(Physiology and molecular biology of extracellular peroxidases, H sub 2 O sub 2 -generating system and deregulated mutants of Phanerochaete chrysosporium)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1992-01-01

We have expanded the work on the LIP genes to Trametes versicolor, the second most studied white-rot fungus after P. chrysosporium. Six LIP genes have been cloned from this organism and one of these has been completely sequenced and compared to the known LIP genes that have been described to date. Our studies gave us further insights into the novel non-integrative transformation system of P. chrysosporium. Our recombinant plasmid pUGLGl-kan, which contains a LIP gene disrupted by the insertion of kan{sup r} determinant, also failed to integrate into the chromosome. Instead, it was maintained as a circular extrachromosomal element andmore » was recoverable as a plasmid both from the meiotic and mitotic progeny. Basic characterization of the lignin peroxidase-negative mutant (lip mutant) and nitrogen-deregulated mutant has been completed. We also investigated the question whether carbon, nitrogen, and Mn(II) regulate LIP expression coordinately or independently. Results indicate that these three environmental controls independently regulate LIP and MNP gene expression. Furthermore, an idiophasic protease has been shown to be responsible for the sharp decline in LIP activity after day 6 of incubation in low nitrogen cultures and addition of glucose to these day 6 cultures has been shown to suppress the protease levels and maintain high levels of LIP. The results further indicated that this protease is synthesized de novo during the idiophase. Additional studies showed that MNPs play a dominant role in the decolorization of chlorolignols in bleached kraft pulp effluents and that LIPs play a relatively minor role in this process. These studies have since been confirmed independently by an Austrian group.« less

[Nasolabial muscle finite-element study and clinical application].

PubMed

Yin, Ningbei; Wu, Jiajun; Chen, Bo; Wang, Yongqian; Song, Tao; Ma, Hengyuan

2015-05-01

To investigate the nasolabial muscle anatomy and biomechanical characteristics. Micro-computed tomography scan was performed in 8 cases of spontaneous abortion fetus lip nasal specimens to construct a three-dimensional model. The nasolabial muscle structure was analyzed using Mimics software. The three-dimensional configuration model of nasolabial muscle was established based on local anatomy and tissue section, and compared with tissue section. Three dimensional finite element analysis was performed on lip nasal muscle related biomechanics and surface deformation in Application verification was carried out in 263 cases of microform cleft lip surgery. There was close relationship between nasolabial muscle. The nasolabial muscle tension system was constituted, based on which a new cleft lip repair surgery was designed and satisfied results were achieved. There is close relationship among nasolabial muscle in anatomy, histology and biomechanics. To obtain better effect, cleft lip repair should be performed on the basis of recovering muscle tension system.

Structure of LiPs ground and excited states

NASA Astrophysics Data System (ADS)

Bressanini, Dario

2018-01-01

The lithium atom in its ground state can bind positronium (Ps) forming LiPs, an electronically stable system. In this study we use the fixed node diffusion Monte Carlo method to perform a detailed investigation of the internal structure of LiPs, establishing to what extent it could be described by smaller interacting subsystems. To study the internal structure of positronic systems we propose a way to analyze the particle distribution functions: We first order the particle-nucleus distances, from the closest to the farthest. We then bin the ordered distances obtaining, for LiPs, five distribution functions that we call sorted distribution functions. We used them to show that Ps is a quite well-defined entity inside LiPs: The positron is forming positronium not only when it is far away from the nucleus, but also when it is in the same region of space occupied by the 2 s electrons. Hence, it is not correct to describe LiPs as positronium "orbiting" around a lithium atom, as sometimes has been done, since the positron penetrates the electronic distribution and can be found close to the nucleus.

Reevaluation of confirmatory tests for human T-cell leukemia virus Type 1 using a luciferase immunoprecipitation system in blood donors.

PubMed

Furuta, Rika A; Ma, Guangyong; Matsuoka, Masao; Otani, Satoshi; Matsukura, Harumichi; Hirayama, Fumiya

2015-04-01

Recently, Japanese Red Cross blood centers have changed the confirmatory test method from an indirect immunofluorescence (IF) technique to Western blotting (WB) for antibodies against human T-cell leukemia virus Type 1 (HTLV-1). In this study, these HTLV-1 tests were assessed using another sensitive method, that is, a luciferase immunoprecipitation system (LIPS), to identify a better confirmatory test for HTLV-1 infection. Plasma samples from 54 qualified donors and 114 HTLV-1 screening-positive donors were tested by LIPS for antibodies against HTLV-1 Gag, Tax, Env, and HBZ recombinant proteins. The donors were categorized into six groups, namely, (Group I) qualified donors, screening positive; (Group II) IF positive; (Group III) IF negative; (Group IV) WB positive; (Group V) WB negative; and (Group VI) screening positive in the previous blood donation, but WB-indeterminate during this study period. In Groups II and IV, all plasma samples tested positive by LIPS for antibodies against Gag and Env proteins. In Group V, all samples tested negative by LIPS, whereas some Group III samples reacted with single or double antigens in LIPS. In Group VI, the LIPS test identified a donor with suspected HTLV-1 infection. The first case of a blood donor with plasma that reacted with HBZ was identified by LIPS. Reevaluation of the current HTLV-1 screening method using the LIPS test showed that both confirmatory tests had similar sensitivity and specificity only when WB indeterminate results were eliminated. LIPS is a promising method for detecting and characterizing HTLV-1 antibodies. © 2014 AABB.

Speech Analysis Based On Image Information from Lip Movement

NASA Astrophysics Data System (ADS)

Talha, Kamil S.; Wan, Khairunizam; Za'ba, S. K.; Mohamad Razlan, Zuradzman; B, Shahriman A.

2013-12-01

Deaf and hard of hearing people often have problems being able to understand and lip read other people. Usually deaf and hard of hearing people feel left out of conversation and sometimes they are actually ignored by other people. There are a variety of ways hearing-impaired person can communicate and gain accsss to the information. Communication support includes both technical and human aids. Human aids include interpreters, lip-readers and note-takers. Interpreters translate the Sign Language and must therefore be qualified. In this paper, vision system is used to track movements of the lip. In the experiment, the proposed system succesfully can differentiate 11 type of phonemes and then classified it to the respective viseme group. By using the proposed system the hearing-impaired persons could practise pronaunciations by themselve without support from the instructor.

Leptospiral outer membrane protein LipL41 is not essential for acute leptospirosis but requires a small chaperone protein, lep, for stable expression.

PubMed

King, Amy M; Bartpho, Thanatchaporn; Sermswan, Rasana W; Bulach, Dieter M; Eshghi, Azad; Picardeau, Mathieu; Adler, Ben; Murray, Gerald L

2013-08-01

Leptospirosis is a worldwide zoonosis caused by pathogenic Leptospira spp., but knowledge of leptospiral pathogenesis remains limited. However, the development of mutagenesis systems has allowed the investigation of putative virulence factors and their involvement in leptospirosis. LipL41 is the third most abundant lipoprotein found in the outer membranes of pathogenic leptospires and has been considered a putative virulence factor. LipL41 is encoded on the large chromosome 28 bp upstream of a small open reading frame encoding a hypothetical protein of unknown function. This gene was named lep, for LipL41 expression partner. In this study, lipL41 was found to be cotranscribed with lep. Two transposon mutants were characterized: a lipL41 mutant and a lep mutant. In the lep mutant, LipL41 protein levels were reduced by approximately 90%. Lep was shown through cross-linking and coexpression experiments to bind to LipL41. Lep is proposed to be a molecular chaperone essential for the stable expression of LipL41. The roles of LipL41 and Lep in the pathogenesis of Leptospira interrogans were investigated; surprisingly, neither of these two unique proteins was essential for acute leptospirosis.

Lip boundary detection techniques using color and depth information

NASA Astrophysics Data System (ADS)

Kim, Gwang-Myung; Yoon, Sung H.; Kim, Jung H.; Hur, Gi Taek

2002-01-01

This paper presents our approach to using a stereo camera to obtain 3-D image data to be used to improve existing lip boundary detection techniques. We show that depth information as provided by our approach can be used to significantly improve boundary detection systems. Our system detects the face and mouth area in the image by using color, geometric location, and additional depth information for the face. Initially, color and depth information can be used to localize the face. Then we can determine the lip region from the intensity information and the detected eye locations. The system has successfully been used to extract approximate lip regions using RGB color information of the mouth area. Merely using color information is not robust because the quality of the results may vary depending on light conditions, background, and the human race. To overcome this problem, we used a stereo camera to obtain 3-D facial images. 3-D data constructed from the depth information along with color information can provide more accurate lip boundary detection results as compared to color only based techniques.

Cheiloscopy and blood groups: Aid in forensic identification.

PubMed

Karim, Bushra; Gupta, Devanand

2014-10-01

Every person has certain features that make them radically distinct from others. One such feature is lip prints. Lip prints remain the same throughout life and are uninfluenced by injuries, diseases, or environmental changes. Different individuals have specific blood groups according to the various antigen-antibody reactions in their bloodstream. To determine the distribution of different patterns of lip prints among subjects having different ABO and Rh blood groups. To determine the correlation between respective characteristics of subjects. In this study, lip prints were obtained from 122 subjects (62 males and 60 females), and associated blood-group matching was performed to determine the predominant lip print type and to determine any correlation between lip print types and blood groups. Tsuchihashi's classification of type I (complete vertical grooves), type I' (incomplete vertical grooves), type II (forking grooves), type III (intersecting grooves), type IV (reticular grooves), and type V (indeterminate grooves) was used to compare with the ABO and Rh blood grouping systems. No correlation was found between lip prints and blood groups. No significant correlation exists between blood group and lip prints. Lip prints play a vital role in identification because they are unique.

Large igneous provinces (LIPs) and carbonatites

NASA Astrophysics Data System (ADS)

Ernst, Richard E.; Bell, Keith

2010-03-01

There is increasing evidence that many carbonatites are linked both spatially and temporally with large igneous provinces (LIPs), i.e. high volume, short duration, intraplate-type, magmatic events consisting mainly of flood basalts and their plumbing systems (of dykes, sills and layered intrusions). Examples of LIP-carbonatite associations include: i. the 66 Ma Deccan flood basalt province associated with the Amba Dongar, Sarnu-Dandali (Barmer), and Mundwara carbonatites and associated alkali rocks, ii. the 130 Ma Paraná-Etendeka (e.g. Jacupiranga, Messum); iii. the 250 Ma Siberian LIP that includes a major alkaline province, Maimecha-Kotui with numerous carbonatites, iv. the ca. 370 Ma Kola Alkaline Province coeval with basaltic magmatism widespread in parts of the East European craton, and v. the 615-555 Ma CIMP (Central Iapetus Magmatic Province) of eastern Laurentia and western Baltica. In the Superior craton, Canada, a number of carbonatites are associated with the 1114-1085 Ma Keweenawan LIP and some are coeval with the pan-Superior 1880 Ma mafic-ultramafic magmatism. In addition, the Phalaborwa and Shiel carbonatites are associated with the 2055 Ma Bushveld event of the Kaapvaal craton. The frequency of this LIP-carbonatite association suggests that LIPs and carbonatites might be considered as different evolutionary ‘pathways’ in a single magmatic process/system. The isotopic mantle components FOZO, HIMU, EM1 but not DMM, along with primitive noble gas signatures in some carbonatites, suggest a sub-lithospheric mantle source for carbonatites, consistent with a plume/asthenospheric upwelling origin proposed for many LIPs.

Improving lip wrinkles: lipstick-related image analysis.

PubMed

Ryu, Jong-Seong; Park, Sun-Gyoo; Kwak, Taek-Jong; Chang, Min-Youl; Park, Moon-Eok; Choi, Khee-Hwan; Sung, Kyung-Hye; Shin, Hyun-Jong; Lee, Cheon-Koo; Kang, Yun-Seok; Yoon, Moung-Seok; Rang, Moon-Jeong; Kim, Seong-Jin

2005-08-01

The appearance of lip wrinkles is problematic if it is adversely influenced by lipstick make-up causing incomplete color tone, spread phenomenon and pigment remnants. It is mandatory to develop an objective assessment method for lip wrinkle status by which the potential of wrinkle-improving products to lips can be screened. The present study is aimed at finding out the useful parameters from the image analysis of lip wrinkles that is affected by lipstick application. The digital photograph image of lips before and after lipstick application was assessed from 20 female volunteers. Color tone was measured by Hue, Saturation and Intensity parameters, and time-related pigment spread was calculated by the area over vermilion border by image-analysis software (Image-Pro). The efficacy of wrinkle-improving lipstick containing asiaticoside was evaluated from 50 women by using subjective and objective methods including image analysis in a double-blind placebo-controlled fashion. The color tone and spread phenomenon after lipstick make-up were remarkably affected by lip wrinkles. The level of standard deviation by saturation value of image-analysis software was revealed as a good parameter for lip wrinkles. By using the lipstick containing asiaticoside for 8 weeks, the change of visual grading scores and replica analysis indicated the wrinkle-improving effect. As the depth and number of wrinkles were reduced, the lipstick make-up appearance by image analysis also improved significantly. The lip wrinkle pattern together with lipstick make-up can be evaluated by the image-analysis system in addition to traditional assessment methods. Thus, this evaluation system is expected to test the efficacy of wrinkle-reducing lipstick that was not described in previous dermatologic clinical studies.

[Reconstruction of Leptospira interrogans lipL21 gene and characteristics of its expression product].

PubMed

Luo, Dong-jiao; Hu, Ye; Dennin, R H; Yan, Jie

2007-09-01

To reconstruct the nucleotide sequence of Leptospira interrogans lipL21 gene for increasing the output of prokaryotic expression and to understand the changes on immunogenicity of the expression products before and after reconstruction, and to determine the position of envelope lipoprotein LipL21 on the surface of leptospiral body. According to the preferred codons of E.coli, the nucleotide sequence of lipL21 gene was designed and synthesized, and then its prokaryotic expression system was constructed. By using SDS-PAGE plus BioRad agarose image analysor, the expression level changes of lipL21 genes before and after reconstruction were measured. A Western blot assay using rabbit anti-TR/Patoc I serum as the first antibody was performed to identify the immunoreactivity of the two target recombinant proteins rLipL21s before and after reconstruction. The changes of cross agglutination titers of antisera against two rLipL21s before and after reconstruction to the different leptospiral serogroups were demonstrated using microscope agglutination test (MAT). Immuno-electronmicroscopy was applied to confirm the location of LipL21s. The expression outputs of original and reconstructed lipL21 genes were 8.5 % and 46.5 % of the total bacterial proteins, respectively. Both the two rLipL21s could take place immune conjugation reaction with TR/Patoc I antiserum. After immunization with each of the two rLipL21s in rabbits, the animals could produce specific antibody. Similar MAT titers with 1:80 - 1:320 of the two antisera against rLipL21s were present. LipL21 was confirmed to locate on the surface of leptospiral envelope. LipL21 is a superficial antigen of Leptospira interrogans. The expression output of the reconstructed lipL21 gene is remarkably increased. The expression rLipL21 maintains fine antigenicity and immunoreactivity and its antibody still shows an extensive cross immunoagglutination activity. The high expression of the reconstructed lipL21 gene will offer a favorable condition to use its product for further developing a novel universal vaccine as well as detection kit of leptospirosis.

Anti-wear additive content in fully synthetic PAO and PAG base oils and its effect on electrostatic and tribological phenomena in a rotating shaft-oil-lip seal system

NASA Astrophysics Data System (ADS)

Gajewski, Juliusz B.; Głogowski, Marek J.

2013-03-01

The paper presents the results of experiments on electrostatic and tribological aspects of different anti-wear additive's contents when an additive is blended with different fully synthetic (poly-α-olefin) and PAG (polyalkylene glycol) base oils in a rotating shaft-oil and oil-lip seal interfacial system. The experimental results are the relationships of electric potential induced in a lip seal's stiffening ring to angular velocity of a rotating metal shaft and to temperature of the oils tested. The braking torque of a shaft is measured with a torquemeter sensor connected directly with a microprocessor-based system for controlling the rotational speed and for measuring the shaft's braking torque and oil temperature. The beneficial and promising results are obtained for PAG when an external DC electric field is applied to the system and the braking torque is then reduced for a certain combination of the base oil and additive's contents. On the basis of the former and present research results an analysis is made to permit one to show how the type of the oils and additives tested can affect both interfaces: rotating shaft-oil and oil-lip of the lip seal and especially the braking torque.

Reconstruction of upper lip muscle system by anatomy, magnetic resonance imaging, and serial histological sections.

PubMed

Bo, Chen; Ningbei, Yin

2014-01-01

Surgeons need references to undertake cleft lip repairs. We aimed to establish a three-dimensional model of upper lip muscles. We examined specimens from 2 adult cadaver heads and 8 adult cadaver lips, obtaining serial sections in the axial, sagittal, and coronal planes. Sections were stained to observe the philtrum, Cupid bow, vermilion, and nostril sill. Reconstruction was done with three-dimensional software (eg, 3D-DOCTOR, MicroMR). Parallel circular muscle fibers existed between modioli. The orbicularis oris deep layer contained fan muscle fibers inclining inward. Some ended at the anterior nasal crest. Others migrated to the depressor septum, crossed the midline, and migrated to the nasalis muscle. At the nostril floor, the depressor septum muscle bundle and ipsilateral orbicularis oris overlapped the nasalis muscle and the contralateral orbicularis oris. This construction shaped the nostril sill. The levator labii superioris alaeque nasi, levator labii superioris, and zygomaticus minor crossed the nasolabial groove and migrated to the superficial orbicularis oris, entering the outer edge of the nasal alar to the upper lip near the vermilion border and philtrum ridge, shaping Cupid bow. Contralateral deep orbicularis oris muscle fibers crossed the philtrum dimple to the lateral philtrum ridge (axial plane). Superficial reticular muscle fibers of the levator labii superioris, zygomaticus minor, zygomaticus major, and orbicularis oris inserted into the medial philtrum ridge (coronal plane). They intersected to form the philtrum ridge. A three-dimensional upper lip muscular system model was established that can be referenced for cleft lip repair and lip operations.

Large Igneous Provinces, Their Giant Mafic Dyke Swarms, and Links to Metallogeny

NASA Astrophysics Data System (ADS)

Jowitt, S.; Ernst, R. E.

2017-12-01

The relationships between large igneous provinces (LIPs), their giant dyke swarms and differing metallogenic systems can be condensed into five distinct although partially overlapping classifications: (1) LIP magmas that directly generate mineral deposits such as orthomagmatic Ni-Cu-PGE sulfides. Many carbonatites (Nb, Ta REE deposits) and kimberlites (diamonds) are also often LIP related. On the other hand, LIP-related thermal pulses (from a mantle plume) can sometimes destroy diamond potential in the overlying lithosphere. A key locus for Ni-Cu-PGE mineralization is within a few hundred km of the plume center region and plume centers are best located using giant radiating dyke swarms. Dyke subswarms with chalcophile element depletions can also be tracked "upstream" toward the plume center to identify exploration targets. (2) LIP magmas that provide energy, fluids, and/or metals for ore types such as hydrothermal volcanogenic massive sulfide (VMS) and iron oxide-copper-gold (IOCG) deposits. Heat loss from the margins of dykes and sills can also generate local enrichments in key metals (e.g. Co) within the surrounding sedimentary rocks. (3) LIP rocks (particularly sills and dykes) can act barriers to fluid flow and/or as reaction zones that control mineralizing events, act as structural traps within hydrocarbon systems, and form impermeable barriers that control water flow and hence aquifer formation (4) surficial effects, such as the formation of Ni-Co laterites and Al bauxites from tropical weathering of LIP mafic-ultramafic rocks (including volcanics fed by radiating dykes as well as the dykes themselves). This category also includes LIP-related anoxia events that generate hydrocarbon source rocks; and (5) indirect links between LIPs and ore deposits, where continental breakup-related LIP events define a `barcode' record (usually dominated by dyke swarms) that can be used to correlate and reconstruct Precambrian supercontinents. This fifth classification type also includes links between major continental breakup (linked to LIPs and their dyke swarms) and distal compression and transpression in the plate tectonic circuit, leading to the formation of orogeny-related deposits such as orogenic Au mineralization.

[The construction of cell-penetrating peptide R8 and pH sensitive cleavable polyethylene glycols co-modified liposomes].

PubMed

Zhang, Li; Wang, Yang; Gao, Hui-le; He, Qin

2015-06-01

The purpose of the study is to construct R8 peptide (RRRRRRRR) and pH sensitive polyethylene glycols (PEG) co-modified liposomes (Cl-Lip) and utilize them in breast cancer treatment. The co-modified liposomes were prepared with soybean phospholipid, cholesterol, DSPE-PEG2K-R8 and PEG5K-Hz-PE (pH sensitive PEG). The size and zeta potential of Cl-Lip were also characterized. The in vitro experiment demonstrated that the Cl-Lip had high serum stability in 50% fetal bovine serum. The cellular uptake of Cl-Lip under different pre-incubated conditions was evaluated on 4T1 cells. And the endocytosis pathway, lysosome escape ability and tumor spheroid penetration ability were also evaluated. The results showed the particle size of the Cl-Lip was (110.4 ± 5.2) nm, PDI of the Cl-Lip was 0.207 ± 0.039 and zeta potential of the Cl-Lip was (-3.46 ± 0.05) mV. The cellular uptake of Cl-Lip on 4T1 cells was pH sensitive, as the cellular uptake of Cl-Lip pre-incubated in pH 6.0 was higher than that of pH 7.4 under each time point. The main endocytosis pathways of Cl-Lip under pH 6.0 were micropinocytosis and energy-dependent pathway. At the same time, the Cl-Lip with pre-incubation in pH 6.0 had high lysosome escape ability and high tumor spheroid penetration ability. All the above results demonstrated that the Cl-Lip we constructed had high pH sensitivity and is a promising drug delivery system.

Three-dimensional facial anthropometry of unilateral cleft lip infants with a structured light scanning system.

PubMed

Li, Guanghui; Wei, Jianhua; Wang, Xi; Wu, Guofeng; Ma, Dandan; Wang, Bo; Liu, Yanpu; Feng, Xinghua

2013-08-01

Cleft lip in the presence or absence of a cleft palate is a major public health problem. However, few studies have been published concerning the soft-tissue morphology of cleft lip infants. Currently, obtaining reliable three-dimensional (3D) surface models of infants remains a challenge. The aim of this study was to investigate a new way of capturing 3D images of cleft lip infants using a structured light scanning system. In addition, the accuracy and precision of the acquired facial 3D data were validated and compared with direct measurements. Ten unilateral cleft lip patients were enrolled in the study. Briefly, 3D facial images of the patients were acquired using a 3D scanner device before and after the surgery. Fourteen items were measured by direct anthropometry and 3D image software. The accuracy and precision of the 3D system were assessed by comparative analysis. The anthropometric data obtained using the 3D method were in agreement with the direct anthropometry measurements. All data calculated by the software were 'highly reliable' or 'reliable', as defined in the literature. The localisation of four landmarks was not consistent in repeated experiments of inter-observer reliability in preoperative images (P<0.05), while the intra-observer reliability in both pre- and postoperative images was good (P>0.05). The structured light scanning system is proven to be a non-invasive, accurate and precise method in cleft lip anthropometry. Copyright © 2013 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

Association between Cheiloscopic Patterns and ABO Blood Groups among South Indian Population.

PubMed

Khanapure, Sneha; Suhas, H G; Potdar, Shrudha; Sam, George; Sudeep, C B; Arjun, M R

2017-07-01

Human beings have few characteristics that are unique from others. Lip prints are one of such feature. They are not changed throughout the life and are not influenced by injuries, diseases, or environmental changes. According to the various antigen-antibody reactions in the bloodstream, different individuals have specific blood groups. To study the distribution of lip print patterns among individuals with different ABO and Rh blood groups and also to know the relation between their characters and blood groups. In the present study, lip prints were collected randomly from 85 individuals, and their blood group matching was performed. This is to identify the most common lip print type and to know any association between lip print types and blood groups. Tsuchihashi's classification of lip prints was used to compare with the ABO and Rh blood grouping systems. It was observed that in individuals with B+, A+, and O- blood groups, predominant pattern was Type IV and individuals having blood group O+ and AB+ common lip print pattern was Type II. This study showed strong association between lip print patterns and ABO blood groups as some blood groups were not included in statistical analysis; further studies including larger sample are essential to substantiate the results. Correlating lip print with blood group helps in identification of the suspects. Along with lip prints, another biological record that remains unchanged throughout the lifetime of a person is the blood group. Determining the blood group of a person from the samples obtained at the site of crime and also recovering lip prints from site can help identify a person.

Congenital Double Lip: A Rare Deformity Treated Surgically

PubMed Central

Aggarwal, Titiksha; Chawla, Kirti; Lamba, Arundeep Kaur; Faraz, Farukh; Tandon, Shruti

2016-01-01

Lip is an important aspect of facial features affecting ones personality. A deformity of the lip characterized by excessive tissue sagging below the usual giving it thicker wider appearance is referred to as double lip. It is a rare occurrence with a proposed male predilection. This article is a report of a 20 years old male with this deformity who presented with the complaint of difficult speech and poor aesthetics. There was no other history patient being systemically healthy. It was successively treated with a simple surgical technique without recurrence over a period of 12 months. PMID:27853696

Wheat germ agglutinin-conjugated liposomes incorporated with cardiolipin to improve neuronal survival in Alzheimer’s disease treatment

PubMed Central

Kuo, Yung-Chih; Lin, Che-Yu; Li, Jay-Shake; Lou, Yung-I

2017-01-01

Curcumin (CRM) and nerve growth factor (NGF) were entrapped in liposomes (LIP) with surface wheat germ agglutinin (WGA) to downregulate the phosphorylation of kinases in Alzheimer’s disease (AD) therapy. Cardiolipin (CL)-conjugated LIP carrying CRM (CRM-CL/LIP) and also carrying NGF (NGF-CL/LIP) were used with AD models of SK-N-MC cells and Wistar rats after an insult with β-amyloid peptide (Aβ). We found that CRM-CL/LIP inhibited the expression of phosphorylated p38 (p-p38), phosphorylated c-Jun N-terminal kinase (p-JNK), and p-tau protein at serine 202 and prevented neurodegeneration of SK-N-MC cells. In addition, NGF-CL/LIP could enhance the quantities of p-neurotrophic tyrosine kinase receptor type 1 and p-extracellular signal-regulated kinase 5 for neuronal rescue. Moreover, WGA-grafted CRM-CL/LIP and WGA-grafted NGF-CL/LIP significantly improved the permeation of CRM and NGF across the blood–brain barrier, reduced Aβ plaque deposition and the malondialdehyde level, and increased the percentage of normal neurons and cholinergic activity in the hippocampus of AD rats. Based on the marker expressions and in vivo evidence, current LIP carriers can be promising drug delivery systems to protect nervous tissue against Aβ-induced apoptosis in the brain during the clinical management of AD. PMID:28280340

Normal growth and development of the lips: a 3-dimensional study from 6 years to adulthood using a geometric model

PubMed Central

FERRARIO, VIRGILIO F.; SFORZA, CHIARELLA; SCHMITZ, JOHANNES H.; CIUSA, VERONICA; COLOMBO, ANNA

2000-01-01

A 3-dimensional computerised system with landmark representation of the soft-tissue facial surface allows noninvasive and fast quantitative study of facial growth. The aims of the present investigation were (1) to provide reference data for selected dimensions of lips (linear distances and ratios, vermilion area, volume); (2) to quantify the relevant growth changes; and (3) to evaluate sex differences in growth patterns. The 3-dimensional coordinates of 6 soft-tissue landmarks on the lips were obtained by an optoelectronic instrument in a mixed longitudinal and cross-sectional study (2023 examinations in 1348 healthy subjects between 6 y of age and young adulthood). From the landmarks, several linear distances (mouth width, total vermilion height, total lip height, upper lip height), the vermilion height-to-mouth width ratio, some areas (vermilion of the upper lip, vermilion of the lower lip, total vermilion) and volumes (upper lip volume, lower lip volume, total lip volume) were calculated and averaged for age and sex. Male values were compared with female values by means of Student's t test. Within each age group all lip dimensions (distances, areas, volumes) were significantly larger in boys than in girls (P < 0.05), with some exceptions in the first age groups and coinciding with the earlier female growth spurt, whereas the vermilion height-to-mouth width ratio did not show a corresponding sexual dimorphism. Linear distances in girls had almost reached adult dimensions in the 13–14 y age group, while in boys a large increase was still to occur. The attainment of adult dimensions was faster in the upper than in the lower lip, especially in girls. The method used in the present investigation allowed the noninvasive evaluation of a large sample of nonpatient subjects, leading to the definition of 3-dimensional normative data. Data collected in the present study could represent a data base for the quantitative description of human lip morphology from childhood to young adulthood. PMID:10853963

Production enhancement of the extracellular lipase LipA in Bacillus subtilis: Effects of expression system and Sec pathway components.

PubMed

Ma, Ran Jing; Wang, Yan Hong; Liu, Lu; Bai, Lei Lei; Ban, Rui

2018-02-01

Lipases are among the most versatile biocatalysts, and are used in a range of industrially relevant bioconversion reactions. However, the production of LipA in recombinant Bacillus subtilis is still limited, due to unresolved issues surrounding the regulation of the expression and secretion systems. In this study, the gene encoding LipA from B. subtilis 168 was expressed in BNA under the control of the P 43 and the P AE promoter. The extracellular lipase activity of the resulting strains BNACL and BNAAL was 7.8 U ml -1 and 12.6 U ml -1 , respectively. To further enhance the expression of LipA, pHP13L was constructed by inserting the P AE -lip into the shuttle vector pHP13, which produced an extracellular lipase activity of 180.5 U ml -1 of BNA/pHP13L. The strain BNAY8 described in Supplement data which lacks eight extracellular proteins was constructed and the deletion a few of the much weaker secreting proteins had no significant effect on the secretion of LipA. Moreover, the four Sec pathway components, secA-prfB, secDF, secYEG, prsA, were individually overexpressed in BNA. The overexpression of secDF and prsA enhanced the production of LipA by 28% and 49%, respectively. Furthermore, the co-overexpression of secDF with prsA improved the extracellular amount of LipA by 59% over that of BNA/pHP13L, reaching 287.8 U ml -1 . It can therefore be said that both regulatory elements and secretion pathway had an impact on the production of secreted LipA. Their optimization and modification is a useful strategy to improve the homologous overproduction of other extracellular proteins in B. subtilis. Copyright © 2017. Published by Elsevier Inc.

Record of the Pacific Large Low Shear Velocity Province Upwellings Preserved in the Cretaceous Large Igneous Provinces

NASA Astrophysics Data System (ADS)

Madrigal, P.; Gazel, E.; Flores, K. E.; Bizimis, M.; Jicha, B. R.

2015-12-01

As the surface expression of deep mantle dynamics, Large Igneous Provinces (LIPs) are associated with the edges of large low shear velocity provinces (LLSVP) rooted at the core-mantle boundary. Instabilities in the LLSVP can cause periodic upwellings of material in the form of mantle plumes, which impact the lithosphere forming LIPs. However, the time frames of these massive lava outpourings are still uncertain. While continental LIPs are more readily accessible, oceanic LIPs have only been studied through drilling and sampling of fragments accreted to continental margins or island arcs, hence, they are relatively less understood. The impact of oceanic LIPs on oceanic biota is conspicuously recorded in global occurrences of black shale deposits that evidence episodes of anoxia and mass extinctions shortly after the formation of LIPs that ultimately can affect life on the entire planet. Our new geochemical and geochronological data of accreted Pacific LIPs found in the coasts of Nicoya Peninsula in Costa Rica record three LIP pulses possibly reflecting upwelling periods of the LLSVP at 140, 120 and 90 Ma. In order to test different models of origin of these LIPS, we created a complete reconstruction of the Pacific Plate configuration from the Mid-Jurassic to Upper-Cretaceous to show the existing correlation between upwelling pulses at edges of the Pacific LLSVP, oceanic anoxic events and the age from Pacific LIPs. We propose that since the formation of the Pacific plate at circa 175-180 Ma, a series of upwellings that interacted with mid-ocean ridge systems separated by 10-20 Ma have affected the planet periodically forming oceanic LIPs that still can be found today on the Pacific seafloor and accreted along the plate margins.

Facial Aesthetic Outcomes of Cleft Surgery: Assessment of Discrete Lip and Nose Images Compared with Digital Symmetry Analysis.

PubMed

Deall, Ciara E; Kornmann, Nirvana S S; Bella, Husam; Wallis, Katy L; Hardwicke, Joseph T; Su, Ting-Li; Richard, Bruce M

2016-10-01

High-quality aesthetic outcomes are of paramount importance to children growing up after cleft lip and palate surgery. Establishing a validated and reliable assessment tool for cleft professionals and families will facilitate cleft units, surgeons, techniques, and protocols to be audited and compared with greater confidence. This study used exemplar images across a five-point aesthetic scale, identified in a pilot project, to score lips and noses as separate units and compared these human scores with computer-based SymNose symmetry scores. Forty-five assessors (17 cleft surgeons nationally and 28 other cleft professionals from the UK South West Tri-centre units), scored 25 standardized photographs, uploaded randomly onto a Web-based platform, twice. Each photograph was shown in three forms: lip and nose together, and separately cropped images of nose only and lip only. The same images were analyzed using the SymNose software program. Scoring lips gave the best intrarater and interrater reliabilities. Nose scores were more variable. Lip scoring associated most closely with the whole-image score. SymNose ranking of the lip images related highly to the same ranking by humans (p = 0.001). The exemplar images maintained their established previous ranking. Images illustrating the aesthetic outcome grades are confirmed. The lip score is reliable and seems to dominate in the whole-image score. Noses are much harder to score reliably. It appears that SymNose can score lip images very effectively by symmetry. Further use of SymNose will be investigated, and families of children with cleft will trial the scoring system. Therapeutic, III.

Rehabilitative treatment of cleft lip and palate: experience of the Hospital for Rehabilitation of Craniofacial Anomalies/USP (HRAC/USP) - Part 5: institutional outcomes assessment and the role of the Laboratory of Physiology.

PubMed

Freitas, José Alberto de Souza; Trindade-Suedam, Ivy Kiemle; Garib, Daniela Gamba; Neves, Lucimara Teixeira das; Almeida, Ana Lúcia Pompéia Fraga de; Yaedú, Renato Yassukata Faria; Oliveira, Thaís Marchini; Soares, Simone; Lauris, Rita de Cássia Moura Carvalho; Yamashita, Renata Paciello; Trindade, Alceu Sergio; Trindade, Inge Elly Kiemle; Pinto, João Henrique Nogueira

2013-01-01

The Laboratory of Physiology provides support for the diagnosis of functional disorders associated with cleft lip and palate and also conducts studies to assess, objectively, the institutional outcomes, as recommended by the World Health Organization. The Laboratory is conceptually divided into three units, namely the Unit for Upper Airway Studies, Unit for Stomatognathic System Studies and the Unit for Sleep Studies, which aims at analyzing the impact of different surgical and dental procedures on the upper airways, stomatognathic system and the quality of sleep of individuals with cleft lip and palate. This paper describes the main goals of the Laboratory in the assessment of procedures which constitute the basis of the rehabilitation of cleft lip and palate, i.e., Plastic Surgery, Orthodontics and Maxillofacial Surgery and Speech Pathology.

A Critical Role of Lyst-Interacting Protein5, a Positive Regulator of Multivesicular Body Biogenesis, in Plant Responses to Heat and Salt Stresses1

PubMed Central

Wang, Fei; Yang, Yan; Wang, Zhe; Zhou, Jie; Fan, Baofang; Chen, Zhixiang

2015-01-01

Multivesicular bodies (MVBs) are unique endosomes containing vesicles in the lumen and play critical roles in many cellular processes. We have recently shown that Arabidopsis (Arabidopsis thaliana) Lyst-Interacting Protein5 (LIP5), a positive regulator of the Suppressor of K+ Transport Growth Defect1 (SKD1) AAA ATPase in MVB biogenesis, is a critical target of the mitogen-activated protein kinases MPK3 and MPK6 and plays an important role in the plant immune system. In this study, we report that the LIP5-regulated MVB pathway also plays a critical role in plant responses to abiotic stresses. Disruption of LIP5 causes compromised tolerance to both heat and salt stresses. The critical role of LIP5 in plant tolerance to abiotic stresses is dependent on its ability to interact with Suppressor of K+ Transport Growth Defect1. When compared with wild-type plants, lip5 mutants accumulate increased levels of ubiquitinated protein aggregates and NaCl under heat and salt stresses, respectively. Further analysis using fluorescent dye and MVB markers reveals that abiotic stress increases the formation of endocytic vesicles and MVBs in a largely LIP5-dependent manner. LIP5 is also required for the salt-induced increase of intracellular reactive oxygen species, which have been implicated in signaling of salt stress responses. Basal levels of LIP5 phosphorylation by MPKs and the stability of LIP5 are elevated by salt stress, and mutation of MPK phosphorylation sites in LIP5 reduces the stability and compromises the ability to complement the lip5 salt-sensitive mutant phenotype. These results collectively indicate that the MVB pathway is positively regulated by pathogen/stress-responsive MPK3/6 through LIP5 phosphorylation and plays a critical role in broad plant responses to biotic and abiotic stresses. PMID:26229051

A New Classification System for Unilateral Cleft Lip and Palate Infants to assist Presurgical Infant Orthopedics.

PubMed

Daigavane, P S; Hazarey, P V; Niranjane, P; Vasudevan, S D; Thombare, B R; Daigavane, S

2015-01-01

The proposed advantages of pre-surgical naso-alveolar moulding (PNAM) are easy primary lip repair which heals under minimum tension reducing the scar formation and improving the aesthetic results in addition to reshaping of alar cartilage and improvement of nasal symmetry.However, the anatomy and alveolar morphology varies for each cleft child; the procedure for PNAM differs accordingly. In an attempt to categorize unilateral cleft lip and palate cases as per anatomical variations, a new classification system has been proposed. This classification aims to give an insight in unilateral cleft morphology based on which modification in PNAM procedure could be done.

Isolation and analysis of lipase-overproducing mutants of Serratia marcescens.

PubMed

Kawai, E; Akatsuka, H; Sakurai, N; Idei, A; Matsumae, H; Shibatani, T; Komatsubara, S; Omori, K

2001-01-01

We have isolated a lipase-overproducing mutant, GE14, from Serratia marcescens 8000 after three rounds of N-methyl-N'-nitro-N-nitrosoguanidine mutagenesis. The mutant GE14 produced 95 kU/ml of extracellular lipase in the lipase medium, which was about threefold higher than that of produced by the original strain 8000. Enzymatic characteristics including specific activity of purified lipases from culture supernatants of GE14 and 8000 were almost same. The lipase gene (lipA) of GE14 contained two base substitutions; one in the promoter region and another in the N-terminal region of the lipA gene without an amino acid substitution. Promoter analysis using lipA-lacZ fusion plasmids revealed that these substitutions were responsible for the increase in the lipA expression level, independently. In contrast, no base substitution was found in the genes encoding the lipase secretion device, the Lip system. In addition, the genes coding for metalloprotease and the cell surface layer protein which are both secreted through the Lip system and associated with extracellular lipase production, also contained no base substitution. The strain GE14 carrying a high-copy-number lipA plasmid produced a larger amount of the extracellular lipase than the recombinant strains of 8000 and other mutants also did, indicating that GE14 was not only a lipase-overproducing strain, but also an advantageous host strain for overproducing the lipase by a recombinant DNA technique. These results suggest that the lipase-overproducing mutant GE14 and its recombinant strains are promising candidates for the industrial production of the S. marcescens lipase.

The experiments of LIPS 3

NASA Technical Reports Server (NTRS)

Severns, J. G.; Hobbs, R. M.; Elliott, N. P.; Towsley, R. H.; Virshup, G. F.

1989-01-01

LIPS 3 is a member of the Living Plume Shield series of spacecraft. In each LIPS project, the plume shield, a simple sheet metal cone, was structurally stiffened, and an active satellite was then built around it. The original purpose of the plume shield was to prevent the plume from solid propellent engines, which are fired outside the atmosphere after the aerodynamic shroud is jettisoned, from reaching the primary payload. The surface of LIPS 3 facing the plume also functioned in this manner, but the anterior surfaces were unaffected, and it was there that all solar arrays, sensors, and experiments were mounted. The purpose of LIPS 3 was to provide a test bed for new space power sources. With the long delays projected for schedules of the STS and other major launch systems, it appeared that a decade might pass before long term flight data could be obtained on many new and innovative power sources. The fact that a launch scheduled for early in 1987 required a plume shield was seen as a unique opportunity to obtain some of this data in a timely manner. The LIPS 3 system, the experiments placed aboard, and the experiment data acquisition subsystem are described. Various problems were encountered during integration and after launch; those which appear to effect the accuracy of experimental results are discussed. A preliminary description is given of the accuracy of the flight experiment data.

A novel computer system for the evaluation of nasolabial morphology, symmetry and aesthetics after cleft lip and palate treatment. Part 2: Comparative anthropometric analysis of patients with repaired unilateral complete cleft lip and palate and healthy individuals.

PubMed

Pietruski, Piotr; Majak, Marcin; Pawlowska, Elzbieta; Skiba, Adam; Antoszewski, Boguslaw

2017-04-01

The aim of this study was to use a novel system, 'Analyse It Doc' (A.I.D.) for a complex anthropometric analysis of the nasolabial region in patients with repaired unilateral complete cleft lip and palate and in healthy individuals. A set of standardized facial photographs in frontal, lateral and submental view have been taken in 50 non-cleft controls (mean age 20.6 years) and 42 patients with repaired unilateral complete cleft and palate (mean age 19.57 years). Then, based on linear, angular and area measurements taken from the digital photographs with the aid of the A.I.D. system, a photogrammetric analysis of intergroup differences in nasolabial morphology and symmetry was conducted. Patients with cleft lip and palate differed from the controls in terms of more than half of analysed angular measurements and proportion indices derived from linear and area measurements of the nasolabial region. The findings presented herein imply that despite primary surgical repair, patients with unilateral complete cleft lip and palate still show some degree of nasolabial dysmorphology. Furthermore, the study demonstrated that the novel computer system is suitable for a reliable, simple and time-efficient anthropometric analysis in a clinical setting. Copyright © 2017 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

LipL53, a temperature regulated protein from Leptospira interrogans that binds to extracellular matrix molecules.

PubMed

Oliveira, Tatiane R; Longhi, Mariana T; Gonçales, Amane P; de Morais, Zenaide M; Vasconcellos, Silvio A; Nascimento, Ana L T O

2010-03-01

The regulation of gene expression by environmental signals, such as temperature and osmolarity, has been correlated with virulence. In this study, we characterize the protein LipL53 from Leptospira interrogans, previously shown to react with serum sample of individual diagnosed with leptospirosis and to be up-regulated by shift to physiological osmolarity. The recombinant protein was expressed in Escherichia coli system, in insoluble form, recovered by urea solubilization and further refolded by decreasing the denaturing agent concentration during the purification procedure. The secondary structure content of the recombinant LipL53, as assessed by circular dichroism, showed a mixture of beta-strands and alpha-helix. The presence of LipL53 transcript at 28 degrees C was only detected within the virulent strains. However, upon shifted of attenuated cultures of pathogenic strains from 28 degrees C to 37 degrees C and to 39 degrees C, this transcript could also be observed. LipL53 binds laminin, collagen IV, cellular and plasma fibronectin in dose-dependent and saturable manner. Animal challenge studies showed that LipL53, although immunogenic, elicited only partial protection in hamsters. LipL53 is probably surface exposed as seen through immunofluorescence confocal microscopy. Our results suggest that LipL53 is a novel temperature regulated adhesin of L. interrogans that may be relevant in the leptospiral pathogenesis. Copyright 2009 Elsevier Masson SAS. All rights reserved.

A Novel Amidotransferase Required for Lipoic Acid Cofactor Assembly in Bacillus subtilis

PubMed Central

Christensen, Quin H.; Martin, Natalia; Mansilla, Maria C.; de Mendoza, Diego; Cronan, John E.

2011-01-01

SUMMARY In the companion paper (Martin et al., 2011) we reported that Bacillus subtilis requires three proteins for lipoic acid metabolism, all of which are members of the lipoate protein ligase family. Two of the proteins, LipM and LplJ, have been shown to be an octanoyltransferase and a lipoate:protein ligase, respectively. The third protein, LipL, is essential for lipoic acid synthesis, but had no detectable octanoyltransferase or ligase activity either in vitro or in vivo. We report that LipM specifically modifies the glycine cleavage system protein, GcvH, and therefore another mechanism must exist for modification of other lipoic acid requiring enzymes (e.g., pyruvate dehydrogenase). We show that this function is provided by LipL which catalyzes the amidotransfer (transamidation) of the octanoyl moiety from octanoyl-GcvH to the E2 subunit of pyruvate dehydrogenase. LipL activity was demonstrated in vitro with purified components and proceeds via a thioester-linked acyl-enzyme intermediate. As predicted, ΔgcvH strains are lipoate auxotrophs. LipL represents a new enzyme activity. It is a GcvH:[lipoyl domain] amidotransferase that probably employs a Cys-Lys catalytic dyad. Although the active site cysteine residues of LipL and LipB are located in different positions within the polypeptide chains, alignment of their structures show these residues occupy similar positions. Thus, these two homologous enzymes have convergent architectures. PMID:21338421

Morphological evaluation of clefts of the lip, palate, or both in dogs.

