designed methods were applied to tract the animal species in livestock wastewater and leachate of carcass under appropriate PCR or real-time PCR condition. In the result, mtDNA primer sets for individual (Cow or Pig) and multiple (Cow and Pig) amplification, and E. Coli uidA primers for fecal source amplification were specific and sensitive to target genes. To determine contamination source, concentration of amplified mtDNA and uidA was competitively quantified in Livestock wastewater, leachate of carcass, and groundwater. The highest concentration of mtDNA and uidA showed in leachate of carcass and livestock wastewater, respectively. Groundwater samples possibly contaminated by leachate of carcass were analyzed by this assay and it was able to prove contamination source.

  6. Comparative analysis of detection limits and specificity of molecular diagnostic markers for three pathogens (Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus terrestris.

    PubMed

    Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G

    2012-04-01

    Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.

  7. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    PubMed

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  8. SPAN: Ocean science

    NASA Technical Reports Server (NTRS)

    Thomas, Valerie L.; Koblinsky, Chester J.; Webster, Ferris; Zlotnicki, Victor; Green, James L.

    1987-01-01

    The Space Physics Analysis Network (SPAN) is a multi-mission, correlative data comparison network which links space and Earth science research and data analysis computers. It provides a common working environment for sharing computer resources, sharing computer peripherals, solving proprietary problems, and providing the potential for significant time and cost savings for correlative data analysis. This is one of a series of discipline-specific SPAN documents which are intended to complement the SPAN primer and SPAN Management documents. Their purpose is to provide the discipline scientists with a comprehensive set of documents to assist in the use of SPAN for discipline specific scientific research.

  9. Simple and rapid method for the detection of Filobasidiella neoformans in a probiotic dairy product by using loop-mediated isothermal amplification.

    PubMed

    Ishikawa, Hiroshi; Kasahara, Kohei; Sato, Sumie; Shimakawa, Yasuhisa; Watanabe, Koichi

    2014-05-16

    Yeast contamination is a serious problem in the food industry and a major cause of food spoilage. Several yeasts, such as Filobasidiella neoformans, which cause cryptococcosis in humans, are also opportunistic pathogens, so a simple and rapid method for monitoring yeast contamination in food is essential. Here, we developed a simple and rapid method that utilizes loop-mediated isothermal amplification (LAMP) for the detection of F. neoformans. A set of five specific LAMP primers was designed that targeted the 5.8S-26S rDNA internal transcribed spacer 2 region of F. neoformans, and the primer set's specificity was confirmed. In a pure culture of F. neoformans, the LAMP assay had a lower sensitivity threshold of 10(2)cells/mL at a runtime of 60min. In a probiotic dairy product artificially contaminated with F. neoformans, the LAMP assay also had a lower sensitivity threshold of 10(2)cells/mL, which was comparable to the sensitivity of a quantitative PCR (qPCR) assay. We also developed a simple two-step method for the extraction of DNA from a probiotic dairy product that can be performed within 15min. This method involves initial protease treatment of the test sample at 45°C for 3min followed by boiling at 100°C for 5min under alkaline conditions. In a probiotic dairy product artificially contaminated with F. neoformans, analysis by means of our novel DNA extraction method followed by LAMP with our specific primer set had a lower sensitivity threshold of 10(3)cells/mL at a runtime of 60min. In contrast, use of our novel method of DNA extraction followed by qPCR assay had a lower sensitivity threshold of only 10(5)cells/mL at a runtime of 3 to 4h. Therefore, unlike the PCR assay, our LAMP assay can be used to quickly evaluate yeast contamination and is sensitive even for crude samples containing bacteria or background impurities. Our study provides a powerful tool for the primary screening of large numbers of food samples for yeast contamination. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    PubMed Central

    Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru

    2005-01-01

    Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082

  11. Efficacy of species-specific recA PCR tests in the identification of Burkholderia cepacia complex environmental isolates.

    PubMed

    Dalmastri, Claudia; Pirone, Luisa; Tabacchioni, Silvia; Bevivino, Annamaria; Chiarini, Luigi

    2005-05-01

    In this study, we evaluated if recA species-specific PCR assays could be successfully applied to identify environmental isolates of the widespread Burkholderia cepacia complex (Bcc) species. A total of 729 Bcc rhizosphere isolates collected in different samplings were assigned to the species B. cepacia genomovar I (61), B. cenocepacia recA lineage IIIB (514), B. ambifaria (124) and B. pyrrocinia (30), by means of recA (RFLP) analysis, and PCR tests were performed to assess sensitivity and specificity of recA species-specific primers pairs. B. cepacia genomovar I specific primers produced the expected amplicon with all isolates of the corresponding species (sensitivity, 100%), and cross-reacted with all B. pyrrocinia isolates. On the contrary, B. cenocepacia IIIB primers did not give the expected amplicon in 164 B. cenocepacia IIIB isolates (sensitivity, 68.1%), and isolates of distinct populations showed different sensitivity. B. ambifaria primers failed to amplify a recA-specific fragment only in a few isolates of this species (sensitivity, 93.5%). The absence of specific amplification in a high number of B. cenocepacia rhizosphere isolates indicates that recA specific PCR assays can lead to an underestimation of environmental microorganisms belonging to this bacterial species.

  12. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

    PubMed

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-09-29

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

  13. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts

    PubMed Central

    Ealba, Erin L.; Schneider, Richard A.

    2013-01-01

    Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056

  15. Development of a multiplex PCR assay for the detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei, Burkholderia thailandensis, and Burkholderia cepacia complex.

    PubMed

    Zakharova, Irina; Teteryatnikova, Natalya; Toporkov, Andrey; Viktorov, Dmitry

    2017-10-01

    Two species of Burkholderia pseudomallei complex (Bpc), B. pseudomallei and B. mallei, can cause severe life-threatening infections. Rapidly discerning individual species within the group and separating them from other opportunistic pathogens of the Burkholderia cepacia complex (Bcc) is essential to establish a correct diagnosis and for epidemiological surveillance. In this study, a multiplex PCR assay based on the detection of an individual set of chromosomal beta-lactamase genes for single-step identification and differentiation of B. pseudomallei, B. mallei, B. thailandensis, and Bcc was developed. Two pairs of primers specific to a distinct class of B metallo-beta-lactamase genes and a pair of primers specific to the oxacillin-hydrolyzing class D beta-lactamase gene were demonstrated to successfully discriminate species within Bpc and from Bcc. The assay sensitivity was 9561 genomic equivalents (GE) for B. pseudomallei, 7827 GE for B. mallei, 8749 GE for B. thailandensis and 6023 GE for B. cepacia. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Real-time PCR array as a universal platform for the detection of genetically modified crops and its application in identifying unapproved genetically modified crops in Japan.

    PubMed

    Mano, Junichi; Shigemitsu, Natsuki; Futo, Satoshi; Akiyama, Hiroshi; Teshima, Reiko; Hino, Akihiro; Furui, Satoshi; Kitta, Kazumi

    2009-01-14

    We developed a novel type of real-time polymerase chain reaction (PCR) array with TaqMan chemistry as a platform for the comprehensive and semiquantitative detection of genetically modified (GM) crops. Thirty primer-probe sets for the specific detection of GM lines, recombinant DNA (r-DNA) segments, endogenous reference genes, and donor organisms were synthesized, and a 96-well PCR plate was prepared with a different primer-probe in each well as the real-time PCR array. The specificity and sensitivity of the array were evaluated. A comparative analysis with the data and publicly available information on GM crops approved in Japan allowed us to assume the possibility of unapproved GM crop contamination. Furthermore, we designed a Microsoft Excel spreadsheet application, Unapproved GMO Checker version 2.01, which helps process all the data of real-time PCR arrays for the easy assumption of unapproved GM crop contamination. The spreadsheet is available free of charge at http://cse.naro.affrc.go.jp/jmano/index.html .

  17. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    PubMed

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  18. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    PubMed

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  19. ATLAS: An advanced PCR-method for routine visualization of telomere length in Saccharomyces cerevisiae.

    PubMed

    Zubko, Elena I; Shackleton, Jennifer L; Zubko, Mikhajlo K

    2016-12-01

    Measuring telomere length is essential in telomere biology. Southern blot hybridization is the predominant method for measuring telomere length in the genetic model Saccharomyces cerevisiae. We have further developed and refined a telomere PCR approach, which was rarely used previously (mainly in specific telomeric projects), into a robust method allowing direct visualisation of telomere length differences in routine experiments with S. cerevisiae, and showing a strong correlation of results with data obtained by Southern blot hybridization. In this expanded method denoted as ATLAS (A-dvanced T-elomere L-ength A-nalysis in S. cerevisiae), we have introduced: 1) set of new primers annealing with high specificity to telomeric regions on five different chromosomes; 2) new approach for designing reverse telomere primers that is based on the ligation of an adaptor of a fixed size to telomeric ends. ATLAS can be used at the scale of individual assays and high-throughput approaches. This simple, time/cost-effective and reproducible methodology will complement Southern blot hybridization and facilitate further progress in telomere research. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. A new cultivation independent approach to detect and monitor common Trichoderma species in soils.

    PubMed

    Hagn, Alexandra; Wallisch, Stefanie; Radl, Viviane; Charles Munch, Jean; Schloter, Michael

    2007-04-01

    A set of primers was developed for the detection, identification and quantification of common Trichoderma species in soil samples. Based on a broad range master alignment primers were derived to amplify an approximate 540 bp fragment comprising the internal transcribed spacer region 1 (ITS 1), 5.8S rDNA and internal transcribed spacer region 2 (ITS 2) from all taxonomic Clades of the genus Trichoderma. The primer set was applied to test strains as well as community DNA isolated from arable and forest soil. For all tested isolates the corresponding internal transcribed spacer regions of Trichoderma spp. strains were amplified, but none of non-Trichoderma origin. PCR with community DNA from soil yielded products of the expected size. Analysis of a clone library established for an arable site showed that all amplified sequences originated exclusively from Trichoderma species mainly being representatives of the Clades Hamatum, Harzianum and Pachybasioides and comprising most of the species known for biocontrol ability. In a realtime PCR approach the primer set uTf/uTr also proved to be a suitable system to quantify DNA of Trichoderma spp. in soils.

