Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

PubMed

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

URPD: a specific product primer design tool

PubMed Central

2012-01-01

Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

URPD: a specific product primer design tool.

PubMed

Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

2012-06-19

Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

PubMed

Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

2015-01-01

This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

PubMed Central

Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

2016-01-01

Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

PubMed

Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

2018-01-01

Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE PAGES

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

2018-03-27

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

PubMed

Pauthenier, Cyrille; Faulon, Jean-Loup

2014-07-01

PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Electrochemical genosensing of Salmonella, Listeria and Escherichia coli on silica magnetic particles.

PubMed

Liébana, Susana; Brandão, Delfina; Cortés, Pilar; Campoy, Susana; Alegret, Salvador; Pividori, María Isabel

2016-01-21

A magneto-genosensing approach for the detection of the three most common pathogenic bacteria in food safety, such as Salmonella, Listeria and Escherichia coli is presented. The methodology is based on the detection of the tagged amplified DNA obtained by single-tagging PCR with a set of specific primers for each pathogen, followed by electrochemical magneto-genosensing on silica magnetic particles. A set of primers were selected for the amplification of the invA (278 bp), prfA (217 bp) and eaeA (151 bp) being one of the primers for each set tagged with fluorescein, biotin and digoxigenin coding for Salmonella enterica, Listeria monocytogenes and E. coli, respectively. The single-tagged amplicons were then immobilized on silica MPs based on the nucleic acid-binding properties of silica particles in the presence of the chaotropic agent as guanidinium thiocyanate. The assessment of the silica MPs as a platform for electrochemical magneto-genosensing is described, including the main parameters to selectively attach longer dsDNA fragments instead of shorter ssDNA primers based on their negative charge density of the sugar-phosphate backbone. This approach resulted to be a promising detection tool with sensing features of rapidity and sensitivity very suitable to be implemented on DNA biosensors and microfluidic platforms. Copyright © 2015 Elsevier B.V. All rights reserved.

Gemi: PCR Primers Prediction from Multiple Alignments

PubMed Central

Sobhy, Haitham; Colson, Philippe

2012-01-01

Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

PubMed

Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

2009-12-01

The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

PubMed Central

Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

2014-01-01

For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

PubMed

Panicker, Gitika; Bej, Asim K

2005-10-01

We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii

PubMed Central

Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon

2005-01-01

Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482

A PCR technique based on the Hip1 interspersed repetitive sequence distinguishes cyanobacterial species and strains.

PubMed

Smith, J K; Parry, J D; Day, J G; Smith, R J

1998-10-01

The use of primers based on the Hip1 sequence as a typing technique for cyanobacteria has been investigated. The discovery of short repetitive sequence structures in bacterial DNA during the last decade has led to the development of PCR-based methods for typing, i.e., distinguishing and identifying, bacterial species and strains. An octameric palindromic sequence known as Hip1 has been shown to be present in the chromosomal DNA of many species of cyanobacteria as a highly repetitious interspersed sequence. PCR primers were constructed that extended the Hip1 sequence at the 3' end by two bases. Five of the 16 possible extended primers were tested. Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA. Each primer produced a distinct set of products for each of the 15 cyanobacterial species tested. The ability of Hip1-based PCR to resolve taxonomic differences was assessed by analysis of independent isolates of Anabaena flos-aquae and Nostoc ellipsosporum obtained from the CCAP (Culture Collection of Algae and Protozoa, IFE, Cumbria, UK). A PCR-based RFLP analysis of products amplified from the 23S-16S rDNA intergenic region was used to characterize the isolates and to compare with the Hip1 typing data. The RFLP and Hip1 typing yielded similar results and both techniques were able to distinguish different strains. On the basis of these results it is suggested that the Hip1 PCR technique may assist in distinguishing cyanobacterial species and strains.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

PubMed Central

Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

2007-01-01

Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

PubMed Central

Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

2015-01-01

Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

PubMed

Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

2018-03-09

Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

PubMed

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Multiplex primer prediction software for divergent targets

PubMed Central

Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

2009-01-01

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

USGS Publications Warehouse

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Lee, H.K.; Flanders, D.J.

The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

A method for automatically extracting infectious disease-related primers and probes from the literature

PubMed Central

2010-01-01

Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1) convert each document into a tree of paper sections, (2) detect the candidate sequences using a set of finite state machine-based recognizers, (3) refine problem sequences using a rule-based expert system, and (4) annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch. PMID:20682041

Molecular diagnosis of group B coltiviruses infections.

PubMed

Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X

1999-08-01

The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.

Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

PubMed Central

Bokulich, Nicholas A.

2013-01-01

Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

swga: a primer design toolkit for selective whole genome amplification.

PubMed

Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

2017-07-15

Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

PubMed

Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

2014-07-01

In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

Multiplexing Short Primers for Viral Family PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S N; Hiddessen, A L; Hara, C A

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

PubMed

Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

2007-01-01

Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

PubMed

Gell, I; Cubero, J; Melgarejo, P

2007-12-01

To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

A new cultivation independent approach to detect and monitor common Trichoderma species in soils.

PubMed

Hagn, Alexandra; Wallisch, Stefanie; Radl, Viviane; Charles Munch, Jean; Schloter, Michael

2007-04-01

A set of primers was developed for the detection, identification and quantification of common Trichoderma species in soil samples. Based on a broad range master alignment primers were derived to amplify an approximate 540 bp fragment comprising the internal transcribed spacer region 1 (ITS 1), 5.8S rDNA and internal transcribed spacer region 2 (ITS 2) from all taxonomic Clades of the genus Trichoderma. The primer set was applied to test strains as well as community DNA isolated from arable and forest soil. For all tested isolates the corresponding internal transcribed spacer regions of Trichoderma spp. strains were amplified, but none of non-Trichoderma origin. PCR with community DNA from soil yielded products of the expected size. Analysis of a clone library established for an arable site showed that all amplified sequences originated exclusively from Trichoderma species mainly being representatives of the Clades Hamatum, Harzianum and Pachybasioides and comprising most of the species known for biocontrol ability. In a realtime PCR approach the primer set uTf/uTr also proved to be a suitable system to quantify DNA of Trichoderma spp. in soils.

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F. William

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F.W.

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.

Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

PubMed

Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

2016-09-01

Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers.

PubMed

Koester, Meike; Gergs, René

2017-10-05

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea

PubMed Central

Kurosaki, Yohei; Magassouba, N’Faly; Oloniniyi, Olamide K.; Cherif, Mahamoud S.; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro

2016-01-01

Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure. PMID:26900929

Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea.

PubMed

Kurosaki, Yohei; Magassouba, N'Faly; Oloniniyi, Olamide K; Cherif, Mahamoud S; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro

2016-02-01

Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure.

PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

PubMed Central

Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

2006-01-01

PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

PubMed Central

Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

2011-01-01

Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

Development of the polymerase chain reaction for diagnosis of chancroid.

PubMed Central

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

3'-terminal sequence of a small round structured virus (SRSV) in Japan.

PubMed

Utagawa, E T; Takeda, N; Inouye, S; Kasuga, K; Yamazaki, S

1994-01-01

We determined the nucleotide sequence of about 1,000 bases from the 3'-terminus of a small round structured virus (SRSV), which caused a gastroenteritis outbreak in Chiba Prefecture, Japan, in 1987. The sequence was compared with the corresponding sequence region of Norwalk virus; it consisted of a part of the open reading frame 2 (ORF2), whole ORF3, and 3'-noncoding region (NCR). The 624-base-long ORF3 had sequence homology of 68% with the corresponding region of Norwalk virus. (The amino acid sequence homology was 74%.) The 94-base-long NCR had 65% homology with Norwalk virus. We then selected two consensus-sequence portions in the above sequence between Chiba and Norwalk viruses for primers in the reverse transcriptase-polymerase chain reaction (RT-PCR). Using this primer set, we detected 669-bp bands in agarose gel electrophoresis of RT-PCR products from feces containing Chiba or Norwalk viruses. Furthermore, in Southern hybridization with Chiba probes which were labeled with digoxigenin-dUTP in PCR, the bands of the two viruses were clearly stained under a low stringency condition. Since both Chiba and Norwalk viruses were detected by the above primer set although they are geographically and chronologically different viruses, our primer-pair may be useful for detection of a broad range of SRSVs which cause gastroenteritis in different areas.

A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

PubMed

Nishitani, Goh; Yoshida, Masaki

2018-06-01

This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

Back to Basics--The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities.

PubMed

Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H

2015-01-01

DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

PubMed

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-01-01

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

Detection and Heterogeneity of Herpesviruses Causing Pacheco's Disease in Parrots

PubMed Central

Tomaszewski, Elizabeth; Wilson, Van G.; Wigle, William L.; Phalen, David N.

2001-01-01

Pacheco's disease (PD) is a common, often fatal, disease of parrots. We cloned a virus isolate from a parrot that had characteristic lesions of PD. Three viral clones were partially sequenced, demonstrating that this virus was an alphaherpesvirus most closely related to the gallid herpesvirus 1. Five primer sets were developed from these sequences. The primer sets were used with PCR to screen tissues or tissue culture media suspected to contain viruses from 54 outbreaks of PD. The primer sets amplified DNA from all but one sample. Ten amplification patterns were detected, indicating that PD is caused by a genetically heterogeneous population of viruses. A single genetic variant (psittacid herpesvirus variant 1) amplified with all primer sets and was the most common virus variant (62.7%). A single primer set (23F) amplified DNA from all of the positive samples, suggesting that PCR could be used as a rapid postmortem assay for these viruses. PCR was found to be significantly more sensitive than tissue culture for the detection of psittacid herpesviruses. PMID:11158102

Microsatellite markers for Vellozia gigantea (Velloziaceae), a narrowly endemic species to the Brazilian campos rupestres.

PubMed

Martins, Ana Paula V; Proite, Karina; Kalapothakis, Evanguedes; Santos, Fabrício R; Chaves, Anderson V; Borba, Eduardo L

2012-07-01

Microsatellite primers were developed for the first time in Velloziaceae, in the endangered species Vellozia gigantea. Using two different protocols, seven primer sets were characterized in three populations of V. gigantea. The primers amplified di- and trinucleotide repeats with six to 12 alleles per locus. These revealed high levels of genetic variation, presenting an average observed heterozygosity of 0.508 in V. gigantea. The seven primers were tested for cross-amplification in three Vellozia species. All primers successfully amplified in V. auriculata. Six primers amplified in V. compacta and three in V. hirsuta. The new marker set described here will be useful for studies of population genetics of V. gigantea. The cross-amplification results indicate the utility of primers for studies in other Vellozia species.

Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

PubMed

Cowan, Ashley F; Elkins, Kelly M

2017-12-01

Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

PubMed

Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

2015-08-01

Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

PubMed

Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

2013-03-01

Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Forensic strategy to ensure the quality of sequencing data of mitochondrial DNA in highly degraded samples.

PubMed

Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki

2014-01-01

Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Novel ITS1 Fungal Primers for Characterization of the Mycobiome

PubMed Central

Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

2017-01-01

ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.

PubMed

Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo

2017-05-28

Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.

Characterization of a Methanogenic Community within an Algal Fed Anaerobic Digester

PubMed Central

Ellis, Joshua T.; Tramp, Cody; Sims, Ronald C.; Miller, Charles D.

2012-01-01

The microbial diversity and metabolic potential of a methanogenic consortium residing in a 3785-liter anaerobic digester, fed with wastewater algae, was analyzed using 454 pyrosequencing technology. DNA was extracted from anaerobic sludge material and used in metagenomic analysis through PCR amplification of the methyl-coenzyme M reductase α subunit (mcrA) gene using primer sets ML, MCR, and ME. The majority of annotated mcrA sequences were assigned taxonomically to the genera Methanosaeta in the order Methanosarcinales. Methanogens from the genus Methanosaeta are obligate acetotrophs, suggesting this genus plays a dominant role in methane production from the analyzed fermentation sample. Numerous analyzed sequences within the algae fed anaerobic digester were unclassified and could not be assigned taxonomically. Relative amplicon frequencies were determined for each primer set to determine the utility of each in pyrosequencing. Primer sets ML and MCR performed better quantitatively (representing the large majority of analyzed sequences) than primer set ME. However, each of these primer sets was shown to provide a quantitatively unique community structure, and thus they are of equal importance in mcrA metagenomic analysis. PMID:23724331

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

PubMed

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-07-08

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification

PubMed Central

Guo, Xu-Guang; Zhou, Shan

2014-01-01

Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

PubMed

Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

PubMed Central

Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Evaluation of a duplex reverse-transcription real-time PCR assay for the detection of encephalomyocarditis virus.

PubMed

Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D

2018-06-01

We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.

Development of new strains and related SCAR markers for an edible mushroom, Hypsizygus marmoreus.

PubMed

Lee, Chang Y; Park, Jeong-Eun; Lee, Jia; Kim, Jong-Kuk; Ro, Hyeon-Su

2012-02-01

New fast-growing and less bitter varieties of Hypsizygus marmoreus were developed by crossing monokaryotic mycelia from a commercial strain (Hm1-1) and a wild strain (Hm3-10). Six of the better tasting new strains with a shorter cultivation period were selected from 400 crosses in a large-scale cultivation experiment. We attempted to develop sequence characterized amplified region (SCAR) markers to identify the new strain from other commercial strains. For the SCAR markers, we conducted molecular genetic analysis on a wild strain and the eight most cultivated H. marmoreus strains collected from various areas in East Asia by randomly amplified polymorphic DNA. Ten unique DNA bands for a commercial Hm1-1 strain and the Hm3-10 strain were extracted and their sequences were determined. Primer sets were designed based on the determined sequences. PCR reactions with the primer sets revealed that four primer sets successfully discriminated the new strains from other commercial strains and are thus suitable for commercial purposes. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

PubMed Central

Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

2005-01-01

Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

PubMed

Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

2005-12-01

Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

Crystallographic observation of nonenzymatic RNA primer extension.

PubMed

Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W

2018-05-31

The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.

Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

PubMed

Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

2017-12-02

DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

PubMed

Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2013-01-01

Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.

PubMed

Murata, C; Ogura, G; Kuroiwa, A

2011-03-01

To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.

Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

PubMed

Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

2011-05-01

A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

Differentiation of Mycoplasma gallisepticum vaccine strains ts-11 and 6/85 from commonly used Mycoplasma gallisepticum challenge strains by PCR.

PubMed

Evans, J D; Leigh, S A

2008-09-01

Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses within the poultry industry. In an effort to develop tools to aid in MG research and diagnostics, we have compared sequences of the attenuated MG vaccine strain ts-11 to those of commonly used pathogenic challenge strains in search of a simple means of differentiation. Via gapA sequence alignments and comparisons, we have identified and designed primers facilitating strain differentiation. When applied to conventional polymerase chain reaction (PCR) assay at low annealing temperature, the primer sets allow for the differentiation of MG attenuated vaccine strains ts-11 as well as the attenuated MG vaccine strain 6/85 from the commonly utilized MG challenge strains R(low), R, and S6. Conventional PCR differentiation is based on the visualization of sole products with the attenuated MG strains ts-11 and 6/85 and the lack of the corresponding products from MG strains R(low), R, and S6. When applied to MG strain F, product visualization varies with the applied primer set. The differentiation of MG strains ts-11 and 6/85 from the pathogenic challenge strains was also accomplished via real-time analyses, however, the primer sets were not able to differentiate MG strains ts-11 and 6/85 from selected MG field isolates.

Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

PubMed Central

2014-01-01

Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.

PubMed

Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo

2016-08-30

Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.

Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food.

PubMed

Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K

2015-09-08

The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.

Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

PubMed Central

Kim, Kwang-Pyo; Singh, Atul K.; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K.

2015-01-01

The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL. PMID:26371000

Enhanced Reliability and Accuracy for Field Deployable Bioforensic Detection and Discrimination of Xylella fastidiosa subsp. pauca, Causal Agent of Citrus Variegated Chlorosis Using Razor Ex Technology and TaqMan Quantitative PCR

PubMed Central

Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333

Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated chlorosis using razor ex technology and TaqMan quantitative PCR.

PubMed

Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.

Multiplex real-time PCR assay for Legionella species.

PubMed

Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

2015-12-01

Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

PubMed Central

Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

1994-01-01

Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

PubMed

Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

2006-09-01

To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Wiesner, G.; Laken, S.

The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

PubMed Central

Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

2015-01-01

High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

Sequetyping: Serotyping Streptococcus pneumoniae by a Single PCR Sequencing Strategy

PubMed Central

Leung, Marcus H.; Bryson, Kevin; Freystatter, Kathrin; Pichon, Bruno; Edwards, Giles; Gillespie, Stephen H.

2012-01-01

The introduction of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to assess vaccine efficacy and replacement serotypes. Conventional serological methods are costly, labor-intensive, and prone to misidentification, while current DNA-based methods have limited serotype coverage requiring multiple PCR primers. In this study, a computer algorithm was developed to interrogate the capsulation locus (cps) of vaccine serotypes to locate primer pairs in conserved regions that border variable regions and could differentiate between serotypes. In silico analysis of cps from 92 serotypes indicated that a primer pair spanning the regulatory gene cpsB could putatively amplify 84 serotypes and differentiate 46. This primer set was specific to Streptococcus pneumoniae, with no amplification observed for other species, including S. mitis, S. oralis, and S. pseudopneumoniae. One hundred thirty-eight pneumococcal strains covering 48 serotypes were tested. Of 23 vaccine serotypes included in the study, most (19/22, 86%) were identified correctly at least to the serogroup level, including all of the 13-valent conjugate vaccine and other replacement serotypes. Reproducibility was demonstrated by the correct sequetyping of different strains of a serotype. This novel sequence-based method employing a single PCR primer pair is cost-effective and simple. Furthermore, it has the potential to identify new serotypes that may evolve in the future. PMID:22553238

A Phylogenomic Approach Based on PCR Target Enrichment and High Throughput Sequencing: Resolving the Diversity within the South American Species of Bartsia L. (Orobanchaceae)

PubMed Central

Tank, David C.

2016-01-01

Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929

Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

PubMed Central

Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

2003-01-01

Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae subsp. dysgalactiae isolated from farmed fish.

PubMed

Nomoto, R; Kagawa, H; Yoshida, T

2008-01-01

To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.

Multiplex PCR method to discriminate Artemisia iwayomogi from other Artemisia plants.

PubMed

Doh, Eui Jeong; Oh, Seung-Eun

2012-01-01

Some plants in the genus Artemisia have been used for medicinal purposes. Among them, Artemisia iwayomogi, commonly referred to as "Haninjin," is one of the major medicinal materials used in traditional Korean medicine. By contrast, Artemisia capillaris and both Artemisia argyi and Artemisia princeps, referred to as "Injinho" and "Aeyup," respectively, are used to treat diseases different from those for which "Haninjin" is prescribed. Therefore, the development of a reliable method to differentiate each Artemisia herb is necessary. We found that a random amplified polymorphic DNA (RAPD) method can be used to efficiently discriminate a few Artemisia plants from one another. To improve the reliability of RAPD amplification, we designed primer sets based on the nucleotide sequences of RAPD products to amplify a sequence-characterized amplified region (SCAR) marker of A. iwayomogi. In addition, we designed two other primer sets to amplify SCAR markers of "Aeyup" (A. argyi and A. princeps) along with "Injinho" (A. capillaris) and Artemisia japonica, which are also traded in Korean herbal markets. Using these three primer sets, we developed a multiplex PCR method concurrently not only to discriminate A. iwayomogi from other Artemisia plants, but also to identify Artemisia plants using a single PCR process.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

PubMed

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

PubMed Central

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus.

PubMed

Raue, R; Hess, M

1998-08-01

Three different polymerase chain reactions (PCRs), two of them combined with restriction enzyme analysis (REA), were developed for detection and differentiation of all 12 fowl adenovirus (FAV) serotypes and the egg drop syndrome (EDS) virus. For primer construction FAV1, FAV10 and EDS virus hexon proteins were aligned and conserved and variable regions were determined. Two primer sets (H1/H2 and H3/H4) for single use were constructed which hybridize in three conserved regions of hexon genes. Each primer pair amplifies approximately half of the hexon gene including two loop regions. An amplification product was detected with both primer sets using purified DNA from all FAV1-12 reference strains. Viral EDS DNA was negative using the H1/H2 or H3/H4 primer pair. HaeII digestion of the H1/H2 amplification products differentiates between all viruses except FAV4 and FAV5. In comparison, much more clustering among genomic closely related FAV serotypes was seen after HpaII digestion of the H3/H4 PCR products. Oligonucleotides H5/H6 located in the variable regions of EDS virus hexon gene do not detect any of the FAV serotypes. The PCRs and REA described are suitable to detect all avian adenoviruses infecting chickens, to distinguish all 12 FAV reference strains and to differentiate FAVs from the EDS virus.

Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

PubMed

Gonzales, J L; Loza, A; Chacon, E

2006-03-15

There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE PAGES

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...

2016-07-15

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Predictive Modeling of K-12 Academic Outcomes: A Primer for Researchers Working with Education Data

ERIC Educational Resources Information Center

Porter, Kristin E.; Balu, Rekha

2016-01-01

Education systems are increasingly creating rich, longitudinal data sets with frequent, and even real-time, data updates of many student measures, including daily attendance, homework submissions, and exam scores. These data sets provide an opportunity for district and school staff members to move beyond an indicators-based approach and instead…

A Primer-Test Centered Equating Method for Setting Cut-Off Scores

ERIC Educational Resources Information Center

Zhu, Weimo; Plowman, Sharon Ann; Park, Youngsik

2010-01-01

This study evaluated the use of a new primary field test method based on test equating to address inconsistent classification among field tests. We analyzed students' information on the Progressive Aerobic Cardiovascular Endurance Run (PACER), mile run (MR), and VO[subscript 2]max from three data sets (college: n = 94; middle school: n = 39;…

SYBR green-based real-time reverse transcription-PCR for typing and subtyping of all hemagglutinin and neuraminidase genes of avian influenza viruses and comparison to standard serological subtyping tests.

PubMed

Tsukamoto, Kenji; Panei, Carlos Javier; Javier, Panei Carlos; Shishido, Makiko; Noguchi, Daigo; Pearce, John; Kang, Hyun-Mi; Jeong, Ok Mi; Lee, Youn-Jeong; Nakanishi, Koji; Ashizawa, Takayoshi

2012-01-01

Continuing outbreaks of H5N1 highly pathogenic (HP) avian influenza virus (AIV) infections of wild birds and poultry worldwide emphasize the need for global surveillance of wild birds. To support the future surveillance activities, we developed a SYBR green-based, real-time reverse transcriptase PCR (rRT-PCR) for detecting nucleoprotein (NP) genes and subtyping 16 hemagglutinin (HA) and 9 neuraminidase (NA) genes simultaneously. Primers were improved by focusing on Eurasian or North American lineage genes; the number of mixed-base positions per primer was set to five or fewer, and the concentration of each primer set was optimized empirically. Also, 30 cycles of amplification of 1:10 dilutions of cDNAs from cultured viruses effectively reduced minor cross- or nonspecific reactions. Under these conditions, 346 HA and 345 NA genes of 349 AIVs were detected, with average sensitivities of NP, HA, and NA genes of 10(1.5), 10(2.3), and 10(3.1) 50% egg infective doses, respectively. Utility of rRT-PCR for subtyping AIVs was compared with that of current standard serological tests by using 104 recent migratory duck virus isolates. As a result, all HA genes and 99% of the NA genes were genetically subtyped, while only 45% of HA genes and 74% of NA genes were serologically subtyped. Additionally, direct subtyping of AIVs in fecal samples was possible by 40 cycles of amplification: approximately 70% of HA and NA genes of NP gene-positive samples were successfully subtyped. This validation study indicates that rRT-PCR with optimized primers and reaction conditions is a powerful tool for subtyping varied AIVs in clinical and cultured samples.

DNA-based identification of Brassica vegetable species for the juice industry.

PubMed

Etoh, Kazumi; Niijima, Noritaka; Yokoshita, Masahiko; Fukuoka, Shin-Ichi

2003-10-01

Since kale (Brassica oleracea var. acephala), a cruciferous vegetable with a high level of vitamins and functional compounds beneficial to health and wellness, has become widely used in the juice industry, a precise method for quality control of vegetable species is necessary. We describe here a DNA-based identification method to distinguish kale from cabbage (Brassica oleracea var. capitata), a closely related species, which can be inadvertently mixed with kale during the manufacturing process. Using genomic DNA from these vegetables and combinatory sets of nucleotide primers, we screened for random amplified polymorphic DNA (RAPD) fragments and found three cabbage-specific fragments. These RAPD fragments, with lengths of 1.4, 0.5, and 1.5 kb, were purified, subcloned, and sequenced. Based on sequence-tagged sites (STS), we designed sets of primers to detect cabbage-specific identification (CAI) DNA markers. Utilizing the CAI markers, we successfully distinguished more than 10 different local cabbage accessions from 20 kale accessions, and identified kale juices experimentally spiked with different amounts of cabbage.

Development of duplex PCR for simultaneous detection of Theileria spp. and Anaplasma spp. in sheep and goats.

PubMed

Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen

2017-05-01

Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3  ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.

Molecular diagnosis of symptomatic toxoplasmosis: a 9-year retrospective and prospective study in a referral laboratory in São Paulo, Brazil.

PubMed

Camilo, Lilian Muniz; Pereira-Chioccola, Vera Lucia; Gava, Ricardo; Meira-Strejevitch, Cristina da Silva; Vidal, Jose Ernesto; Brandão de Mattos, Cinara Cássia; Frederico, Fábio Batista; De Mattos, Luiz Carlos; Spegiorin, Lígia Cosentino Junqueira Franco

Symptomatic forms of toxoplasmosis are a serious public health problem and occur in around 10-20% of the infected people. Aiming to improve the molecular diagnosis of symptomatic toxoplasmosis in Brazilian patients, this study evaluated the performance of real time PCR testing two primer sets (B1 and REP-529) in detecting Toxoplasma gondii DNA. The methodology was assayed in 807 clinical samples with known clinical diagnosis, ELISA, and conventional PCR results in a 9-year period. All samples were from patients with clinical suspicion of several features of toxoplasmosis. According to the minimum detection limit curve (in C T ), REP-529 had greater sensitivity to detect T. gondii DNA than B1. Both primer sets were retrospectively evaluated using 515 DNA from different clinical samples. The 122 patients without toxoplasmosis provided high specificity (REP-529, 99.2% and B1, 100%). From the 393 samples with positive ELISA, 146 had clinical diagnosis of toxoplasmosis and positive conventional PCR. REP-529 and B1 sensitivities were 95.9% and 83.6%, respectively. Comparison of REP-529 and B1 performances was further analyzed prospectively in 292 samples. Thus, from a total of 807 DNA analyzed, 217 (26.89%) had positive PCR with, at least one primer set and symptomatic toxoplasmosis confirmed by clinical diagnosis. REP-529 was positive in 97.23%, whereas B1 amplified only 78.80%. After comparing several samples in a Brazilian referral laboratory, this study concluded that REP-529 primer set had better performance than B1 one. These observations were based after using cases with defined clinical diagnosis, ELISA, and conventional PCR. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

PubMed

Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

2011-04-28

The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

PubMed

Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

2012-01-01

An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

USGS Publications Warehouse

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Specific Detection of Clavibacter michiganensis subsp. sepedonicus by Amplification of Three Unique DNA Sequences Isolated by Subtraction Hybridization.

PubMed

Mills, D; Russell, B W; Hanus, J W

1997-08-01

ABSTRACT Three single-copy, unique DNA fragments, designated Cms50, Cms72, and Cms85, were isolated from strain CS3 of Clavibacter michiganensis subsp. sepedonicus by subtraction hybridization using driver DNA from C. michiganensis subsp. insidiosus, C. michiganensis subsp. michiganensis, and Rhodococcus facians. Radio-labeled probes made of these fragments and used in Southern blot analysis revealed each to be absolutely specific to all North American C. michiganensis subsp. sepedonicus strains tested, including plasmidless and nonmucoid strains. The probes have no homology with genomic DNA from related C. michiganensis subspecies insidiosus, michiganensis, and tessellarius, nor with DNA from 11 additional bacterial species and three unidentified strains, some of which have been previously reported to display cross-reactivity with C. michiganensis subsp. sepedonicus-specific antisera. The three fragments shared no homology, and they appeared to be separated from each other by at least 20 kbp in the CS3 genome. Internal primer sets permitted amplification of each fragment by the polymerase chain reaction (PCR) only from C. michiganensis subsp. sepedonicus DNA. In a PCR-based sensitivity assay using a primer set that amplifies Cms85, the lowest level of detection of C. michiganensis subsp. sepedonicus was 100 CFU per milliliter when cells were added to potato core fluid. Erroneous results that may arise from PCR artifacts and mutational events are, therefore, minimized by the redundancy of the primer sets, and the products should be verifiable with unique capture probes in sequence-based detection systems.

Quantification of Endospore-Forming Firmicutes by Quantitative PCR with the Functional Gene spo0A

PubMed Central

Bueche, Matthieu; Wunderlin, Tina; Roussel-Delif, Ludovic; Junier, Thomas; Sauvain, Loic; Jeanneret, Nicole

2013-01-01

Bacterial endospores are highly specialized cellular forms that allow endospore-forming Firmicutes (EFF) to tolerate harsh environmental conditions. EFF are considered ubiquitous in natural environments, in particular, those subjected to stress conditions. In addition to natural habitats, EFF are often the cause of contamination problems in anthropogenic environments, such as industrial production plants or hospitals. It is therefore desirable to assess their prevalence in environmental and industrial fields. To this end, a high-sensitivity detection method is still needed. The aim of this study was to develop and evaluate an approach based on quantitative PCR (qPCR). For this, the suitability of functional genes specific for and common to all EFF were evaluated. Seven genes were considered, but only spo0A was retained to identify conserved regions for qPCR primer design. An approach based on multivariate analysis was developed for primer design. Two primer sets were obtained and evaluated with 16 pure cultures, including representatives of the genera Bacillus, Paenibacillus, Brevibacillus, Geobacillus, Alicyclobacillus, Sulfobacillus, Clostridium, and Desulfotomaculum, as well as with environmental samples. The primer sets developed gave a reliable quantification when tested on laboratory strains, with the exception of Sulfobacillus and Desulfotomaculum. A test using sediment samples with a diverse EFF community also gave a reliable quantification compared to 16S rRNA gene pyrosequencing. A detection limit of about 104 cells (or spores) per gram of initial material was calculated, indicating this method has a promising potential for the detection of EFF over a wide range of applications. PMID:23811505

Hindering the illegal trade in dog and cat furs through a DNA-based protocol for species identification.

PubMed

Garofalo, Luisa; Mariacher, Alessia; Fanelli, Rita; Fico, Rosario; Lorenzini, Rita

2018-01-01

In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.

Characterization of polymorphic microsatellites for the invasive grass Microstegium vimineum (Poaceae).