PubMed

Peralta, Santiago; Fiani, Nadine; Kan-Rohrer, Kimi H; Verstraete, Frank J M

2017-08-01

OBJECTIVE To systematically characterize the morphology of cleft lip, cleft palate, and cleft lip and palate in dogs. ANIMALS 32 client-owned dogs with clefts of the lip (n = 5), palate (23), or both (4) that had undergone a CT or cone-beam CT scan of the head prior to any surgical procedures involving the oral cavity or face. PROCEDURES Dog signalment and skull type were recorded. The anatomic form of each defect was characterized by use of a widely used human oral-cleft classification system on the basis of CT findings and clinical images. Other defect morphological features, including shape, relative size, facial symmetry, and vomer involvement, were also recorded. RESULTS 9 anatomic forms of cleft were identified. Two anatomic forms were identified in the 23 dogs with cleft palate, in which differences in defect shape and size as well as vomer abnormalities were also evident. Seven anatomic forms were observed in 9 dogs with cleft lip or cleft lip and palate, and most of these dogs had incisive bone abnormalities and facial asymmetry. CONCLUSIONS AND CLINICAL RELEVANCE The morphological features of congenitally acquired cleft lip, cleft palate, and cleft lip and palate were complex and varied among dogs. The features identified here may be useful for surgical planning, developing of clinical coding schemes, or informing genetic, embryological, or clinical research into birth defects in dogs and other species.

Electrostatic and tribological phenomena and their effect on the braking torque in the shaft-oil-lip seal system

NASA Astrophysics Data System (ADS)

Gajewski, Juliusz B.; Glogowski, Marek J.

2008-12-01

The former research [1] was carried out on the influence of tribocharging in a system: metal rotating shaft-oil-lip seal on its work, especially on changes in the shaft braking torque with the increasing angular shaft velocity and oil temperature. The results obtained suggested that there be a possibility of reducing the braking torque by an external electric field. The compensation for the electric field generated in the system by natural tribocharging was proposed. The reduction in the braking torque seemed possible while applying an external DC electric field to the system. In general, the torque tended to increase with the increasing DC electric field for a variety of the oils and lip seals used and for different shaft angular velocities (rotational speeds) and oil temperatures. The braking torque reduction was achieved only for one lip seal and some different oils, which was and is a promising, expected result. The research results were yet presented elsewhere [1-3] and here some novel attempt has been made to interpret the results obtained in their physical—tribological and especially electrostatic—aspects since there has been a lack of such an interpretation in the literature of the subject.

Nasolabial Morphology Following Nasoalveolar Molding in Infants With Unilateral Cleft Lip and Palate.

PubMed

Nur Yilmaz, Rahime Burcu; Germeç Çakan, Derya

2018-06-01

The aim of the present study is to evaluate the effects of nasoalveolar molding (NAM) therapy on nasolabial morphology three dimensionally, and compare the nasolabial linear and surface distance measurements in infants with unilateral cleft lip and palate. Facial plaster casts of 42 infants with unilateral cleft lip and palate taken at the onset (pre-NAM) and finishing stage (post-NAM) of NAM were scanned with 3dMDface stereophotogrammetry system (3dMD, Atlanta, GA). Nineteen nasolabial linear and surface distance measurements were performed on three-dimensional images. In addition to standard descriptive statistical calculations (means and SDs), pre- and post-NAM measurements were evaluated by paired t test. All measurements except lip gap, nostril floor width, and nostril diameter increased between pre-NAM and post-NAM. Nostril and lip height increased significantly on the cleft side (P < 0.05). No differences were present between linear and surface distance measurements except for nasal width measurement. Nasal and lip symmetry improved with NAM. The use of surface distance measurements may be advised particularly for continuous and curved anatomic structures in which circumference differences are expected.

Discrimination of speech and non-speech sounds following theta-burst stimulation of the motor cortex

PubMed Central

Rogers, Jack C.; Möttönen, Riikka; Boyles, Rowan; Watkins, Kate E.

2014-01-01

Perceiving speech engages parts of the motor system involved in speech production. The role of the motor cortex in speech perception has been demonstrated using low-frequency repetitive transcranial magnetic stimulation (rTMS) to suppress motor excitability in the lip representation and disrupt discrimination of lip-articulated speech sounds (Möttönen and Watkins, 2009). Another form of rTMS, continuous theta-burst stimulation (cTBS), can produce longer-lasting disruptive effects following a brief train of stimulation. We investigated the effects of cTBS on motor excitability and discrimination of speech and non-speech sounds. cTBS was applied for 40 s over either the hand or the lip representation of motor cortex. Motor-evoked potentials recorded from the lip and hand muscles in response to single pulses of TMS revealed no measurable change in motor excitability due to cTBS. This failure to replicate previous findings may reflect the unreliability of measurements of motor excitability related to inter-individual variability. We also measured the effects of cTBS on a listener’s ability to discriminate: (1) lip-articulated speech sounds from sounds not articulated by the lips (“ba” vs. “da”); (2) two speech sounds not articulated by the lips (“ga” vs. “da”); and (3) non-speech sounds produced by the hands (“claps” vs. “clicks”). Discrimination of lip-articulated speech sounds was impaired between 20 and 35 min after cTBS over the lip motor representation. Specifically, discrimination of across-category ba–da sounds presented with an 800-ms inter-stimulus interval was reduced to chance level performance. This effect was absent for speech sounds that do not require the lips for articulation and non-speech sounds. Stimulation over the hand motor representation did not affect discrimination of speech or non-speech sounds. These findings show that stimulation of the lip motor representation disrupts discrimination of speech sounds in an articulatory feature-specific way. PMID:25076928

Discrimination of speech and non-speech sounds following theta-burst stimulation of the motor cortex.

PubMed

Rogers, Jack C; Möttönen, Riikka; Boyles, Rowan; Watkins, Kate E

2014-01-01

Perceiving speech engages parts of the motor system involved in speech production. The role of the motor cortex in speech perception has been demonstrated using low-frequency repetitive transcranial magnetic stimulation (rTMS) to suppress motor excitability in the lip representation and disrupt discrimination of lip-articulated speech sounds (Möttönen and Watkins, 2009). Another form of rTMS, continuous theta-burst stimulation (cTBS), can produce longer-lasting disruptive effects following a brief train of stimulation. We investigated the effects of cTBS on motor excitability and discrimination of speech and non-speech sounds. cTBS was applied for 40 s over either the hand or the lip representation of motor cortex. Motor-evoked potentials recorded from the lip and hand muscles in response to single pulses of TMS revealed no measurable change in motor excitability due to cTBS. This failure to replicate previous findings may reflect the unreliability of measurements of motor excitability related to inter-individual variability. We also measured the effects of cTBS on a listener's ability to discriminate: (1) lip-articulated speech sounds from sounds not articulated by the lips ("ba" vs. "da"); (2) two speech sounds not articulated by the lips ("ga" vs. "da"); and (3) non-speech sounds produced by the hands ("claps" vs. "clicks"). Discrimination of lip-articulated speech sounds was impaired between 20 and 35 min after cTBS over the lip motor representation. Specifically, discrimination of across-category ba-da sounds presented with an 800-ms inter-stimulus interval was reduced to chance level performance. This effect was absent for speech sounds that do not require the lips for articulation and non-speech sounds. Stimulation over the hand motor representation did not affect discrimination of speech or non-speech sounds. These findings show that stimulation of the lip motor representation disrupts discrimination of speech sounds in an articulatory feature-specific way.

Metabolism of fatty acids and lipid hydroperoxides in human body monitoring with Fourier transform Infrared Spectroscopy.

PubMed

Yoshida, Satoshi; Zhang, Qin-Zeng; Sakuyama, Shu; Matsushima, Satoshi

2009-07-24

The metabolism of dietary fatty acids in human has been measured so far using human blood cells and stable-isotope labeled fatty acids, however, no direct data was available for human peripheral tissues and other major organs. To realize the role of dietary fatty acids in human health and diseases, it would be eager to develop convenient and suitable method to monitor fatty acid metabolism in human. We have developed the measurement system in situ for human lip surface lipids using the Fourier transform infrared spectroscopy (FTIR) - attenuated total reflection (ATR) detection system with special adaptor to monitor metabolic changes of lipids in human body. As human lip surface lipids may not be much affected by skin sebum constituents and may be affected directly by the lipid constituents of diet, we could detect changes of FTIR-ATR spectra, especially at 3005 to approximately 3015 cm(-1), of lip surface polyunsaturated fatty acids in a duration time-dependent manner after intake of the docosahexaenoic acid (DHA)-containing triglyceride diet. The ingested DHA appeared on the lip surface and was detected by FTIR-ATR directly and non-invasively. It was found that the metabolic rates of DHA for male volunteer subjects with age 60s were much lower than those with age 20s. Lipid hydroperoxides were found in lip lipids which were extracted from the lip surface using a mixture of ethanol/ethylpropionate/iso-octane solvents, and were the highest in the content just before noon. The changes of lipid hydroperoxides were detected also in situ with FTIR-ATR at 968 cm(-1). The measurements of lip surface lipids with FTIR-ATR technique may advance the investigation of human lipid metabolism in situ non-invasively.

The process of development of a prioritization tool for a clinical decision support build within a computerized provider order entry system: Experiences from St Luke's Health System.

PubMed

Wolf, Matthew; Miller, Suzanne; DeJong, Doug; House, John A; Dirks, Carl; Beasley, Brent

2016-09-01

To establish a process for the development of a prioritization tool for a clinical decision support build within a computerized provider order entry system and concurrently to prioritize alerts for Saint Luke's Health System. The process of prioritizing clinical decision support alerts included (a) consensus sessions to establish a prioritization process and identify clinical decision support alerts through a modified Delphi process and (b) a clinical decision support survey to validate the results. All members of our health system's physician quality organization, Saint Luke's Care as well as clinicians, administrators, and pharmacy staff throughout Saint Luke's Health System, were invited to participate in this confidential survey. The consensus sessions yielded a prioritization process through alert contextualization and associated Likert-type scales. Utilizing this process, the clinical decision support survey polled the opinions of 850 clinicians with a 64.7 percent response rate. Three of the top rated alerts were approved for the pre-implementation build at Saint Luke's Health System: Acute Myocardial Infarction Core Measure Sets, Deep Vein Thrombosis Prophylaxis within 4 h, and Criteria for Sepsis. This study establishes a process for developing a prioritization tool for a clinical decision support build within a computerized provider order entry system that may be applicable to similar institutions. © The Author(s) 2015.

Comparative study of upper lip frenectomy with the CO2 laser versus the Er, Cr: YSGG laser

PubMed Central

Pié-Sánchez, Jordi; España-Tost, Antonio J.; Arnabat-Domínguez, Josep

2012-01-01

Objectives: To compare upper lip frenulum reinsertion, bleeding, surgical time and surgical wound healing in frenectomies performed with the CO2 laser versus the Er, Cr:YSGG laser. Study design: A prospective study was carried out on 50 randomized pediatric patients who underwent rhomboidal resection of the upper lip frenulum with either the CO2 laser or the Er,Cr:YSGG laser. Twenty-five patients were assigned to each laser system. All patients were examined at 7, 14, 21 days and 4 months after the operation in order to assess the surgical wound healing. Results: Insertion of the frenulum, which was preoperatively located between the upper central incisors, migrated to the mucogingival junction as a result of using both laser systems in all patients. Only two patients required a single dose of 650 mg of paracetamol, one of either study group. CO2 laser registered improved intraoperative bleeding control results and shorter surgical times. On the other hand, the Er,Cr:YSGG laser achieved faster healing. Conclusions: Upper lip laser frenectomy is a simple technique that results in minimum or no postoperative swelling or pain, and which involves upper lip frenulum reinsertion at the mucogingival junction. The CO2 laser offers a bloodless field and shorter surgical times compared with the Er,Cr:YSGG laser. On the other hand, the Er,Cr:YSGG laser achieved faster wound healing. Key words:Frenectomy, upper lip frenulum, CO2 laser, Er,Cr:YSGG laser, laser. PMID:22143683

Some observations on computer lip-reading: moving from the dream to the reality

NASA Astrophysics Data System (ADS)

Bear, Helen L.; Owen, Gari; Harvey, Richard; Theobald, Barry-John

2014-10-01

In the quest for greater computer lip-reading performance there are a number of tacit assumptions which are either present in the datasets (high resolution for example) or in the methods (recognition of spoken visual units called "visemes" for example). Here we review these and other assumptions and show the surprising result that computer lip-reading is not heavily constrained by video resolution, pose, lighting and other practical factors. However, the working assumption that visemes, which are the visual equivalent of phonemes, are the best unit for recognition does need further examination. We conclude that visemes, which were defined over a century ago, are unlikely to be optimal for a modern computer lip-reading system.

Decoding Target Distance and Saccade Amplitude from Population Activity in the Macaque Lateral Intraparietal Area (LIP)

PubMed Central

Bremmer, Frank; Kaminiarz, Andre; Klingenhoefer, Steffen; Churan, Jan

2016-01-01

Primates perform saccadic eye movements in order to bring the image of an interesting target onto the fovea. Compared to stationary targets, saccades toward moving targets are computationally more demanding since the oculomotor system must use speed and direction information about the target as well as knowledge about its own processing latency to program an adequate, predictive saccade vector. In monkeys, different brain regions have been implicated in the control of voluntary saccades, among them the lateral intraparietal area (LIP). Here we asked, if activity in area LIP reflects the distance between fovea and saccade target, or the amplitude of an upcoming saccade, or both. We recorded single unit activity in area LIP of two macaque monkeys. First, we determined for each neuron its preferred saccade direction. Then, monkeys performed visually guided saccades along the preferred direction toward either stationary or moving targets in pseudo-randomized order. LIP population activity allowed to decode both, the distance between fovea and saccade target as well as the size of an upcoming saccade. Previous work has shown comparable results for saccade direction (Graf and Andersen, 2014a,b). Hence, LIP population activity allows to predict any two-dimensional saccade vector. Functional equivalents of macaque area LIP have been identified in humans. Accordingly, our results provide further support for the concept of activity from area LIP as neural basis for the control of an oculomotor brain-machine interface. PMID:27630547

Acinetobacter baumannii Is Dependent on the Type II Secretion System and Its Substrate LipA for Lipid Utilization and In Vivo Fitness

PubMed Central

Johnson, Tanya L.; Waack, Ursula; Smith, Sara; Mobley, Harry

2015-01-01

ABSTRACT Gram-negative bacteria express a number of sophisticated secretion systems to transport virulence factors across the cell envelope, including the type II secretion (T2S) system. Genes for the T2S components GspC through GspN and PilD are conserved among isolates of Acinetobacter baumannii, an increasingly common nosocomial pathogen that is developing multidrug resistance at an alarming rate. In contrast to most species, however, the T2S genes are dispersed throughout the genome rather than linked into one or two operons. Despite this unique genetic organization, we show here that the A. baumannii T2S system is functional. Deletion of gspD or gspE in A. baumannii ATCC 17978 results in loss of secretion of LipA, a lipase that breaks down long-chain fatty acids. Due to a lack of extracellular lipase, the gspD mutant, the gspE mutant, and a lipA deletion strain are incapable of growth on long-chain fatty acids as a sole source of carbon, while their growth characteristics are indistinguishable from those of the wild-type strain in nutrient-rich broth. Genetic inactivation of the T2S system and its substrate, LipA, also has a negative impact on in vivo fitness in a neutropenic murine model for bacteremia. Both the gspD and lipA mutants are outcompeted by the wild-type strain as judged by their reduced numbers in spleen and liver following intravenous coinoculation. Collectively, our findings suggest that the T2S system plays a hitherto-unrecognized role in in vivo survival of A. baumannii by transporting a lipase that may contribute to fatty acid metabolism. IMPORTANCE Infections by multidrug-resistant Acinetobacter baumannii are a growing health concern worldwide, underscoring the need for a better understanding of the molecular mechanisms by which this pathogen causes disease. In this study, we demonstrated that A. baumannii expresses a functional type II secretion (T2S) system that is responsible for secretion of LipA, an extracellular lipase required for utilization of exogenously added lipids. The T2S system and the secreted lipase support in vivo colonization and thus contribute to the pathogenic potential of A. baumannii. PMID:26668261

Influence of nasoalveolar molding on skeletal development in patients with unilateral cleft lip and palate at 5 years of age.

PubMed

Akarsu-Guven, Bengisu; Arisan, Arda; Ozgur, Figen; Aksu, Muge

2018-04-01

The aim of this retrospective study was to assess the influence of presurgical nasoalveolar molding (NAM) on skeletal development in patients with operated unilateral cleft lip and palate at 5 years of age. Lateral cephalometric radiographs of 26 unilateral cleft lip and palate patients who had undergone presurgical NAM (NAM group) and 20 unilateral cleft lip and palate patients who did not have any presurgical NAM (non-NAM group) were analyzed. The radiographs were digitally traced using Quick Ceph Studio software (version 3.5.1.r (1151); Quick Ceph Systems, San Diego, Calif). Independent samples t tests were performed for statistical analysis. No significant differences were observed in sagittal and vertical skeletal measurements between the NAM and non-NAM groups. NAM resulted in no significant difference in skeletal development in unilateral cleft lip and palate patients compared with those without NAM in early childhood. Copyright © 2018. Published by Elsevier Inc.

The Physiologic Development of Speech Motor Control: Lip and Jaw Coordination

PubMed Central

Green, Jordan R.; Moore, Christopher A.; Higashikawa, Masahiko; Steeve, Roger W.

2010-01-01

This investigation was designed to describe the development of lip and jaw coordination during speech and to evaluate the potential influence of speech motor development on phonologic development. Productions of syllables containing bilabial consonants were observed from speakers in four age groups (i.e., 1-year-olds, 2-year-olds, 6-year-olds, and young adults). A video-based movement tracking system was used to transduce movement of the upper lip, lower lip, and jaw. The coordinative organization of these articulatory gestures was shown to change dramatically during the first several years of life and to continue to undergo refinement past age 6. The present results are consistent with three primary phases in the development of lip and jaw coordination for speech: integration, differentiation, and refinement. Each of these developmental processes entails the existence of distinct coordinative constraints on early articulatory movement. It is suggested that these constraints will have predictable consequences for the sequence of phonologic development. PMID:10668666

Summative Evaluation of the Learning Initiatives Program (LIP). Final Report

ERIC Educational Resources Information Center

Human Resources and Skills Development Canada, 2005

2005-01-01

The Learning Initiatives Program (LIP), formerly the Learning Initiatives Fund (LIF), is a contribution program which was established in 1994 to encourage and support initiatives that contribute to the development of a results-oriented, accessible, relevant and accountable learning system in Canada. Through this program, Human Resources and Skills…

Development of Information System for Patients with Cleft Lip and Palate undergoing Operation.

PubMed

Augsornwan, Darawan; Pattangtanang, Pantamanas; Surakunprapha, Palakorn

2015-08-01

Srinagarind Hospital has 150-200 patients with cleft lip and palate each year. When patients are admitted to hospital for surgery patients and family feel they are in a crisis of life, they feel fear anxiety and need to know about how to take care of wound, they worry if patient will feel pain, how to feed patients and many things about patients. Information is very important for patients/family to prevent complications and help their decision process, decrease parents stress and encourage better co-operation. To develop information system for patients with cleft lip-palate undergoing operation. This is an action research divided into 3 phases. Phase 1 Situation review: in this phase we interview, nursing care observation, and review nursing documents about the information giving. Phase 2 Develop information system: focus groups, for discussion about what nurses can do to develop the system to give information to patients/parents. Phase 3 evaluation: by interviewing 61 parents using the structure questionnaire. 100 percent of patients/parents received information but some items were not received. Patients/parents satisfaction was 94.9 percent, no complications. The information system development provides optimal care for patients and family with cleft lip and palate, but needs to improve some techniques or tools to give more information and evaluate further the nursing outcome after.

Neuronal responses to target onset in oculomotor and somatomotor parietal circuits differ markedly in a choice task.

PubMed

Kubanek, J; Wang, C; Snyder, L H

2013-11-01

We often look at and sometimes reach for visible targets. Looking at a target is fast and relatively easy. By comparison, reaching for an object is slower and is associated with a larger cost. We hypothesized that, as a result of these differences, abrupt visual onsets may drive the circuits involved in saccade planning more directly and with less intermediate regulation than the circuits involved in reach planning. To test this hypothesis, we recorded discharge activity of neurons in the parietal oculomotor system (area LIP) and in the parietal somatomotor system (area PRR) while monkeys performed a visually guided movement task and a choice task. We found that in the visually guided movement task LIP neurons show a prominent transient response to target onset. PRR neurons also show a transient response, although this response is reduced in amplitude, is delayed, and has a slower rise time compared with LIP. A more striking difference is observed in the choice task. The transient response of PRR neurons is almost completely abolished and replaced with a slow buildup of activity, while the LIP response is merely delayed and reduced in amplitude. Our findings suggest that the oculomotor system is more closely and obligatorily coupled to the visual system, whereas the somatomotor system operates in a more discriminating manner.

An anatomical subunit-based outcome assessment scale for bilateral cleft lip and palate.

PubMed

Bonanthaya, K; Shetty, P N; Fudalej, P S; Rao, D D; Bitra, S; Pabari, M; Rachwalski, M

2017-08-01

As there is currently no internationally accepted outcome measurement tool available for complete bilateral cleft lip and palate (CBCLP), the goal of this prospective study was to develop a numerical evaluation scale that allows reliable scoring of this cleft deformity. Our cohort comprised 121 Indian subjects with CBCLP who underwent surgical repair (mean age at time of surgery 6.53 months) using a modified Millard technique. A panel of three professionals evaluated each subject's outcome of bilateral cleft lip repair 6 months postoperatively on two-dimensional (2D) full-face photographs in the frontal view and worm's eye view. A simple two-point rating system was applied to separately analyse a total of 12 components of lip, nose, and scar. The results and mean scores for the analysed anatomical areas were 2.2±1.01 (max=3) for nose, 5.4±1.54 (max=8) for lip, and 1.9±1.3 (max=3) for scar, with a total score 7.7±2.21 (max=12) indicating a good surgical outcome. The inter-examiner ICC for nose, lip, scar, and total score was calculated at 0.836, 0.889, 0.723, and 0.927 respectively and indicated a strong level of repeatability and reliability that was highly significant (P<0.001). In conclusion, we were able to develop and test a scoring system for measuring outcomes in CBCLP that warrants simplicity of use, reliability and reproducibility. Copyright © 2017 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Carcinomatous myelitis and meningitis after a squamous cell carcinoma of the lip.

PubMed

Pougnet, Isabelle; Murati, Anne; Sarran, Anthony; Viens, Patrice; Sabatier, Renaud

2014-01-01

Nervous central system metastases from head and neck squamous cell carcinoma (SCC) are rare. We report an exceptional case of isolated leptomeningeal and spinal cord involvement few years after the diagnosis of invasive SCC of the lip. A 33-year-old man with a history of infracentimetric carcinoma of the lip developed back pain associated with progressive neurological disorders leading to paraplegia. This atypical presentation led to initial misdiagnosis, but radiological and cytological explorations finally confirmed the diagnosis of leptomeningeal and intramedullar secondary spinal cord lesions from his previously treated head and neck SCC. Systemic targeted therapy with epidermal growth factor receptor inhibitor and intrathecal chemotherapy led to prolonged disease stabilization. To our knowledge, this is the first case of isolated neurological metastases from a head and neck SCC. Combination of systemic targeted therapy and intrathecal chemotherapy may be effective in such cases.

The effect of requirements prioritization on avionics system conceptual design

NASA Astrophysics Data System (ADS)

Lorentz, John

This dissertation will provide a detailed approach and analysis of a new collaborative requirements prioritization methodology that has been used successfully on four Coast Guard avionics acquisition and development programs valued at $400M+. A statistical representation of participant study results will be discussed and analyzed in detail. Many technically compliant projects fail to deliver levels of performance and capability that the customer desires. Some of these systems completely meet "threshold" levels of performance; however, the distribution of resources in the process devoted to the development and management of the requirements does not always represent the voice of the customer. This is especially true for technically complex projects such as modern avionics systems. A simplified facilitated process for prioritization of system requirements will be described. The collaborative prioritization process, and resulting artifacts, aids the systems engineer during early conceptual design. All requirements are not the same in terms of customer priority. While there is a tendency to have many thresholds inside of a system design, there is usually a subset of requirements and system performance that is of the utmost importance to the design. These critical capabilities and critical levels of performance typically represent the reason the system is being built. The systems engineer needs processes to identify these critical capabilities, the associated desired levels of performance, and the risks associated with the specific requirements that define the critical capability. The facilitated prioritization exercise is designed to collaboratively draw out these critical capabilities and levels of performance so they can be emphasized in system design. Developing the purpose, scheduling and process for prioritization events are key elements of systems engineering and modern project management. The benefits of early collaborative prioritization flow throughout the project schedule, resulting in greater success during system deployment and operational testing. This dissertation will discuss the data and findings from participant studies, present a literature review of systems engineering and design processes, and test the hypothesis that the prioritization process had no effect on stakeholder sentiment related to the conceptual design. In addition, the "Requirements Rationalization" process will be discussed in detail. Avionics, like many other systems, has transitioned from a discrete electronics engineering, hard engineering discipline to incorporate software engineering as a core process of the technology development cycle. As with other software-based systems, avionics now has significant soft system attributes that must be considered in the design process. The boundless opportunities that exist in software design demand prioritization to focus effort onto the critical functions that the software must provide. This has been a well documented and understood phenomenon in the software development community for many years. This dissertation will attempt to link the effect of software integrated avionics to the benefits of prioritization of requirements in the problem space and demonstrate the sociological and technical benefits of early prioritization practices.

Purification and characterization of halophilic lipase of Chromohalobacter sp. from ancient salt well.

PubMed

Ai, Li; Huang, Yaping; Wang, Chuan

2018-06-04

A halophilic lipase (LipS2) was produced by Chromohalobacter canadensis strain which was isolated from ancient salt well of Zigong, China. LipS2 was purified to homogeneity and showed a single band with molecular mass of 58 kDa by SDS-PAGE. LipS2 preferred middle-to-long acyl chain esters with C14 triglycerides as optimum substrate. It was noteworthy that LipS2 displayed efficient hydrolysis activity to some vegetable oils which were composed of polyunsaturated fatty acid. LipS2 showed high activity in range of 2.5-3.5 M NaCl, no activity without salt. Optimum temperature and pH were 55 °C and pH 8.5, respectively. Notably, the thermostability and pH stability of LipS2, varying with salt concentration, reached optimum in the presence of 3.0 M NaCl. LipS2 was stimulated by Ca 2+ and Mg 2+ , inhibited by Zn 2+ , Cu 2+ , Mn 2+ , Fe 2+ , and Hg 2+ . Moreover, LipS2 displayed significant tolerance to organic solvents including methanol, ethanol, ethyl acetate and acetone, especially, LipS2 activity was enhanced markedly by the hexane and benzene. Non-ionic surfactants increased LipS2 activity, while ionic surfactants decreased activity. This was the first report on halophilic lipase of Chromohalobacter from ancient salt well. The results suggested that LipS2 may have considerable potential for biotechnological applications. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Speech Motor Development during Acquisition of the Voicing Contrast

ERIC Educational Resources Information Center

Grigos, Maria I.; Saxman, John H.; Gordon, Andrew M.

2005-01-01

Lip and jaw movements were studied longitudinally in 19-month-old children as they acquired the voicing contrast for /p/ and /b/. A movement tracking system obtained lip and jaw kinematics as participants produced the target utterances /papa/ and /baba/. Laryngeal adjustments were also tracked through acoustically recorded voice onset time (VOT)…

Identification of Skeletal Deformities in Far Eastern Catfish, Silurus asotus under Indoor Aquaculture Condition

PubMed Central

Yang, Won Seok; Gil, Hyun Woo; Yoo, Gwang Yeol; Park, In-Seok

2015-01-01

For the 2 years of farming, at the indoor circulating aquaculture system, four kinds of skeletal deformities were found among 60 Far Eastern catfish, Silurus asotus. Deformities saw jawbone’s luxation, abnormality of upper lip and malocclusion. Spinal deformity was most fatal deformities with low weight and small length. Jawbone’s luxation had 1 maxilla and 2 mandibles. Abnormality of upper lip had just lip was back over. Malocclusion’s left maxilla and right maxilla were not balanced. This experiment was any deformities in this species through the deformity can grasp how it affects. PMID:27004272

Laser weld jig. [Patent application

DOEpatents

Van Blarigan, P.; Haupt, D.L.

1980-12-05

A system is provided for welding a workpiece along a predetermined weld line that may be of irregular shape, which includes the step of forming a lip on the workpiece to extend parallel to the weld line, and moving the workpiece by engaging the lip between a pair of rotatable members. Rotation of one of the members at a constant speed, causes the workpiece to move so that all points on the weld line sequentially pass a fixed point in space at a constant speed, so that a laser welding beam can be directed at that fixed point to form a weld along the weld line. The workpiece can include a reusable jig forming the lip, and with the jig constructed to detachably hold parts to be welded at a position wherein the weld line of the parts extends parallel to the lip on the jig.

Sexually selected lip colour indicates male group-holding status in the mating season in a multi-level primate society

PubMed Central

Grueter, Cyril C.; Zhu, Pingfen; Allen, William L.; Higham, James P.; Ren, Baoping; Li, Ming

2015-01-01

Sexual selection typically produces ornaments in response to mate choice, and armaments in response to male–male competition. Unusually among mammals, many primates exhibit colour signals that may be related to one or both processes. Here, we document for the first time correlates of facial coloration in one of the more brightly coloured primates, the black-and-white snub-nosed monkey (Rhinopithecus bieti). Snub-nosed monkeys have a one-male unit (OMU) based social organization, but these units aggregate semi-permanently into larger bands. This form of mating system causes many males to become associated with bachelor groups. We quantified redness of the prominent lower lip in 15 males (eight bachelors, seven OMU holders) in a group at Xiangguqing, China. Using mixed models, our results show that lip redness increases with age. More interestingly, there is a significant effect of the interaction of group-holding status and mating season on redness; that is, lip colour of OMU males undergoes reddening in the mating season, whereas the lips of subadult and juvenile bachelor males become paler at that time of year. These results indicate that lip coloration is a badge of (group-holding) status during the mating season, with non-adults undergoing facial differentiation, perhaps to avoid the costs of reproductive competition. Future research should investigate whether lip coloration is a product of male–male competition, and/or female mate choice. PMID:27019735

Invariant principles of speech motor control that are not language-specific.

PubMed

Chakraborty, Rahul

2012-12-01

Bilingual speakers must learn to modify their speech motor control mechanism based on the linguistic parameters and rules specified by the target language. This study examines if there are aspects of speech motor control which remain invariant regardless of the first (L1) and second (L2) language targets. Based on the age of academic exposure and proficiency in L2, 21 Bengali-English bilingual participants were classified into high (n = 11) and low (n = 10) L2 (English) proficiency groups. Using the Optotrak 3020 motion sensitive camera system, the lips and jaw movements were recorded while participants produced Bengali (L1) and English (L2) sentences. Based on kinematic analyses of the lip and jaw movements, two different variability measures (i.e., lip aperture and lower lip/jaw complex) were computed for English and Bengali sentences. Analyses demonstrated that the two groups of bilingual speakers produced lip aperture complexes (a higher order synergy) that were more consistent in co-ordination than were the lower lip/jaw complexes (a lower order synergy). Similar findings were reported earlier in monolingual English speakers by Smith and Zelaznik. Thus, this hierarchical organization may be viewed as a fundamental principle of speech motor control, since it is maintained even in bilingual speakers.

[Effect of soft tissue thickness of upper lip on lip retraction in orthodontical-treated Class II, Division 1 females].

PubMed

Zou, Lanyi; Chen, Yunjia; Liu, Henglang; Na, Bi; He, Jinlong; Fan, Xiaoping

2016-04-01

To establish the Chinese Han national criteria for the thickness of upper lip in Chongqing and to investigate the effect of lip thickness on lip retraction in orthodontic treatment.
 A total of 240 adult patients (male=120, female=120) of Chinese Han nationality aged 18-35 years in Chongqing were treated with cephalograms and measured the thickness of upper lip. We established the Chinese Han national criteria for the thickness of upper lip in Chongqing according to the results. Sixty-eight female patients with Angle II 1 from Department of Orthodontics Stomatological Hospital of Chongqing Medical University were treated with maxillary premolars extraction, and pre- and post-treated with lateral cephalograms, then divided into 3 groups according to our criteria: a thin lips group, a normal lips group and a thick lips group. The ratio of the incisors retraction and the upper lip retraction were measured and calculated. The correlation between incisors retraction and the upper lip retraction was analyzed by the Pearson correlation method.
 There was statistical significance in the thickness of upper lip between males and females (P<0.01). The ratio of maxillary inscior retraction to the upper lip soft tissue retraction was 1.6:1, 2.2:1 and 2.9:1 in the thin lips group, the normal lips group and the thick lips group, respectively.
 Gender differences exist in the thickness of upper lip. Upper lip retraction with the incisors was negatively correlated with the soft tissue thickness of the upper lip in females with Angle II 1.

The Last Gasp - the Terminal Magmatic Stages of the Keweenaw LIP

NASA Astrophysics Data System (ADS)

Rooney, T. O.; Brown, E.; Moucha, R.; Stein, C. A.; Stein, S.

2016-12-01

The Keweenaw Flood Basalts, which represent the magmatic record of the best preserved example of a Precambrian Large Igneous Province (LIP), erupted contemporaneously with the development of the failed Mid-Continent Rift ca. 1.1 Ga. At 2 x 106 km3 in volume, the Keweenaw LIP is roughly equivalent in scale to the Parana-Etendeka LIP, but the origin and evolution of the magmatic source of the Keweenaw LIP remains poorly constrained. Specifically, while modern LIPs have a primary magmatic pulse lasting <5Ma, followed by a long phase of waning activity, the Keweenaw LIP underwent significant flood basalt eruptions for ca. 21 Myr. Here we examine the geochemical characteristics of the final phases of magmatic activity within the Keweenaw LIP - the Lake Shore Traps - which erupted ca. 1087 Ma within an alluvial fan sequence (Copper Harbor Conglomerate). The Lake Shore Traps are best exposed at High Rock Bay, where 62 flows ( 1-30m thick) are observed intercalated with thin paleosols over a 530m thickness. Thus, while this late-stage activity might represent a waning phase of magmatism, the thickness represents some half of the total average thickness of modern continental flood basalt provinces. Our initial data suggests a dominantly tholeiitic magma series spanning an unexpectedly wide and continuous range of compositions from basalt to andesite; rare alkaline lavas are also evident. Distinctive geochemical stratigraphic patterns were observed suggesting crystal fractionation and recharge events dominated the magma system. Our initial data do not show any unambiguous parallels between the geochemical characteristics of the Lake Shore Traps and prior phases of magmatic activity in the province. We explore the potential source characteristics of these lavas to refine the source and conditions of melt generation during the terminal phase of activity in the region.

Comparative genomic analysis reveals 2-oxoacid dehydrogenase complex lipoylation correlation with aerobiosis in archaea.

PubMed

Borziak, Kirill; Posner, Mareike G; Upadhyay, Abhishek; Danson, Michael J; Bagby, Stefan; Dorus, Steve

2014-01-01

Metagenomic analyses have advanced our understanding of ecological microbial diversity, but to what extent can metagenomic data be used to predict the metabolic capacity of difficult-to-study organisms and their abiotic environmental interactions? We tackle this question, using a comparative genomic approach, by considering the molecular basis of aerobiosis within archaea. Lipoylation, the covalent attachment of lipoic acid to 2-oxoacid dehydrogenase multienzyme complexes (OADHCs), is essential for metabolism in aerobic bacteria and eukarya. Lipoylation is catalysed either by lipoate protein ligase (LplA), which in archaea is typically encoded by two genes (LplA-N and LplA-C), or by a lipoyl(octanoyl) transferase (LipB or LipM) plus a lipoic acid synthetase (LipA). Does the genomic presence of lipoylation and OADHC genes across archaea from diverse habitats correlate with aerobiosis? First, analyses of 11,826 biotin protein ligase (BPL)-LplA-LipB transferase family members and 147 archaeal genomes identified 85 species with lipoylation capabilities and provided support for multiple ancestral acquisitions of lipoylation pathways during archaeal evolution. Second, with the exception of the Sulfolobales order, the majority of species possessing lipoylation systems exclusively retain LplA, or either LipB or LipM, consistent with archaeal genome streamlining. Third, obligate anaerobic archaea display widespread loss of lipoylation and OADHC genes. Conversely, a high level of correspondence is observed between aerobiosis and the presence of LplA/LipB/LipM, LipA and OADHC E2, consistent with the role of lipoylation in aerobic metabolism. This correspondence between OADHC lipoylation capacity and aerobiosis indicates that genomic pathway profiling in archaea is informative and that well characterized pathways may be predictive in relation to abiotic conditions in difficult-to-study extremophiles. Given the highly variable retention of gene repertoires across the archaea, the extension of comparative genomic pathway profiling to broader metabolic and homeostasis networks should be useful in revealing characteristics from metagenomic datasets related to adaptations to diverse environments.

The attractive lip: A photomorphometric analysis.

PubMed

Penna, V; Fricke, A; Iblher, N; Eisenhardt, S U; Stark, G B

2015-07-01

Throughout literature, there are different parameters defining the ideal shape of the lip and lower third of the face. This study was conducted to clarify what it is that makes lips attractive - and whether there are gender-related differences of an attractive lip and lower third of the face. Pictures of the lip and chin region of 176 patients were photographed in a standardised way and evaluated by 250 voluntary judges through an internet presentation by means of an analogue Likert scaling system. We found a significant higher ratio of upper vermillion height/mouth-nose distance in frontal-view images of attractive compared to unattractive female (p < 0.001) and male (p < 0.05) perioral regions. Furthermore, the ratio of upper vermillion height/chin-nose distance was significantly higher in attractive than in unattractive female (p < 0.005) and male (p < 0.05) lip and chin regions. The nasolabial angle was significantly sharper in attractive compared to unattractive female perioral regions (p < 0.001). Moreover, attractive female lip and chin regions showed a wider mentolabial angle compared to unattractive female lip and chin regions (p < 0.05). Comparing men and women, we found that attractive female perioral regions showed a higher ratio of lower vermillion height/chin-mouth distance (p < 0.05) and lower vermillion height/chin-nose distance than attractive male perioral regions (p < 0.05). We were able to define certain parameters of the lip and lower third of the face that seem to add to the attractivity of female and male individuals and prove that there are gender-related differences in form and shape of an attractive lower third of the face. Copyright © 2015 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

A Biomechanical Modeling Study of the Effects of the Orbicularis Oris Muscle and Jaw Posture on Lip Shape

ERIC Educational Resources Information Center

Stavness, Ian; Nazari, Mohammad Ali; Perrier, Pascal; Demolin, Didier; Payan, Yohan

2013-01-01

Purpose: The authors' general aim is to use biomechanical models of speech articulators to explore how possible variations in anatomical structure contribute to differences in articulatory strategies and phone systems across human populations. Specifically, they investigated 2 issues: (a) the link between lip muscle anatomy and variability in…

Priority rating : stormwater outfall prioritization scheme

DOT National Transportation Integrated Search

1996-10-01

The prioritization system, which compares the impacts of one outfall to another : and makes a determination of their overall impacts, was developed in the : Prioritization Method for Retrofitting Highways with Stormwater BMPs, prepared : by the Water...

Evaluation and integration of disparate classification systems for clefts of the lip

PubMed Central

Wang, Kathie H.; Heike, Carrie L.; Clarkson, Melissa D.; Mejino, Jose L. V.; Brinkley, James F.; Tse, Raymond W.; Birgfeld, Craig B.; Fitzsimons, David A.; Cox, Timothy C.

2014-01-01

Orofacial clefting is a common birth defect with wide phenotypic variability. Many systems have been developed to classify cleft patterns to facilitate diagnosis, management, surgical treatment, and research. In this review, we examine the rationale for different existing classification schemes and determine their inter-relationships, as well as strengths and deficiencies for subclassification of clefts of the lip. The various systems differ in how they describe and define attributes of cleft lip (CL) phenotypes. Application and analysis of the CL classifications reveal discrepancies that may result in errors when comparing studies that use different systems. These inconsistencies in terminology, variable levels of subclassification, and ambiguity in some descriptions may confound analyses and impede further research aimed at understanding the genetics and etiology of clefts, development of effective treatment options for patients, as well as cross-institutional comparisons of outcome measures. Identification and reconciliation of discrepancies among existing systems is the first step toward creating a common standard to allow for a more explicit interpretation that will ultimately lead to a better understanding of the causes and manifestations of phenotypic variations in clefting. PMID:24860508

Is it possible to define the ideal lips?

PubMed

Kar, M; Muluk, N B; Bafaqeeh, S A; Cingi, C

2018-02-01

The lips are an essential component of the symmetry and aesthetics of the face. Cosmetic surgery to modify the lips has recently gained in popularity, but the results are in some cases disasterous. In this review, we describe the features of the ideal lips for an individual's face. The features of the ideal lips with respect to facial anatomy, important anatomical landmarks of the face, the facial proportions of the lips and ethnic and sexual differences are described. The projection and relative sizes of the upper and lower lips are as significant to lip aesthetics as the proportion of the lips to the rest of the facial structure. Robust, pouty lips are considered to be sexually attractive by both males and females. Horizontal thirds and the golden ratio describe the proportions that contribute to the beauty and attractiveness of the lips. In young Caucasians, the ideal ratio of the vertical height of the upper lip to that of the lower lip is 1:1.6. Blacks, genetically, have a greater lip volume. The shape and volume of a person's lips are of great importance in the perception of beauty by humans. The appearance of the lips in part determines the attractiveness of a person's face. In females, fuller lips in relation to facial width as well as greater vermilion height are considered to be attractive. Copyright © 2018 Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.

Prioritizing removal of dams for passage of diadromous fishes on a major river system

USGS Publications Warehouse

Kocovsky, P.M.; Ross, R.M.; Dropkin, D.S.

2009-01-01

Native diadromous fishes have been extirpated from much of the Susquehanna River system for nearly a century. Recent restoration efforts have focused on removal of dams, but there are hundreds of dams and presently there is no biologically based system to assist in prioritizing their removal. We present a new method that uses existing habitat suitability index models (HSI) for American shad Alosa sapidissima, alewife A. pseudoharengus, blueback herring A. aestivalis, and American eel Anguilla rostrata to prioritize the removal of non-hydropower dams within the Susquehanna River system. We ranked HSI scores for each of the four species, association between a landscape-scale factor and HSIs, length of river opened by removing a dam, and distance from the mouth at Chesapeake Bay for each dam and then calculated a mean rank prioritization for dam removal by averaging the ranks for the seven criteria. This prioritization method is resistant to outliers, is not strongly affected by somewhat arbitrary decisions on metrics included in the analysis, and provides a biologically based prioritization for dam removal that can be easily amended to include other metrics or adapted to other river systems and that complements other social and economic considerations that must be included in decisions to remove dams.

Dynamic Integration of Task-Relevant Visual Features in Posterior Parietal Cortex

PubMed Central

Freedman, David J.

2014-01-01

Summary The primate visual system consists of multiple hierarchically organized cortical areas, each specialized for processing distinct aspects of the visual scene. For example, color and form are encoded in ventral pathway areas such as V4 and inferior temporal cortex, while motion is preferentially processed in dorsal pathway areas such as the middle temporal area. Such representations often need to be integrated perceptually to solve tasks which depend on multiple features. We tested the hypothesis that the lateral intraparietal area (LIP) integrates disparate task-relevant visual features by recording from LIP neurons in monkeys trained to identify target stimuli composed of conjunctions of color and motion features. We show that LIP neurons exhibit integrative representations of both color and motion features when they are task relevant, and task-dependent shifts of both direction and color tuning. This suggests that LIP plays a role in flexibly integrating task-relevant sensory signals. PMID:25199703

Laser weld jig

DOEpatents

Van Blarigan, Peter; Haupt, David L.

1982-01-01

A system is provided for welding a workpiece (10, FIG. 1) along a predetermined weld line (12) that may be of irregular shape, which includes the step of forming a lip (32) on the workpiece to extend parallel to the weld line, and moving the workpiece by engaging the lip between a pair of rotatable members (34, 36). Rotation of one of the members at a constant speed, causes the workpiece to move so that all points on the weld line sequentially pass a fixed point in space (17) at a constant speed, so that a laser welding beam can be directed at that fixed point to form a weld along the weld line. The workpiece can include a reuseable jig (24) forming the lip, and with the jig constructed to detachably hold parts (22, 20) to be welded at a position wherein the weld line of the parts extends parallel to the lip on the jig.

[The new potentials of magneto-laser therapy and electrostimulation in children with cleft palate and upper lip].

PubMed

Gerasimenko, M Iu; Filatova, E V; Borisenko, O V; Levchenkova, V D; Grishina, N V; Spiridonova, N Z; Shevchenko, E Iu; Goncharenko, L L

2000-01-01

The paper presents rationale for design of new procedures of physiotherapy in children with expanded palate and upper lip; morphofunctional features of prenatal and early postnatal formation of central nervous system; a multilayer technique of magneto-laser radiation to the projection of the anterior central gyrus and the technique of electrostimulation by the system of the wink reflex which can influence central mechanisms of regulation and adaptation before and early after uranoplasty and cheiloplasty.