  1. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  2. Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

    USDA-ARS?s Scientific Manuscript database

    The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

  3. GSP: a web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

  4. The Fungal Frontier: A Comparative Analysis of Methods Used in the Study of the Human Gut Mycobiome

    PubMed Central

    Huseyin, Chloe E.; Rubio, Raul Cabrera; O’Sullivan, Orla; Cotter, Paul D.; Scanlan, Pauline D.

    2017-01-01

    The human gut is host to a diverse range of fungal species, collectively referred to as the gut “mycobiome”. The gut mycobiome is emerging as an area of considerable research interest due to the potential roles of these fungi in human health and disease. However, there is no consensus as to what the best or most suitable methodologies available are with respect to characterizing the human gut mycobiome. The aim of this study is to provide a comparative analysis of several previously published mycobiome-specific culture-dependent and -independent methodologies, including choice of culture media, incubation conditions (aerobic versus anaerobic), DNA extraction method, primer set and freezing of fecal samples to assess their relative merits and suitability for gut mycobiome analysis. There was no significant effect of media type or aeration on culture-dependent results. However, freezing was found to have a significant effect on fungal viability, with significantly lower fungal numbers recovered from frozen samples. DNA extraction method had a significant effect on DNA yield and quality. However, freezing and extraction method did not have any impact on either α or β diversity. There was also considerable variation in the ability of different fungal-specific primer sets to generate PCR products for subsequent sequence analysis. Through this investigation two DNA extraction methods and one primer set was identified which facilitated the analysis of the mycobiome for all samples in this study. Ultimately, a diverse range of fungal species were recovered using both approaches, with Candida and Saccharomyces identified as the most common fungal species recovered using culture-dependent and culture-independent methods, respectively. As has been apparent from ecological surveys of the bacterial fraction of the gut microbiota, the use of different methodologies can also impact on our understanding of gut mycobiome composition and therefore requires careful consideration. Future research into the gut mycobiome needs to adopt a common strategy to minimize potentially confounding effects of methodological choice and to facilitate comparative analysis of datasets. PMID:28824566

  5. A Novel Real-Time PCR Assay of microRNAs Using S-Poly(T), a Specific Oligo(dT) Reverse Transcription Primer with Excellent Sensitivity and Specificity

    PubMed Central

    Kang, Kang; Zhang, Xiaoying; Liu, Hongtao; Wang, Zhiwei; Zhong, Jiasheng; Huang, Zhenting; Peng, Xiao; Zeng, Yan; Wang, Yuna; Yang, Yi; Luo, Jun; Gou, Deming

    2012-01-01

    Background MicroRNAs (miRNAs) are small, non-coding RNAs capable of postranscriptionally regulating gene expression. Accurate expression profiling is crucial for understanding the biological roles of miRNAs, and exploring them as biomarkers of diseases. Methodology/Principal Findings A novel, highly sensitive, and reliable miRNA quantification approach,termed S-Poly(T) miRNA assay, is designed. In this assay, miRNAs are subjected to polyadenylation and reverse transcription with a S-Poly(T) primer that contains a universal reverse primer, a universal Taqman probe, an oligo(dT)11 sequence and six miRNA-specific bases. Individual miRNAs are then amplified by a specific forward primer and a universal reverse primer, and the PCR products are detected by a universal Taqman probe. The S-Poly(T) assay showed a minimum of 4-fold increase in sensitivity as compared with the stem-loop or poly(A)-based methods. A remarkable specificity in discriminating among miRNAs with high sequence similarity was also obtained with this approach. Using this method, we profiled miRNAs in human pulmonary arterial smooth muscle cells (HPASMC) and identified 9 differentially expressed miRNAs associated with hypoxia treatment. Due to its outstanding sensitivity, the number of circulating miRNAs from normal human serum was significantly expanded from 368 to 518. Conclusions/Significance With excellent sensitivity, specificity, and high-throughput, the S-Poly(T) method provides a powerful tool for miRNAs quantification and identification of tissue- or disease-specific miRNA biomarkers. PMID:23152780

  6. Novel 16S rDNA primers revealed the diversity and habitats-related community structure of sphingomonads in 10 different niches.

    PubMed

    Huang, Yili; Feng, Hao; Lu, Hang; Zeng, Yanhua

    2017-07-01

    It is believed that sphingomonads are ubiquitously distributed in environments. However detailed information about their community structure and their co-relationship with environmental parameters remain unclear. In this study, novel sphingomonads-specific primers based on the 16S rRNA gene were designed to investigate the distribution of sphingomonads in 10 different niches. Both in silico and in-practice tests on pure cultures and environmental samples showed that Sph384f/Sph701r was an efficient primer set. Illumina MiSeq sequencing revealed that community structures of sphingomonads were significantly different among the 10 samples, although 12 sphingomonad genera were present in all samples. Based on RDA analysis and Monte Carlo permutation test, sphingomonad community structure was significantly correlated with limnetic and marine habitat types. Among these niches, the genus Sphingomicrobium showed strong positive correlation with marine habitats, whereas genera Sphingobium, Novosphingobium, Sphingopyxis, and Sphingorhabdus showed strong positive correlation with limnetic habitats. Our study provided direct evidence that sphingomonads are ubiquitously distributed in environments, and revealed for the first time that their community structure can be correlated with habitats.

  7. Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

    PubMed

    Makeyev, E V; Bamford, D H

    2001-05-01

    Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

  8. Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

    PubMed

    Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

    2018-02-01

    The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

  9. Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

    PubMed

    Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

    2014-11-01

    In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. ABC Assay: Method Development and Application to Quantify the Role of Three DWV Master Variants in Overwinter Colony Losses of European Honey Bees.

    PubMed

    Kevill, Jessica L; Highfield, Andrea; Mordecai, Gideon J; Martin, Stephen J; Schroeder, Declan C

    2017-10-27

    Deformed wing virus (DWV) is one of the most prevalent honey bee viral pathogens in the world. Typical of many RNA viruses, DWV is a quasi-species, which is comprised of a large number of different variants, currently consisting of three master variants: Type A, B, and C. Little is known about the impact of each variant or combinations of variants upon the biology of individual hosts. Therefore, we have developed a new set of master variant-specific DWV primers and a set of standards that allow for the quantification of each of the master variants. Competitive reverse transcriptase polymerase chain reaction (RT-PCR) experimental design confirms that each new DWV primer set is specific to the retrospective master variant. The sensitivity of the ABC assay is dependent on whether DNA or RNA is used as the template and whether other master variants are present in the sample. Comparison of the overall proportions of each master variant within a sample of known diversity, as confirmed by next-generation sequence (NGS) data, validates the efficiency of the ABC assay. The ABC assay was used on archived material from a Devon overwintering colony loss (OCL) 2006-2007 study; further implicating DWV type A and, for the first time, possibly C in the untimely collapse of honey bee colonies. Moreover, in this study DWV type B was not associated with OCL. The use of the ABC assay will allow researchers to quickly and cost effectively pre-screen for the presence of DWV master variants in honey bees.

  11. Back to Basics--The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities.

    PubMed

    Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H

    2015-01-01

    DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.

  12. Detection of pathogenic Leptospira spp. infections among mammals captured in the Peruvian Amazon basin region.

    PubMed

    Bunnell, J E; Hice, C L; Watts, D M; Montrueil, V; Tesh, R B; Vinetz, J M

    2000-01-01

    To identify potential zoonotic reservoirs of pathogenic leptospires in the Peruvian Amazon basin, wild mammals were trapped from July 1997 to December 1998 near the city of Iquitos. After extraction of nucleic acids from animal kidneys, DNA of pathogenic leptospires was identified by polymerase chain reaction (PCR) assays using one of two primer sets, one amplifying a region of the 23S rRNA gene, and the other amplifying a gene fragment specific for Leptospira spp (G1/G2 primers). Overall, 29% (40 of 136) of the mammals tested showed evidence of renal infection by Leptospira spp., including 20% (13 of 64) of the rodents, 39% (20 of 51) of the marsupials, and 35% (7 of 20) of the chiropterans (bats). Marsupials and chiropterans were implicated as more significant reservoir hosts of leptospires pathogenic to humans than previously recognized.

  13. An alternative nested-PCR assay for the detection of Toxoplasma gondii strains based on GRA7 gene sequences.

    PubMed

    Costa, Maria Eduarda S M; Oliveira, Claudio Bruno S; Andrade, Joelma Maria de A; Medeiros, Thatiany A; Neto, Valter F Andrade; Lanza, Daniel C F

    2016-07-01

    Toxoplasma gondii is a widespread parasite able to infect virtually any nucleated cells of warm-blooded hosts. In some cases, T. gondii detection using already developed PCR primers can be inefficient in routine laboratory tests, especially to detect atypical strains. Here we report a new nested-PCR protocol able to detect virtually all T. gondii isolates. Analyzing 685 sequences available in GenBank, we determine that GRA7 is one of the most conserved genes of T. gondii genome. Based on an alignment of 85 GRA7 sequences new primer sets that anneal in the highly conserved regions of this gene were designed. The new GRA7 nested-PCR assay providing sensitivity and specificity equal to or greater than the gold standard PCR assays for T. gondii detection, that amplify the B1 sequence or the repetitive 529bp element. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  15. SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

    PubMed Central

    Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

    2006-01-01

    Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

  16. SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

    PubMed

    Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

    2006-07-01

    Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

  17. Improved PCR assay for the specific detection and quantitation of Escherichia coli serotype O157 in water.

    PubMed

    Cho, Min Seok; Joh, Kiseong; Ahn, Tae-Young; Park, Dong Suk

    2014-09-01

    Escherichia coli serotype O157 is still a major global healthcare problem. However, only limited information is now available on the molecular and serological detection of pathogenic bacteria. Therefore, the development of appropriate strategies for their rapid identification and monitoring is still needed. In general, the sequence analysis based on stx, slt, eae, hlyA, rfb, and fliCh7 genes is widely employed for the identification of E. coli serotype O157; but there have been critical defects in the diagnosis and identification of E. coli serotype O157, in that they are also present in other E. coli serogroups. In this study, NCBI-BLAST searches using the nucleotide sequences of the putative regulatory protein gene from E. coli O157:H7 str. Sakai found sequence difference at the serotype level. The specific primers from the putative regulatory protein gene were designed and investigated for their sensitivity and specificity for detecting the pathogen in environment water samples. The specificity of the primer set was evaluated using genomic DNA from 8 isolates of E. coli serotype O157 and 32 other reference strains. In addition, the sensitivity and specificity of this assay were confirmed by successful identification of E. coli serotype O157 in environmental water samples. In conclusion, this study showed that the newly developed quantitative serotype-specific PCR method is a highly specific and efficient tool for the surveillance and rapid detection of high-risk E. coli serotype O157.