PubMed

Novy, Ari; Flory, S Luke; Honig, Joshua A; Bonos, Stacy; Hartman, Jean Marie

2012-02-01

Microsatellite markers were developed for the invasive plant Microstegium vimineum (Poaceae) to assess its population structure and to facilitate tracking of invasion expansion. Using 454 sequencing, 11 polymorphic and six monomorphic microsatellite primer sets were developed for M. vimineum. The primer sets were tested on individuals sampled from six populations in the United States and China. The polymorphic primers amplified di-, tri-, and tetranucleotide repeats with three to 10 alleles per locus. These markers will be useful for a variety of applications including tracking of invasion dynamics and population genetics studies.

Validation and Application of a Real-time PCR Protocol for the Specific Detection and Quantification of Clavibacter michiganensis subsp. sepedonicus in Potato.

PubMed

Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk

2015-06-01

Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×10(2) copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10(-6) dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension.

Validation and Application of a Real-time PCR Protocol for the Specific Detection and Quantification of Clavibacter michiganensis subsp. sepedonicus in Potato

PubMed Central

Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk

2015-01-01

Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×102 copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10−6 dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension. PMID:26060431

Sebacinales are associates of the leafy liverwort Lophozia excisa in the southern maritime Antarctic.

PubMed

Newsham, Kevin K; Bridge, Paul D

2010-06-01

The leafy liverwort Lophozia excisa, which is colonised by basidiomycete fungi in other biomes and which evidence suggests may be colonised by mycorrhizal fungi in Antarctica, was sampled from Léonie Island in the southern maritime Antarctic (67 degrees 36' S, 68 degrees 21' W). Microscopic examination of plants indicated that fungal hyphae colonised 78% of the rhizoids of the liverwort, apparently by entering the tips of rhizoids prior to growing into their bases, where they formed hyphal coils. Extensive colonisation of stem medullary cells by hyphae was also observed. DNA was extracted from surface-sterilised liverwort tissues and sequenced following nested PCR, using the primer set ITS1F/TW14, followed by a second round of amplification using the ITSSeb3/TW13 primer set. Neighbour-joining analyses showed that the sequences obtained nested in Sebacinales clade B as a 100% supported sister group to Sebacinales sequences from the leafy liverworts Lophozia sudetica, L. incisa and Calypogeia muelleriana sampled from Europe. Direct PCR using the fungal specific primer set ITS1F/ITS4 similarly identified fungi belonging to Sebacinales clade B as the principal colonists of L. excisa tissues. These observations indicate the presence of a second mycothallus in Antarctica and support the previous suggestion that the Sebacinales has a wide geographical distribution.

Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

USDA-ARS?s Scientific Manuscript database

TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

PubMed

Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2017-02-01

Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment. Copyright © 2016 Elsevier B.V. All rights reserved.

A Hamiltonian approach to the planar optimization of mid-course corrections

NASA Astrophysics Data System (ADS)

Iorfida, E.; Palmer, P. L.; Roberts, M.

2016-04-01

Lawden's primer vector theory gives a set of necessary conditions that characterize the optimality of a transfer orbit, defined accordingly to the possibility of adding mid-course corrections. In this paper a novel approach is proposed where, through a polar coordinates transformation, the primer vector components decouple. Furthermore, the case when transfer, departure and arrival orbits are coplanar is analyzed using a Hamiltonian approach. This procedure leads to approximate analytic solutions for the in-plane components of the primer vector. Moreover, the solution for the circular transfer case is proven to be the Hill's solution. The novel procedure reduces the mathematical and computational complexity of the original case study. It is shown that the primer vector is independent of the semi-major axis of the transfer orbit. The case with a fixed transfer trajectory and variable initial and final thrust impulses is studied. The acquired related optimality maps are presented and analyzed and they express the likelihood of a set of trajectories to be optimal. Furthermore, it is presented which kind of requirements have to be fulfilled by a set of departure and arrival orbits to have the same profile of primer vector.

MethPrimer: designing primers for methylation PCRs.

PubMed

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

PubMed

Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

2015-07-01

Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

USDA-ARS?s Scientific Manuscript database

Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

Transferability of microsatellite markers of Capsicum annuum L. to C. frutescens L. and C. chinense Jacq.

PubMed

Carvalho, S I C; Ragassi, C F; Oliveira, I B; Amaral, Z P S; Reifschneider, F J B; Faleiro, F G; Buso, G S C

2015-07-17

In order to support further genetic, diversity, and phylogeny studies of Capsicum species, the transferability of a Capsicum annuum L. simple sequence repeat (SSR) microsatellite set was analyzed for C. frutescens L. ("malagueta" and "tabasco" peppers) and C. chinense Jacq. (smell peppers, among other types). A total of 185 SSR primers were evaluated in 12 accessions from 115 C. frutescens L. and 480 C. chinense Jacq, representing different types within each species. Transferability to C. frutescens L. and C. chinense Jacq. occurred for 116 primers (62.7%). Nineteen (16.37%) were polymorphic in C. frutescens L. and 36 (31.03%) in C. chinense Jacq., 17 of which were coincident and could be used to analyze samples obtained for the 2 species. Among these primers, CA49 showed a different amplitude range of alleles between the 2 species (130-132 base pairs for C. frutescens L. and 120-128 base pairs for C. chinense Jacq.), and could differentiate the species. A total of 55 alleles were identified among the 19 polymorphic SSR loci among accessions of C. frutescens L., with the number of alleles per locus ranging from 2 to 5, a mean of 2.89, and the polymorphic information content ranging from 0.30 to 0.65. The number of alleles identified in C. chinense Jacq. was 119, ranging from 2 to 5 alleles per locus, an average of 3.30, and polymorphic information content from 0.19 to 0.68. The C. annuum L. SSR primers were most often transfer-able and polymorphic for C. frutescens L. and C. chinense Jacq., and we present a set of SSR for each species.

Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

PubMed

Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

2017-07-01

Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

Alignment-Free Design of Highly Discriminatory Diagnostic Primer Sets for Escherichia coli O104:H4 Outbreak Strains

PubMed Central

Bielaszewska, Martina; Karch, Helge; Toth, Ian K.

2012-01-01

Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact. PMID:22496820

Development of PCR-based assays for detecting and differentiating three species of botrytis infecting broad bean

USDA-ARS?s Scientific Manuscript database

Botrytis cinerea, B. fabae and B. fabiopsis are known to cause chocolate spot on broad bean. This study was conducted to develop PCR-based assays to detect and differentiate this three species. Two sets of primers, Bc-f/Bc-r for B. cinerea and Bfab-f/Bfab-r for B. fabiopsis, were designed based on t...

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

46 CFR 160.024-3 - Materials, workmanship, construction, and performance requirements.

Code of Federal Regulations, 2011 CFR

2011-10-01

....29 mm (0.090 in.) and 2.67 mm (0.015 in.) in thickness. The centered primer shall be set below the surface of the base between 0.25 mm (0.010 in.) and 0.50 mm (0.020 in.). (d) Performance. Signals shall...

46 CFR 160.024-3 - Materials, workmanship, construction, and performance requirements.

Code of Federal Regulations, 2010 CFR

2010-10-01

....29 mm (0.090 in.) and 2.67 mm (0.015 in.) in thickness. The centered primer shall be set below the surface of the base between 0.25 mm (0.010 in.) and 0.50 mm (0.020 in.). (d) Performance. Signals shall...

Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

PubMed Central

Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

2013-01-01

We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

Multiprimer PCR system for differential identification of mycobacteria in clinical samples.

PubMed Central

Del Portillo, P; Thomas, M C; Martínez, E; Marañón, C; Valladares, B; Patarroyo, M E; Carlos López, M

1996-01-01

A novel multiprimer PCR method with the potential to identify mycobacteria in clinical samples is presented. The assay relies on the simultaneous amplification of three bacterial DNA genomic fragments by using different sets of oligonucleotide primers. The first set of primers amplifies a 506-bp fragment from the gene for the 32-kDa antigen of Mycobacterium tuberculosis, which is present in most of the species belonging to the genus Mycobacterium. The second set of primers amplifies a 984-bp fragment from the IS6110 insertion sequence of the bacteria belonging to the M. tuberculosis complex. The third set of primers, derived from an M. tuberculosis species-specific sequence named MTP40, amplifies a 396-bp genomic fragment. Thus, while the multiprimer system would render three amplification fragments from the M. tuberculosis genome and two fragments from the Mycobacterium bovis genome, a unique amplification fragment would be obtained from nontuberculous mycobacteria. The results obtained, using reference mycobacterial strains and typed clinical isolates, show that the multiprimer PCR method may be a rapid, sensitive, and specific tool for the differential identification of various mycobacterial strains in a single-step assay. PMID:8789008

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

PubMed

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

PubMed Central

2012-01-01

Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

PubMed Central

Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

2016-01-01

Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

Use of molecular techniques to evaluate the survival of a microorganism injected into an aquifer

USGS Publications Warehouse

Thiem, S.M.; Krumme, M.L.; Smith, R.L.; Tiedje, J.M.

1994-01-01

A PCR primer set and an internal probe that are specific for Pseudomonas sp. strain B13, a 3-chlorobenzoate-metabolizing strain, were developed. Using this primer set and probe, we were able to detect Pseudomonas sp. strain B13 DNA sequences in DNA extracted from aquifer samples 14.5 months after Pseudomonas sp. strain B13 had been injected into a sand and gravel aquifer. This primer set and probe were also used to analyze isolates from 3-chlorobenzoate enrichments of the aquifer samples by Southern blot analysis. Hybridization of Southern blots with the Pseudomonas sp. strain B13-specific probe and a catabolic probe in conjunction with restriction fragment length polymorphism (RFLP) analysis of ribosome genes was used to determine that viable Pseudomonas sp. strain B13 persisted in this environment. We isolated a new 3-chlorobenzoate-degrading strain from one of these enrichment cultures. The B13-specific probe does not hybridize to DNA from this isolate. The new strain could be the result of gene exchange between Pseudomonas sp. strain B13 and an indigenous bacterium. This speculation is based on an RFLP pattern of ribosome genes that differs from that of Pseudomonas sp. strain B13, the fact that identically sized restriction fragments hybridized to the catabolic gene probe, and the absence of any enrichable 3-chlorobenzoate-degrading strains in the aquifer prior to inoculation.

Improved PCR assay for the species-specific identification and quantitation of Legionella pneumophila in water.

PubMed

Cho, Min Seok; Ahn, Tae-Young; Joh, Kiseong; Lee, Eui Seok; Park, Dong Suk

2015-11-01

Legionellosis outbreak is a major global health care problem. However, current Legionella risk assessments may be compromised by uncertainties in Legionella detection methods, infectious dose, and strain infectivity. These limitations may place public health at significant risk, leading to significant monetary losses in health care. However, there are still unmet needs for its rapid identification and monitoring of legionellae in water systems. Therefore, in the present study, a primer set was designed based on a LysR-type transcriptional regulator (LTTR) family protein gene of Legionella pneumophila subsp. pneumophila str. Philadelphia 1 because it was found that this gene is structurally diverse among species through BLAST searches. The specificity of the primer set was evaluated using genomic DNA from 6 strains of L. pneumophila, 5 type strains of other related Legionella species, and other 29 reference pathogenic bacteria. The primer set used in the PCR assay amplified a 264-bp product for only targeted six strains of L. pneumophila. The assay was also able to detect at least 1.39 × 10(3) copies/μl of cloned amplified target DNA using purified DNA or 7.4 × 10(0) colony-forming unit per reaction when using calibrated cell suspension. In addition, the sensitivity and specificity of this assay were confirmed by successful detection of Legionella pneumophila in environmental water samples.

A simplified strategy for sensitive detection of Rose rosette virus compatible with three RT-PCR chemistries.

PubMed

Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M

2016-06-01

Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

PubMed

Smielewska-Loś, E

2003-01-01

Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

SYBR green-based real-time reverse transcription-PCR for typing and subtyping of all hemagglutinin and neuraminidase genes of avian influenza viruses and comparison to standard serological subtyping tests

USGS Publications Warehouse

Tsukamoto, K.; Javier, P.C.; Shishido, M.; Noguchi, D.; Pearce, J.; Kang, H.-M.; Jeong, O.M.; Lee, Y.-J.; Nakanishi, K.; Ashizawa, T.

2012-01-01

Continuing outbreaks of H5N1 highly pathogenic (HP) avian influenza virus (AIV) infections of wild birds and poultry worldwide emphasize the need for global surveillance of wild birds. To support the future surveillance activities, we developed a SYBR green-based, real-time reverse transcriptase PCR (rRT-PCR) for detecting nucleoprotein (NP) genes and subtyping 16 hemagglutinin (HA) and 9 neuraminidase (NA) genes simultaneously. Primers were improved by focusing on Eurasian or North American lineage genes; the number of mixed-base positions per primer was set to five or fewer, and the concentration of each primer set was optimized empirically. Also, 30 cycles of amplification of 1:10 dilutions of cDNAs from cultured viruses effectively reduced minor cross- or nonspecific reactions. Under these conditions, 346 HA and 345 NA genes of 349 AIVs were detected, with average sensitivities of NP, HA, and NA genes of 10 1.5, 10 2.3, and 10 3.1 50% egg infective doses, respectively. Utility of rRT-PCR for subtyping AIVs was compared with that of current standard serological tests by using 104 recent migratory duck virus isolates. As a result, all HA genes and 99% of the NA genes were genetically subtyped, while only 45% of HA genes and 74% of NA genes were serologically subtyped. Additionally, direct subtyping of AIVs in fecal samples was possible by 40 cycles of amplification: approximately 70% of HA and NA genes of NP gene-positive samples were successfully subtyped. This validation study indicates that rRT-PCR with optimized primers and reaction conditions is a powerful tool for subtyping varied AIVs in clinical and cultured samples. Copyright ?? 2012, American Society for Microbiology. All Rights Reserved.

PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

PubMed

Janczarek, Monika; Palusińska-Szysz, Marta

2016-05-01

Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

The development of loop-mediated isothermal amplification (LAMP) assays for the rapid authentication of five forbidden vegetables in strict vegetarian diets

PubMed Central

Lee, Meng-Shiou; Su, Ting-Ying; Lien, Yi-Yang; Sheu, Shyang-Chwen

2017-01-01

Plant-based food ingredients such as garlic, Chinese leek, Chinese onion, green onion and onion are widely used in many cuisines around the world. However, these ingredients known as the “five forbidden vegetables” (FFVs) are not allowed in some vegetarian diets. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of FFVs using five respective LAMP primer sets. The specific primers targeted the ITS1-5.8S-ITS2 nuclear ribosomal DNA sequence regions among the five vegetables. The results demonstrated that the identification of FFVs using the newly developed LAMP assay is more sensitive than the traditional PCR method. Using pepper, basil, parsley, chili and ginger as references, established LAMP primer sets showed high specificity for the identification of the FFV species. Moreover, when FFVs were mixed with other plant ingredients at different ratios (100:0, 50:50, 20:80, 10:90, 5:95, 2:98, and 1:99), no cross-reactivity was evident using LAMP. Finally, genomic DNAs extracted from boiled and steamed FFVs in processed foods were used as templates; the performance of the LAMP reaction was not influenced using validated LAMP primers. Not only can FFV ingredients be identified but commercial foods containing FFVs can also be authenticated. This LAMP method will be useful for the authentication of FFVs in practical food markets in the future. PMID:28290475

The development of loop-mediated isothermal amplification (LAMP) assays for the rapid authentication of five forbidden vegetables in strict vegetarian diets.

PubMed

Lee, Meng-Shiou; Su, Ting-Ying; Lien, Yi-Yang; Sheu, Shyang-Chwen

2017-03-14

Plant-based food ingredients such as garlic, Chinese leek, Chinese onion, green onion and onion are widely used in many cuisines around the world. However, these ingredients known as the "five forbidden vegetables" (FFVs) are not allowed in some vegetarian diets. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of FFVs using five respective LAMP primer sets. The specific primers targeted the ITS1-5.8S-ITS2 nuclear ribosomal DNA sequence regions among the five vegetables. The results demonstrated that the identification of FFVs using the newly developed LAMP assay is more sensitive than the traditional PCR method. Using pepper, basil, parsley, chili and ginger as references, established LAMP primer sets showed high specificity for the identification of the FFV species. Moreover, when FFVs were mixed with other plant ingredients at different ratios (100:0, 50:50, 20:80, 10:90, 5:95, 2:98, and 1:99), no cross-reactivity was evident using LAMP. Finally, genomic DNAs extracted from boiled and steamed FFVs in processed foods were used as templates; the performance of the LAMP reaction was not influenced using validated LAMP primers. Not only can FFV ingredients be identified but commercial foods containing FFVs can also be authenticated. This LAMP method will be useful for the authentication of FFVs in practical food markets in the future.

Assessment for Intervention: A Problem-Solving Approach

ERIC Educational Resources Information Center

Brown-Chidsey, Rachel, Ed.

2005-01-01

This cutting-edge volume offers a complete primer on conducting problem-solving based assessments in school or clinical settings. Presented are an effective framework and up-to-date tools for identifying and remediating the many environmental factors that may contribute to a student's academic, emotional, or behavioral difficulties, and for…

Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

USGS Publications Warehouse

Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

2007-01-01

The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

PubMed Central

Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

2015-01-01

The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

PubMed

Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

2008-08-01

A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

PubMed Central

Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

2005-01-01

Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

PubMed Central

2004-01-01

With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests that they are adequate for a three-base-pair alphabet for DNA replication. PMID:15078225

ABACAS: algorithm-based automatic contiguation of assembled sequences

PubMed Central

Assefa, Samuel; Keane, Thomas M.; Otto, Thomas D.; Newbold, Chris; Berriman, Matthew

2009-01-01

Summary: Due to the availability of new sequencing technologies, we are now increasingly interested in sequencing closely related strains of existing finished genomes. Recently a number of de novo and mapping-based assemblers have been developed to produce high quality draft genomes from new sequencing technology reads. New tools are necessary to take contigs from a draft assembly through to a fully contiguated genome sequence. ABACAS is intended as a tool to rapidly contiguate (align, order, orientate), visualize and design primers to close gaps on shotgun assembled contigs based on a reference sequence. The input to ABACAS is a set of contigs which will be aligned to the reference genome, ordered and orientated, visualized in the ACT comparative browser, and optimal primer sequences are automatically generated. Availability and Implementation: ABACAS is implemented in Perl and is freely available for download from http://abacas.sourceforge.net Contact: sa4@sanger.ac.uk PMID:19497936

Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

PubMed

Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

2014-01-01

Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

PubMed Central

Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

2018-01-01

MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

Influenza Risk Management: Lessons Learned from an A(H1N1) pdm09 Outbreak Investigation in an Operational Military Setting

DTIC Science & Technology

2013-07-10

of the virus in Spain was detected during an outbreak investigation of influenza -like illness (ILI) in soldiers from an engineering military academy...SwInfA primer and probe set) and specific A(H1N1) pdm09 influenza A viruses using SwH1 primer and probe set developed by CDC, Atlanta (WHO...CY062374, CY062375 and CY062376. Viral culture Influenza viruses were isolated from clinical samples by infecting Madin Darby Canine Kidney (MDCK

A new rapid methodological strategy to assess BRCA mutational status.

PubMed

Vuttariello, Emilia; Borra, Marco; Calise, Celeste; Mauriello, Elvira; Greggi, Stefano; Vecchione, Aldo; Biffali, Elio; Chiappetta, Gennaro

2013-07-01

Hereditary cancers account for approximately 10 % of breast and ovarian cancers. Mutations of the BRCA1 and BRCA2 genes, encoding two proteins involved in DNA repair, underlie most cases of such hereditary cancers. Women with BRCA mutations develop breast cancer in 50-80 % of cases and ovarian cancer in 10-40 % of cases. Assessing BRCA mutational status is needed to direct the clinical management of women with predisposition to these hereditary cancers. However, BRCA screening constitutes a bottleneck in terms of costs and time to deliver results. We developed a PCR-based assay using 73 primer pairs covering the entire coding regions of BRCA1 and BRCA2. PCR primers, containing at the 5' end the universal M13 primer sequences, were pre-spotted in 96-well plates. Following PCR, direct sequencing was performed using M13 primers, allowing to standardize the conditions. PCR amplification and sequencing were successful for each amplicon. We tested and validated the assay on 10 known gDNAs from patients with Hereditary breast and ovarian cancer (HBOC). Our strategy is a promising time and cost-effective method to detect BRCA mutations in the clinical setting, which is essential to formulate a personalized therapy for patients with HBOC.

PCR detection of uncultured rumen bacteria.

PubMed

Rosero, Jaime A; Strosová, Lenka; Mrázek, Jakub; Fliegerová, Kateřina; Kopečný, Jan

2012-07-01

16S rRNA sequences of ruminal uncultured bacterial clones from public databases were phylogenetically examined. The sequences were found to form two unique clusters not affiliated with any known bacterial species: cluster of unidentified sequences of free floating rumen fluid uncultured bacteria (FUB) and cluster of unidentified sequences of bacteria associated with rumen epithelium (AUB). A set of PCR primers targeting 16S rRNA of ruminal free uncultured bacteria and rumen epithelium adhering uncultured bacteria was designed based on these sequences. FUB primers were used for relative quantification of uncultured bacteria in ovine rumen samples. The effort to increase the population size of FUB group has been successful in sulfate reducing broth and culture media supplied with cellulose.

PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

PubMed

Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

2017-01-24

The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

PubMed

Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

2007-04-10

To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

PubMed

Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

2015-07-01

Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes.

PubMed

Treder, Krzysztof; Chołuj, Joanna; Zacharzewska, Bogumiła; Babujee, Lavanya; Mielczarek, Mateusz; Burzyński, Adam; Rakotondrafara, Aurélie M

2018-02-01

Potato virus Y (PVY) infection has been a global challenge for potato production and the leading cause of downgrading and rejection of seed crops for certification. Accurate and timely diagnosis is a key for effective disease control. Here, we have optimized a reverse transcription loop-mediated amplification (RT-LAMP) assay to differentiate the PVY O and N serotypes. The RT-LAMP assay is based on isothermal autocyclic strand displacement during DNA synthesis. The high specificity of this method relies heavily on the primer sets designed for the amplification of the targeted regions. We designed specific primer sets targeting a region within the coat protein gene that contains nucleotide signatures typical for O and N coat protein types, and these primers differ in their annealing temperature. Combining this assay with total RNA extraction by magnetic capture, we have established a highly sensitive, simplified and shortened RT-LAMP procedure as an alternative to conventional nucleic acid assays for diagnosis. This optimized procedure for virus detection may be used as a preliminary test for identifying the viral serotype prior to investing time and effort in multiplex RT-PCR tests when a specific strain is needed.

Evaluation of the PCR method for identification of Bifidobacterium species.

PubMed

Youn, S Y; Seo, J M; Ji, G E

2008-01-01

Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

PubMed

Wang, Deguo; Liu, Yanhong

2015-05-26

Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

NASA Astrophysics Data System (ADS)

Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

2015-12-01

Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

PubMed Central

Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

2013-01-01

Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

A PCR-Based Diagnostic System for Differentiating Two Weevil Species (Coleoptera: Curculionidae) of Economic Importance to the Chilean Citrus Industry.

PubMed

Aguirre, C; Olivares, N; Luppichini, P; Hinrichsen, P

2015-02-01

A PCR-based method was developed to identify Naupactus cervinus (Boheman) and Naupactus xanthographus (Germar), two curculionids affecting the citrus industry in Chile. The quarantine status of these two species depends on the country to which fruits are exported. This identification method was developed because it is not possible to discriminate between these two species at the egg stage. The method is based on the species-specific amplification of sequences of internal transcribed spacers, for which we cloned and sequenced these genome fragments from each species. We designed an identification system based on two duplex-PCR reactions. Each one contains the species-specific primer set and a second generic primer set that amplify a short 18S region common to coleopterans, to avoid false negatives. The marker system is able to differentiate each Naupactus species at any life stage, and with a diagnostic sensitivity to 0.045 ng of genomic DNA. This PCR kit was validated by samples collected from different citrus production areas throughout Chile and showed 100% accuracy in differentiating the two Naupactus species. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowman, Stephen M

2008-09-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.

PubMed

Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun

2007-10-01

Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.

Novel 16S rDNA primers revealed the diversity and habitats-related community structure of sphingomonads in 10 different niches.

PubMed

Huang, Yili; Feng, Hao; Lu, Hang; Zeng, Yanhua

2017-07-01

It is believed that sphingomonads are ubiquitously distributed in environments. However detailed information about their community structure and their co-relationship with environmental parameters remain unclear. In this study, novel sphingomonads-specific primers based on the 16S rRNA gene were designed to investigate the distribution of sphingomonads in 10 different niches. Both in silico and in-practice tests on pure cultures and environmental samples showed that Sph384f/Sph701r was an efficient primer set. Illumina MiSeq sequencing revealed that community structures of sphingomonads were significantly different among the 10 samples, although 12 sphingomonad genera were present in all samples. Based on RDA analysis and Monte Carlo permutation test, sphingomonad community structure was significantly correlated with limnetic and marine habitat types. Among these niches, the genus Sphingomicrobium showed strong positive correlation with marine habitats, whereas genera Sphingobium, Novosphingobium, Sphingopyxis, and Sphingorhabdus showed strong positive correlation with limnetic habitats. Our study provided direct evidence that sphingomonads are ubiquitously distributed in environments, and revealed for the first time that their community structure can be correlated with habitats.

Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

PubMed

Makeyev, E V; Bamford, D H

2001-05-01

Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

A TaqMan real-time PCR-based assay for the identification of Fasciola spp.

PubMed

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-30

Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.

Universal primers for amplification of the complete mitochondrial control region in marine fish species.

PubMed

Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

2012-01-01

Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

One-step reverse transcription loop mediated isothermal amplification assay for detection of Apple chlorotic leaf spot virus

USDA-ARS?s Scientific Manuscript database

A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the detection of Apple chlorotic leaf spot virus (ACLSV) was developed. In this method, a set of four primers was designed based on the conserved regions in the coat protein gene of ACLSV, and was synthesized for the ...

A new diagnostic real-time PCR method for huanglongbing detection in citrus root tissue

USDA-ARS?s Scientific Manuscript database

Citrus fibrous root tissue was evaluated as an alternative source material for Huanglongbing (HLB) diagnosis by real-time PCR using primer-probe set TXCChlb, developed in the present study based on 16S rDNA of “Candidatus Liberibacter asiaticus” (CLas). Real-time PCR data obtained with DNA samples p...

Application of the multiplex PCR method for discrimination of Artemisia iwayomogi from other Artemisia herbs.

PubMed

Lee, Mi Young; Doh, Eui Jeong; Kim, Eung Soo; Kim, Young Wha; Ko, Byong Seob; Oh, Seung-Eun

2008-04-01

Some plants classified in the genus Artemisia are used for medicinal purposes. In particular, A. iwayomogi, which is referred to as 'Haninjin,' is used as an important medicinal material in traditional Korean medicine. However, A. capillaris, and both A. argyi and A. princeps, referred to as 'Injinho' and 'Aeyup,' respectively, are used for purposes other than those for which 'Haninjin' is utilized. However, it is occasionally difficult to differentiate 'Haninjin' from 'Injinho' and/or 'Aeyup' on the basis of their morphological features, particularly when in the dried and/or sliced form. Therefore, the development of a reliable method by which to discriminate 'Haninjin' from other Artemisia herbs, especially 'Injinho' and 'Aeyup,' is clearly necessary. We recently determined that the RAPD (random amplified polymorphic DNA) technique can be used to discriminate efficiently between some Artemisia herbs. In particular, when applied to RAPD, the non-specific UBC primer 391 (5'-GCG AAC CTC G-3') was demonstrated to amplify PCR products specific to A. iwayomogi. Based on the nucleotide sequences of the PCR product, we designed a 2F1 (5'-ACC TCG GAC CTA AAT ACA-3')/ 2F3 (5'-TTA TGA TTC ATG TTC AAT TC-3') primer set to amplify a SCAR (sequence-characterized amplified region) marker of A. iwayomogi. Employing this primer set, along with two other primer sets amplifying SCAR markers of 'Aeyup' (A. argyi and A. princeps) and both 'Injinho' (A. capillaris) and A. japonica, which are classified into the same subgroup in a phenogram constructed from RAPD analysis, we developed a multiplex PCR method by which A. iwayomogi could be discriminated with certainty from other Artemisia herbs. Via this method, we determined not only whether the tested Artemisia herb was A. iwayomogi, but also which Artemisia herbs were tested concurrently with A. iwayomogi.

Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

PubMed Central

2012-01-01

Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

Fast-Acting Rubber-To-Coated-Aluminum Adhesive

NASA Technical Reports Server (NTRS)

Comer, Dawn A.; Novak, Howard; Vazquez, Mark

1991-01-01

Cyanoacrylate adhesive used to join rubber to coated aluminum easier to apply and more effective. One-part material applied in single coat to aluminum treated previously with epoxy primer and top coat. Parts mated as soon as adhesive applied; no drying necessary. Sets in 5 minutes. Optionally, accelerator brushed onto aluminum to reduce setting time to 30 seconds. Clamping parts together unnecessary. Adhesive comes in four formulations, all based on ethyl cyanoacrylate with various amounts of ethylene copolymer rubber, poly(methyl methacrylate), silicon dioxide, hydroquinone, and phthalic anhydride.

Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

PubMed

Vela, J; Vitorica, J; Ruano, D

2001-12-01

We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

Genetic diversity of Iranian honey bee (Apis mellifera meda Skorikow, 1829) populations based on ISSR markers.

PubMed

Rahimi, A; Mirmoayedi, A; Kahrizi, D; Zarei, L; Jamali, S

2016-04-30

Honey bee is one of the most important insects considering its role in agriculture,ecology and economy as a whole. In this study, the genetic diversity of different Iranian honey bee populations was evaluated using inter simple sequence repeat (ISSR) markers. During May to September 2014, 108 young worker honey bees were collected from six different populations in 30 different geoclimatic locations from Golestan, Mazendaran, Guilan, West Azerbaijan, East Azerbaijan, Ardebil provinces of Iran. DNA was extracted from the worker honey bees. The quality and quantity of extracted DNA were measured. A set of ten primers were screened with the laboratory populations of honey bees. The number of fragments produced in the different honey bee populations varied from 3 to 10, varying within 150 to 1500 bp. The used ten ISSR primers generated 40 polymorphic fragments, and the average heterozygosity for each primer was 0.266. Maximum numbers of bands were recorded for primer A1. A dendrogram based on the Unweighted Pair Group Method with Arithmetic mean (UPGMA) method generated two sub-clusters. Honey bee populations of Golestan, Mazendaran, Guilan provinces were located in the first group. The second group included honey bee populations of Ardebil, West Azerbaijan, East Azerbaijan provinces, but this group showed a close relationship with other populations. The results showed obviously the ability of the ISSR marker technique to detect the genetic diversity among the honey bee populations.