A New Perspective on Neonatal Smiling: Differences between the Judgments of Expert Coders and Naive Observers

ERIC Educational Resources Information Center

Dondi, Marco; Messinger, Daniel; Colle, Marta; Tabasso, Alessia; Simion, Francesca; Barba, Beatrice Dalla; Fogel, Alan

2007-01-01

To better understand the form and recognizability of neonatal smiling, 32 newborns (14 girls; M = 25.6 hr) were videorecorded in the behavioral states of alertness, drowsiness, active sleep, and quiet sleep. Baby Facial Action Coding System coding of both lip corner raising (simple or non-Duchenne) and lip corner raising with cheek raising…

Effects of Normal and Perturbed Social Play on the Duration and Amplitude of Different Types of Infant Smiles

ERIC Educational Resources Information Center

Fogel, Alan; Hsu, Hui-Chin; Shapiro, Alyson F.; Nelson-Goens, G. Christina; Secrist, Cory

2006-01-01

Different types of smiling varying in amplitude of lip corner retraction were investigated during 2 mother-infant games--peekaboo and tickle--at 6 and 12 months and during normally occurring and perturbed games. Using Facial Action Coding System (FACS), infant smiles were coded as simple (lip corner retraction only), Duchenne (simple plus cheek…

47 CFR 10.410 - Prioritization.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 47 Telecommunication 1 2010-10-01 2010-10-01 false Prioritization. 10.410 Section 10.410 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL COMMERCIAL MOBILE ALERT SYSTEM Alert Message Requirements § 10.410 Prioritization. A Participating CMS Provider is required to transmit Presidential Alerts...

Kinematic Features of Jaw and Lips Distinguish Symptomatic From Presymptomatic Stages of Bulbar Decline in Amyotrophic Lateral Sclerosis.

PubMed

Bandini, Andrea; Green, Jordan R; Wang, Jun; Campbell, Thomas F; Zinman, Lorne; Yunusova, Yana

2018-05-17

The goals of this study were to (a) classify speech movements of patients with amyotrophic lateral sclerosis (ALS) in presymptomatic and symptomatic phases of bulbar function decline relying solely on kinematic features of lips and jaw and (b) identify the most important measures that detect the transition between early and late bulbar changes. One hundred ninety-two recordings obtained from 64 patients with ALS were considered for the analysis. Feature selection and classification algorithms were used to analyze lip and jaw movements recorded with Optotrak Certus (Northern Digital Inc.) during a sentence task. A feature set, which included 35 measures of movement range, velocity, acceleration, jerk, and area measures of lips and jaw, was used to classify sessions according to the speaking rate into presymptomatic (> 160 words per minute) and symptomatic (< 160 words per minute) groups. Presymptomatic and symptomatic phases of bulbar decline were distinguished with high accuracy (87%), relying only on lip and jaw movements. The best features that allowed detecting the differences between early and later bulbar stages included cumulative path of lower lip and jaw, peak values of velocity, acceleration, and jerk of lower lip and jaw. The results established a relationship between facial kinematics and bulbar function decline in ALS. Considering that facial movements can be recorded by means of novel inexpensive and easy-to-use, video-based methods, this work supports the development of an automatic system for facial movement analysis to help clinicians in tracking the disease progression in ALS.

Updating and improving methodology for prioritizing highway project locations on the strategic intermodal system (SIS).

DOT National Transportation Integrated Search

2016-04-01

The Florida Department of Transportation (FDOT) District One developed the Congestion Management Process : (CMP) system to prioritize low-cost, near-term highway improvements on the Strategic Intermodal System (SIS). : The existing CMP system is desi...

The Metagenome-Derived Enzymes LipS and LipT Increase the Diversity of Known Lipases

PubMed Central

Chow, Jennifer; Kovacic, Filip; Dall Antonia, Yuliya; Krauss, Ulrich; Fersini, Francesco; Schmeisser, Christel; Lauinger, Benjamin; Bongen, Patrick; Pietruszka, Joerg; Schmidt, Marlen; Menyes, Ina; Bornscheuer, Uwe T.; Eckstein, Marrit; Thum, Oliver; Liese, Andreas; Mueller-Dieckmann, Jochen; Jaeger, Karl-Erich; Streit, Wolfgang R.

2012-01-01

Triacylglycerol lipases (EC 3.1.1.3) catalyze both hydrolysis and synthesis reactions with a broad spectrum of substrates rendering them especially suitable for many biotechnological applications. Most lipases used today originate from mesophilic organisms and are susceptible to thermal denaturation whereas only few possess high thermotolerance. Here, we report on the identification and characterization of two novel thermostable bacterial lipases identified by functional metagenomic screenings. Metagenomic libraries were constructed from enrichment cultures maintained at 65 to 75°C and screened resulting in the identification of initially 10 clones with lipolytic activities. Subsequently, two ORFs were identified encoding lipases, LipS and LipT. Comparative sequence analyses suggested that both enzymes are members of novel lipase families. LipS is a 30.2 kDa protein and revealed a half-life of 48 h at 70°C. The lipT gene encoded for a multimeric enzyme with a half-life of 3 h at 70°C. LipS had an optimum temperature at 70°C and LipT at 75°C. Both enzymes catalyzed hydrolysis of long-chain (C12 and C14) fatty acid esters and additionally hydrolyzed a number of industry-relevant substrates. LipS was highly specific for (R)-ibuprofen-phenyl ester with an enantiomeric excess (ee) of 99%. Furthermore, LipS was able to synthesize 1-propyl laurate and 1-tetradecyl myristate at 70°C with rates similar to those of the lipase CalB from Candida antarctica. LipS represents the first example of a thermostable metagenome-derived lipase with significant synthesis activities. Its X-ray structure was solved with a resolution of 1.99 Å revealing an unusually compact lid structure. PMID:23112831

Prioritizing Genetic Testing in Patients With Kallmann Syndrome Using Clinical Phenotypes

PubMed Central

Costa-Barbosa, Flavia Amanda; Balasubramanian, Ravikumar; Keefe, Kimberly W.; Shaw, Natalie D.; Al-Tassan, Nada; Plummer, Lacey; Dwyer, Andrew A.; Buck, Cassandra L.; Choi, Jin-Ho; Seminara, Stephanie B.; Quinton, Richard; Monies, Dorota; Meyer, Brian; Hall, Janet E.; Pitteloud, Nelly

2013-01-01

Context: The complexity of genetic testing in Kallmann syndrome (KS) is growing and costly. Thus, it is important to leverage the clinical evaluations of KS patients to prioritize genetic screening. Objective: The objective of the study was to determine which reproductive and nonreproductive phenotypes of KS subjects have implications for specific gene mutations. Subjects: Two hundred nineteen KS patients were studied: 151 with identified rare sequence variants (RSVs) in 8 genes known to cause KS (KAL1, NELF, CHD7, HS6ST1, FGF8/FGFR1, or PROK2/PROKR2) and 68 KS subjects who remain RSV negative for all 8 genes. Main Outcome Measures: Reproductive and nonreproductive phenotypes within each genetic group were measured. Results: Male KS subjects with KAL1 RSVs displayed the most severe reproductive phenotype with testicular volumes (TVs) at presentation of 1.5 ± 0.1 mL vs 3.7 ± 0.3 mL, P < .05 vs all non-KAL1 probands. In both sexes, synkinesia was enriched but not unique to patients with KAL1 RSVs compared with KAL1-negative probands (43% vs 12%; P < .05). Similarly, dental agenesis and digital bone abnormalities were enriched in patients with RSVs in the FGF8/FGFR1 signaling pathway compared with all other gene groups combined (39% vs 4% and 23% vs 0%; P < .05, respectively). Hearing loss marked the probands with CHD7 RSVs (40% vs 13% in non-CHD7 probands; P < .05). Renal agenesis and cleft lip/palate did not emerge as statistically significant phenotypic predictors. Conclusions: Certain clinical features in men and women are highly associated with genetic causes of KS. Synkinesia (KAL1), dental agenesis (FGF8/FGFR1), digital bony abnormalities (FGF8/FGFR1), and hearing loss (CHD7) can be useful for prioritizing genetic screening. PMID:23533228

[Effect of limb ischemic preconditioning on the expression of p38 MAPK and HSP 70 in CA3 and DG regions of the hippocampus of rats].

PubMed

Sun, Xiao-Cai; Li, Wen-Bin; Zhao, Li; Jia, Hui-Xian; Wang, Fang; Zhang, Min; Li, Shu-Qin

2013-01-01

To observe the expression of p38 MAPK and HSP 70 in CA3 and dentate gyrus (DG) regions of the hippocampus of rats induced by limb ischemic preconditioning (LIP). Ninety-six rats were randomly divided into sham and LIP groups. And the animals in the LIP group were further divided into LIP 6 h, LIP 12 h, LIP 1 d, LIP 2 d, LIP 3 d, LIP 4 d and LIP 5 d subgroups according to the time of reperfusion after LIP. Immunohistochemical staining and Western blot were used to observe the expression of p38 MAPK and HSP 70 in CA3 and DG regions of the hippocampus. The results of the immunohistochemical staining and Western blot were consistent, which indicated that there were fluctuation in the p-p38 MAPK and HSP 70 expression in CA3 and DG regions after LIP compared with those of the sham group. The expression of p-p38 MAPK began to be up-regulated 1d after LIP and reached its peak at 3 d and lasted for 4 d after LIP. However, the expression of HSP 70 was significantly up-regulated 2 d after LIP compared to the sham group, reached its peak at 3 d and lasted until the 4 d after LIP. LIP up-regulates the expression of p38 MAPK and HSP 70 in the CA3 and DG regions of the hippocampus of rats.

Oblique lip-alveolar banding in patients with cleft lip and palate.

PubMed

Naidoo, S; Bütow, K-W

2015-04-01

We report an oblique lip-alveolar band, a rare banding of soft tissue that involves the lip and alveolus, which we have found in five patients with cleft lip and palate (0.2%), compared with an incidence of the Simonartz lip-lip band of 5.7%). To our knowledge this has not been reported previously. In two patients the bands affected the cleft lip and alveolus bilaterally, with or without the palatal cleft, and in three the bands were unilateral cleft lip and alveolus with or without the palatal cleft. Copyright © 2015 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Preparation and investigation of Ulex europaeus agglutinin I-conjugated liposomes as potential oral vaccine carriers.

PubMed

Li, KeXin; Chen, DaWei; Zhao, XiuLi; Hu, HaiYang; Yang, ChunRong; Pang, DaHai

2011-11-01

We prepared and optimized Ulex europaeus agglutinin I (UEAI)-modified Bovine serum albumin (BSA)-encapsulating liposomes (UEAI-LIP) as oral vaccine carriers and examined the feasibility of inducing systemic and mucosal immune responses by oral administration of UEAILIP. The prepared systems were characterized in vitro for their average size, zeta potential, encapsulation efficiency (EE%) and conjugation efficiency (CE%). In vitro release studies indicated that the presence of UEAI around the optimized liposomes was able to prevent a burst release of loaded BSA and provide sustained release of the encapsulated protein. In vivo immune-stimulating results in KM mice showed that BSA given intramuscularly generated systemic response only but both systemic and mucosal immune responses could be induced simultaneously in the groups in which BSA-loaded liposomes (LIP) and UEAI-LIP were administered intragastrically. Furthermore, the modification of UEAI on the surface of liposomes could further enhance the IgA and IgG levels obviously. In conclusion, this study demonstrated the high potential of lectin-modified liposomes containing the antigen as carriers for oral vaccine.

Glial heterotopia of the lip: A rare presentation.

PubMed

Dadaci, Mehmet; Bayram, Fazli Cengiz; Ince, Bilsev; Bilgen, Fatma

2016-01-01

Glial heterotopia represents collections of normal glial tissue in an abnormal location distant to the central nervous system or spinal canal with no intracranial connectivity. Nasal gliomas are non-neoplastic midline tumours, with limited growth potential and no similarity to the central nervous system gliomas. The nose and the nasopharynx are the most common sites of location. Existence of glial heterotopia in the lip region is a rare developmental disorder. We report a case of large glial heterotopia in the upper lip region in a full-term female newborn which had intracranial extension with a fibrotic band. After the surgery, there was no recurrence in the follow-up period of 3 years. When glial heterotopia, which is a rare midline anomaly, is suspected, possible intracranial connection and properties of the mass should be evaluated by magnetic resonance imaging. By this way, lower complication rate and better aesthetic results can be achieved with early diagnosis and proper surgery.

Reflex responses of lip muscles in young and older women.

PubMed

Wohlert, A B

1996-06-01

The perioral reflex in response to innocuous mechanical stimulation of the lip vermilion was studied in 20 young and 20 older women. Responses to stimuli at the right and left sides of both the upper and lower lips were recorded. Results show significant specificity of response, especially for upper lip sites. Reflex response at the site of stimulation was greatest in amplitude and shortest in latency, followed by response at sites ipsilateral to the site of stimulation. Younger subjects showed greater localizing tendency than older subjects. Stimulation was significantly less likely to produce a reflex response in the older group. When reflex responses did occur, they were significantly lower in amplitude and longer in latency than the responses of the younger group. Nonetheless, reflex responses were common in both groups, with responses at the site of stimulation occurring 78% of the time in older women and 90% of the time in younger women. Every participant showed at least one reflex response to lip stimulation. Results suggest decreasing complexity of synaptic drive to the perioral system in old age but also show that reflexive response does not deteriorate completely, remaining an available element for motor control in normal older women.

Lip prints and inheritance of cleft lip and cleft palate.

PubMed

Cj, Manasa Ravath; Hc, Girish; Murgod, Sanjay; Hegde, Ramesh B; Jk, Savita

2014-07-01

Labial mucosa has elevations and depressions forming a pattern called 'Lip Prints'. Parents of patients with cleft lip &/or palate are known to have a particular lip print pattern. Analysis of lip prints and relationship between Cheiloscopy and inheritance of cleft lip &/or cleft palate. The study included 100 subjects [study groupparents with children having cleft lip &/or cleft palate, 50 fathers and 50 mothers) and 50 subjects (control group-parents having children without cleft lip &/or cleft palate, 25 fathers and 25 mothers. The lip prints of the subjects were obtained using the cellophane method and analysed using Suzuki & Tsuchihashi classification of lip prints. The data was subjected to Chi- Square test, Fisher Exact test and Student t-test [two tailed, independent]. A new whorl pattern was present in the study group. The groove count was higher in the fathers' than in the mothers' prints in the upper lip and vice versa in the lower lip. The new pattern was present in the study group in a significant number of cases. The groove count was significantly high in the study group. These two parameters can be of significant value to similar future studies.

Lip Prints and Inheritance of Cleft Lip and Cleft Palate

PubMed Central

CJ, Manasa Ravath; HC, Girish; Hegde, Ramesh B; JK, Savita

2014-01-01

Background: Labial mucosa has elevations and depressions forming a pattern called ‘Lip Prints’. Parents of patients with cleft lip &/or palate are known to have a particular lip print pattern. Objectives: Analysis of lip prints and relationship between Cheiloscopy and inheritance of cleft lip &/or cleft palate. Methodology: The study included 100 subjects [study groupparents with children having cleft lip &/or cleft palate, 50 fathers and 50 mothers) and 50 subjects (control group-parents having children without cleft lip &/or cleft palate, 25 fathers and 25 mothers. The lip prints of the subjects were obtained using the cellophane method and analysed using Suzuki & Tsuchihashi classification of lip prints. The data was subjected to Chi- Square test, Fisher Exact test and Student t-test [two tailed, independent]. Results: A new whorl pattern was present in the study group. The groove count was higher in the fathers’ than in the mothers’ prints in the upper lip and vice versa in the lower lip. Conclusion: The new pattern was present in the study group in a significant number of cases. The groove count was significantly high in the study group. These two parameters can be of significant value to similar future studies. PMID:25177633

Refractory Pigmentation Associated with Laugier-Hunziker Syndrome following Er:YAG Laser Treatment.

PubMed

Ergun, Sertan; Saruhanoğlu, Alp; Migliari, Dante-Antonio; Maden, Ilay; Tanyeri, Hakkı

2013-01-01

The present report describes a case of Laugier-Hunziker syndrome (LHS), a rare benign condition. A patient with LHS develops acquired melanotic pigmentation of the lips and buccal mucosa, often with pigmentation of the nails occurring. No systemic symptoms are associated with this syndrome. Normally, no treatment is required for this condition, unless for aesthetic reason, mainly due to pigmentation on the lip mucosa. We present a case of LHS, 37-year-old female, whose pigmentations on her lip and in the oral cavity were treated with an Er:YAG laser. At the postoperative 12th month followup, the lesions recurred. The effects of any surgical attempt to treat pigmentations associated with LHS were discussed.

Prevalence of dental anomalies in children with cleft lip and unilateral and bilateral cleft lip and palate.

PubMed

Rullo, R; Festa, V M; Rullo, R; Addabbo, F; Chiodini, P; Vitale, M; Perillo, L

2015-09-01

To examine the prevalence of different types of dental anomalies in children with nonsyndromic cleft lip, unilateral cleft lip-palate, and bilateral cleft lip-palate. A sample of 90 patients (aged 4-20 years) affected by isolated cleft lip, unilateral and bilateral cleft lip and palate was examined. Cleft patients were classified into one of three groups according to cleft type: (1) Unilateral Cleft Lip-Palate, (2) Bilateral Cleft Lip-Palate, and (3) Cleft Lip. Intraoral exams, panoramic radiographs and dental casts, were used to analyse the prevalence of the various dental anomalies included in this study. There were no statistically significant differences between patients with cleft lip, unilateral cleft lip and palate and bilateral cleft lip and palate. The congenital absence of the cleft-side lateral incisor was observed in 40% of the sample, and a total of 30% patients showed supernumerary teeth at the incisors region. Second premolar agenesis was found in 4.4% of patients, whereas in 18.9% of the sample there was an ectopic dental eruption. Lateral or central incisors rotation was noted in 31.1% of the sample, while shape anomaly, lateral incisor microdontia, and enamel hypoplasia were detected respectively in 25.6%, 5.6% and 18.9% of cleft patients. High prevalence of different dental anomalies in children with cleft lip and unilateral and bilateral cleft lip and palate has been confirmed. This study, in particular, shows the presence of ectopic and rotated teeth in the cleft area.

Presurgical Unilateral Cleft Lip Anthropometrics and the Presence of Dental Anomalies.

PubMed

Antonarakis, Gregory S; Fisher, David M

2015-07-01

To investigate associations between cleft lip anthropometrics and dental anomalies in the permanent dentition in unilateral cleft lip patients. Retrospective cross-sectional study. Children with unilateral clefts of the lip, with or without cleft palate. Anthropometric lip measurements, made immediately prior to lip repair, were available for each patient. The presence of dental anomalies in the permanent dentition was assessed radiographically. The presence of associations between anthropometric lip measurements and prevalence rates of different dental anomalies were determined using logistic regression analyses. In the 122 included patients, the cleft lateral lip element was deficient in height in 80% and in transverse length in 84% of patients. Patients with more deficient cleft side lateral lip height and less deficient cleft side lateral lip transverse length were more likely to present with cleft side maxillary lateral incisor agenesis. On the other hand, patients with a less deficient cleft side lateral lip height and more deficient cleft side lateral lip transverse length were more likely to present with a cleft side supernumerary maxillary lateral incisor. When looking only at incomplete clefts, the cleft side lateral lip transverse length deficiency was more predictive of the presence of supernumerary maxillary lateral incisors (P = .030), while for complete clefts, the cleft side lateral lip height deficiency was more predictive of the presence of maxillary lateral incisor agenesis (P = .035). In patients with unilateral clefts, cleft lip anthropometrics have a predictive role in determining the occurrence of dental anomalies.

Cell-bound lipases from Burkholderia sp. ZYB002: gene sequence analysis, expression, enzymatic characterization, and 3D structural model.

PubMed

Shu, Zhengyu; Lin, Hong; Shi, Shaolei; Mu, Xiangduo; Liu, Yanru; Huang, Jianzhong

2016-05-03

The whole-cell lipase from Burkholderia cepacia has been used as a biocatalyst in organic synthesis. However, there is no report in the literature on the component or the gene sequence of the cell-bound lipase from this species. Qualitative analysis of the cell-bound lipase would help to illuminate the regulation mechanism of gene expression and further improve the yield of the cell-bound lipase by gene engineering. Three predictive cell-bound lipases, lipA, lipC21 and lipC24, from Burkholderia sp. ZYB002 were cloned and expressed in E. coli. Both LipA and LipC24 displayed the lipase activity. LipC24 was a novel mesophilic enzyme and displayed preference for medium-chain-length acyl groups (C10-C14). The 3D structural model of LipC24 revealed the open Y-type active site. LipA displayed 96 % amino acid sequence identity with the known extracellular lipase. lipA-inactivation and lipC24-inactivation decreased the total cell-bound lipase activity of Burkholderia sp. ZYB002 by 42 % and 14 %, respectively. The cell-bound lipase activity from Burkholderia sp. ZYB002 originated from a multi-enzyme mixture with LipA as the main component. LipC24 was a novel lipase and displayed different enzymatic characteristics and structural model with LipA. Besides LipA and LipC24, other type of the cell-bound lipases (or esterases) should exist.

Four-point injection technique for lip augmentation.

PubMed

Sahan, Ali; Funda, Tamer

2018-06-01

Lip augmentation procedures with hyaluronic acid dermal fillers have become increasingly popular worldwide because full lips are often considered beautiful and youthful. The goal of a lip augmentation procedure is to create smooth lips with adequate volume and a natural appearance. Various techniques for lip augmentation have been utilized and described. In the four-point injection technique, the lips were divided equally into right side and left side. Four entry points were made above the vermilion border for the upper lip and below the vermilion border for the lower lip. The filler was administered with a fanning technique through each entry point. Between January 2017 and November 2017, 50 female patients underwent a nonsurgical lip augmentation procedure with injectable fillers using this technique. Forty-five patients (90%) reported that they were satisfied or extremely satisfied with their lip enhancement procedure. No serious complications were observed. The advantages of this technique are reducing the risk of complications like erythema, edema, and vascular injuries, and providing easy access to injection sites.

LIPS database with LIPService: a microscopic image database of intracellular structures in Arabidopsis guard cells.

PubMed

Higaki, Takumi; Kutsuna, Natsumaro; Hasezawa, Seiichiro

2013-05-16

Intracellular configuration is an important feature of cell status. Recent advances in microscopic imaging techniques allow us to easily obtain a large number of microscopic images of intracellular structures. In this circumstance, automated microscopic image recognition techniques are of extreme importance to future phenomics/visible screening approaches. However, there was no benchmark microscopic image dataset for intracellular organelles in a specified plant cell type. We previously established the Live Images of Plant Stomata (LIPS) database, a publicly available collection of optical-section images of various intracellular structures of plant guard cells, as a model system of environmental signal perception and transduction. Here we report recent updates to the LIPS database and the establishment of a database table, LIPService. We updated the LIPS dataset and established a new interface named LIPService to promote efficient inspection of intracellular structure configurations. Cell nuclei, microtubules, actin microfilaments, mitochondria, chloroplasts, endoplasmic reticulum, peroxisomes, endosomes, Golgi bodies, and vacuoles can be filtered using probe names or morphometric parameters such as stomatal aperture. In addition to the serial optical sectional images of the original LIPS database, new volume-rendering data for easy web browsing of three-dimensional intracellular structures have been released to allow easy inspection of their configurations or relationships with cell status/morphology. We also demonstrated the utility of the new LIPS image database for automated organelle recognition of images from another plant cell image database with image clustering analyses. The updated LIPS database provides a benchmark image dataset for representative intracellular structures in Arabidopsis guard cells. The newly released LIPService allows users to inspect the relationship between organellar three-dimensional configurations and morphometrical parameters.

Face mask ventilation in edentulous patients: a comparison of mandibular groove and lower lip placement.

PubMed

Racine, Stéphane X; Solis, Audrey; Hamou, Nora Ait; Letoumelin, Philippe; Hepner, David L; Beloucif, Sadek; Baillard, Christophe

2010-05-01

In edentulous patients, it may be difficult to perform face mask ventilation because of inadequate seal with air leaks. Our aim was to ascertain whether the "lower lip" face mask placement, as a new face mask ventilation method, is more effective at reducing air leaks than the standard face mask placement. Forty-nine edentulous patients with inadequate seal and air leak during two-hand positive-pressure ventilation using the ventilator circle system were prospectively evaluated. In the presence of air leaks, defined as a difference of at least 33% between inspired and expired tidal volumes, the mask was placed in a lower lip position by repositioning the caudal end of the mask above the lower lip while maintaining the head in extension. The results are expressed as mean +/- SD or median (25th-75th percentiles). Patient characteristics included age (71 +/- 11 yr) and body mass index (24 +/- 4 kg/m2). By using the standard method, the median inspired and expired tidal volumes were 450 ml (400-500 ml) and 0 ml (0-50 ml), respectively, and the median air leak was 400 ml (365-485 ml). After placing the mask in the lower lip position, the median expired tidal volume increased to 400 ml (380-490), and the median air leak decreased to 10 ml (0-20 ml) (P < 0.001 vs. standard method). The lower lip face mask placement with two hands reduced the air leak by 95% (80-100%). In edentulous patients with inadequate face mask ventilation, the lower lip face mask placement with two hands markedly reduced the air leak and improved ventilation.

Vaccination with leptospiral outer membrane lipoprotein LipL32 reduces kidney invasion of Leptospira interrogans serovar canicola in hamsters.

PubMed

Humphryes, P C; Weeks, M E; AbuOun, M; Thomson, G; Núñez, A; Coldham, N G

2014-04-01

The Leptospira interrogans vaccines currently available are serovar specific and require regular booster immunizations to maintain protection of the host. In addition, a hamster challenge batch potency test is necessary to evaluate these vaccines prior to market release, requiring the use of a large number of animals, which is ethically and financially undesirable. Our previous work showed that the N terminus of the outer membrane protein LipL32 was altered in Leptospira interrogans serovar Canicola vaccines that fail the hamster challenge test, suggesting that it may be involved in the protective immune response. The aim of this study was to determine if vaccination with LipL32 protein alone could provide a protective response against challenge with L. interrogans serovar Canicola to hamsters. Recombinant LipL32, purified from an Escherichia coli expression system, was assessed for protective immunity in five groups of hamsters (n = 5) following a challenge with the virulent L. interrogans serovar Canicola strain Kito as a challenge strain. However, no significant survival against the L. interrogans serovar Canicola challenge was observed compared to that of unvaccinated negative controls. Subsequent histological analysis revealed reduced amounts of L. interrogans in the kidneys from the hamsters vaccinated with recombinant LipL32 protein prior to challenge; however, no significant survival against the L. interrogans serovar Canicola challenge was observed compared to that of unvaccinated negative controls. This finding corresponded to a noticeably reduced severity of renal lesions. This study provides evidence that LipL32 is involved in the protective response against L. interrogans serovar Canicola in hamsters and is the first reported link to LipL32-induced protection against kidney invasion.

Evaluation of truncated LipL32 expressed by Escherichia coli and Pichia pastoris for serodiagnosis of Leptospira infection in rodents.

PubMed

Shiokawa, Kanae; Gamage, Chandika D; Koizumi, Nobuo; Sakoda, Yoshihiro; Shimizu, Kenta; Tsuda, Yoshimi; Yoshimatsu, Kumiko; Arikawa, Jiro

2016-02-01

The applicability of the recombinant LipL32 for serodiagnosis of leptospiral infection in field rodents was assessed in this study. An immunodominant region of LipL32 was determined by monoclonal antibodies, and then, truncated LipL32 (tLipL32) was designed to contain the region (87-188th amino acid). The tLipL32 was compared between two recombinant expression hosts Escherichia coli and Pichia pastoris in ELISA. With field rat sera, tLipL32 expressed by P. pastoris (tLipL32p) had high antigenicity without background reactions, while tLipL32 expressed by E. coli (tLipL32e) showed high background reactions, which were reduced by pre-adsorption of sera with E. coli. To evaluate tLipL32-ELISA, field rat sera were tentatively divided into a Leptospira infection positive (12 sera) and a negative group (12 sera) based on the results from flaB gene PCR of kidney samples and WB with whole Leptospira cell. Consequently, the sensitivity of tLipL32p-ELISA for field rat sera was 83% . A similar result was obtained from tLipL32e-ELISA with adsorbed sera, (92%). However, sensitivity of tLipL32e-ELISA using sera without an adsorption treatment was 50%. Regardless of the expression host, tLipL32-ELISA had 100% specificity and sensitivity in experimentally infected laboratory rats. These results suggest that recombinant LipL32 expressed by P. pastoris is more applicable for serodiagnosis in field rats due to a lack of background reaction.

Drug targeted virtual screening and molecular dynamics of LipU protein of Mycobacterium tuberculosis and Mycobacterium leprae.

PubMed

Kaur, Gurkamaljit; Pandey, Bharati; Grover, Arbind; Garewal, Naina; Grover, Abhinav; Kaur, Jagdeep

2018-03-30

The lipolytic protein LipU was conserved in mycobacterium sp. including M. tuberculosis (MTB LipU) and M. leprae (MLP LipU). The MTB LipU was identified in extracellular fraction and was reported to be essential for the survival of mycobacterium. Therefore to address the problem of drug resistance in pathogen, LipU was selected as a drug target and the viability of finding out some FDA approved drugs as LipU inhibitors in both the cases was explored. Three-dimensional (3D) model structures of MTB LipU and MLP LipU were generated and stabilized through molecular dynamics (MD). FDA approved drugs were screened against these proteins. The result showed that the top-scoring compounds for MTB LipU were Diosmin, Acarbose and Ouabain with the Glide XP score of -12.8, -11.9 and -11.7 kcal/mol, respectively, whereas for MLP LipU protein, Digoxin (-9.2 kcal/mol), Indinavir (-8.2 kcal/mol) and Travoprost (-8.2 kcal/mol) showed highest affinity. These drugs remained bound in the active site pocket of MTB LipU and MLP LipU structure and interaction grew stronger after dynamics. RMSD, RMSF and Rg were found to be persistent throughout the simulation period. Hydrogen bonds along with large number of hydrophobic interactions stabilized the complex structures. Binding free energies obtained through Prime/MM-GBSA were found in the significant range from -63.85 kcal/mol to -34.57 kcal/mol for MTB LipU and -71.33 kcal/mol to -23.91 kcal/mol for MLP LipU. The report suggested high probability of these drugs to demolish the LipU activity and could be probable drug candidates to combat TB and leprosy disease.

Assessing Angle's malocclusion among cleft lip and/or palate patients in Jammu.

PubMed

Gupta, Akshay; Gupta, Anur; Bhardwaj, Amit; Vikram, S; Gomathi, Ajeetha; Singh, Karanprakash

2016-04-01

The study was conducted to examine the patients with abnormalities of cleft lip and/or palate and its association with different types of malocclusion. This descriptive study was done among 168 patients with abnormalities of cleft lip and/or palate. Angle's classification of malocclusion was applied for assessment of occlusion as Class I, Class II, and Class III. The types of oral clefts classification such as cleft lip unilateral and cleft lip bilateral, cleft palate (CP), unilateral cleft lip with palate (UCLP) and bilateral cleft lip with palate (BCLP) was considered. Chi-square test was applied to analyze the data at P < 0.05. The study showed different categories of clefts patients as cleft lip (81), CP (31), and both cleft lip and palate (53). The occurrence of unilateral cleft lip (44) was maximum among the sample followed by UCLP (39), and bilateral cleft lip (31). Maximum subjects with Class II (10.7%) and Class III (4.9%) malocclusion were seen with unilateral cleft lip deformities. None of the patients with UCLP had Class III malocclusion. Cleft lip was the most commonly observed deformity and high frequency of Class II and III malocclusion was evident. Therefore, patients with such abnormalities should be screened timely.

Morphology of the Nasal Apparatus in Pygmy (Kogia Breviceps) and Dwarf (K. Sima) Sperm Whales.

PubMed

Thornton, Steven W; Mclellan, William A; Rommel, Sentiel A; Dillaman, Richard M; Nowacek, Douglas P; Koopman, Heather N; Pabst, D Ann

2015-07-01

Odontocete echolocation clicks are generated by pneumatically driven phonic lips within the nasal passage, and propagated through specialized structures within the forehead. This study investigated the highly derived echolocation structures of the pygmy (Kogia breviceps) and dwarf (K. sima) sperm whales through careful dissections (N = 18 K. breviceps, 6 K. sima) and histological examinations (N = 5 K. breviceps). This study is the first to show that the entire kogiid sound production and transmission pathway is acted upon by complex facial muscles (likely derivations of the m. maxillonasolabialis). Muscles appear capable of tensing and separating the solitary pair of phonic lips, which would control echolocation click frequencies. The phonic lips are enveloped by the "vocal cap," a morphologically complex, connective tissue structure unique to kogiids. Extensive facial muscles appear to control the position of this structure and its spatial relationship to the phonic lips. The vocal cap's numerous air crypts suggest that it may reflect sounds. Muscles encircling the connective tissue case that surrounds the spermaceti organ may change its shape and/or internal pressure. These actions may influence the acoustic energy transmitted from the phonic lips, through this lipid body, to the melon. Facial and rostral muscles act upon the length of the melon, suggesting that the sound "beam" can be focused as it travels through the melon and into the environment. This study suggests that the kogiid echolocation system is highly tunable. Future acoustic studies are required to test these hypotheses and gain further insight into the kogiid echolocation system. © 2015 Wiley Periodicals, Inc.

The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

PubMed

Hermes, Fatemah A; Cronan, John E

2013-10-01

The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

Necrotizing Lip Infection Causing Septic Thrombophlebitis of the Neck: A Rare Variant of Lemierre Syndrome.

PubMed

Cuddy, Karl; Saadat, Nariman; Khatib, Baber; Patel, Ashish

2018-01-01

Lemierre syndrome is an uncommon condition in which internal jugular vein thrombosis presents after recent oropharyngeal infection. Frequently, this is accompanied by septic emboli. This report outlines a variant of this disease process, with septic thrombophlebitis of the neck associated with a necrotizing skin infection of the lower lip and chin. A 25-year-old man with lower lip and chin swelling, initially managed with intravenous antibiotics, progressed to the development of a left facial vein thrombus, septic emboli to the lungs, and a necrotizing lower lip and chin infection that was managed with debridement, thrombectomy, and prolonged hemodynamic and pulmonary support. A necrotizing skin infection with thrombus of the jugular system and septic emboli is a very rare variant of Lemierre syndrome. Early recognition of an infection with septic emboli and/or necrotizing pathobiological findings allows for prompt antibiotic and surgical therapy, minimizing the mortality of these potentially lethal infections. Copyright © 2017 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Orofacial granulomatosis affecting lip and gingiva in a 15-year-old patient: A rare case report.

PubMed

Bansal, Monika; Singh, Nootan; Patne, Shashikant; Singh, Satyendra Kumar

2015-03-01

Orofacial granulomatosis (OFG) is a rare disorder affecting the orofacial region, and clinically characterized by diffuse, nontender, soft to firm, painless swelling restricted to one or both lips and intraoral sites such as tongue, gingiva and buccal mucosa. Histologically, OFG is characterized by noncaseating granulomatous inflammation. The early diagnosis of OFG is essential for the better prognosis of the lesion. Delay in diagnosis of OFG results into formation of indurated and permanent swelling of the lip that not only compromises esthetic appearance but also causes impairment in function such as speaking and eating. Early diagnosis of OFG is challenging to the health care professionals due to clinical and histological resemblance to other chronic granulomatous disorders. Thus, dentists may act as a first person to diagnose the lesion and play an important role in the multidisciplinary treatment of granulomatous disorders. Here, we present a case of OFG affecting lips and gingiva in a 15-year-old patient without any identifiable systemic or local causes.

Detailed characterization of the LLNL imaging proton spectrometer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rasmus, A. M., E-mail: rasmus@lanl.gov, E-mail: arasmus@umich.edu; University of Michigan, Ann Arbor, Michigan 48109; Hazi, A. U.

2016-11-15

Ultra-intense short pulse lasers incident on solid targets (e.g., thin Au foils) produce well collimated, broad-spectrum proton beams. These proton beams can be used to characterize magnetic fields, electric fields, and density gradients in high energy-density systems. The LLNL-Imaging Proton Spectrometer (L-IPS) was designed and built [H. Chen et al., Rev. Sci. Instrum. 81, 10D314 (2010)] for use with such laser produced proton beams. The L-IPS has an energy range of 50 keV-40 MeV with a resolving power (E/dE) of about 275 at 1 MeV and 21 at 20 MeV, as well as a single spatial imaging axis. In ordermore » to better characterize the dispersion and imaging capability of this diagnostic, a 3D finite element analysis solver is used to calculate the magnetic field of the L-IPS. Particle trajectories are then obtained via numerical integration to determine the dispersion relation of the L-IPS in both energy and angular space.« less

Numerical Investigation of the Effect of Radial Lip Seal Geometry on Sealing Performance

NASA Astrophysics Data System (ADS)

Tok, G.; Parlar, Z.; Temiz, V.

2018-01-01

Sealing elements are often needed in industry and especially in machine design. With the change and development of machine technology from day to day, sealing elements show continuous development and change in parallel with these developments. Many factors influence the performance of the sealing elements such as shaft surface roughness, radial force, lip geometry etc. In addition, the radial lip seals must have a certain pre-load and interference in order to provide a good sealing. This also affects the friction torque. Researchers are developing new seal designs to reduce friction losses in mechanical systems. In the presented study, the effect of the lip seal geometry on sealing performance will be examined numerically. The numerical model created for this purpose will be verified with experimental data firstly. In the numerical model, shaft and seal will be modeled as hyper-elastic in 2D and 3D. NBR (Nitrile Butadiene Rubber) as seal material will be analyzed for the rotating shaft state at constant speed by applying a uniform radial force.

Cleft Lip and Palate

MedlinePlus

Cleft lip and cleft palate are birth defects that occur when a baby's lip or mouth do not form properly. They happen early during ... A baby can have a cleft lip, a cleft palate, or both. A cleft lip happens if the ...

Outcome-dependent coactivation of lip and tongue primary somatosensory representation following hypoglossal-facial transfer after peripheral facial palsy.

PubMed

Rottler, Philipp; Schroeder, Henry W S; Lotze, Martin

2014-02-01

A hypoglossal-facial transfer is a common surgical strategy for reanimating the face after persistent total hemifacial palsy. We were interested in how motor recovery is associated with cortical reorganization of lip and tongue representation in the primary sensorimotor cortex after the transfer. Therefore, we used functional magnetic resonance imaging (fMRI) in 13 patients who underwent a hypoglossal-facial transfer after unilateral peripheral facial palsy. To identify primary motor and somatosensory tongue and lip representation sites, we measured repetitive tongue and lip movements during fMRI. Electromyography (EMG) of the perioral muscles during tongue and lip movements and standardized evaluation of lip elevation served as outcome parameters. We found an association of cortical representation sites in the pre- and postcentral gyrus (decreased distance of lip and tongue representation) with symmetry of recovered lip movements (lip elevation) and coactivation of the lip during voluntary tongue movements (EMG-activity of the lip during tongue movements). Overall, our study shows that hypoglossal-facial transfer resulted in an outcome-dependent cortical reorganization with activation of the cortical tongue area for restituded movement of the lip. Copyright © 2012 Wiley Periodicals, Inc.

Cone-Beam Computed Tomography Analysis of the Nasopharyngeal Airway in Nonsyndromic Cleft Lip and Palate Subjects.

PubMed

Al-Fahdawi, Mahmood Abd; Farid, Mary Medhat; El-Fotouh, Mona Abou; El-Kassaby, Marwa Abdelwahab

2017-03-01

  To assess the nasopharyngeal airway volume, cross-sectional area, and depth in previously repaired nonsyndromic unilateral cleft lip and palate versus bilateral cleft lip and palate patients compared with noncleft controls using cone-beam computed tomography with the ultimate goal of finding whether cleft lip and palate patients are more liable to nasopharyngeal airway obstruction.   A retrospective analysis comparing bilateral cleft lip and palate, unilateral cleft lip and palate, and control subjects. Significance at P ≤ .05.   Cleft Care Center and the outpatient clinic that are both affiliated with our faculty.   Cone-beam computed tomography data were selected of 58 individuals aged 9 to 12 years: 14 with bilateral cleft lip and palate and 20 with unilateral cleft lip and palate as well as 24 age- and gender-matched noncleft controls.   Volume, depth, and cross-sectional area of nasopharyngeal airway were measured.   Patients with bilateral cleft lip and palate showed significantly larger nasopharyngeal airway volume than controls and patients with unilateral cleft lip and palate (P < .001). Patients with bilateral cleft lip and palate showed significantly larger cross-sectional area than those with unilateral cleft lip and palate (P < .001) and insignificant cross-sectional area compared with controls (P > .05). Patients with bilateral cleft lip and palate showed significantly larger depth than controls and those with unilateral cleft lip and palate (P < .001). Patients with unilateral cleft lip and palate showed insignificant nasopharyngeal airway volume, cross-sectional area, and depth compared with controls (P > .05).   Unilateral and bilateral cleft lip and palate patients did not show significantly less volume, cross-sectional area, or depth of nasopharyngeal airway than controls. From the results of this study we conclude that unilateral and bilateral cleft lip and palate patients at the studied age and stage of repaired clefts are not more prone to nasopharyngeal airway obstruction than controls.

Patient-tailored prioritization for a pediatric care decision support system through machine learning.

PubMed

Klann, Jeffrey G; Anand, Vibha; Downs, Stephen M

2013-12-01

Over 8 years, we have developed an innovative computer decision support system that improves appropriate delivery of pediatric screening and care. This system employs a guidelines evaluation engine using data from the electronic health record (EHR) and input from patients and caregivers. Because guideline recommendations typically exceed the scope of one visit, the engine uses a static prioritization scheme to select recommendations. Here we extend an earlier idea to create patient-tailored prioritization. We used Bayesian structure learning to build networks of association among previously collected data from our decision support system. Using area under the receiver-operating characteristic curve (AUC) as a measure of discriminability (a sine qua non for expected value calculations needed for prioritization), we performed a structural analysis of variables with high AUC on a test set. Our source data included 177 variables for 29 402 patients. The method produced a network model containing 78 screening questions and anticipatory guidance (107 variables total). Average AUC was 0.65, which is sufficient for prioritization depending on factors such as population prevalence. Structure analysis of seven highly predictive variables reveals both face-validity (related nodes are connected) and non-intuitive relationships. We demonstrate the ability of a Bayesian structure learning method to 'phenotype the population' seen in our primary care pediatric clinics. The resulting network can be used to produce patient-tailored posterior probabilities that can be used to prioritize content based on the patient's current circumstances. This study demonstrates the feasibility of EHR-driven population phenotyping for patient-tailored prioritization of pediatric preventive care services.

Developing a performance measurement approach to benefit/cost freight project prioritization.

DOT National Transportation Integrated Search

2014-10-01

Future reauthorizations of the federal transportation bill will require a comprehensive and quantitative analysis of the freight benefits : of proposed freight system projects. To prioritize public investments in freight systems and to insure conside...

The Determination of Nursing Manpower Requirements in Humanitarian Assistance Missions for Hospital Ships

DTIC Science & Technology

2007-06-01

cleft lips and cleft palates which resulted in lower volume and slightly higher acuity. Other cases such as orthopedics and gynecology are performed at...nutritional and metabolic diseases, and immunity disorders. The category of congenital anomalies involved surgical repairs of cleft lips and... palates , while the category for diseases of the digestive system included patients with hernias. In contrast, the category for diseases of the nervous

Deregulation of the endogenous C/EBPβ LIP isoform predisposes to tumorigenesis.

PubMed

Bégay, Valérie; Smink, Jeske J; Loddenkemper, Christoph; Zimmermann, Karin; Rudolph, Cornelia; Scheller, Marina; Steinemann, Doris; Leser, Ulf; Schlegelberger, Brigitte; Stein, Harald; Leutz, Achim

2015-01-01

Two long and one truncated isoforms (termed LAP*, LAP, and LIP, respectively) of the transcription factor CCAAT enhancer binding protein beta (C/EBPβ) are expressed from a single intronless Cebpb gene by alternative translation initiation. Isoform expression is sensitive to mammalian target of rapamycin (mTOR)-mediated activation of the translation initiation machinery and relayed through an upstream open reading frame (uORF) on the C/EBPβ mRNA. The truncated C/EBPβ LIP, initiated by high mTOR activity, has been implied in neoplasia, but it was never shown whether endogenous C/EBPβ LIP may function as an oncogene. In this study, we examined spontaneous tumor formation in C/EBPβ knockin mice that constitutively express only the C/EBPβ LIP isoform from its own locus. Our data show that deregulated C/EBPβ LIP predisposes to oncogenesis in many tissues. Gene expression profiling suggests that C/EBPβ LIP supports a pro-tumorigenic microenvironment, resistance to apoptosis, and alteration of cytokine/chemokine expression. The results imply that enhanced translation reinitiation of C/EBPβ LIP promotes tumorigenesis. Accordingly, pharmacological restriction of mTOR function might be a therapeutic option in tumorigenesis that involves enhanced expression of the truncated C/EBPβ LIP isoform. Elevated C/EBPβ LIP promotes cancer in mice. C/EBPβ LIP is upregulated in B-NHL. Deregulated C/EBPβ LIP alters apoptosis and cytokine/chemokine networks. Deregulated C/EBPβ LIP may support a pro-tumorigenic microenvironment.