  18. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-01-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  19. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    PubMed Central

    2010-01-01

    Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

  20. Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

    PubMed

    Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

    2016-07-01

    Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

  1. Q-PCR based bioburden assessment of drinking water throughout treatment and delivery to the International Space Station

    NASA Technical Reports Server (NTRS)

    Newcombe, David; Stuecker, Tara; La Duc, Myron; Venkateswaran, Kasthuri

    2005-01-01

    Previous studies indicated evidence of opportunistic pathogens samples obtained during missions to the International Space Station (ISS). This study utilized TaqMan quantitative PCR to determine specific gene abundance in potable and non-potable ISS waters. Probe and primer sets specific to the small subunit rRNA genes were used to elucidate overall bacterial rRNA gene numbers. while those specific for Burkholderia cepacia and Stenotrophomonas maltophilia were optimized and used to probe for the presence of these two opportunistic pathogens. This research builds upon previous microbial diversity studies of ISS water and demonstrates the utility of Q-PCR tool to examine water quality.

  2. Rapid detection of Lactobacillus kefiranofaciens in kefir grain and kefir milk using newly developed real-time PCR.

    PubMed

    Kim, Dong-Hyeon; Chon, Jung-Whan; Kim, Hong-Seok; Yim, Jin-Hyeok; Kim, Hyunsook; Seo, Kun-Ho

    2015-04-01

    Lactobacillus kefiranofaciens is an indicator microorganism for kefir and a key factor in kefir grain formation and kefiran production. We designed a novel real-time PCR primer and probe set, LKF_KU504, for the rapid detection of L. kefiranofaciens. In inclusivity and exclusivity tests, only 14 L. kefiranofaciens strains were positive among 61 microorganisms, indicating 100 % sensitivity and specificity. The LKF_KU504 set also differentiated kefir milk from 30 commercial nonkefir yogurts. The levels of L. kefiranofaciens in kefir grain and kefir milk were significantly different, indicating L. kefiranofaciens was more concentrated in kefir grain than in kefir milk.

  3. Universal primers for amplification of the complete mitochondrial control region in marine fish species.

    PubMed

    Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

    2012-01-01

    Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

  4. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  5. Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

    PubMed

    Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

    2018-01-01

    Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

  6. Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus"

    PubMed Central

    Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg

    2018-01-01

    Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016

  7. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    NASA Astrophysics Data System (ADS)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

    2017-02-01

    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  8. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  9. Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    PubMed Central

    2011-01-01

    Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

  10. Development of a molecular approach to describe the composition of Trichoderma communities.

    PubMed

    Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele

    2010-01-01

    Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.

  11. Advanced Analysis to Distinguish between Physical Decrease and Inactivation of Viable Phages in Aerosol by Quantitating Phage-Specific Particles.

    PubMed

    Shimasaki, Noriko; Nojima, Yasuhiro; Sakakibara, Masaya; Kikuno, Ritsuko; Iizuka, Chiori; Okaue, Akira; Okuda, Shunji; Shinohara, Katsuaki

    2018-01-01

     Recent studies have investigated the efficacy of air-cleaning products against pathogens in the air. A standard method to evaluate the reduction in airborne viruses caused by an air cleaner has been established using a safe bacteriophage instead of pathogenic viruses; the reduction in airborne viruses is determined by counting the number of viable airborne phages by culture, after operating the air cleaner. The reduction in the number of viable airborne phages could be because of "physical decrease" or "inactivation". Therefore, to understand the mechanism of reduction correctly, an analysis is required to distinguish between physical decrease and inactivation. The purpose of this study was to design an analysis to distinguish between the physical decrease and inactivation of viable phi-X174 phages in aerosols. We established a suitable polymerase chain reaction (PCR) system by selecting an appropriate primer-probe set for PCR and validating the sensitivity, linearity, and specificity of the primer-probe set to robustly quantify phi-X174-specific airborne particles. Using this quantitative PCR system and culture assay, we performed a behavior analysis of the phage aerosol in a small chamber (1 m 3 ) at different levels of humidity, as humidity is known to affect the number of viable airborne phages. The results revealed that the reduction in the number of viable airborne phages was caused not only by physical decrease but also by inactivation under particular levels of humidity. Our study could provide an advanced analysis to differentiate between the physical decrease and inactivation of viable airborne phages.

  12. Detecting in situ copepod diet diversity using molecular technique: development of a copepod/symbiotic ciliate-excluding eukaryote-inclusive PCR protocol.

    PubMed

    Hu, Simin; Guo, Zhiling; Li, Tao; Carpenter, Edward J; Liu, Sheng; Lin, Senjie

    2014-01-01

    Knowledge of in situ copepod diet diversity is crucial for accurately describing pelagic food web structure but is challenging to achieve due to lack of an easily applicable methodology. To enable analysis with whole copepod-derived DNAs, we developed a copepod-excluding 18S rDNA-based PCR protocol. Although it is effective in depressing amplification of copepod 18S rDNA, its applicability to detect diverse eukaryotes in both mono- and mixed-species has not been demonstrated. Besides, the protocol suffers from the problem that sequences from symbiotic ciliates are overrepresented in the retrieved 18S rDNA libraries. In this study, we designed a blocking primer to make a combined primer set (copepod/symbiotic ciliate-excluding eukaryote-common: CEEC) to depress PCR amplification of symbiotic ciliate sequences while maximizing the range of eukaryotes amplified. We firstly examined the specificity and efficacy of CEEC by PCR-amplifying DNAs from 16 copepod species, 37 representative organisms that are potential prey of copepods and a natural microplankton sample, and then evaluated the efficiency in reconstructing diet composition by detecting the food of both lab-reared and field-collected copepods. Our results showed that the CEEC primer set can successfully amplify 18S rDNA from a wide range of isolated species and mixed-species samples while depressing amplification of that from copepod and targeted symbiotic ciliate, indicating the universality of CEEC in specifically detecting prey of copepods. All the predetermined food offered to copepods in the laboratory were successfully retrieved, suggesting that the CEEC-based protocol can accurately reconstruct the diets of copepods without interference of copepods and their associated ciliates present in the DNA samples. Our initial application to analyzing the food composition of field-collected copepods uncovered diverse prey species, including those currently known, and those that are unsuspected, as copepod prey. While testing is required, this protocol provides a useful strategy for depicting in situ dietary composition of copepods.

  13. Identification and authentication of Rosa species through development of species-specific SCAR marker(s).

    PubMed

    Bashir, K M I; Awan, F S; Khan, I A; Khan, A I; Usman, M

    2014-05-30

    Roses (Rosa indica) belong to one of the most crucial groups of plants in the floriculture industry. Rosa species have special fragrances of interest to the perfume and pharmaceutical industries. The genetic diversity of plants based on morphological characteristics is difficult to measure under natural conditions due to the influence of environmental factors, which is why a reliable fingerprinting method was developed to overcome this problem. The development of molecular markers will enable the identification of Rosa species. In the present study, randomly amplified polymorphic DNA (RAPD) analysis was done on four Rosa species, Rosa gruss-an-teplitz (Surkha), Rosa bourboniana, Rosa centifolia, and Rosa damascena. A polymorphic RAPD fragment of 391 bp was detected in R. bourboniana, which was cloned, purified, sequenced, and used to design a pair of species-specific sequence-characterized amplified region (SCAR) primers (forward and reverse). These SCAR primers were used to amplify the specific regions of the rose genome. These PCR amplifications with specific primers are less sensitive to reaction conditions, and due to their high reproducibility, these species-specific SCAR primers can be used for marker-assisted selection and identification of Rosa species.

  14. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    PubMed Central

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  15. A blackberry (Rubus L.) expressed sequence tag library for the development of simple sequence repeat markers

    PubMed Central

    Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P

    2008-01-01

    Background The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST) library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR), and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry. PMID:18570660

  16. Competitor internal standards for quantitative detection of mycoplasma DNA.

    PubMed

    Sidhu, M K; Rashidbaigi, A; Testa, D; Liao, M J

    1995-05-01

    Homologous internal controls were used as competitor DNA in the polymerase chain reaction for the quantitative detection of mycoplasma DNA. PCR primer sets were designed on the basis of the most conserved nucleotide sequences of the 16S rRNA gene of mycoplasma species. Amplification of this gene was examined in five different mycoplasma species: Mycoplasma orale, M. hyorhinus, M. synoviae, M. gallisepticum and M. pneumoniae. To evaluate the primers, a number of different cell lines were assayed for the detection of mycoplasma infections. All positive cell lines showed a distinct product on agarose gels while uninfected cells showed no DNA amplification. Neither bacterial nor eukaryotic DNA produced any cross-reaction with the primers used, thus confirming their specificity. Internal control DNA to be used for quantitation was constructed by modifying the sizes of the wild-type amplified products and cloning them in plasmid vectors. These controls used the same primer binding sites as the wild-type and the amplified products were differentiated by a size difference. The detection limits for all the mycoplasma species by competitive quantitative PCR were estimated to range from 4 to 60 genome copies per assay as determined by ethidium bromide-stained agarose gels. These internal standards also serve as positive controls in PCR-based detection of mycoplasma DNA, and therefore accidental contamination of test samples with wild-type positive controls can be eliminated. The quantitative PCR method developed will be useful in monitoring the progression and significance of mycoplasma in the disease process.

  17. Best Development Practices: A Primer for Smart Growth

    EPA Pesticide Factsheets

    Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

  18. Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

    PubMed

    Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

    2007-10-01

    Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

  19. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    PubMed Central

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  20. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    PubMed

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  1. Primers As Socializing Agents in American and Finnish Schools.