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

PubMed Central

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

2006-01-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

PubMed

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

2006-07-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

DOE PAGES

Yoon, Hyejin; Leitner, Thomas

2014-12-17

Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

Review of "A School Privatization Primer for Michigan School Officials, Media and Residents"

ERIC Educational Resources Information Center

Belfield, Clive

2008-01-01

Issued by the Mackinac Center for Public Policy, "A School Privatization Primer for Michigan School Officials, Media and Residents" examines the "contracting out" of public school support services--specifically food, transportation, and custodial services. The report describes the prevalence of contracting out and sets forth…

Primers As Socializing Agents in American and Finnish Schools.

ERIC Educational Resources Information Center

Hyona, Jukka; And Others

1995-01-01

Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

PubMed

Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

2016-07-01

This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step.

An alternative nested-PCR assay for the detection of Toxoplasma gondii strains based on GRA7 gene sequences.

PubMed

Costa, Maria Eduarda S M; Oliveira, Claudio Bruno S; Andrade, Joelma Maria de A; Medeiros, Thatiany A; Neto, Valter F Andrade; Lanza, Daniel C F

2016-07-01

Toxoplasma gondii is a widespread parasite able to infect virtually any nucleated cells of warm-blooded hosts. In some cases, T. gondii detection using already developed PCR primers can be inefficient in routine laboratory tests, especially to detect atypical strains. Here we report a new nested-PCR protocol able to detect virtually all T. gondii isolates. Analyzing 685 sequences available in GenBank, we determine that GRA7 is one of the most conserved genes of T. gondii genome. Based on an alignment of 85 GRA7 sequences new primer sets that anneal in the highly conserved regions of this gene were designed. The new GRA7 nested-PCR assay providing sensitivity and specificity equal to or greater than the gold standard PCR assays for T. gondii detection, that amplify the B1 sequence or the repetitive 529bp element. Copyright © 2016 Elsevier B.V. All rights reserved.

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

UniPrime2: a web service providing easier Universal Primer design.

PubMed

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

PubMed

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

Standardized molecular diagnostic tool for the identification of cryptic species within the Bemisia tabaci complex.

PubMed

Elfekih, Samia; Tay, Wee Tek; Gordon, Karl; Court, Leon N; De Barro, Paul J

2018-01-01

The whitefly Bemisia tabaci complex harbours over 40 cryptic species that have been placed in 11 phylogenetically distinct clades based on the molecular characterization of partial mitochondrial DNA COI (mtCOI) gene region. Four cryptic species are currently within the invasive clade, i.e. MED, MEAM1, MEAM2 and IO. Correct identification of these species is a critical step towards implementing reliable measures for plant biosecurity and border protection; however, no standardized B. tabaci-specific primers are currently available which has caused inconsistencies in the species identification processes. We report three sets of polymerase chain reaction (PCR) primers developed to amplify the mtCOI region which can be used for genotyping MED, MEAM1 and IO species, and tested these primers on 91 MED, 35 MEAM1 and five IO individuals. PCR and sequencing of amplicons identified a total of 21, six and one haplotypes in MED, MEAM1 and IO respectively, of which six haplotypes were new to the B. tabaci database. These primer pairs enabled standardization and robust molecular species identification via mtCOI screening of the targeted invasive cryptic species and will improve quarantine decisions. Use of this diagnostic tool could be extended to other species within the complex. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification.

PubMed

Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun

2015-07-08

We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.

Use of a Hierarchical Oligonucleotide Primer Extension Approach for Multiplexed Relative Abundance Analysis of Methanogens in Anaerobic Digestion Systems

PubMed Central

Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu

2013-01-01

In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716

One-Tube-Only Standardized Site-Directed Mutagenesis: An Alternative Approach to Generate Amino Acid Substitution Collections

PubMed Central

Mingo, Janire; Erramuzpe, Asier; Luna, Sandra; Aurtenetxe, Olaia; Amo, Laura; Diez, Ibai; Schepens, Jan T. G.; Hendriks, Wiljan J. A. J.; Cortés, Jesús M.; Pulido, Rafael

2016-01-01

Site-directed mutagenesis (SDM) is a powerful tool to create defined collections of protein variants for experimental and clinical purposes, but effectiveness is compromised when a large number of mutations is required. We present here a one-tube-only standardized SDM approach that generates comprehensive collections of amino acid substitution variants, including scanning- and single site-multiple mutations. The approach combines unified mutagenic primer design with the mixing of multiple distinct primer pairs and/or plasmid templates to increase the yield of a single inverse-PCR mutagenesis reaction. Also, a user-friendly program for automatic design of standardized primers for Ala-scanning mutagenesis is made available. Experimental results were compared with a modeling approach together with stochastic simulation data. For single site-multiple mutagenesis purposes and for simultaneous mutagenesis in different plasmid backgrounds, combination of primer sets and/or plasmid templates in a single reaction tube yielded the distinct mutations in a stochastic fashion. For scanning mutagenesis, we found that a combination of overlapping primer sets in a single PCR reaction allowed the yield of different individual mutations, although this yield did not necessarily follow a stochastic trend. Double mutants were generated when the overlap of primer pairs was below 60%. Our results illustrate that one-tube-only SDM effectively reduces the number of reactions required in large-scale mutagenesis strategies, facilitating the generation of comprehensive collections of protein variants suitable for functional analysis. PMID:27548698

Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.

Pathotypic characterization of Newcastle disease virus isolated from vaccinated chicken in West Java, Indonesia.

PubMed

Putri, Dwi Desmiyeni; Handharyani, Ekowati; Soejoedono, Retno Damajanti; Setiyono, Agus; Mayasari, Ni Luh Putu Ika; Poetri, Okti Nadia

2017-04-01

This research was conducted to differentiate and characterize eight Newcastle disease virus (NDV) isolates collected from vaccinated chicken at commercial flocks in West Java, Indonesia, in 2011, 2014 and 2015 by pathotype specific primers. A total of eight NDV isolates collected from clinical outbreaks among commercial vaccinated flocks in West Java, Indonesia, in 2011, 2014, and 2015 were used in this study. Reverse transcription-polymerase chain reaction was used to detect and differentiate virulence of NDV strains, using three sets of primers targeting their M and F gene. First primers were universal primers to detect NDV targeting matrix (M) gene. Other two sets of primers were specific for the fusion (F) gene cleavage site sequence of virulent and avirulent NDV strains. Our results showed that three isolates belong to NDV virulent strains, and other five isolates belong to NDV avirulent strains. The nucleotide sequence of the F protein cleavage site showed 112 K/R-R-Q/R-K-R/G-F 117 on NDV virulent strains and 112 G-K/R-Q-G-R-L 117 on NDV avirulent strain. Result from the current study suggested that NDV virulent strain were circulating among vaccinated chickens in West Java, Indonesia; this might possess a risk of causing ND outbreaks and causing economic losses within the poultry industry.

Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

PubMed

Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

2016-04-15

In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

PubMed

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Initialization of Formation Flying Using Primer Vector Theory

NASA Technical Reports Server (NTRS)

Mailhe, Laurie; Schiff, Conrad; Folta, David

2002-01-01

In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

Assessing the performance of a Loop Mediated Isothermal Amplification (LAMP) assay for the detection and subtyping of high-risk suptypes of Human Papilloma Virus (HPV) for Oropharyngeal Squamous Cell Carcinoma (OPSCC) without DNA purification.

PubMed

Rohatensky, Mitchell G; Livingstone, Devon M; Mintchev, Paul; Barnes, Heather K; Nakoneshny, Steven C; Demetrick, Douglas J; Dort, Joseph C; van Marle, Guido

2018-02-08

Oropharyngeal Squamous Cell Carcinoma (OPSCC) is increasing in incidence despite a decline in traditional risk factors. Human Papilloma Virus (HPV), specifically subtypes 16, 18, 31 and 35, has been implicated as the high-risk etiologic agent. HPV positive cancers have a significantly better prognosis than HPV negative cancers of comparable stage, and may benefit from different treatment regimens. Currently, HPV related carcinogenesis is established indirectly through Immunohistochemistry (IHC) staining for p16, a tumour suppressor gene, or polymerase chain reaction (PCR) that directly tests for HPV DNA in biopsied tissue. Loop mediated isothermal amplification (LAMP) is more accurate than IHC, more rapid than PCR and is significantly less costly. In previous work we showed that a subtype specific HPV LAMP assay performed similar to PCR on purified DNA. In this study we examined the performance of this LAMP assay without DNA purification. We used LAMP assays using established primers for HPV 16 and 18, and new primers for HPV 31 and 35. LAMP reaction conditions were tested on serial dilutions of plasmid HPV DNA to confirm minimum viral copy number detection thresholds. LAMP was then performed directly on different human cell line samples without DNA purification. Our LAMP assays could detect 10 5 , 10 3 , 10 4 , and 10 5 copies of plasmid DNA for HPV 16, 18, 31, and 35, respectively. All primer sets were subtype specific, with no cross-amplification. Our LAMP assays also reliably amplified subtype specific HPV DNA from samples without requiring DNA isolation and purification. The high risk OPSCC HPV subtype specific LAMP primer sets demonstrated, excellent clinically relevant, minimum copy number detection thresholds with an easy readout system. Amplification directly from samples without purification illustrated the robust nature of the assay, and the primers used. This lends further support HPV type specific LAMP assays, and these specific primer sets and assays can be further developed to test for HPV in OPSCC in resource and lab limited settings, or even bedside testing.

Detection of spring viraemia of carp virus (SVCV) by loop-mediated isothermal amplification (LAMP) in koi carp, Cyprinus carpio L

USGS Publications Warehouse

Shivappa, R.B.; Savan, R.; Kono, T.; Sakai, M.; Emmenegger, E.; Kurath, G.; Levine, Jay F.

2008-01-01

Spring viraemia of carp virus (SVCV) is a rhabdovirus associated with systemic illness and mortality in cyprinids. Several diagnostic tests are available for detection of SVCV. However, most of these tests are time consuming and are not well adapted for field-based diagnostics. In this study, a diagnostic tool for SVCV detection based on reverse transcription loop-mediated isothermal amplification (RT-LAMP) has been developed. Based on the nucleotide sequence of the glycoprotein (G) gene of SVCV North Carolina (NC) isolate, four sets (each set containing two outer and two inner) of primers were designed. Temperature and time conditions were optimized to 65 ??C and 60 min, respectively, for LAMP and RT-LAMP using one primer set. In vitro specificity was evaluated using four different strains of fish rhabdoviruses and RT-LAMP was found to be specific to SVCV. Serial dilutions of SVCV NC isolate was used to evaluate the in vitro sensitivity of RT-LAMP. Sensitivity of the assays was similar to RT-PCR and detected SVCV even at the lowest dilution of 10 1 TCID50 mL-1. The ability of RT-LAMP to detect SVCV from infected carp was also tested and the assay detected SVCV from all infected fish. The isothermal temperature requirements, high specificity and sensitivity, and short incubation time of the RT-LAMP assay make it an excellent choice as a field diagnostic test for SVCV. ?? 2008 The Authors.

Improving qPCR methodology for detection of foaming bacteria by analysis of broad-spectrum primers and a highly specific probe for quantification of Nocardia spp. in activated sludge.

PubMed

Asvapathanagul, P; Olson, B H

2017-01-01

To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.

Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

USDA-ARS?s Scientific Manuscript database

Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

Primer vector theory and applications

NASA Technical Reports Server (NTRS)

Jezewski, D. J.

1975-01-01

A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

PubMed Central

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-01-01

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

GSP: A web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

Primer3_masker: integrating masking of template sequence with primer design software.

PubMed

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

Detection of Bacillus spores using PCR and FTA filters.

PubMed

Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

2004-05-01

Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

A novel non-sequencing approach for rapid authentication of Testudinis Carapax et Plastrum and Trionycis Carapax by species-specific primers

PubMed Central

Yu, Pingtian; Lu, Yi; Jiao, Zhaoqun; Chen, Liqun; Zhou, Ying; Shen, Yuping; Jia, Xiaobin

2018-01-01

A novel non-sequencing approach was developed to detect short DNA fragments (ca 100 bp) for rapid authentication of two natural products, namely Testudinis Carapax et Plastrum and Trionycis Carapax, based on the difference in mitochondrial genome. Five specifically designed primer reactions were established to target species for reliable identification of their commercial products. They were confirmed to have a high level of inter-species-specificity and good intra-species stability. The limit of detection was estimated to be 1 ng of genomes for all of five assays. Also, the validation results demonstrated that the raw materials and processed products in addition to some of the highly processed products can be conveniently authenticated with good sensitivity and precision by this newly proposed approach. Especially, when reference sample mixtures were assayed, these primer sets have still performed well but not the prevailing COI barcoding technology. These could assist in the discrimination and identification of other animal-derived medicines for their form of raw material, the pulverized and the complex. PMID:29765667

Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

PubMed Central

Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

2013-01-01

The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

Development of Genomic Microsatellite Markers in Carthamus tinctorius L. (Safflower) Using Next Generation Sequencing and Assessment of Their Cross-Species Transferability and Utility for Diversity Analysis

PubMed Central

Variath, Murali Tottekkad; Joshi, Gopal; Bali, Sapinder; Agarwal, Manu; Kumar, Amar; Jagannath, Arun; Goel, Shailendra

2015-01-01

Background Safflower (Carthamus tinctorius L.), an Asteraceae member, yields high quality edible oil rich in unsaturated fatty acids and is resilient to dry conditions. The crop holds tremendous potential for improvement through concerted molecular breeding programs due to the availability of significant genetic and phenotypic diversity. Genomic resources that could facilitate such breeding programs remain largely underdeveloped in the crop. The present study was initiated to develop a large set of novel microsatellite markers for safflower using next generation sequencing. Principal Findings Low throughput genome sequencing of safflower was performed using Illumina paired end technology providing ~3.5X coverage of the genome. Analysis of sequencing data allowed identification of 23,067 regions harboring perfect microsatellite loci. The safflower genome was found to be rich in dinucleotide repeats followed by tri-, tetra-, penta- and hexa-nucleotides. Primer pairs were designed for 5,716 novel microsatellite sequences with repeat length ≥ 20 bases and optimal flanking regions. A subset of 325 microsatellite loci was tested for amplification, of which 294 loci produced robust amplification. The validated primers were used for assessment of 23 safflower accessions belonging to diverse agro-climatic zones of the world leading to identification of 93 polymorphic primers (31.6%). The numbers of observed alleles at each locus ranged from two to four and mean polymorphism information content was found to be 0.3075. The polymorphic primers were tested for cross-species transferability on nine wild relatives of cultivated safflower. All primers except one showed amplification in at least two wild species while 25 primers amplified across all the nine species. The UPGMA dendrogram clustered C. tinctorius accessions and wild species separately into two major groups. The proposed progenitor species of safflower, C. oxyacantha and C. palaestinus were genetically closer to cultivated safflower and formed a distinct cluster. The cluster analysis also distinguished diploid and tetraploid wild species of safflower. Conclusion Next generation sequencing of safflower genome generated a large set of microsatellite markers. The novel markers developed in this study will add to the existing repertoire of markers and can be used for diversity analysis, synteny studies, construction of linkage maps and marker-assisted selection. PMID:26287743

Development of loop-mediated isothermal amplification with Plasmodium falciparum unique genes for molecular diagnosis of human malaria.

PubMed

Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian

2017-07-01

In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a promising tool for diagnosis of P. falciparum infection.

Development and Validation of Broad-Range Qualitative and Clade-Specific Quantitative Molecular Probes for Assessing Mercury Methylation in the Environment.

PubMed

Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A

2016-10-01

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.

FindGDPs: fast identification of primers for labeling microbial transcriptomes for DNA microarray analysis

PubMed Central

Blick, Robert J.; Revel, Andrew T.; Hansen, Eric J.

2008-01-01

Summary FindGDPs is a program that uses a greedy algorithm to quickly identify a set of genome-directed primers that specifically anneal to all of the open reading frames in a genome and that do not exhibit full-length complementarity to the members of another user-supplied set of nucleotide sequences. Availability The program code is distributed under the GNU General Public License at http://www8.utsouthwestern.edu/utsw/cda/dept131456/files/159331.html Contact eric.hansen@utsouthwestern.edu PMID:15593406

A review of the prevalence, utility, and caveats of using chloroplast simple sequence repeats for studies of plant biology1

PubMed Central

Wheeler, Gregory L.; Dorman, Hanna E.; Buchanan, Alenda; Challagundla, Lavanya; Wallace, Lisa E.

2014-01-01

Microsatellites occur in all plant genomes and provide useful markers for studies of genetic diversity and structure. Chloroplast microsatellites (cpSSRs) are frequently targeted because they are more easily isolated than nuclear microsatellites. Here, we quantified the frequency and uses of cpSSRs based on a literature review of over 400 studies published 1995–2013. These markers are an important and economical tool for plant biologists and continue to be used alongside modern genomics approaches to study genetic diversity and structure, evolutionary history, and hybridization in native and agricultural species. Studies using species-specific primers reported a greater number of polymorphic loci than those employing universal primers. A major disadvantage to cpSSRs is fragment size homoplasy; therefore, we documented its occurrence at several cpSSR loci within and between species of Acmispon (Fabaceae). Based on our empirical data set, we recommend targeted sequencing of a subset of samples combined with fragment genotyping as a cost-efficient, data-rich approach to the use of cpSSRs and as a test of homoplasy. The availability of genomic resources for plants aids in the development of primers for new study systems, thereby enhancing the utility of cpSSRs across plant biology. PMID:25506520

Exploring target-specific primer extension in combination with a bead-based suspension array for multiplexed detection and typing using Streptococcus suis as a model pathogen

PubMed Central

van der Wal, Fimme J.; Achterberg, René P.; van Solt-Smits, Conny; Bergervoet, Jan H. W.; de Weerdt, Marjanne; Wisselink, Henk J.

2017-01-01

We investigated the feasibility of an assay based on target-specific primer extension, combined with a suspension array, for the multiplexed detection and typing of a veterinary pathogen in animal samples, using Streptococcus suis as a model pathogen. A procedure was established for simultaneous detection of 6 S. suis targets in pig tonsil samples (i.e., 4 genes associated with serotype 1, 2, 7, or 9, the generic S. suis glutamate dehydrogenase gene [gdh], and the gene encoding the extracellular protein factor [epf]). The procedure was set up as a combination of protocols: DNA isolation from porcine tonsils, a multiplex PCR, a multiplex target-specific primer extension, and finally a suspension array as the readout. The resulting assay was compared with a panel of conventional PCR assays. The proposed multiplex assay can correctly identify the serotype of isolates and is capable of simultaneous detection of multiple targets in porcine tonsillar samples. The assay is not as sensitive as the current conventional PCR assays, but with the correct sampling strategy, the assay can be useful for screening pig herds to establish which S. suis serotypes are circulating in a pig population. PMID:28980519

Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing.

PubMed

Li, Yong; Zhang, Weirui

2015-10-01

Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker-assisted breeding.

Introducing a primer for career development and promotion: succeeding as a psychologist in an academic health center.

PubMed

Christophersen, Edward; Butt, Zeeshan

2012-12-01

Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.

Priming cases disturb visual search patterns in screening mammography

NASA Astrophysics Data System (ADS)

Lewis, Sarah J.; Reed, Warren M.; Tan, Alvin N. K.; Brennan, Patrick C.; Lee, Warwick; Mello-Thoms, Claudia

2015-03-01

Rationale and Objectives: To investigate the effect of inserting obvious cancers into a screening set of mammograms on the visual search of radiologists. Previous research presents conflicting evidence as to the impact of priming in scenarios where prevalence is naturally low, such as in screening mammography. Materials and Methods: An observer performance and eye position analysis study was performed. Four expert breast radiologists were asked to interpret two sets of 40 screening mammograms. The Control Set contained 36 normal and 4 malignant cases (located at case # 9, 14, 25 and 37). The Primed Set contained the same 34 normal and 4 malignant cases (in the same location) plus 2 "primer" malignant cases replacing 2 normal cases (located at positions #20 and 34). Primer cases were defined as lower difficulty cases containing salient malignant features inserted before cases of greater difficulty. Results: Wilcoxon Signed Rank Test indicated no significant differences in sensitivity or specificity between the two sets (P > 0.05). The fixation count in the malignant cases (#25, 37) in the Primed Set after viewing the primer cases (#20, 34) decreased significantly (Z = -2.330, P = 0.020). False-Negatives errors were mostly due to sampling in the Primed Set (75%) in contrast to in the Control Set (25%). Conclusion: The overall performance of radiologists is not affected by the inclusion of obvious cancer cases. However, changes in visual search behavior, as measured by eye-position recording, suggests visual disturbance by the inclusion of priming cases in screening mammography.

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR

PubMed Central

Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

PubMed

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-11-16

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

High resolution melting (HRM) analysis as a new tool for rapid identification of Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum.

PubMed

Ren, Xingxing; Fu, Ying; Xu, Chenggang; Feng, Zhou; Li, Miao; Zhang, Lina; Zhang, Jianmin; Liao, Ming

2017-05-01

Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum represent the most common causative agents of chicken salmonellosis, which result in high mortality and morbidity throughout the world. It is difficult and laborious to discriminate these diseases based on biochemical or phenotypic methods. Herein, we report the development of a single nucleotide polymorphism (SNP) PCR-high resolution melt (PCR-HRM) assay for the detection and discrimination of both S. Pullorum and S. Gallinarun. The gene rfbS, which encodes a factor involved in the biosynthesis of ADP paratose in serogroup D of Salmonella, has been identified as a robust genetic marker for the identification of S. Pullorum and S. Gallinarun based on polymorphisms at positions 237 and 598. Therefore, PCR-HRM analyses were used to characterize this gene. A total of 15 reference and 33 clinical isolates of Salmonella and related Gram-negative bacteria were detected using 2 sets of primers. Our PCR-HRM assay could distinguish S. Pullorum from S. Gallinarun and other strains using the primer pair SP-237F/237R. Similarly, S. Gallinarun could be distinguished from S. Pullorum and other strains using primer set SG-598F/598R. These 2 assays showed high specificity (100%) for both S. Pullorum and S. Gallinarun; the sensitivity of these 2 assays was at least 100-fold greater than that of the allele-specific PCR assay. This present study demonstrated that HRM analysis represents a potent, simple, and economic tool for the rapid, specific, and sensitive detection of S. Pullorum and S. Gallinarun. Our approach also may aid efforts for purification of Avian Salmonella disease. © 2016 Poultry Science Association Inc.

High-throughput gender identification of penguin species using melting curve analysis.

PubMed

Tseng, Chao-Neng; Chang, Yung-Ting; Chiu, Hui-Tzu; Chou, Yii-Cheng; Huang, Hurng-Wern; Cheng, Chien-Chung; Liao, Ming-Hui; Chang, Hsueh-Wei

2014-04-03

Most species of penguins are sexual monomorphic and therefore it is difficult to visually identify their genders for monitoring population stability in terms of sex ratio analysis. In this study, we evaluated the suitability using melting curve analysis (MCA) for high-throughput gender identification of penguins. Preliminary test indicated that the Griffiths's P2/P8 primers were not suitable for MCA analysis. Based on sequence alignment of Chromo-Helicase-DNA binding protein (CHD)-W and CHD-Z genes from four species of penguins (Pygoscelis papua, Aptenodytes patagonicus, Spheniscus magellanicus, and Eudyptes chrysocome), we redesigned forward primers for the CHD-W/CHD-Z-common region (PGU-ZW2) and the CHD-W-specific region (PGU-W2) to be used in combination with the reverse Griffiths's P2 primer. When tested with P. papua samples, PCR using P2/PGU-ZW2 and P2/PGU-W2 primer sets generated two amplicons of 148- and 356-bp, respectively, which were easily resolved in 1.5% agarose gels. MCA analysis indicated the melting temperature (Tm) values for P2/PGU-ZW2 and P2/PGU-W2 amplicons of P. papua samples were 79.75°C-80.5°C and 81.0°C-81.5°C, respectively. Females displayed both ZW-common and W-specific Tm peaks, whereas male was positive only for ZW-common peak. Taken together, our redesigned primers coupled with MCA analysis allows precise high throughput gender identification for P. papua, and potentially for other penguin species such as A. patagonicus, S. magellanicus, and E. chrysocome as well.

PRISE2: software for designing sequence-selective PCR primers and probes.

PubMed

Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

2014-09-25

PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

Comparison of PCR primer-based strategies for characterization of ammonia oxidizer communities in environmental samples.

PubMed

Mahmood, Shahid; Freitag, Thomas E; Prosser, James I

2006-06-01

PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

Identification of hallucinogenic fungi from the genera Psilocybe and Panaeolus by amplified fragment length polymorphism.

PubMed

Lee, J C; Cole, M; Linacre, A

2000-05-01

Unambiguous identification of the hallucinogenic fungi of the genera Psilocybe and Panaeolus is required by national and international drug control legislation. We report on a DNA-based test using the technique of amplified fragment length polymorphism (AFLP). AFLP can differentiate species of the two genera Psilocybe and Panaeolus by using different primer sets. The identification of hallucinogenic fungi using a DNA-based test, which can be used in conjunction with morphological features, will assist in forensic investigations.

Implementation of Novel Design Features for qPCR-Based eDNA Assessment

PubMed Central

Veldhoen, Nik; Hobbs, Jared; Ikonomou, Georgios; Hii, Michael; Lesperance, Mary; Helbing, Caren C.

2016-01-01

Environmental stewardship requires timely, accurate information related to the status of a given ecosystem and the species that occupy it. Recent advances in the application of the highly sensitive real-time quantitative polymerase chain reaction (qPCR) towards identification of constituents within environmental DNA (eDNA) now allow targeted detection of the presence of species-specific biological material within a localized geographic region. However, as with all molecular techniques predicated on the specificity and sensitivity of the PCR assay, careful validation of each eDNA qPCR assay in development must be performed both under controlled laboratory conditions and when challenged with field-derived eDNA samples. Such a step-wise approach forms the basis for incorporation of innovative qPCR design features that strengthen the implementation and interpretation of the eDNA assay. This includes empirical determination that the qPCR assay is refractory to the presence of human DNA and the use of a tripartite assay approach comprised of 1) a primer set targeting plant chloroplast that evaluates the presence of amplifiable DNA from field samples to increase confidence in a negative result, 2) an animal group primer set to increase confidence in the assay result, and 3) a species-specific primer set to assess presence of DNA from the target species. To demonstrate this methodology, we generated eDNA assays specific for the North American bullfrog (Lithobates (Rana) catesbeiana) and the Rocky Mountain tailed frog (Ascaphus montanus) and characterized each with respect to detection sensitivity and specificity with demonstrated performance in a field survey scenario. The qPCR design features presented herein address specific challenges of eDNA assays thereby increasing their interpretative power. PMID:27802293

Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

PubMed

Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

2008-01-01

Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory compliance.

Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

PubMed

Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

2018-01-01

Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

PubMed

Chen, Huaihai; Yu, Fangbo; Shi, Wei

2016-12-01

Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

PubMed

Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

1996-04-15

A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

Newly developed primers for complete YCF1 amplification in Pinus (Pinaceae) chloroplasts with possible family-wide utility

Treesearch

Matthew Parks; Aaron Liston; Rich Cronn

2011-01-01

Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...

Simple sequence repeat marker loci discovery using SSR primer.

PubMed

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing1

PubMed Central

Li, Yong; Zhang, Weirui

2015-01-01

Premise of the study: Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Methods and Results: Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. Conclusions: This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding. PMID:26504683

A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

PubMed

Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

2012-06-01

The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

An isothermal based recombinase polymerase amplification assay for rapid, sensitive and robust indexing of citrus yellow mosaic virus.

PubMed

Kumar, P V; Sharma, S K; Rishi, N; Ghosh, D K; Baranwal, V K

Management of viral diseases relies on definite and sensitive detection methods. Citrus yellow mosaic virus (CYMV), a double stranded DNA virus of the genus Badnavirus, causes yellow mosaic disease in citrus plants. CYMV is transmitted through budwood and requires a robust and simplified indexing protocol for budwood certification programme. The present study reports development and standardization of an isothermal based recombinase polymerase amplification (RPA) assay for a sensitive, rapid, easy, and cost-effective method for detection and diagnosis of CYMV. Two different oligonucleotide primer sets were designed from ORF III (coding for polyprotein) and ORF II (coding for virion associated protein) regions of CYMV to perform amplification assays. Comparative evaluation of RPA, PCR and immuno-capture recombinase polymerase amplification (IC-RPA) based assays were done using purified DNA and plant crude sap. CYMV infection was efficiently detected from the crude sap in RPA and IC-RPA assays. The primer set used in RPA was specific and did not show any cross-amplification with banana streak MY virus (BSMYV), another Badnavirus species. The results from the present study indicated that RPA assay can be used easily in routine indexing of citrus planting material. To the best of our knowledge, this is the first report on development of a rapid and simplified isothermal detection assay for CYMV and can be utilized as an effective technique in quarantine and budwood certification process.

A New Single-Step PCR Assay for the Detection of the Zoonotic Malaria Parasite Plasmodium knowlesi

PubMed Central

Lucchi, Naomi W.; Poorak, Mitra; Oberstaller, Jenna; DeBarry, Jeremy; Srinivasamoorthy, Ganesh; Goldman, Ira; Xayavong, Maniphet; da Silva, Alexandre J.; Peterson, David S.; Barnwell, John W.; Kissinger, Jessica; Udhayakumar, Venkatachalam

2012-01-01

Background Recent studies in Southeast Asia have demonstrated substantial zoonotic transmission of Plasmodium knowlesi to humans. Microscopically, P. knowlesi exhibits several stage-dependent morphological similarities to P. malariae and P. falciparum. These similarities often lead to misdiagnosis of P. knowlesi as either P. malariae or P. falciparum and PCR-based molecular diagnostic tests are required to accurately detect P. knowlesi in humans. The most commonly used PCR test has been found to give false positive results, especially with a proportion of P. vivax isolates. To address the need for more sensitive and specific diagnostic tests for the accurate diagnosis of P. knowlesi, we report development of a new single-step PCR assay that uses novel genomic targets to accurately detect this infection. Methodology and Significant Findings We have developed a bioinformatics approach to search the available malaria parasite genome database for the identification of suitable DNA sequences relevant for molecular diagnostic tests. Using this approach, we have identified multi-copy DNA sequences distributed in the P. knowlesi genome. We designed and tested several novel primers specific to new target sequences in a single-tube, non-nested PCR assay and identified one set of primers that accurately detects P. knowlesi. We show that this primer set has 100% specificity for the detection of P. knowlesi using three different strains (Nuri, H, and Hackeri), and one human case of malaria caused by P. knowlesi. This test did not show cross reactivity with any of the four human malaria parasite species including 11 different strains of P. vivax as well as 5 additional species of simian malaria parasites. Conclusions The new PCR assay based on novel P. knowlesi genomic sequence targets was able to accurately detect P. knowlesi. Additional laboratory and field-based testing of this assay will be necessary to further validate its utility for clinical diagnosis of P. knowlesi. PMID:22363751

Novel Approach on the Optimisation of Mid-Course Corrections Along Interplanetary Trajectories

NASA Astrophysics Data System (ADS)

Iorfida, Elisabetta; Palmer, Phil; Roberts, Mark

The primer vector theory, firstly proposed by Lawden, defines a set of necessary conditions to characterise whether an impulsive thrust trajectory is optimal with respect to propellant usage, within a two-body problem context. If the conditions are not satisfied, one or more potential intermediate impulses are performed along the transfer arc, in order to lower the overall cost. The method is based on the propagation of the state transition matrix and on the solution of a boundary value problem, which leads to a mathematical and computational complexity.In this paper, a different approach is introduced. It is based on a polar coordinates transformation of the primer vector which allows the decoupling between its in-plane and out-of-plane components. The out-of-plane component is solved analytically while for the in-plane ones a Hamiltonian approximation is made.The novel procedure reduces the mathematical complexity and the computational cost of Lawden's problem and gives also a different perspective about the optimisation of a transfer trajectory.

Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

PubMed

Glais, Laurent; Jacquot, Emmanuel

2015-01-01

Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay.

White primer permits a corrosion-resistant coating of minimum weight

NASA Technical Reports Server (NTRS)

Albrecht, R. H.; Jensen, D. P.; Schnake, P.

1966-01-01

White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

Primer Modification Improves Rapid and Sensitive In Vitro and Field-Deployable Assays for Detection of High Plains Virus Variants

PubMed Central

Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.

2014-01-01

A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, H.U.G.; Gray, J.W.

1995-06-27

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, Heinz-Ulrich G.; Gray, Joe W.

1995-01-01

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

Development of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae.

PubMed

Liu, Hailan; Guo, Xiaoqin; Wu, Jiasheng; Chen, Guo-Bo; Ying, Yeqing

2013-03-01

KEY MESSAGE : We develop a set of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae. Being evolutionary conserved, single-copy orthologous (COSII) genes are particularly useful in comparative mapping and phylogenetic investigation among species. In this study, we identified 2,684 COSII genes based on five sequenced Poaceae genomes including rice, maize, sorghum, foxtail millet, and brachypodium, and then developed 1,072 COSII markers whose transferability and polymorphism among five bamboo species were further evaluated with 46 pairs of randomly selected primers. 91.3 % of the 46 primers obtained clear amplification in at least one bamboo species, and 65.2 % of them produced polymorphism in more than one species. We also used 42 of them to construct the phylogeny for the five bamboo species, and it might reflect more precise evolutionary relationship than the one based on the vegetative morphology. The results indicated a promising prospect of applying these markers to the investigation of genetic diversity and the classification of Poaceae. To ease and facilitate access of the information of common interest to readers, a web-based database of the COSII markers is provided ( http://www.sicau.edu.cn/web/yms/PCOSWeb/PCOS.html ).

Information theory-based algorithm for in silico prediction of PCR products with whole genomic sequences as templates.

PubMed

Cao, Youfang; Wang, Lianjie; Xu, Kexue; Kou, Chunhai; Zhang, Yulei; Wei, Guifang; He, Junjian; Wang, Yunfang; Zhao, Liping

2005-07-26

A new algorithm for assessing similarity between primer and template has been developed based on the hypothesis that annealing of primer to template is an information transfer process. Primer sequence is converted to a vector of the full potential hydrogen numbers (3 for G or C, 2 for A or T), while template sequence is converted to a vector of the actual hydrogen bond numbers formed after primer annealing. The former is considered as source information and the latter destination information. An information coefficient is calculated as a measure for fidelity of this information transfer process and thus a measure of similarity between primer and potential annealing site on template. Successful prediction of PCR products from whole genomic sequences with a computer program based on the algorithm demonstrated the potential of this new algorithm in areas like in silico PCR and gene finding.

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

PubMed

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

PubMed

Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

2004-09-01

Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

Identification of duck plague virus by polymerase chain reaction.

PubMed

Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

1999-01-01

A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

Development of internal COI primers to improve and extend barcoding of fruit flies (Diptera: Tephritidae: Dacini).

PubMed

Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K

2018-06-06

Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

PubMed

Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

2009-08-01

Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

Detection of Helicobacter pylori DNA in inflamed dental pulp specimens from Japanese children and adolescents.

PubMed

Ogaya, Yuko; Nomura, Ryota; Watanabe, Yoshiyuki; Nakano, Kazuhiko

2015-01-01

The oral cavity has been implicated as a source of Helicobacter pylori infection in childhood. Various PCR methods have been used to detect H. pylori DNA in oral specimens with various detection rates reported. Such disparity in detection rates complicates the estimation of the true infection rate of H. pylori in the oral cavity. In the present study, we constructed a novel PCR system for H. pylori detection and used it to analyse oral specimens. Firstly, the nucleotide alignments of genes commonly used for H. pylori detection were compared using the complete genome information for 48 strains registered in the GenBank database. Candidate primer sets with an estimated amplification size of approximately 300-400 bp were selected, and the specificity and sensitivity of the detection system using each primer set were evaluated. Five sets of primers targeting ureA were considered appropriate, of which a single primer set was chosen for inclusion in the PCR system. The sensitivity of the system was considered appropriate and its detection limit established as one to ten cells per reaction. The novel PCR system was used to examine H. pylori distribution in oral specimens (40 inflamed pulp tissues, 40 saliva samples) collected from Japanese children, adolescents and young adults. PCR analysis revealed that the detection rate of H. pylori in inflamed pulp was 15 %, whereas no positive reaction was found in any of the saliva specimens. Taken together, our novel PCR system was found to be reliable for detecting H. pylori. The results obtained showed that H. pylori was detected in inflamed pulp but not saliva specimens, indicating that an infected root canal may be a reservoir for H. pylori. © 2015 The Authors.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

PubMed

Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus"

PubMed Central

Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016

Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

NASA Astrophysics Data System (ADS)

Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

2017-02-01

There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.

PubMed

Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung

2016-06-01

Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.

Development of Cross-Assembly Phage PCR-Based Methods ...

EPA Pesticide Factsheets

Technologies that can characterize human fecal pollution in environmental waters offer many advantages over traditional general indicator approaches. However, many human-associated methods cross-react with non-human animal sources and lack suitable sensitivity for fecal source identification applications. The genome of a newly discovered bacteriophage (~97 kbp), the Cross-Assembly phage or “crAssphage”, assembled from a human gut metagenome DNA sequence library is predicted to be both highly abundant and predominately occur in human feces suggesting that this double stranded DNA virus may be an ideal human fecal pollution indicator. We report the development of two human-associated crAssphage endpoint PCR methods (crAss056 and crAss064). A shotgun strategy was employed where 384 candidate primers were designed to cover ~41 kbp of the crAssphage genome deemed favorable for method development based on a series of bioinformatics analyses. Candidate primers were subjected to three rounds of testing to evaluate assay optimization, specificity, limit of detection (LOD95), geographic variability, and performance in environmental water samples. The top two performing candidate primer sets exhibited 100% specificity (n = 70 individual samples from 8 different animal species), >90% sensitivity (n = 10 raw sewage samples from different geographic locations), LOD95 of 0.01 ng/µL of total DNA per reaction, and successfully detected human fecal pollution in impaired envi

Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

PubMed

López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

2003-01-01

ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

Development of a quantitative fluorescence single primer isothermal amplification-based method for the detection of Salmonella.

PubMed

Wang, Jianchang; Li, Rui; Hu, Lianxia; Sun, Xiaoxia; Wang, Jinfeng; Li, Jing

2016-02-16

Food-borne disease caused by Salmonella has long been, and continues to be, an important global public health problem, necessitating rapid and accurate detection of Salmonella in food. Real time PCR is the most recently developed approach for Salmonella detection. Single primer isothermal amplification (SPIA), a novel gene amplification technique, has emerged as an attractive microbiological testing method. SPIA is performed under a constant temperature, eliminating the need for an expensive thermo-cycler. In addition, SPIA reactions can be accomplished in 30 min, faster than real time PCR that usually takes over 2h. We developed a quantitative fluorescence SPIA-based method for the detection of Salmonella. Using Salmonella Typhimurium genomic DNA as template and a primer targeting Salmonella invA gene, we showed the detection limit of SPIA was 2.0 × 10(1)fg DNA. Its successful amplification of different serotypic Salmonella genomic DNA but not non-Salmonella bacterial DNA demonstrated the specificity of SPIA. Furthermore, this method was validated with artificially contaminated beef. In conclusion, we showed high sensitivity and specificity of SPIA in the detection of Salmonella, comparable to real time PCR. In addition, SPIA is faster and more cost-effective (non-use of expensive cyclers), making it a potential alternative for field detection of Salmonella in resource-limited settings that are commonly encountered in developing countries. Copyright © 2015 Elsevier B.V. All rights reserved.

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

PubMed

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Prevalence and diversity of Hepatozoon canis in naturally infected dogs in Japanese islands and peninsulas.

PubMed

El-Dakhly, Khaled Mohamed; Goto, Minami; Noishiki, Kaori; El-Nahass, El-Shaymaa; Hirata, Akihiro; Sakai, Hiroki; Takashima, Yasuhiro; El-Morsey, Ahmed; Yanai, Tokuma

2013-09-01

Canine hepatozoonosis is a worldwide protozoal disease caused by Hepatozoon canis and Hepatozoon americanum and is transmitted by ixodid ticks, Rhipicephalus and Amblyomma spp., respectively. H. canis infection is widespread in Africa, Europe, South America, and Asia, including Japan. The objective of this study was to study the distribution pattern and diversity of H. canis in naturally infected dogs in nine Japanese islands and peninsulas. Therefore, 196 hunting dogs were randomly sampled during the period from March to September 2011 and the ages and sexes were identified. Direct microscopy using Giemsa-stained blood smears revealed H. canis gametocytes in the peripheral blood of 45 (23.6%) dogs. Polymerase chain reaction (PCR) was performed on EDTA-anticoagulated blood, initially with the common primer set (B18S-F and B18S-R) amplifying the 1,665-bp portion of the 18S rRNA gene, and then with the specific primer set (HepF and HepR) amplifying about 660 bp fragments of the same gene. Based on PCR, 84 (42.9%) dogs were positive using the common primer and 81 (41.3%) were positive using the specific primer. The current investigation indicated that all screened areas, except for Sado Island and Atsumi Peninsula, were infected. Yaku Island had the highest infection rate (84.6% in males and 100.0% in females), while Ishigaki Island showed the lowest infection rates (8.3% in males and 17.7% in females). Both sexes were infected with no significant difference. However, diversity of infection among the surveyed islands and peninsulas was significantly different (P < 0.05). Although H. canis has previously been reported in dogs in Japan, the higher infection rate described in the current study and the diversity of infection in a wide range of islands strongly encourage prospective studies dealing with the prevention and treatment of the infection in dogs, as well as control of ticks.

Detection of Naegleria Species in Environmental Samples from Peninsular Malaysia

PubMed Central

Ithoi, Init; Ahmad, Arine Fadzlun; Nissapatorn, Veeranoot; Lau, Yee Ling; Mahmud, Rohela; Mak, Joon Wah

2011-01-01

Background In Malaysia, researchers and medical practitioners are unfamiliar with Naegleria infections. Thus little is known about the existence of pathogenic Naegleria fowleri, and the resultant primary amoebic meningoencephalitis (PAM) is seldom included in the differential diagnosis of central nervous system infections. This study was conducted to detect the presence of Naegleria species in various environmental samples. Methods/Findings A total of 41 Naegleria-like isolates were isolated from water and dust samples. All these isolates were subjected to PCR using two primer sets designed from the ITS1-ITS2 regions. The N. fowleri species-specific primer set failed to produce the expected amplicon. The Naegleria genus-specific primers produced amplicons of 408 bp (35), 450 bp (2), 457 bp (2) or 381 bp (2) from all 41 isolates isolated from aquatic (33) and dust (8) samples. Analysis of the sequences from 10 representative isolates revealed that amplicons with fragments 408, 450 and 457 bp showed homology with non-pathogenic Naegleria species, and 381 bp showed homology with Vahlkampfia species. These results concurred with the morphological observation that all 39 isolates which exhibited flagella were Naegleria, while 2 isolates (AC7, JN034055 and AC8, JN034056) that did not exhibit flagella were Vahlkampfia species. Conclusion To date, pathogenic species of N. fowleri have not been isolated from Malaysia. All 39 isolates that produced amplicons (408, 450 and 457 bp) from the genus-specific primers were identified as being similar to nonpathogenic Naegleria. Amplicon 408 bp from 5 representative isolates showed 100% and 99.7% identity to Naegleria philippinensis isolate RJTM (AM167890) and is thus believed to be the most common species in our environment. Amplicons 450 bp and 457 bp were respectively believed to be from 2 new species of Naegleria, since representative isolates showed lower homology and had a longer base pair length when compared to the reference species in the Genbank, Naegleria schusteri (AJ566626) and Naegleria laresi (AJ566630), respectively. PMID:21915311

PCR detection of psychrophilic Clostridium spp. causing 'blown pack' spoilage of vacuum-packed chilled meats.

PubMed

Broda, D M; Boerema, J A; Bell, R G

2003-01-01

To develop a practical molecular procedure that directly, without isolation, and specifically detects the presence of clostridia which cause 'blown pack' spoilage of vacuum-packed meat. Primer sets and PCR amplification procedures were developed that detect the presence of 16S rDNA gene and/or 16S-23S rDNA internal transcribed spacer fragments of 'blown pack' causing clostridia in meat. The specificity of the developed procedures was evaluated with DNA obtained from close phylogenetic neighbours of 'blown pack' causing clostridia, food clostridia and common meat spoilage microorganisms. The sensitivity of detection was assessed in non-enriched and low-temperature-enriched beef mince inoculated with serially diluted pure cultures of Clostridium estertheticum DSMZ 8809T and Cl. gasigenes DB1AT. The efficacy of detection procedures was evaluated for naturally contaminated vacuum-packed meat samples. Three primer sets, 16SE, 16SDB and EISR, produced amplicons of the expected size with DNA templates from target clostridia, but failed to yield PCR products with DNAs from any other microorganisms tested. With 16SE and 16SDB primers, minimum levels of detection were 104 CFU g(-1) for non-enriched, and 102 CFU g(-1) for enriched meat samples. Based on the established specificity of these primers, as well as DNA sequencing of amplicons, Cl. gasigenes was confirmed as the causative agent of 'blown pack' spoilage in two packs, and Cl. estertheticum as the causative agent in the third. The developed method can be used for rapid detection of 'blown pack' causing clostridia in commercial blown packs, or following low temperature enrichment, for detection of these microorganisms in meat containing as few as 100 clostridial cells per gram. The paper reports practical procedures that can be used for rapid confirmation of the causative agents of clostridial 'blown pack' spoilage in commercial spoiled packs, or for detection of psychrophilic clostridia in epidemiological trace back of 'blown pack' spoilage incidents in meat processing plants.

A New Primer to Amplify pmoA Gene From NC10 Bacteria in the Sediments of Dongchang Lake and Dongping Lake.

PubMed

Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu

2017-08-01

Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.

The significance of gtf genes in caries expression: a rapid identification of Streptococcus mutans from dental plaque of child patients.

PubMed

Mishra, Apurva; Pandey, Ramesh K; Manickam, Natesan

2015-01-01

Rapid phylogenetic and functional gene (gtfB) identification of S. mutans from the dental plaque derived from children. Dental plaque collected from fifteen patients of age group 7-12 underwent centrifugation followed by genomic DNA extraction for S. mutans. Genomic DNA was processed with S. mutans specific primers in suitable PCR condtions for phylogenetic and functional gene (gtfB) identification. The yield and results were confirmed by agarose gel electrophoresis. 1% agarose gel electrophoresis depicts the positive PCR amplification at 1,485 bp when compared with standard 1 kbp indicating the presence of S. mutans in the test sample. Another PCR reaction was set using gtfB primers specific for S. mutans for functional gene identification. 1.2% agarose gel electrophoresis was done and a positive amplication was observed at 192 bp when compared to 100 bp standards. With the advancement in molecular biology techniques, PCR based identification and quantification of the bacterial load can be done within hours using species-specific primers and DNA probes. Thus, this technique may reduce the laboratory time spend in conventional culture methods, reduces the possibility of colony identification errors and is more sensitive to culture techniques.

Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

PubMed Central

Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

2006-01-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

PubMed

Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

2006-12-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

PubMed

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

High-utility conserved avian microsatellite markers enable parentage and population studies across a wide range of species

PubMed Central

2013-01-01

Background Microsatellites are widely used for many genetic studies. In contrast to single nucleotide polymorphism (SNP) and genotyping-by-sequencing methods, they are readily typed in samples of low DNA quality/concentration (e.g. museum/non-invasive samples), and enable the quick, cheap identification of species, hybrids, clones and ploidy. Microsatellites also have the highest cross-species utility of all types of markers used for genotyping, but, despite this, when isolated from a single species, only a relatively small proportion will be of utility. Marker development of any type requires skill and time. The availability of sufficient “off-the-shelf” markers that are suitable for genotyping a wide range of species would not only save resources but also uniquely enable new comparisons of diversity among taxa at the same set of loci. No other marker types are capable of enabling this. We therefore developed a set of avian microsatellite markers with enhanced cross-species utility. Results We selected highly-conserved sequences with a high number of repeat units in both of two genetically distant species. Twenty-four primer sets were designed from homologous sequences that possessed at least eight repeat units in both the zebra finch (Taeniopygia guttata) and chicken (Gallus gallus). Each primer sequence was a complete match to zebra finch and, after accounting for degenerate bases, at least 86% similar to chicken. We assessed primer-set utility by genotyping individuals belonging to eight passerine and four non-passerine species. The majority of the new Conserved Avian Microsatellite (CAM) markers amplified in all 12 species tested (on average, 94% in passerines and 95% in non-passerines). This new marker set is of especially high utility in passerines, with a mean 68% of loci polymorphic per species, compared with 42% in non-passerine species. Conclusions When combined with previously described conserved loci, this new set of conserved markers will not only reduce the necessity and expense of microsatellite isolation for a wide range of genetic studies, including avian parentage and population analyses, but will also now enable comparisons of genetic diversity among different species (and populations) at the same set of loci, with no or reduced bias. Finally, the approach used here can be applied to other taxa in which appropriate genome sequences are available. PMID:23497230

Multiplex detection of agricultural pathogens

DOEpatents

Siezak, Thomas R.; Gardner, Shea; Torres, Clinton; Vitalis, Elizabeth; Lenhoff, Raymond J.

2013-01-15

Described are kits and methods useful for detection of agricultural pathogens in a sample. Genomic sequence information from agricultural pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay and/or an array assay to successfully identify the presence or absence of pathogens in a sample.

[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

PubMed

Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

2013-10-18

To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

Assay Design Affects the Interpretation of T-Cell Receptor Gamma Gene Rearrangements

PubMed Central

Cushman-Vokoun, Allison M.; Connealy, Solomon; Greiner, Timothy C.

2010-01-01

Interpretation of capillary electrophoresis results derived from multiplexed fluorochrome-labeled primer sets can be complicated by small peaks, which may be incorrectly interpreted as clonal T-cell receptor-γ gene rearrangements. In this report, different assay designs were used to illustrate how design may adversely affect specificity. Ten clinical cases, with subclonal peaks containing one of the two infrequently used joining genes, were identified with a tri-color, one-tube assay. The DNA was amplified with the same NED fluorochrome on all three joining primers, first combined (one-color assay) and then amplified separately using a single NED-labeled joining primer. The single primer assay design shows how insignificant peaks could easily be wrongly interpreted as clonal T-cell receptor-γ gene rearrangements. Next, the performance of the one-tube assay was compared with the two-tube BIOMED-2-based TCRG Gene Clonality Assay in a series of 44 cases. Whereas sensitivity was similar between the two methods (92.9% vs. 96.4%; P = 0.55), specificity was significantly less in the BIOMED-2 assay (87.5% vs. 56.3%; P = 0.049) when a 2× ratio was used to define clonality. Specificity was improved to 81.3% by the use of a 5× peak height ratio (P = 0.626). These findings illustrate how extra caution is needed in interpreting a design with multiple, separate distributions, which is more difficult to interpret than a single distribution assay. PMID:20959612

Competitor internal standards for quantitative detection of mycoplasma DNA.

PubMed

Sidhu, M K; Rashidbaigi, A; Testa, D; Liao, M J

1995-05-01

Homologous internal controls were used as competitor DNA in the polymerase chain reaction for the quantitative detection of mycoplasma DNA. PCR primer sets were designed on the basis of the most conserved nucleotide sequences of the 16S rRNA gene of mycoplasma species. Amplification of this gene was examined in five different mycoplasma species: Mycoplasma orale, M. hyorhinus, M. synoviae, M. gallisepticum and M. pneumoniae. To evaluate the primers, a number of different cell lines were assayed for the detection of mycoplasma infections. All positive cell lines showed a distinct product on agarose gels while uninfected cells showed no DNA amplification. Neither bacterial nor eukaryotic DNA produced any cross-reaction with the primers used, thus confirming their specificity. Internal control DNA to be used for quantitation was constructed by modifying the sizes of the wild-type amplified products and cloning them in plasmid vectors. These controls used the same primer binding sites as the wild-type and the amplified products were differentiated by a size difference. The detection limits for all the mycoplasma species by competitive quantitative PCR were estimated to range from 4 to 60 genome copies per assay as determined by ethidium bromide-stained agarose gels. These internal standards also serve as positive controls in PCR-based detection of mycoplasma DNA, and therefore accidental contamination of test samples with wild-type positive controls can be eliminated. The quantitative PCR method developed will be useful in monitoring the progression and significance of mycoplasma in the disease process.

Quenching of Unincorporated Amplification Signal Reporters in Reverse-Transcription Loop-Mediated Isothermal Amplification Enabling Bright, Single-Step, Closed-Tube, and Multiplexed Detection of RNA Viruses.

PubMed

Ball, Cameron S; Light, Yooli K; Koh, Chung-Yan; Wheeler, Sarah S; Coffey, Lark L; Meagher, Robert J

2016-04-05

Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of the reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read "quasar"), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). Furthermore, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.

A multiplex PCR-based method to identify strongylid parasite larvae recovered from ovine faecal cultures and/or pasture samples.

PubMed

Bisset, S A; Knight, J S; Bouchet, C L G

2014-02-24

A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.

A set of plastid loci for use in multiplex fragment length genotyping for intraspecific variation in Pinus (Pinaceae)1

PubMed Central

Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann

2014-01-01

• Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625

Development of loop-mediated isothermal amplification (LAMP) assays for the rapid detection of allergic peanut in processed food.

PubMed

Sheu, Shyang-Chwen; Tsou, Po-Chuan; Lien, Yi-Yang; Lee, Meng-Shiou

2018-08-15

Peanut is a widely and common used in many cuisines around the world. However, peanut is also one of the most important food allergen for causing anaphylactic reaction. To prevent allergic reaction, the best way is to avoid the food allergen or food containing allergic ingredient such as peanut before food consuming. Thus, to efficient and precisely detect the allergic ingredient, peanut or related product, is essential and required for maintain consumer's health or their interest. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of allergic peanut using specifically designed primer sets. Two sets of the specific LAMP primers respectively targeted the internal transcribed sequence 1 (ITS1) of nuclear ribosomal DNA sequence regions and the ara h1 gene sequence of Arachia hypogeae (peanut) were used to address the application of LAMP for detecting peanut in processed food or diet. The results demonstrated that the identification of peanut using the newly designed primers for ITS 1 sequence is more sensitive rather than primers for sequence of Ara h1 gene when performing LAMP assay. Besides, the sensitivity of LAMP for detecting peanut is also higher than the traditional PCR method. These LAMP primers sets showed high specificity for the identification of the peanut and had no cross-reaction to other species of nut including walnut, hazelnut, almonds, cashew and macadamia nut. Moreover, when minimal 0.1% peanuts were mixed with other nuts ingredients at different ratios, no any cross-reactivity was evident during performing LAMP. Finally, genomic DNAs extracted from boiled and steamed peanut were used as templates; the detection of peanut by LAMP was not affected and reproducible. As to this established LAMP herein, not only can peanut ingredients be detected but commercial foods containing peanut can also be identified. This assay will be useful and potential for the rapid detection of peanut in practical food markets. Copyright © 2018 Elsevier Ltd. All rights reserved.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

PubMed

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-11-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

Development of microsatellite markers in Lupinus luteus (Fabaceae) and cross-species amplification in other lupine species.

PubMed

Gonzalez, Lorena B Parra; Straub, Shannon C K; Doyle, Jeff J; Ortega, Paula E Mora; Garrido, Haroldo E Salvo; Butler, Iván J Maureira

2010-08-01

Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to investigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties. • Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collection of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2-4 alleles per locus. These revealed a moderate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet. • These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding strategies in yellow lupine.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

PubMed Central

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-01-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

USGS Publications Warehouse

Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

2010-01-01

A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

PubMed Central

Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

2014-01-01

A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

PubMed Central

Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

2003-01-01

A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

Development of Fluorescent Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) using Quenching Probes for the Detection of the Middle East Respiratory Syndrome Coronavirus.

PubMed

Shirato, Kazuya; Semba, Shohei; El-Kafrawy, Sherif A; Hassan, Ahmed M; Tolah, Ahmed M; Takayama, Ikuyo; Kageyama, Tsutomu; Notomi, Tsugunori; Kamitani, Wataru; Matsuyama, Shutoku; Azhar, Esam Ibraheem

2018-05-12

Clinical detection of Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV) in patients is achieved using genetic diagnostic methods, such as real-time RT-PCR assay. Previously, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of MERS-CoV [Virol J. 2014. 11:139]. Generally, amplification of RT-LAMP is monitored by the turbidity induced by precipitation of magnesium pyrophosphate with newly synthesized DNA. However, this mechanism cannot completely exclude the possibility of unexpected reactions. Therefore, in this study, fluorescent RT-LAMP assays using quenching probes (QProbes) were developed specifically to monitor only primer-derived signals. Two primer sets (targeting nucleocapsid and ORF1a sequences) were constructed to confirm MERS cases by RT-LAMP assay only. Our data indicate that both primer sets were capable of detecting MERS-CoV RNA to the same level as existing genetic diagnostic methods, and that both were highly specific with no cross-reactivity observed with other respiratory viruses. These primer sets were highly efficient in amplifying target sequences derived from different MERS-CoV strains, including camel MERS-CoV. In addition, the detection efficacy of QProbe RT-LAMP was comparable to that of real-time RT-PCR assay using clinical specimens from patients in Saudi Arabia. Altogether, these results indicate that QProbe RT-LAMP assays described here can be used as powerful diagnostic tools for rapid detection and surveillance of MERS-CoV infections. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Effects of silane- and MDP-based primers application orders on zirconia-resin adhesion-A ToF-SIMS study.

PubMed

Chuang, Shu-Fen; Kang, Li-Li; Liu, Yi-Chuan; Lin, Jui-Che; Wang, Ching-Cheng; Chen, Hui-Min; Tai, Cheng-Kun

2017-08-01

To evaluate the 3-methacryloyloxypropyltrimethoxysilane (MPS)- and 10-methacryloyloxydecyl-dihydrogen-phosphate (MDP)-base primers, in their single or sequential applications, with regard to modifying zirconia surfaces and improving resin-zirconia adhesion. Zirconia disks received different treatments: without primer (Zr), MPS-base primer (S), MDP-base primer (M), MPS/MDP mixture (SMmix), MPS followed by MDP (SM), and MDP followed by MPS (MS). The compositions and chemical interactions of the coatings to zirconia were analyzed using time-of-flight secondary ion mass spectrometry (ToF-SIMS) and reconstructed 3D ion images. Surface wettability of these coatings to water and resin adhesive was assessed. The shear bond strength (SBS) between resin and the treated zirconia was also examined before and after thermocycling. Groups S and MS presented substantial OH - ions in the coatings and zirconia substrate. PO 2 - and PO 3 - fragments existed in all MDP-treatment groups with various proportions and distributions, while groups M and SM showed higher proportions of PO 3 - and the zirconium phosphate related ions. In 3D ion images, PO 3 - in groups M and SM was denser and segregated to the interface, but was dispersed or overlaid above PO 2 - in SMmix and MS. All the primers increased the surface wettability to water and resin, with M and SM presenting superhydrophilic surfaces. All MDP-treatment groups showed improved SBS before thermocycling, while M and SM retained higher SBS after this. The MDP-base primer shows a relevant function in facilitating POZr bonding and enhancing resin-zirconia bonding. The co-treated MPS impairs the chemical activity of MDP, especially if it is the final coat. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

PubMed Central

2009-01-01

Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

DOEpatents

McKinney, Nancy

2002-01-01

PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

Poliovirus serotype-specific VP1 sequencing primers.

PubMed

Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

2011-06-01

The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.

PubMed

Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R

2001-04-01

A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.

Multiplex detection of agricultural pathogens

DOEpatents

McBride, Mary Teresa; Slezak, Thomas Richard; Messenger, Sharon Lee

2010-09-14

Described are kits and methods useful for detection of seven agricultural pathogens (BPSV; BHV; BVD; FMDV; BTV; SVD; and VESV) in a sample. Genomic sequence information from 7 agricultural pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.

Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

PubMed

Kokosková, B; Mráz, I; Fousek, J

2010-05-01

Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

Array of Synthetic Oligonucleotides to Generate Unique Multi-Target Artificial Positive Controls and Molecular Probe-Based Discrimination of Liposcelis Species

PubMed Central

Arif, Mohammad; Opit, George; Mendoza-Yerbafría, Abigail; Dobhal, Shefali; Li, Zhihong; Kučerová, Zuzana; Ochoa-Corona, Francisco M.

2015-01-01

Several species of the genus Liposcelis are common insect pests that cause serious qualitative and quantitative losses to various stored grains and processed grain products. They also can contaminate foods, transmit pathogenic microorganisms and cause allergies in humans. The common occurrence of multi-species infestations and the fact that it is difficult to identify and discriminate Liposcelis spp. make accurate, rapid detection and discriminatory tools absolutely necessary for confirmation of their identity. In this study, PCR primers and probes specific to different Liposcelis spp. were designed based on nucleotide sequences of the cytochrome oxidase 1 (CO1) gene. Primer sets ObsCo13F/13R, PeaCo15F/14R, BosCO7F/7R, BruCo5F/5R, and DecCo11F/11R were used to specifically detect Liposcelis obscura Broadhead, Liposcelis pearmani Lienhard, Liposcelis bostrychophila Badonnel, Liposcelis brunnea Motschulsky and Liposcelis decolor (Pearman) in multiplex endpoint PCRs, which amplified products of 438-, 351-, 191-, 140-, and 87-bp, respectively. In multiplex TaqMan qPCR assays, orange, yellow, red, crimson and green channels corresponding to reporter dyes 6-ROXN, HEX, Cy5, Quasar705 and 6-FAM specifically detected L. obscura, L. brunnea, L. bostrychophila, L. pearmani and L. decolor, respectively. All developed primer and probe sets allowed specific amplification of corresponding targeted Liposcelis species. The development of multiplex endpoint PCR and multiplex TaqMan qPCR will greatly facilitate psocid identification and their management. The use of APCs will streamline and standardize PCR assays. APC will also provide the opportunity to have all positive controls in a single tube, which reduces maintenance cost and labor, but increases the accuracy and reliability of the assays. These novel methods from our study will have applications in pest management, biosecurity, quarantine, food safety, and routine diagnostics. PMID:26086728

Detecting in situ copepod diet diversity using molecular technique: development of a copepod/symbiotic ciliate-excluding eukaryote-inclusive PCR protocol.