Expression of LIP1 and LIP2 genes from Geotrichum species in Baker's yeast strains and their application to the bread-making process.

PubMed

Monfort, A; Blasco, A; Sanz, P; Prieto, J A

1999-02-01

Lipolytic baker's yeast strains able to produce extracellular active lipase have been constructed by transformation with plasmids containing the LIP1 and LIP2 genes from Geotrichum sp. under the control of the Saccharomyces cerevisiae actin promoter (pACT1). Lipase productivity differed between both constructs, YEpACT-LIP1-t and YEpACT-LIP2-t, being higher for the strain bearing the LIP2 gene in all culture media tested. This result appeared not to be the consequence of a defect in the transcription of the LIP1 gene as revealed by Northern blot analysis. Replacing the signal sequence of LIP1 by that of LIP2 in the YEpACT-LIP1-t plasmid enhanced significantly the secretion of lipase 1, but the levels of lipase activity were still lower than those found for the YEpACT-LIP2-t transformant. Recombinant lipase 2 protein produced by baker's yeast exhibited biochemical properties similar to those of the natural enzyme. Fermented dough prepared with YEpACT-LIP2-t-carrying cells rendered a bread with a higher loaf volume and a more uniform crumb structure than that prepared with control yeast. These effects were stronger by the addition in the bread dough formulas of a preferment enriched in recombinant lipase 2.

Species-specific differences in adaptive phenotypic plasticity in an ecologically relevant trophic trait: hypertrophic lips in Midas cichlid fishes.

PubMed

Machado-Schiaffino, Gonzalo; Henning, Frederico; Meyer, Axel

2014-07-01

The spectacular species richness of cichlids and their diversity in morphology, coloration, and behavior have made them an ideal model for the study of speciation and adaptive evolution. Hypertrophic lips evolved repeatedly and independently in African and Neotropical cichlid radiations. Cichlids with hypertrophic lips forage predominantly in rocky crevices and it has been hypothesized that mechanical stress caused by friction could result in larger lips through phenotypic plasticity. To test the influence of the environment on the size and development of lips, we conducted a series of breeding and feeding experiments on Midas cichlids. Full-sibs of Amphilophus labiatus (thick-lipped) and Amphilophus citrinellus (thin-lipped) each were split into a control group which was fed food from the water column and a treatment group whose food was fixed to substrates. We found strong evidence for phenotypic plasticity on lip area in the thick-lipped species, but not in the thin-lipped species. Intermediate phenotypic values were observed in hybrids from thick- and thin-lipped species reared under "control" conditions. Thus, both a genetic, but also a phenotypic plastic component is involved in the development of hypertrophic lips in Neotropical cichlids. Moreover, species-specific adaptive phenotypic plasticity was found, suggesting that plasticity is selected for in recent thick-lipped species. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

Evaluation and comparison of native and recombinant LipL21 protein-based ELISAs for diagnosis of bovine leptospirosis.

PubMed

Joseph, Siju; Thomas, Naicy; Thangapandian, E; Singh, Vijendra P; Verma, Rishendra; Srivastava, S K

2012-03-01

A 21-kDa leptospiral lipoprotein (LipL21) was evaluated for its diagnostic potential to detect bovine leptospirosis by ELISA. Both native LipL21 (nLipL21) and recombinant LipL21 (rLipL21) proteins were tested and compared regarding diagnostic efficiency, and no statistically significant difference was observed. The sensitivity of rLipL21 ELISA for 62 microscopic agglutination test (MAT) positive sera was 100% and the specificity with 378 MAT negative sera was 97.09%. Thus, rLipL21 protein-based ELISA could be used as an alternative to MAT for the diagnosis of bovine leptospirosis.

Flash Detection Efficiencies of Long Range Lightning Detection Networks During GRIP

NASA Technical Reports Server (NTRS)

Mach, Douglas M.; Bateman, Monte G.; Blakeslee, Richard J.

2012-01-01

We flew our Lightning Instrument Package (LIP) on the NASA Global Hawk as a part of the Genesis and Rapid Intensification Processes (GRIP) field program. The GRIP program was a NASA Earth science field experiment during the months of August and September, 2010. During the program, the LIP detected lighting from 48 of the 213 of the storms overflown by the Global Hawk. The time and location of tagged LIP flashes can be used as a "ground truth" dataset for checking the detection efficiency of the various long or extended range ground-based lightning detection systems available during the GRIP program. The systems analyzed included Vaisala Long Range (LR), Vaisala GLD360, the World Wide Lightning Location Network (WWLLN), and the Earth Networks Total Lightning Network (ENTLN). The long term goal of our research is to help understand the advantages and limitations of these systems so that we can utilize them for both proxy data applications and cross sensor validation of the GOES-R Geostationary Lightning Mapper (GLM) sensor when it is launched in the 2015 timeframe.

Cheilitis in acne vulgaris patients with no previous use of systemic retinoid products.

PubMed

Balighi, Kamran; Daneshpazhooh, Maryam; Lajevardi, Vahideh; Talebi, Shahin; Azizpour, Arghavan

2017-08-01

Isotretinoin is commonly used in the treatment of acne vulgaris. While one of the more common side-effects is cheilitis, we have observed an increased incidence of cheilitis prior to the commencement of systemic isotretinoin. The aim of this study was to assess the prevalence of cheilitis among acne vulgaris patients. A non-interventional cross-sectional study of patients with acne vulgaris. Patients with previous use of systemic retinoids were excluded. The patients were examined for signs and symptoms of cheilitis. Of a total of 400 patients, 134 (34%) had evidence of cheilitis at initial presentation. Two-thirds (63%) were female (P < 0.001). The distribution of the cheilitis was as follows; 55% on the lower lip, 30% on both lips, and 16% on the upper lip. Over a quarter (27%) of patients with cheilitis had acne excorie, compared with only 8% of patients with no signs of cheilitis. Our findings suggest that cheilitis is quite common among acne vulgaris patients even before treatment with isotretinoin. © 2016 The Australasian College of Dermatologists.

Low-intensity laser irradiation use for oral and lip precancer treatment

NASA Astrophysics Data System (ADS)

Kunin, Anatoly A.; Podolskaya, Elana E.; Stepanov, Nicolay N.; Petrov, Anatoly; Erina, Stanislava V.; Pankova, Svetlana N.

1996-09-01

Precancer and background diseases of the oral mucosa and lips, such as lichen planus, chronic ulcers and fissures, meteorological heilit, lupus erythematosus, after radiation heilit were treated by low-intensity laser irradiation. Laser therapy of the over-mentioned diseases was combined with medicinal treatment. All the patients were selected and treated in the limits of dispensary system. THe choice of diagnostic methods were made according to each concrete nosological form. A great attention was paid to the goal- directly sanitation of the oral cavity and treatment of attended internal diseases. The etiological factors were revealed and statistically analyzed. The results received during our researches demonstrated high effectiveness of laser irradiation combined with medicinal therapy in the treatment of oral mucosa and lips precancer diseases.

A study of lip prints and its reliability as a forensic tool

PubMed Central

Verma, Yogendra; Einstein, Arouquiaswamy; Gondhalekar, Rajesh; Verma, Anoop K.; George, Jiji; Chandra, Shaleen; Gupta, Shalini; Samadi, Fahad M.

2015-01-01

Introduction: Lip prints, like fingerprints, are unique to an individual and can be easily recorded. Therefore, we compared direct and indirect lip print patterns in males and females of different age groups, studied the inter- and intraobserver bias in recording the data, and observed any changes in the lip print patterns over a period of time, thereby, assessing the reliability of lip prints as a forensic tool. Materials and Methods: Fifty females and 50 males in the age group of 15 to 35 years were selected for the study. Lips with any deformity or scars were not included. Lip prints were registered by direct and indirect methods and transferred to a preformed registration sheet. Direct method of lip print registration was repeated after a six-month interval. All the recorded data were analyzed statistically. Results: The predominant patterns were vertical and branched. More females showed the branched pattern and males revealed an equal prevalence of vertical and reticular patterns. There was an interobserver agreement, which was 95%, and there was no change in the lip prints over time. Indirect registration of lip prints correlated with direct method prints. Conclusion: Lip prints can be used as a reliable forensic tool, considering the consistency of lip prints over time and the accurate correlation of indirect prints to direct prints. PMID:26668449

The effect of a voiced lip trill on estimated glottal closed quotient.

PubMed

Gaskill, Christopher S; Erickson, Molly L

2008-11-01

The use of lip trills has been advocated for both vocal habilitation and rehabilitation. A voiced lip trill requires continuous vibration of the lips while simultaneously maintaining phonation. The mechanism of any effects of a lip trill on vocal fold vibration is still unknown. While other techniques that either constrict or artificially lengthen the vocal tract have been investigated, no studies thus far have systematically examined the effect of lip trills on vocal fold vibration. Classically trained singers and vocally untrained participants produced a lip trill for approximately 1 minute, and vocal fold closed quotient (CQ) was calculated both during the lip trill and on a sustained spoken vowel before and after the trill. Data are reported for both a group design and a single-subject design. Most participants showed a tendency for a reduction in CQ during the lip trill, with a more pronounced change in the untrained participants.

Preoperative Cleft Lip Measurements and Maxillary Growth in Patients With Unilateral Cleft Lip and Palate.

PubMed

Antonarakis, Gregory S; Tompson, Bryan D; Fisher, David M

2016-11-01

Maxillary growth in patients with cleft lip and palate is highly variable. The authors' aim was to investigate associations between preoperative cleft lip measurements and maxillary growth determined cephalometrically in patients with complete unilateral cleft lip and palate (cUCLP). Retrospective cross-sectional study. Children with cUCLP. Preoperative cleft lip measurements were made at the time of primary cheiloplasty and available for each patient. Maxillary growth was evaluated on lateral cephalometric radiographs taken prior to any orthodontic treatment and alveolar bone grafting (8.5 ± 0.7 years). The presence of associations between preoperative cleft lip measurements and cephalometric measures of maxillary growth was determined using regression analyses. In the 58 patients included in the study, the cleft lateral lip element was deficient in height in 90% and in transverse width in 81% of patients. There was an inverse correlation between cleft lateral lip height and transverse width with a β coefficient of -0.382 (P = .003). Patients with a more deficient cleft lateral lip height displayed a shorter maxillary length (β coefficient = 0.336; P = .010), a less protruded maxilla (β coefficient = .334; P = .008), and a shorter anterior maxillary height (β coefficient = 0.306; P = .020) than those with a less deficient cleft lateral lip height. Patients with cUCLP present with varying degrees of lateral lip hypoplasia. Preoperative measures of lateral lip deficiency are related to later observed deficiencies of maxillary length, protrusion, and height.

LipC (Rv0220) Is an Immunogenic Cell Surface Esterase of Mycobacterium tuberculosis

PubMed Central

Shen, Guomiao; Singh, Krishna; Chandra, Dinesh; Serveau-Avesque, Carole; Maurin, Damien; Canaan, Stéphane; Singla, Rupak; Behera, Digambar

2012-01-01

We have reported previously the identification of novel proteins of Mycobacterium tuberculosis by the immunoscreening of an expression library of M. tuberculosis genomic DNA with sera obtained from M. tuberculosis-infected rabbits at 5 weeks postinfection. In this study, we report the further characterization of one of these antigens, LipC (Rv0220). LipC is annotated as a member of the Lip family based on the presence of the consensus motif “GXSXG” characteristic of esterases. Although predicted to be a cytoplasmic enzyme, we provide evidence that LipC is a cell surface protein that is present in both the cell wall and the capsule of M. tuberculosis. Consistent with this localization, LipC elicits strong humoral immune responses in both HIV-negative (HIV−) and HIV-positive (HIV+) tuberculosis (TB) patients. The absence of anti-LipC antibodies in sera from purified protein derivative-positive (PPD+) healthy subjects confirms its expression only during active M. tuberculosis infection. Epitope mapping of LipC identified 6 immunodominant epitopes, 5 of which map to the exposed surface of the modeled LipC protein. The recombinant LipC (rLipC) protein also elicits proinflammatory cytokine and chemokine responses from macrophages and pulmonary epithelial cells. rLipC can hydrolyze short-chain esters with the carbon chain containing 2 to 10 carbon atoms. Together, these studies demonstrate that LipC is a novel cell surface-associated esterase of M. tuberculosis that is highly immunogenic and elicits both antibodies and cytokines/chemokines. PMID:22038913

Molecular identification of lipase LipA from Pseudomonas protegens Pf-5 and characterization of two whole-cell biocatalysts Pf-5 and Top10lipA.

PubMed

Zha, Daiming; Xu, Li; Zhang, Houjin; Yan, Yunjun

2014-05-01

To identify lipase LipA (PFL_0617) from Pseudomonas protegens Pf-5, a lipA deletion mutant (Pf0617) and a complementary strain (Pf0617lipA) were constructed, and their effects on the lipase production were examined. Pf0617 remarkably decreased its whole-cell lipase activity, whereas Pf0617lipA made its whole-cell lipase activity not only restore to wild-type level but also get a further increment. However, the deletion and overexpression of lipA did not affect the extracellular lipase activity. In addition, the unbroken whole cells of these strains were able to catalyze the hydrolysis of membrane-permeable p-nitrophenyl esters, but could not hydrolyze the membrane-impermeable olive oil. These results confirmed that LipA was an intracellular lipase and Pf-5 could also be used as a natural whole-cell biocatalyst. To evaluate the potential of Pf-5 as a whole-cell biocatalyst and separately characterize the whole-cell LipA, the properties of the whole-cell lipases from Pf-5 and Top10lipA were characterized. The results demonstrated that both Pf-5 and Top10lipA exhibited high tolerance to alkaline condition, high temperature, heavy metal ions, surfactants, and organic solvents. Taken together, lipA can realize functional expression in E. coli Top10, and Pf-5 and Top10lipA as whole-cell biocatalysts may have enormous potential in applications.

Department of Defense Birth and Infant Health Registry: Birth Defects Among Infants Born to US Military Families: 2001 Annual Report

DTIC Science & Technology

2008-05-30

741.0, 741.9 w/o 740.0-740.10 Cleft palate 749.0 Encephalocele 742.0 Cleft lip with, w/o cleft palate 749.1, 749.2 Microcephalus 742.1...Estimated Rate per 1,000 Live Births Central nervous system 4.37 Eye 0.77 Ear 0.28 Heart* 12.69 Respiratory 0.35 Cleft lip / palate 1.84 Upper

Correlations of frontal lip-line canting with craniofacial morphology and muscular activity.

PubMed

Cho, Jin-Hyoung; Kim, Eun-Jung; Kim, Byeong-Chae; Cho, Ki-Hyun; Lee, Ki-Heon; Hwang, Hyeon-Shik

2007-09-01

The purpose of this study was to investigate factors affecting lip-line canting by using musculoskeletal analyses. Fifty-six adults with lip-line canting were selected as subjects. They were divided into 3 groups according to the changes of lip line during smiling: increasing (group I), decreasing (group D), and minimal (group M). Lip-line canting at rest was correlated to craniofacial morphology and muscular activity: Regarding craniofacial morphology, various craniofacial measurements in lateral and frontal cephalograms were used, including inclination of the tongue blade placed across both first molars. The zygomaticus major was the focus of the measurement of muscular activity affecting lip-line canting, and its activity during smiling was evaluated by using a needle electrode. In group I, lip-line canting at rest showed a significant correlation with the right-left (R/L) difference of muscular activity, but no significant correlation with the measurements of craniofacial morphology. In group D, lip-line canting showed a positive correlation with the measurements of craniofacial morphology, such as the inclination of the tongue blade, and a negative correlation with the R/L difference of muscular activity. In group M, lip-line canting showed no significant correlation with the R/L difference of muscular activity, but a significant correlation with inclination of the tongue blade. The results indicate that lip-line canting is caused by craniofacial morphology when the change of lip-line canting during smiling is minimal, whereas lip-line canting is affected by the R/L difference of muscular activity in addition to craniofacial morphology when the cant of lip line markedly changes during smiling. The findings suggest that the cause of lip-line canting can be identified easily by the change of canting during smiling, without complicated musculoskeletal analyses.

Infantile Hemangiomas of the Lip: Patterns, Outcomes, and Implications.

PubMed

Yanes, Daniel A; Pearson, Gregory D; Witman, Patricia M

2016-09-01

Infantile hemangiomas of the lip are potentially problematic because of high visibility and risk of disfigurement and ulceration. This study examined sizes, patterns, and locations of lip hemangiomas, their prognostic value, and their implications in hemangioma pathogenesis. Records of 106 patients seen for lip hemangiomas from 2006 to 2013 at Nationwide Children's Hospital were reviewed. Localized hemangiomas were mapped to a location on the lip based on their focus. Size, location, and morphology were assessed with regard to outcome. Poor outcomes were considered to be marked anatomic deformity, scarring, functional complications, and ulceration. Of 72 untreated hemangiomas with discernible outcomes, 92% of segmental lip hemangiomas were associated with poor outcomes, as opposed to 32% of localized hemangiomas (p < 0.001). Localized lip hemangiomas originated from six distinct locations. Localized untreated hemangiomas with poor outcomes were, on average, approximately 2.36 cm(2) larger (95% confidence interval 1.47, 3.25) than those that resolved favorably (p < 0.001); 52% of upper lip untreated hemangiomas and 6% of lower lip hemangiomas had poor outcomes (p = 0.001), and 61% of untreated localized hemangiomas involving the vermilion border and 25% of those that did not had poor outcomes (p = 0.01). Hemangiomas that received early medical or surgical intervention were less likely to have poor outcomes than untreated hemangiomas (p = 0.03). Localized lip hemangiomas occur in distinct locations on the lip that are not random and appear to reflect known models of facial development. Segmental morphology is associated with poor outcomes. In localized hemangiomas, the upper lip is associated with more problematic outcomes than the lower lip. Large size and involvement of the vermilion border are also valuable prognostic indicators associated with poor outcomes. Early intervention in lip hemangiomas is associated with better outcomes. © 2016 Wiley Periodicals, Inc.

The connecting link! Lip prints and fingerprints.

PubMed

Negi, Amita; Negi, Anurag

2016-01-01

Lip prints and fingerprints are considered to be unique to each individual. The study of fingerprints and lip prints is very popular in personal identification of the deceased and in criminal investigations. This study was done to find the predominant lip and fingerprint patterns in males and females in the North Indian population and also to find any correlation between lip print and fingerprint patterns within a gender. Two hundred students (100 males, 100 females) were included in the study. Lip prints were recorded for each individual using a dark-colored lipstick and the right thumb impression was recorded using an ink pad. The lip prints and fingerprints were analyzed using a magnifying glass. The Chi-square test was used for statistical analysis. The branched pattern in males and the vertical pattern in females were the predominant lip print patterns. The predominant fingerprint pattern in both males and females was found to be the loop pattern, followed by the whorl pattern and then the arch pattern. No statistically significant correlation was found between lip prints and fingeprints. However, the arch type of fingerprint was found to be associated with different lip print patterns in males and females. Lip prints and fingerprints can be used for personal identification in a forensic scenario. Further correlative studies between lip prints and fingerprints could be useful in forensic science for gender identification.

Comparative analysis of lip with thumbprints: An identification tool in personal authentication.

PubMed

Naik, Rashmi; Ahmed Mujib, B R; Telagi, Neethu; Hallur, Jaydeva

2017-01-01

Identification of person living or dead using diverse characteristics is the basis in forensic science. The uniqueness of lip and fingerprints and further, association between them can be useful in establishing facts in legal issues. The present study was carried out to determine the distribution of different lip print patterns among subjects having different thumbprint patterns and to determine the correlation between lip print patterns and thumbprint patterns. The study sample comprised 100 students randomly selected from Bapuji Dental College Hospital, Davangere, Karnataka, 50 males and 50 females aged between 18 and 20 years. Red colored lipstick was applied on the lips by a lipstick applicator brush. Lip and thumb impressions were made on No. 1 Whatman filter paper and visualized using magnifying lens. Three main types of fingerprints (loop, whorl and arch) were identified; Tsuchihashi Y classification of lip print patterns was followed in the study. Chi-square test was used to see the association between lip and thumbprints. The correlation between lip and left thumb print patterns for gender identification was statistically significant. In both males and females, Type II lip pattern associated with loop finger pattern were most significant and in males, Type III lip pattern with whorl type of finger pattern showed statistical significance. We conclude that the correlation found between lip print and thumbprint can be utilized in the field of forensic science for gender identification.

PHIRST Trial - pharmacist consults: prioritization of HIV-patients with a referral screening tool.

PubMed

Awad, Catherine; Canneva, Arnaud; Chiasson, Charles-Olivier; Galarneau, Annie; Schnitzer, Mireille E; Sheehan, Nancy L; Wong, Alison Yj

2017-11-01

The role of pharmacists in HIV outpatient clinics has greatly increased in the past decades. Given the limited resources of the health system, the prioritization of pharmacist consults is now a main concern. This study aimed to create a scoring system allowing for standardized prioritization of pharmacist consults for patients living with HIV. Data was retrospectively collected from 200 HIV patients attending the Chronic Viral Illness Service at the McGill University Health Center. An expert panel consisting of four pharmacists working in the field of HIV prioritized each patient individually, after which a consensus was established and was considered as the gold standard. In order to create a scoring system, two different methods (Delphi, statistical) were used to assign a weight to each characteristic considered to be important in patient prioritization. A third method (equal weight to each characteristic) was also evaluated. The total score per patient for each method was then compared to the expert consensus in order to establish the score cut-offs to indicate the appropriate categories of delay in which to see the patient. All three systems failed to accurately prioritize patients into urgency categories ("less than 48 h", "less than 1 month", "less than 3 months", "no consult required") according to expert pharmacist consensus. The presence of high level interactions between patient characteristics, the limited number of patients and the low prevalence of some characteristics were hypothesized as the main causes for the results. Creating a prioritization tool for pharmacy consults in HIV outpatient clinics is a complex task and developing a decision tree algorithm may be a more appropriate approach in the future to take into account the importance of combinations of patient characteristic.

Midfacial Changes Through Anterior Maxillary Distraction Osteogenesis in Patients With Cleft Lip and Palate.

PubMed

Kanzaki, Hiroyuki; Imai, Yoshimichi; Nakajo, Tetsu; Daimaruya, Takayoshi; Sato, Akimitsu; Tachi, Masahiro; Nunomura, Youhei; Itagaki, Yusuke; Nishimura, Kazuaki; Kochi, Shoko; Igarashi, Kaoru

2017-06-01

Maxillary hypoplasia is a major issue in cleft lip and palate patients, and predictable surgical maxillary advancement is required. In the present study, the changes and stability of the maxilla and soft tissue profile achieved after the application of anterior maxillary distraction osteogenesis (AMDO) using intraoral expander in unilateral cleft lip and palate and isolated cleft palate patients were investigated by comparing to the Le Fort I osteotomy (LFI) and maxillary distraction osteogenesis (DO) with rigid external distraction (RED) system.Ten patients who underwent orthognathic treatment with AMDO were examined (AMDO group). Changes in the positions of soft and hard tissue landmarks were calculated from the lateral cephalograms taken before the distraction, at the end of the distraction, and 1 year after the surgery. They were compared with the changes in 7 other unilateral cleft lip and palate patients who underwent LFI (LFI group) and 6 others who underwent DO with RED (RED group).The mean maxillary advancement of the AMDO group was similar to that of the RED group, judged by the change of point A. During DO, the AMDO group showed less clockwise rotation of mandible compared to the RED group. The soft tissue advancement of the upper lip and nose in the AMDO group was similar to that in the RED group, which was significantly larger than that in the LFI group.Our results indicate that AMDO can be surgical option to cleft lip and palate patients with less invasive but excellent improvement in both midfacial skeletal and soft tissue similar to DO-RED.

The effects of lipiodol and cyclosporin A on the hepatobiliary disposition of doxorubicin in pigs.

PubMed

Dubbelboer, Ilse R; Lilienberg, Elsa; Hedeland, Mikael; Bondesson, Ulf; Piquette-Miller, Micheline; Sjögren, Erik; Lennernäs, Hans

2014-04-07

Doxorubicin (DOX) emulsified in Lipiodol (LIP) is used as local palliative treatment for unresectable intermediate stage hepatocellular carcinoma. The objective of this study was to examine the poorly understood effects of the main excipient in the drug delivery system, LIP, alone or together with cyclosporin A (CsA), on the in vivo liver disposition of DOX and its active metabolite doxorubicinol (DOXol). The advanced, multi-sampling-site, acute pig model was used; samples were collected from three blood vessels (v. portae, v. hepatica and v. femoralis), bile and urine. The four treatment groups (TI-TIV) all received two intravenous 5 min infusions of DOX into an ear vein: at 0 and 200 min. Before the second dose, the pigs received a portal vein infusion of saline (TI), LIP (TII), CsA (TIII) or LIP and CsA (TIV). Concentrations of DOX and DOXol were analyzed using UPLC-MS/MS. The developed multicompartment model described the distribution of DOX and DOXol in plasma, bile and urine. LIP did not affect the pharmacokinetics of DOX or DOXol. CsA (TIII and TIV) had no effect on the plasma pharmacokinetics of DOX, but a 2-fold increase in exposure to DOXol and a significant decrease in hepatobiliary clearance of DOX and DOXol were observed. Model simulations supported that CsA inhibits 99% of canalicular biliary secretion of both DOX and DOXol, but does not affect the metabolism of DOX to DOXol. In conclusion, LIP did not directly interact with transporters, enzymes and/or biological membranes important for the hepatobiliary disposition of DOX.

Procedures for prioritizing road improvements under the statewide highway plan : final report.

DOT National Transportation Integrated Search

1990-01-01

The road improvement prioritizing system currently utilized by the Virginia Department of Transportation is similar to the method utilized by many states: it is a sufficiency rating system that evaluates proposed projects on the basis of points assig...

Prevalence of Dental Anomalies in Patients With Nonsyndromic Cleft Lip and/or Palate in a Brazilian Population.

PubMed

Paranaiba, Lívia Máris Ribeiro; Coletta, Ricardo D; Swerts, Mário Sérgio Oliveira; Quintino, Rafaela Pacífico; de Barros, Letízia Monteiro; Martelli-Júnior, Hercílio

2013-07-01

Objective : Many studies have demonstrated a high frequency of dental anomalies in patients with cleft lip and/or palate. Because dental anomalies may complicate dental treatment, we investigated the prevalence of dental anomalies in a group of Brazilian patients with nonsyndromic cleft lip and/or palate. Design, Participants, Setting : Retrospective analysis was performed using clinical records of 296 patients aged between 12 and 30 years with repaired nonsyndromic cleft lip and/or palate without history of tooth extraction and orthodontic treatment. Associations between oral clefts and presence of dental anomalies outside the cleft area were investigated. Results : Dental anomalies were identified in 39.9% of the nonsyndromic cleft lip and/or palate patients, and tooth agenesis (47.5%), impacted tooth (13.1%), and microdontia (12.7%) were the most common anomalies. Cleft lip patients were less affected by dental anomalies compared with cleft palate or cleft lip and palate patients (p  =  .057). Specifically, patients with unilateral cleft lip and palate were significantly more affected by dental anomalies than those with bilateral cleft lip and palate (p  =  .00002), and individuals with unilateral complete cleft lip and palate (p  =  .002) and complete cleft palate (p  =  .01) were significantly more affected by tooth agenesis than other cleft types. Agenesis of the premolars (p  =  .043) and maxillary lateral incisors (p  =  .03) were significantly more frequent in patients with unilateral complete cleft lip and palate. Conclusions : The present study revealed a high frequency of dental anomalies in nonsyndromic cleft lip and/or palate patients and further demonstrated that patients with unilateral cleft lip and palate were frequently more affected by dental anomalies than those with bilateral cleft lip and palate. Moreover, our results demonstrate that dental anomalies should be considered during dental treatment planning for individuals affected by nonsyndromic cleft lip and/or palate.

Morphological patterns of lip prints in Mangaloreans based on Suzuki and Tsuchihashi classification

PubMed Central

Jeergal, Prabhakar A; Pandit, Siddharth; Desai, Dinkar; Surekha, R; Jeergal, Vasanti A

2016-01-01

Introduction: Cheiloscopy is the study of the furrows or grooves present on the red part or vermilion border of the human lips. The present study aims to classify the characteristics of lip prints and to know the most common morphological pattern specific to Mangalorean people of Southern India. For the first time, this study also assesses the association between gender and different lip segments within a population. Materials and Methods: A total of 200 residents of Mangalore (100 males and 100 females) were included of age ranging from 18 years to 60 years. Materials used to take the impression of lips included red lipstick, A4 size white bond paper and cellophane tape. The prints obtained were scanned using a Canon Image Scanner and stored in a folder on a personal computer. The images were cropped and inverted in gray scale using Adobe Photoshop software. Each lip print was divided into eight segments and was examined. Suzuki and Tsuchihashi's classification (1970) was used to classify the types of grooves, and the results were statistically analyzed. Six types of grooves were recorded in the Mangalorean's lips. Statistical Analysis: Association between gender and different lip segments was tested using Chi-square analysis in the given population. Results: In males, the groove Type I' was the highest recorded followed by Type III, Type II, Type I, Type IV and Type V in descending order. In females, Type I' was the highest recorded followed by Type II, Type III, Type IV, Type I and Type V in descending order. Conclusion: Males and females displayed statistically significant differences in lip print patterns for different lip sites: lower medial lip, as well as upper and lower lateral segments. Only the upper medial lip segment displayed no statistically significant difference in lip print pattern between males and females. This shows that the distribution of lip prints is generally dissimilar for males and females, with varying predominance according to lip segment. PMID:27601831

Increased virulence of Mycobacterium tuberculosis H37Rv overexpressing LipY in a murine model.

PubMed

Singh, Vipul K; Srivastava, Mrigank; Dasgupta, Arunava; Singh, Mohan P; Srivastava, Ranjana; Srivastava, Brahm S

2014-05-01

We have investigated the role of Rv3097c-encoded lipase (LipY) on the virulence of Mycobacterium tuberculosis. It has been shown that the overexpression of LipY in strain H37Rv induced increase in virulence of recombinant H37Rv::LipY strain. Compared to H37Rv, infection with H37Rv::LipY caused enhanced mortality, weight loss, bacterial load in lungs, splenomegaly, worsening lung morphology and pathology. Mice immunized with recombinant LipY antigen were protected against challenge with H37Rv::LipY, which correlated with enhanced survival of challenged mice and striking decrease in pathological features observed in unimmunized mice. To probe the cause of increase in virulence of H37Rv::LipY, the immune status of the host infected with H37Rv and H37Rv::LipY was compared. It was found that overexpression of LipY compromised immune responses resulting in attenuation of Th1 and Th17 responses, significant increase in IL-10, decrease in number of macrophages and T cells, and increase in numbers of Treg, and DCs in the lungs whereas in mice immunized with LipY an increased pool of T cells and DCs was observed. This led us to conclude that the increase in the virulence of H37Rv::LipY was due to downregulation of the host's protective immunity and the Rv3097c encoded LipY lipase is a virulence factor of M. tuberculosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Attitudes of Germans towards distributive issues in the German health system.

PubMed

Ahlert, Marlies; Pfarr, Christian

2016-05-01

Social health care systems are inevitably confronted with the scarcity of resources and the resulting distributional challenges. Since prioritization implies distributional effects, decisions regarding respective rules should take citizens' preferences into account. In this study we concentrate on two distributive issues in the German health system: firstly, we analyze the acceptance of prioritizing decisions concerning the treatment of certain patient groups, in this case patients who all need a heart operation. We focus on the patient criteria smoking behavior, age and whether the patient has or does not have young children. Secondly, we investigate Germans' opinions towards income-dependent health services. The results reveal the strong effects of individuals' attitudes regarding general aspects of the health system on priorities, e.g. that individuals with an unhealthy lifestyle should not be prioritized. In addition, experience of limited access to health services is found to have a strong influence on citizens' attitudes, too. Finally, decisions on different prioritization criteria are found to be not independent.

The use of SymNose for quantitative assessment of lip symmetry following repair of complete bilateral cleft lip and palate.

PubMed

Russell, James H B; Kiddy, Harriet C; Mercer, Nigel S

2014-07-01

The SymNose computer program has been proposed as an objective method for the quantitative assessment of lip symmetry following unilateral cleft lip repair. This study aims to demonstrate the use of SymNose in patients with complete bilateral cleft lip and palate (BCLP), a group previously excluded from computer-based analysis. A retrospective cohort study compared several parameters of lip symmetry between BCLP cases and non-cleft controls. 15 BCLP cases aged 10 (±1 year) who had undergone primary repair were recruited from the patient database at the South West Cleft Unit, Frenchay Hospital. Frontal facial photographs were selected for measurement. 15 age-matched controls were recruited from a local school. Lip symmetry was expressed as: percentage mismatch of left vermillion border and upper lip area over the right, horizontal lip tilt and lateral deviation of the lip. A significant increase in lip asymmetry was found in the BCLP group expressed as upper vermillion border mismatch across computer-defined and user-defined midlines (mean difference was 16.4% (p < 0.01) and 17.5% (p < 0.01) respectively). The results suggest that a significant degree of lip asymmetry remains in BCLP patients even after primary repair. This challenges previous assumptions that those with bilateral defects would be relatively symmetrical. Copyright © 2013 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Co-expression, purification and characterization of the lipase and foldase of Burkholderia contaminans LTEB11.

PubMed

Alnoch, Robson Carlos; Stefanello, Adriano Alves; Paula Martini, Viviane; Richter, Jeferson Luiz; Mateo, Cesar; Souza, Emanuel Maltempi de; Mitchell, David Alexander; Muller-Santos, Marcelo; Krieger, Nadia

2018-05-30

Genes encoding lipase LipBC (lipA) and foldase LifBC (lipB) were identified in the genome of Burkholderia contaminans LTEB11. Analysis of the predicted amino acid sequence of lipA showed its high identity with lipases from Pseudomonas luteola (91%), Burkholderia cepacia (96%) and Burkholderia lata (97%), and classified LipBC lipase in the lipase subfamily I.2. The genes lipA and lipB were amplified and cloned into expression vectors pET28a(+) and pT7-7, respectively. His-tagged LipBC and native LifBC were co-expressed in Escherichia coli and purified. LipBC and LifBC have molecular weights of 35.9 kDa and 37 kDa, respectively, and remain complexed after purification. The Lip-LifBC complex was active and stable over a wide range of pH values (6.5-10) and temperatures (25-45 °C), with the highest specific activity (1426 U mg -1 ) being against tributyrin. The Lip-LifBC complex immobilized on Sepabeads was able to catalyze the synthesis of ethyl-oleate in n‑hexane with an activity of 4 U g -1 , maintaining high conversion (>80%) over 5 reaction cycles of 6 h at 45 °C. The results obtained in this work provide a basis for the development of applications of recombinant LipBC in biocatalysis. Copyright © 2018 Elsevier B.V. All rights reserved.

Modification of Perioral Stiffness in Patients With Repaired Cleft Lip and Palate

PubMed Central

Barlow, Steven M.; Trotman, Carroll-Ann; Chu, Shin-Ying; Lee, Jaehoon

2013-01-01

Objective To measure and compare the perioral stiffness among three groups of pediatric subjects: a group of patients with a repaired cleft lip (and palate) who had a secondary lip revision surgery (revision), another group of patients with repaired cleft lip (and palate) who did not have secondary surgery (nonrevision), and a group of noncleft “normal” patients (noncleft). Design A parallel, three-group, nonrandomized clinical trial. Participants A total of 16 patients with repaired cleft lip/palate who did not have lip revision, 13 patients with repaired cleft lip/palate who had lip revision surgery and were tested at 18 to 24 months postsurgery, and 27 noncleft patients. Analysis Nonparticipatory perioral stiffness was sampled using a recently developed face-referenced measurement technology known as OroSTIFF. Perioral stiffness, derived as a quotient from resultant force and interangle lip span, was modeled with multilevel regression techniques. Real-time calculation of the perioral stiffness function demonstrated a significant quadratic relation between imposed interangle stretch and resultant force for each of the three groups. Results This nonlinear stiffness growth function was significantly elevated in the nonrevision patients compared with the noncleft controls and is likely due to the presence of scar tissue in the upper lip; it was significantly lower among patients with cleft lip/palate who completed lip revision surgery. Conclusion This study demonstrates the efficacy of applying an objective measurement to map differences in perioral tissue biomechanics among patients born with orofacial clefts. PMID:21247345

Lower lip deformity in patients with cleft and non-cleft Class III malocclusion before and after orthognathic surgery.

PubMed

Park, Joo Seok; Koh, Kyung S; Choi, Jong Woo

2015-10-01

Orthognathic surgery does not yield the same cosmetic benefits in patients with Class III jaw deformities associated with clefts as for patients without clefts. Preoperative upper lip tightness caused by cleft lip repair may not fully explain this difference, suggesting that a lower lip deformity is present. The study compared the outcomes of orthognathic surgery in patients with cleft and non-cleft Class III malocclusion, focusing on lip relationship. The surgical records of 50 patients with Class III malocclusion, including 25 with and 25 without clefts, who had undergone orthognathic surgery, were retrospectively analyzed. Lateral cephalometric tracings, preoperatively and at 6 months postoperatively, were superimposed to analyze the soft tissue changes at seven reference points. At 6 months after surgery, there were no significant differences in skeletal location, whereas the soft tissues of the lower lip differed significantly between patients with and without cleft (p=0.002), indicating the persistence of a lower lip deformity in cleft patients. Moreover, the soft tissues of the lower lip receded in non-cleft patients and protruded in cleft patients after orthognathic surgery. Lower lip deformity and upper lip tightness may result in an unsatisfactory relationship between the upper and lower lips of patients with cleft-related jaw deformity after orthognathic surgery. Other factors were less important than the pathology of the lower lip. Copyright © 2015 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Cleft lip and palate: an adverse pregnancy outcome due to undiagnosed maternal and paternal coeliac disease.

PubMed

Arakeri, Gururaj; Arali, Veena; Brennan, Peter A

2010-07-01

Development of orofacial component involves a complex series of events. Any insult to this significant event can lead to various orofacial cleft defects. The main categories among orofacial clefts are isolated cleft palate and cleft lip with or without cleft palate. There have been many factors implicated in the development of the anomaly. The environmental factors which contribute and the genes which predispose to the condition remain obscure despite decades of research. Though it is generally agreed that folic acid deficiency is a contributory factor for non-syndromic cleft lip and palate, fewer concerns are directed towards the role for maternal/paternal nutrition in orofacial cleft origin. However, previously undescribed, here we consider the potential influence of maternal and paternal coeliac disease on the etiology of non-syndromic cleft lip and palate as an unfavorable pregnancy outcome. We postulated this relationship based on our observation, study and an empirical survey, and could be due either to (I) folic acid mal absorption (II) a genetically mediated genomic imprinting system. Copyright 2010 Elsevier Ltd. All rights reserved.

Long-term stability of intra-oral maxillary distraction in unilateral cleft lip and palate: a case report.

PubMed

Nevzatoğlu, Sirin; Küçükkeleş, Nazan; Güzel, Zeki

2013-11-01

This case report presents short and long-term treatment results of a unilateral cleft lip and palate patient treated with a modified intra-oral tooth-bone borne distraction appliance. The chief complaints of a 16 year-old, unilateral cleft lip and palate patient were poor facial aesthetics, crowding and a fistula. Severe maxillary retrognathism was treated via distraction osteogenesis of the maxilla and performed using an intra-oral tooth-bone borne appliance. Treatment continued to completion with a multibracket system. At an eight-year review following the distraction procedure, the short and long-term results were determined cephalometrically. Following the distraction, A-point advanced 7 mm, 2 mm of which relapsed during fixed appliance treatment. At the end of the active treatment, the patient's skeletal and dental Class III relationship improved to Class I, which was preserved at the long-term review. The profile was markedly improved by the distraction osteogenesis. In cases of severe maxillary retrognathism as a result of a cleft lip and palate, maxillary distraction osteogenesis provides a viable alternative to orthognathic surgery.

Developmental change in variability of lip muscle activity during speech.

PubMed

Wohlert, Amy B; Smith, Anne

2002-12-01

Compared to adults, children's speech production measures sometimes show higher trial-to-trial variability in both kinematic and acoustic analyses. A reasonable hypothesis is that this variability reflects variations in neural drive to muscles as the developing system explores different solutions to achieving vocal tract goals. We investigated that hypothesis in the present study by analyzing EMG waveforms produced across repetitions of a phrase spoken by 7-year-olds, 12-year-olds, and young adults. The EMG waveforms recorded via surface electrodes at upper lip sites were clearly modulated in a consistent manner corresponding to lip closure for the bilabial consonants in the utterance. Thus we were able to analyze the amplitude envelope of the rectified EMG with a phrase-level variability index previously used with kinematic data. Both the 7- and 12-year-old children were significantly more variable on repeated productions than the young adults. These results support the idea that children are using varying combinations of muscle activity to achieve phonetic goals. Even at age 12 years, these children were not adult-like in their performance. These and earlier kinematic studies of the oral motor system suggest that children retain their flexibility, employing more degrees of freedom than adults, to dynamically control lip aperture during speech. This strategy is adaptive given the many neurophysiological and biomechanical changes that occur during the transition from adolescence to adulthood.

Two redundant octanoyltransferases and one obligatory lipoyl synthase provide protein-lipoylation autonomy to plastids of Arabidopsis.

PubMed

Ewald, R; Hoffmann, C; Neuhaus, E; Bauwe, H

2014-01-01

Octanoyltransferases (LIP2) are important for the lipoylation of several α-ketoacid decarboxylases and glycine decarboxylase, all of which are essential multienzyme complexes of central metabolism, by attaching de novo-synthesised octanoyl moieties to the respective target subunits. Lipoyl synthase (LIP1) then inserts two sulphur atoms each into the protein-bound octanoyl chains to generate the functional lipoamide arms. In plants, most of the above multienzyme complexes occur only in mitochondria. Pyruvate dehydrogenase is an exception, since it also occurs in plastids. Plastidial LIP1 and LIP2 are known, but it is not clear how essential these enzymes are. Here, we report that not just one but two redundant LIP2 isoforms, LIP2p and LIP2p2, operate in plastids of Arabidopsis. The combined deletion of the two isoenzymes is embryo-lethal. Deletion of the plastidial lipoyl synthase LIP1p is also embryo-lethal, indicating that all plastidial LIP1 activity is due to LIP1p. These features suggest that protein lipoylation is based on an autonomous and partially redundant de novo lipoylation pathway in plastids. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

Comparison of Lip Print Patterns in Two Indian Subpopulations and Its Correlation in ABO Blood Groups.

PubMed

Sr, Ashwinirani; Suragimath, Girish; Sande, Abhijeet R; Kulkarni, Prasad; Nimbal, Anand; Shankar, T; Gowd, T Snigdha; Shetty, Prajwal K

2014-10-01

The study of lip-print pattern (cheiloscopy) is a scientific method for personal identification and plays a major role in forensic and criminal investigations. To compare the lip print patterns in Kerala and Maharashtra population and correlate between ABO blood groups. Two hundred subjects, 100 from Maharashtra and 100 from Kerala were considered for the study. Lip prints were recorded, analyzed according to Tsuchihashi classification. The lip print patterns were compared in the two populations, correlated in ABO blood groups. The data obtained was statistically analyzed with SPSS software using chi-square test. In our study, predominant lip print pattern observed in Kerala population was type IV (53%) and Maharashtra population was type II (42%). The difference between the two population was statistically significant (p<0.001). Subjects with A+ and O- blood groups had type II lip print predominance. Subjects with B+, AB+ and O+ blood groups had type IV predominance. The lip print patterns do not show any correlation in ABO blood groups. Lip prints are unique to each individual and are different even in two persons. Lip print patterns were different in the two sub populations studied, and they showed no correlation in ABO blood groups.

IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

PubMed

Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

2017-06-26

Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

Frequency and correlation of lip prints, fingerprints and ABO blood groups in population of Sriganganagar District, Rajasthan.

PubMed

Sandhu, Harpreet; Verma, Pradhuman; Padda, Sarfaraz; Raj, Seetharamaiha Sunder

2017-11-01

To investigate the frequency and uniqueness of different lip print patterns, fingerprint patterns in relation to gender and ABO Rh blood groups among a semi-urban population of Sriganganagar, Rajasthan. The study was conducted on 1200 healthy volunteers aged 18-30 years. The cheiloscopic and dermatographic data of each subject were obtained and were analysed according to the Suzuki and Tsuchihashi and Henry systems of classification, respectively. Two forensic experts analyzed the patterns independently. The ABO Rh blood group was also recorded for each subject. The Chi square statistical analysis was done and tests were considered significant when p value <0.001 and Cohen kappa test was applied to analyze inter-observer reliability. The B+ blood group was noted as most common in both genders while least common were A- among males and AB- in females. Type II lip pattern was most predominant while the least common was Type I' in males and Type I' and Type V in females. The UL fingerprint pattern was the most common, while RL was least noted in both genders. All the fingerprint patterns showed correlation with different lip print patterns. A correlation was found between different blood groups and lip print patterns except Type I (vertical) lip pattern. A positive correlation was observed between all the blood groups and fingerprint patterns, except for RL pattern. There is an association between lip print patterns, fingerprint patterns and ABO blood groups in both the genders. Thus, correlating the uniqueness of these physical evidences sometimes helps the forensic team members in accurate personal identification or it can at least narrow the search for an individual where there are no possible data referring to the identity of the subject. Copyright © 2017 by Academy of Sciences and Arts of Bosnia and Herzegovina.