    ERIC Educational Resources Information Center

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  2. Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

    PubMed

    Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

    2017-03-22

    Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

  3. Comprehensive Multiplex One-Step Real-Time TaqMan qRT-PCR Assays for Detection and Quantification of Hemorrhagic Fever Viruses

    PubMed Central

    Li, Jiandong; Qu, Jing; He, Chengcheng; Zhang, Shuo; Li, Chuan; Zhang, Quanfu; Liang, Mifang; Li, Dexin

    2014-01-01

    Background Viral hemorrhagic fevers (VHFs) are a group of animal and human illnesses that are mostly caused by several distinct families of viruses including bunyaviruses, flaviviruses, filoviruses and arenaviruses. Although specific signs and symptoms vary by the type of VHF, initial signs and symptoms are very similar. Therefore rapid immunologic and molecular tools for differential diagnosis of hemorrhagic fever viruses (HFVs) are important for effective case management and control of the spread of VHFs. Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assay is one of the reliable and desirable methods for specific detection and quantification of virus load. Multiplex PCR assay has the potential to produce considerable savings in time and resources in the laboratory detection. Results Primers/probe sets were designed based on appropriate specific genes for each of 28 HFVs which nearly covered all the HFVs, and identified with good specificity and sensitivity using monoplex assays. Seven groups of multiplex one-step real-time qRT-PCR assays in a universal experimental system were then developed by combining all primers/probe sets into 4-plex reactions and evaluated with serial dilutions of synthesized viral RNAs. For all the multiplex assays, no cross-reactivity with other HFVs was observed, and the limits of detection were mainly between 45 and 150 copies/PCR. The reproducibility was satisfactory, since the coefficient of variation of Ct values were all less than 5% in each dilution of synthesized viral RNAs for both intra-assays and inter-assays. Evaluation of the method with available clinical serum samples collected from HFRS patients, SFTS patients and Dengue fever patients showed high sensitivity and specificity of the related multiplex assays on the clinical specimens. Conclusions Overall, the comprehensive multiplex one-step real-time qRT-PCR assays were established in this study, and proved to be specific, sensitive, stable and easy to serve as a useful tool for rapid detection of HFVs. PMID:24752452

  4. Does fingerprinting truly represent the diversity of wine yeasts? A case study with interdelta genotyping of Saccharomyces cerevisiae strains.

    PubMed

    Pfliegler, W P; Sipiczki, M

    2016-12-01

    Simple and efficient genotyping methods are widely used to assess the diversity of a large number of microbial strains, e.g. wine yeasts isolated from a specific geographical area or a vintage. Such methods are often also the first to be applied, to decrease the number of strains deemed interesting for a more time-consuming physiological characterization. Here, we aimed to use a physiologically characterized strain collection of 69 Saccharomyces cerevisiae strains from Hungarian wine regions to determine whether geographical origin or physiological similarity can be recovered by clustering the strains with one or two simultaneously used variations of interdelta genotyping. Our results indicate that although a detailed clustering with high resolution can be achieved with this method, the clustering of strains is largely contrasting when different primer sets are used and it does not recover geographical or physiological groups. Genotyping is routinely used for assessing the diversity of a large number of isolates/strains of a single species, e.g. a collection of wine yeasts. We tested the efficiency of interdelta genotyping on a collection of Saccharomyces wine yeasts from four wine regions of Hungary that was previously characterized physiologically. Interdelta fingerprinting recovered neither physiological nor geographical similarities, and in addition, the two different primer pairs widely used for this method showed conflicting and barely comparable results. Thus, this method does not necessarily represent the true diversity of a strain collection, but detailed clustering may be achieved by the combined use of primer sets. © 2016 The Society for Applied Microbiology.

  5. UniPrime2: a web service providing easier Universal Primer design.

    PubMed

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  6. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    PubMed

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-08

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. First report of Hibiscus infecting Cilevirus in Citrus sinensis in Meta and Casanare, Colombia

    USDA-ARS?s Scientific Manuscript database

    In February 2015, two sweet orange samples with severe citrus leprosis (CiL) symptoms were collected from Meta and Casanare states in Colombia and assayed for Cilevirus, Dichorhavirus and Higrevirus associated with CiL disease. PCR primers specific for CiLV-C2, but not primers specific for CiLV-C, C...

  8. Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone

    DTIC Science & Technology

    2013-10-01

    and 5’‐GCC AAA TGC AGT TTA AGC TCT GCT‐3’ (antisense). The gene‐specific primers for mouse b‐actin were 5’‐GGC CGT ACC ACT GGC ATC GTG ATG‐ 3...cycles. The gene‐specific primers for CYP24A1 mRNA were 5’‐CGG GTG GAC CAT TTA CAA CTC GG‐3’ (sense) and 5’‐CTC AAC AGG CTC ATT GTC TGT GG‐3’ (antisense...The gene specific designing primers for b‐actinwere 5’‐ GTG CGT GAC ATC AAA GAG‐3’ (sense) and 5’‐GCC ACA GGA TTC CAT ACC‐3’ (antisense). The

  9. Easy and inexpensive molecular detection of dengue, chikungunya and zika viruses in febrile patients.

    PubMed

    Calvo, Eliana P; Sánchez-Quete, Fernando; Durán, Sandra; Sandoval, Isabel; Castellanos, Jaime E

    2016-11-01

    Dengue (DENV), chikungunya (CHIKV) and zika (ZIKV) are arthropod-borne viruses (arboviruses) sharing a common vector, the mosquito Aedes aegypti. At initial stages, patients infected with these viruses have similar clinical manifestations, however, the outcomes and clinical management of these diseases are different, for this reason early and accurate identification of the causative virus is necessary. This paper reports the development of a rapid and specific nested-PCR for detection of DENV, CHIKV and ZIKV infection in the same sample. A set of six outer primers targeting the C-preM, E1, and E gene respectively was used in a multiplex one-step RT-PCR assay, followed by the second round of amplification with specific inner primers for each virus. The specificity of the present assay was validated with positive and negative serum samples for viruses and supernatants of infected cells. The assay was tested using clinical samples from febrile patients. In these samples, we detected mono and dual infections and a case of triple co-infection DENV-CHIKV-ZIKV. This assay might be a useful and an inexpensive tool for detection of these infections in regions where these arboviruses co-circulate. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Rapid detection of avian influenza virus a and subtype H5N1 by single step multiplex reverse transcription-polymerase chain reaction.

    PubMed

    Wei, Hui-Ling; Bai, Gui-Rong; Mweene, Aaron S; Zhou, Ying-Chun; Cong, Yan-Long; Pu, Juan; Wang, Shuai; Kida, Hiroshi; Liu, Jin-Hua

    2006-06-01

    Outbreaks of H5N1 highly pathogenic avian influenza (HPAI) virus caused great economic losses to the poultry industry and resulted in human deaths in Thailand and Viet Nam in 2004. Rapid typing and subtyping of H5N1 viruses, especially from clinical specimens, are desirable for taking prompt control measures to prevent the spread of the disease. Here, we developed a set of oligonucleotide primers able to detect, type and subtype H5 and N1 influenza viruses in a single step multiplex reverse transcription-polymerase chain reaction (RT-PCR). RNA was extracted from allantoic fluid or from specimens with guanidinium isothiocyanate reagent. Reverse transcription and PCR were carried out with a mixture of primers specific for influenza viruses of type A, subtype H5 and N1 in a single reaction system under identical conditions. The amplified DNA fragments were analyzed by agarose gel electrophoresis. All the H5N1 viruses tested in the study and the experimental specimens presented three specific bands by the method established here. The results presented here suggest that the method described below is rapid and specific and, therefore, could be valuable in the rapid detection of H5N1 influenza viruses in clinics.

  11. One-Tube-Only Standardized Site-Directed Mutagenesis: An Alternative Approach to Generate Amino Acid Substitution Collections

    PubMed Central

    Mingo, Janire; Erramuzpe, Asier; Luna, Sandra; Aurtenetxe, Olaia; Amo, Laura; Diez, Ibai; Schepens, Jan T. G.; Hendriks, Wiljan J. A. J.; Cortés, Jesús M.; Pulido, Rafael

    2016-01-01

    Site-directed mutagenesis (SDM) is a powerful tool to create defined collections of protein variants for experimental and clinical purposes, but effectiveness is compromised when a large number of mutations is required. We present here a one-tube-only standardized SDM approach that generates comprehensive collections of amino acid substitution variants, including scanning- and single site-multiple mutations. The approach combines unified mutagenic primer design with the mixing of multiple distinct primer pairs and/or plasmid templates to increase the yield of a single inverse-PCR mutagenesis reaction. Also, a user-friendly program for automatic design of standardized primers for Ala-scanning mutagenesis is made available. Experimental results were compared with a modeling approach together with stochastic simulation data. For single site-multiple mutagenesis purposes and for simultaneous mutagenesis in different plasmid backgrounds, combination of primer sets and/or plasmid templates in a single reaction tube yielded the distinct mutations in a stochastic fashion. For scanning mutagenesis, we found that a combination of overlapping primer sets in a single PCR reaction allowed the yield of different individual mutations, although this yield did not necessarily follow a stochastic trend. Double mutants were generated when the overlap of primer pairs was below 60%. Our results illustrate that one-tube-only SDM effectively reduces the number of reactions required in large-scale mutagenesis strategies, facilitating the generation of comprehensive collections of protein variants suitable for functional analysis. PMID:27548698

  12. Efficient and Specific Detection of Salmonella in Food Samples Using a stn-Based Loop-Mediated Isothermal Amplification Method

    PubMed Central

    2015-01-01

    The Salmonella enterotoxin (stn) gene exhibits high homology among S. enterica serovars and S. bongori. A set of 6 specific primers targeting the stn gene were designed for detection of Salmonella spp. using the loop-mediated isothermal amplification (LAMP) method. The primers amplified target sequences in all 102 strains of 87 serovars of Salmonella tested and no products were detected in 57 non-Salmonella strains. The detection limit in pure cultures was 5 fg DNA/reaction when amplified at 65°C for 25 min. The LAMP assay could detect Salmonella in artificially contaminated food samples as low as 220 cells/g of food without a preenrichment step. However, the sensitivity was increased 100-fold (~2 cells/g) following 5 hr preenrichment at 35°C. The LAMP technique, with a preenrichment step for 5 and 16 hr, was shown to give 100% specificity with food samples compared to the reference culture method in which 67 out of 90 food samples gave positive results. Different food matrixes did not interfere with LAMP detection which employed a simple boiling method for DNA template preparation. The results indicate that the LAMP method, targeting the stn gene, has great potential for detection of Salmonella in food samples with both high specificity and high sensitivity. PMID:26543859

  13. A DNA Barcode-Based RPA Assay (BAR-RPA) for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao).

    PubMed

    Tian, Enwei; Liu, Qianqian; Ye, Haoting; Li, Fang; Chao, Zhi

    2017-12-18

    Background: Wuzhimaotao (the dry root of Ficus hirta ) is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans , which contains gelsemine that is extremely neurotoxic) and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA) with species-specific primers targeting the internal transcribed spacer (ITS) region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species-specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min) of the ITS region under a constant and mild temperature range of 37-42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  14. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  15. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection

    PubMed Central

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-01-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

  16. Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

    PubMed

    Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

    2016-09-01

    Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

  17. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

    PubMed

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-06-01

    Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

  18. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection.