PubMed

Hu, Simin; Guo, Zhiling; Li, Tao; Carpenter, Edward J; Liu, Sheng; Lin, Senjie

2014-01-01

Knowledge of in situ copepod diet diversity is crucial for accurately describing pelagic food web structure but is challenging to achieve due to lack of an easily applicable methodology. To enable analysis with whole copepod-derived DNAs, we developed a copepod-excluding 18S rDNA-based PCR protocol. Although it is effective in depressing amplification of copepod 18S rDNA, its applicability to detect diverse eukaryotes in both mono- and mixed-species has not been demonstrated. Besides, the protocol suffers from the problem that sequences from symbiotic ciliates are overrepresented in the retrieved 18S rDNA libraries. In this study, we designed a blocking primer to make a combined primer set (copepod/symbiotic ciliate-excluding eukaryote-common: CEEC) to depress PCR amplification of symbiotic ciliate sequences while maximizing the range of eukaryotes amplified. We firstly examined the specificity and efficacy of CEEC by PCR-amplifying DNAs from 16 copepod species, 37 representative organisms that are potential prey of copepods and a natural microplankton sample, and then evaluated the efficiency in reconstructing diet composition by detecting the food of both lab-reared and field-collected copepods. Our results showed that the CEEC primer set can successfully amplify 18S rDNA from a wide range of isolated species and mixed-species samples while depressing amplification of that from copepod and targeted symbiotic ciliate, indicating the universality of CEEC in specifically detecting prey of copepods. All the predetermined food offered to copepods in the laboratory were successfully retrieved, suggesting that the CEEC-based protocol can accurately reconstruct the diets of copepods without interference of copepods and their associated ciliates present in the DNA samples. Our initial application to analyzing the food composition of field-collected copepods uncovered diverse prey species, including those currently known, and those that are unsuspected, as copepod prey. While testing is required, this protocol provides a useful strategy for depicting in situ dietary composition of copepods.

Culture-Independent Study of the Late-Stage of a Bloom of the Toxic Dinoflagellate Ostreopsis cf. ovata: Preliminary Findings Suggest Genetic Differences at the Sub-Species Level and Allow ITS2 Structure Characterization.

PubMed

Ramos, Vitor; Salvi, Daniele; Machado, João Paulo; Vale, Micaela; Azevedo, Joana; Vasconcelos, Vitor

2015-06-30

Available genomic data for the toxic, bloom-forming, benthic Ostreopsis spp. are traditionally obtained from isolates rather than from individuals originally present in environmental samples. Samples from the final phase of the first reported Ostreopsis bloom in European North Atlantic waters (Algarve, south coast of Portugal) were studied and characterized, using a culture-independent approach. In the first instance, a microscopy-based analysis revealed the intricate complexity of the samples. Then, we evaluated the adequacy of commonly used molecular tools (i.e., primers and nuclear ribosomal markers) for the study of Ostreopsis diversity in natural samples. A PCR-based methodology previously developed to identify/detect common Ostreopsis species was tested, including one new combination of existing PCR primers. Two sets of environmental rRNA sequences were obtained, one of them (1052 bp) with the newly tested primer set. These latter sequences encompass both the ITS1-5.8S-ITS2 region and the D1/D2 domain of the LSU rRNA gene, leading us to an accurate identification of ITS2. In turn, this allowed us to predict and show for the first time the ITS2 secondary structure of Ostreopsis. With 92 bp in length and a two-helix structure, the ITS2 of this genus revealed to be unique among the dinoflagellates. Both the PCR approach as the phylogenetic analyses allowed to place the Ostreopsis cells observed in the samples within the O. cf. ovata phylospecies' complex, discarding the presence of O. cf. siamensis. The (phylo)genetic results point out a certain level of nucleotide sequence divergence, but were inconclusive in relation to a possible geographic origin of the O. cf. ovata population from the Algarve's bloom.

A survey of alterations in microbial community diversity in marine sediments in response to oil from the Deepwater Horizon spill: Northern Gulf of Mexico shoreline, Texas to Florida

USGS Publications Warehouse

Lisle, John T.

2011-01-01

Microbial community genomic DNA was extracted from sediment samples collected from the northern Gulf of Mexico (NGOM) coast. These samples had a high probability of being impacted by Macondo-1 (M-1) well oil from the Deepwater Horizon (DWH) drilling site. The hypothesis for this project was that presence of M-1 oil in coastal sediments would significantly alter the diversity within the microbial communities associated with the impacted sediments. To determine if community-level changes did or did not occur following exposure to M-1 oil, microbial community-diversity fingerprints were generated and compared. Specific sequences within the community's genomic DNA were first amplified using the polymerase chain reaction (PCR) using a primer set that provides possible resolution to the species level. A second nested PCR that was performed on the primary PCR products using a primer set on which a GC-clamp was attached to one of the primers. These nested PCR products were separated using denaturing-gradient gel electrophoresis (DGGE) that resolves the nested PCR products based on sequence dissimilarities (or similarities), forming a genomic fingerprint of the microbial diversity within the respective samples. Sediment samples with similar fingerprints were grouped and compared to oil-fingerprint data from Rosenbauer and others (2010). The microbial community fingerprints grouped closely when identifying those sites that had been impacted by M-1 oil (N=12) and/or some mixture of M-1 and other oil (N=4), based upon the oil fingerprints. This report represents some of the first information on naturally occurring microbial communities in sediment from shorelines along the NGOM coast. These communities contain microbes capable of degrading oil and related hydrocarbons, making this information relevant to response and recovery of the NGOM from the DWH incident.

Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

PubMed Central

Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

1996-01-01

In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

PubMed Central

2013-01-01

Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

PubMed

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

In-planta detection and monitorization of endophytic colonization by a Beauveria bassiana strain using a new-developed nested and quantitative PCR-based assay and confocal laser scanning microscopy.

PubMed

Landa, B B; López-Díaz, C; Jiménez-Fernández, D; Montes-Borrego, M; Muñoz-Ledesma, F J; Ortiz-Urquiza, A; Quesada-Moraga, E

2013-10-01

Beauveria bassiana strain 04/01-Tip obtained from larvae of the opium poppy stem gall Iraella luteipes endophytically colonizes opium poppy plants and protect it against this pest. Development of a specific, rapid and sensitive technique that allows accurately determining the process and factors leading to the establishment of this strain in opium poppy plants would be essential to achieve its efficient control in a large field scale. For that purpose in the present study, species-specific primers that can be used in conventional or quantitative PCR protocols were developed for specifically identification and detection of B. bassiana in plant tissues. The combination of the designed BB.fw/BB.rv primer set with the universal ITS1-F/ITS4 primer set in a two-step nested-PCR approach, has allowed the amplification of up to 10fg of B. bassiana. This represented an increase in sensitivity of 10000- and 1000-fold of detection than when using the BB.fw/BB.rv primers in a single or single-tube semi-nested PCR approaches, respectively. The BB.fw and BB.rv primer set were subsequently optimized to be used in real time quantitative PCR assays and allowed to accurately quantify B. bassiana DNA in different plant DNA backgrounds (leaves and seeds) without losing accuracy and efficiency. The qPCR protocol was used to monitor the endophytic colonization of opium poppy leaves byB. bassiana after inoculation with the strain EABb 04/01-Tip, detecting as low as 26fg of target DNA in leaves and a decrease in fungal biomass over time. PCR quantification data were supported in parallel with CLMS by the monitoring of spatial and temporal patterns of leaf and stem colonization using a GFP-tagged transformant of the B. bassiana EABb 04/01-Tip strain, which enabled to demonstrate that B. bassiana effectively colonizes aerial tissues of opium poppy plants mainly through intercellular spaces and even leaf trichomes. A decline in endophytic colonization was also observed by the last sampling times, i.e. from 10 to 15days after inoculation, although fungal structures still remained present in the leaf tissues. These newly developed molecular protocols should facilitate the detection, quantification and monitoring of endophytic B. bassiana strains in different tissues and host plants and would help to unravel the factors and process governing the specific endophytic association between opium poppy and strain EABb 04/01-Tip providing key insights to formulate a sustainable strategy for I. luteipes management in the host. Copyright © 2013 Elsevier Inc. All rights reserved.

Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.

PubMed

Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon

2015-10-01

Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.

Reading Assessment: A Primer for Teachers and Tutors.

ERIC Educational Resources Information Center

Caldwell, JoAnne Schudt

This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…

Murrinh Nganki (Our Language), 1.

ERIC Educational Resources Information Center

Street, Chester; And Others

This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…

Real-time PCR (qPCR) primer design using free online software.

PubMed

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

Rapid identification of red-flesh loquat cultivars using EST-SSR markers based on manual cultivar identification diagram strategy.

PubMed

Li, X Y; Xu, H X; Chen, J W

2014-04-29

Manual cultivar identification diagram is a new strategy for plant cultivar identification based on DNA markers, providing information to efficiently separate cultivars. We tested 25 pairs of apple EST-SSR primers for amplification of PCR products from loquat cultivars. These EST-SSR primers provided clear amplification products from the loquat cultivars, with a relatively high transferability rate of 84% to loquat; 11 pairs of primers amplified polymorphic products. After analysis of 24 red-fleshed loquat accessions, we found that only 7 pairs of primers could clearly separate all of them. A cultivar identification diagram of the 24 cultivars was constructed using polymorphic bands from the DNA fingerprints and EST-SSR primers. Any two of the 24 cultivars could be rapidly separated from each other, according to the polymorphic bands from the cultivars; the corresponding primers were marked in the correct position on the cultivar identification diagram. This red-flesh loquat cultivar identification diagram can separate the 24 red-flesh loquat cultivars, which is of benefit for loquat cultivar identification for germplasm management and breeding programs.

TipMT: Identification of PCR-based taxon-specific markers.

PubMed

Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C

2017-02-11

Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .

A primer on polymer nomenclature: Structure-based, sourced-based and trade names

USDA-ARS?s Scientific Manuscript database

Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

Genetic diversity of Palestine landraces of faba bean (Vicia faba) based on RAPD markers.

PubMed

Basheer-Salimia, R; Shtaya, M; Awad, M; Abdallah, J; Hamdan, Y

2013-09-03

Until now, neither phenotypic nor molecular approaches have been used to characterize the landraces of Palestine faba beans (Vicia faba). We used PCR-based RAPD markers to determine the genetic diversity and relatedness among 26 Palestinian faba bean landraces (traditional farmers' varieties) from 8 localities in the West Bank, Palestine. In tests with 37 primers, 14 generated no polymorphic bands, 12 exhibited weak and unclear products, and 11 primers produced good amplification products with high intensity and pattern stability. Ninety-four DNA fragments (loci) were detected, with an average of 8.54 loci per primer and size ranging from 160 to 1370 bp. A minimum of 4 and a maximum of 14 DNA fragments were obtained using (OPA-05 and OPA-09) and (BC-261) primers, respectively. The maximum percentage of polymorphic markers was 71.4 (BC-298) and the minimum was 50.0 (OPA-05, -09, -16). The 11 primers exhibited relatively high collective resolving power (Rp) values of 26.316, and varied from 0.154 for the OPA-09 primer to 5.236 for the BC-261, with an overall mean of 2.392. The primers BC-261, -322, and -298 were found to be the most useful RAPD primers to assess the genetic diversity of Palestinian faba beans, as they revealed relatively high Rp rates (5.236, 3.618, and 3.150, respectively). Based on the Jaccard coefficient, the genetic distance ranged from 0.358 to 0.069, with a mean of 0.213. We conclude that the RAPD technique is useful for determining genetic diversity and for developing suitable fingerprints for faba bean landraces grown in Palestine.

Development and molecular characterization of genic molecular markers for grain protein and calcium content in finger millet (Eleusine coracana (L.) Gaertn.).

PubMed

Nirgude, M; Babu, B Kalyana; Shambhavi, Y; Singh, U M; Upadhyaya, H D; Kumar, Anil

2014-03-01

Finger millet (Eleusine coracana (L.) Gaertn), holds immense agricultural and economic importance for its high nutraceuticals quality. Finger millets seeds are rich source of calcium and its proteins are good source of essential amino acids. In the present study, we developed 36 EST-SSR primers for the opaque2 modifiers and 20 anchored-SSR primers for calcium transporters and calmodulin for analysis of the genetic diversity of 103 finger millet genotypes for grain protein and calcium contents. Out of the 36 opaque2 modifiers primers, 15 were found polymorphic and were used for the diversity analysis. The highest PIC value was observed with the primer FMO2E33 (0.26), while the lowest was observed FMO2E27 (0.023) with an average value of 0.17. The gene diversity was highest for the primer FMO2E33 (0.33), however it was lowest for FMO2E27 (0.024) at average value of 0.29. The percentage polymorphism shown by opaque2 modifiers primers was 68.23%. The diversity analysis by calcium transporters and calmodulin based anchored SSR loci revealed that the highest PIC was observed with the primer FMCA8 (0.30) and the lowest was observed for FMCA5 (0.023) with an average value of 0.18. The highest gene diversity was observed for primer FMCA8 (0.37), while lowest for FMCA5 (0.024) at an average of 0.21. The opaque2 modifiers specific EST-SSRs could able to differentiate the finger millet genotypes into high, medium and low protein containing genotypes. However, calcium dependent candidate gene based EST-SSRs could broadly differentiate the genotypes based on the calcium content with a few exceptions. A significant negative correlation between calcium and protein content was observed. The present study resulted in identification of highly polymorphic primers (FMO2E30, FMO2E33, FMO2-18 and FMO2-14) based on the parameters such as percentage of polymorphism, PIC values, gene diversity and number of alleles.

Methods, compounds and systems for detecting a microorganism in a sample

DOEpatents

Colston, Jr, Bill W.; Fitch, J. Patrick; Gardner, Shea N.; Williams, Peter L.; Wagner, Mark C.

2016-09-06

Methods to identify a set of probe polynucleotides suitable for detecting a set of targets and in particular methods for identification of primers suitable for detection of target microorganisms related polynucleotides, set of polynucleotides and compositions, and related methods and systems for detection and/or identification of microorganisms in a sample.

A teat papillomatosis case in a Damascus goat (Shami goat) in Hatay province, Turkey: a new putative papillomavirus?

PubMed

Dogan, Fırat; Dorttas, Selvi Deniz; Bilge Dagalp, Seval; Ataseven, Veysel Soydal; Alkan, Feray

2018-06-01

Papillomaviruses (PVs) are epitheliotropic viruses that cause benign proliferative lesions in the skin (warts or papillomas) and mucous membranes of their natural hosts. Recently, new PVs have been found in many animal species. The most common current approach for identifying novel PV types is based on PCR, using various consensus or degenerated primer (broad-range primers), designed on the basis of the multiple alignment of nucleotide or amino acid sequences of a large number of different human papillomaviruses (HPV). PVs have been classified according to the sequence similarity of one of their capsid proteins, L1, without taking into account other regions of the genome and without considering the phenotypic characteristics of the viral infection. In this study, we performed molecular detection and typing of a PV in a goat with teat papillomatosis. Firstly, PCR was performed using the FAP59/FAP64 and MY09/MY11 primer pairs for the L1 gene region. The PV DNA was found to be positive only with the FAP59/FAP64 primer pair. PV DNA was then tested with three primer sets in four different combinations (L2Bf/FAP64, L2Bf/L1Br, FAP59/FAP64, L1Bf/LCRBr) for the gene region encoding the L1, L2 and LCR proteins. The goat teat papilloma sample was amplified using FAP59/FAP64 primers and two primer pairs (L2Bf/FAP64 and L2Bf/L1Br). We obtained products matching approximately 604 bp of the L1 region of the virus. PV DNA was used for typing using sequence analysis/PCR with some type-specific primers for bovids, caprids and cervids. The results of the sequence analysis suggested one new putative PV type with sequence identity ranging from 46.45 to 80.09% to other known papillomaviruses, including Capra hircus papillomavirus (ChPV-2), bovine papillomavirus (BPV) 6, 7, 10, 11 and 12, Rangifer tarandus papillomavirus 3 (RtPV-3) and BPV-7Z (Alpine wild ruminant papillomavirus; Cervus elaphus papillomavirus). We therefore propose that this is the first identification of a new putative type, MG523274 (HTY-goat-TR2016), in a goat with teat papillomatosis. It is essential to identify PV types in different animal species and investigate their prevalence/distribution and clinical consequences in order to develop appropriate prophylactic and/or therapeutic procedures and to determine the interspecies transmission potential and evolution of PVs.

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

PubMed Central

Ogrean, Christy; Jackson, Ben; Covino, James

2010-01-01

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213

Nuclear Matrix Proteins in Disparity of Prostate Cancer

DTIC Science & Technology

2011-07-01

using G3PDH 3’ primer and PCR primer 1 followed by two rounds of hybridization. In the first hybridization, the RsaI-digested driver cDNA was mixed...determined using β-actin to confirm the reduced relative abundance of the housekeeping gene after SSH. The SSH nested PCR products were cloned using pCR®2.1...variability of DNA concentration. Additionally, negative and positive controls ( housekeeping genes) from the Ambion™ ArrayControls™ Set were included

Regulation of Mammary Stem Cell Quiescence via Post-Translational Modification of DeltaNp63alpha

DTIC Science & Technology

2014-02-01

mRNA expression in atopic dermatitis following narrow- band ultraviolet B phototherapy: results of a pilot study. J Dermatol Sci 44: 56– 58. 39. Lee...Change II site-directed mutagenesis kit ( Cat # 200523-5) with the following set of primers; sense primer 59-CGATGCTCTCGCTCCAGCACCCGC- CATCCCCTCC-39, and...Invitrogen, Cat #11668) according to manufacturers protocol. Kinome Screen The Silencer Select Human Kinase siRNA Library ( Cat - alog#4397918) from Ambion

Multiplex Real-Time PCR Assays that Measure the Abundance of Extremely Rare Mutations Associated with Cancer

PubMed Central

Vargas, Diana Y.; Kramer, Fred Russell; Tyagi, Sanjay; Marras, Salvatore A. E.

2016-01-01

We describe the use of “SuperSelective” primers that enable the detection and quantitation of somatic mutations whose presence relates to cancer diagnosis, prognosis, and therapy, in real-time PCR assays that can potentially analyze rare DNA fragments present in blood samples (liquid biopsies). The design of these deoxyribonucleotide primers incorporates both a relatively long “5' anchor sequence” that hybridizes strongly to target DNA fragments, and a very short, physically and functionally separate, “3' foot sequence” that is perfectly complementary to the mutant target sequence, but mismatches the wild-type sequence. As few as ten mutant fragments can reliably be detected in the presence of 1,000,000 wild-type fragments, even when the difference between the mutant and the wild type is only a single nucleotide polymorphism. Multiplex PCR assays employing a set of SuperSelective primers, and a corresponding set of differently colored molecular beacon probes, can be used in situations where the different mutations, though occurring in different cells, are located in the same codon. These non-symmetric real-time multiplex PCR assays contain limited concentrations of each SuperSelective primer, thereby enabling the simultaneous determination of each mutation’s abundance by comparing its threshold value to the threshold value of a reference gene present in the sample. PMID:27244445

The largest subunit of RNA polymerase II as a new marker gene to study assemblages of arbuscular mycorrhizal fungi in the field.

PubMed

Stockinger, Herbert; Peyret-Guzzon, Marine; Koegel, Sally; Bouffaud, Marie-Lara; Redecker, Dirk

2014-01-01

Due to the potential of arbuscular mycorrhizal fungi (AMF, Glomeromycota) to improve plant growth and soil quality, the influence of agricultural practice on their diversity continues to be an important research question. Up to now studies of community diversity in AMF have exclusively been based on nuclear ribosomal gene regions, which in AMF show high intra-organism polymorphism, seriously complicating interpretation of these data. We designed specific PCR primers for 454 sequencing of a region of the largest subunit of RNA polymerase II gene, and established a new reference dataset comprising all major AMF lineages. This gene is known to be monomorphic within fungal isolates but shows an excellent barcode gap between species. We designed a primer set to amplify all known lineages of AMF and demonstrated its applicability in combination with high-throughput sequencing in a long-term tillage experiment. The PCR primers showed a specificity of 99.94% for glomeromycotan sequences. We found evidence of significant shifts of the AMF communities caused by soil management and showed that tillage effects on different AMF taxa are clearly more complex than previously thought. The high resolving power of high-throughput sequencing highlights the need for quantitative measurements to efficiently detect these effects.

A Real-Time PCR Assay to Identify and Discriminate Among Wild-Type and Vaccine Strains of Varicella-Zoster Virus and Herpes Simplex Virus in Clinical Specimens, and Comparison With the Clinical Diagnoses

PubMed Central

Harbecke, Ruth; Oxman, Michael N.; Arnold, Beth A.; Ip, Charlotte; Johnson, Gary R.; Levin, Myron J.; Gelb, Lawrence D.; Schmader, Kenneth E.; Straus, Stephen E.; Wang, Hui; Wright, Peter F.; Pachucki, Constance T.; Gershon, Anne A.; Arbeit, Robert D.; Davis, Larry E.; Simberkoff, Michael S.; Weinberg, Adriana; Williams, Heather M.; Cheney, Carol; Petrukhin, Luba; Abraham, Katalin G.; Shaw, Alan; Manoff, Susan; Antonello, Joseph M.; Green, Tina; Wang, Yue; Tan, Charles; Keller, Paul M.

2014-01-01

A real-time PCR assay was developed to identify varicella-zoster virus (VZV) and herpes simplex virus (HSV) DNA in clinical specimens from subjects with suspected herpes zoster (HZ; shingles). Three sets of primers and probes were used in separate PCR reactions to detect and discriminate among wild-type VZV (VZV-WT), Oka vaccine strain VZV (VZV-Oka), and HSV DNA, and the reaction for each virus DNA was multiplexed with primers and probe specific for the human β-globin gene to assess specimen adequacy. Discrimination of all VZV-WT strains, including Japanese isolates and the Oka parent strain, from VZV-Oka was based upon a single nucleotide polymorphism at position 106262 in ORF 62, resulting in preferential amplification by the homologous primer pair. The assay was highly sensitive and specific for the target virus DNA, and no cross-reactions were detected with any other infectious agent. With the PCR assay as the gold standard, the sensitivity of virus culture was 53% for VZV and 77% for HSV. There was 92% agreement between the clinical diagnosis of HZ by the Clinical Evaluation Committee and the PCR assay results. PMID:19475609

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

Genetic relationships among strains of Xanthomonas fragariae based on random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus PCR data and generation of multiplexed PCR primers useful for the identification of this phytopathogen.

PubMed Central

Pooler, M R; Ritchie, D F; Hartung, J S

1996-01-01

Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198

Identification of spider-mite species and their endosymbionts using multiplex PCR.

PubMed

Zélé, Flore; Weill, Mylène; Magalhães, Sara

2018-02-01

Spider mites of the genus Tetranychidae are severe crop pests. In the Mediterranean a few species coexist, but they are difficult to identify based on morphological characters. Additionally, spider mites often harbour several species of endosymbiotic bacteria, which may affect the biology of their hosts. Here, we propose novel, cost-effective, multiplex diagnostic methods allowing a quick identification of spider-mite species as well as of the endosymbionts they carry. First, we developed, and successfully multiplexed in a single PCR, primers to identify Tetranychus urticae, T. evansi and T. ludeni, some of the most common tetranychids found in southwest Europe. Moreover, we demonstrated that this method allows detecting multiple species in a single pool, even at low frequencies (up to 1/100), and can be used on entire mites without DNA extraction. Second, we developed another set of primers to detect spider-mite endosymbionts, namely Wolbachia, Cardinium and Rickettsia in a multiplex PCR, along with a generalist spider-mite primer to control for potential failure of DNA amplification in each PCR. Overall, our method represents a simple, cost-effective and reliable method to identify spider-mite species and their symbionts in natural field populations, as well as to detect contaminations in laboratory rearings. This method may easily be extended to other species.

Amplification of thermostable lipase genes fragment from thermogenic phase of domestic waste composting process

NASA Astrophysics Data System (ADS)

Nurhasanah, Nurbaiti, Santi; Madayanti, Fida; Akhmaloka

2015-09-01

Lipases are lipolytic enzymes, catalyze the hydrolysis of fatty acid ester bonds of triglycerides to produce free fatty acids and glycerol. The enzyme is widely used in various fields of biotechnological industry. Hence, lipases with unique properties (e.g.thermostable lipase) are still being explored by variation methods. One of the strategy is by using metagenomic approach to amplify the gene directly from environmental sample. This research was focused on amplification of lipase gene fragment directly from the thermogenic phase of domestic waste composting in aerated trenches. We used domestic waste compost from waste treatment at SABUGA, ITB for the sample. Total chromosomal DNA were directly extracted from several stages at thermogenic phase of compost. The DNA was then directly used as a template for amplification of thermostable lipase gene fragments using a set of internal primers namely Flip-1a and Rlip-1a that has been affixed with a GC clamp in reverse primer. The results showed that the primers amplified the gene from four stages of thermogenic phase with the size of lipase gene fragment of approximately 570 base pairs (bp). These results were further used for Denaturing Gradient Gel Electrophoresis (DGGE) analysis to determine diversity of thermostable lipase gene fragments.

Quenching of unincorporated amplification signal reporters in reverse-transcription loop-mediated isothermal amplification enabling bright, single-step, closed-tube, and multiplexed detection of RNA viruses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ball, Cameron S.; Light, Yooli K.; Koh, Chung -Yan

Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of themore » reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read “quasar”), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). As a result, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.« less

Environmental metabarcodes for insects: in silico PCR reveals potential for taxonomic bias.

PubMed

Clarke, Laurence J; Soubrier, Julien; Weyrich, Laura S; Cooper, Alan

2014-11-01

Studies of insect assemblages are suited to the simultaneous DNA-based identification of multiple taxa known as metabarcoding. To obtain accurate estimates of diversity, metabarcoding markers ideally possess appropriate taxonomic coverage to avoid PCR-amplification bias, as well as sufficient sequence divergence to resolve species. We used in silico PCR to compare the taxonomic coverage and resolution of newly designed insect metabarcodes (targeting 16S) with that of existing markers [16S and cytochrome oxidase c subunit I (COI)] and then compared their efficiency in vitro. Existing metabarcoding primers amplified in silico <75% of insect species with complete mitochondrial genomes available, whereas new primers targeting 16S provided >90% coverage. Furthermore, metabarcodes targeting COI appeared to introduce taxonomic PCR-amplification bias, typically amplifying a greater percentage of Lepidoptera and Diptera species, while failing to amplify certain orders in silico. To test whether bias predicted in silico was observed in vitro, we created an artificial DNA blend containing equal amounts of DNA from 14 species, representing 11 insect orders and one arachnid. We PCR-amplified the blend using five primer sets, targeting either COI or 16S, with high-throughput amplicon sequencing yielding more than 6 million reads. In vitro results typically corresponded to in silico PCR predictions, with newly designed 16S primers detecting 11 insect taxa present, thus providing equivalent or better taxonomic coverage than COI metabarcodes. Our results demonstrate that in silico PCR is a useful tool for predicting taxonomic bias in mixed template PCR and that researchers should be wary of potential bias when selecting metabarcoding markers. © 2014 John Wiley & Sons Ltd.

Quenching of unincorporated amplification signal reporters in reverse-transcription loop-mediated isothermal amplification enabling bright, single-step, closed-tube, and multiplexed detection of RNA viruses

DOE PAGES

Ball, Cameron S.; Light, Yooli K.; Koh, Chung -Yan; ...

2016-03-16

Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of themore » reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read “quasar”), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). As a result, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.« less

Development and validation of microsatellite markers for Brachiaria ruziziensis obtained by partial genome assembly of Illumina single-end reads

PubMed Central

2013-01-01

Background Brachiaria ruziziensis is one of the most important forage species planted in the tropics. The application of genomic tools to aid the selection of superior genotypes can provide support to B. ruziziensis breeding programs. However, there is a complete lack of information about the B. ruziziensis genome. Also, the availability of genomic tools, such as molecular markers, to support B. ruziziensis breeding programs is rather limited. Recently, next-generation sequencing technologies have been applied to generate sequence data for the identification of microsatellite regions and primer design. In this study, we present a first validated set of SSR markers for Brachiaria ruziziensis, selected from a de novo partial genome assembly of single-end Illumina reads. Results A total of 85,567 perfect microsatellite loci were detected in contigs with a minimum 10X coverage. We selected a set of 500 microsatellite loci identified in contigs with minimum 100X coverage for primer design and synthesis, and tested a subset of 269 primer pairs, 198 of which were polymorphic on 11 representative B. ruziziensis accessions. Descriptive statistics for these primer pairs are presented, as well as estimates of marker transferability to other relevant brachiaria species. Finally, a set of 11 multiplex panels containing the 30 most informative markers was validated and proposed for B. ruziziensis genetic analysis. Conclusions We show that the detection and development of microsatellite markers from genome assembled Illumina single-end DNA sequences is highly efficient. The developed markers are readily suitable for genetic analysis and marker assisted selection of Brachiaria ruziziensis. The use of this approach for microsatellite marker development is promising for species with limited genomic information, whose breeding programs would benefit from the use of genomic tools. To our knowledge, this is the first set of microsatellite markers developed for this important species. PMID:23324172

Collecting in collections: a PCR strategy and primer set for DNA barcoding of decades-old dried museum specimens.

PubMed

Mitchell, Andrew

2015-09-01

Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past. © 2015 John Wiley & Sons Ltd.

A complex structure in the mRNA of Tf1 is recognized and cleaved to generate the primer of reverse transcription.

PubMed

Lin, J H; Levin, H L

1997-01-15

All retroviruses and LTR-containing retrotransposons are thought to require specific tRNA molecules to serve as primers of reverse transcription. An exception is the LTR-containing retrotransposon Tf1, isolated from Schizosaccharomyces pombe. Instead of requiring a tRNA, the reverse transcriptase of Tf1 uses the first 11 bases of the Tf1 transcript as the primer for reverse transcription. The primer is generated by a cleavage that occurs between bases 11 and 12 of the Tf1 mRNA. Sequence analysis of the 5' untranslated region of the Tf1 mRNA resulted in the identification of a region with the potential to form an RNA structure of 89 bases that included the primer binding site and the first 11 bases of the Tf1 mRNA. Systematic mutagenesis of this region revealed 34 single-point mutants in the structure that resulted in reduced transposition activity. The defects in transposition correlated with reduced level of Tf1 reverse transcripts as determined by DNA blot analysis. Evidence that the RNA structure did form in vivo included the result that strains with second site mutations that restored complementarity resulted in increased levels of reverse transcripts and Tf1 transposition. The majority of the mutants defective for reverse transcription were unable to cleave the Tf1 mRNA between bases 11 and 12. These data indicate that formation of an extensive RNA structure was required for the cleavage reaction that generated the primer for Tf1 reverse transcription.