Inheritance pattern of lip prints among Malay population: A pilot study.

PubMed

George, Renjith; Nora Afandi, Nurulain Syafinaz Binti; Zainal Abidin, Siti Nur Hayati Binti; Binti Ishak, Nur Ismawani; Soe, Htoo Htoo Kyaw; Ismail, Abdul Rashid Hj

2016-04-01

We assessed the resemblance of lip print patterns between parents and biological offspring in families of 31 Malay students as well as the distribution of different types of lip print in the study group. Only a few studies have successfully established the inheritance pattern of lip prints. Such studies can be population specific and need to be conducted in various populations. No such study have been conducted in Malay population in Malaysia, according to our knowledge. Present study was carried out to ascertain whether there is any inherence pattern in lip prints and thereby to investigate the potential role of lip prints in personal identification. We found 58.06% resemblance of lip print patterns between the parents and their biological offspring in our study. The influence of heredity in lip print pattern is still a new concept and there is lack of concrete evidence. The data from our study shows that there is potential influence of inheritance in the lip print patterns among the family members. Further researches involving larger samples size are suggested to derive more reliable and accurate results. The most common lip print pattern among the study group is type I (29.84%) followed by type II (23.12%), type III (22.45%), type I' (13.44%), type IV (9.54%) and type V (1.61%). Racial variations in lip print patterns and their prevalence may serve as an aid in forensic identification and crime scene investigation. The results of this pilot study will help in establishing guidelines for future researches on lip print analysis in Malaysia. Lip print patterns are unique and individualistic. However, there are some similarities in basic patterns of lip prints between family members which may be attributed to influence of inheritance. 1. To determine the inheritance pattern of lip prints among Malay family members of the student. 2. To identify the distribution of different types of lip prints among Malay population. and Observational pilot study. Lip prints of 124 individuals from 31 families consisting of father, mother and two children were recorded and classified based on Tsuchihashi Classification (1974). Statistical analysis was performed for resemblance pattern among family members (Karl-Pearson Correlation Coefficient) and inter-observer variability (Kappa test). 58.06% positive resemblance was found between parents and biological offspring. The highest lip print pattern in the study group was type I (29.84%) and the least was type V (1.61%). There is positive resemblance in lip print patterns among family members which may be attributed to influence of inheritance. However, further studies with larger sample sizes need to be conducted to confirm the results. Type I lip print was the most prevalent pattern among the study subjects. Copyright © 2016 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Prioritizing Training To Maximize Results: The 3 Box System.

ERIC Educational Resources Information Center

Kearns, Paul

2003-01-01

Considers fundamentals of effective training and focuses on the evaluation of training. Describes the 3 Box System, which provides a framework for discussing: (1) basic training needs and priorities; (2) added value training, including ROI (return on investment); evaluation; and (3) prioritizing training budgets. (LRW)

High Tumor Penetration of Paclitaxel Loaded pH Sensitive Cleavable Liposomes by Depletion of Tumor Collagen I in Breast Cancer.

PubMed

Zhang, Li; Wang, Yang; Yang, Yuting; Liu, Yayuan; Ruan, Shaobo; Zhang, Qianyu; Tai, Xiaowei; Chen, Jiantao; Xia, Tai; Qiu, Yue; Gao, Huile; He, Qin

2015-05-13

The network of collagen I in tumors could prevent the penetration of drugs loaded in nanoparticles, and this would lead to impaired antitumor efficacy. In this study, free losartan (an angiotensin inhibitor) was injected before treatment to reduce the level of collagen I, which could facilitate the penetration of nanoparticles. Then the pH-sensitive cleavable liposomes (Cl-Lip) were injected subsequently to exert the antitumor effect. The Cl-Lip was constituted by PEG(5K)-Hydrazone-PE and DSPE-PEG(2K)-R8. When the Cl-Lip reached to the tumor site by the enhanced permeability and retention (EPR) effect, PEG(5K)-Hydrazone-PE was hydrolyzed from the Cl-Lip under the low extra-cellular pH conditions of tumors, then the R8 peptide was exposed, and finally liposomes could be internalized into tumor cells by the mediation of R8 peptide. In vitro experiments showed both the cellular uptake of Cl-Lip by 4T1 cells and cytotoxicity of paclitaxel loaded Cl-Lip (PTX-Cl-Lip) were pH sensitive. In vivo experiments showed the Cl-Lip had a good tumor targeting ability. After depletion of collagen I, Cl-Lip could penetrate into the deep place of tumors, the tumor accumulation of Cl-Lip was further increased by 22.0%, and the oxygen distributed in tumor tissues was also enhanced. The antitumor study indicated free losartan in combination with PTX-Cl-Lip (59.8%) was more effective than injection with PTX-Cl-Lip only (37.8%) in 4T1 tumor bearing mice. All results suggested that depletion of collagen I by losartan dramatically increased the penetration of PTX-Cl-Lip and combination of free losartan and PTX-CL-Lip could lead to better antitumor efficacy of chemical drugs. Thus, the combination strategy might be a promising tactic for better treatment of solid tumors with a high level of collagen I.

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

The Development of the Cleft Aesthetic Rating Scale: A New Rating Scale for the Assessment of Nasolabial Appearance in Complete Unilateral Cleft Lip and Palate Patients.

PubMed

Mosmuller, David G M; Mennes, Lisette M; Prahl, Charlotte; Kramer, Gem J C; Disse, Melissa A; van Couwelaar, Gijs M; Niessen, Frank B; Griot, J P W Don

2017-09-01

  The development of the Cleft Aesthetic Rating Scale, a simple and reliable photographic reference scale for the assessment of nasolabial appearance in complete unilateral cleft lip and palate patients.   A blind retrospective analysis of photographs of cleft lip and palate patients was performed with this new rating scale.   VU Medical Center Amsterdam and the Academic Center for Dentistry of Amsterdam.   Complete unilateral cleft lip and palate patients at the age of 6 years.   Photographs that showed the highest interobserver agreement in earlier assessments were selected for the photographic reference scale. Rules were attached to the rating scale to provide a guideline for the assessment and improve interobserver reliability. Cropped photographs revealing only the nasolabial area were assessed by six observers using this new Cleft Aesthetic Rating Scale in two different sessions.   Photographs of 62 children (6 years of age, 44 boys and 18 girls) were assessed. The interobserver reliability for the nose and lip together was 0.62, obtained with the intraclass correlation coefficient. To measure the internal consistency, a Cronbach alpha of .91 was calculated. The estimated reliability for three observers was .84, obtained with the Spearman Brown formula.   A new, easy to use, and reliable scoring system with a photographic reference scale is presented in this study.

Test of the movement expansion model: Anticipatory vowel lip protrusion and constriction in French and English speakers

PubMed Central

Noiray, Aude; Cathiard, Marie-Agnès; Ménard, Lucie; Abry, Christian

2011-01-01

The modeling of anticipatory coarticulation has been the subject of longstanding debates for more than 40 yr. Empirical investigations in the articulatory domain have converged toward two extreme modeling approaches: a maximal anticipation behavior (Look-ahead model) or a fixed pattern (Time-locked model). However, empirical support for any of these models has been hardly conclusive, both within and across languages. The present study tested the temporal organization of vocalic anticipatory coarticulation of the rounding feature from [i] to [u] transitions for adult speakers of American English and Canadian French. Articulatory data were synchronously recorded using an Optotrak for lip protrusion and a dedicated Lip-Shape-Tracking-System for lip constriction. Results show that (i) protrusion is an inconsistent parameter for tracking anticipatory rounding gestures across individuals, more specifically in English; (ii) labial constriction (between-lip area) is a more reliable correlate, allowing for the description of vocalic rounding in both languages; (iii) when tested on the constriction component, speakers show a lawful anticipatory behavior expanding linearly as the intervocalic consonant interval increases from 0 to 5 consonants. The Movement Expansion Model from Abry and Lallouache [(1995a) Bul. de la Comm. Parlée 3, 85–99; (1995b) Proceedings of ICPHS4, 152–155.] predicted such a regular behavior, i.e., a lawful variabilitywith a speaker-specific expansion rate, which is not language-specific. PMID:21303015

Test of the movement expansion model: anticipatory vowel lip protrusion and constriction in French and English speakers.

PubMed

Noiray, Aude; Cathiard, Marie-Agnès; Ménard, Lucie; Abry, Christian

2011-01-01

The modeling of anticipatory coarticulation has been the subject of longstanding debates for more than 40 yr. Empirical investigations in the articulatory domain have converged toward two extreme modeling approaches: a maximal anticipation behavior (Look-ahead model) or a fixed pattern (Time-locked model). However, empirical support for any of these models has been hardly conclusive, both within and across languages. The present study tested the temporal organization of vocalic anticipatory coarticulation of the rounding feature from [i] to [u] transitions for adult speakers of American English and Canadian French. Articulatory data were synchronously recorded using an Optotrak for lip protrusion and a dedicated Lip-Shape-Tracking-System for lip constriction. Results show that (i) protrusion is an inconsistent parameter for tracking anticipatory rounding gestures across individuals, more specifically in English; (ii) labial constriction (between-lip area) is a more reliable correlate, allowing for the description of vocalic rounding in both languages; (iii) when tested on the constriction component, speakers show a lawful anticipatory behavior expanding linearly as the intervocalic consonant interval increases from 0 to 5 consonants. The Movement Expansion Model from Abry and Lallouache [(1995a) Bul. de la Comm. Parlée 3, 85-99; (1995b) Proceedings of ICPHS 4, 152-155.] predicted such a regular behavior, i.e., a lawful variability with a speaker-specific expansion rate, which is not language-specific.

Application of Ulex europaeus agglutinin I-modified liposomes for oral vaccine: Ex Vivo bioadhesion and in Vivo immunity.

PubMed

Li, KeXin; Zhao, Xiuli; Xu, Shiyi; Pang, DaHai; Yang, ChunRong; Chen, DaWei

2011-01-01

The conjugation of Ulex europaeus agglutinin I (UEAI) onto surface of liposomes has been demonstrated to effectively improve the intestinal absorption of antigen, subsequently induced strong mucosal and systemic immune responses. In this context, we prepared bovine serum albumin (BSA)-encapsulating UEAI-modified liposomes (UEAI-LIP) and unmodified ones (LIP). The specific bioadhesion on mice gastro-intestinal mucosa was studied ex vivo. An important increase of interaction between UEAI-conjugated liposomes and the intestinal segments with Peyer's Patches (PPs) was observed compared with the unconjugated one (p<0.01). However, under the presence of α-L-fucose, which is the reported specific sugar for UEAI, specifically inhibited the activity of these conjugates. The immune-stimulating activity in vivo was studied by measuring immunoglobulin G (IgG) levels in serum and immunoglobulin A (IgA) levels in intestinal mucosal secretions following oral administration of BSA solution, LIP and UEAI-LIP in mice. Results indicate that antigen encapsulated in liposomes, especially the UEAI-modified ones, was favorable for inducing immune response. At 42 d after the first immunization, the highest IgG and IgA antibody levels produced by UEAI-LIP occurred, respectively showing 4.4-fold and 5-fold higher levels compared to those of the groups receiving BSA alone. This data demonstrated high potential of UEAI-modified liposomes for their use as carrier for oral vaccines.

Oral strength in subjects with a unilateral cleft lip and palate.

PubMed

Van Lierde, Kristiane M; Bettens, Kim; Luyten, Anke; Plettinck, Janne; Bonte, Katrien; Vermeersch, Hubert; Roche, Nathalie

2014-08-01

Facial appearance and speech outcome may affect psychosocial functioning in girls and boys. Several studies reported dissatisfaction with facial appearance and more specifically the lip and mouth profile in children with cleft lip and palate (CLP). The purpose of this controlled study was to measure the tongue and lip strength and endurance in boys and girls with CLP. Twenty-five subjects (mean age: 10.6 years) with a unilateral CLP and a gender- and age- matched control group were selected. All subjects with an unilateral CLP consulted the same craniofacial team and had undergone an identical surgical procedure. Surgical procedure of the lip was performed using a modified Millard technique without primary nose correction at an average age of 5.5 months. The Iowa Oral Performance instrument was used to measure lip and tongue strength and tongue endurance. The results of the Iowa Oral Performance measurement showed no significant differences between the subjects with an unilateral cleft lip and palate and the age and gender matched control group without a cleft lip and palate. There is no significant differences regarding oral strength more specifically the lip and tongue strength and endurance between subjects with and without an unilateral cleft lip and palate. ENT specialists and speech pathologists must be aware of this aspect of the normal lip and tongue functions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Secondary repair of cleft lip deformity.

PubMed

Tessier, P; Tulasne, J F

1984-10-01

A considerable number of procedures have been described for secondary improvements of the lip. They involve the scars, the Cupid's bow, the philtrum, the alar base, the vestibulum and the columella. In fact, these procedures may give a good aesthetic result in a static position, but the truly successful results occur with normal movements. A normal motion of the lip is impossible without a proper dissection and reorientation of the muscles. Satisfactory lip motion cannot be realized with a defective alveolus or piriform aperture that retracts the alar base. Consequently, a good lip or nasal base cannot be achieved without bony restoration of the alveolus and piriform aperture. A transversely short lip never has normal mobility, and it must be widened by an Abbé flap. A tight, retruded lip on a retruded maxilla cannot be improved by a prosthetic vestibular plate because a greater tension will restrict movements. The lip must be advanced with the maxilla, then widened if necessary by an Abbé flap. A thick prolapsed lip never has normal movement; it must be raised by an infranasal excision. A cleft lip has nothing to gain from being displayed under a short nose, or, still worse, under a upturned nose. The nose must be kept long enough to cast a shadow on the lip. For the same reason, a bone graft is often necessary in bilateral clefts because the nose is short and retruded.

Characteristic patterns of lip prints in Egyptian population sample at Dakahlia Governorate.

PubMed

Ragab, Ahmed Refat; El-Dakroory, Sahar Abd El-Aziz; Rahman, Rania Hamed Abdel

2013-03-01

Human identification is one of the most challenging sciences. Recently, study of lip prints has become slightly fashionable in forensic field. The aim of the present work is to determine the pattern of lip prints and evaluate its uniqueness in a sample of Egyptian population. The study included 955 subjects (2-65 years old). Lip prints were taken by direct rolling methods against hard background and each lip print was divided into six areas to be examined by magnifying hand lens. Thereafter, they were scanned and examined by the Microsoft office picture manager program. The results revealed that the lip print for each individual was unique and the complete vertical pattern was the commonest type among males and females living in Dakahlia Governorate, Egypt. Sex could not be differentiated from the lip print. It can be concluded that lip print analysis is an ancillary tool for personal identification especially in criminal investigations.

Reconstruction of the lower vermilion with a musculomucosal flap from the upper lip in the repair of extensive lower lip and chin defects.

PubMed

Rong, Li; Lan, Shi-Jie; Zhang, Duo; Wang, Wang-Shu; Liu, Chao; Peng, Wei-Hai

2014-09-01

In the repair of extensive lower lip and chin defects, the reconstruction of vermilion at the same time is a great challenge to plastic surgeons. We describe a novel method for the reconstruction of lower vermilion with musculomucosal flap from the upper lip in the repair of extensive lower lip and chin defects. Two patients underwent extensive lower lip and chin reconstruction together with vermilion reconstruction. This technique used 3 basic components: musculomucosal flap from the upper lip, buccal mucosal advancement flap, and cutaneous rotational flap from the neck. All the flaps survived without significant complications. Labial function in the motions of expression and speaking was maintained. The patients could basically close their mouths completely, and there were no drooping or small-mouth deformities postoperatively. Functional and cosmetically acceptable lower-lip and chin reconstructions in both patients were achieved.

The Effect of Cleft Lip and Palate, and the Timing of Lip Repair on Mother-Infant Interactions and Infant Development

ERIC Educational Resources Information Center

Murray, Lynne; Hentges, Francoise; Hill, Jonathan; Karpf, Janne; Mistry, Beejal; Kreutz, Marianne; Woodall, Peter; Moss, Tony; Goodacre, Tim

2008-01-01

Background: Children with cleft lip and palate are at risk for psychological problems. Difficulties in mother-child interactions may be relevant, and could be affected by the timing of lip repair. Method: We assessed cognitive development, behaviour problems, and attachment in 94 infants with cleft lip (with and without cleft palate) and 96…

Preliminary Analysis of the 3-Dimensional Morphology of the Upper Lip Configuration at the Completion of Facial Expressions in Healthy Japanese Young Adults and Patients With Cleft Lip.

PubMed

Matsumoto, Kouzou; Nozoe, Etsuro; Okawachi, Takako; Ishihata, Kiyohide; Nishinara, Kazuhide; Nakamura, Norifumi

2016-09-01

To develop criteria for the analysis of upper lip configuration of patients with cleft lip while they produce various facial expressions by comparing the 3-dimensional (3D) facial morphology of healthy Japanese adults and patients with cleft lip. Twenty healthy adult Japanese volunteers (10 men, 10 women, controls) without any observed facial abnormalities and 8 patients (4 men, 4 women) with unilateral cleft lip and palate who had undergone secondary lip and nose repair were recruited for this study. Facial expressions (resting, smiling, and blowing out a candle) were recorded with 2 Artec MHT 3D scanners, and images were superimposed by aligning the T-zone of the faces. The positions of 14 specific points were set on each face, and the positional changes of specific points and symmetry of the upper lip cross-section were analyzed. Furthermore, the configuration observed in healthy controls was compared with that in patients with cleft lip before and after surgery. The mean absolute values for T-zone overlap ranged from 0.04 to 0.15 mm. Positional changes of specific points in the controls showed that the nose and lip moved backward and laterally upward when smiling and the lips moved forward and downward medially when blowing out a candle; these movements were bilaterally symmetrical in men and women. In patients with cleft lip, the positional changes of the specific points were minor compared with those of the controls while smiling and blowing out a candle. The left-versus-right symmetry of the upper lip cross-section exceeded 1.0 mm in patients with cleft lip, which was markedly higher than that in the controls (0.17 to 0.91 mm). These left-versus-right differences during facial expressions were decreased after surgery. By comparing healthy individuals with patients with cleft lip, this study has laid the basis for determining control values for facial expressions. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

[Antitumor effects of matrix protein of vesicular stomatic virus on EL4 lymphoma mice].

PubMed

Lin, Shi-jia; Yu, Qin-mei; Meng, Wen-tong; Wen, Yan-jun; Chen, Li-juan; Niu, Ting

2011-03-01

To explore antitumor effects of plasmid pcDNA3. 1-MP encoding matrix protein of vesicular stomatitis virus (VSV) complexed with cationic liposome (DOTAP:CHOL) in mice with EL4 lymphoma. C57BL/6 mouse model with EL4 lymphoma was established. Sixty mice bearing EL4 lymphoma were divided randomly into five groups including Lip-MP, Lip-pVAX, Lip, ADM and NS groups, which were intravenously injected with liposome-pcDNA 3. 1-MP complex, liposome-pVAX complex, empty liposome, Adriamycin and normal saline respectively every three days. Tumor volumes and survival time were monitored. Microvessel density and tumor proliferative index in tumor tissues were determined by CD31, Ki-67 immunohistochemistry staining, meanwhile the tumor apoptosis index was measured by TUNEL method. From 6 days after treatments on, the tumor volume in Lip-MP group was much smaller than that in Lip-pVAX, Lip and NS group (P < 0.05). The median survival time of mice in Lip-MP group, 44 days after inoculation of tumor cells, was significantly higher than that in other groups (P < 0.05), which was 39 days, 38.5 days and 34 days in Lip-pVAX, Lip and NS groups respectively. The MVD value in tumor tissues in Lip-MP group was less than that in Lip-pVAX, Lip and NS groups (P < 0.05). Ki67 staining revealed that Lip-MP complex apparently suppressed the proliferation of EL4 tumor cells in vivo (P < 0.05). TUNEL assays showed that apoptosis index of tumor cells in Lip-MP group, 10.60 +/- 1.71, was much higher than that in other three groups (P < 0.05). Lip-MP complex, the plasmid encoding matrix protein of VSV (VSV-MP) encapsulated in cationic liposome, significantly inhibited the growth of tumor and prolonged the survival of mice bearing EL4 lymphoma, which may be related to the induction of tumor cell apoptosis, inhibition of tumor angiogenesis, and suppression of tumor cell proliferation.

Glossary of terms and table of conversion factors used in design of chemical propulsion systems

NASA Technical Reports Server (NTRS)

Keller, R. B., Jr. (Compiler)

1979-01-01

The glossary presented is based entirely on terms used in the monographs on Chemical Propulsion. Significant terms relating to material properties and to material fabrication are presented. The terms are arranged in alphabetical order, with multiple word terms appearing in the normal sequence of usage; for example, ablative cooling appears as such, not as cooling, ablative, and lip seal appears as such, not as seal, lip. Conversion Factors for converting U.S. customary units to the International System of Units are presented in alphabetical order of the physical quantity (e.g., density, heat flux, specific impulse) involved.

Plan of study to quantify the hydrologic relations between the Rio Grande and the Santa Fe Group aquifer system near Albuquerque, central New Mexico

USGS Publications Warehouse

McAda, D.P.

1996-01-01

The Albuquerque Basin in central New Mexico covers an area of about 3,060 square miles. Ground water from the Santa Fe Group aquifer system of the Albuquerque Basin is the principal source of water for municipal, domestic, commercial, and industrial uses in the Albuquerque area, an area of about 410 square miles. Ground- water withdrawal in the basin has increased from about 97,000 acre-feet in 1970 to about 171,000 acre-feet in 1994. About 92 percent of the 1994 total was withdrawn in the Albuquerque area. Management of ground water in the Albuquerque Basin is related to the surface water in the Rio Grande. Because the aquifer system is hydraulically connected to the Rio Grande and water in the river is fully appropriated, the ability to reliably estimate the effects of ground-water withdrawals on flow in the river is important. This report describes the components of the Rio Grande/Santa Fe Group aquifer system in the Albuquerque area and the data availability and data and interpretation needs relating to those components, and presents a plan of study to quantify the hydrologic relations between the Rio Grande and the Santa Fe Group aquifer system. The information needs related to the components of the river/aquifer system are prioritized. Information that is necessary to improve the understanding or quantification of a component in the river/aquifer system is prioritized as essential. Information that could add additional understanding of the system, but would not be necessary to improve the quantification of the system, is prioritized as useful. The study elements are prioritized in the same manner as the information needs; study elements designed to provide information considered necessary to improve the quantification of the system are prioritized as essential, and those designed to provide information that would add additional understanding of the system, but would not be necessary to improve the quantification of the system, are prioritized as useful.

Cleft Lip and Palate

MedlinePlus

... Safe Videos for Educators Search English Español Cleft Lip and Cleft Palate KidsHealth / For Kids / Cleft Lip and Cleft Palate ... the back of your mouth. What's a Cleft Lip or Cleft Palate? The word cleft means a gap or split ...

Identification and characterization of lipases from Malassezia restricta, a causative agent of dandruff.

PubMed

Sommer, Bettina; Overy, David P; Kerr, Russell G

2015-11-01

Dandruff, a skin disorder affecting 50% of the world population, is linked with proliferation of lipophilic yeasts of the genus Malassezia (particularly Malassezia globosa and M. restricta). Most Malassezia species show a unique lipid dependency and require external lipids for growth. Genome mining of the incomplete M. restricta genome led to the identification of eight lipase sequences. Sequences representing the class 3 and LIP lipase families were used to clone the lipases MrLip1, MrLip2 and MrLip3, recombinantly expressed in Pichia pastoris, and tested for their activity using mono-, di- and triacylglycerol substrates. Hydrolysis by the M. restricta lipase MrLip1 and MrLip2 (family class 3) was limited to the mono- and diacylglycerol, while MrLip3 (family LIP) hydrolyzed all three substrates. This result confirms that Malassezia family LIP lipases are responsible for the hydrolysis of triacylglycerols, the main component of human sebum. Furthermore, the information regarding lipases from M. restricta presented here might aid in the search for anti-dandruff agents. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Paying more than lip service to lip lesions.

PubMed Central

Bentley, Janna M.; Barankin, Benjamin; Lauzon, Gilles J.

2003-01-01

OBJECTIVE: To review the epidemiology, etiology, diagnosis, management, and prognosis of the most common, potentially lethal, lip lesions: leukoplakia, actinic cheilitis, and squamous cell carcinoma (SCC). QUALITY OF EVIDENCE MEDLINE: was searched from 1966 to 2002 for English-language articles on prevalence of lip lesions. No articles for a family physician audience were found. MEDLINE was searched again using the terms "leukoplakia," "actinic cheilitis," and "squamous cell carcinoma." Randomized, controlled trials were selected; non-blinded trials, population-based studies, and systematic reviews were also used. MAIN MESSAGE: Leukoplakia, actinic cheilitis, and SCC of the lips are relatively common presentations that can cause substantial morbidity and, more rarely, mortality. Any abnormality of the lips can be an embarrassment. Because of the seriousness and frequency of lip disease, it is important to look for, diagnose, and treat lip lesions to prevent morbidity and mortality and also to maintain social acceptance and self-esteem. CONCLUSION: Knowledge of leukoplakia, actinic cheilitis, and SCC of the lips will aid family physicians in diagnosing and managing these lesions and in preventing associated morbidity and mortality. PMID:14526863

A Multi-criteria Decision Analysis System for Prioritizing Sites and Types of Low Impact Development Practices

NASA Astrophysics Data System (ADS)

Song, Jae Yeol; Chung, Eun-Sung

2017-04-01

This study developed a multi-criteria decision analysis framework to prioritize sites and types of low impact development (LID) practices. This framework was systemized as a web-based system coupled with the Storm Water Management Model (SWMM) from the Environmental Protection Agency (EPA). Using the technique for order of preference by similarity to ideal solution (TOPSIS), which is a type of multi-criteria decision-making (MCDM) method, multiple types and sites of designated LID practices are prioritized. This system is named the Water Management Prioritization Module (WMPM) and is an improved version of the Water Management Analysis Module (WMAM) that automatically generates and simulates multiple scenarios of LID design and planning parameters for a single LID type. WMPM can simultaneously determine the priority of multiple LID types and sites. In this study, an infiltration trench and permeable pavement were considered for multiple sub-catchments in South Korea to demonstrate the WMPM procedures. The TOPSIS method was manually incorporated to select the vulnerable target sub-catchments and to prioritize the LID planning scenarios for multiple types and sites considering socio-economic, hydrologic and physical-geometric factors. In this application, the Delphi method and entropy theory were used to determine the subjective and objective weights, respectively. Comparing the ranks derived by this system, two sub-catchments, S16 and S4, out of 18 were considered to be the most suitable places for installing an infiltration trench and porous pavement to reduce the peak and total flow, respectively, considering both socio-economic factors and hydrological effectiveness. WMPM can help policy-makers to objectively develop urban water plans for sustainable development. Keywords: Low Impact Development, Multi-Criteria Decision Analysis, SWMM, TOPSIS, Water Management Prioritization Module (WMPM)

Ensuring relevance for Cochrane reviews: evaluating processes and methods for prioritizing topics for Cochrane reviews.

PubMed

Nasser, Mona; Welch, Vivian; Tugwell, Peter; Ueffing, Erin; Doyle, Jodie; Waters, Elizabeth

2013-05-01

The purpose of this study was to assess the presence and effectiveness of existing systems of prioritization for Cochrane review topics and to explore methods of improving those systems. We surveyed groups of Cochrane review authors and recorded any evidence of their use of priority-setting processes or policies. To evaluate the effectiveness of the policies we encountered, we assessed them using two frameworks from the literature: "Accountability for Reasonableness" (1) and Sibbald's 2009 framework (2) for successful priority setting. We then held two workshops with the subject groups to discuss our findings and their implications. Of the 66 groups surveyed, 29 had a system in place to inform the selection or prioritization of topics for Cochrane reviews. Fifteen groups used a more comprehensive structured approach that eventually resulted in a list of ranked priority titles for authoring, updating, or disseminating Cochrane reviews. Most groups involved researchers, practitioners, and patients in their prioritization processes. Groups within The Cochrane Collaboration currently use a range of different priority-setting systems, some of which are more detailed than others. These differences often reflect the nature of The Cochrane Collaboration itself: given the topic breadth, history, and variety of international contexts present in the organization, a single unified system would not always be appropriate. All Cochrane entities, however, should have or develop strategic plans to improve the inclusiveness and transparency of their own prioritization processes, increase the number of finished prioritized reviews, and make more effective use of feedback from end users to increase the likelihood of producing reviews that have positive effects on health outcomes. Copyright © 2013 Elsevier Inc. All rights reserved.

Dynamic Circuitry for Updating Spatial Representations: III. From Neurons to Behavior

PubMed Central

Berman, Rebecca A.; Heiser, Laura M.; Dunn, Catherine A.; Saunders, Richard C.; Colby, Carol L.

2008-01-01

Each time the eyes move, the visual system must adjust internal representations to account for the accompanying shift in the retinal image. In the lateral intraparietal cortex (LIP), neurons update the spatial representations of salient stimuli when the eyes move. In previous experiments, we found that split-brain monkeys were impaired on double-step saccade sequences that required updating across visual hemifields, as compared to within hemifield (Berman et al. 2005; Heiser et al. 2005). Here we describe a subsequent experiment to characterize the relationship between behavioral performance and neural activity in LIP in the split-brain monkey. We recorded from single LIP neurons while split-brain and intact monkeys performed two conditions of the double-step saccade task: one required across-hemifield updating and the other within-hemifield updating. We found that, despite extensive experience with the task, the split-brain monkeys were significantly more accurate for within-hemifield as compared to across-hemifield sequences. In parallel, we found that population activity in LIP of the split-brain monkeys was significantly stronger for within-hemifield as compared to across-hemifield conditions of the double-step task. In contrast, in the normal monkey, both the average behavioral performance and population activity showed no bias toward the within-hemifield condition. Finally, we found that the difference between within-hemifield and across-hemifield performance in the split-brain monkeys was reflected at the level of single neuron activity in LIP. These findings indicate that remapping activity in area LIP is present in the split-brain monkey for the double-step task and co-varies with spatial behavior on within-hemifield compared to across-hemifield sequences. PMID:17493922

Dental Care for a Child with Cleft Lip and Palate

MedlinePlus

... Volunteer Efforts Dental Care for a Child with Cleft Lip and Palate skip to submenu What We Do Cleft & Craniofacial ... version of this factsheet, click here How does cleft lip/palate affect the teeth? A cleft of the lip, ...

Comparison of Lip Print Patterns in Two Indian Subpopulations and Its Correlation in ABO Blood Groups

PubMed Central

Suragimath, Girish; Sande, Abhijeet R; Kulkarni, Prasad; Nimbal, Anand; Shankar, T.; Gowd, T. Snigdha; Shetty, Prajwal K

2014-01-01

Background: The study of lip-print pattern (cheiloscopy) is a scientific method for personal identification and plays a major role in forensic and criminal investigations. Objective: To compare the lip print patterns in Kerala and Maharashtra population and correlate between ABO blood groups. Materials and Methods: Two hundred subjects, 100 from Maharashtra and 100 from Kerala were considered for the study. Lip prints were recorded, analyzed according to Tsuchihashi classification. The lip print patterns were compared in the two populations, correlated in ABO blood groups. The data obtained was statistically analyzed with SPSS software using chi-square test. Results: In our study, predominant lip print pattern observed in Kerala population was type IV (53%) and Maharashtra population was type II (42%). The difference between the two population was statistically significant (p<0.001). Subjects with A+ and O- blood groups had type II lip print predominance. Subjects with B+, AB+ and O+ blood groups had type IV predominance. The lip print patterns do not show any correlation in ABO blood groups. Conclusion: Lip prints are unique to each individual and are different even in two persons. Lip print patterns were different in the two sub populations studied, and they showed no correlation in ABO blood groups. PMID:25478445

Study of lip hydration with application of photoprotective lipstick: influence of skin phototype, size of lips, age, sex and smoking habits.

PubMed

López-Jornet, Pía; Camacho-Alonso, Fabio; Rodríguez-Espin, Ana

2010-05-01

To study lip hydration levels when applying a lipstick sunscreen for 3 months and to evaluate the influence of size of lips, age, sex, smoking and skin phototype. The study group was formed by 140 volunteer subjects, one group consisting of 70 patients applying a commercial lipstick sunscreen three times a day and the other group of 70 controls in which no product was applied. The age range was 20-86 years. The influence in lip hydration levels of age, sex, phototype, size of the lips and smoking habits was studied using a Corneometer 825 (Courage & Khazaka Electronic GmbH, Cologne, Germany). An increase in lip hydration was found between the basal (53.49 +/- 15.259) and final (59.34 +/- 14.51) Corneometer 825 (Courage & Khazaka Electronic GmbH, Cologne, Germany) measurements over the three months of treatment, with statistically significant differences with respect to the control (p=0.002). However, no statistically significant differences in lip hydration were observed with regard to age, (p=0.48), gender (p=0.876), skin phototype (p=0.653), lip area (p=0.291) and smoking (p=0.178). Application of a lipstick sunscreen 3 times a day for 3 months increases lip hydration.

Primary Premaxillary Ostectomy and Setback: Dealing With the "Fly-away" Premaxilla.

PubMed

Farhadi, Rana; Wallace, Robert D

2018-05-14

This study aimed to analyze our outcomes of primary premaxillary ostectomy and setback combined with lip adhesion as the first stage in repair of the bilateral cleft lip with fly-away premaxilla. This retrospective study included all patients who required primary premaxillary setback by a single surgeon to achieve successful lip repair between 2011 and 2017 at a tertiary children's hospital. All patients had bilateral cleft lip and complete cleft palate with significant premaxillary protrusion. All patients either had failed presurgical orthodontic manipulation or were thought to be poor candidates because of the rigidity of the premaxilla on clinical examination. Patient data were obtained from review of medical records and photographs. Surgical technique is described. Eleven patients with bilateral cleft lip, all of whom also had complete cleft palate, underwent primary premaxillary setback and lip adhesion at an average age of 8.2 months. The mean follow-up was 1.9 years (range, 139 days to 4.5 years). All patients subsequently completed formal lip repair, of which 10 have undergone palatoplasty. Serial photography documented stable premaxillary position and successful lip repair within the follow-up time frame. No patient had postoperative premaxillary instability or vascular compromise. One patient had dehiscence of the lip adhesion requiring reoperation. Primary premaxillary ostectomy and setback allows for successful staged formal lip repair in patients with bilateral cleft lip and palate who have failed presurgical infant orthopedics. Further research is required regarding long-term follow-up with respect to midfacial growth.

[Cosmetic technique application on the modification of lip deformity after cleft lip surgery].

PubMed

Lixian, Chen; Huajun, Wang; Caixia, Gong; Qian, Zheng; Bing, Shi; Bihe, Zhang

2018-02-01

This study aims to explore the effect of cosmetic technique on the modification of lip deformity after cleft lip surgery. A total of 35 patients with postoperative cleft lip and who needed two-stage repair due to the nasolabial deformity were selected. Cosmetic technique was used to modify their lip deformities prior to the surgery. Front photos of the patients were taken before and after modification of their lip deformities. These photos were subsequently assessed by both the patients and the medical staff. The visual analogue method, Asher-McDade aesthetic index, and Mortier PB scale were used by patients and medical staff to evaluate changes in the lip shape by the cosmetic technique. Prior to the cosmetic technique application, the mean self-score of the patients and the mean scores of the medical staff were 56±13 and 3.22±1.11 points, respectively. After the cosmetic technique application, the mean self-score of the patients and the mean scores of the medical staff were 67±12 and 2.85±1.03 points, respectively. The differences were statistically significant for both the patients and the medical staff (P<0.05). Appropriate use of the cosmetic technique can modify the lip deformity after the cleft lip surgery to a certain degree. The use of this technique exerts evident effects in restoring the symmetry
of lip peak and the continuity of the labial arch and in highlighting the philtrum column.

Methylphenidate Induced Lip and Tongue Biting.

PubMed

Gokcen, Cem; Karadag, Mehmet; Aksoy, Ihsan

2018-05-31

Attention deficit hyperactivity disorder (ADHD) is a life-long neurodevelopmental disorder and treatment depends on pharmacotherapy because of its biological origin. Stimulant drugs are the most commonly used treatment for ADHD and they have various side effects. Herein, we report a case who bit off the tip of her tongue with Osmotic Release Oral System methylphenidate (OROS MPH) 36 mg/day, bit the tip of her lower lip with immediate release (IR) MPH 10 mg/day and lateral part of her tongue with IR MPH 20 mg/day. A diagnosis of epilepsy was unlikely because of the normal neurological examination and electroencephalography findings. This case was considered as an atypical side effect of MPH such as perseverative/compulsive behaviours and movement disorders. Clinicians should be aware of that stimulant medications may cause lip and tongue biting behavior and this may effect treatment compliance tremendously.

Development of the object permanence concept in cleft lip and palate and noncleft lip and palate infants.

PubMed

Pecyna, P M; Feeney-Giacoma, M E; Neiman, G S

1987-06-01

Studies of language acquisition in cleft lip and palate infants have not investigated the development of specific cognitive concepts, such as object permanence, which may be related to early linguistic skills. This study obtained comparative data on the development of the object permanence concept in cleft lip and palate and noncleft lip and palate infants to determine whether there were significant differences in rate or sequence of development. Infants were tested for the object permanence concept from 12 through 18 months of age. Results revealed significant improvement in all infants' scores with age, indicating progressive development of the concept. Further, while scores were not significantly different between the cleft lip and palate groups, scores for these groups were significantly better than scores for noncleft lip and palate infants. Superior performance of the cleft lip and palate infants may have resulted from increased environmental stimulation provided by their parents. Implications for intervention and future research in this area are presented.

Isolation and characterisation of obligately anaerobic, lipolytic bacteria from the rumen of red deer.

PubMed

Jarvis, G N; Strömpl, C; Moore, E R; Thiele, J H

1998-03-01

Two Gram-positive, obligately anaerobic, lipolytic bacteria, isolates LIP4 and LIP5, were obtained from the rumen contents of juvenile red deer. These mesophilic bacterial strains were capable of hydrolysing the neutral lipids, tallow, tripalmitin and oliver oil, into their constituent free long-chain fatty acid and glycerol moieties. The latter compound was dissimilated by both isolates, with isolate LIP4 producing propionate as the predominant product, while isolate LIP5 produced acetate, ethanol and succinate. The lactate-utilising isolate LIP4 grew on a limited range of saccharide substrates including glucose, fructose and ribose, and exhibited an unusual cell wall structure and morphology. The isolate LIP5 grew upon a wider range of saccharides, but was unable to use lactate as a substrate. Based upon phenotypic and 16S rRNA gene sequence analyses, isolate LIP4 clusters with species in the genus Propionibacterium, while isolate LIP5 is a member of clostridial cluster XIVa.

Exciplexes versus Loose Ion Pairs: How Does the Driving Force Impact the Initial Product Ratio of Photoinduced Charge Separation Reactions?

PubMed Central

2014-01-01

Many donor–acceptor systems can undergo a photoinduced charge separation reaction, yielding loose ion pairs (LIPs). LIPs can be formed either directly via (distant) electron transfer (ET) or indirectly via the dissociation of an initially formed exciplex or tight ion pair. Establishing the prevalence of one of the reaction pathways is challenging because differentiating initially formed exciplexes from LIPs is difficult due to similar spectroscopic footprints. Hence, no comprehensive reaction model has been established for moderately polar solvents. Here, we employ an approach based on the time-resolved magnetic field effect (MFE) of the delayed exciplex luminescence to distinguish the two reaction channels. We focus on the effects of the driving force of ET and the solvent permittivity. We show that, surprisingly, the exciplex channel is significant even for an exergonic ET system with a free energy of ET of −0.58 eV and for the most polar solutions studied (butyronitrile). Our findings demonstrate that exciplexes play a crucial role even in polar solvents and at moderate driving forces, contrary to what is usually assumed. PMID:25243054

Recognizing Whispered Speech Produced by an Individual with Surgically Reconstructed Larynx Using Articulatory Movement Data

PubMed Central

Cao, Beiming; Kim, Myungjong; Mau, Ted; Wang, Jun

2017-01-01

Individuals with larynx (vocal folds) impaired have problems in controlling their glottal vibration, producing whispered speech with extreme hoarseness. Standard automatic speech recognition using only acoustic cues is typically ineffective for whispered speech because the corresponding spectral characteristics are distorted. Articulatory cues such as the tongue and lip motion may help in recognizing whispered speech since articulatory motion patterns are generally not affected. In this paper, we investigated whispered speech recognition for patients with reconstructed larynx using articulatory movement data. A data set with both acoustic and articulatory motion data was collected from a patient with surgically reconstructed larynx using an electromagnetic articulograph. Two speech recognition systems, Gaussian mixture model-hidden Markov model (GMM-HMM) and deep neural network-HMM (DNN-HMM), were used in the experiments. Experimental results showed adding either tongue or lip motion data to acoustic features such as mel-frequency cepstral coefficient (MFCC) significantly reduced the phone error rates on both speech recognition systems. Adding both tongue and lip data achieved the best performance. PMID:29423453

An intelligent healthcare management system: a new approach in work-order prioritization for medical equipment maintenance requests.

PubMed

Hamdi, Naser; Oweis, Rami; Abu Zraiq, Hamzeh; Abu Sammour, Denis

2012-04-01

The effective maintenance management of medical technology influences the quality of care delivered and the profitability of healthcare facilities. Medical equipment maintenance in Jordan lacks an objective prioritization system; consequently, the system is not sensitive to the impact of equipment downtime on patient morbidity and mortality. The current work presents a novel software system (EQUIMEDCOMP) that is designed to achieve valuable improvements in the maintenance management of medical technology. This work-order prioritization model sorts medical maintenance requests by calculating a priority index for each request. Model performance was assessed by utilizing maintenance requests from several Jordanian hospitals. The system proved highly efficient in minimizing equipment downtime based on healthcare delivery capacity, and, consequently, patient outcome. Additionally, a preventive maintenance optimization module and an equipment quality control system are incorporated. The system is, therefore, expected to improve the reliability of medical equipment and significantly improve safety and cost-efficiency.

Cleft Lip Repair, Nasoalveolar Molding, and Primary Cleft Rhinoplasty.

PubMed

Bhuskute, Aditi A; Tollefson, Travis T

2016-11-01

Cleft lip and palate are the fourth most common congenital birth defect. Management requires multidisciplinary care owing to the complexity of these clefts on midface growth, dentition, Eustachian tube function, and lip and nasal cosmesis. Repair requires planning, but can be performed systematically to reduce variability of outcomes. The use of primary rhinoplasty at the time of cleft lip repair can improve nose symmetry and reduce nasal deformity. Use of nasoalveolar molding ranging from lip taping to the use of preoperative infant orthopedics has played an important role in improving functional and cosmetic results of cleft lip repair. Copyright © 2016 Elsevier Inc. All rights reserved.

Unfavourable results in the repair of the cleft lip

PubMed Central

Narayanan, Puthucode V.; Adenwalla, Hirji Sorab

2013-01-01

Introduction: Unfavorable results in unilateral and bilateral cleft lip repair are often easy to spot but not always easy to prevent as to treat. We have tried to deal with the more common problems and explain possible causes and the best possible management options from our experience. Unilateral cleft lip repair: Unfavorable results immediately after repair involve Dehiscence and Scaring. Delayed blemishes include vermillion notching, a short lip, deficiency in the height of the lateral vermillion on the cleft side, white roll malalignment, oro-vestibular fistula, the cleft lip nose deformity, a narrow nostril and a “high-riding” nostril. We analyze the causes of these blemishes and outline our views regarding the treatment of these. Bilateral cleft lip: Immediate problems again include dehiscence as also loss of prolabium or premaxilla. Delayed unfavorable results are central vermillion deficiency, a lip that is too tight, bilateral cleft lip nose deformity, problems with the premaxilla and maxillary growth disturbances. Here again we discuss the causation of these problems and our preferred methods of treatment. Conclusion: We have detailed the significant unfavorable results after unilateral and bilateral cleft lip surgery. The methods of treatment advocated have been layer from our own experience. PMID:24501453

Identifying and Prioritizing Critical Hardwood Resources

Treesearch

Sam C. Doak; Sharon Johnson; Marlyce Myers

1991-01-01

A logical framework is required to provide a focus for the implementation of a variety of landowner incentive techniques in accordance with existing goals to protect and enhance hardwood resources. A system is presented for identifying and prioritizing critical hardwood resources for site specific conservation purposes. Flexibility is built into this system so that...