    PubMed

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

    2016-08-01

    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.

  19. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    PubMed Central

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  20. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  1. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    PubMed Central

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  2. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    PubMed Central

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  3. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  4. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    PubMed

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  5. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.

    1975-01-01

    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  6. Characterization and application of a quantitative DNA marker that discriminates sex in Chinook salmon (Oncorhynchus tshawytscha)

    USGS Publications Warehouse

    Clifton, D.R.; Rodriguez, R.J.

    1997-01-01

    A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

  7. Characterization and application of a quantitative DNA marker that discriminates sex in chinook salmon (Oncorhynchus tshawytscha)

    USGS Publications Warehouse

    Clifton, D.R.; Rodriguez, R.J.

    1997-01-01

    A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

  8. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  9. Use of SCW4 gene primers in PCR methods for the identification of six medically important Aspergillus species.

    PubMed

    Arancia, Silvia; Sandini, Silvia; De Carolis, Elena; Vella, Antonietta; Sanguinetti, Maurizio; Norelli, Sandro; De Bernardis, Flavia

    2016-10-01

    Aspergillus species are the cause of invasive mold infections in immunocompromised patients: Aspergillus fumigatus, A. flavus and A. terreus account for most cases of invasive aspergillosis (IA). As certain species are associated with higher mortality and vary in their resistance to antifungal therapy, diagnosis requires increasingly rapid molecular methods that enable sensitive detection and species discrimination. We have developed PCR and Multiplex PCR assays for the detection of six medically important Aspergillus spp. species DNA in bronchoalveolar lavage (BAL) specimens from hematology and intensive care unit (ICU) patients at risk of IA, using different species and genus-specific PCR primers, selected within the SCW4 gene, encoding a cell wall glucanase of A. fumigatus, similar to mannoprotein Mp65 of Candida albicans. The genus-specific PCR primers were able to amplify only Aspergillus DNAs but not that belonging to other fungal genera tested. The species-specific PCR primers allowed differentiation of each Aspergillus species by the amplicon length produced. The methods described in this study are rapid (less than 4 h), reproducible, simple and specific and demonstrate potential application in the clinical laboratory.

  10. Identifying of meat species using polymerase chain reaction (PCR)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

  11. ABC Assay: Method Development and Application to Quantify the Role of Three DWV Master Variants in Overwinter Colony Losses of European Honey Bees

    PubMed Central

    Kevill, Jessica L.; Highfield, Andrea; Mordecai, Gideon J.; Schroeder, Declan C.

    2017-01-01

    Deformed wing virus (DWV) is one of the most prevalent honey bee viral pathogens in the world. Typical of many RNA viruses, DWV is a quasi-species, which is comprised of a large number of different variants, currently consisting of three master variants: Type A, B, and C. Little is known about the impact of each variant or combinations of variants upon the biology of individual hosts. Therefore, we have developed a new set of master variant-specific DWV primers and a set of standards that allow for the quantification of each of the master variants. Competitive reverse transcriptase polymerase chain reaction (RT-PCR) experimental design confirms that each new DWV primer set is specific to the retrospective master variant. The sensitivity of the ABC assay is dependent on whether DNA or RNA is used as the template and whether other master variants are present in the sample. Comparison of the overall proportions of each master variant within a sample of known diversity, as confirmed by next-generation sequence (NGS) data, validates the efficiency of the ABC assay. The ABC assay was used on archived material from a Devon overwintering colony loss (OCL) 2006–2007 study; further implicating DWV type A and, for the first time, possibly C in the untimely collapse of honey bee colonies. Moreover, in this study DWV type B was not associated with OCL. The use of the ABC assay will allow researchers to quickly and cost effectively pre-screen for the presence of DWV master variants in honey bees. PMID:29077069

  12. Development of a genus-specific next generation sequencing approach for sensitive and quantitative determination of the Legionella microbiome in freshwater systems.

    PubMed

    Pereira, Rui P A; Peplies, Jörg; Brettar, Ingrid; Höfle, Manfred G

    2017-03-31

    Next Generation Sequencing (NGS) has revolutionized the analysis of natural and man-made microbial communities by using universal primers for bacteria in a PCR based approach targeting the 16S rRNA gene. In our study we narrowed primer specificity to a single, monophyletic genus because for many questions in microbiology only a specific part of the whole microbiome is of interest. We have chosen the genus Legionella, comprising more than 20 pathogenic species, due to its high relevance for water-based respiratory infections. A new NGS-based approach was designed by sequencing 16S rRNA gene amplicons specific for the genus Legionella using the Illumina MiSeq technology. This approach was validated and applied to a set of representative freshwater samples. Our results revealed that the generated libraries presented a low average raw error rate per base (<0.5%); and substantiated the use of high-fidelity enzymes, such as KAPA HiFi, for increased sequence accuracy and quality. The approach also showed high in situ specificity (>95%) and very good repeatability. Only in samples in which the gammabacterial clade SAR86 was present more than 1% non-Legionella sequences were observed. Next-generation sequencing read counts did not reveal considerable amplification/sequencing biases and showed a sensitive as well as precise quantification of L. pneumophila along a dilution range using a spiked-in, certified genome standard. The genome standard and a mock community consisting of six different Legionella species demonstrated that the developed NGS approach was quantitative and specific at the level of individual species, including L. pneumophila. The sensitivity of our genus-specific approach was at least one order of magnitude higher compared to the universal NGS approach. Comparison of quantification by real-time PCR showed consistency with the NGS data. Overall, our NGS approach can determine the quantitative abundances of Legionella species, i. e. the complete Legionella microbiome, without the need for species-specific primers. The developed NGS approach provides a new molecular surveillance tool to monitor all Legionella species in qualitative and quantitative terms if a spiked-in genome standard is used to calibrate the method. Overall, the genus-specific NGS approach opens up a new avenue to massive parallel diagnostics in a quantitative, specific and sensitive way.

  13. [Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

    PubMed

    Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

    2006-09-01

    To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

  14. A review of the prevalence, utility, and caveats of using chloroplast simple sequence repeats for studies of plant biology1

    PubMed Central

    Wheeler, Gregory L.; Dorman, Hanna E.; Buchanan, Alenda; Challagundla, Lavanya; Wallace, Lisa E.

    2014-01-01

    Microsatellites occur in all plant genomes and provide useful markers for studies of genetic diversity and structure. Chloroplast microsatellites (cpSSRs) are frequently targeted because they are more easily isolated than nuclear microsatellites. Here, we quantified the frequency and uses of cpSSRs based on a literature review of over 400 studies published 1995–2013. These markers are an important and economical tool for plant biologists and continue to be used alongside modern genomics approaches to study genetic diversity and structure, evolutionary history, and hybridization in native and agricultural species. Studies using species-specific primers reported a greater number of polymorphic loci than those employing universal primers. A major disadvantage to cpSSRs is fragment size homoplasy; therefore, we documented its occurrence at several cpSSR loci within and between species of Acmispon (Fabaceae). Based on our empirical data set, we recommend targeted sequencing of a subset of samples combined with fragment genotyping as a cost-efficient, data-rich approach to the use of cpSSRs and as a test of homoplasy. The availability of genomic resources for plants aids in the development of primers for new study systems, thereby enhancing the utility of cpSSRs across plant biology. PMID:25506520

  15. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    PubMed

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  16. Genetic relationships among strains of Xanthomonas fragariae based on random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus PCR data and generation of multiplexed PCR primers useful for the identification of this phytopathogen.

    PubMed Central

    Pooler, M R; Ritchie, D F; Hartung, J S

    1996-01-01

    Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198

  17. Rapid and Sensitive Detection of sFAT-1 Transgenic Pigs by Visual Loop-Mediated Isothermal Amplification.

    PubMed

    Tao, Chenyu; Yang, Yalan; Li, Xunbi; Zheng, Xinmin; Ren, Hongyan; Li, Kui; Zhou, Rong

    2016-07-01

    Genetically modified (GM) livestock have the potential to contribute to improving the environment and human health, with consumption of fewer resources and reduced waste production. However, the transgene process also poses risks. The safety assessment and control of transgenic animal products have drawn wide attention, and the relevant regulations and technology are being developed. Quick testing technology plays a significant role in on-site and customs sampling. Nowadays, loop-mediated isothermal amplification (LAMP) was widely applied in nucleic acid analysis because of its simplicity, rapidity, high efficiency and specificity. In this study, a specific, sensitive detection system for detecting sFAT-1 transgenic pigs was designed. A set of six primers including two loop primers was designed for the target sequence. The DNA samples were amplified in less than 1 h at the optimized temperature and detecting by both Nephelometer LA-320c and unaided eyes directly adding calcein. The detection limit of sFAT-1 LAMP was as low as 1.26 ng/μL. Furthermore, blind tests of transgenic and non-transgenic DNA samples were all correctly detected. Hence, the results in this study demonstrated that LAMP is a very useful tool for transgenic detection.