Diagnostics of Tree Diseases Caused by Phytophthora austrocedri Species.

PubMed

Mulholland, Vincent; Elliot, Matthew; Green, Sarah

2015-01-01

We present methods for the detection and quantification of four Phytophthora species which are pathogenic on trees; Phytophthora ramorum, Phytophthora kernoviae, Phytophthora lateralis, and Phytophthora austrocedri. Nucleic acid extraction methods are presented for phloem tissue from trees, soil, and pure cultures on agar plates. Real-time PCR methods are presented and include primer and probe sets for each species, general advice on real-time PCR setup and data analysis. A method for sequence-based identification, useful for pure cultures, is also included.

A Primer for Agent-Based Simulation and Modeling in Transportation Applications

DOT National Transportation Integrated Search

2013-11-01

Agent-based modeling and simulation (ABMS) methods have been applied in a spectrum of research domains. This primer focuses on ABMS in the transportation interdisciplinary domain, describes the basic concepts of ABMS and the recent progress of ABMS i...

A survey of microbial community diversity in marine sediments impacted by petroleum hydrocarbons from the Gulf of Mexico and Atlantic shorelines, Texas to Florida

USGS Publications Warehouse

Lisle, John T.; Stellick, Sarah H.

2011-01-01

Microbial community genomic DNA was extracted from sediment samples collected along the Gulf of Mexico and Atlantic coasts from Texas to Florida. Sample sites were identified as being ecologically sensitive and (or) as having high potential of being impacted by Macondo-1 (M-1) well oil from the Deepwater Horizon blowout. The diversity within the microbial communities associated with the collected sediments provides a baseline dataset to which microbial community-diversity data from impacted sites could be compared. To determine the microbial community diversity in the samples, genetic fingerprints were generated and compared. Specific sequences within the community genomic DNA were first amplified using the polymerase chain reaction (PCR) with a primer set that provides possible resolution to the species level. A second nested PCR was performed on the primary PCR products using a primer set on which a GC-clamp was attached to one of the primers. The nested PCR products were separated using denaturing-gradient gel electrophoresis (DGGE) that resolves the nested PCR products based on sequence dissimilarities (or similarities), forming a genomic fingerprint of the microbial diversity within the respective samples. Samples with similar fingerprints were grouped and compared to oil-fingerprint data from the same sites (Rosenbauer and others, 2011). The microbial community fingerprints were generally grouped into sites that had been shown to contain background concentrations of non-Deepwater Horizon oil. However, these groupings also included sites where no oil signature was detected. This report represents some of the first information on naturally occurring microbial communities in sediment from shorelines along the Gulf of Mexico and Atlantic coasts from Texas to Florida.

Chromate content versus particle size for aircraft paints.

PubMed

LaPuma, Peter T; Rhodes, Brian S

2002-12-01

Many industries rely on the corrosion inhibiting properties of chromate-containing primer paints to protect metal from oxidation. However, chromate contains hexavalent chromium (Cr(6+)), a known human carcinogen. The concentration of Cr(6+) as a function of paint particle size has important implications to worker health and environmental release from paint facilities. This research examines Cr(6+) content as a function of particle size for three types of aircraft primer paints: solvent-based epoxy-polyamide, water-based epoxy-polyamide, and solvent-based polyurethane. Cascade impactors were used to collect and separate paint particles based on their aerodynamic diameter, from 0.7 to 34.1 microm. The mass of the dry paint collected at each stage was determined and an atomic absorption spectrometer was used to analyze for Cr(6+) content. For all three paints, particles less than 7.0 microm contained disproportionately less Cr(6+) per mass of dry paint than larger particles, and the Cr(6+)concentration decreased substantially as particle size decreased. The smallest particles, 0.7 to 1.0 microm, contained approximately 10% of the Cr(6+) content, per mass of dry paint, compared to particles larger than 7.0 microm. The paint gun settings of air to paint ratio was found to have no influence on the Cr(6+) bias.

Nodavirus infections in Israeli mariculture.

PubMed

Ucko, M; Colorni, A; Diamant, A

2004-08-01

Viral encephalopathy and retinopathy (VER) infections were diagnosed in five fish species: Epinephelus aeneus, Dicentrarchus labrax, Sciaenops ocellatus, Lates calcarifer and Mugil cephalus cultured on both the Red Sea and Mediterranean coasts of Israel during 1998-2002. Spongiform vacuolation of nervous tissue was observed in histological sections of all examined species. With transmission electron microscopy, paracrystalline arrays and pieces of membrane-associated non-enveloped virions measuring approximately 30 nm in diameter were observed in the brain and retina of all species. At the molecular level, the nodavirus was detected by using a primer set that amplified the T4 region of the coat protein gene. When the same set of primers was used to search for VER in an additional fish species, Sparus aurata, it was found to produce non-specific amplicons, giving rise to false-positive results. This problem was overcome by using a different primer set (F1/VR3), designed on a highly conserved region of the virus gene, which amplified a fragment of 254 bp, and confirmed that S. aurata was nodavirus-free. This set was validated on all five species of infected fish, as well as clinically healthy fish. Comparison of the coat protein genes from the Israeli isolated sequences indicated that more than one viral strain was involved. No strict host-specificity was evident. Red Sea and Mediterranean isolated sequences grouped in distinct clusters, together with several foreign isolates from the Mediterranean area and the Far East, as phylogenetically close to the Epinephelus akaara RGNNV type.

Design and validation of a real-time RT-PCR for the simultaneous detection of enteroviruses and parechoviruses in clinical samples.

PubMed

Cabrerizo, María; Calvo, Cristina; Rabella, Nuria; Muñoz-Almagro, Carmen; del Amo, Eva; Pérez-Ruiz, Mercedes; Sanbonmatsu-Gámez, Sara; Moreno-Docón, Antonio; Otero, Almudena; Trallero, Gloria

2014-11-01

Human enteroviruses (EVs) and parechoviruses (HPeVs) are important etiological agents causing infections such as meningitis, encephalitis and sepsis-like disease in neonates and young children. We have developed a real-time RT-PCR for simultaneous detection of EV and HPeV in clinical samples. Primers and probe sets were designed from the conserved 5'-noncoding region of the genomes. The sensitivity, specificity and reproducibility of the technique were measured using a set of 25 EV and 6 HPeV types. All EVs but no HPeVs were detected with the EV primers-probe set. The HPeV primers-probe set detected only the 6 HPeV types. The lower detection limit was found to be 4 and 40CCID50/ml for HPeV and EV respectively, demonstrating high sensitivity of the technique for both viruses. The threshold cycle values were highly reproducible on repeat testing of positive controls among assay runs. The assay was evaluated in 53 clinical samples of suspected meningitis, sepsis or febrile syndromes from children under 3 years. In 11 of these (21%) EVs were detected, while 4, i.e. 7.5%, were HPeV positive. Molecular typing was carried out for 73% of the viruses. In summary, the RT-PCR method developed demonstrated effectively both EV and HPeV detection, which can cause similar clinical symptoms in infants. Copyright © 2014 Elsevier B.V. All rights reserved.

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

PubMed

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Plastid primers for angiosperm phylogenetics and phylogeography.

PubMed

Prince, Linda M

2015-06-01

PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

PubMed Central

Eastman, Alexander W.; Yuan, Ze-Chun

2015-01-01

Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID:25653642

Innovations in bonding to zirconia-based materials: Part I.

PubMed

Aboushelib, Moustafa N; Matinlinna, Jukka P; Salameh, Ziad; Ounsi, Hani

2008-09-01

Establishing a reliable bond to zirconia-based materials has proven to be difficult which is the major limitation against fabricating adhesive zirconia restorations. This bond could be improved using novel selective infiltration etching conditioning in combination with engineered zirconia primers. Aim of the work was to evaluate resin-to-zirconia bond strength using selective infiltration etching and novel silane-based zirconia primers. Zirconia discs (Procera Zirconia) received selective infiltration etching surface treatment followed by coating with either of five especially engineered experimental zirconia primers. Pre-aged resin-composite discs (Tetric Ivo Ceram) were bonded to the treated surface using an MDP-containing resin-composite (Panavia F 2.0). The bilayered specimens were cut into microbars and the microtensile bond strength (MTBS) was evaluated. 'As-sintered' zirconia discs served as a control (alpha=0.05). The broken microbars were examined using a scanning electron microscope (SEM). The combination of selective infiltration etching with experimental zirconia primers significantly improved (F=3805, P<0.0001) the MTBS values (41+/-5.8 MPa) compared to the 'as-sintered' surface using the same primers which demonstrated spontaneous failure and very low bond strength values (2.6+/-3.1 MPa). SEM analysis revealed that selective infiltration etching surface treatment resulted in a nano-retentive surface where the zirconia primers were able to penetrate and interlock which explained the higher MTBS values observed for the treated specimens.

Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

PubMed

McMeel, O M; Hoey, E M; Ferguson, A

2001-01-01

The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

A Dozen Primers on Important Information Standards

ERIC Educational Resources Information Center

Dempsey, Kathy, Comp.

2007-01-01

This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

PubMed

van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

2008-09-01

To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

PubMed

Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

2014-09-01

Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

A Primer on Polymer Nomenclature: Structure-Based, Sourced- Based, and Trade Names

ERIC Educational Resources Information Center

Cheng, H. N.; Howell, Bob A.

2017-01-01

Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structurebased and source-based nomenclatures, together with trivial and trade…

Setting up Targeted Research Interviews: A Primer for Students and New Interviewers

ERIC Educational Resources Information Center

Noy, Darren

2009-01-01

This article analyzes key strategic considerations for setting up targeted research interviews, including human subjects and Institutional Review Board requirements, approaching respondents, the medium of contact, using technology, cultural conceptions of time and commitment, using networks, wading through bureaucracies, and watching for warning…

i-rDNA: alignment-free algorithm for rapid in silico detection of ribosomal gene fragments from metagenomic sequence data sets.

PubMed

Mohammed, Monzoorul Haque; Ghosh, Tarini Shankar; Chadaram, Sudha; Mande, Sharmila S

2011-11-30

Obtaining accurate estimates of microbial diversity using rDNA profiling is the first step in most metagenomics projects. Consequently, most metagenomic projects spend considerable amounts of time, money and manpower for experimentally cloning, amplifying and sequencing the rDNA content in a metagenomic sample. In the second step, the entire genomic content of the metagenome is extracted, sequenced and analyzed. Since DNA sequences obtained in this second step also contain rDNA fragments, rapid in silico identification of these rDNA fragments would drastically reduce the cost, time and effort of current metagenomic projects by entirely bypassing the experimental steps of primer based rDNA amplification, cloning and sequencing. In this study, we present an algorithm called i-rDNA that can facilitate the rapid detection of 16S rDNA fragments from amongst millions of sequences in metagenomic data sets with high detection sensitivity. Performance evaluation with data sets/database variants simulating typical metagenomic scenarios indicates the significantly high detection sensitivity of i-rDNA. Moreover, i-rDNA can process a million sequences in less than an hour on a simple desktop with modest hardware specifications. In addition to the speed of execution, high sensitivity and low false positive rate, the utility of the algorithmic approach discussed in this paper is immense given that it would help in bypassing the entire experimental step of primer-based rDNA amplification, cloning and sequencing. Application of this algorithmic approach would thus drastically reduce the cost, time and human efforts invested in all metagenomic projects. A web-server for the i-rDNA algorithm is available at http://metagenomics.atc.tcs.com/i-rDNA/

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

PubMed

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

USGS Publications Warehouse

Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

1999-01-01

We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

Forensic SNP genotyping with SNaPshot: Technical considerations for the development and optimization of multiplexed SNP assays.

PubMed

Fondevila, M; Børsting, C; Phillips, C; de la Puente, M; Consortium, Euroforen-NoE; Carracedo, A; Morling, N; Lareu, M V

2017-01-01

This review explores the key factors that influence the optimization, routine use, and profile interpretation of the SNaPshot single-base extension (SBE) system applied to forensic single-nucleotide polymorphism (SNP) genotyping. Despite being a mainly complimentary DNA genotyping technique to routine STR profiling, use of SNaPshot is an important part of the development of SNP sets for a wide range of forensic applications with these markers, from genotyping highly degraded DNA with very short amplicons to the introduction of SNPs to ascertain the ancestry and physical characteristics of an unidentified contact trace donor. However, this technology, as resourceful as it is, displays several features that depart from the usual STR genotyping far enough to demand a certain degree of expertise from the forensic analyst before tackling the complex casework on which SNaPshot application provides an advantage. In order to provide the basis for developing such expertise, we cover in this paper the most challenging aspects of the SNaPshot technology, focusing on the steps taken to design primer sets, optimize the PCR and single-base extension chemistries, and the important features of the peak patterns observed in typical forensic SNP profiles using SNaPshot. With that purpose in mind, we provide guidelines and troubleshooting for multiplex-SNaPshot-oriented primer design and the resulting capillary electrophoresis (CE) profile interpretation (covering the most commonly observed artifacts and expected departures from the ideal conditions). Copyright © 2017 Central Police University.

GSP: a web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.

1995-01-01

The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

PCR-based methods for identification of potentially zoonotic ascaridoid parasites of the dog, fox and cat.

PubMed

Jacobs, D E; Zhu, X; Gasser, R B; Chilton, N B

1997-11-01

Genomic DNA was extracted from ascaridoid nematodes collected from dogs, foxes and cats. A region spanning the second internal transcribed spacer (ITS-2) of the ribosomal DNA of each sample was amplified by PCR. Representative ITS-2 products for each nematode species (Toxocara canis, Toxocara cati and Toxascaris leonina) were sequenced. Restriction sites were identified for use as genetic markers in a PCR-linked RFLP assay. The three species could be differentiated from each other and from other ascaridoids that may be found in human tissues by use of two endonucleases, HinfI and RsaI. Primers were designed to unique regions of the ITS-2 sequences of the three species for use in diagnostic PCR procedures and primer sets evaluated against panels of homologous and heterologous DNA samples. Results suggest that both methods are good candidates for further development for the detection and/or identification of ascaridoid larvae in human tissues.

Primary Care Integration of Psychiatric and Behavioral Health Services: A Primer for Providers and Case Report of Local Implementation.

PubMed

Guerrero, Anthony Ps; Takesue, Cori L; Medeiros, Jared Hn; Duran, Aileen A; Humphry, Joseph W; Lunsford, Ryan M; Shaw, Diana V; Fukuda, Michael H; Hishinuma, Earl S

2017-06-01

Mental health conditions are common, disabling, potentially life-threatening, and costly; however, they are mostly treatable with early detection and intervention. Unfortunately, mental healthcare is in significantly short supply both nationally and locally, and particularly in small, rural, and relatively isolated communities. This article provides physicians and other health practitioners with a primer on the basic rationale and principles of integrating behavioral healthcare - particularly psychiatric specialty care - in primary care settings, including effective use of teleconferencing. Referring to a local-based example, this paper describes the programmatic components (universal screening, telephone availability, mutually educational team rounds, as-needed consultations, etc) that operationalize and facilitate successful primary care integration, and illustrates how these elements are applied to population segments with differing needs for behavioral healthcare involvement. Lastly, the article discusses the potential value of primary care integration in promoting quality, accessibility, and provider retention; discusses how new developments in healthcare financing could enhance the sustainability of primary care integration models; and summarizes lessons learned.

Rapid and sensitive identification of the herbal tea ingredient Taraxacum formosanum using loop-mediated isothermal amplification.

PubMed

Lai, Guan-Hua; Chao, Jung; Lin, Ming-Kuem; Chang, Wen-Te; Peng, Wen-Huang; Sun, Fang-Chun; Lee, Meng-Shiunn; Lee, Meng-Shiou

2015-01-09

Taraxacum formosanum (TF) is a medicinal plant used as an important component of health drinks in Taiwan. In this study, a rapid, sensitive and specific loop-mediated isothermal amplification (LAMP) assay for authenticating TF was established. A set of four specific LAMP primers was designed based on the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA (nrDNA) of TF. LAMP amplicons were successfully amplified and detected when purified genomic DNA of TF was added in the LAMP reaction under isothermal condition (65 °C) within 45 min. These specific LAMP primers have high specificity and can accurately discriminate Taraxacum formosanum from other adulterant plants; 1 pg of genomic DNA was determined to be the detection limit of the LAMP assay. In conclusion, using this novel approach, TF and its misused plant samples obtained from herbal tea markets were easily identified and discriminated by LAMP assay for quality control.

Rapid and Sensitive Identification of the Herbal Tea Ingredient Taraxacum formosanum Using Loop-Mediated Isothermal Amplification

PubMed Central

Lai, Guan-Hua; Chao, Jung; Lin, Ming-Kuem; Chang, Wen-Te; Peng, Wen-Huang; Sun, Fang-Chun; Lee, Meng-Shiunn; Lee, Meng-Shiou

2015-01-01

Taraxacum formosanum (TF) is a medicinal plant used as an important component of health drinks in Taiwan. In this study, a rapid, sensitive and specific loop-mediated isothermal amplification (LAMP) assay for authenticating TF was established. A set of four specific LAMP primers was designed based on the nucleotide sequence of the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA (nrDNA) of TF. LAMP amplicons were successfully amplified and detected when purified genomic DNA of TF was added in the LAMP reaction under isothermal condition (65 °C) within 45 min. These specific LAMP primers have high specificity and can accurately discriminate Taraxacum formosanum from other adulterant plants; 1 pg of genomic DNA was determined to be the detection limit of the LAMP assay. In conclusion, using this novel approach, TF and its misused plant samples obtained from herbal tea markets were easily identified and discriminated by LAMP assay for quality control. PMID:25584616

Detection of different South American hantaviruses.

PubMed

Guterres, Alexandro; de Oliveira, Renata Carvalho; Fernandes, Jorlan; Schrago, Carlos Guerra; de Lemos, Elba Regina Sampaio

2015-12-02

Hantaviruses are the etiologic agents of Hemorrhagic Fever with Renal Syndrome (HFRS) in Old World, and Hantavirus Pulmonary Syndrome (HPS)/Hantavirus Cardiopulmonary Syndrome (HCPS), in the New World. Serological methods are the most common approach used for laboratory diagnosis of HCPS, however theses methods do not allow the characterization of viral genotypes. The polymerase chain reaction (PCR) has been extensively used for diagnosis of viral infections, including those caused by hantaviruses, enabling detection of few target sequence copies in the sample. However, most studies proposed methods of PCR with species-specific primers. This study developed a simple and reliable diagnostic system by RT-PCR for different hantavirus detection. Using new primers set, we evaluated human and rodent hantavirus positive samples of various regions from Brazil. Besides, we performed computational analyzes to evaluate the detection of other South American hantaviruses. The diagnostic system by PCR proved to be a sensible and simple assay, allowing amplification of Juquitiba virus, Araraquara virus, Laguna Negra virus, Rio Mamore virus and Jabora virus, beyond of the possibility of the detecting Andes, Anajatuba, Bermejo, Choclo, Cano Delgadito, Lechiguanas, Maciel, Oran, Pergamino and Rio Mearim viruses. The primers sets designed in this study can detect hantaviruses from almost all known genetics lineages in Brazil and from others South America countries and also increases the possibility to detect new hantaviruses. These primers could easily be used both in diagnosis of suspected hantavirus infections in humans and also in studies with animals reservoirs. Copyright © 2015 Elsevier B.V. All rights reserved.

Establishment of a sensitive system for analysis of human vaginal microbiota on the basis of rRNA-targeted reverse transcription-quantitative PCR.

PubMed

Kurakawa, Takashi; Ogata, Kiyohito; Tsuji, Hirokazu; Kado, Yukiko; Takahashi, Takuya; Kida, Yumi; Ito, Masahiro; Okada, Nobuhiko; Nomoto, Koji

2015-04-01

Ten specific primer sets, for Lactobacillus gasseri, Lactobacillus crispatus, Atopobium vaginae, Gardnerella vaginalis, Mobiluncus curtisii, Chlamydia trachomatis/muridarum, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Bifidobacterium adolescentis, and Bifidobacterium angulatum, were developed for quantitative analysis of vaginal microbiota. rRNA-targeted reverse transcription-quantitative PCR (RT-qPCR) analysis of the vaginal samples from 12 healthy Japanese volunteers using the new primer sets together with 25 existing primer sets revealed the diversity of their vaginal microbiota: Lactobacilli such as L. crispatus, L. gasseri, Lactobacillus jensenii, Lactobacillus iners, and Lactobacillus vaginalis, as the major populations at 10(7) cells/ml vaginal fluid, were followed by facultative anaerobes such as Streptococcus and strict anaerobes at lower population levels of 10(4) cells/ml or less. Certain bacterial vaginosis (BV)-related bacteria, such as G. vaginalis, A. vaginae, M. curtisii, and Prevotella, were also detected in some subjects. Especially in one subject, both G. vaginalis and A. vaginae were detected at high population levels of 10(8.8) and 10(8.9) cells/ml vaginal fluid, suggesting that she is an asymptomatic BV patient. These results suggest that the RT-qPCR system is effective for accurate analysis of major vaginal commensals and diagnosis of several vaginal infections. Copyright © 2015 Elsevier B.V. All rights reserved.

A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

Collecting Behavioral Data in General Education Settings: A Primer for Behavioral Data Collection

ERIC Educational Resources Information Center

Lee, David L.; Vostal, Brooks; Lylo, Brooke; Hua, Youjia

2011-01-01

Recent trends toward the inclusion of students with disabilities mean that a majority of students with emotional and behavioral disorders (EBD) now spend at least 40% of their day in general education settings. With this change in location, teachers in general education settings are now asked to perform tasks that were not given much emphasis…

A primer on standards setting as it applies to surgical education and credentialing.

PubMed

Cendan, Juan; Wier, Daryl; Behrns, Kevin

2013-07-01

Surgical technological advances in the past three decades have led to dramatic reductions in the morbidity associated with abdominal procedures and permanently altered the surgical practice landscape. Significant changes continue apace including surgical robotics, natural orifice-based surgery, and single-incision approaches. These disruptive technologies have on occasion been injurious to patients, and high-stakes assessment before adoption of new technologies would be reasonable. We reviewed the drivers for well-established psychometric techniques available for the standards-setting process. We present a series of examples that are relevant in the surgical domain including standards setting for knowledge and skills assessments. Defensible standards for knowledge and procedural skills will likely become part of surgical clinical practice. Understanding the methodology for determining standards should position the surgical community to assist in the process and lead within their clinical settings as standards are considered that may affect patient safety and physician credentialing.

Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

PubMed

Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

2011-12-01

Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

A multiplex primer design algorithm for target amplification of continuous genomic regions.

PubMed

Ozturk, Ahmet Rasit; Can, Tolga

2017-06-19

Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR

PubMed Central

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.

Identification of forensic samples by using an infrared-based automatic DNA sequencer.

PubMed

Ricci, Ugo; Sani, Ilaria; Klintschar, Michael; Cerri, Nicoletta; De Ferrari, Francesco; Giovannucci Uzielli, Maria Luisa

2003-06-01

We have recently introduced a new protocol for analyzing all core loci of the Federal Bureau of Investigation's (FBI) Combined DNA Index System (CODIS) with an infrared (IR) automatic DNA sequencer (LI-COR 4200). The amplicons were labeled with forward oligonucleotide primers, covalently linked to a new infrared fluorescent molecule (IRDye 800). The alleles were displayed as familiar autoradiogram-like images with real-time detection. This protocol was employed for paternity testing, population studies, and identification of degraded forensic samples. We extensively analyzed some simulated forensic samples and mixed stains (blood, semen, saliva, bones, and fixed archival embedded tissues), comparing the results with donor samples. Sensitivity studies were also performed for the four multiplex systems. Our results show the efficiency, reliability, and accuracy of the IR system for the analysis of forensic samples. We also compared the efficiency of the multiplex protocol with ultraviolet (UV) technology. Paternity tests, undegraded DNA samples, and real forensic samples were analyzed with this approach based on IR technology and with UV-based automatic sequencers in combination with commercially-available kits. The comparability of the results with the widespread UV methods suggests that it is possible to exchange data between laboratories using the same core group of markers but different primer sets and detection methods.

FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

A tool for design of primers for microRNA-specific quantitative RT-qPCR.

PubMed

Busk, Peter K

2014-01-28

MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.

PubMed

Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin

2015-05-15

The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity. Copyright © 2014 Elsevier B.V. All rights reserved.

Estimating biodiversity of fungi in activated sludge communities using culture-independent methods.

PubMed

Evans, Tegan N; Seviour, Robert J

2012-05-01

Fungal diversity of communities in several activated sludge plants treating different influent wastes was determined by comparative sequence analyses of their 18S rRNA genes. Methods for DNA extraction and choice of primers for PCR amplification were both optimised using denaturing gradient gel electrophoresis profile patterns. Phylogenetic analysis revealed that the levels of fungal biodiversity in some communities, like those treating paper pulp wastes, were low, and most of the fungi detected in all communities examined were novel uncultured representatives of the major fungal subdivisions, in particular, the newly described clade Cryptomycota. The fungal populations in activated sludge revealed by these culture-independent methods were markedly different to those based on culture-dependent data. Members of the genera Penicillium, Cladosporium, Aspergillus and Mucor, which have been commonly identified in mixed liquor, were not identified in any of these plant communities. Non-fungal eukaryotic 18S rRNA genes were also amplified with the primer sets used. This is the first report where culture-independent methods have been applied to flocculated activated sludge biomass samples to estimate fungal community composition and, as expected, the data obtained gave a markedly different view of their population biodiversity compared to that based on culture-dependent methods.

Development of an assay for rapid identification of meat from yak and cattle using polymerase chain reaction technique.

PubMed

Yin, R H; Bai, W L; Wang, J M; Wu, C D; Dou, Q L; Yin, R L; He, J B; Luo, G B

2009-09-01

Yak meat is of good quality with fine texture, high protein and low fat content, and rich in amino acids compared with that of cattle, and it lacks anabolic steroids or other drugs. In general terms, however, the meat yield of yak is relatively low compared with that of the cattle. In order to prevent possible adulteration of yak meat with cattle meat, based on the sequence of mitochondrial 12S rRNA gene, a multiplex PCR-based approach was proposed for rapid identification of the meat from yak and cattle using three primers designed in this work. Through the combinatorial usage of three primers with a single reaction set, two fragments of 290 and 159bp were amplified from the cattle meat DNA, whereas only a fragment of 290bp was obtained from the yak meat DNA. Using the assay described, satisfactory amplification was accomplished in the analysis of raw and heat-treated binary meat mixtures of yak/cattle with a detection limit of 0.1% for cattle meat. The technique is fast and straightforward. It might be a useful tool in the quality control of yak meat and meat products.

Analysis of genetic diversity and population structure of oil palm (Elaeis guineensis) from China and Malaysia based on species-specific simple sequence repeat markers.

PubMed

Zhou, L X; Xiao, Y; Xia, W; Yang, Y D

2015-12-08

Genetic diversity and patterns of population structure of the 94 oil palm lines were investigated using species-specific simple sequence repeat (SSR) markers. We designed primers for 63 SSR loci based on their flanking sequences and conducted amplification in 94 oil palm DNA samples. The amplification result showed that a relatively high level of genetic diversity was observed between oil palm individuals according a set of 21 polymorphic microsatellite loci. The observed heterozygosity (Ho) was 0.3683 and 0.4035, with an average of 0.3859. The Ho value was a reliable determinant of the discriminatory power of the SSR primer combinations. The principal component analysis and unweighted pair-group method with arithmetic averaging cluster analysis showed the 94 oil palm lines were grouped into one cluster. These results demonstrated that the oil palm in Hainan Province of China and the germplasm introduced from Malaysia may be from the same source. The SSR protocol was effective and reliable for assessing the genetic diversity of oil palm. Knowledge of the genetic diversity and population structure will be crucial for establishing appropriate management stocks for this species.

Development of SCAR marker for discrimination of Artemisia princeps and A. argyi from other Artemisia herbs.

PubMed

Lee, Mi Young; Doh, Eui Jeong; Park, Chae Haeng; Kim, Young Hwa; Kim, Eung Soo; Ko, Byong Seob; Oh, Seung-Eun

2006-04-01

Some Artemisia herbs are used for medicinal purposes. In particular, A. princeps and A. argyi are classified as 'Aeyup' and are used as important medicinal material in traditional Korean medicine. On the other hand, A. capillaris and A. iwayomogi, which are classified as 'Injinho' and 'Haninjin', respectively, are used for other purposes distinct from those of 'Aeyup'. However, sometimes 'Aeyup' is not clearly discriminated from 'Injinho' and/or 'Haninjin'. Furthermore, Artemisia capillaris and/or A. iwayomogi have been used in place of A. princeps and A. argyi. In this study, we developed an efficient method to discriminate A. argyi and A. princeps from other Artemisia plants. The RAPD (random amplified polymorphic DNA) method efficiently discriminated various Artemisia herbs. In particular, non-specific primer 329 (5'-GCG AAC CTC C-3'), which shows polymorphism among Artemisia herbs, amplified 838 bp products, which are specific to A. princeps and A. argyi only. Based on nucleotide sequence of the primer 329 product, we designed a Fb (5'-CAT CAA CCA TGG CTT ATC CT-3') and R7 (5'-GCG AAC CTC CCC ATT CCA-3') primer-set to amplify a 254 bp sized SCAR (sequence characterized amplified regions) marker, through which A. princeps and A. argyi can be efficiently discriminated from other Artemisia herbs, particularly, A. capillaris and A. iwayomogi.

Quantification of intestinal bacterial populations by real-time PCR with a universal primer set and minor groove binder probes: a global approach to the enteric flora.

PubMed

Ott, Stephan J; Musfeldt, Meike; Ullmann, Uwe; Hampe, Jochen; Schreiber, Stefan

2004-06-01

The composition of the human intestinal flora is important for the health status of the host. The global composition and the presence of specific pathogens are relevant to the effects of the flora. Therefore, accurate quantification of all major bacterial populations of the enteric flora is needed. A TaqMan real-time PCR-based method for the quantification of 20 dominant bacterial species and groups of the intestinal flora has been established on the basis of 16S ribosomal DNA taxonomy. A PCR with conserved primers was used for all reactions. In each real-time PCR, a universal probe for quantification of total bacteria and a specific probe for the species in question were included. PCR with conserved primers and the universal probe for total bacteria allowed relative and absolute quantification. Minor groove binder probes increased the sensitivity of the assays 10- to 100-fold. The method was evaluated by cross-reaction experiments and quantification of bacteria in complex clinical samples from healthy patients. A sensitivity of 10(1) to 10(3) bacterial cells per sample was achieved. No significant cross-reaction was observed. The real-time PCR assays presented may facilitate understanding of the intestinal bacterial flora through a normalized global estimation of the major contributing species.

Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane

PubMed Central

Zhou, Dinggang; Guo, Jinlong; Xu, Liping; Gao, Shiwu; Lin, Qingliang; Wu, Qibin; Wu, Luguang; Que, Youxiong

2014-01-01

To meet the demand for detection of foreign genes in genetically modified (GM) sugarcane necessary for regulation of gene technology, an efficient method with high specificity and rapidity was developed for the cry1Ac gene, based on loop-mediated isothermal amplification (LAMP). A set of four primers was designed using the sequence of cry1Ac along with optimized reaction conditions: 5.25 mM of Mg2+, 4:1 ratio of inner primer to outer primer, 2.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. Three post-LAMP detection methods (precipitation, calcein (0.60 mM) with Mn2+ (0.05 mM) complex and SYBR Green I visualization), were shown to be effective. The sensitivity of the LAMP method was tenfold higher than that of conventional PCR when using templates of the recombinant cry1Ac plasmid or genomic DNA from cry1Ac transgenic sugarcane plants. More importantly, this system allowed detection of the foreign gene on-site when screening GM sugarcane without complex and expensive instruments, using the naked eye. This method can not only provide technological support for detection of cry1Ac, but can also further facilitate the use of this detection technique for other transgenes in GM sugarcane. PMID:24810230

RUCS: rapid identification of PCR primers for unique core sequences.

PubMed

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

2017-12-15

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

PubMed Central

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

PubMed

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

PubMed Central

Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

2003-01-01

We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

A NASTRAN primer for the analysis of rotating flexible blades

NASA Technical Reports Server (NTRS)

Lawrence, Charles; Aiello, Robert A.; Ernst, Michael A.; Mcgee, Oliver G.

1987-01-01

This primer provides documentation for using MSC NASTRAN in analyzing rotating flexible blades. The analysis of these blades includes geometrically nonlinear (large displacement) analysis under centrifugal loading, and frequency and mode shape (normal modes) determination. The geometrically nonlinear analysis using NASTRAN Solution sequence 64 is discussed along with the determination of frequencies and mode shapes using Solution Sequence 63. A sample problem with the complete NASTRAN input data is included. Items unique to rotating blade analyses, such as setting angle and centrifugal softening effects are emphasized.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

PubMed

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Computer-Mediated Materials for Chinese Character Learning.

ERIC Educational Resources Information Center

Hsu, Hui-Mei; Gao, Liwei

2002-01-01

Reviews four sets of computer-mediated materials for Chinese character learning. These include the following: Write Chinese, Chinese Characters Primer, Animated Chinese Characters, and USC Chinese Character Page. (Author/VWL)

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Grapevine fleck virus-like viruses in Vitis.

PubMed

Sabanadzovic, S; Abou-Ghanem, N; Castellano, M A; Digiaro, M; Martelli, G P

2000-01-01

Two sets of degenerate primers for the specific amplification of 572-575 nt and 386 nt segments of the methyltransferase and RNA- dependent RNA polymerase cistrons of members of the genera Tymovirus and Marafivirus and of the unassigned virus Grapevine fleck virus (GFkV) were designed on the basis of available sequences. These primers were used for amplifying and subsequent cloning and sequencing part of the open reading frame 1 of the genome of GFkV, Grapevine asteroid mosaic-associated virus (GAMaV) and of another previously unreported virus, for which the name Grapevine red globe virus (GRGV) is proposed. Computer-assisted analysis of the amplified genome portions showed that the three grapevine viruses are phylogenetically related with one another and with sequenced tymoviruses and marafiviruses. The relationships with tymoviruses was confirmed by the type of ultrastructural modifications induced in the host cells. RdRp-specific degenerate primers were successfully used for the aspecific detection of the three viruses in crude grapevine sap extracts. Specific virus identification was obtained with RT-PCR using antisense virus-specific primers.

Diagnosis and molecular characterization of Trichomonas vaginalis in sex workers in the Philippines

PubMed Central

Queza, Macario Ireneo P; Rivera, Windell L

2013-01-01

Trichomonas vaginalis is a pathogenic protozoon which causes the sexually transmitted infection, trichomoniasis. The absence or non-specificity of symptoms often leads to misdiagnosis of the infection. In this study, 969 samples consisting of vaginal swabs and urine were collected and screened from social hygiene clinics across the Philippines. Of the 969 samples, 216 were used for the comparative analysis of diagnostic tools such as wet mount microscopy, culture, and PCR utilizing universal trichomonad primers, TFR1/2 and species-specific primers, TVK3/7 and TV1/2. PCR demonstrated higher sensitivity of 100% compared to 77% of the wet mount. PCR primer set TVK3/7 and culture had the same and the best expected average performance [receiver-operating characteristic (ROC): 0.98]. Prevalence of infection in the sample population was 6.8%. PMID:23683368

Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

PubMed

Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

2014-09-01

Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We found that a number of variables, including the virus type examined, primers and probe efficiency and stability, and assay conditions, including thermocycler platform, can affect the data obtained from qRT-PCR assays. These results indicate that qRT-PCR assays can be used to detect IBV challenge virus, but each assay, including the assay conditions and thermocycler, should be individually evaluated if those data are expected to be comparable to virus detection in embryonated eggs.

A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

PubMed

Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

2015-02-01

A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

PubMed

Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

2014-11-01

In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

PubMed

Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

2015-01-01

Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and the prevention of preterm delivery.

Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases

PubMed Central

Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

2015-01-01

Background Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. Methods We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Results Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. Conclusions We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and the prevention of preterm delivery. PMID:26042418

Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples.

PubMed

Alasaad, Noor; Alzubi, Hussein; Kader, Ahmad Abdul

2016-06-01

Food and feed samples were randomly collected from different sources, including local and imported materials from the Syrian local market. These included maize, barley, soybean, fresh food samples and raw material. GMO detection was conducted by PCR and nested PCR-based techniques using specific primers for the most used foreign DNA commonly used in genetic transformation procedures, i.e., 35S promoter, T-nos, epsps, cryIA(b) gene and nptII gene. The results revealed for the first time in Syria the presence of GM foods and feeds with glyphosate-resistant trait of P35S promoter and NOS terminator in the imported soybean samples with high frequency (5 out of the 6 imported soybean samples). While, tests showed negative results for the local samples. Also, tests revealed existence of GMOs in two imported maize samples detecting the presence of 35S promoter and nos terminator. Nested PCR results using two sets of primers confirmed our data. The methods applied in the brief data are based on DNA analysis by Polymerase Chain Reaction (PCR). This technique is specific, practical, reproducible and sensitive enough to detect up to 0.1% GMO in food and/or feedstuffs. Furthermore, all of the techniques mentioned are economic and can be applied in Syria and other developing countries. For all these reasons, the DNA-based analysis methods were chosen and preferred over protein-based analysis.

A Web-Based Adaptive Tutor to Teach PCR Primer Design

ERIC Educational Resources Information Center

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

FUNGAL BIOGEOGRAPHY. Response to Comment on "Global diversity and geography of soil fungi".

PubMed

Tedersoo, Leho; Bahram, Mohammad; Põlme, Sergei; Anslan, Sten; Riit, Taavi; Kõljalg, Urmas; Nilsson, R Henrik; Hildebrand, Falk; Abarenkov, Kessy

2015-08-28

Schadt and Rosling (Technical Comment, 26 June 2015, p. 1438) argue that primer-template mismatches neglected the fungal class Archaeorhizomycetes in a global soil survey. Amplicon-based metabarcoding of nine barcode-primer pair combinations and polymerase chain reaction (PCR)-free shotgun metagenomics revealed that barcode and primer choice and PCR bias drive the diversity and composition of microorganisms in general, but the Archaeorhizomycetes were little affected in the global study. We urge that careful choice of DNA markers and primers is essential for ecological studies using high-throughput sequencing for identification. Copyright © 2015, American Association for the Advancement of Science.

Development of highly polymorphic simple sequence repeat markers using genome-wide microsatellite variant analysis in Foxtail millet [Setaria italica (L.) P. Beauv.

PubMed Central

2014-01-01

Background Foxtail millet (Setaria italica (L.) Beauv.) is an important gramineous grain-food and forage crop. It is grown worldwide for human and livestock consumption. Its small genome and diploid nature have led to foxtail millet fast becoming a novel model for investigating plant architecture, drought tolerance and C4 photosynthesis of grain and bioenergy crops. Therefore, cost-effective, reliable and highly polymorphic molecular markers covering the entire genome are required for diversity, mapping and functional genomics studies in this model species. Result A total of 5,020 highly repetitive microsatellite motifs were isolated from the released genome of the genotype 'Yugu1’ by sequence scanning. Based on sequence comparison between S. italica and S. viridis, a set of 788 SSR primer pairs were designed. Of these primers, 733 produced reproducible amplicons and were polymorphic among 28 Setaria genotypes selected from diverse geographical locations. The number of alleles detected by these SSR markers ranged from 2 to 16, with an average polymorphism information content of 0.67. The result obtained by neighbor-joining cluster analysis of 28 Setaria genotypes, based on Nei’s genetic distance of the SSR data, showed that these SSR markers are highly polymorphic and effective. Conclusions A large set of highly polymorphic SSR markers were successfully and efficiently developed based on genomic sequence comparison between different genotypes of the genus Setaria. The large number of new SSR markers and their placement on the physical map represent a valuable resource for studying diversity, constructing genetic maps, functional gene mapping, QTL exploration and molecular breeding in foxtail millet and its closely related species. PMID:24472631

Development of highly polymorphic simple sequence repeat markers using genome-wide microsatellite variant analysis in Foxtail millet [Setaria italica (L.) P. Beauv].

PubMed

Zhang, Shuo; Tang, Chanjuan; Zhao, Qiang; Li, Jing; Yang, Lifang; Qie, Lufeng; Fan, Xingke; Li, Lin; Zhang, Ning; Zhao, Meicheng; Liu, Xiaotong; Chai, Yang; Zhang, Xue; Wang, Hailong; Li, Yingtao; Li, Wen; Zhi, Hui; Jia, Guanqing; Diao, Xianmin

2014-01-28

Foxtail millet (Setaria italica (L.) Beauv.) is an important gramineous grain-food and forage crop. It is grown worldwide for human and livestock consumption. Its small genome and diploid nature have led to foxtail millet fast becoming a novel model for investigating plant architecture, drought tolerance and C4 photosynthesis of grain and bioenergy crops. Therefore, cost-effective, reliable and highly polymorphic molecular markers covering the entire genome are required for diversity, mapping and functional genomics studies in this model species. A total of 5,020 highly repetitive microsatellite motifs were isolated from the released genome of the genotype 'Yugu1' by sequence scanning. Based on sequence comparison between S. italica and S. viridis, a set of 788 SSR primer pairs were designed. Of these primers, 733 produced reproducible amplicons and were polymorphic among 28 Setaria genotypes selected from diverse geographical locations. The number of alleles detected by these SSR markers ranged from 2 to 16, with an average polymorphism information content of 0.67. The result obtained by neighbor-joining cluster analysis of 28 Setaria genotypes, based on Nei's genetic distance of the SSR data, showed that these SSR markers are highly polymorphic and effective. A large set of highly polymorphic SSR markers were successfully and efficiently developed based on genomic sequence comparison between different genotypes of the genus Setaria. The large number of new SSR markers and their placement on the physical map represent a valuable resource for studying diversity, constructing genetic maps, functional gene mapping, QTL exploration and molecular breeding in foxtail millet and its closely related species.

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

PubMed Central

Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

2015-01-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species.

PubMed

Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W

2015-07-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.

The acid-base resistant zone in three dentin bonding systems.

PubMed

Inoue, Go; Nikaido, Toru; Foxton, Richard M; Tagami, Junji

2009-11-01

An acid-base resistant zone has been found to exist after acid-base challenge adjacent to the hybrid layer using SEM. The aim of this study was to examine the acid-base resistant zone using three different bonding systems. Dentin disks were applied with three different bonding systems, and then a resin composite was light-cured to make dentin disk sandwiches. After acid-base challenge, the polished surfaces were observed using SEM. For both one- and two-step self-etching primer systems, an acid-base resistant zone was clearly observed adjacent to the hybrid layer - but with differing appearances. For the wet bonding system, the presence of an acid-base resistant zone was unclear. This was because the self-etching primer systems etched the dentin surface mildly, such that the remaining mineral phase of dentin and the bonding agent yielded clear acid-base resistant zones. In conclusion, the acid-base resistant zone was clearly observed when self-etching primer systems were used, but not so for the wet bonding system.

Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

NASA Astrophysics Data System (ADS)

Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

2004-12-01

The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection of microorganisms with important genes from more other environments.

Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

PubMed Central

Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

2010-01-01

A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

Use of tannin anticorrosive reaction primer to improve traditional coating systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matamala, G.; Droguett, G.; Smeltzer, W.

1994-04-01

Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

PubMed

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections

PubMed Central

Schäffer, Sylvia; Zachos, Frank E.

2017-01-01

DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher) material is often very difficult to (nearly) impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens. PMID:28358863

Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections.

PubMed

Schäffer, Sylvia; Zachos, Frank E; Koblmüller, Stephan

2017-01-01

DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher) material is often very difficult to (nearly) impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.

Development of Species-Specific Primers for Agronomical Thrips and Multiplex Assay for Quarantine Identification of Western Flower Thrips.

PubMed

Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

2014-10-01

While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

PubMed

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Community-based interventions to promote increased physical activity: a primer.

PubMed

Bopp, Melissa; Fallon, Elizabeth

2008-01-01

Current recommendations, based on an abundance of empirical data documenting the impact of physical activity (PA) on preventing morbidity and mortality associated with common chronic diseases, indicate that adults should accumulate 30 minutes of moderate-intensity PA > or =5 days per week. However, worldwide rates of PA remain low, indicating a great need for large-scale implementation of evidence-based PA interventions. We briefly present practical aspects of intervention planning, implementation and evaluation within common community settings. The first stage of intervention planning is formative research, which allows for a better understanding of the elements needed for a successful intervention. Partnering with community settings (schools, worksites, faith-based organizations and healthcare organizations) offers many benefits and the opportunity to reach specific populations. Setting-based approaches allow for multilevel strategies, ranging from individual-based programmes and educational initiatives to physical and social environmental changes. Various settings such as healthcare, worksite, and school- and community-based settings are discussed. Intervention delivery methods and strategies can range, depending on the population and setting targeted, from small-group approaches to mediated methods (e.g. print, telephone, electronic). The final phase of intervention planning and implementation is evaluation. Several objective and subjective methods of PA assessment are available to determine the effectiveness of the intervention. We have highlighted the need for process evaluation of intervention implementation to provide valuable information for the dissemination and sustainability of successful interventions. Although there are numerous considerations for the design, implementation, assessment and evaluation of PA interventions, the potential for positive impact on the overall health of the public indicates the necessity for programmes designed to increase PA.

Primer ID Validates Template Sampling Depth and Greatly Reduces the Error Rate of Next-Generation Sequencing of HIV-1 Genomic RNA Populations

PubMed Central

Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr

2015-01-01

ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299

Hepatitis E Virus (HEV) Detection and Quantification by a Real-Time Reverse Transcription-PCR Assay Calibrated to the World Health Organization Standard for HEV RNA

PubMed Central

Germer, Jeffrey J.; Ankoudinova, Irina; Belousov, Yevgeniy S.; Mahoney, Walt; Dong, Chen; Meng, Jihong; Mandrekar, Jayawant N.

2017-01-01

ABSTRACT Hepatitis E virus (HEV) has emerged as a cause of chronic hepatitis among immunocompromised patients. Molecular assays have become important tools for the diagnosis and management of these chronically infected patients. A real-time reverse transcription-quantitative PCR (RT-qPCR) assay utilizing Pleiades probe chemistry and an RNA internal control for the simultaneous detection and quantification of HEV RNA in human serum was developed based on an adaptation of a previously described and broadly reactive primer set targeting the overlapping open reading frame 2/3 (ORF2/3) nucleotide sequence of HEV. A chimeric bovine viral diarrhea virus construct containing an HEV RNA insert (SynTura HEV) was developed, value assigned with the first World Health Organization (WHO) international standard for HEV RNA (code 6329/10), and used to prepare working assay calibrators and controls, which supported an assay quantification range of 100 to 5,000,000 IU/ml. The analytical sensitivity (95% detection rate) of this assay was 25.2 IU/ml (95% confidence interval [CI], 19.2 to 44.1 IU/ml). The assay successfully amplified 16 different HEV sequences with significant nucleotide mismatching in primer/probe binding regions, while evaluation of a WHO international reference panel for HEV genotypes (code 8578/13) showed viral load results falling within the result ranges generated by WHO collaborative study participants for all panel members (genotypes 1 to 4). Broadly reactive RT-qPCR primers targeting HEV ORF2/3 were successfully adapted for use in an assay based on Pleiades probe chemistry. The availability of secondary standards calibrated to the WHO HEV international standard can improve the standardization and performance of assays for the detection and quantification of HEV RNA. PMID:28228493

Morpho-molecular analysis as a prognostic model for repulsive feedback of the medicinal plant "Andrographis paniculata" to allogamy.

PubMed

Valdiani, Alireza; Talei, Daryush; Javanmard, Arash; Tan, Soon Guan; Kadir, Mihdzar Abdul; Maziah, Mahmood

2014-06-01

Andrographis paniculata Nees. (AP) is a self-pollinated medicinal herb with a wide range of pharmaceutical properties, facing a low diversity in Malaysia. Cross-pollination of AP accessions leads to considerable rates of heterosis in the agro-morphological characteristics and anticancer phytochemicals of this eminent medicinal herb. However, the poor crossability of the plant at the interpopulation or intraspecific levels is an obstacle from the evolutionary and breeding points of view as an average of 4.56% crossability was recorded for AP in this study. Hence, this research aimed to elicit the impact of parental genetic distances (GDs) on the rate of crossability of AP using seven accessions in 21 possible cross combinations. To this end, a set of 55 randomly amplified polymorphic DNA (RAPD) primers and a total of 13 agro-morphological markers were employed to test the hypothesis. Twenty-two out of the 55 RAPD primers amplified a total of 257 bands of which 107 bands were found to be polymorphic. The principal component analysis (PCA) based on the RAPD markers revealed that the studied AP accessions were distributed to three distinct groups. Furthermore, it was noticed that even a minor increase in GD between two parents can cause a decline in their crossability. Unlike, the morphological-based GDs acted neutrally to crossability. This finding suggests that, despite the low genetic diversity among the Malaysian APs, a population prescreening using RAPD markers would be useful to enhance the rate of fruit set through selecting the genetically adjacent parents. Copyright © 2014 Elsevier B.V. All rights reserved.

Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.

PubMed

Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan

2015-09-01

The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE PAGES

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

2015-12-09

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

Routes to effective evacuation planning primer series : evacuating populations with special needs.

DOT National Transportation Integrated Search

2009-04-01

Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

High-throughput detection of human papillomavirus-18 L1 gene methylation, a candidate biomarker for the progression of cervical neoplasia.

PubMed

Turan, Tolga; Kalantari, Mina; Cuschieri, Kate; Cubie, Heather A; Skomedal, Hanne; Bernard, Hans-Ulrich

2007-04-25

The L1 gene of human papillomavirus-18 (HPV-18) is consistently hypermethylated in cervical carcinomas, but frequently hypo- or unmethylated in exfoliated cells from asymptomatic patients. In precancerous lesions, L1 is sporadically hypermethylated, correlating with the severity of the neoplasia. In order to explore the potential of using L1 methylation as a workable biomarker for carcinogenic progression of HPV-18 infections in routinely taken samples, our aim was to develop methylation-detection techniques that were sensitive and rapid without being overly complex technically. Therein, we developed a methylation-specific PCR (MSP) through the design of primer sets that specifically amplify either methylated or unmethylated HPV-18 L1 DNA within bisulfite-modified sample DNA. Amplification of unmethylated and in vitro methylated HPV-18 DNA by MSP resulted in 2500 copies of either of the two L1 DNA species being detected, a satisfactory sensitivity considering that bisulfite treatment leads to the fragmentation of about 99% of sample DNA. The primers proved specific and did not generate false positive results at concentrations exceeding the lowest limit of detection by a factor of 400. DNA from carcinomas yielded PCR signals only with the methylation-specific primers, and not with primers specific for unmethylated L1 genes. The inverse result was obtained with DNA from precursor lesions that contained only hypomethylated DNA. High-grade precursor lesions and carcinomas that contained hyper- as well as hypomethylated L1 DNA yielded PCR signals with both primers. By developing a fluorescence based real-time PCR, we quantitatively analyzed samples with in vitro methylated and unmethylated L1 DNA, and could distinguish clinical samples with hyper- and hypomethylated DNA or mixtures of both DNAs. The methylation-specific and real-time PCR techniques permitted efficient HPV-18 L1 methylation analyses and open the door for larger-scale clinical studies where the utility of methylation status to predict the progression of HPV-18 infection and HPV-18 associated lesions is assessed.

A field based detection method for Rose rosette virus using isothermal probe-based Reverse transcription-recombinase polymerase amplification assay.

PubMed

Babu, Binoy; Washburn, Brian K; Ertek, Tülin Sarigül; Miller, Steven H; Riddle, Charles B; Knox, Gary W; Ochoa-Corona, Francisco M; Olson, Jennifer; Katırcıoğlu, Yakup Zekai; Paret, Mathews L

2017-09-01

Rose rosette disease, caused by Rose rosette virus (RRV; genus Emaravirus) is a major threat to the rose industry in the U.S. The only strategy currently available for disease management is early detection and eradication of the infected plants, thereby limiting its potential spread. Current RT-PCR based diagnostic methods for RRV are time consuming and are inconsistent in detecting the virus from symptomatic plants. Real-time RT-qPCR assay is highly sensitive for detection of RRV, but it is expensive and requires well-equipped laboratories. Both the RT-PCR and RT-qPCR cannot be used in a field-based testing for RRV. Hence a novel probe based, isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA) assay, using primer/probe designed based on the nucleocapsid gene of the RRV has been developed. The assay is highly specific and did not give a positive reaction to other viruses infecting roses belonging to both inclusive and exclusive genus. Dilution assays using the in vitro transcript showed that the primer/probe set is highly sensitive, with a detection limit of 1 fg/μl. In addition, a rapid technique for the extraction of viral RNA (<5min) has been standardized from RRV infected tissue sources, using PBS-T buffer (pH 7.4), which facilitates the virus adsorption onto the PCR tubes at 4°C for 2min, followed by denaturation to release the RNA. RT-exoRPA analysis of the infected plants using the primer/probe indicated that the virus could be detected from leaves, stems, petals, pollen, primary roots and secondary roots. In addition, the assay was efficiently used in the diagnosis of RRV from different rose varieties, collected from different states in the U.S. The entire process, including the extraction can be completed in 25min, with less sophisticated equipments. The developed assay can be used with high efficiency in large scale field testing for rapid detection of RRV in commercial nurseries and landscapes. Copyright © 2017 Elsevier B.V. All rights reserved.

Microsatellite markers for northern red oak (Fagaceae: Quercus rubra)

Treesearch

Preston R. Aldrich; Charles H. Michler; Weilin Sun; Jeanne Romero-Severson

2002-01-01

We provide primer sequences for 14 (GA)n microsatellite loci developed from northern red oak, an important timber species. We screened loci using two sets of samples. A parent-offspring set included DNA from seven acorns collected from one mother tree along with maternal DNA, to determine that all progeny carried a maternal allele at each locus....

Development of a molecular approach to describe the composition of Trichoderma communities.

PubMed

Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele

2010-01-01

Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.

Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

PubMed Central

Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

2005-01-01

A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

Influence of phosphoproteins' biomimetic analogs on remineralization of mineral-depleted resin-dentin interfaces created with ion-releasing resin-based systems.

PubMed

Sauro, Salvatore; Osorio, Raquel; Watson, Timothy F; Toledano, Manuel

2015-07-01

The study aimed at evaluating the remineralization of acid-etched dentin pre-treated with primers containing biomimetic analogs and bonded using an ion-releasing light-curable resin-based material. An experimental etch-and-rinse adhesive system filled with Ca(2+), PO4(3-)-releasing Ca-Silicate micro-fillers was created along with two experimental primers containing biomimetic analogs such as sodium trimetaphosphate (TMP) and/or polyaspartic acid (PLA). Dentin specimens etched with 37% H3PO4 were pre-treated with two different aqueous primers containing the polyanionic biomimetic analogs or deionized water and subsequently bonded using the experimental resin-based materials. The specimens were sectioned and analyzed by AFM/nanoindentation to evaluate changes in the modulus of elasticity (Ei) across the resin-dentin interface at different AS storage periods (up to 90 days). Raman cluster analysis was also performed to evaluate the chemical changes along the interface. The phosphate uptake by the acid-etched dentin was evaluated using the ATR-FTIR. Additional resin-dentin specimens were tested for microtensile bond strength. SEM examination was performed after de-bonding, while confocal laser microscopy was used to evaluate the interfaces ultramorphology and micropermeability. Both biomimetic primers induced phosphate uptake by acid-etched dentin. Specimens created with the ion-releasing resin in combination with the pre-treatment primers containing either PLA and TMA showed the greatest recovery of the Ei of the hybrid layer, with no decrease in μTBS (p>0.05) after 3-month AS storage. The ion-releasing resin applied after use of the biomimetic primers showed the greatest reduction in micropermeability due to mineral precipitation; these results were confirmed using SEM. The use of the ion-releasing resin-based system applied to acid-etched dentin pre-treated with biomimetic primers containing analogs of phosphoproteins such as poly-l-aspartic acid and/or sodium trimetaphosphate provides a suitable bonding approach for biomimetic remineralization of resin-dentin interfaces. Copyright © 2015 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

PubMed

Liu, Ning; Tian, Ru; Loeb, Daniel D

2003-02-18

Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

PubMed

Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

2008-06-15

A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

Detection and Diversity of Fungal Nitric Oxide Reductase Genes (p450nor) in Agricultural Soils

PubMed Central

Welsh, Allana; Orellana, Luis H.; Konstantinidis, Konstantinos T.; Chee-Sanford, Joanne C.; Sanford, Robert A.; Schadt, Christopher W.

2016-01-01

ABSTRACT Members of the Fungi convert nitrate (NO3−) and nitrite (NO2−) to gaseous nitrous oxide (N2O) (denitrification), but the fungal contributions to N loss from soil remain uncertain. Cultivation-based methodologies that include antibiotics to selectively assess fungal activities have limitations, and complementary molecular approaches to assign denitrification potential to fungi are desirable. Microcosms established with soils from two representative U.S. Midwest agricultural regions produced N2O from added NO3− or NO2− in the presence of antibiotics to inhibit bacteria. Cultivation efforts yielded 214 fungal isolates belonging to at least 15 distinct morphological groups, 151 of which produced N2O from NO2−. Novel PCR primers targeting the p450nor gene, which encodes the nitric oxide (NO) reductase responsible for N2O production in fungi, yielded 26 novel p450nor amplicons from DNA of 37 isolates and 23 amplicons from environmental DNA obtained from two agricultural soils. The sequences shared 54 to 98% amino acid identity with reference P450nor sequences within the phylum Ascomycota and expand the known fungal P450nor sequence diversity. p450nor was detected in all fungal isolates that produced N2O from NO2−, whereas nirK (encoding the NO-forming NO2− reductase) was amplified in only 13 to 74% of the N2O-forming isolates using two separate nirK primer sets. Collectively, our findings demonstrate the value of p450nor-targeted PCR to complement existing approaches to assess the fungal contributions to denitrification and N2O formation. IMPORTANCE A comprehensive understanding of the microbiota controlling soil N loss and greenhouse gas (N2O) emissions is crucial for sustainable agricultural practices and addressing climate change concerns. We report the design and application of a novel PCR primer set targeting fungal p450nor, a biomarker for fungal N2O production, and demonstrate the utility of the new approach to assess fungal denitrification potential in fungal isolates and agricultural soils. These new PCR primers may find application in a variety of biomes to assess the fungal contributions to N loss and N2O emissions. PMID:26969694

A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

PubMed

Kemp, S J; Maillard, J C; Teale, A J

1993-04-01

A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

Rapid development of microsatellite markers with 454 pyrosequencing in a vulnerable fish, the mottled skate, Raja pulchra.

PubMed

Kang, Jung-Ha; Park, Jung-Youn; Jo, Hyun-Su

2012-01-01

The mottled skate, Raja pulchra, is an economically valuable fish. However, due to a severe population decline, it is listed as a vulnerable species by the International Union for Conservation of Nature. To analyze its genetic structure and diversity, microsatellite markers were developed using 454 pyrosequencing. A total of 17,033 reads containing dinucleotide microsatellite repeat units (mean, 487 base pairs) were identified from 453,549 reads. Among 32 loci containing more than nine repeat units, 20 primer sets (62%) produced strong PCR products, of which 14 were polymorphic. In an analysis of 60 individuals from two R. pulchra populations, the number of alleles per locus ranged from 1-10, and the mean allelic richness was 4.7. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy-Weinberg equilibrium test showed significant deviation in two of the 28 single-loci after sequential Bonferroni's correction. Using 11 primer sets, cross-species amplification was demonstrated in nine related species from four families within two classes. Among the 11 loci amplified from three other Rajidae family species; three loci were polymorphic. A monomorphic locus was amplified in all three Rajidae family species and the Dasyatidae family. Two Rajidae polymorphic loci amplified monomorphic target DNAs in four species belonging to the Carcharhiniformes class, and another was polymorphic in two Carcharhiniformes species.

16S rRNA PCR-Denaturing Gradient Gel Electrophoresis of Oral Lactobacillus casei Group and Their Phenotypic Appearances.

PubMed

Piwat, S; Teanpaisan, R

2013-01-01

This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances.

16S rRNA PCR-Denaturing Gradient Gel Electrophoresis of Oral Lactobacillus casei Group and Their Phenotypic Appearances

PubMed Central

Piwat, S.; Teanpaisan, R.