Cybersecurity and Resilience | Energy Systems Integration Facility | NREL

Science.gov Websites

, and offer prioritized action items to improve organizational protocols. The team is also helping and provide a prioritized list of action items for gaps in security controls. Security architectures

Neural control of the lips differs for young and older adults following a perturbation

PubMed Central

de Miranda Marzullo, Ana Carolina; Neto, Osmar Pinto; Ballard, Kirrie J.; Robin, Donald A.; Chaitow, Lauren

2011-01-01

Aging impairs the control of many skilled movements including speech. The purpose of this paper was to investigate whether young and older adults adapt to lower lip perturbations during speech differently. Twenty men (10 young, 26 ± 3 years of age; 10 older, 60 ± 9 years of age) were requested to repeat the word (“papa”) 300 times. In 15% of the trials, the subjects experienced a mechanical perturbation on the lower lip. Displacement and neural activation (EMG) of the upper and lower lips were evaluated. Perturbations to the lower lip caused a greater increase in the maximum displacement of the lower lip for older adults compared with young adults (34.7 ± 19% vs. 13.4 ± 17%; P = 0.017). Furthermore, young adults exhibited significantly greater 30–100 Hz normalized EMG power for the lower lip compared to the upper lip (P < 0.005). In young adults, changes from normal to perturbed trials in the 30–50 Hz frequency band of the EMG were negatively correlated to the changes from normal to perturbed trials in the lower lip maximum displacement (R2 = 0.48; P = 0.025). It is concluded that young adults adapt better to lower lip perturbations compared with older adults and that the associated neural activation strategy of the involved muscle is different for the two age groups. PMID:20852991

Lamprey immune protein-1 (LIP-1) from Lampetra japonica induces cell cycle arrest and cell death in HeLa cells.

PubMed

Chi, Xiaoyuan; Su, Peng; Bi, Dan; Tai, Zhao; Li, Yingying; Pang, Yue; Li, Qingwei

2018-04-01

The lamprey (Lampetra japonica), a representative of the jawless vertebrates, is the oldest extant species in the world. LIP-1, which has a jacalin-like domain and an aerolysin pore-forming domain, has previously been identified in Lampetra japonica. However, the structure and function of the LIP-1 protein have not been described. In this study, the LIP-1 gene was overexpressed in HeLa cells and H293T cells. The results showed that the overexpression of LIP-1 in HeLa cells significantly elevated LDH release (P < 0.05), phosphatidylserine exposure and ROS accumulation. The overexpression of LIP-1 also had remarkable effects on the organelles in HeLa cells, while it had no effect on H293T cell organelles. Array data indicated that overexpression of LIP-1 primarily upregulated P53 signaling pathways in HeLa cells. Cell cycle assay results confirmed that LIP-1 caused arrest in the G 2 /M phase of the cell cycle in HeLa cells. In summary, our findings provide insights into the function and characterization of LIP-1 genes in vertebrates and establish the foundation for further research into the biological function of LIP-1. Our observations suggest that this lamprey protein has the potential for use in new applications in the medical field. Copyright © 2018. Published by Elsevier Ltd.

Serovar prevalence of Leptospira in semirural India and the development of an IgM-based indirect ELISA.

PubMed

Chandy, Sara; Kirubanandhan, Lokeshwaran; Hemavathy, Priya; Khadeeja, Anees Mohammad; Kurian, Siby Jacob; Venkataraman, Krishnan; Mørch, Kristine; Mathai, Dilip; Manoharan, Anand

2017-03-31

Leptospirosis is a major public health problem in India. However, it has been underreported and under-diagnosed due to a lack of awareness of the disease, a functional surveillance system, and appropriate laboratory diagnostic facilities. This multicenter study aimed to understand the Leptospira serovars causing leptospirosis in seven secondary-level hospitals in six states in India. Since early and accurate diagnosis of leptospirosis is one of the challenges faced by clinicians in India due to the poor specificity and sensitivity of commercially available diagnostic systems, an in-house indirect enzyme-linked immunosorbent assay (ELISA) was developed. Genomic DNA from L. interrogans serovar Canicola was used for polymerase chain reaction amplification, cloning, and expression of the lipL32 gene in E. coli to amplify, clone, and express the lipL32 gene. Australis was the common serovar seen at all the study centers. Serovar Icterohaemorrhagiae was seen in samples from Tamil Nadu and Assam. In-house ELISA was standardized using the purified recombinant LipL32 polypeptide and was used to evaluate serum. Subsequently, acute serum samples from leptospirosis patients (n = 60) were screened. Compared to the gold standard, the microscopic agglutination test, sensitivity and specificity of the in-house ELISA was 95% and 90%, respectively. Understanding Leptospira serovars circulating in leptospirosis-endemic areas will help to formulate better vaccines. LipL32-based ELISA may serve as a valuable tool for early diagnosis of leptospirosis.

Development of microLIPS (Luciferase Immunoprecipitation Systems): a novel microfluidic assay for rapid serum antibody detection

NASA Astrophysics Data System (ADS)

Chandrangsu, Matt; Burbelo, Peter D.; Iadarola, Michael J.; Smith, Paul D.; Morgan, Nicole Y.

2012-06-01

There is considerable interest in the development of rapid, point-of-care antibody detection for the diagnosis of infectious and auto-immune diseases. In this paper, we present work on the development of a self-contained microfluidic format for the Luciferase Immunoprecipitation Systems (LIPS) assay. Whereas the majority of immunoassays for antigen-specific antibodies employ either bacteria- or yeast-expressed proteins and require the use of secondary antibodies, the LIPS technique uses a fusion protein comprised of a Renilla luciferase reporter and the antigen of interest produced via mammalian cell culture, ensuring the addition of mammalian post-translational modifications. Patient serum is mixed with the fusion protein and passed over immobilized Protein A/G; after washing, the only remaining luciferase-tagged antigens are those retained by specific antibodies. These can be quantitatively measured using chemiluminescence upon the introduction of coelenterazine. The assay has been successfully employed for a wide variety of diseases in a microwell format. We report on a recent demonstration of rapid HSV-2 diagnosis with the LIPS assay in a microfluidic format, using one microliter of serum and obtaining results in under ten minutes. We will also discuss recent progress on two fronts, both aimed at the deployment of this technology in the field: first, simplifying assay operation through the automation of flow control using power-free means; and second, efforts to increase signal levels, primarily through strategies to increase antibody binding capacity, in order to move towards portable battery powered electronics.

Prioritizing Scientific Data for Transmission

NASA Technical Reports Server (NTRS)

Castano, Rebecca; Anderson, Robert; Estlin, Tara; DeCoste, Dennis; Gaines, Daniel; Mazzoni, Dominic; Fisher, Forest; Judd, Michele

2004-01-01

A software system has been developed for prioritizing newly acquired geological data onboard a planetary rover. The system has been designed to enable efficient use of limited communication resources by transmitting the data likely to have the most scientific value. This software operates onboard a rover by analyzing collected data, identifying potential scientific targets, and then using that information to prioritize data for transmission to Earth. Currently, the system is focused on the analysis of acquired images, although the general techniques are applicable to a wide range of data modalities. Image prioritization is performed using two main steps. In the first step, the software detects features of interest from each image. In its current application, the system is focused on visual properties of rocks. Thus, rocks are located in each image and rock properties, such as shape, texture, and albedo, are extracted from the identified rocks. In the second step, the features extracted from a group of images are used to prioritize the images using three different methods: (1) identification of key target signature (finding specific rock features the scientist has identified as important), (2) novelty detection (finding rocks we haven t seen before), and (3) representative rock sampling (finding the most average sample of each rock type). These methods use techniques such as K-means unsupervised clustering and a discrimination-based kernel classifier to rank images based on their interest level.

Age-related changes of the dental aesthetic zone at rest and during spontaneous smiling and speech.

PubMed

Van der Geld, Pieter; Oosterveld, Paul; Kuijpers-Jagtman, Anne Marie

2008-08-01

The aims of this study were to analyse lip line heights and age effects in an adult male population during spontaneous smiling, speech, and tooth display in the natural rest position and to determine whether lip line height follows a consistent pattern during these different functions. The sample consisted of 122 randomly selected male participants from three age cohorts (20-25 years, 35-40 years, and 50-55 years). Lip line heights were measured with a digital videographic method for smile analysis, which had previously been tested and found reliable. Statistical analysis of the data was carried out using correlation analysis, analysis of variance, and Tukey's post hoc tests. Maxillary lip line heights during spontaneous smiling were generally higher in the premolar area than at the anterior teeth. The aesthetic zone in 75 per cent of the participants included all maxillary teeth up to the first molar. Coherence in lip line heights during spontaneous smiling, speech, and tooth display in the natural rest position was confirmed by significant correlations. In older subjects, maxillary lip line heights decreased significantly in all situations. Lip line heights during spontaneous smiling were reduced by approximately 2 mm. In older participants, the mandibular lip line heights also changed significantly and teeth were displayed less during spontaneous smiling. Mandibular tooth display in the rest position increased significantly. Upper lip length increased significantly by almost 4 mm in older subjects, whereas upper lip elevation did not change significantly. The significant increasing lip coverage of the maxillary teeth indicates that the effects of age should be included in orthodontic treatment planning.

Dermatoglyphics and Cheiloscopy as Key Tools in Resolving the Genetic Correlation of Inheritance Patterns in Cleft Lip and Palate Patients: An Assessment of 160 Patients.

PubMed

Singh, Priyankar; Nathani, Dipesh B

2017-09-01

  The objective of this study was to correlate dermatoglyphics and cheiloscopy with genetic inheritance in cleft lip and cleft palate patients.   This was a case-control study to look for asymmetry in finger and lip print patterns. All of the participants were divided into two equal groups (40 mothers and 40 fathers in each group). The data were analyzed by three evaluators who were blind to the study to avoid any chances of error.   A sample of 160 sporadic participants were identified and evaluated. Group A was composed of 80 healthy parents not affected by cleft lip and cleft palate but had at least one child born with nonsyndromic cleft. Group B consisted of 80 healthy parents not affected by cleft lip and cleft palate and had healthy children without cleft lip and cleft palate.   Main outcome measures were marked dermatoglyphic asymmetry and specific lip print pattern in the study group.   We found marked asymmetry in various fingerprints and specific type II and type III lip print in the study group when compared with the control group. It was observed that groove count on the lip was significantly more frequent in study group parents.   Our study determined that there is a significant correlation between increased dermatoglyphic asymmetry and specific type II and type III lip print pattern in parents of children born with cleft. This could act as an important screening marker for the prediction of cleft lip and cleft palate inheritance.

The development of the nursing care system for patients with cleft lip-palate and craniofacial deformities at Tawanchai Cleft Center, Srinagarind Hospital, Khon Kaen, Thailand.

PubMed

Pradubwong, Suteera; Pongpagatip, Sumalee; Volrathongchai, Kanittha; Chowchuen, Bowornsilp

2012-11-01

The highest incidence of cleft lip-palate and craniofacial deformities in Thailand occur in the Northeastern Region. There is the necessity for an interdisciplinary care team as well as the specialized care center with systematic coordinated care, thus "Tawanchai Cleft Center" is becoming a superior medical center for patients with cleft lip-palate and craniofacial deformities. Therefore, the development of the nursing care system for patients with cleft lip-palate and craniofacial deformities at Tawanchai Cleft Center, Srinagarind Hospital is extremely important and necessary. To develop the nursing care system appropriate for a super tertiary hospital (Tawanchai Cleft Center). It is a participation study which has 3 steps as follows, 1) Analyzing the situations and collecting the opinions of the 22 Out-patient Surgery Department staff and Tawanchai Cleft Center staff by using 6 questions, 2) Summarizing of the situation analysis from the meetings and the questionnaires, then using such summary as the guidelines for developing the nursing care system from January 2011 onwards, 3) evaluating the satisfaction after the 4 month development period (May-August 2011) with 106 caregivers by using 8 questions and being analyzed by the average value, percentage and standard deviation. 1) The nursing care system consisted of psychosocial care, breast feeding, counseling and other assistance as required. This various assistance responded to the patient/family problems by following the treatment guideline of the multidisciplinary team which uses the continuous evaluation processes for the holistic patient/family care. 2) The patients with complete cleft lip-palate were the most common type, found in 44 cases or 41.53 percent. The highest number of caregivers were mothers which were 68 percent; the average age of those mothers was 36 years old. The highest number of them finished elementary school at 43 percent and 40 percent were farmers. The satisfaction for the services of Tawanchai Cleft Center showed the average for each satisfaction subject all at very good level (x = 3.56, SD = 0.13). The care for patients with CLP and craniofacial deformities at Tawanchai Cleft Center Srinagarind Hospital has been developed in order to have the appropriate nursing care system to provide superior quality care, which provides patient-holistic care, as well as improving effective accessibility to the services. Thus, the patients/caregivers who are satisfied with given services, get continuing monitoring and treatment and are able to live their lives in the society happily.

Development of the Object Permanence Concept in Cleft Lip and Palate and Noncleft Lip and Palate Infants.

ERIC Educational Resources Information Center

Pecyna, Paula M.; And Others

1987-01-01

The development of the concept of object permanence was investigated with eight infants with cleft lip/palate and four nonimpaired infants. Superior performance of the cleft lip/palate group was found, possibly due to increased environmental stimulation provided by parents. (DB)

Doublecortin is expressed in trigeminal motoneurons that innervate the velar musculature of lampreys: considerations on the evolution and development of the trigeminal system.

PubMed

Barreiro-Iglesias, Antón; Romaus-Sanjurjo, Daniel; Senra-Martínez, Pablo; Anadón, Ramón; Rodicio, María Celina

2011-01-01

Studies in lampreys have revealed interesting aspects of the evolution of the trigeminal system and the jaw. In the present study, we found a marker that distinguishes subpopulations of trigeminal motoneurons innervating two different kinds of oropharyngeal muscles. Immunofluorescence with an antibody against doublecortin (DCX; a neuron-specific phosphoprotein) enabled identification of the trigeminal motoneurons that innervate the velar musculature of larval and recently transformed sea lampreys. DCX-immunoreactive (-ir) motoneurons were observed in the rostro-lateral part of the trigeminal motor nucleus of these animals, but not in lampreys 1 month or more after metamorphosis. Combined double DCX/tubulin and serotonin/tubulin immunofluorescence and tract-tracing experiments with neurobiotin (NB) were also performed in larvae for further characterization of this system. Rich innervation by DCX-ir fibers was observed on the muscle fibers of the velum but not on the upper lip or lower lip muscles, which were innervated by tubulin-ir/DCX-negative fibers. No double-labelled DCX-ir motoneurons were observed in experiments in which the tracer NB was applied to the upper lip. Innervation of velar muscles by serotonergic fibers is also reported. The present results indicate that development of the trigeminal motoneurons innervating the velum differs from that of the trigeminal motoneurons innervating the lips, which is probably related to the dramatic regression of the velum during metamorphosis. The absence of data on a similar subsystem in the trigeminal motor nucleus of gnathostomes suggests that they may be lamprey-specific motoneurons. These results provide support for the "heterotopic theory" of jaw evolution and are inconsistent with the theories of a velar origin for the gnathostome jaw. © 2011 Wiley Periodicals, Inc.

Cytokeratin expression in pseudoepitheliomatous hyperplasia of oral paracoccidioidomycosis.

PubMed

Kaminagakura, E; Bonan, P R F; Lopes, M A; Almeida, O P; Scully, C

2006-08-01

Paracoccidioidomycosis (Pmycosis) is one the most prevalent deep systemic mycoses in Latin America. It is characterized by granulomatous inflammation and pseudoepitheliomatous hyperplasia. Cytokeratins (CKs) are a group of intermediate filaments of epithelial cells and their expression varies according to the epithelium type, differentiation and pathological processes. This study describes cytokeratin expression as examined by immunohistochemistry, in 28 cases of oral Pmycosis involving the buccal mucosa, lip, gingiva and hard palate. Expression of CKs in the basal layer of the epithelium in pseudoepitheliomatous hyperplasia of Pmycosis was similar to that in normal oral mucosa (NOM), but in Pmycosis CK1 and CK10 were not expressed in the spinous and superficial layers of the lip, gingiva or hard palate, and, in the spinous and superficial layers of the lip and buccal mucosa, CK14 was positive in contrast to NOM where it was negative. In Pmycosis, CK6 was more frequently expressed in the spinous layer of the lip, gingiva and hard palate, but nevertheless CK16 expression was decreased in the spinous and superficial layers of the gingiva and hard palate. We conclude that pseudoepitheliomatous hyperplasia in oral Pmycosis shows a different pattern of CK expression, particularly CKs 1, 10 and 14, compared with NOM.

Permanent make-up colorants may cause severe skin reactions.

PubMed

Wenzel, Sabrina M; Welzel, Julia; Hafner, Christian; Landthaler, Michael; Bäumler, Wolfgang

2010-10-01

In recent years, cosmetic tattoos [permanent make-up (PMU)] on eyelids, eyebrows and lips have become increasingly popular. However, most colorants are manufactured for non-medical purposes, without any established history of safe use in humans. To investigate severe adverse reactions, such as swelling, burning, and the development of papules, of the lips and the surrounding area in 4 patients who had had at least two PMU procedures on their lips. Adverse skin reactions were examined with patch and prick testing of the colorants. In addition, skin biopsies were taken in the centre of the prick test for histology. One patient declined prick testing. Beauticians tended to use various PMU products, but all contained Pigment Red 181 (CI 73360). All patients tested showed a clear delayed reaction to Pigment Red 181 or the tattoo ink, or both, after prick testing. Histology indicated an allergic reaction. Each lip lesion slowly abated after several months of topical or systemic therapy with steroids in combination with tacrolimus, but none has yet completely resolved. In light of the severe and often therapy-resistant skin reactions, we strongly recommend the regulation and control of the substances used in PMU colorants. © 2010 John Wiley & Sons A/S.

Development of a Novel Lipophilic, Magnetic Nanoparticle for in Vivo Drug Delivery

PubMed Central

Linemann, Thomas; Thomsen, Louiza B.; Du Jardin, Kristian G.; Laursen, Jens C.; Jensen, Jesper B.; Lichota, Jacek; Moos, Torben

2013-01-01

The aim of the present study was to evaluate the transfection potential of chitosan-coated, green-fluorescent magnetic nanoparticles (MNPs) (chi-MNPs) after encapsulation inside polyethylglycol (PEG)ylated liposomes that produced lipid-encapsulated chitosan-coated MNPs (lip-MNPs), and also to evaluate how these particles would distribute in vivo after systemic injection. The transfection potential of both chi-MNPs and lip-MNPs was evaluated in vitro in rat brain endothelial 4 (RBE4) cells with and without applying a magnetic field. Subsequently, the MNPs were evaluated in vivo in young rats. The in vitro investigations revealed that the application of a magnetic field resulted in an increased cellular uptake of the particles. The lip-MNPs were able to transfect the RBE4 cells with an incidence of approximately 20% of a commercial transfection agent. The in vivo distribution studies revealed that lip-MNPs had superior pharmacokinetic properties due to evasion of the RES, including hepatic Kuppfer cells and macrophages in the spleen. In conclusion, we were able to design a novel lipid-encapsulated MNP with the ability to carry genetic material, with favorable pharmacokinetic properties, and under the influence of a magnetic field with the capability to mediate transfection in vitro. PMID:24300449

DOD Financial Management: Improvements Needed in the Navys Audit Readiness Efforts for Fund Balance with Treasury

DTIC Science & Technology

2016-08-01

prioritization of key information technology limits management’s ability to focus audit readiness efforts on the systems with the highest risk...corrective actions for the higher-risk systems first. For an audit readiness plan for key information technology systems, the Navy provided a schedule...prioritization of key information technology systems used in the FBWT process limits management’s ability to focus audit readiness efforts on the most

Lower lip reconstruction with nasolabial flap--going back to basics.

PubMed

Coutinho, Inês; Ramos, Leonor; Gameiro, Ana Rita; Vieira, Ricardo; Figueiredo, Américo

2015-01-01

Squamous cell carcinoma of the lower lip is frequent, and radical excision sometimes leads to complex defects. Many lip repair techniques are aggressive requiring general anesthesia and a prolonged post-operative period. The nasolabial flap, while a common flap for the repair of other facial defects, is an under-recognized option for the reconstruction of the lower lip. We describe the use of nasolabial flap for the repair of a large defect of the lower lip in a ninety year-old male, with good functional results and acceptable cosmetic outcome. We believe the nasolabial flap is a good alternative for intermediate-to-large lower lip defects in patients with impaired general condition.

Design guide for helicopter transmission seals

NASA Technical Reports Server (NTRS)

Hayden, T. S.; Keller, C. H., Jr.

1974-01-01

A detailed approach for the selection and design of seals for helicopter transmissions is presented. There are two major types of seals presently being used and they are lip type seals and mechanical type seals. Lip type seals can be divided in conventional lip seals and hydrodynamic lip seals. Conventional lip seals can be used for slow-speed, low-pressure, low-temperature sealing. Hydrodynamic lip seals although they are as pressure and temperature limited as conventional lip seals, can operate at a higher speed. Mechanical types seals are comprised of face seals and circumferential seals. Face seals are capable of high speed, high pressure, and high temperature. Circumferential seals can be used in high-speed and high-temperature applications, but will leak excessively at moderate pressures. The performance goals of transmission seals are a life that is at least equal to the scheduled overhaul interval of the gearbox component and a leakage rate of near zero.

Feeding Techniques for Children Who Have Cleft Lip and Palate.

ERIC Educational Resources Information Center

Klein, Marsha Dunn

This pamphlet on feeding techniques for children who have cleft lip and palate emphasizes the role of the parent as part of a team involving many specialists. The pamphlet begins with explanations of complete and incomplete separations of the lip, unilateral and bilateral cleft lips, corrective surgical procedures, etc. The importance of weight…

[The apron mucosal flap of the lower lip for the repair of the secondary deformities of the cleft lip].

PubMed

Wu, K; Xu, J; Lin, Y

1996-05-01

Twelve cases of secondary deformities of the cleft lip were repaired with the apron mucosal flap of the lower lip. The operation method is described. The advantages and disadvantages are discussed. Good results were obtained in patients with mild or medium secondary deformities.

78 FR 44422 - Airworthiness Directives; Eurocopter France (Eurocopter) Helicopters

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-24

..., rust, overheating, and condition. This AD is prompted by six reports of hydraulic pump drive belt... lip seals, rust on the lip seals, evidence of overheating revealed by brown discoloring of the bearing... pulley bearing for leaking grease, a crack or tear in the lip seals, a run of rust on the lip seals...

Analysis of select facial and dental esthetic parameters.

PubMed

Nold, Sarah L; Horvath, Sebastian D; Stampf, Susanne; Blatz, Markus B

2014-01-01

This clinical study examined objective smile parameters in the natural anterior dentition. Standardized intraoral and extraoral photographs were taken of 106 Caucasian adults (54 women, 52 men) with a healthy dentition. The following parameters were analyzed: correlation of dental and facial midline, upper lip position and curvature, relationship of the maxillary anterior incisal curve with lower lip, number of teeth displayed in a smile, distance between maxillary anterior teeth and lower lip, slope of tooth, and lip arc. The simple frequency distribution of measured variables revealed an average smile with coinciding dental and facial midlines, an average smile line, and a straight upper lip curvature. With an average smile, the maxillary anterior teeth did not touch the lower lip, teeth were displayed up to the second premolar, and the maxillary anterior incisal curve was parallel to the lower lip. Oval was the most prevalent tooth form. A slope of 9 degrees was detected for the mean tooth arc and 13 degrees for the mean lip arc. The outcomes of this clinical study provide a quantifiable frame for esthetic evaluation, treatment planning, and restoration fabrication.

Extracellular expression of YlLip11 with a native signal peptide from Yarrowia lipolytica MSR80 in three different yeast hosts.

PubMed

Kumari, Arti; Baronian, Keith; Kunze, Gotthard; Gupta, Rani

2015-06-01

Lipase YlLip11 from Yarrowia lipolytica was expressed with a signal peptide encoding sequence in Arxula adeninivorans, Saccharomyces cerevisiae and Hansenula polymorpha using the Xplor®2 transformation/expression platform and an expression module with the constitutive Arxula-derived TEF1 promoter. The YlLip11 signal peptide was functional in all of the yeast hosts with 97% of the recombinant enzyme being secreted into the culture medium. However, recombinant YlLip11 with His Tag fused at C-terminal was not active. The best recombinant YlLip11 producing A. adeninivorans G1212/YRC102-YlLip11 transformant cultivated in shake flasks produced 2654 U/L lipase, followed by S. cerevisiae SEY6210/YRC103-YlLip11 (1632U/L) and H. polymorpha RB11/YRC103-YlLip11 (1144U/L). Although the biochemical parameters of YlLip11 synthesized in different hosts were similar, their glycosylation level and thermo stability differed. The protein synthesized by the H. polymorpha transformant had the highest degree of glycosylation and with a t1/2 of 60min at 70°C, exhibited the highest thermostability. Copyright © 2015 Elsevier Inc. All rights reserved.

Aesthetic Evaluation of the Nasolabial Region in Children with Unilateral Cleft Lip and Palate Comparing Expert versus Nonexperience Health Professionals

PubMed Central

Paiva, Tatiana Saito; Andre, Marcia; Paiva, Wellingson Silva; Mattos, Beatriz Silva Camara

2014-01-01

Esthetic evaluation of cleft lip and palate rehabilitation outcomes may assist in the determination of new surgical interventions and aid in reevaluation of treatment protocols. Our objective was to compare esthetics assessments of the nasolabial region in children with a unilateral cleft lip and palate between healthcare professionals who were experienced in the treatment of cleft lip and palate and those who were inexperienced. The study group included 55 patients between 6 and 12 years of age who had already undergone primary reconstructive surgery for unilateral cleft lip. Standardized digital photographs were obtained, and the esthetic features of the nose, lip, and nasolabial region were evaluated. We used only cropped photographic images in the assessments of healthcare professionals with and without experience in cleft lip and palate. Interrater analysis revealed highly reliable assessments made by both the experienced and inexperienced professionals. There was no statistically significant difference in the esthetic attractiveness of the lip and nose between the experienced and inexperienced professionals. Compared with the inexperienced professionals, the experienced professional evaluators showed higher satisfaction with the esthetic appearance of the nasolabial region; however, no difference was observed in the analysis of the lip or nose alone. PMID:25126560

Whorl Patterns on the Lower Lip are Associated with Nonsyndromic Cleft Lip with or without Cleft Palate

PubMed Central

Neiswanger, Katherine; Chirigos, Kevin W.; Klotz, Cherise M.; Cooper, Margaret E.; Bardi, Kathleen M.; Brandon, Carla A.; Weinberg, Seth M.; Vieira, Alexandre R.; Martin, Rick A.; Czeizel, Andrew E.; Castilla, Eduardo E.; Poletta, Fernando A.; Marazita, Mary L.

2009-01-01

Nonsyndromic cleft lip with or without cleft palate (CL/P) is a common birth defect due to both genetic and environmental factors. Whorl lip print patterns are circular grooves on the central upper lip and/or the left and right lower lip. To determine if whorls are more common in families with CL/P than in controls, the Pittsburgh Orofacial Cleft Study collected lip prints from over 450 subjects, i.e., individuals with CL/P, their relatives, and unrelated controls—from the U.S., Argentina, and Hungary. Using a narrow definition of lower-lip whorl, the frequency of whorls in the U.S sample was significantly elevated in cleft individuals and their family members, compared to unrelated controls (14.8% and 13.2% versus 2.3%; P = 0.003 and 0.001, respectively). Whorls were more frequent in CL/P families from Argentina than in CL/P families from the U.S. or Hungary. If these results are confirmed, whorl lip print patterns could be part of an expanded phenotypic spectrum of nonsyndromic CL/P. As such, they may eventually be useful in a clinical setting, allowing recurrence risk calculations to incorporate individual phenotypic information in addition to family history data. PMID:19921634

Interrelationship of Smoking, Lip and Gingival Melanin Pigmentation, and Periodontal Status

PubMed Central

Multani, Suraj

2013-01-01

Background Cigarette smoking is a significant risk factor for periodontal disease. It also causes pigmentation of oral mucosa. The present study was aimed to assess the effects of smoking on lip and gingival pigmentation and periodontal status and the relationship between pigmentation and periodontal parameters. Methods A total of 109 smokers and an equal number of non-smoker controls (mean age: 35.9 years, range: 35-44 years) comprised the study sample. All the participants were assessed for pigmentation on lip and gingiva and overall periodontal status (gingival bleeding, probing depth, and loss of attachment at six points in each tooth). Findings All the smokers in this study had lip and gingival pigmentation. Two-third of non-smokers had no pigmentation. The mean scores of lip and gingival pigmentation in smokers were seven and four times higher than those of non-smokers, respectively. Pigmentation and periodontal parameters (except gingival bleeding) were found to be positively related with exposure to smoking exposure. Probing depth and loss of attachment were the highest in subjects with pigmented lips and grade three pigmented gingiva. Conclusion Smoking influenced lip and gingival pigmentation and periodontium. All individuals with lip pigmentation presented some form of gingival pigmentation. Probing depth and loss of attachment were more severe in subjects with lip and gingival pigmentation. PMID:24494159

Blood glucose measurement in vivo using hollow-fiber based, mid-infrared ATR probe with multi-reflection prism

NASA Astrophysics Data System (ADS)

Kino, Saiko; Omori, Suguru; Matsuura, Yuji

2016-03-01

An attenuated-total-reflection (ATR), mid-infrared spectroscopy system that consists of hollow optical fibers, a trapezoidal multi-reflection ATR prism, and a conventional FT-IR spectrometer has been developed to measure blood glucose levels. Owing to the low transmission loss and high flexibility of the hollow-optical fiber, the system can measure any sites of the human body where blood capillaries are close to the surface of mucosa, such as inner lips. Using a multi-reflection prism brought about higher sensitivity, and the flat and wide contact surface of the prism resulted in higher measurement reproducibility. The results of in-vivo measurement of human inner lips showed the feasibility of the proposed system, and the measurement errors were within 20%.

Ear Infection in Isolated Cleft Lip: Etiological Implications.

PubMed

Ruegg, Teresa A; Cooper, Margaret E; Leslie, Elizabeth J; Ford, Matthew D; Wehby, George L; Deleyiannis, Frederic W B; Czeizel, Andrew E; Hecht, Jacqueline T; Marazita, Mary L; Weinberg, Seth M

2017-03-01

  Chronic ear infections are a common occurrence in children with orofacial clefts involving the secondary palate. Less is known about the middle ear status of individuals with isolated clefts of the lip, although several studies have reported elevated rates of ear infection in this group. The purpose of this retrospective study was to test the hypothesis that chronic ear infections occur more frequently in isolated cleft lip cases (n = 94) compared with controls (n = 183).   A questionnaire was used to obtain information on history of chronic ear infection. The association between ear infection status (present/absent) and cleft lip status (cleft lip case/control) was tested using both chi-square and logistic regression.   The reported occurrence of chronic ear infection was significantly greater in cleft lip cases (31%) compared with unaffected controls (11%). After adjusting for age and sex, having a cleft lip increased the odds of being positive for ear infection by a factor greater than 3 (odds ratio = 3.698; 95% confidence interval = 1.91 to 7.14). Within cleft lip cases, there was no difference in the occurrence of ear infection by defect laterality or by the type of clefting present in the family history. Although velopharyngeal insufficiency was present in 18.4% of our cleft lip sample, there was no statistical association between ear infection and abnormal speech patterns. These results may have potential implications both for the clinical management of isolated cleft lip cases and for understanding the etiology of orofacial clefting.

Acoustic properties of healthy and reconstructed cleft lip

NASA Astrophysics Data System (ADS)

Thijssen, Johan M.; van Hees, Nancy J.; Weijers, Gert G.; Huyskens, Rinske W.; Nillesen, Maartje; Katsaros, Christos; de Korte, Chris L.

2006-03-01

The feasibility of echographic imaging of the tissues in healthy lip and in reconstructed cleft lip and estimating the dimensions and the normalized echo level of these tissues is investigated. Echographic images of the upper lip were made with commercial medical ultrasound equipment, using a linear array transducer (7-11 MHz bandwidth) and a non-contact gel coupling. Tissue dimensions were measured by means of software calipers. Echo levels were calibrated and corrected for beam characteristics, gel path and tissue attenuation by using a tissue-mimicking phantom. At central position of philtrum, mean thickness (and standard deviation) of lip loose connective tissue layer, orbicularis oris muscle and dense connective layer was 4.0 (sd 0.1) mm, 2.3 (sd 0.7) mm, 2.2 (sd 0.7) mm, respectively, in healthy lip at rest. Mean (sd) echo level of muscle and dense connective tissue layer with respect to echo level of lip loose connective tissue layer was in relaxed condition: - 19.3 (sd 0.6) dB and - 10.7 (sd 4.0) dB, respectively. Echo level of loose connective tissue layer was +25.6 (sd 4.2) dB relative to phantom echo level obtained in the focus of the transducer. Color mode echo images were calculated, after adaptive filtering of the images, which show the tissues in separate colors and highlight the details of healthy lip and reconstructed cleft lip. Quantitative assessment of thickness and echo level of various lip tissues is feasible after proper calibration of the echographic equipment. Diagnostic potentials of the developed quantitative echographic techniques for non-invasive evaluation of the outcome of cleft lip reconstruction are promising.

Self-reports of psychosocial functioning among children and young adults with cleft lip and palate.

PubMed

Hunt, Orlagh; Burden, Donald; Hepper, Peter; Stevenson, Mike; Johnston, Chris

2006-09-01

A cross-sectional study was employed to determine the psychosocial effects of cleft lip and/or palate among children and young adults, compared with a control group of children and young adults without cleft lip and palate. The study comprised 160 children and young adults with cleft lip and/or palate and 113 children and young adults without cleft lip and/or palate. All participants were between 8 and 21 years of age. Psychological functioning (anxiety, self-esteem, depression, and behavioral problems) was assessed using validated psychological questionnaires. Happiness with facial appearance was rated using a visual analog scale. Social functioning, including experience of teasing/bullying and satisfaction with speech, was assessed using a semistructured interview. Participants with cleft lip and/or palate reported greater behavioral problems (p < .001) and more symptoms of depression (p < .01); they were teased more often (p < .001) and were less happy with their facial appearance (p < .01) and speech (p < .001), compared with controls. There were no significant difference between subjects with cleft lip and/or palate and subjects without cleft lip and/or palate in terms of anxiety (p > .05) or self-esteem (p > .05). Having been teased was a significant predictor of poor psychological functioning, more so than having a cleft lip and/or palate per se (p < .001). Teasing was greater among participants who had cleft lip and/ or palate and it was a significant predictor of poorer psychosocial functioning. Children and young adults with cleft lip and/or palate require psychological assessment, specifically focusing on their experience of teasing, as part of their routine cleft care.

Can commonly used profile planes be used to evaluate changes in lower lip position?

PubMed

Buschang, Peter H; Fretty, Kimberly; Campbell, Phillip M

2011-07-01

To determine the validity of five profile planes commonly used to describe the horizontal changes of the lower lip during orthodontic treatment. Pretreatment and posttreatment cephalograms of 79 patients (12.4 ± 2.8 years of age) were evaluated. Lower lip (labrale inferiorus) changes over time were measured relative to the Rickett's E-line, Steiner's S1-line, Burstone's B-line, Sushner's S2-line, and Holdaway's H-line. As an independent measure of actual horizontal lip changes, the labrale inferiorus was measured relative to a stable reference plane registered on the sella and oriented on the SN-7°. The lower lip actually moved anteriorly 2.35 ± 3.35 mm during orthodontic treatment; the five profile planes indicated that the lower lip moved to a more retrusive, posterior position. The five profile planes also showed no statistically significant sex differences in terms of the treatment changes that occurred, while the actual lip changes showed that males exhibited significantly greater changes than females. Actual treatment changes showed that the lower lip moved to a more protrusive position with nonextraction than with extraction treatments, changes that were not evident based on the five profile lines. While lip changes based on the five profile planes demonstrated moderately high to high intercorrelations ranging from 0.81 to 0.97, they showed only weak correlations (r < .35) with the actual horizontal changes of the labrale inferiorus. While all five planes measured similar aspects of positional change, none of them closely reflected the actual lower lip changes that occurred. These planes should not be used to measure changes in lip position that occur during treatment.

Interactions of the Human LIP5 Regulatory Protein with Endosomal Sorting Complexes Required for Transport*♦

PubMed Central

Skalicky, Jack J.; Arii, Jun; Wenzel, Dawn M.; Stubblefield, William-May B.; Katsuyama, Angela; Uter, Nathan T.; Bajorek, Monika; Myszka, David G.; Sundquist, Wesley I.

2012-01-01

The endosomal sorting complex required for transport (ESCRT) pathway remodels membranes during multivesicular body biogenesis, the abscission stage of cytokinesis, and enveloped virus budding. The ESCRT-III and VPS4 ATPase complexes catalyze the membrane fission events associated with these processes, and the LIP5 protein helps regulate their interactions by binding directly to a subset of ESCRT-III proteins and to VPS4. We have investigated the biochemical and structural basis for different LIP5-ligand interactions and show that the first microtubule-interacting and trafficking (MIT) module of the tandem LIP5 MIT domain binds CHMP1B (and other ESCRT-III proteins) through canonical type 1 MIT-interacting motif (MIM1) interactions. In contrast, the second LIP5 MIT module binds with unusually high affinity to a novel MIM element within the ESCRT-III protein CHMP5. A solution structure of the relevant LIP5-CHMP5 complex reveals that CHMP5 helices 5 and 6 and adjacent linkers form an amphipathic “leucine collar” that wraps almost completely around the second LIP5 MIT module but makes only limited contacts with the first MIT module. LIP5 binds MIM1-containing ESCRT-III proteins and CHMP5 and VPS4 ligands independently in vitro, but these interactions are coupled within cells because formation of stable VPS4 complexes with both LIP5 and CHMP5 requires LIP5 to bind both a MIM1-containing ESCRT-III protein and CHMP5. Our studies thus reveal how the tandem MIT domain of LIP5 binds different types of ESCRT-III proteins, promoting assembly of active VPS4 enzymes on the polymeric ESCRT-III substrate. PMID:23105106

Serodiagnosis of Equine Leptospirosis by Enzyme-Linked Immunosorbent Assay Using Four Recombinant Protein Markers

PubMed Central

Ye, Cuilian; Yan, Weiwei; McDonough, Patrick L.; McDonough, Sean P.; Mohamed, Hussni; Divers, Thomas J.; Chang, Yung-Fu

2014-01-01

Leptospirosis, caused by Leptospira spp., is one of the most common zoonotic diseases in the world. We tested four recombinant proteins of Leptospira interrogans, namely, rLipL21, rLoa22, rLipL32, and rLigACon4-8, to evaluate their potential for use as antigens for the diagnosis of equine leptospirosis. We employed equine sera (n = 130) that were microscopic agglutination test (MAT) negative and sera (n = 176) that were MAT positive for the 5 serovars that most commonly cause equine leptospirosis. The sensitivity and specificity of ELISA compared to MAT were 82.39% and 86.15%, respectively, for LigACon4-8, 77.84% and 92.31%, respectively, for Loa22, 77.84% and 86.15%, respectively, for LipL32, and 84.66% and 83.85%, respectively, for LipL21. When one of the two antigens was test positive, the sensitivity and specificity of ELISA were 93.75% and 78.46%, respectively, for rLigACon4-8 and LipL32, 93.18% and 76.15%, respectively, for rLigACon4-8 and LipL21, 89.77% and 80.77%, respectively, for rLigACon4-8 and Loa22, 91.48% and 78.46%, respectively, for LipL21 and Loa22, 93.75% and 76.92%, respectively, for LipL21 and LipL32, and 90.34% and 80.77%, respectively, for Loa22 and LipL32. In conclusion, we have developed an indirect ELISA utilizing rLigACon4-8, rLoa22, rLipL32, and rLipL21 as diagnostic antigens for equine leptospirosis. The use of four antigens in the ELISA was found to be sensitive and specific, the assay was easy to perform, and the results concurred with the results of the standard Leptospira MAT. PMID:24451330

Theoretical evaluation of engine auxiliary inlet design for supersonic V/STOL aircraft

NASA Technical Reports Server (NTRS)

Boles, Michael A.; Heavner, Richard L.

1988-01-01

A higher order panel method is used to evaluate the potential flow of a two dimensional supersonic V/STOL inlet. A non-symmetric analytical inlet model is developed to closely match a wind tunnel model. The analytical inlet is analyzed for flow characteristics around the lower cowl lip and auxiliary inlets. The results are obtained from the output of a computer program that is based on the Hess Panel Method which determines source strengths of panels distributed over a three dimensional body. The analytical model was designed for the implementation of drooped/translated cowl lip and auxiliary inlets as flow improvement concepts. A 40 or 70 degree droop lip can be incorporated on the inlet to determine if these geometry modifications result in flow improvements which may reduce the propensity for flow separation on the interior portion of the lip. Auxiliary inlets are employed to decrease the mass flow over the inlet lip. Thus, the peak flow velocity is reduced at the lip which also lessens the likelihood of flow separation on the interior portion of the lip. A 2, 4, and 6 inch translated lip can be employed to also decrease mass flow over the inlet lower lip in the same manner as the auxiliary inlet. The performance results of the flow improvement concepts show that three possible inlet configurations provide a situation where separation is less likely to occur. A 70 degree droop lip maintains flow conditions such that attached flow over the lower cowl lip may exist for the entire angle of attack range studied. A 0 degree droop and translated lip combination provides similar results for the angle of attack range. The third configuration consists of a 0 degree droop and auxiliary inlet combination. This configuration provides slightly less favorable results than the other two, but still allows for conditions favorable to attached flow within the inlet.

Association of Nodal Metastasis and Mortality With Vermilion vs Cutaneous Lip Location in Cutaneous Squamous Cell Carcinoma of the Lip.

PubMed

Wang, David M; Kraft, Stefan; Rohani, Pooyan; Murphy, George F; Besaw, Robert J; Karia, Pritesh S; Morgan, Frederick C; Schmults, Chrysalyne D

2018-06-01

Although the lip is considered a high-risk location in cutaneous squamous cell carcinoma (cSCC), it has not been established whether this risk stems from vermilion or cutaneous locations or both. To compare differences in risks of recurrence, metastasis, and death from cSCCs on the vermilion vs cutaneous lip. Retrospective cohort study of 303 patients with 310 primary cSCCs of the lip (138 cutaneous, 172 vermilion) diagnosed between 2000 and 2015 at 2 academic tertiary care centers in Boston, Massachusetts. Development of local recurrence, nodal metastasis, distant metastasis, disease-specific death, and all-cause death. Of the 303 study participants with 310 SCCs of the lip, 153 (50.5%) were men, and 150 (49.5%) were women; median age at diagnosis, 68 years (range, 27-93 years). Outcomes were as follows for vermilion vs cutaneous locations: local recurrence, 6.4% (11 of 172) vs 2.9% (4 of 138); nodal metastasis, 7.6% (13 of 172) vs 1.5% (2 of 138); distant metastasis, 0.6% (1 of 172) vs 0.7% (1 of 138); disease-specific death, 3.5% (6 of 172) vs 2.9% (4 of 138); and all-cause death, 26.7% (46 of 172) vs 29.0% (40 of 138). The difference was statistically significant for nodal metastasis (P = .01). In multivariable analysis, nodal metastasis was associated with vermilion lip location (subhazard ratio, 5.0; 95% CI, 1.1-23.8) and invasion beyond fat (fascia or beyond for vermilion lip) (subhazard ratio, 4.4; 95% CI, 1.3-14.9). The risk of nodal metastasis is 5-fold greater for cSCCs on the vermilion lip compared with those on the cutaneous lip. Squamous cell carcinomas of the cutaneous lip have a nodal metastasis risk similar to cSCCs in general (1.5%). Thus, vermilion involvement appears responsible for the increased risk associated with cSCC of lip. Vermilion involvement may merit radiologic nodal staging and inclusion in future tumor staging, since it was independently associated with higher-risk cSCC of the lip region.

Evolution and Production of Calcareous Nannoplankton During the Cretaceous as Proxies of LIP-induced Oceanic Fertilization, Acidification and Anoxia

NASA Astrophysics Data System (ADS)

Erba, E.; Bottini, C.; Tiraboschi, D.

2008-12-01

Through the Phanerozoic, biota have been intimately linked to Earth's degassing inducing major changes in composition and structure of the ocean-atmosphere system. Emplacement of large igneous provinces (LIPs) has been the primary natural source of atmCO2 with dramatic consequences on climate and ecosystems. During the mid-Cretaceous the Ontong Java-Manihiki and Caribbean Plateaus LIPs are recognized as responsible of pCO2 as high as 2000 ppm. Coeval biocalcification crises occurred in pelagic and neritic settings, suggesting a causal link between high concentrations of carbon dioxide and drops in benthic and planktonic calcifiers' efficiency. Within the oceanic biosphere, calcareous nannoplankton play a key-role as: (1) is widespread and consists of cosmopolitan and endemic taxa; (2) has a 220 My-long evolutionary history; (3) is one the most effective calcite producers; (4) is relevant for the C cycle; (5) is extremely sensitive to environmental variations. Diversity pulses of Cretaceous calcareous nannoplankton are grossly coeval with LIP construction, climate and sea-level changes, variations in ocean structure and composition, suggesting that evolutionary patterns are closely linked to environmental modifications. We explored time-intervals of LIP formation marked by nannoplankton adaptation/evolution, quantifying evolutionary rates, species richness, abundance, calcite production and morphometry. High-resolution investigations of the initial phase of both early Aptian oceanic anoxic event (OAE) 1a and latest Cenomanian OAE 2 pointed out major evolutionary changes, decreases in heavily calcified nannoliths and occurrence of dwarf coccoliths. Nannoplankton calcification crises and dwarfism is here interpreted as forced by rapidly increasing pCO2 during formation of the Ontong Java-Maniniki and Caribbean Plateaus. Alternatively or concurrently, calcification crash and dwarfism might result from enhanced fertility associated to OAE1a and OAE2 regardless of ocean alkalinity. However, such global nutrification episodes must be linked as well to LIP construction via supply of biolimiting metals. Contrary to common reasoning, we stress the fact that emplacement of Cretaceous LIPs did not cause extinctions among calcareous nannoplankton.