  18. Analysis of genetic diversity and population structure of oil palm (Elaeis guineensis) from China and Malaysia based on species-specific simple sequence repeat markers.

    PubMed

    Zhou, L X; Xiao, Y; Xia, W; Yang, Y D

    2015-12-08

    Genetic diversity and patterns of population structure of the 94 oil palm lines were investigated using species-specific simple sequence repeat (SSR) markers. We designed primers for 63 SSR loci based on their flanking sequences and conducted amplification in 94 oil palm DNA samples. The amplification result showed that a relatively high level of genetic diversity was observed between oil palm individuals according a set of 21 polymorphic microsatellite loci. The observed heterozygosity (Ho) was 0.3683 and 0.4035, with an average of 0.3859. The Ho value was a reliable determinant of the discriminatory power of the SSR primer combinations. The principal component analysis and unweighted pair-group method with arithmetic averaging cluster analysis showed the 94 oil palm lines were grouped into one cluster. These results demonstrated that the oil palm in Hainan Province of China and the germplasm introduced from Malaysia may be from the same source. The SSR protocol was effective and reliable for assessing the genetic diversity of oil palm. Knowledge of the genetic diversity and population structure will be crucial for establishing appropriate management stocks for this species.

  19. Detection of two fungal biocontrol agents against root-knot nematodes by RAPD markers.

    PubMed

    Zhu, Ming Liang; Mo, Ming He; Xia, Zhen Yuan; Li, Yun Hua; Yang, Shu Jun; Li, Tian Fei; Zhang, Ke Qin

    2006-05-01

    The strain ZK7 of Pochonia chlamydosporia var. chlamydosporia and IPC of Paecilomyces lilacinus are highly effective in the biological control against root-knot nematodes infecting tobacco. When applied, they require a specific monitoring method to evaluate the colonization and dispersal in soil. In this work, the randomly amplified polymorphic DNA (RAPD) technique was used to differentiate between the two individual strains and 95 other isolates, including isolates of the same species and common soil fungi. This approach allowed the selection of specific fragments of 1.2 kb (Vc1200) and 2.0 kb (Vc2000) specific for ZK7, 1.4 kb (P1400) and 0.85 kb (P850) specific for IPC, using the random Primers OPL-02, OPD-05, OPD-05 and OPC-11, respectively. These fragments were cloned, sequenced, and used to design sequence-characterized amplification region (SCAR) primers specific for the two strains. In classical polymerase chain reaction (PCR), with serial dilution of ZK7 and IPC pure culture DNAs template, the detection limits of these oligonucleotide SCAR-PCR primers were found to be 10, 1000, 500, 100 pg, respectively. In the dot blotting, digoxigenin (DIG)-labeled amplicons from these four primers specifically recognized the corresponding fragments in the DNAs template of these two strains. The detection limit of these amplicons were 0.2, 0.2, 0.5, 0.5 mug, respectively.

  20. Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys

    PubMed Central

    Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E

    2012-01-01

    Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311

  1. Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

    PubMed

    Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

    1999-01-01

    A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

  2. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  3. Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing.

    PubMed

    Li, Yong; Zhang, Weirui

    2015-10-01

    Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker-assisted breeding.

  4. Introducing a primer for career development and promotion: succeeding as a psychologist in an academic health center.

    PubMed

    Christophersen, Edward; Butt, Zeeshan

    2012-12-01

    Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.

  5. Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.

    PubMed

    Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L

    2010-01-01

    Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.

  6. Identification of duck plague virus by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto indefinido y al gen para la proteina de la DNA polimerasa en otros virus herpes. Se encontraron tres o cuatro grupos de iniciadores especificos para el virus vacunal y para el 100% (7/7) de los a??slamientos de campo, pero no amplificaron el DNA del virus de hepatitis por cuerpos de inclusi??n de grullas. Se analiz?? la especificidad de un primer juego de iniciadores con moldes del genoma de otros virus herpes aviares, incluyendo el ?!guila dorada, ?!guila de cabeza blanca, lechuza de cuernos grandes, lechuza blanca, halc??n peregrino, palomas, aves psit?!cidas y pollos (virus de laringotraqueitis infecciosa), pero no se produjeron los productos finales. Por lo tanto, esta prueba de reacci??n en cadena por la polimerasa es altamente especifica para el DNA del virus. Dos grupos de iniciadores fueron capaces de detectar un fragmento de DNA de la cepa vacunal equivalente a cinco copias del genoma. Adem?!s, se determin?? que la proporci??n de la dosis infecciosa en cultivo celular y copias del genoma del virus vacunal de c??lulas de embri??n de pato infectadas era de 10 a 100 respectivamente, haciendo la prueba de la reacci??n en cadena por la polimerasa 20 veces m?!s sensible que el cultivo celular para detectar el virus. La velocidad, sensibilidad y especificidad de la prueba de la reacci??n en cadena por la polimerasa suministra una herramienta de investigaci??n y de diagn??stico altamente mejorada para el estudio de la epizootiolog?-a del virus.

  7. Plastid primers for angiosperm phylogenetics and phylogeography.

    PubMed

    Prince, Linda M

    2015-06-01

    PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

  8. Real-Time PCR Method for Detection of Salmonella spp. in Environmental Samples.

    PubMed

    Kasturi, Kuppuswamy N; Drgon, Tomas

    2017-07-15

    The methods currently used for detecting Salmonella in environmental samples require 2 days to produce results and have limited sensitivity. Here, we describe the development and validation of a real-time PCR Salmonella screening method that produces results in 18 to 24 h. Primers and probes specific to the gene invA , group D, and Salmonella enterica serovar Enteritidis organisms were designed and evaluated for inclusivity and exclusivity using a panel of 329 Salmonella isolates representing 126 serovars and 22 non- Salmonella organisms. The invA - and group D-specific sets identified all the isolates accurately. The PCR method had 100% inclusivity and detected 1 to 2 copies of Salmonella DNA per reaction. Primers specific for Salmonella -differentiating fragment 1 (Sdf-1) in conjunction with the group D set had 100% inclusivity for 32 S Enteritidis isolates and 100% exclusivity for the 297 non-Enteritidis Salmonella isolates. Single-laboratory validation performed on 1,741 environmental samples demonstrated that the PCR method detected 55% more positives than the V itek i mmuno d iagnostic a ssay s ystem (VIDAS) method. The PCR results correlated well with the culture results, and the method did not report any false-negative results. The receiver operating characteristic (ROC) analysis documented excellent agreement between the results from the culture and PCR methods (area under the curve, 0.90; 95% confidence interval of 0.76 to 1.0) confirming the validity of the PCR method. IMPORTANCE This validated PCR method detects 55% more positives for Salmonella in half the time required for the reference method, VIDAS. The validated PCR method will help to strengthen public health efforts through rapid screening of Salmonella spp. in environmental samples.

  9. Real-Time PCR Method for Detection of Salmonella spp. in Environmental Samples

    PubMed Central

    Drgon, Tomas

    2017-01-01

    ABSTRACT The methods currently used for detecting Salmonella in environmental samples require 2 days to produce results and have limited sensitivity. Here, we describe the development and validation of a real-time PCR Salmonella screening method that produces results in 18 to 24 h. Primers and probes specific to the gene invA, group D, and Salmonella enterica serovar Enteritidis organisms were designed and evaluated for inclusivity and exclusivity using a panel of 329 Salmonella isolates representing 126 serovars and 22 non-Salmonella organisms. The invA- and group D-specific sets identified all the isolates accurately. The PCR method had 100% inclusivity and detected 1 to 2 copies of Salmonella DNA per reaction. Primers specific for Salmonella-differentiating fragment 1 (Sdf-1) in conjunction with the group D set had 100% inclusivity for 32 S. Enteritidis isolates and 100% exclusivity for the 297 non-Enteritidis Salmonella isolates. Single-laboratory validation performed on 1,741 environmental samples demonstrated that the PCR method detected 55% more positives than the Vitek immunodiagnostic assay system (VIDAS) method. The PCR results correlated well with the culture results, and the method did not report any false-negative results. The receiver operating characteristic (ROC) analysis documented excellent agreement between the results from the culture and PCR methods (area under the curve, 0.90; 95% confidence interval of 0.76 to 1.0) confirming the validity of the PCR method. IMPORTANCE This validated PCR method detects 55% more positives for Salmonella in half the time required for the reference method, VIDAS. The validated PCR method will help to strengthen public health efforts through rapid screening of Salmonella spp. in environmental samples. PMID:28500041

  10. Detection and quantification of Plectosphaerella cucumerina, a potential biological control agent of potato cyst nematodes, by using conventional PCR, real-time PCR, selective media, and baiting.

    PubMed

    Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R

    2003-08-01

    Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.

  11. Primer and platform effects on 16S rRNA tag sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tremblay, Julien; Singh, Kanwar; Fern, Alison

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  12. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  13. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

    2016-01-01

    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

  14. Simple sequence repeat marker loci discovery using SSR primer.

    PubMed

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  15. Identification of hare meat by a species-specific marker of mitochondrial origin.

    PubMed

    Santos, Cristina G; Melo, Vitor S; Amaral, Joana S; Estevinho, Letícia; Oliveira, M Beatriz P P; Mafra, Isabel

    2012-03-01

    Meat species identification in food has gained increasing interest in recent years due to public health, economic and legal concerns. Following the consumer trend towards high quality products, game meat has earned much attention. The aim of the present work was to develop a DNA-based technique able to identify hare meat. Mitochondrial cytochrome b gene was used to design species-specific primers for hare detection. The new primers proved to be highly specific to Lepus species, allowing the detection of 0.01% of hare meat in pork meat by polymerase chain reaction (PCR). A real-time PCR assay with the new intercalating EvaGreen dye was further proposed as a specific and fast tool for hare identification with increased sensitivity (1pg) compared to end-point PCR (10pg). It can be concluded that the proposed new primers can be used by both species-specific end-point PCR or real-time PCR to accurately authenticate hare meat. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    PubMed

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. A 22-mer primer enhances discriminatory power of AP-PCR fingerprinting technique in characterization of leptospires.

    PubMed

    Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C

    2004-11-01

    To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.

  18. Differentiation of Mycoplasma gallisepticum vaccine strains ts-11 and 6/85 from commonly used Mycoplasma gallisepticum challenge strains by PCR.