2013-01-01

This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances. PMID:24191230

Rapid Development of Microsatellite Markers with 454 Pyrosequencing in a Vulnerable Fish, the Mottled Skate, Raja pulchra

PubMed Central

Kang, Jung-Ha; Park, Jung-Youn; Jo, Hyun-Su

2012-01-01

The mottled skate, Raja pulchra, is an economically valuable fish. However, due to a severe population decline, it is listed as a vulnerable species by the International Union for Conservation of Nature. To analyze its genetic structure and diversity, microsatellite markers were developed using 454 pyrosequencing. A total of 17,033 reads containing dinucleotide microsatellite repeat units (mean, 487 base pairs) were identified from 453,549 reads. Among 32 loci containing more than nine repeat units, 20 primer sets (62%) produced strong PCR products, of which 14 were polymorphic. In an analysis of 60 individuals from two R. pulchra populations, the number of alleles per locus ranged from 1–10, and the mean allelic richness was 4.7. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy–Weinberg equilibrium test showed significant deviation in two of the 28 single-loci after sequential Bonferroni’s correction. Using 11 primer sets, cross-species amplification was demonstrated in nine related species from four families within two classes. Among the 11 loci amplified from three other Rajidae family species; three loci were polymorphic. A monomorphic locus was amplified in all three Rajidae family species and the Dasyatidae family. Two Rajidae polymorphic loci amplified monomorphic target DNAs in four species belonging to the Carcharhiniformes class, and another was polymorphic in two Carcharhiniformes species. PMID:22837688

A Descriptive Overview of Japanese Shipbuilding Surface Preparation and Coating Methods

DTIC Science & Technology

1982-09-01

INORGANIC SHOP PRIMER I Materials I Weight BASE PASTE Total Alkyl-silicate Catalyst Alcohol Special organic resin Tinting pigment Anti-sagging agent... Alcohol Zinc powder 32.0 2.0 6.0 0.5 8.0 40.0 100.0 Shop Primer Composition (Courtesy of Chugoku Marine Paints 51 Limited) 4.2.1 Shop Primer...at a pH of 10 is added to minimize the oxydizing reactions which lead to salt formation and adhesion failure. “Galvanite” is the trade name for the

In vitro cytotoxicity of orthodontic primers.

PubMed

D'Antò, Vincenzo; Spagnuolo, Gianrico; Polito, Ilaria; Paduano, Sergio; Ambrosio, Luigi; Valletta, Rosa

2009-01-01

The aim of this study was to evaluate the cytotoxicity of four orthodontic primers: Transbond XT and Transbond MIP (3M, USA), Eagle Fluorsure (American Orthodontics, USA) and Ortho Solo (Ormco, USA). Balb 3T3 cells were exposed to different concentrations of primers (0-0.25 mg/ml). Mitochondrial dehydrogenase activity was evaluated by MTT assay and cell necrosis was measured by flow cytometry (propidium iodide staining). All the materials decreased cell viability in a dose related manner. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease of mitochondrial activity was ranked as follows: Transbond XT (45.57 mg/ml) > Eagle Fluorsure (49.27 mg/ml) > Transbond MIP (64.35 mg/ml) > Ortho solo (70.09 mg/ml). Our results suggest that the cytotoxic potencies demonstrated by orthodontic primers might be of clinical relevance since they disturbed cell metabolism and induced cell death in monolayer cultures.

ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

PubMed

Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

2017-10-01

ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

PubMed

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

PubMed

Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

2006-01-01

A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls.

PubMed

Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

2010-03-05

The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.

Homoeologous cloning of omega-secalin gene family in a wheat 1BL/1RS translocation.

PubMed

Chai, Jian Fang; Liu, Xu; Jia, Ji Zeng

2005-08-01

Wheat 1BL/1RS translocations are widely planted in China as well as in most of the wheat producing area in the world for their good qualities of disease resistance and high yield. 1BL/1RS translocations are however poor in bread making, partially caused by a family of small monomeric proteins, omega-secalins, which are encoded by genes on 1RS. Based on published sequence of a rye omega-secalin gene we designed a pair of primers to cover the whole mature protein coding sequence. A major band could be amplified from 1BL/1RS translocations but not from euploid wheat. Using this primer set we conducted PCR amplification by using high fidelity Pfu polymerase on the genomic DNAs and cDNAs purified from a 1BL/1RS translocation Lankao 906. Sequencing analysis indicated that this gene family contains several members of 1150 bp, 1076 bp, 1075 bp, 1052 bp and 1004 bp genes, including two pseudogenes and three active genes. The gene transcripts were differentially expressed in developing seeds.

Comparative analysis of microsatellite variability in five macaw species (Psittaciformes, Psittacidae): Application for conservation

PubMed Central

Presti, Flavia T.; Oliveira-Marques, Adriana R.; Caparroz, Renato; Biondo, Cibele; Miyaki, Cristina Y.

2011-01-01

Cross-amplification was tested and variability in microsatellite primers (designed for Neotropical parrots) compared, in five macaw species, viz., three endangered blue macaws (Cyanopsitta spixii [extinct in the wild], Anodorhynchus leari [endangered] and Anodorhynchus hyacinthinus [vulnerable]), and two unthreatened red macaws (Ara chloropterus and Ara macao). Among the primers tested, 84.6% successfully amplified products in C. spixii, 83.3% in A. leari, 76.4% in A. hyacinthinus, 78.6% in A. chloropterus and 71.4% in A. macao. The mean expected heterozygosity estimated for each species, and based on loci analyzed in all the five, ranged from 0.33 (A. hyacinthinus) to 0.85 (A. macao). As expected, the results revealed lower levels of genetic variability in threatened macaw species than in unthreatened. The low combined probability of genetic identity and the moderate to high potential for paternity exclusion, indicate the utility of the microsatellite loci set selected for each macaw species in kinship and population studies, thus constituting an aid in planning in-situ and ex-situ conservation. PMID:21734841

Development of a multiplex PCR assay for the detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei, Burkholderia thailandensis, and Burkholderia cepacia complex.

PubMed

Zakharova, Irina; Teteryatnikova, Natalya; Toporkov, Andrey; Viktorov, Dmitry

2017-10-01

Two species of Burkholderia pseudomallei complex (Bpc), B. pseudomallei and B. mallei, can cause severe life-threatening infections. Rapidly discerning individual species within the group and separating them from other opportunistic pathogens of the Burkholderia cepacia complex (Bcc) is essential to establish a correct diagnosis and for epidemiological surveillance. In this study, a multiplex PCR assay based on the detection of an individual set of chromosomal beta-lactamase genes for single-step identification and differentiation of B. pseudomallei, B. mallei, B. thailandensis, and Bcc was developed. Two pairs of primers specific to a distinct class of B metallo-beta-lactamase genes and a pair of primers specific to the oxacillin-hydrolyzing class D beta-lactamase gene were demonstrated to successfully discriminate species within Bpc and from Bcc. The assay sensitivity was 9561 genomic equivalents (GE) for B. pseudomallei, 7827 GE for B. mallei, 8749 GE for B. thailandensis and 6023 GE for B. cepacia. Copyright © 2017 Elsevier B.V. All rights reserved.

ATLAS: An advanced PCR-method for routine visualization of telomere length in Saccharomyces cerevisiae.

PubMed

Zubko, Elena I; Shackleton, Jennifer L; Zubko, Mikhajlo K

2016-12-01

Measuring telomere length is essential in telomere biology. Southern blot hybridization is the predominant method for measuring telomere length in the genetic model Saccharomyces cerevisiae. We have further developed and refined a telomere PCR approach, which was rarely used previously (mainly in specific telomeric projects), into a robust method allowing direct visualisation of telomere length differences in routine experiments with S. cerevisiae, and showing a strong correlation of results with data obtained by Southern blot hybridization. In this expanded method denoted as ATLAS (A-dvanced T-elomere L-ength A-nalysis in S. cerevisiae), we have introduced: 1) set of new primers annealing with high specificity to telomeric regions on five different chromosomes; 2) new approach for designing reverse telomere primers that is based on the ligation of an adaptor of a fixed size to telomeric ends. ATLAS can be used at the scale of individual assays and high-throughput approaches. This simple, time/cost-effective and reproducible methodology will complement Southern blot hybridization and facilitate further progress in telomere research. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

PubMed

Meena, Ram Prasnna; Baranwal, V K

2016-09-01

Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.

A systematic approach to novel virus discovery in emerging infectious disease outbreaks.

PubMed

Sridhar, Siddharth; To, Kelvin K W; Chan, Jasper F W; Lau, Susanna K P; Woo, Patrick C Y; Yuen, Kwok-Yung

2015-05-01

The discovery of novel viruses is of great importance to human health-both in the setting of emerging infectious disease outbreaks and in disease syndromes of unknown etiology. Despite the recent proliferation of many efficient virus discovery methods, careful selection of a combination of methods is important to demonstrate a novel virus, its clinical associations, and its relevance in a timely manner. The identification of a patient or an outbreak with distinctive clinical features and negative routine microbiological workup is often the starting point for virus hunting. This review appraises the roles of culture, electron microscopy, and nucleic acid detection-based methods in optimizing virus discovery. Cell culture is generally slow but may yield viable virus. Although the choice of cell line often involves trial and error, it may be guided by the clinical syndrome. Electron microscopy is insensitive but fast, and may provide morphological clues to choice of cell line or consensus primers for nucleic acid detection. Consensus primer PCR can be used to detect viruses that are closely related to known virus families. Random primer amplification and high-throughput sequencing can catch any virus genome but cannot yield an infectious virion for testing Koch postulates. A systematic approach that incorporates carefully chosen combinations of virus detection techniques is required for successful virus discovery. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Species identification and sex determination of the genus Nepenthes (Nepenthaceae).

PubMed

Mokkamul, Piya; Chaveerach, Arunrat; Sudmoon, Runglawan; Tanee, Tawatchai

2007-02-15

Nepenthes species are well known for their ornamentally attractive pitchers. The species diversity was randomly surveyed in some conservation areas of Thailand and three species were found, namely N. gracilis Korth., N. mirabilis Druce. and N. smilesii Hemsl. Young plants as unknown species from Chatuchak market were added in plant sampled set. Thirty two Inter Simple Sequence Repeat (ISSR) primers were screened and 13 successful primers were used to produce DNA banding patterns for constructing a dendrogram. The dendrogram is potentially power tool to identify unknown species from Chatuchak market, differentiate species population, population by geographical areas and sex determination. The geographical area of N. mirabilis was specified to Southern and Northeastern regions and finally, subdivided into exact areas according to province. Male and female plants of N. gracilis at Phu Wua Wildlife Sanctuary and N. mirabilis at Bung Khonglong non-hunting area were determined. Two unknown species from Chatuchak market were analyzed to be N. mirabilis with the genetic similarities (S) 77.2 to 84.7. Be more sex specific in all sample studied, 37 Random Amplified Polymorphic DNA (RAPD) primers were investigated. The result shows that only one RAPD primer show high resolution results at about 750 bp specific male-related marker.

The development and mapping of functional markers in Fragaria and their transferability and potential for mapping in other genera.

PubMed

Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R

2007-01-01

We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.

Consensus-Degenerate Hybrid Oligonucleotide Primers for Amplification of Priming Glycosyltransferase Genes of the Exopolysaccharide Locus in Strains of the Lactobacillus casei Group

PubMed Central

Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis

2003-01-01

A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729

The Reverse Transcriptase of the Tf1 Retrotransposon Has a Specific Novel Activity for Generating the RNA Self-Primer That Is Functional in cDNA Synthesis▿

PubMed Central

Hizi, Amnon

2008-01-01

The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5′ end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3′ end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs. PMID:18753200

The reverse transcriptase of the Tf1 retrotransposon has a specific novel activity for generating the RNA self-primer that is functional in cDNA synthesis.

PubMed

Hizi, Amnon

2008-11-01

The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5' end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3' end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs.

Comparative analysis of detection limits and specificity of molecular diagnostic markers for three pathogens (Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus terrestris.

PubMed

Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G

2012-04-01

Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.

A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the LightCycler.

PubMed

Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg

2002-12-01

The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.

Early detection of Aspergillus carbonarius and A. niger on table grapes: a tool for quality improvement.

PubMed

Ayoub, F; Reverberi, M; Ricelli, A; D'Onghia, A M; Yaseen, T

2010-09-01

Aspergillus carbonarius and A. niger aggregate are the main fungal contaminants of table grapes. Besides their ability to cause black rot, they can produce ochratoxin A (OTA), a mycotoxin that has attracted increasing attention worldwide. The objective of this work was to set up a simple and rapid molecular method for the early detection of both fungi in table grapes before fungal development becomes evident. Polymerase chain reaction (PCR)-based assays were developed by designing species-specific primers based on the polyketide synthases (PKS(S)) sequences of A. carbonarius and A. niger that have recently been demonstrated to be involved in OTA biosynthesis. Three table grape varieties (Red globe, Crimson seedless, and Italia) were inoculated with A. carbonarius and A. niger aggregate strains producing OTA. The extracted DNA from control (non-inoculated) and inoculated grapes was amplified by PCR using ACPKS2F-ACPKS2R for A. carbonarius and ANPKS5-ANPKS6 for A. niger aggregate. Both primers allowed a clear detection, even in symptomless samples. PCR-based methods are considered to be a good alternative to traditional diagnostic means for the early detection of fungi in complex matrix for their high specificity and sensitivity. The results obtained could be useful for the definition of a 'quality label' for tested grapes to improve the safety measures taken to guarantee the production of fresh table grapes.

Effect of metal primers on bond strength of resin cements to base metals.

PubMed

Fonseca, Renata Garcia; de Almeida, Juliana Gomes dos Santos Paes; Haneda, Isabella Gagliardi; Adabo, Gelson Luis

2009-04-01

A strong and durable bond between a metal framework and a resin-based luting agent is desired. Metal primers have been shown to be very effective on noble alloys. However, there is insufficient information about their effect on base metals. The purpose of this study was to evaluate the effect of metal primers on the shear bond strength of resin cements to base metals. A total of 160 cast commercially pure titanium (CP Ti) and NiCr alloy (VeraBond II) disks were embedded in a polyvinyl chloride ring, and their surfaces were smoothed with silicon carbide papers (320, 400, and 600 grit) and airborne-particle abraded with 50-mum aluminum oxide. Specimens of each metal were divided into 4 groups (n=20), which received one of the following luting techniques: (1) Panavia F, (2) Alloy Primer plus Panavia F, (3) Bistite II DC, or (4) Metaltite plus Bistite II DC. Forty minutes after preparation, all specimens were stored in distilled water at 37 degrees C for 24 hours and then thermal cycled (1000 cycles, 5-55 degrees C). After thermal cycling, the specimens were stored in 37 degrees C distilled water for an additional 24 hours or 6 months before being tested in shear mode. Data (MPa) were analyzed using 3-way ANOVA and the post hoc Tukey test (alpha=.05). Each specimen was examined under an optical microscope (x30), and the failure mode was classified as adhesive, cohesive, or a combination of these. The only significant difference between the Panavia F and Alloy Primer plus Panavia F groups occurred in the NiCr alloy at 24 hours, at which point Panavia F demonstrated superior bond strength compared to Alloy Primer plus Panavia F (P<.001). The Bistite II DC and Metaltite plus Bistite II DC groups were not significantly different. The Bistite II DC and Metaltite plus Bistite II DC groups demonstrated significantly lower bond strength to CP Ti (P<.001) than the Panavia F and Alloy Primer plus Panavia F groups, and significantly lower bond strength to NiCr alloy (P<.001) than Panavia F. The Panavia F (P<.01) and Alloy Primer plus Panavia F groups' bond strength to titanium presented a significant increase (P<.001) in shear bond strength at 6 months. In general, the groups exhibited higher shear bond strength to CP Ti than to NiCr alloy (P<.01). The failure mode was 100% adhesive for all groups. The metal primers did not promote an increase in adhesive bonding of resin cements to NiCr alloy and to CP Ti. Water storage had no adverse effect on the shear bond strength of the groups. The shear bond strengths to titanium were significantly higher than those to the NiCr alloy.

Investigating the diversity of the 18S SSU rRNA hyper-variable region of Theileria in cattle and Cape buffalo (Syncerus caffer) from southern Africa using a next generation sequencing approach.

PubMed

Mans, Ben J; Pienaar, Ronel; Ratabane, John; Pule, Boitumelo; Latif, Abdalla A

2016-07-01

Molecular classification and systematics of the Theileria is based on the analysis of the 18S rRNA gene. Reverse line blot or conventional sequencing approaches have disadvantages in the study of 18S rRNA diversity and a next-generation 454 sequencing approach was investigated. The 18S rRNA gene was amplified using RLB primers coupled to 96 unique sequence identifiers (MIDs). Theileria positive samples from African buffalo (672) and cattle (480) from southern Africa were combined in batches of 96 and sequenced using the GS Junior 454 sequencer to produce 825711 informative sequences. Sequences were extracted based on MIDs and analysed to identify Theileria genotypes. Genotypes observed in buffalo and cattle were confirmed in the current study, while no new genotypes were discovered. Genotypes showed specific geographic distributions, most probably linked with vector distributions. Host specificity of buffalo and cattle specific genotypes were confirmed and prevalence data as well as relative parasitemia trends indicate preference for different hosts. Mixed infections are common with African buffalo carrying more genotypes compared to cattle. Associative or exclusion co-infection profiles were observed between genotypes that may have implications for speciation and systematics: specifically that more Theileria species may exist in cattle and buffalo than currently recognized. Analysis of primers used for Theileria parva diagnostics indicate that no new genotypes will be amplified by the current primer sets confirming their specificity. T. parva SNP variants that occur in the 18S rRNA hypervariable region were confirmed. A next generation sequencing approach is useful in obtaining comprehensive knowledge regarding 18S rRNA diversity and prevalence for the Theileria, allowing for the assessment of systematics and diagnostic assays based on the 18S gene. Copyright © 2016 Elsevier GmbH. All rights reserved.

Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri.

PubMed

Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo

2007-10-01

Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.

Multiplex detection of respiratory pathogens

DOEpatents

McBride, Mary [Brentwood, CA; Slezak, Thomas [Livermore, CA; Birch, James M [Albany, CA

2012-07-31

Described are kits and methods useful for detection of respiratory pathogens (influenza A (including subtyping capability for H1, H3, H5 and H7 subtypes) influenza B, parainfluenza (type 2), respiratory syncytial virus, and adenovirus) in a sample. Genomic sequence information from the respiratory pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.

Detection of Fungi from an Indoor Environment using Loop-mediated Isothermal Amplification (LAMP) Method.

PubMed

Nakayama, Takako; Yamazaki, Takashi; Yo, Ayaka; Tone, Kazuya; Mahdi Alshahni, Mohamed; Fujisaki, Ryuichi; Makimura, Koichi

2017-01-01

　Loop-mediated isothermal amplification (LAMP) is a useful DNA detection method with high specificity and sensitivity. The LAMP reaction is carried out within a short time at a constant temperature without the need for thermal cycling. We developed a LAMP primer set for detecting a wide range of fungi by aligning the sequences of the large subunit ribosomal RNA gene of Candida albicans (Ascomycota), Cryptococcus neoformans (Basidiomycota), and Mucor racemosus (Mucorales). The threshold of C. albicans rDNA as template with our LAMP primer set was in the range of 10-100 copies per a reaction. In this study, we evaluated the correlation between colony forming units (CFU) and LAMP detection rate using the LAMP method for environmental fungi. The LAMP method should be a useful means of detecting fungi in indoor environments, disaster areas, or even in confined manned spacecraft to prevent allergies or infections caused by fungi.

A rapid screening with direct sequencing from blood samples for the diagnosis of Leigh syndrome.

PubMed

Shimbo, Hiroko; Takagi, Mariko; Okuda, Mitsuko; Tsuyusaki, Yu; Takano, Kyoko; Iai, Mizue; Yamashita, Sumimasa; Murayama, Kei; Ohtake, Akira; Goto, Yu-Ichi; Aida, Noriko; Osaka, Hitoshi

2014-01-01

Large numbers of genes are responsible for Leigh syndrome (LS), making genetic confirmation of LS difficult. We screened our patients with LS using a limited set of 21 primers encompassing the frequently reported gene for the respiratory chain complexes I (ND1-ND6, and ND4L), IV(SURF1), and V(ATP6) and the pyruvate dehydrogenase E1α-subunit. Of 18 LS patients, we identified mutations in 11 patients, including 7 in mDNA (two with ATP6), 4 in nuclear (three with SURF1). Overall, we identified mutations in 61% of LS patients (11/18 individuals) in this cohort. Sanger sequencing with our limited set of primers allowed us a rapid genetic confirmation of more than half of the LS patients and it appears to be efficient as a primary genetic screening in this cohort.

Factors That Affect Large Subunit Ribosomal DNA Amplicon Sequencing Studies of Fungal Communities: Classification Method, Primer Choice, and Error

PubMed Central

Porter, Teresita M.; Golding, G. Brian

2012-01-01

Nuclear large subunit ribosomal DNA is widely used in fungal phylogenetics and to an increasing extent also amplicon-based environmental sequencing. The relatively short reads produced by next-generation sequencing, however, makes primer choice and sequence error important variables for obtaining accurate taxonomic classifications. In this simulation study we tested the performance of three classification methods: 1) a similarity-based method (BLAST + Metagenomic Analyzer, MEGAN); 2) a composition-based method (Ribosomal Database Project naïve Bayesian classifier, NBC); and, 3) a phylogeny-based method (Statistical Assignment Package, SAP). We also tested the effects of sequence length, primer choice, and sequence error on classification accuracy and perceived community composition. Using a leave-one-out cross validation approach, results for classifications to the genus rank were as follows: BLAST + MEGAN had the lowest error rate and was particularly robust to sequence error; SAP accuracy was highest when long LSU query sequences were classified; and, NBC runs significantly faster than the other tested methods. All methods performed poorly with the shortest 50–100 bp sequences. Increasing simulated sequence error reduced classification accuracy. Community shifts were detected due to sequence error and primer selection even though there was no change in the underlying community composition. Short read datasets from individual primers, as well as pooled datasets, appear to only approximate the true community composition. We hope this work informs investigators of some of the factors that affect the quality and interpretation of their environmental gene surveys. PMID:22558215

Application of SCAR (sequence characterized amplified region) analysis to authenticate Lycium barbarum (wolfberry) and its adulterants.

PubMed

Sze, Stephen Cho-Wing; Song, Ju-Xian; Wong, Ricky Ngok-Shun; Feng, Yi-Bin; Ng, Tzi-Bun; Tong, Yao; Zhang, Kalin Yan-Bo

2008-09-01

Fructus Lycii (Gouqizi) is well known in Chinese herbal medicine for its restorative function of benefiting the liver and kidney, replenishing vital essence and improving eyesight. However, ten species and varieties of Lycium have benn found to be substitutes or adulterants of Lycium barbarum (wolfberry) in commercial markets in the Hong Kong Special Administrative Region and in China generally. L. barbarum cv. 'Tianjinense' and Lycium chinense var. potaninii are the most common examples. It is difficult to differentiate among the Lycium species by traditional morphological and histological analyses. An easy and reliable approach based on SCAR (sequence characterized amplified region) analysis was developed in the present study to differentiate L. barbarum from other Lycium species. Two characteristic bands of approx. 700 and 650 bp were detected on the RAPD (random amplification of polymorphic DNA) profiles generated from samples of L. barbarum and L. chinense var. potaninii using the primer OPC-7. They were isolated and sequenced. Two primer sets, based on the sequences, could amplify a single specific band in samples of L. barbarum respectively, whereas no bands were detected in samples of L. chinense var. potaninii. The results confirmed that the SCAR technique can be employed for authenticating L. barbarum and its adulterants.

Simultaneous Genotyping of the rs4762 and rs699 Polymorphisms in Angiotensinogen Gene and Correlation with Iranian CAD Patients with Novel Hexa-primer ARMS-PCR

PubMed Central

KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud

2017-01-01

Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324

Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

PubMed

Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

2016-01-01

The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

Characterization of Biofilm Community Structure by Ribosomal RNA sequences

DTIC Science & Technology

1989-12-01

for strains of Fibrobacter, 2) Desulfobacter genus-specific probe, 3) Desulfosarcina genus-specific probe, 4) archaebacterial kingdom -specific probes...and 5) eubacterial kingdom -specific probes 5) eukaryote kingdom -specific probe and 6) a general probe encompassing all characterized sulfate-reducing...sets have been fabricated. The group-specific primer sets selectively amplify either sulfate-reducing bacteria or archaebacteria . The SRB-specific

Is the simian virus SV40 associated with idiopathic focal segmental glomerulosclerosis in humans?

PubMed

Galdenzi, Gabriella; Lupo, Antonio; Anglani, Franca; Perini, Marino; Galeazzi, Luciano; Giunta, Sergio; Marcantoni, Carmelita; Del Prete, Dorella; Graziotto, Romina; D'angelo, Angela; Maschio, Giuseppe; Gambaro, Giovanni

2003-01-01

Glomerulosclerosis was reported in mice transgenic for the simian polyomavirus SV40 early region that contains the transforming sequences encoding the SV40 large T-antigen (TAG). This was discovered when an SV40 epidemic occurred following the use of contaminated polio vaccines during 1955-1963, and led to investigations that showed an association between SV40 infection and tumors in humans. We investigated the possible association of SV40 infection and idiopathic focal segmental glomerulosclerosis (FSGS). The study was performed in 17 Bouin-fixed, paraffin-embedded renal biopsies from FSGS patients and 10 matched biopsies from patients with IgA glomerulonephritis; all patients had undergone polio vaccination in the early 1960s. Extracted DNA was polymerase chain reaction (PCR) amplified using SV.for3/SV.rev primers and GabE1/GabE2 primers; both sets of primers map in the region of SV40 TAG sequences, and amplify a fragment of respectively 105-bp and 135-bp. The biopsies considered were those in which the DNA was sufficiently intact to allow amplification of a fragment of 102-bp of the ApoE gene. Three FSGS and none of the IgA biopsies were positive for the SV.for3/SV.rev fragment. Conversely, amplification with GabE1/GabE2 primers did not lead to any specific product in either the IgA or FSGS biopsies. Restriction fragment length polymorphism and sequencing analyses revealed that the positive results obtained with the SV.for3/SV.rev primers were due to amplicons generated by multiple dimerization of forward and reverse primers. With the limited number of patients investigated, this study excludes the hypothesis that SV40 is associated with idiopathic FSGS.

Developmental validation of the MiSeq FGx Forensic Genomics System for Targeted Next Generation Sequencing in Forensic DNA Casework and Database Laboratories.

PubMed

Jäger, Anne C; Alvarez, Michelle L; Davis, Carey P; Guzmán, Ernesto; Han, Yonmee; Way, Lisa; Walichiewicz, Paulina; Silva, David; Pham, Nguyen; Caves, Glorianna; Bruand, Jocelyne; Schlesinger, Felix; Pond, Stephanie J K; Varlaro, Joe; Stephens, Kathryn M; Holt, Cydne L

2017-05-01

Human DNA profiling using PCR at polymorphic short tandem repeat (STR) loci followed by capillary electrophoresis (CE) size separation and length-based allele typing has been the standard in the forensic community for over 20 years. Over the last decade, Next-Generation Sequencing (NGS) matured rapidly, bringing modern advantages to forensic DNA analysis. The MiSeq FGx™ Forensic Genomics System, comprised of the ForenSeq™ DNA Signature Prep Kit, MiSeq FGx™ Reagent Kit, MiSeq FGx™ instrument and ForenSeq™ Universal Analysis Software, uses PCR to simultaneously amplify up to 231 forensic loci in a single multiplex reaction. Targeted loci include Amelogenin, 27 common, forensic autosomal STRs, 24 Y-STRs, 7 X-STRs and three classes of single nucleotide polymorphisms (SNPs). The ForenSeq™ kit includes two primer sets: Amelogenin, 58 STRs and 94 identity informative SNPs (iiSNPs) are amplified using DNA Primer Set A (DPMA; 153 loci); if a laboratory chooses to generate investigative leads using DNA Primer Set B, amplification is targeted to the 153 loci in DPMA plus 22 phenotypic informative (piSNPs) and 56 biogeographical ancestry SNPs (aiSNPs). High-resolution genotypes, including detection of intra-STR sequence variants, are semi-automatically generated with the ForenSeq™ software. This system was subjected to developmental validation studies according to the 2012 Revised SWGDAM Validation Guidelines. A two-step PCR first amplifies the target forensic STR and SNP loci (PCR1); unique, sample-specific indexed adapters or "barcodes" are attached in PCR2. Approximately 1736 ForenSeq™ reactions were analyzed. Studies include DNA substrate testing (cotton swabs, FTA cards, filter paper), species studies from a range of nonhuman organisms, DNA input sensitivity studies from 1ng down to 7.8pg, two-person human DNA mixture testing with three genotype combinations, stability analysis of partially degraded DNA, and effects of five commonly encountered PCR inhibitors. Calculations from ForenSeq™ STR and SNP repeatability and reproducibility studies (1ng template) indicate 100.0% accuracy of the MiSeq FGx™ System in allele calling relative to CE for STRs (1260 samples), and >99.1% accuracy relative to bead array typing for SNPs (1260 samples for iiSNPs, 310 samples for aiSNPs and piSNPs), with >99.0% and >97.8% precision, respectively. Call rates of >99.0% were observed for all STRs and SNPs amplified with both ForenSeq™ primer mixes. Limitations of the MiSeq FGx™ System are discussed. Results described here demonstrate that the MiSeq FGx™ System meets forensic DNA quality assurance guidelines with robust, reliable, and reproducible performance on samples of various quantities and qualities. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Comparison of endogenous feline leukemia virus RNA content in feline vaccine and nonvaccine site-associated sarcomas.

PubMed

Kidney, B A; Ellis, J A; Haines, D M; Jackson, M L

2001-12-01

To determine whether feline vaccine site-associated sarcomas (VSS) contain a higher amount of endogenous FeLV (enFeLV) RNA, compared with feline nonvaccine site-associated sarcomas (non-VSS). Formalin-fixed paraffin-embedded (FFPE) tissues from 50 VSS and 50 cutaneous non-VSS. RNA was extracted from FFPE sections of each tumor, and regions of the long terminal repeat (LTR) and envelope (env) gene of enFeLV were amplified by use of reverse transcriptase-polymerase chain reaction (RT-PCR). The density of each RT-PCR product band for enFeLV was compared with that of a constitutively expressed gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). An integrated density value (IDV) was determined by use of densitometry, and the IDV ratio for enFeLV to GAPDH was calculated for each enFeLV primer set. The median (interquartile range) of the IDV ratio for the enFeLV LTR primer set was 0.52 (0.26 to 1.17) for the VSS group and 0.84 (0.21 to 1.53) for the non-VSS group. The median (interquartile range) of the IDV ratio for the enFeLV env primer set was 0.60 (0.37 to 0.91) for the VSS group and 0.59 (0.36 to 1.09) for the non-VSS group. Because the amount of enFeLV RNA within the LTR and env gene was not significantly different between the VSS and non-VSS groups, enFeLV replication or expression is unlikely to be involved in VSS development.

Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

PubMed Central

Liu, Ning; Tian, Ru; Loeb, Daniel D.

2003-01-01

Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

PubMed Central

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

PubMed

Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

2010-08-01

To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

Rapid diagnosis of common deletional α-thalassemia in the Chinese population by qPCR based on identical primer homologous fragments.

PubMed

Long, Ju

2016-05-01

In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.