Characterization of purified and xerogel immobilized novel lignin peroxidase produced from Trametes versicolor IBL-04 using solid state medium of corncobs.

PubMed

Asgher, Muhammad; Iqbal, Hafiz Muhammad Nasir; Irshad, Muhammad

2012-08-03

Cost-effective production of industrially important enzymes is a key for their successful exploitation on industrial scale. Keeping in view the extensive industrial applications of lignin peroxidase (LiP), this study was performed to purify and characterize the LiP from an indigenous strain of Trametes versicolor IBL-04. Xerogel matrix enzyme immobilization technique was applied to improve the kinetic and thermo-stability characteristics of LiP to fulfil the requirements of the modern enzyme consumer sector of biotechnology. A novel LiP was isolated from an indigenous T. versicolor IBL-04 strain. T. versicolor IBL-04 was cultured in solid state fermentation (SSF) medium of corn cobs and maximum LiP activity of 592 ± 6 U/mL was recorded after five days of incubation under optimum culture conditions. The crude LiP was 3.3-fold purified with specific activity of 553 U/mg after passing through the DEAE-cellulose and Sephadex-G-100 chromatography columns. The purified LiP exhibited a relatively low molecular weight (30 kDa) homogenous single band on native and SDS-PAGE. The LiP was immobilized by entrapping in xerogel matrix of trimethoxysilane (TMOS) and proplytetramethoxysilane (PTMS) and maximum immobilization efficiency of 88.6% was achieved. The free and immobilized LiPs were characterized and the results showed that the free and immobilized LiPs had optimum pH 6 and 5 while optimum temperatures were 60°C and 80°C, respectively. Immobilization was found to enhance the activity and thermo-stability potential of LiP significantly and immobilized LiP remained stable over broad pH and temperature range as compare to free enzyme. Kinetic constants K(m) and V(max) were 70 and 56 μM and 588 and 417 U/mg for the free and immobilized LiPs, respectively. Activity of this novel extra thermo-stable LiP was stimulated to variable extents by Cu(2+), Mn(2+) and Fe(2+) whereas, Cystein, EDTA and Ag(+) showed inhibitory effects. The indigenously isolated white rot fungal strain T. versicolor IBL-04 showed tremendous potential for LiP synthesis in SSF of corncobs in high titters (592 U/mL) than other reported Trametes (Coriolus, Polyporus) species. The results obtained after dual phase characterization suggested xerogel matrix entrapment a promising tool for enzyme immobilization, hyper-activation and stabilization against high temperature and inactivating agents. The pH and temperature optima, extra thermo-stability features and kinetic characteristics of this novel LiP of T. versicolor IBL-04 make it a versatile enzyme for various industrial and biotechnological applications.

Characterization of purified and Xerogel immobilized Novel Lignin Peroxidase produced from Trametes versicolor IBL-04 using solid state medium of Corncobs

PubMed Central

2012-01-01

Background Cost-effective production of industrially important enzymes is a key for their successful exploitation on industrial scale. Keeping in view the extensive industrial applications of lignin peroxidase (LiP), this study was performed to purify and characterize the LiP from an indigenous strain of Trametes versicolor IBL-04. Xerogel matrix enzyme immobilization technique was applied to improve the kinetic and thermo-stability characteristics of LiP to fulfil the requirements of the modern enzyme consumer sector of biotechnology. Results A novel LiP was isolated from an indigenous T. versicolor IBL-04 strain. T. versicolor IBL-04 was cultured in solid state fermentation (SSF) medium of corn cobs and maximum LiP activity of 592 ± 6 U/mL was recorded after five days of incubation under optimum culture conditions. The crude LiP was 3.3-fold purified with specific activity of 553 U/mg after passing through the DEAE-cellulose and Sephadex-G-100 chromatography columns. The purified LiP exhibited a relatively low molecular weight (30 kDa) homogenous single band on native and SDS-PAGE. The LiP was immobilized by entrapping in xerogel matrix of trimethoxysilane (TMOS) and proplytetramethoxysilane (PTMS) and maximum immobilization efficiency of 88.6% was achieved. The free and immobilized LiPs were characterized and the results showed that the free and immobilized LiPs had optimum pH 6 and 5 while optimum temperatures were 60°C and 80°C, respectively. Immobilization was found to enhance the activity and thermo-stability potential of LiP significantly and immobilized LiP remained stable over broad pH and temperature range as compare to free enzyme. Kinetic constants Km and Vmax were 70 and 56 μM and 588 and 417 U/mg for the free and immobilized LiPs, respectively. Activity of this novel extra thermo-stable LiP was stimulated to variable extents by Cu2+, Mn2+ and Fe2+ whereas, Cystein, EDTA and Ag+ showed inhibitory effects. Conclusions The indigenously isolated white rot fungal strain T. versicolor IBL-04 showed tremendous potential for LiP synthesis in SSF of corncobs in high titters (592 U/mL) than other reported Trametes (Coriolus, Polyporus) species. The results obtained after dual phase characterization suggested xerogel matrix entrapment a promising tool for enzyme immobilization, hyper-activation and stabilization against high temperature and inactivating agents. The pH and temperature optima, extra thermo-stability features and kinetic characteristics of this novel LiP of T. versicolor IBL-04 make it a versatile enzyme for various industrial and biotechnological applications. PMID:22862820

Lip Movements for an Unfamiliar Vowel: Mandarin Front Rounded Vowel Produced by Japanese Speakers

ERIC Educational Resources Information Center

Saito, Haruka

2016-01-01

Purpose: The study was aimed at investigating what kind of lip positions are selected by Japanese adult participants for an unfamiliar Mandarin rounded vowel /y/ and if their lip positions are related to and/or differentiated from those for their native vowels. Method: Videotaping and post hoc tracking measurements for lip positions, namely…

Multi-sources data fusion framework for remote triage prioritization in telehealth.

PubMed

Salman, O H; Rasid, M F A; Saripan, M I; Subramaniam, S K

2014-09-01

The healthcare industry is streamlining processes to offer more timely and effective services to all patients. Computerized software algorithm and smart devices can streamline the relation between users and doctors by providing more services inside the healthcare telemonitoring systems. This paper proposes a multi-sources framework to support advanced healthcare applications. The proposed framework named Multi Sources Healthcare Architecture (MSHA) considers multi-sources: sensors (ECG, SpO2 and Blood Pressure) and text-based inputs from wireless and pervasive devices of Wireless Body Area Network. The proposed framework is used to improve the healthcare scalability efficiency by enhancing the remote triaging and remote prioritization processes for the patients. The proposed framework is also used to provide intelligent services over telemonitoring healthcare services systems by using data fusion method and prioritization technique. As telemonitoring system consists of three tiers (Sensors/ sources, Base station and Server), the simulation of the MSHA algorithm in the base station is demonstrated in this paper. The achievement of a high level of accuracy in the prioritization and triaging patients remotely, is set to be our main goal. Meanwhile, the role of multi sources data fusion in the telemonitoring healthcare services systems has been demonstrated. In addition to that, we discuss how the proposed framework can be applied in a healthcare telemonitoring scenario. Simulation results, for different symptoms relate to different emergency levels of heart chronic diseases, demonstrate the superiority of our algorithm compared with conventional algorithms in terms of classify and prioritize the patients remotely.

A Novel Mechanism of Regulating the ATPase VPS4 by Its Cofactor LIP5 and the Endosomal Sorting Complex Required for Transport (ESCRT)-III Protein CHMP5

DOE PAGES

Vild, Cody J.; Li, Yan; Guo, Emily Z.; ...

2015-01-30

Disassembly of the endosomal sorting complex required for transport (ESCRT) machinery from biological membranes is a critical final step in cellular processes that require the ESCRT function. This reaction is catalyzed by VPS4, an AAA-ATPase whose activity is tightly regulated by a host of proteins, including LIP5 and the ESCRT-III proteins. In this paper, we present structural and functional analyses of molecular interactions between human VPS4, LIP5, and the ESCRT-III proteins. The N-terminal domain of LIP5 (LIP5NTD) is required for LIP5-mediated stimulation of VPS4, and the ESCRT-III protein CHMP5 strongly inhibits the stimulation. Both of these observations are distinct frommore » what was previously described for homologous yeast proteins. The crystal structure of LIP5NTD in complex with the MIT (microtubule-interacting and transport)-interacting motifs of CHMP5 and a second ESCRT-III protein, CHMP1B, was determined at 1 Å resolution. It reveals an ESCRT-III binding induced moderate conformational change in LIP5NTD, which results from insertion of a conserved CHMP5 tyrosine residue (Tyr 182) at the core of LIP5NTD structure. Finally, mutation of Tyr 182 partially relieves the inhibition displayed by CHMP5. Together, these results suggest a novel mechanism of VPS4 regulation in metazoans, where CHMP5 functions as a negative allosteric switch to control LIP5-mediated stimulation of VPS4.« less

Comparison of upper and lower lip muscle activity between stutterers and fluent speakers.

PubMed

de Felício, Cláudia Maria; Freitas, Rosana Luiza Rodrigues Gomes; Vitti, Mathias; Regalo, Simone Cecilio Hallak

2007-08-01

There is a widespread clinical view that stuttering is associated with high levels of muscles activity. The proposal of this research was to compare stutterers and fluent speakers with respect to the electromyographic activity of the upper and lower lip muscles. Ten individuals who stutter and 10 fluent speakers (control group) paired by gender and age were studied (mean age: 13.4 years). Groups were defined by the speech sample analysis of the ABFW-Language Test. A K6-I EMG (Myo-tronics Co., Seattle, WA, USA) with double disposable silver electrodes (Duotrodes, Myo-tronics Co., Seattle, WA) being used in order to analyze lip muscle activity. The clinical conditions investigated were movements during speech, orofacial non-speech tasks, and rest. Electromyographic data were normalized by lip pursing activity. The non-parametric Mann-Whitney test was used for the comparison of speech fluency profile, and the Student t-test for independent samples for group comparison regarding electromyographic data. There was a statistically significant difference between groups regarding speech fluency profile and upper lip activity in the following conditions: lip lateralization to the right and to the left and rest before exercises (P<0.05). There was no significant difference between groups regarding lower lip activity (P>0.05). The EMG activity of the upper lip muscle in the group with stuttering was significantly lower than in the control group in some of the clinical conditions analyzed. There was no significant difference between groups regarding the lower lip muscle. The subjects who stutter did not present higher levels of muscle activity in lip muscles than fluent speakers.

Role of manganese peroxidases and lignin peroxidases of Phanerochaete chrysosporium in the decolorization of kraft bleach plant effluent.

PubMed

Michel, F C; Dass, S B; Grulke, E A; Reddy, C A

1991-08-01

The role of lignin peroxidases (LIPs) and manganese peroxidases (MNPs) of Phanerochaete chrysosporium in decolorizing kraft bleach plant effluent (BPE) was investigated. Negligible BPE decolorization was exhibited by a per mutant, which lacks the ability to produce both the LIPs and the MNPs. Also, little decolorization was seen when the wild type was grown in high-nitrogen medium, in which the production of LIPs and MNPs is blocked. A lip mutant of P. chrysosporium, which produces MNPs but not LIPs, showed about 80% of the activity exhibited by the wild type, indicating that the MNPs play an important role in BPE decolorization. When P. chrysosporium was grown in a medium with 100 ppm of Mn(II), high levels of MNPs but no LIPs were produced, and this culture also exhibited high rates of BPE decolorization, lending further support to the idea that MNPs play a key role in BPE decolorization. When P. chrysosporium was grown in a medium with no Mn(II), high levels of LIPs but negligible levels of MNPs were produced and the rate and extent of BPE decolorization by such cultures were quite low, indicating that LIPs play a relatively minor role in BPE decolorization. Furthermore, high rates of BPE decolorization were seen on days 3 and 4 of incubation, when the cultures exhibit high levels of MNP activity but little or no LIP activity. These results indicate that MNPs play a relatively more important role than LIPs in BPE decolorization by P. chrysosporium.

One-Step Partially Purified Lipases (ScLipA and ScLipB) from Schizophyllum commune UTARA1 Obtained via Solid State Fermentation and Their Applications.

PubMed

Kam, Yew Chee; Woo, Kwan Kit; Ong, Lisa Gaik Ai

2017-12-08

Lipases with unique characteristics are of value in industrial applications, especially those targeting cost-effectiveness and less downstream processes. The aims of this research were to: (i) optimize the fermentation parameters via solid state fermentation (SSF); and (ii) study the performance in hydrolysis and esterification processes of the one-step partially purified Schizophyllum commune UTARA1 lipases. Lipase was produced by cultivating S. commune UTARA1 on sugarcane bagasse (SB) with used cooking oil (UCO) via SSF and its production was optimized using Design-Expert ® 7.0.0. Fractions 30% ( Sc LipA) and 70% ( Sc LipB) which contained high lipase activity were obtained by stepwise (NH₄)₂SO₄ precipitation. Crude fish oil, coconut oil and butter were used to investigate the lipase hydrolysis capabilities by a free glycerol assay. Results showed that Sc LipA has affinities for long, medium and short chain triglycerides, as all the oils investigated were degraded, whereas Sc LipB has affinities for long chain triglycerides as it only degrades crude fish oil. During esterification, Sc LipA was able to synthesize trilaurin and triacetin. Conversely, Sc LipB was specific towards the formation of 2-mono-olein and triacetin. From the results obtained, it was determined that Sc LipA and Sc LipB are sn -2 regioselective lipases. Hence, the one-step partial purification strategy proved to be feasible for partial purification of S. commune UTARA1 lipases that has potential use in industrial applications.

An Approach for Integrating the Prioritization of Functional and Nonfunctional Requirements

PubMed Central

Dabbagh, Mohammad; Lee, Sai Peck

2014-01-01

Due to the budgetary deadlines and time to market constraints, it is essential to prioritize software requirements. The outcome of requirements prioritization is an ordering of requirements which need to be considered first during the software development process. To achieve a high quality software system, both functional and nonfunctional requirements must be taken into consideration during the prioritization process. Although several requirements prioritization methods have been proposed so far, no particular method or approach is presented to consider both functional and nonfunctional requirements during the prioritization stage. In this paper, we propose an approach which aims to integrate the process of prioritizing functional and nonfunctional requirements. The outcome of applying the proposed approach produces two separate prioritized lists of functional and non-functional requirements. The effectiveness of the proposed approach has been evaluated through an empirical experiment aimed at comparing the approach with the two state-of-the-art-based approaches, analytic hierarchy process (AHP) and hybrid assessment method (HAM). Results show that our proposed approach outperforms AHP and HAM in terms of actual time-consumption while preserving the quality of the results obtained by our proposed approach at a high level of agreement in comparison with the results produced by the other two approaches. PMID:24982987

An approach for integrating the prioritization of functional and nonfunctional requirements.

PubMed

Dabbagh, Mohammad; Lee, Sai Peck

2014-01-01

Due to the budgetary deadlines and time to market constraints, it is essential to prioritize software requirements. The outcome of requirements prioritization is an ordering of requirements which need to be considered first during the software development process. To achieve a high quality software system, both functional and nonfunctional requirements must be taken into consideration during the prioritization process. Although several requirements prioritization methods have been proposed so far, no particular method or approach is presented to consider both functional and nonfunctional requirements during the prioritization stage. In this paper, we propose an approach which aims to integrate the process of prioritizing functional and nonfunctional requirements. The outcome of applying the proposed approach produces two separate prioritized lists of functional and non-functional requirements. The effectiveness of the proposed approach has been evaluated through an empirical experiment aimed at comparing the approach with the two state-of-the-art-based approaches, analytic hierarchy process (AHP) and hybrid assessment method (HAM). Results show that our proposed approach outperforms AHP and HAM in terms of actual time-consumption while preserving the quality of the results obtained by our proposed approach at a high level of agreement in comparison with the results produced by the other two approaches.

Lung Injury Prediction Score Is Useful in Predicting Acute Respiratory Distress Syndrome and Mortality in Surgical Critical Care Patients

PubMed Central

Bauman, Zachary M.; Gassner, Marika Y.; Coughlin, Megan A.; Mahan, Meredith; Watras, Jill

2015-01-01

Background. Lung injury prediction score (LIPS) is valuable for early recognition of ventilated patients at high risk for developing acute respiratory distress syndrome (ARDS). This study analyzes the value of LIPS in predicting ARDS and mortality among ventilated surgical patients. Methods. IRB approved, prospective observational study including all ventilated patients admitted to the surgical intensive care unit at a single tertiary center over 6 months. ARDS was defined using the Berlin criteria. LIPS were calculated for all patients and analyzed. Logistic regression models evaluated the ability of LIPS to predict development of ARDS and mortality. A receiver operator characteristic (ROC) curve demonstrated the optimal LIPS value to statistically predict development of ARDS. Results. 268 ventilated patients were observed; 141 developed ARDS and 127 did not. The average LIPS for patients who developed ARDS was 8.8 ± 2.8 versus 5.4 ± 2.8 for those who did not (p < 0.001). An ROC area under the curve of 0.79 demonstrates LIPS is statistically powerful for predicting ARDS development. Furthermore, for every 1-unit increase in LIPS, the odds of developing ARDS increase by 1.50 (p < 0.001) and odds of ICU mortality increase by 1.22 (p < 0.001). Conclusion. LIPS is reliable for predicting development of ARDS and predicting mortality in critically ill surgical patients. PMID:26301105

PVR/CD155 Ala67Thr Mutation and Cleft Lip/Palate.

PubMed

Vieira, Alexandre R; Letra, Ariadne; Silva, Renato M; Granjeiro, Jose M; Shimizu, Takehiko; Poletta, Fernando A; Mereb, Juan C; Castilla, Eduardo E; Orioli, Iêda M

2018-03-01

The 19q13 locus has been linked to cleft lip and palate by our group and independently by others. Here we fine mapped the region in an attempt to identify an etiological variant that can explain cleft lip and palate occurrence. A total of 2739 individuals born with cleft lip and palate, related to individuals born with cleft lip and palate, and unrelated were studied. We used linkage and association approaches to fine map the interval between D19S714 and D19S433 and genotypes were defined by the use of TaqMan chemistry. We confirmed our previous findings that markers in PVR/CD155 are associated with cleft lip and palate. We studied the mutation Ala67Thr further and calculated its penetrance. We also attempted to detect PVR/CD155 expression in human whole saliva. Our results showed that markers in PVR/CD155 are associated with cleft lip and palate and the penetrance of the Ala67Thr is very low (between 1% and 5%). We could not detect PVR/CD155 expression in adult human whole saliva and PVR/CD155 possibly interacts with maternal infection to predispose children to cleft lip only.

Incidence angle bounds for lip flow separation of three 13.97-centimeter-diameter inlets

NASA Technical Reports Server (NTRS)

Luidens, R. W.; Abbott, J. M.

1976-01-01

Low speed wind tunnel tests were conducted to establish a procedure for determining inlet-lip flow separation and to make preliminary examination of the incidence angle bounds for lip flow separation on inlets intended for the nacelles of STOL (short takeoff and landing) aircraft. Three inlets were tested. Two of the inlets had short centerbodies with lower lip area contraction ratios of 1.30 and 1.44. The third inlet had a cylindrical centerbody extended forward into the inlet throat with a lower lip area contraction ratio of 1.44. The inlets were sized to fit a 13.97 centimeter-diameter fan. For inlet throat Mach numbers less than about 0.43, the lip flow separation angle was increased by either increasing the ratio of throat velocity to freestream velocity (Vt/Vo) or by increasing the lower lip area contraction ratio. For throat Mach numbers greater than a certain value (ranging from 0.43 to 0.52), increasing throat Mach number in some cases resulted in a decrease in the lip flow separation angle. Extending a cylindrical centerbody into the inlet throat increased the flow separation angle for nearly all values of Vt/Vo.

Evaluating wildland fire danger and prioritizing vegetation and fuels treatments

Treesearch

Paul F. Hessburg; Keith M. Reynolds; Robert E. Keane; Kevin M. James; R. Brion Salter

2010-01-01

We present a prototype decision support system for evaluating wild-land fire danger and prioritizing subwatersheds for vegetation and fuels treatment. We demonstrate the use of the system with an example from the Rocky Mountain region in the State of Utah, which represents a planning area of about 4.8 million ha and encompasses 575 complete subwatersheds. In a logic...

A Quantitative and Novel Approach to the Prioritization of Zoonotic Diseases in North America: A Public Perspective

PubMed Central

Ng, Victoria; Sargeant, Jan M.

2012-01-01

Background Zoonoses account for over half of all communicable diseases causing illness in humans. As there are limited resources available for the control and prevention of zoonotic diseases, a framework for their prioritization is necessary to ensure resources are directed into those of highest importance. Although zoonotic outbreaks are a significant burden of disease in North America, the systematic prioritization of zoonoses in this region has not been previously evaluated. Methodology/Principal Findings This study describes the novel use of a well-established quantitative method, conjoint analysis (CA), to identify the relative importance of 21 key characteristics of zoonotic diseases that can be used for their prioritization in Canada and the US. Relative importance weights from the CA were used to develop a point-scoring system to derive a recommended list of zoonoses for prioritization in Canada and the US. Over 1,500 participants from the general public were recruited to complete the online survey (761 from Canada and 778 from the US). Hierarchical Bayes models were fitted to the survey data to derive CA-weighted scores. Scores were applied to 62 zoonotic diseases of public health importance in Canada and the US to rank diseases in order of priority. Conclusions/Significance This was the first study to describe a systematic and quantitative approach to the prioritization of zoonoses in North America involving public participants. We found individuals with no prior knowledge or experience in prioritizing zoonoses were capable of producing meaningful results using CA as a novel quantitative approach to prioritization. More similarities than differences were observed between countries suggesting general agreement in disease prioritization between Canadians and Americans. We demonstrate CA as a potential tool for the prioritization of zoonoses; other prioritization exercises may also consider this approach. PMID:23133639

Modeling Personalized Email Prioritization: Classification-based and Regression-based Approaches

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoo S.; Yang, Y.; Carbonell, J.

2011-10-24

Email overload, even after spam filtering, presents a serious productivity challenge for busy professionals and executives. One solution is automated prioritization of incoming emails to ensure the most important are read and processed quickly, while others are processed later as/if time permits in declining priority levels. This paper presents a study of machine learning approaches to email prioritization into discrete levels, comparing ordinal regression versus classier cascades. Given the ordinal nature of discrete email priority levels, SVM ordinal regression would be expected to perform well, but surprisingly a cascade of SVM classifiers significantly outperforms ordinal regression for email prioritization. Inmore » contrast, SVM regression performs well -- better than classifiers -- on selected UCI data sets. This unexpected performance inversion is analyzed and results are presented, providing core functionality for email prioritization systems.« less

Tidal wetlands of the Yaquina and Alsea River estuaries, Oregon: Geographic Information Systems layer development and recommendations for National Wetlands Inventory revisions

USGS Publications Warehouse

Brophy, Laura S.; Reusser, Deborah A.; Janousek, Christopher N.

2013-01-01

Geographic Information Systems (GIS) layers of current, and likely former, tidal wetlands in two Oregon estuaries were generated by enhancing the 2010 National Wetlands Inventory (NWI) data with expert local field knowledge, Light Detection and Ranging-derived elevations, and 2009 aerial orthophotographs. Data were generated for two purposes: First, to enhance the NWI by recommending revised Cowardin classifications for certain NWI wetlands within the study area; and second, to generate GIS data for the 1999 Yaquina and Alsea River Basins Estuarine Wetland Site Prioritization study. Two sets of GIS products were generated: (1) enhanced NWI shapefiles; and (2) shapefiles of prioritization sites. The enhanced NWI shapefiles contain recommended changes to the Cowardin classification (system, subsystem, class, and/or modifiers) for 286 NWI polygons in the Yaquina estuary (1,133 acres) and 83 NWI polygons in the Alsea estuary (322 acres). These enhanced NWI shapefiles also identify likely former tidal wetlands that are classified as upland in the current NWI (64 NWI polygons totaling 441 acres in the Yaquina estuary; 16 NWI polygons totaling 51 acres in the Alsea estuary). The former tidal wetlands were identified to assist strategic planning for tidal wetland restoration. Cowardin classifications for the former tidal wetlands were not provided, because their current hydrology is complex owing to dikes, tide gates, and drainage ditches. The scope of this project did not include the field evaluation that would be needed to determine whether the former tidal wetlands are currently wetlands, and if so, determine their correct Cowardin classification. The prioritization site shapefiles contain 49 prioritization sites totaling 2,177 acres in the Yaquina estuary, and 39 prioritization sites totaling 1,045 acres in the Alsea estuary. The prioritization sites include current and former (for example, diked) tidal wetlands, and provide landscape units appropriate for basin-scale wetland restoration and conservation action planning. Several new prioritization sites (not included in the 1999 prioritization) were identified in each estuary, consisting of NWI polygons formerly classified as nontidal wetland or upland. The GIS products of this project improve the accuracy and utility of the NWI data, and provide useful tools for estuarine resource management.

Fatigue testing of metric bolts fitted with lip-type nuts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dragoni, E.

This paper addresses the effect of the external shape of lip-type nuts on the fatigue strength of commercial M10 bolts loaded in tension. Evolving from the standard configuration, six nut geometries are compared, characterized by lips of different shape (cylindrical, tapered or both) and length. Testing and statistical treatment of the data are performed in accordance with a JSME standard involving 14 specimens for each geometry. Within the class of merely cylindrical lips, only limited advantages over the standard assembly are detected. In particular, the bolt strength remains mostly unaffected by lengthening of the lip beyond one third of themore » nut height. Conversely, tapering of the lip end so as to thin its wall around the entry section of the bolt results in substantial improvements. In this case, the strength increase is roughly proportional to the taper length. Adoption of a tapered lip covering two thirds of the nut height enhances the bolt strength by about one fourth with respect to the standard geometry.« less

Evaluation of Teeth Development in Unilateral Cleft Lip and Palate Patients in Mixed Dentition by Using Medical Image Control Systems.

PubMed

Gezgin, O; Botsali, M S

2018-02-01

The aim of this study was to evaluate the crown and root development in patients with cleft lip and palate using medical software programmes. In our study, 25 patients with mixed dentition unilateral cleft lip and palate were examined with cone-beam computed tomography (CBCT). The tomography images obtained as high resolution medical images on the computer control system (MIMICS 15.0, Materialise, Leuven, Belgium and SOLIDWORKS 2014 Premium, Concord, Massachusetts) were converted to three-dimensional volumetric images. These three-dimensional images of the cleft on the sides of the teeth in the crown and root growth were measured by mesiodistal length and crown/root rate with volume and area. These measurements were compared with a control group of healthy individuals. There were no statistically significant differences in the volume, surface area and MD size, crown/root ratio of central incisor, canine, first premolar and second premolar teeth within defect, and healthy teeth. However, it was found that there was a significant difference between the volume, surface area and MD size, and crown/root ratio of the lateral teeth in each group. In particular, among patients with cleft lip and palate, on obtaining a solid model of the tooth structure by using these programs, tooth development can be examined in more detail, diagnosis can be made more reliable, as well as in treatment planning. We believe that these programs can be used to resolve certain limitations such as a lack of an application to be used in routine dental treatment and in particular the need to do more study.

Management of an infant with cleft lip and palate with phocomelia in dental practice.

PubMed

Muthu, M S

2000-12-01

Cleft lip and palate is a severe birth defect occurring approximately one in 800-1000 newborn infants. The incidence varies widely among races. Cleft lip and palate together account for approximately 50% of all cases whereas isolated cleft lip and isolated cleft palate occur in about 25% of cases. Many of these congenital anomalies appear to be genetically determined though the majority are of unknown causes or teratogenic influences. Presented here is a 3 day old infant with bilateral cleft lip and palate and phocomelia for whom a feeding obturator was made and delivered to facilitate feeding.

47 CFR 10.410 - Prioritization.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 47 Telecommunication 1 2012-10-01 2012-10-01 false Prioritization. 10.410 Section 10.410 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL COMMERCIAL MOBILE ALERT SYSTEM Alert Message... required to transmit Imminent Threat Alerts and AMBER Alerts on a first in-first out (FIFO) basis. ...

Integrated prioritization method for active and passive highway-rail crossings.

DOT National Transportation Integrated Search

2013-01-01

This two-year research project developed a prioritization system for highway-rail at-grade crossings that addressed the following major concerns: (1) warrants to identify low-volume, passive crossings with risk factors; (2) a broader priority index t...

Endocrine Profiling and Prioritization Using ToxCast Assays

EPA Science Inventory

The U.S. EPA's Endocrine Disruptor Screening Program (EDSP) is charged with screening pesticide chemicals and environmental contaminants for their potential to affect the endocrine systems of humans and wildlife (http://www.epa.gov/endo/). The prioritization of chemicals for test...

Thymoquinone, an active constituent of Nigella sativa seeds, binds with bilirubin and protects mice from hyperbilirubinemia and cyclophosphamide-induced hepatotoxicity.

PubMed

Laskar, Amaj A; Khan, Masood A; Rahmani, Arshad H; Fatima, Sana; Younus, Hina

2016-08-01

Some reports indicate that thymoquinone (TQ), the main constituent of Nigella sativa seeds, is hepatoprotective. The aim of this study was to determine whether TQ is able to bind directly to bilirubin, and whether TQ or liposomal formulation of TQ (Lip-TQ) can reduce cyclophosphamide (CYP)-induced liver toxicity, serum bilirubin level in mice. The binding of TQ with bilirubin was studied by UV-VIS, fluorescence and Near-UV CD spectroscopy. Inhibition of binding of bilirubin to erythrocytes by TQ was also examined. To increase the in vivo efficacy, Lip-TQ was prepared and used against CYP-induced toxicity. The protective role of TQ or Lip-TQ against CYP-induced toxicity was assessed by determining the liver function parameters, the levels of superoxide dismutase (SOD) and catalase (CAT), and histological studies. It was found that TQ binds to bilirubin and significantly inhibits the binding of bilirubin to erythrocytes. Lip-TQ (10 mg/kg) significantly reduced the levels of aspartate transaminase (AST) from 254 ± 48 to 66 ± 18 IU/L (P < 0.001), alanine transaminase (ALT) from 142 ± 28 to 47.8 ± 16 IU/L (P < 0.05) and serum bilirubin from 2.8 ± 0.50 to 1.24 ± 0.30 mg/dl (P < 0.05). Treatment with Lip-TQ reduced the CYP-induced inflammation and hemorrhage in liver tissues. Moreover, treatment with free or Lip-TQ protected the activity of SOD and CAT in CYP-injected mice. Therefore, TQ can reduce the level of bilirubin in systemic circulation in disease conditions that lead to hyperbilirubinemia and liver toxicity and hence may be used as a supplement in the treatment of liver ailments. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Articulation disorders and duration, severity and L-dopa dosage in idiopathic Parkinson's disease.

PubMed

Pawlukowska, Wioletta; Gołąb-Janowska, Monika; Safranow, Krzysztof; Rotter, Iwona; Amernik, Katarzyna; Honczarenko, Krystyna; Nowacki, Przemysław

2015-01-01

Parkinson's disease (PD) is one of the most common diseases of the central nervous system (CNS). It is frequently heralded by speech disturbances, which are one of its first symptoms. The aim of this paper is to share our own experience concerning the correlation between the severity of speech disorders and the PD duration, its severity and the intake of L-dopa. The research included 93 patients with idiopathic PD, aged 26-86 years (mean age 65.1 years). Participants were examined neurologically according to the Unified Parkinson's Disease Rating Scale (UPDRS) and the Hoehn and Yahr Scale. They were also assessed by Frenchay Dysarthria Assessment. Considerable and severe disorders were concurrent with impairments in the mobility of the tongue, lips, the jaw as well as the pitch and loudness of the voice. The strongest correlation but at a moderate level was found to exist between the severity of labial impairment, voice loudness and the length of the disease. There was also a positive correlation between lip movement while the motions were being diversified, lip arrangement while speaking and the intake of L-dopa. As PD progresses a significant decline in vocal articulation can be observed, which is due to reduced mobility within the lips and the jaw. Exacerbation of articulation disorders resulting from progression of the disease does not materially influence the UPDRSS scores. L-dopa has been found to positively affect the mobility of the lips while the patient is speaking and their arrangement at rest. Copyright © 2015 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Validity of a Manual Soft Tissue Profile Prediction Method Following Mandibular Setback Osteotomy

PubMed Central

Kolokitha, Olga-Elpis

2007-01-01

Objectives The aim of this study was to determine the validity of a manual cephalometric method used for predicting the post-operative soft tissue profiles of patients who underwent mandibular setback surgery and compare it to a computerized cephalometric prediction method (Dentofacial Planner). Lateral cephalograms of 18 adults with mandibular prognathism taken at the end of pre-surgical orthodontics and approximately one year after surgery were used. Methods To test the validity of the manual method the prediction tracings were compared to the actual post-operative tracings. The Dentofacial Planner software was used to develop the computerized post-surgical prediction tracings. Both manual and computerized prediction printouts were analyzed by using the cephalometric system PORDIOS. Statistical analysis was performed by means of t-test. Results Comparison between manual prediction tracings and the actual post-operative profile showed that the manual method results in more convex soft tissue profiles; the upper lip was found in a more prominent position, upper lip thickness was increased and, the mandible and lower lip were found in a less posterior position than that of the actual profiles. Comparison between computerized and manual prediction methods showed that in the manual method upper lip thickness was increased, the upper lip was found in a more anterior position and the lower anterior facial height was increased as compared to the computerized prediction method. Conclusions Cephalometric simulation of post-operative soft tissue profile following orthodontic-surgical management of mandibular prognathism imposes certain limitations related to the methods implied. However, both manual and computerized prediction methods remain a useful tool for patient communication. PMID:19212468

Validity of a manual soft tissue profile prediction method following mandibular setback osteotomy.

PubMed

Kolokitha, Olga-Elpis

2007-10-01

The aim of this study was to determine the validity of a manual cephalometric method used for predicting the post-operative soft tissue profiles of patients who underwent mandibular setback surgery and compare it to a computerized cephalometric prediction method (Dentofacial Planner). Lateral cephalograms of 18 adults with mandibular prognathism taken at the end of pre-surgical orthodontics and approximately one year after surgery were used. To test the validity of the manual method the prediction tracings were compared to the actual post-operative tracings. The Dentofacial Planner software was used to develop the computerized post-surgical prediction tracings. Both manual and computerized prediction printouts were analyzed by using the cephalometric system PORDIOS. Statistical analysis was performed by means of t-test. Comparison between manual prediction tracings and the actual post-operative profile showed that the manual method results in more convex soft tissue profiles; the upper lip was found in a more prominent position, upper lip thickness was increased and, the mandible and lower lip were found in a less posterior position than that of the actual profiles. Comparison between computerized and manual prediction methods showed that in the manual method upper lip thickness was increased, the upper lip was found in a more anterior position and the lower anterior facial height was increased as compared to the computerized prediction method. Cephalometric simulation of post-operative soft tissue profile following orthodontic-surgical management of mandibular prognathism imposes certain limitations related to the methods implied. However, both manual and computerized prediction methods remain a useful tool for patient communication.

Lip moisturizer poisoning

MedlinePlus

... poisoning URL of this page: //medlineplus.gov/ency/article/002723.htm Lip moisturizer poisoning To use the sharing features on this page, please enable JavaScript. This poisoning results from eating or swallowing lip ...

Oral Mucosal Lesions: Oral Cavity Biology-Part I.

PubMed

Sehgal, Virendra N; Syed, Nazim Hussain; Aggarwal, Ashok; Sehgal, Shruti

2015-01-01

It is important to evaluate the background of oral cavity biology to define morphologic abrasions in oral mucosa following a host of local and/ or systemic disorders. The oral cavity is not only the beginning of the digestive system, but it also plays a significant role in communication; the voice (although the voice is produced in the throat), tongue, lips, and jaw are its essential components to produce the range of sounds. The vestibule and the oral cavity are its major parts, and are usually moist. The lips and the teeth are in approximation, marking its start up. The anatomy of the oral cavity in brief has been reviewed in right prospective for disease related changed morphology, thus facilitating interpretation.

Unilateral cleft lip and palate: Simultaneous early repair of the nose, anterior palate and lip

PubMed Central

Laberge, Louise Caouette

2007-01-01

Unilateral cleft lip and palate is a defect involving the lip, nose and maxilla. These structures are inter-related, and simultaneous early correction of all the aspects of the defect is necessary to obtain a satisfactory result that will be maintained with growth. The surgical technique combining various procedures is presented and compared with previously published reports. PMID:19554125

Phase I/II Study of Postoperative Adjuvant Chemoradiation for Advanced-Stage Cutaneous Squamous Cell Carcinoma of the Head and Neck (cSCCHN)

ClinicalTrials.gov

2014-11-17

Recurrent Skin Cancer; Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Squamous Cell Carcinoma of the Skin; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Lip and Oral Cavity

Spillage and flux density on a receiver aperture lip. [of solar thermal collector

NASA Technical Reports Server (NTRS)

Jaffe, L. D.

1985-01-01

In a dish-type point-focusing solar thermal collector, the spillage and the flux density on the receiver aperture lip are related in a very simple way, if the aperture is circular and centered on the optical axis. Specifically, the flux density on the lip is equal to the spillage times the peak flux density in the plane of the lip.

Cleft Lip and Palate Repair.

PubMed

Gatti, Gian Luca; Freda, Nicola; Giacomina, Alessandro; Montemagni, Marina; Sisti, Andrea

2017-11-01

Cleft lip and palate is the most frequent congenital craniofacial deformity. In this article, the authors describe their experience with cleft lip and palate repair. Data regarding patients presenting with primary diagnosis of cleft lip and/or palate, between 2009 and 2015, were reviewed. Details including demographics, type of cleft, presence of known risk factors, surgical details, and follow-up visits were collected. Documented complications were reported. Caregivers' satisfaction was assessed with a survey. The survey used to assess satisfaction with cleft-related features was based on the cleft evaluation profile (CEP). In addition, 4 assessors used visual analog scale (VAS) to assess the aesthetic satisfaction. Seven hundred fifty-two patients with primary diagnosis of cleft lip and/or palate underwent surgical correction at "S. Chiara" Hospital, 432 (57.45%) male and 320 (42.55%) female. The most common cleft types in our study were incomplete cleft palate (152 patients) and left unilateral complete cleft lip and palate (152 patients). Associated syndromes were found in 46 patients (6.12%). Cleft lip was repaired using a modified Tennison-Randall technique when the defect was unilateral, whereas a modified Mulliken technique was used for bilateral cleft lip. Cleft palate was repaired using the Bardach technique or Von Langenbeck technique at 5 to 6 months of age. Cleft lip and palate was repaired in several surgical steps. In total, complications were reported in 81 of 752 patients (14.16%). Average fathers' satisfaction score assessed using CEP was 4.5 (lip), 4.8 (nose), 4.7 (teeth), 4.8 (bite), 4.2 (breathing), 4.6 (profile). Average mothers' satisfaction score assessed using CEP was 4.3 (lip), 4.6 (nose), 4.4 (teeth), 4.5 (bite), 4.1 (breathing), 4.4 (profile). Average level of aesthetic satisfaction, assessed using VAS, was 8.7 (fathers), 8.1 (mothers), 7.9 (lay person), and 8.0 (senior cleft surgeon). The multidisciplinary management of children with oral cleft determinated good results, in terms of satisfaction and aesthetic appearance. From our experience, periosteoplasty and lip-adhesion are key surgical techniques.

Cadaveric Assessment of Lip Injections: Locating the Serious Threats.

PubMed

Tansatit, Tanvaa; Apinuntrum, Prawit; Phetudom, Thavorn

2017-04-01

Lip augmentation could be a possible cause of blindness following filler injections. This study evaluated the risk by simulating clinical scenarios of marginal injections to the upper and lower lips and then evaluated the risk of vascular injuries. A 22G cannula was inserted bilaterally along the wet-dry junction of the upper and lower lip margins in fifteen cadavers, and then both lips were dissected to verify possible injuries to the superior and inferior labial arteries. The position of the labial arteries in the vermilion zone was documented to determine the appropriate injection technique. In the marginal injections to the lips, arterial injuries occurred at the medial segment of the vermilion zone of both the upper and lower lips, at the terminal part of the labial arteries or a distal branch. Considering arterial anatomy, the upper lip has a higher chance of arterial injury than the lower lip. The cannula should not be inserted in the submucosa as it is recommended to evert the vermilion because both the superior and inferior labial arteries are located in the submucosa of the medial and middle segments of the vermilion in all specimens. Awareness of the possibility of vascular injury is necessary during injections of the medial segments of the vermilion of the lips. Vermilion border and marginal injections are recommended for safe and effective lip augmentation. Deep injection around the oral commissure and submucosal injection of the medial and middle segments of the vermilion zone are prohibited because of the high risk of arterial injury. This journal requires that authors assign a level of evidence to each submission to which Evidence-Based Medicine rankings are applicable. This excludes Review Articles, Book Reviews, and manuscripts that concern Basic Science, Animal Studies, Cadaver Studies, and Experimental Studies. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266.

Since 200 Ma Nearly all Large Igneous Provinces (LIPS) Have Been Emplaced Above Deep Mantle Low Velocity Volumes (DMLVVS)

NASA Astrophysics Data System (ADS)

Burke, K.

2001-12-01

Restoration, by plate rotation, of the 25 LIPs (Table 1 of Coffin and Eldholm in AGU Monog.121) that have erupted at the Earth's surface since 200 Ma to their original eruption sites shows that at their times of eruption 24 of the LIPs lay above one or other of the "Sub-African" and "Sub-Pacific" DMLVVs (Garnero:AREPS 2000 Fig.5). The Columbia River LIP is the exception. This concentration of LIPs over DMLVVs is indicative of a possible role for DMLVVs in LIP formation. Persistence of an association of LIPs with DMLVVs for 200 My indicates that DMLVVs are long-lived mantle features consistent with the suggestion that no refrigerating subducted slabs have penetrated the two DMLVVs during the past 200 My. The two LIP provinces provide complementary information about how DMLVVs may interact with the Earth's surface. That in the Pacific, where plate motion has been fast, is better for revealing short-term changes. By contrast plate motion has generally been slow over the "Sub-African" DMLVV and there the longer-term record of interaction with the surface is better. That record, which extends back as far as 200 Ma, includes evidence of (1) A DMLVV role in the break-up of the Super-continent of Pangea, with LIP formation, intra-continental rifting and the establishment of new plate boundaries.(2) The construction of plate-wide Basin and Swell topography on the African plate during the past 30 My.(3) The eruption of 9 LIPs into pre-existing intra-continental rifts, which I suggest has been a consequence of "upside-down drainage"along the base of the lithosphere (Cf. Sleep 1997) and (4) The eruption of as many as 7 LIPs within a 10 M sq.km. region around Kerguelen

[Colorimetric investigation of normal tongue and lip colors from 516 healthy adults by visible reflection spectrum].

PubMed

Zeng, Chang-chun; Yang, Li; Xu, Ying; Liu, Pei-pei; Guo, Shi-jun; Liu, Song-hao

2011-09-01

Using the data from normal tongue and lip colors of normal people which were collected by the visible reflection spectrum, we analyzed the colorimetric parameters of tongue and lip colors. In this study, 516 healthy students aging from 19 to 26 from the colleges and universities of Guangdong Province of China were taken as research subjects. After collecting the data of tongue and lip colors of the 516 subjects using visible reflectance spectroscopy, CIE XYZ tristimulus values as defined by the International Commission on Illumination in 1964 were calculated, and the colorimetric parameters of the normal tongue and lip colors were obtained, such as the CIE 1964 chromaticity coordinate, brightness, dominant wavelength and excitation purity. The results of CIE 1964 chromaticity diagram calculated on the visible reflection spectrum showed that the normal tongue color chromaticity coordinate x(10) was 0.341 3±0.008 5 and y(10) was 0.332 6±0.005 1, and the normal lip color chromaticity coordinate x(10) was 0.357 7±0.009 2 and y(10) was 0.338 3±0.005 7; the brightness Y values of the normal tongue color and lip colors were 17.96±3.78 and 19.78±3.72, the dominant wavelength values of the normal tongue color and lip color were (626.3±51.6) nm and (600.4±18.2) nm, and the excitation purity values of the normal tongue color and lip color were 0.083±0.031 and 0.144±0.036, respectively. Application of the visible reflection spectrum is a standard way to collect colorimetric data for inspection of the complexion. The investigation of chromaticity coordinates, brightness, dominant wavelength and excitation purity of the normal tongue and lip colors may offer the basic reference for diagnosing morbid complexion on the tongue and lip colors in traditional Chinese medicine.