    PubMed

    Evans, J D; Leigh, S A

    2008-09-01

    Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses within the poultry industry. In an effort to develop tools to aid in MG research and diagnostics, we have compared sequences of the attenuated MG vaccine strain ts-11 to those of commonly used pathogenic challenge strains in search of a simple means of differentiation. Via gapA sequence alignments and comparisons, we have identified and designed primers facilitating strain differentiation. When applied to conventional polymerase chain reaction (PCR) assay at low annealing temperature, the primer sets allow for the differentiation of MG attenuated vaccine strains ts-11 as well as the attenuated MG vaccine strain 6/85 from the commonly utilized MG challenge strains R(low), R, and S6. Conventional PCR differentiation is based on the visualization of sole products with the attenuated MG strains ts-11 and 6/85 and the lack of the corresponding products from MG strains R(low), R, and S6. When applied to MG strain F, product visualization varies with the applied primer set. The differentiation of MG strains ts-11 and 6/85 from the pathogenic challenge strains was also accomplished via real-time analyses, however, the primer sets were not able to differentiate MG strains ts-11 and 6/85 from selected MG field isolates.

  19. [Design of primers to DNA of lactic acid bacteria].

    PubMed

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  20. Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

    PubMed

    Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

    2016-11-22

    Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

  1. Development and Characterization of Microsatellite Markers for the Cape Gooseberry Physalis peruviana

    PubMed Central

    Simbaqueba, Jaime; Sánchez, Pilar; Sanchez, Erika; Núñez Zarantes, Victor Manuel; Chacon, Maria Isabel; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

    2011-01-01

    Physalis peruviana, commonly known as Cape gooseberry, is an Andean Solanaceae fruit with high nutritional value and interesting medicinal properties. In the present study we report the development and characterization of microsatellite loci from a P. peruviana commercial Colombian genotype. We identified 932 imperfect and 201 perfect Simple Sequence Repeats (SSR) loci in untranslated regions (UTRs) and 304 imperfect and 83 perfect SSR loci in coding regions from the assembled Physalis peruviana leaf transcriptome. The UTR SSR loci were used for the development of 162 primers for amplification. The efficiency of these primers was tested via PCR in a panel of seven P. peruviana accessions including Colombia, Kenya and Ecuador ecotypes and one closely related species Physalis floridana. We obtained an amplification rate of 83% and a polymorphic rate of 22%. Here we report the first P. peruviana specific microsatellite set, a valuable tool for a wide variety of applications, including functional diversity, conservation and improvement of the species. PMID:22039540

  2. Development and characterization of microsatellite markers for the Cape gooseberry Physalis peruviana.

    PubMed

    Simbaqueba, Jaime; Sánchez, Pilar; Sanchez, Erika; Núñez Zarantes, Victor Manuel; Chacon, Maria Isabel; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

    2011-01-01

    Physalis peruviana, commonly known as Cape gooseberry, is an Andean Solanaceae fruit with high nutritional value and interesting medicinal properties. In the present study we report the development and characterization of microsatellite loci from a P. peruviana commercial Colombian genotype. We identified 932 imperfect and 201 perfect Simple Sequence Repeats (SSR) loci in untranslated regions (UTRs) and 304 imperfect and 83 perfect SSR loci in coding regions from the assembled Physalis peruviana leaf transcriptome. The UTR SSR loci were used for the development of 162 primers for amplification. The efficiency of these primers was tested via PCR in a panel of seven P. peruviana accessions including Colombia, Kenya and Ecuador ecotypes and one closely related species Physalis floridana. We obtained an amplification rate of 83% and a polymorphic rate of 22%. Here we report the first P. peruviana specific microsatellite set, a valuable tool for a wide variety of applications, including functional diversity, conservation and improvement of the species.

  3. Evidence for Placental HPV Infection in Both HIV Positive and Negative Women

    PubMed Central

    Chisanga, Chrispin; Eggert, Dawn; Mitchell, Charles D.; Wood, Charles; Angeletti, Peter C.

    2016-01-01

    Human papillomaviruses (HPVs) have previously been reported to infect epithelial trophoblast cells of the placenta. To investigate this possibility, 200 placental samples from Zambian women were separated into HIV+ and HIV− groups and tested for HPV by redundant primer PCR, using GP5+/GP6+ and CPI/CPII primer sets. Three HPV genotypes (HPV6, 16 and 90) were detected in placental samples. Whereas, 20 different HPV genotypes were detected in vaginal sampling of the same patients, suggesting that compartment specific sub-populations of HPV may exist. The incidence of HPV16 in placental samples was almost 2-fold greater in HIV+ women compared to HIV− (p = 0.0241). HPV16 L1 expression, detected by immunochemistry, was significantly higher in HIV+ than HIV− samples (p = 0.0231). HPV16 DNA was detected in the nuclei of trophoblast cells by in situ hybridization. Overall, these results suggest that HPVs infect the placenta and that HIV significantly influences these infections. PMID:26865986

  4. Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

    PubMed

    Glais, Laurent; Jacquot, Emmanuel

    2015-01-01

    Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay.

  5. An improved assay for the determination of Huntington`s disease allele size

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reeves, C.; Klinger, K.; Miller, G.

    1994-09-01

    The hallmark of Huntington`s disease (HD) is the expansion of a polymorphic (CAG)n repeat. Several methods have been published describing PCR amplification of this region. Most of these assays require a complex PCR reaction mixture to amplify this GC-rich region. A consistent problem with trinucleotide repeat PCR amplification is the presence of a number of {open_quotes}stutter bands{close_quotes} which may be caused by primer or amplicon slippage during amplification or insufficient polymerase processivity. Most assays for HD arbitrarily select a particular band for diagnostic purposes. Without a clear choice for band selection such an arbitrary selection may result in inconsistent intra-more » or inter-laboratory findings. We present an improved protocol for the amplification of the HD trinucleotide repeat region. This method simplifies the PCR reaction buffer and results in a set of easily identifiable bands from which to determine allele size. HD alleles were identified by selecting bands of clearly greater signal intensity. Stutter banding was much reduced thus permitting easy identification of the most relevant PCR product. A second set of primers internal to the CCG polymorphism was used in selected samples to confirm allele size. The mechanism of action of N,N,N trimethylglycine in the PCR reaction is not clear. It may be possible that the minimal isostabilizing effect of N,N,N trimethylglycine at 2.5 M is significant enough to affect primer specificity. The use of N,N,N trimethylglycine in the PCR reaction facilitated identification of HD alleles and may be appropriate for use in other assays of this type.« less

  6. A survey of microbial community diversity in marine sediments impacted by petroleum hydrocarbons from the Gulf of Mexico and Atlantic shorelines, Texas to Florida

    USGS Publications Warehouse

    Lisle, John T.; Stellick, Sarah H.

    2011-01-01

    Microbial community genomic DNA was extracted from sediment samples collected along the Gulf of Mexico and Atlantic coasts from Texas to Florida. Sample sites were identified as being ecologically sensitive and (or) as having high potential of being impacted by Macondo-1 (M-1) well oil from the Deepwater Horizon blowout. The diversity within the microbial communities associated with the collected sediments provides a baseline dataset to which microbial community-diversity data from impacted sites could be compared. To determine the microbial community diversity in the samples, genetic fingerprints were generated and compared. Specific sequences within the community genomic DNA were first amplified using the polymerase chain reaction (PCR) with a primer set that provides possible resolution to the species level. A second nested PCR was performed on the primary PCR products using a primer set on which a GC-clamp was attached to one of the primers. The nested PCR products were separated using denaturing-gradient gel electrophoresis (DGGE) that resolves the nested PCR products based on sequence dissimilarities (or similarities), forming a genomic fingerprint of the microbial diversity within the respective samples. Samples with similar fingerprints were grouped and compared to oil-fingerprint data from the same sites (Rosenbauer and others, 2011). The microbial community fingerprints were generally grouped into sites that had been shown to contain background concentrations of non-Deepwater Horizon oil. However, these groupings also included sites where no oil signature was detected. This report represents some of the first information on naturally occurring microbial communities in sediment from shorelines along the Gulf of Mexico and Atlantic coasts from Texas to Florida.

  7. Quantitative Detection of the nosZ Gene, Encoding Nitrous Oxide Reductase, and Comparison of the Abundances of 16S rRNA, narG, nirK, and nosZ Genes in Soils

    PubMed Central

    Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L.

    2006-01-01

    Nitrous oxide (N2O) is an important greenhouse gas in the troposphere controlling ozone concentration in the stratosphere through nitric oxide production. In order to quantify bacteria capable of N2O reduction, we developed a SYBR green quantitative real-time PCR assay targeting the nosZ gene encoding the catalytic subunit of the nitrous oxide reductase. Two independent sets of nosZ primers flanking the nosZ fragment previously used in diversity studies were designed and tested (K. Kloos, A. Mergel, C. Rösch, and H. Bothe, Aust. J. Plant Physiol. 28:991-998, 2001). The utility of these real-time PCR assays was demonstrated by quantifying the nosZ gene present in six different soils. Detection limits were between 101 and 102 target molecules per reaction for all assays. Sequence analysis of 128 cloned quantitative PCR products confirmed the specificity of the designed primers. The abundance of nosZ genes ranged from 105 to 107 target copies g−1 of dry soil, whereas genes for 16S rRNA were found at 108 to 109 target copies g−1 of dry soil. The abundance of narG and nirK genes was within the upper and lower limits of the 16S rRNA and nosZ gene copy numbers. The two sets of nosZ primers gave similar gene copy numbers for all tested soils. The maximum abundance of nosZ and nirK relative to 16S rRNA was 5 to 6%, confirming the low proportion of denitrifiers to total bacteria in soils. PMID:16885263

  8. Comparison of MY09/11 consensus PCR and type-specific PCRs in the detection of oncogenic HPV types.

    PubMed

    Depuydt, C E; Boulet, G A V; Horvath, C A J; Benoy, I H; Vereecken, A J; Bogers, J J

    2007-01-01

    The causal relationship between persistent infection with high-risk HPV and cervical cancer has resulted in the development of HPV DNA detection systems. The widely used MY09/11 consensus PCR targets a 450bp conserved sequence in the HPV L1 gene, and can therefore amplify a broad spectrum of HPV types. However, limitations of these consensus primers are evident, particularly in regard to the variability in detection sensitivity among different HPV types. This study compared MY09/11 PCR with type-specific PCRs in the detection of oncogenic HPV types. The study population comprised 15, 774 patients. Consensus PCR failed to detect 522 (10.9%) HPV infections indicated by type-specific PCRs. A significant correlation between failure of consensus PCR and HPV type was found. HPV types 51, 68 and 45 were missed most frequently. The clinical relevance of the HPV infections missed by MY09/11 PCR was reflected in the fraction of cases with cytological abnormalities and in follow-up, showing 104 (25.4%) CIN2+ cases. The MY09/11 false negativity could be the result of poor sensitivity, mismatch of MY09/11 primers or disruption of L1 target by HPV integration or DNA degradation. Furthermore, MY09/11 PCR lacked specificity for oncogenic HPVs. Diagnostic accuracy of the PCR systems, in terms of sensitivity (MY09/11 PCR: 87.9%; type-specific PCRs: 98.3%) and specificity (MY09/11 PCR: 38.7%; type-specific PCRs: 76.14%), and predictive values for histologically confirmed CIN2+, suggest that type-specific PCRs could be used in a clinical setting as a reliable screening tool.

  9. Development of new strains and related SCAR markers for an edible mushroom, Hypsizygus marmoreus.

    PubMed

    Lee, Chang Y; Park, Jeong-Eun; Lee, Jia; Kim, Jong-Kuk; Ro, Hyeon-Su

    2012-02-01

    New fast-growing and less bitter varieties of Hypsizygus marmoreus were developed by crossing monokaryotic mycelia from a commercial strain (Hm1-1) and a wild strain (Hm3-10). Six of the better tasting new strains with a shorter cultivation period were selected from 400 crosses in a large-scale cultivation experiment. We attempted to develop sequence characterized amplified region (SCAR) markers to identify the new strain from other commercial strains. For the SCAR markers, we conducted molecular genetic analysis on a wild strain and the eight most cultivated H. marmoreus strains collected from various areas in East Asia by randomly amplified polymorphic DNA. Ten unique DNA bands for a commercial Hm1-1 strain and the Hm3-10 strain were extracted and their sequences were determined. Primer sets were designed based on the determined sequences. PCR reactions with the primer sets revealed that four primer sets successfully discriminated the new strains from other commercial strains and are thus suitable for commercial purposes. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  10. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    PubMed

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  11. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

    PubMed Central

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

    2016-01-01

    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  12. Competitive amplification of differentially melting amplicons (CADMA) enables sensitive and direct detection of all mutation types by high-resolution melting analysis.

    PubMed

    Kristensen, Lasse S; Andersen, Gitte B; Hager, Henrik; Hansen, Lise Lotte

    2012-01-01

    Sensitive and specific mutation detection is of particular importance in cancer diagnostics, prognostics, and individualized patient treatment. However, the majority of molecular methodologies that have been developed with the aim of increasing the sensitivity of mutation testing have drawbacks in terms of specificity, convenience, or costs. Here, we have established a new method, Competitive Amplification of Differentially Melting Amplicons (CADMA), which allows very sensitive and specific detection of all mutation types. The principle of the method is to amplify wild-type and mutated sequences simultaneously using a three-primer system. A mutation-specific primer is designed to introduce melting temperature decreasing mutations in the resulting mutated amplicon, while a second overlapping primer is designed to amplify both wild-type and mutated sequences. When combined with a third common primer very sensitive mutation detection becomes possible, when using high-resolution melting (HRM) as detection platform. The introduction of melting temperature decreasing mutations in the mutated amplicon also allows for further mutation enrichment by fast coamplification at lower denaturation temperature PCR (COLD-PCR). For proof-of-concept, we have designed CADMA assays for clinically relevant BRAF, EGFR, KRAS, and PIK3CA mutations, which are sensitive to, between 0.025% and 0.25%, mutated alleles in a wild-type background. In conclusion, CADMA enables highly sensitive and specific mutation detection by HRM analysis. © 2011 Wiley Periodicals, Inc.

  13. Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oetting, W.S.; Wiesner, G.; Laken, S.

    The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

  14. A teat papillomatosis case in a Damascus goat (Shami goat) in Hatay province, Turkey: a new putative papillomavirus?

    PubMed

    Dogan, Fırat; Dorttas, Selvi Deniz; Bilge Dagalp, Seval; Ataseven, Veysel Soydal; Alkan, Feray

    2018-06-01

    Papillomaviruses (PVs) are epitheliotropic viruses that cause benign proliferative lesions in the skin (warts or papillomas) and mucous membranes of their natural hosts. Recently, new PVs have been found in many animal species. The most common current approach for identifying novel PV types is based on PCR, using various consensus or degenerated primer (broad-range primers), designed on the basis of the multiple alignment of nucleotide or amino acid sequences of a large number of different human papillomaviruses (HPV). PVs have been classified according to the sequence similarity of one of their capsid proteins, L1, without taking into account other regions of the genome and without considering the phenotypic characteristics of the viral infection. In this study, we performed molecular detection and typing of a PV in a goat with teat papillomatosis. Firstly, PCR was performed using the FAP59/FAP64 and MY09/MY11 primer pairs for the L1 gene region. The PV DNA was found to be positive only with the FAP59/FAP64 primer pair. PV DNA was then tested with three primer sets in four different combinations (L2Bf/FAP64, L2Bf/L1Br, FAP59/FAP64, L1Bf/LCRBr) for the gene region encoding the L1, L2 and LCR proteins. The goat teat papilloma sample was amplified using FAP59/FAP64 primers and two primer pairs (L2Bf/FAP64 and L2Bf/L1Br). We obtained products matching approximately 604 bp of the L1 region of the virus. PV DNA was used for typing using sequence analysis/PCR with some type-specific primers for bovids, caprids and cervids. The results of the sequence analysis suggested one new putative PV type with sequence identity ranging from 46.45 to 80.09% to other known papillomaviruses, including Capra hircus papillomavirus (ChPV-2), bovine papillomavirus (BPV) 6, 7, 10, 11 and 12, Rangifer tarandus papillomavirus 3 (RtPV-3) and BPV-7Z (Alpine wild ruminant papillomavirus; Cervus elaphus papillomavirus). We therefore propose that this is the first identification of a new putative type, MG523274 (HTY-goat-TR2016), in a goat with teat papillomatosis. It is essential to identify PV types in different animal species and investigate their prevalence/distribution and clinical consequences in order to develop appropriate prophylactic and/or therapeutic procedures and to determine the interspecies transmission potential and evolution of PVs.

  15. [Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].

    PubMed

    Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun

    2009-10-01

    To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.

  16. Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing1

    PubMed Central

    Li, Yong; Zhang, Weirui

    2015-01-01

    Premise of the study: Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Methods and Results: Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. Conclusions: This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding. PMID:26504683

  17. Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.

    PubMed

    Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo

    2016-08-30

    Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.

  18. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  19. Visual Detection of Canine Parvovirus Based on Loop-Mediated Isothermal Amplification Combined with Enzyme-Linked Immunosorbent Assay and with Lateral Flow Dipstick

    PubMed Central

    SUN, Yu-Ling; YEN, Chon-Ho; TU, Ching-Fu

    2013-01-01

    ABSTRACT Loop-mediated isothermal amplification (LAMP) combined with enzyme-linked immunosorbent assay (LAMP–ELISA) and with lateral flow dipstick (LAMP–LFD) are rapid, sensitive and specific methods for the visual detection of clinical pathogens. In this study, LAMP–ELISA and LAMP–LFD were developed for the visual detection of canine parvovirus (CPV). For LAMP, a set of four primers (biotin-labeled forward inner primers) was designed to specifically amplify a region of the VP2 gene of CPV. The optimum time and temperature for LAMP were 60 min and 65°C, respectively. The specific capture oligonucleotide probes, biotin-labeled CPV probe for LAMP–ELISA and fluorescein isothiocyanate-labeled CPV probe for LAMP–LFD were also designed for hybridization with LAMP amplicons on streptavidin-coated wells and LFD strips, respectively. For the comparison of detection sensitivity, conventional PCR and LAMP for CPV detection were also performed. The CPV detection limits by PCR, PCR–ELISA, LAMP, LAMP–ELISA and LAMP–LFD were 102, 102, 10−1, 10−1 and 10−1 TCID50/ml, respectively. In tests using artificially contaminated dog fecal samples, the samples with CPV inoculation levels of ≥1 TCID50/ml gave positive results by both LAMP–ELISA and LAMP–LFD. Our data indicated that both LAMP–ELISA and LAMP–LFD are promising as rapid, sensitive and specific methods for an efficient diagnosis of CPV infection. PMID:24334855

  20. Development of a single-tube loop-mediated isothermal amplification assay for detection of four pathogens of bacterial meningitis.

    PubMed

    Huy, Nguyen Tien; Hang, Le Thi Thuy; Boamah, Daniel; Lan, Nguyen Thi Phuong; Van Thanh, Phan; Watanabe, Kiwao; Huong, Vu Thi Thu; Kikuchi, Mihoko; Ariyoshi, Koya; Morita, Kouichi; Hirayama, Kenji

    2012-12-01

    Several loop-mediated isothermal amplification (LAMP) assays have been developed to detect common causative pathogens of bacterial meningitis (BM). However, no LAMP assay is reported to detect Streptococcus agalactiae and Streptococcus suis, which are also among common pathogens of BM. Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial pathogen. Thus, we aimed to design and develop a single-tube LAMP assay capable of detecting multiple bacterial species, based on the nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide sequences of the 16S rRNA genes of main pathogens involved in BM were aligned to identify conserved regions, which were further used to design broad range specific LAMP assay primers. We successfully designed a set of broad range specific LAMP assay primers for simultaneous detection of four species including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity with other bacteria including Haemophilus influenzae, Neisseria meningitidis and Escherichia coli. The sensitivity of our LAMP assay was 100-1000 times higher compared with the conventional PCR assay. The bacterial species could be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Top