Development of speech motor control: lip movement variability.

PubMed

Schötz, Susanne; Frid, Johan; Löfqvist, Anders

2013-06-01

This study examined variability of lip movements across repetitions of the same utterance as a function of age in Swedish speakers. The specific purpose was to extend earlier findings by examining variability in both phase and amplitude. Subjects were 50 typically developed native Swedish children and adults (28 females, 22 males, aged 5 to 31 yr). Lip movements were recorded during 15 to 20 repetitions of a short Swedish phrase using three-dimensional articulography. After correction for head movements, the kinematic records were expressed in a maxilla-based coordinate system. Movement onset and offset of the utterance were identified using kinematic landmarks. The Euclidean distance between receivers on the upper and lower lips was calculated and subjected to functional data analysis to assess both phase and amplitude variability. Results show a decrease in both indices as a function of age, with a greater reduction of amplitude variability. There was no difference between males and females for either index. The two indices were moderately correlated with each other, suggesting that they capture different aspects of speech production. Utterance duration also decreased with age, but variability was unrelated to duration. The standard deviation of utterance duration also decreased with age. The present results thus suggest that age related changes in speech motor control continue up until 30 years of age.

Cleft lip and palate in context: Learning from, and adding to, the sociological literature on long-term conditions.

PubMed

Abualfaraj, Raed; Daly, Blanaid; McDonald, Fraser; Scambler, Sasha

2018-07-01

Cleft lip and palate is a common congenital anomaly affecting males and females. While there is psychological research on cleft lip and palate, there is relatively little research exploring the social context of cleft lip and palate and the experiences of living with the condition on a daily basis. Drawing on common themes emerging from sociological work which have explored the experiences of people living with long-term conditions (uncertainty, social relations, self-esteem and self-image and biomedical concerns), we argue that these themes can be used to help elucidate the experiences of people living with cleft lip and palate. Within this framework, the findings of a qualitative study exploring the experiences of people living with cleft lip and palate are presented. The results suggest that all four themes can be found within the accounts of people living with cleft lip and palate, and there are many commonalities between the experiences of these people and those living with other long-term conditions. Conversely there are interesting areas of divergence. Unlike most long-term conditions, cleft lip and palate is not degenerative and treatment means symptoms will reduce over time. This is reflected in narratives around 'normality' as the endpoint of the care pathway. In addition, prenatal diagnosis means that the vast majority of participants within this study were born into, and grew up within, the care pathway. This has implications for the way in which cleft lip and palate is understood and the provision of information, relationships with members of the care team over time and the temporal and contextualised impact of cleft lip and palate on social relations and the self.

A Longitudinal Study of the Presence of Dental Anomalies in the Primary and Permanent Dentitions of Cleft Lip and/or Palate Patients.

PubMed

Suzuki, Akira; Nakano, Masayuki; Yoshizaki, Keigo; Yasunaga, Atsushi; Haruyama, Naoto; Takahashi, Ichiro

2017-05-01

  The aim is to survey primary and permanent dental anomalies: hypodontia, microdontia, a supernumerary tooth, and fused teeth in patients with cleft lip and/or palate.   Retrospective longitudinal study Subjects :  The subjects were selected from all 1724 patients with cleft lip and/or palate who were registered at the orthodontic clinic of Kyushu University Hospital, Fukuoka, Japan, from 1970 to 2009. Finally, 994 subjects were evaluated for primary dentition, 1352 for permanent dentition, and 871 for the longitudinal changes from primary to permanent dentition.   The prevalence of dental anomalies was compared for each tooth type, among various cleft types, between males and females, and between the alveolar cleft area and the noncleft area.   The prevalence of hypodontia was 16.2% for primary dentition and 52.7% for permanent dentition in the subjects with cleft lip and/or palate. Hypodontia increased with the severity of the cleft type. Multiple hypodontia was found more frequently in the subjects with bilateral cleft lip and palate and the subjects with unilateral cleft lip and palate. Microformed lateral incisors were found in 22.7% of permanent lateral incisors but not in primary dentition. Supernumerary teeth were found in 17.7% of the subjects with cleft lip and/or palate for primary maxillary dentition and in 5.7% for permanent maxillary dentition.   The prevalence of hypodontia was greater in permanent dentition than in primary dentition; although, it was not much different between males and females or between the right and left sides. The prevalence of dental anomalies was significantly different among four groups by cleft type: cleft lip, cleft lip and alveolus, cleft lip and palate, and cleft palate.

Formation of a tyrosine adduct involved in lignin degradation by Trametopsis cervina lignin peroxidase: a novel peroxidase activation mechanism.

PubMed

Miki, Yuta; Pogni, Rebecca; Acebes, Sandra; Lucas, Fátima; Fernández-Fueyo, Elena; Baratto, Maria Camilla; Fernández, María I; de los Ríos, Vivian; Ruiz-Dueñas, Francisco J; Sinicropi, Adalgisa; Basosi, Riccardo; Hammel, Kenneth E; Guallar, Victor; Martínez, Angel T

2013-06-15

LiP (lignin peroxidase) from Trametopsis cervina has an exposed catalytic tyrosine residue (Tyr181) instead of the tryptophan conserved in other lignin-degrading peroxidases. Pristine LiP showed a lag period in VA (veratryl alcohol) oxidation. However, VA-LiP (LiP after treatment with H2O2 and VA) lacked this lag, and H2O2-LiP (H2O2-treated LiP) was inactive. MS analyses revealed that VA-LiP includes one VA molecule covalently bound to the side chain of Tyr181, whereas H2O2-LiP contains a hydroxylated Tyr181. No adduct is formed in the Y171N variant. Molecular docking showed that VA binding is favoured by sandwich π stacking with Tyr181 and Phe89. EPR spectroscopy after peroxide activation of the pre-treated LiPs showed protein radicals other than the tyrosine radical found in pristine LiP, which were assigned to a tyrosine-VA adduct radical in VA-LiP and a dihydroxyphenyalanine radical in H2O2-LiP. Both radicals are able to oxidize large low-redox-potential substrates, but H2O2-LiP is unable to oxidize high-redox-potential substrates. Transient-state kinetics showed that the tyrosine-VA adduct strongly promotes (>100-fold) substrate oxidation by compound II, the rate-limiting step in catalysis. The novel activation mechanism is involved in ligninolysis, as demonstrated using lignin model substrates. The present paper is the first report on autocatalytic modification, resulting in functional alteration, among class II peroxidases.

Unit Advancement Flap for Lower Lip Reconstruction.

PubMed

Ogino, Akihiro; Onishi, Kiyoshi; Okada, Emi; Nakamichi, Miho

2018-05-01

Lower lip reconstruction requires consideration of esthetic and functional outcome in selecting a surgical procedure, and reconstruction with local tissue is useful. The authors reconstructed full-thickness defects with a unit advancement flap. Reconstruction was performed using this method in 4 patients with lower lip squamous cell carcinoma in whom tumor resection with preservation of the mouth angle was possible. The lower lip resection width was 30 to 45 mm, accounting for 50% to 68% of the entire width of the lower lip. The flap was prepared by lateral extension from above the mental unit and matched with the potential wrinkle line of the lower lip in order to design a unit morphology surrounded by the anterior margin of the depressor labii inferioris muscle. It was elevated as a full-thickness flap composed of the orbicularis oris muscle, skin, and mucosa of the residual lower lip from the bilateral sides, and advanced to the defect. Flap transfer was adjusted by small triangular resection of the skin on the lateral side of the mental unit. The postoperative scar was inconspicuous in all patients and there was no impairment of the mouth opening-closing or articulation functions. This was a relatively simple surgical procedure. A blood supply of the flap was stable, and continuity of the orbicularis oris muscle was reconstructed by transferred the residual lower lip advancement flap from the bilateral sides. The postoperative mouth opening-closing function was sufficient, and dentures could be placed from an early phase in elderly patients. The postoperative scar was consistent with the lip unit morphology, being esthetically superior. This procedure may be applicable for reconstruction of defects approximately 1/3 to 2/3 the width of the lower lip where the mouth angle is preserved.

Clinical Assessment of Immediate and Long-Term Effects of a Two-Step Topical Hyaluronic Acid Lip Treatment.

PubMed

Makino, Elizabeth T; Tan, Priscilla; Qian, Kun; Babcock, Michael; Mehta, Rahul C

2017-04-01

Key features of lip aging include loss of volume, color, and definition as well as increases in lines/wrinkles and uneven skin texture. A single-center, open-label clinical study was conducted to assess the efficacy and tolerability of a novel, topical two-step lip treatment (HA5 LS) in female subjects presenting with mild to moderate lip dryness and mild to severe lip condition. Subjects were instructed to apply HA5 LS at least three times a day to ensure coverage 8 hours a day for four weeks. Clinical assessments for efficacy and tolerability were conducted at baseline, baseline post-application, week 2, and week 4. Standardized digital photography, subject self-assessment questionnaires, and instrumentation measurements for skin hydration (corneometer) and lip plumpness (digital caliper) were also conducted. Thirty-six female subjects aged 22-40 years enrolled in the study. HA5 LS provided instant and long term effects, achieving significant improvements in all clinical grading parameters including lip texture, color, definition/contour, scaling, cupping, lines/wrinkles, lip plumpness, and overall lip condition from baseline post-application to week 4 (all P less than equal to .001; Wilcoxon signed-rank test). Instrumentation measurements for hydration and digital caliper at weeks 2 and 4 were also significant (all P less than equal to .032; paired t-test). HA5 LS was also well-tolerated and highly-rated by subjects throughout the study duration. Results from this study suggest that HA5 LS addresses the key features of lip aging, providing both instant and long-term benefits.

J Drugs Dermatol. 2017;16(4):366-371.

Estimation of gender using cheiloscopy and dermatoglyphics

PubMed Central

Tandon, Aanchal; Srivastava, Abhinav; Jaiswal, Rohit; Patidar, Madhvika; Khare, Aashish

2017-01-01

Background and Objective: Forensic dentistry plays a vital role in detection and resolution of crime, civil proceedings and personal identification. With ever-increasing demands placed upon law enforcement to provide sufficient physical evidence linking a perpetrator to a crime, it makes sense to utilize any type of physical characteristic to identify a suspect of an offense. The least invasive and cost-effective procedure among all methods of human identification is the study of lip prints and fingerprints. This study is done to determine the predominant pattern of fingerprint and lip print in males and females and to correlate it for gender identification. Materials and Methods: The study sample comprised 100 individuals (50 males and 50 females) aged between 20 and 50 years; dark-colored lipstick was applied uniformly on the lips. The glued portion of cellophane tape was dabbed first in the center and then pressed uniformly over the corner of lips. Cellophane tape was then stuck to a white chart sheet for the purpose of permanent record. Lip print patterns were analyzed following the classification of Suzuki and Tsuchihashi. The imprint of left thumb was taken on a white chart sheet using a blue ink stamp pad and visualized using magnifying lens. Fingerprints were analyzed by following the classification given by Kücken. Correlation of lip print and fingerprint was analyzed using Chi-square test. Results: The overall correlation of lip prints with fingerprints in males revealed branched lip pattern associated with whorl fingerprint and in females as vertical lip print pattern associated with loop fingerprint. Conclusion: We conclude that the study between lip print and fingerprint can aid in gender determination. PMID:29386811

Updating and improving methodology for prioritizing highway project locations on the strategic intermodal system : [summary].

DOT National Transportation Integrated Search

2016-05-01

Florida International University researchers examined the existing performance measures and the project prioritization method in the CMP and updated them to better reflect the current conditions and strategic goals of FDOT. They also developed visual...

How to breathe when you are short of breath

MedlinePlus

... pursed lip breathing; Hypoxia - pursed lip breathing; Chronic respiratory failure - pursed lip breathing ... et al, eds. Murray and Nadel's Textbook of Respiratory Medicine . 6th ed. Philadelphia, PA: Elsevier Saunders; 2016: ...

Galea and subgalea graft for lip augmentation revision.

PubMed

de Benito, J; Fernández-Sanza, I

1996-01-01

In this paper we will review the results obtained during the last 2 years with the aponeurotic galea and subgalea for vermillion lip augmentation. The survey was carried out on 42 patients who displayed either an absence of or reduction in the vermillion of one or both lips or a senile lip. In all cases the surgical procedure introduced aponeurotic galea and subgalea in the space found between the orbicular lip muscle and the vestibular mucus, just behind the vermillion. All the operations were performed under local anaesthetic. The size of the aponeurotic galea fragment removed varied in length between 10 and 12 cms. and in width between 1 and 2 cms., using the following parameters for its dimensions: the previous volume of the lips, and the distance between the two buccal commissures when in the "smile position."

Surgical Correction of Whistle Deformity Using Cross-Muscle Flap in Secondary Cleft Lip

PubMed Central

Choi, Woo Young; Kim, Gyu Bo; Han, Yun Ju

2012-01-01

Background The whistle deformity is one of the common sequelae of secondary cleft lip deformities. Santos reported using a crossed-denuded flap for primary cleft lip repair to prevent a vermilion notching. The authors modified this technique to correct the whistle deformity, calling their version the cross-muscle flap. Methods From May 2005 to January 2011, 14 secondary unilateral cleft lip patients were treated. All suffered from a whistle deformity, which is characterized by the deficiency of the central tubercle, notching in the upper lip, and bulging on the lateral segment. The mean age of the patients was 13.8 years and the mean follow-up period was 21.8 weeks. After elevation from the lateral vermilion and medial tubercle, two muscle flaps were crossed and turned over. The authors measured the three vertical heights and compared the two height ratios before and after surgery for evaluation of the postoperative results. Results None of the patients had any notable complications and the whistle deformity was corrected in all cases. The vertical height ratios at the midline on the upper lip and the affected Cupid's bow point were increased (P<0.05). The motion of the upper lip was acceptable. Conclusions A cross muscle flap is simple and it leaves a minimal scar on the lip. We were able to reconstruct the whistle deformity in secondary unilateral cleft lip patients with a single state procedure using a cross-muscle flap. PMID:23094241

Lip-reading enhancement for law enforcement

NASA Astrophysics Data System (ADS)

Theobald, Barry J.; Harvey, Richard; Cox, Stephen J.; Lewis, Colin; Owen, Gari P.

2006-09-01

Accurate lip-reading techniques would be of enormous benefit for agencies involved in counter-terrorism and other law-enforcement areas. Unfortunately, there are very few skilled lip-readers, and it is apparently a difficult skill to transmit, so the area is under-resourced. In this paper we investigate the possibility of making the lip-reading task more amenable to a wider range of operators by enhancing lip movements in video sequences using active appearance models. These are generative, parametric models commonly used to track faces in images and video sequences. The parametric nature of the model allows a face in an image to be encoded in terms of a few tens of parameters, while the generative nature allows faces to be re-synthesised using the parameters. The aim of this study is to determine if exaggerating lip-motions in video sequences by amplifying the parameters of the model improves lip-reading ability. We also present results of lip-reading tests undertaken by experienced (but non-expert) adult subjects who claim to use lip-reading in their speech recognition process. The results, which are comparisons of word error-rates on unprocessed and processed video, are mixed. We find that there appears to be the potential to improve the word error rate but, for the method to improve the intelligibility there is need for more sophisticated tracking and visual modelling. Our technique can also act as an expression or visual gesture amplifier and so has applications to animation and the presentation of information via avatars or synthetic humans.

Expression and purification of the non-tagged LipL32 of pathogenic Leptospira.

PubMed

Hauk, P; Carvalho, E; Ho, P L

2011-04-01

Leptospirosis is a reemerging infectious disease and the most disseminated zoonosis worldwide. A leptospiral surface protein, LipL32, only occurs in pathogenic Leptospira, and is the most abundant protein on the bacterial surface, being described as an important factor in host immunogenic response and also in bacterial infection. We describe here an alternative and simple purification protocol for non-tagged recombinant LipL32. The recombinant LipL32(21-272) was expressed in Escherichia coli without His-tag or any other tag used to facilitate recombinant protein purification. The recombinant protein was expressed in the soluble form, and the purification was based on ion exchange (anionic and cationic) and hydrophobic interactions. The final purification yielded 3 mg soluble LipL32(21-272) per liter of the induced culture. Antiserum produced against the recombinant protein was effective to detect native LipL32 from cell extracts of several Leptospira serovars. The purified recombinant LipL32(21-272) produced by this protocol can be used for structural, biochemical and functional studies and avoids the risk of possible interactions and interferences of the tags commonly used as well as the time consuming and almost always inefficient methods to cleave these tags when a tag-free LipL32 is needed. Non-tagged LipL32 may represent an alternative antigen for biochemical studies, for serodiagnosis and for the development of a vaccine against leptospirosis.

Prevalence of dental anomalies in a population of cleft lip and palate patients.

PubMed

Al Jamal, Ghaida A; Hazza'a, Abdalla M; Rawashdeh, Ma'amon A

2010-07-01

The aim of our study was to investigate radiographically the prevalence of dental anomalies in a group of Jordanian cleft lip and/or palate subjects. This is a retrospective review of panoramic radiographs of 78 subjects with cleft lip and/or palate that were evaluated from their file records and investigated for possible dental anomalies. Dental anomalies were found frequently in cleft lip and/or palate subjects. Missing teeth were found in 66.7% of the patients; the tooth most commonly missing was the maxillary lateral incisor. Supernumerary teeth were found in 16.7% of patients; 37% had microdontia; 70.5% had taurodontism; 30.8% had transposition and/or ectopic teeth; 19.2% had dilacerations; and 30.8% had hypoplastic teeth. There was no statistically significant difference in the above anomalies' prevalence between males and females. However, it was found that subjects with bilateral cleft lip and/or palate had significantly more microdontia (p = .005), dilaceration (p = .002), and hypoplastic teeth (p = .0001) than subjects with unilateral cleft lip and/or palate. The prevalence of dental anomalies in cleft lip and/or palate patients was higher than what had been reported in the normal Jordanian population. This emphasizes the relation of cleft lip and/or palate to all dental anomalies studied. Although our study represents a thorough and complete description of dental anomalies present in a sample of cleft lip and/or palate subjects, larger samples are required to effectively determine the relationship of each dental anomaly with cleft type.

A Study of the Combined Use of a Hearing Aid and Tactual Aid in an Adult with Profound Hearing Loss

ERIC Educational Resources Information Center

Reed, Charlotte M.; Delhorne, Lorraine A.

2006-01-01

This study examined the benefits of the combined used of a hearing aid and tactual aid to supplement lip-reading in the reception of speech and for the recognition of environmental sounds in an adult with profound hearing loss. Speech conditions included lip-reading alone (L), lip-reading + tactual aid (L+TA) lip-reading + hearing aid (L+HA) and…

[Improving care for cleft lip and palate patients: uniform and patient-orientated outcome measures].

PubMed

Haj, M; de Gier, H H W; van Veen-van der Hoek, M; Versnel, S L; van Adrichem, L N; Wolvius, E B; Hazelzet, J A; Koudstaal, M J

2018-02-01

The quality of care for patients with cleft lip and palate is extremely variable across the world. Treatment protocols differ and methods of data registration are not uniform. Improving this care by means of comparative research is challenging. The best treatment programmes can be identified by uniformly registering patient-orientated outcomes and comparing the outcomes with those of other treatment centres. That knowledge can be used to improve one's own care. An international team consisting of specialists and cleft lip and palate patients has developed a set of outcome measures that are considered by patients to be most important. This team is coordinated by the International Consortium of Health Outcomes Measurement (ICHOM). The cleft lip and palate outcome set can be used by all centres worldwide in following up on cleft lip and palate patients. In the Erasmus Medical Centre in Rotterdam, the 'Zorgmonitor Schisis' (Care Monitor Cleft Lip and Palate) has been built, an application in which these outcome measures are collected at fixed times. Implementing this set of outcome measures in other cleft lip and palate treatment centres and using the outcomes as (inter)national benchmarks will result in transparency and the improvement of the treatment of cleft lip and palate worldwide.

Electromyographic analysis of superior orbicularis oris muscle function in children surgically treated for unilateral complete cleft lip and palate.

PubMed

Szyszka-Sommerfeld, Liliana; Woźniak, Krzysztof; Matthews-Brzozowska, Teresa; Kawala, Beata; Mikulewicz, Marcin

2017-09-01

The aim of this study was to assess the electrical activity of the superior orbicularis oris muscle in children surgically treated for unilateral complete cleft lip and palate (UCCLP). The sample comprised 45 patients 6.38-12.68 years of age with UCCLP and 40 subjects 6.61-11.71 years of age with no clefts. Electromyographical (EMG) recordings were taken with a DAB-Bluetooth Instrument (Zebris Medical GmbH, Germany) in the rest position and during saliva swallowing, lip protrusion and reciprocal compression of the lips, as well as while producing the phonemes /p/, /b/, and /m/ combined with the vowel /a/. The electrical activity of the upper lip during saliva swallowing and lip compression was significantly greater in the cleft group. Similar resting level activity was observed in both groups. During the production of the /p/, /b/, and /m/ phonemes combined with the vowel /a/ the results showed no significant differences in the EMG activity between children with UCCLP and noncleft subjects. Patients with UCCLP have abnormal upper lip function characterized by increased activity of the superior orbicularis oris muscle during saliva swallowing and lip compression, and this may affect facial morphology. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Tooth display and lip position during spontaneous and posed smiling in adults.

PubMed

Van Der Geld, Pieter; Oosterveld, Paul; Berge, Stefaan J; Kuijpers-Jagtman, Anne M

2008-08-01

To analyze differences in tooth display, lip-line height, and smile width between the posed smiling record, traditionally produced for orthodontic diagnosis, and the spontaneous (Duchenne) smile of joy. The faces of 122 male participants were each filmed during spontaneous and posed smiling. Spontaneous smiles were elicited through the participants watching a comical movie. Maxillary and mandibular lip-line heights, tooth display, and smile width were measured using a digital videographic method for smile analysis. Paired sample t-tests were used to compare measurements of posed and spontaneous smiling. Maxillary lip-line heights during spontaneous smiling were significantly higher than during posed smiling. Compared to spontaneous smiling, tooth display in the (pre)molar area during posed smiling decreased by up to 30%, along with a significant reduction of smile width. During posed smiling, also mandibular lip-line heights changed and the teeth were more covered by the lower lip than during spontaneous smiling. Reduced lip-line heights, tooth display, and smile width on a posed smiling record can have implications for the diagnostics of lip-line height, smile arc, buccal corridors, and plane of occlusion. Spontaneous smiling records next to posed smiling records are therefore recommended for diagnostic purposes. Because of the dynamic nature of spontaneous smiling, it is proposed to switch to dynamic video recording of the smile.

Genetic dissection of adaptive form and function in rapidly speciating cichlid fishes.

PubMed

Henning, Frederico; Machado-Schiaffino, Gonzalo; Baumgarten, Lukas; Meyer, Axel

2017-05-01

Genes of major phenotypic effects and strong genetic correlations can facilitate adaptation, direct selective responses, and potentially lead to phenotypic convergence. However, the preponderance of this type of genetic architecture in repeatedly evolved adaptations remains unknown. Using hybrids between Haplochromis chilotes (thick-lipped) and Pundamilia nyererei (thin-lipped) we investigated the genetics underlying hypertrophied lips and elongated heads, traits that evolved repeatedly in cichlids. At least 25 loci of small-to-moderate and mainly additive effects were detected. Phenotypic variation in lip and head morphology was largely independent. Although several QTL overlapped for lip and head morphology traits, they were often of opposite effects. The distribution of effect signs suggests strong selection on lips. The fitness implications of several detected loci were demonstrated using a laboratory assay testing for the association between genotype and variation in foraging performance. The persistence of low fitness alleles in head morphology appears to be maintained through antagonistic pleiotropy/close linkage with positive-effect lip morphology alleles. Rather than being based on few major loci with strong positive genetic correlations, our results indicate that the evolution of the Lake Victoria thick-lipped ecomorph is the result of selection on numerous loci distributed throughout the genome. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

The effects of lip revision surgery on nasolabial esthetics in patients with cleft lip.

PubMed

Mercado, A M; Phillips, C; Vig, K W L; Trotman, C-A

2014-11-01

1) To determine the concordance among surgeons on subjective assessments of nasolabial esthetics in children with repaired cleft lip; and 2) to evaluate longitudinal changes in nasolabial esthetics in relation to cleft lip revision surgery. School of Dentistry at University of North Carolina, Chapel Hill. Children with repaired unilateral cleft lip: 32 had lip revision surgery and 27 did not have surgery. Retrospective observational study from a non-randomized clinical trial. Ratings of nasolabial esthetics performed by six surgeons using the Asher-McDade scale at baseline and 12-month follow-up. Concordance among surgeons ranged from poor to acceptable. Nasolabial ratings at follow-up were better in the Revision group than in the Non-Revision group, although differences were small. The most prevalent change in the Revision Group was improvement in one or more units on the scale, while 'no change' was most prevalent in the Non-Revision group. Participants in the Revision group were more likely to receive a 'no' in relation to the need for lip or nose revision at the follow-up visit. There were mild esthetic improvements observed in relation to lip revision surgery, which should be interpreted with caution given the subjectivity of the rating method used. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Ultra high vacuum seal arrangement

DOEpatents

Flaherty, Robert

1981-01-01

Arrangement for demountably sealing two concentric metallic tubes in an ultra high vacuum system which facilitates remote actuation. A tubular seal includes integral spaced lips which circumferentially engage the metallic tubes. The lips plastically deform the metallic tubes by mechanical forces resulting from a martensite to austenite transformation of the tubular seal upon application of a predetermined temperature. The sealing force is released upon application of another temperature which causes a transformation from the stronger austenite to the weaker martensite. Use of a dual acting sealing ring and driving ring circumferentially contacting the sealing ring is particularly applicable to sealing larger diameter concentric metallic members.

[Progress in studies on the genetic risk factors for nonsyndromic cleft lip or palate in China].

PubMed

Huang, Y Q

2017-04-09

Cleft lip and palate is the most common congenital defects of oral and maxillofacial region in human beings. The etiology of this malformation is complex, with both genetic and environmental causal factors are involved. To provide a better understanding in the genetic etiology of cleft lip or palate, the author summarized recent years studies based on Chinese population. Those researches included validation of some candidate genes for cleft lip or palate, using genome wide association analysis which included six independent cohorts from China to elucidate the genetic architecture of non-syndromic cleft lip with or without cleft palate in Chinese population and finally found a new susceptibility locus. This locus was on the 16p13.3 (rs8049367) between CREBBP and ADCY9. It has been mentioned common methods of genetic analysis involved in the researches on cleft lip or palate in this paper. Furthermore, we try to discuss new methods to illustrate the etiology of cleft lip and palate that could provide more inspiration on future researches.

The influence of lip form on incisal display with lips in repose on the esthetic preferences of dentists and lay people.

PubMed

Kim, Jee; Topolski, Richard; Dickinson, Douglas; Ramos, Van

2017-09-01

Information is lacking for viewer preferences for incisal display with lips in repose. The purpose of this online survey was to establish measurement parameters to classify and define a lip form and to evaluate the influence of lip form on dentists' and laypersons' preferences for the amount of incisal display with lips in repose. Computer-generated male and female models were created using 3 different lip forms each, straight, moderate, and high. Three images of these models (frontal full face, zoomed-in frontal around the mouth, and oblique zoomed-in image of the mouth) were arranged in an interactive survey that was disseminated on the Websites Facebook, Instagram, DentalTown and by word-of-mouth. Respondents manipulated the incisal display of all 3 images in unison, using a slide bar, and the resulting incisal display was measured in millimeters and served as the primary dependent measure. Survey demographic data were obtained from an online survey site. Data were assessed for skewness, kurtosis, and outliers and analyzed with 5-way ANOVA: 2 sex levels for model, 2 levels for sex of respondent, 3 levels for lip height, 3 levels for occupation, and 5 levels of ethnicity, with multiple comparisons corrected with Bonferroni adjustments and post hoc comparisons performed using the Scheffé test (α=.05 for all comparisons). A total of 1039 individuals consented to the study. A final sample size of 687 respondents was obtained after excluding 352 who failed to complete the survey. The results indicated that lip form affected the esthetic perception of incisal display significantly (P<.001), with a preference for a greater amount of incisal display corresponding with increasing lip forms. Sex of the model was also significant, with greater incisal display being preferred for female faces. A significant difference was found for respondents' ethnicity, with African Americans generally preferring smaller incisal displays than other ethnic groups. No other main effects were found to be statistically significant. Only 2 interactions were shown to be statistically significant. Post hoc tests examining the interaction between lip form and sex of model showed a preference for greater incisal displays for female faces with high lip forms. A 3-way interaction was observed between lip form, sex of respondent, and occupation. Significant differences were identified for the 3 different lip forms for both sexes of models. As the lip form changed from straight to moderate to high, there was a preference for increased incisal display. Incisal display preferences for male and female models were the same for all respondents, except for the high lip form, for which a greater amount of incisal display was preferred for the female model. Sex and occupation of respondent failed to produce main effects. Respondents' ethnicity was shown to be statistically significant, with African Americans generally preferring shorter incisal displays. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

Eating high fat chow increases the sensitivity of rats to 8-OH-DPAT-induced lower lip retraction.

PubMed

Li, Jun-Xu; Ju, Shutian; Baladi, Michelle G; Koek, Wouter; France, Charles P

2011-12-01

Eating high fat food can alter sensitivity to drugs acting on dopamine systems; this study examined whether eating high fat food alters sensitivity to a drug acting on serotonin (5-HT) systems. Sensitivity to (+)-8-hydroxy-2-(dipropylamino) tetralin hydrobromide (8-OH-DPAT; 5-HT1A receptor agonist)-induced lower lip retraction was examined in separate groups (n=8-9) of rats with free access to standard (5.7% fat) or high fat (34.3% fat) chow; sensitivity to quinpirole (dopamine D3/D2 receptor agonist)-induced yawning was also examined. Rats eating high fat chow gained more body weight than rats eating standard chow and, after 6 weeks of eating high fat chow, they were more sensitive to 8-OH-DPAT (0.01-0.1 mg/kg)-induced lower lip retraction and quinpirole (0.0032-0.32 mg/kg)-induced yawning. These changes were not reversed when rats that previously ate high fat chow were switched to eating standard chow and sensitivity to 8-OH-DPAT and quinpirole increased when rats that previously ate standard chow ate high fat chow. These data extend previous results showing changes in sensitivity to drugs acting on dopamine systems in animals eating high fat chow to a drug acting at 5-HT1A receptors and they provide support for the notion that eating certain foods impacts sensitivity to drugs acting on monoamine systems.

Eating high fat chow increases the sensitivity of rats to 8-OH-DPAT-induced lower lip retraction

PubMed Central

Li, Jun-Xu; Ju, Shutian; Baladi, Michelle G; Koek, Wouter; France, Charles P

2011-01-01

Eating high fat food can alter sensitivity to drugs acting on dopamine systems; this study examined whether eating high fat food alters sensitivity to a drug acting on serotonin (5-HT) systems. Sensitivity to (+)-8-hydroxy-2-(dipropylamino) tetralin hydrobromide (8-OH-DPAT; 5-HT1A receptor agonist)-induced lower lip retraction was examined in separate groups (n=8-9) of rats with free access to standard (5.7% fat) or high fat (34.3% fat) chow; sensitivity to quinpirole (dopamine D3/D2 receptor agonist)-induced yawning was also examined. Rats eating high fat chow gained more body weight than rats eating standard chow and, after 6 weeks of eating high fat chow, they were more sensitive to 8-OH-DPAT (0.01-0.1 mg/kg)-induced lower lip retraction and quinpirole (0.0032-0.32 mg/kg)-induced yawning. These changes were not reversed when rats that previously ate high fat chow were switched to eating standard chow and sensitivity to 8-OH-DPAT and quinpirole increased when rats that previously ate standard chow ate high fat chow. These data extend previous results showing changes in sensitivity to drugs acting on dopamine systems in animals eating high fat chow to a drug acting at 5-HT1A receptors and they provide support for the notion that eating certain foods impacts sensitivity to drugs acting on monoamine systems. PMID:21979831

Cleft Lip and Palate Surgery

MedlinePlus

... The experts in face, mouth and jaw surgery. Cleft Lip / Palate and Craniofacial Surgery This type of surgery is ... the carefully orchestrated, multiple-stage correctional program for cleft lip and palate patients. The goal is to help restore the ...

Cleft Lip and Cleft Palate

MedlinePlus

... to obese women may have increased risk of cleft lip and palate. Males are more likely to have a cleft ... more common in females. In the United States, cleft lip and palate are reportedly most common in Native Americans and ...

Dental Care for a Child with Cleft Lip and Palate

MedlinePlus

... Donor Spotlight Fundraising Ideas Vehicle Donation Volunteer Efforts Dental Care for a Child with Cleft Lip and ... submenu What We Do Cleft & Craniofacial Educational Materials Dental Care for a Child with Cleft Lip and ...

“Partial duplication of lower lip and hemimandible” A rare case

PubMed Central

Nayak, Bibhuti Bhusan; Mohanty, Nilamani

2012-01-01

Duplication of mandible and lower lip is a very rare congenital entity. We report an extremely uncommon case of Congenital Duplication of Lower lip and Mandible in a 3 year old girl, who was treated surgically in a single stage for correction of both lip and mandible. This was a commissure preserving single staged procedure. The Surgical procedure, the problems related to this anomaly and the embryology are discussed. PMID:23450337

The convergence rate of approximate solutions for nonlinear scalar conservation laws

NASA Technical Reports Server (NTRS)

Nessyahu, Haim; Tadmor, Eitan

1991-01-01

The convergence rate is discussed of approximate solutions for the nonlinear scalar conservation law. The linear convergence theory is extended into a weak regime. The extension is based on the usual two ingredients of stability and consistency. On the one hand, the counterexamples show that one must strengthen the linearized L(sup 2)-stability requirement. It is assumed that the approximate solutions are Lip(sup +)-stable in the sense that they satisfy a one-sided Lipschitz condition, in agreement with Oleinik's E-condition for the entropy solution. On the other hand, the lack of smoothness requires to weaken the consistency requirement, which is measured in the Lip'-(semi)norm. It is proved for Lip(sup +)-stable approximate solutions, that their Lip'convergence rate to the entropy solution is of the same order as their Lip'-consistency. The Lip'-convergence rate is then converted into stronger L(sup p) convergence rate estimates.

Isolation and characterization of novel lipases from a metagenomic library of the microbial community in the pitcher fluid of the carnivorous plant Nepenthes hybrida.

PubMed

Morohoshi, Tomohiro; Oikawa, Manabu; Sato, Shoko; Kikuchi, Noriko; Kato, Norihiro; Ikeda, Tsukasa

2011-10-01

Members of the genus Nepenthes are carnivorous plants that use the pitfall method of insect capture as a supplementary nutritional source. We extracted metagenomic DNA from the microbial community found in the pitcher fluid of Nepenthes and constructed a plasmid-based metagenomic library. An activity-based screening method enabled the isolation of two lipase genes, lip1 and lip2. Both Lip1 and Lip2 belong to a novel family or subfamily of lipases and show lipase activities in acidic conditions, such as those found in pitcher fluid. This study was conducted under the assumption that the secreted Lip1 and Lip2 were capable of enzymatic activity in the acidic pitcher fluid. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Complex Correction of Complete Cleft Lip with Severe Prominent Premaxilla using Lip Adhesion and Nasoalveolar Molding Device.

PubMed

Seo, Bin Na; Park, Su Han; Yang, Jeong Yeol; Son, Kyung Min; Cheon, Ji Seon

2015-04-01

Nasoalveolar molding (NAM) device is an effective treatment for protruding maxilla in infants with cleft palate. However, only a few studies have investigated the effect of NAM devices on the treatment of protruding maxilla in infants with cleft lip only. We have designed a combination treatment using NAM devices prior to cheiloplasy for cleft lip-only patients with severe anterior protrusion of the premaxilla. Three cleft lip-only infants with 1-cm or more of premaxilla protrusion were included. Definitive cheiloplasty was performed at 6 months of age without any preoperative correction in infant 1. Cheiloplasty was performed in conjunction with the use of NAM device and lip adhesion in infants 2 and 3. Postoperative columella length and anterior-posterior dimension of the protruding premaxilla were compared amongst the infants. We were able to obtain satisfactory postoperative columella length and general nasal appearance.

[A Patient with Lower Lip Verrucous Carcinoma Treated with a Tongue Flap for Functional and Esthetic Reconstruction].

PubMed

Koike, Takashi; Kanno, Takahiro; Karino, Masaaki; Sekine, Joji

2017-11-01

Surgery is generally indicated for the treatment of lower lip carcinoma. However, surgery can lead to esthetic as well as functional issues, with disturbances in eating and articulation. If the defect involves less than one-third of the width of the lower lip, primary closure is possible. If the defect is wider, reconstructive local flaps may be necessary for both esthetic and functional recovery. This report describes a case of lower lip verrucous carcinoma in which a tongue flap was used to treat a defect involving more than half the width of the lower lip following resection. The patient was a 91-year-old woman who complained of lower lip discomfort. A biopsy revealed verrucous carcinoma, and we performed resection. After a 3-week waiting period, we performed secondary tongue flap reconstruction. Satisfactory function and cosmetic results were achieved.

Sex differences in oral asymmetries during wordrepetition.

PubMed

Hausmann, M; Behrendt-Körbitz, S; Kautz, H; Lamm, C; Radelt, F; Güntürkün, O

1998-12-01

During speech production the right side of the mouth is opened to a larger degree in most people. This facial asymmetry is thought to be related to a left hemisphere dominance in language processing and/or motor programming. We investigated asymmetrical lip separations during discrete or serial word productions in right handed persons. The results revealed a right sided lip separation bias in both genders during discrete word production in which the words had to be uttered once. As soon as the words had to be produced continuously, however, a clear sex difference appeared with males having the usual right bias but females now showing no clear asymmetry, with a tendency for larger lip separations on the left side. These results suggest the existence of two separate neural systems from which one controls the discrete task and which is left hemisphere dominant in both genders. The other is probably involved in serial word productions and shows a sex difference with regard to its asymmetry pattern.

Infrared thermography and meridian-effect evidence and explanation in Bell's palsy patients treated by moxibustion at the Hegu (LI4) acupoint

PubMed Central

Guan, Ling; Li, Gaobo; Yang, Yiling; Deng, Xiufang; Cai, Peisi

2012-01-01

Subjects with Bell's palsy and healthy individuals were treated with moxibustion thermal stimulation on the Hegu (LI4) acupoint; an infrared thermal imaging system was used to observe facial-temperature changes. Bell's palsy patients developed low or high temperatures at the affected side, with poor symmetry. Healthy people showed high temperatures on the forehead, medial angle of the eye, nasal ala and around the lips, but low temperatures on bilateral cheeks, thus forming a “T-type hot area” in the face, with good temperature symmetry. Moxibustion treatment for 11 minutes significantly improved high asymmetry in temperature in the faces of Bell's palsy patients. This evidence indicates that moxibustion treatment on Hegu enables increases in facial temperatures in healthy people and Bell's palsy patients, especially around the lips. Moxibustion stimulation at the Hegu not only improves the global circulation but also has specific effects on the lips in Bell's palsy patients, but the underlying mechanism needs further investigation. PMID:25745463

Advances in liver transplantation allocation systems.

PubMed

Schilsky, Michael L; Moini, Maryam

2016-03-14

With the growing number of patients in need of liver transplantation, there is a need for adopting new and modifying existing allocation policies that prioritize patients for liver transplantation. Policy should ensure fair allocation that is reproducible and strongly predictive of best pre and post transplant outcomes while taking into account the natural history of the potential recipients liver disease and its complications. There is wide acceptance for allocation policies based on urgency in which the sickest patients on the waiting list with the highest risk of mortality receive priority. Model for end-stage liver disease and Child-Turcotte-Pugh scoring system, the two most universally applicable systems are used in urgency-based prioritization. However, other factors must be considered to achieve optimal allocation. Factors affecting pre-transplant patient survival and the quality of the donor organ also affect outcome. The optimal system should have allocation prioritization that accounts for both urgency and transplant outcome. We reviewed past and current liver allocation systems with the aim of generating further discussion about improvement of current policies.

Prevalence of cleft lip and/or palate in children from Lodz between years 1981-2010.

PubMed

Antoszewski, Bogusław; Fijałkowska, Marta

2016-03-01

Congenital malformations constitute a serious problem of both medical and social nature. Cleft lip and/or palate represent the most common congenital anomaly of the face that is why it is essential to know the real frequency of the described phenomenon. The aim of this paper is to determine the frequency of cleft lip and/or palate and the types of malformations that occurred in Lodz city between the years 1981-2010. Our clinic has been carrying on the studies concerning the incidence of cleft lip and/or palate since 1981. The Polish Registry of Congenital Malformations has been operating in Poland since 1 April 1997. The team has managed to obtain data, from the Registry, concerning the total number of all live born infants and the number of children with cleft lip and/or palate, who were born in Lodz, between 1998 and 2010. In years 1981-2010, 319 children, in 210 952 live born infants, were born with cleft lip and/or palate in Lodz. The isolated cleft palate was observed more frequently in girls and the unilateral cleft of lip and palate in boys. In all three decades palate clefts are more common whereas bilateral lip, alveolus and palate clefts are more infrequent. A small tendency to decrease in actual cleft lip and/or palate frequency among children, in the period of 30 years, is observed in Lodz. Over the years it has still been observed that the isolated cleft palate is the most common type of defect. © 2015 Japanese Teratology Society.

Practical Repair Method for Unilateral Cleft Lips: Straight-Line Advanced Release Technique.

PubMed

Baek, Rong-Min; Choi, Jun-Ho; Kim, Baek-Kyu

2016-04-01

Straight-line closure repair of unilateral cleft lips was first introduced in the 1840s, and since then, many different techniques have been attempted for cleft repair. However, these methods have several disadvantages and are difficult to adopt. In this study, we describe our novel technique, known as Straight-Line Advanced Release Technique (StART), and its application in treating several cases of unilateral cleft lip. The preoperative design of the surgical method is drawn on the skin, the vermilion, and the oral mucosa. A total of 13 points are marked (points 0-12). The A flap, B flap, triangular flap, M (medial mucosal) flap, and L (lateral mucosal) flap are designed. After completion of the preoperative marking, the wide dissection is performed to separate the orbicularis oris muscle completely from the abnormally inserted bony structure and the enveloped skin-mucosal flap. The freed orbicularis oris muscle is then reconstructed with full width. After all planes of the lip wound are closed, a straight vertical skin suture line is achieved without any unnecessary transverse scar. Unilateral cleft lip repair using StART was conducted in 145 patients between 1993 and 2012. Cases of microform cleft lip were excluded. A total of 21 patients (14%) required a secondary operation on the lip after the first unilateral cheiloplasty. In all patients, satisfactory surgical outcomes were obtained with an indistinct straight-lined scar and a well-aligned lip contour. To acquire a natural and balanced shape in unilateral cleft lip repair, we recommend the novel StART.

The influence of lower lip position on the perceived attractiveness of chin prominence.

PubMed

Modarai, Faranak; Donaldson, Jane Catalina; Naini, Farhad B

2013-09-01

To evaluate the influence of the lower lip prominence for varying degrees of chin prominence in the sagittal plane and to establish whether lower lip prominence affects the perceived desire for surgery. To assess differences in preference between orthodontists and laypeople as well as the effect of age, gender, and ethnicity of observers on perceptions of attractiveness and desire for surgery. A silhouette of an idealized profile image was created. The image was manipulated to create six images demonstrating different degrees of retrogenia and progenia altered in 4-mm increments from -12 mm to +12 mm and six images demonstrating chin and lower lip prominence in 4-mm increments from -12 mm to +12 mm. One hundred laypeople and 30 orthodontists ranked the images from the most to the least attractive. A duplicate of one of the images was used in order to assess intraexaminer reliability. The amount and direction of sagittal chin position and the prominence of the lower lip were found to have a significant effect on image rank. Chin protrusion was less attractive than retrusion and surgery was desired more often for these images. The overall direction of opinion was the same for laypeople and orthodontists. The chin prominence observed in a progenic patient is deemed less attractive than the combined chin and lower lip prominence observed in a patient with mandibular prognathism. In profiles with a more prominent chin a more protrusive lower lip position was preferred. When the chin was retrusive, a normal lower lip position was preferred to a retrusive lip.

Gender determination: Role of lip prints, finger prints and mandibular canine index

PubMed Central

KRISHNAN, RESHMA POOTHAKULATH; THANGAVELU, RADHIKA; RATHNAVELU, VIDHYA; NARASIMHAN, MALATHI

2016-01-01

Personal identification has a pivotal role in forensic investigations. Gender determination is an essential step in personal identification. Despite the advent of advanced techniques such as DNA fingerprinting, methods such as lip print and fingerprint analysis and mandibular canine index calculations are routinely used in gender determination, as they are simple and cost-effective. The present study investigated the hypothesis that lip print analysis is an effective tool in gender determination compared with fingerprint analysis and the mandibular canine index. The predominant patterns of lip prints and fingerprints were analyzed in males and females, and the efficacy of the mandibular canine index in gender determination was evaluated. The study group comprised 50 students, 25 males and 25 females who were 18–25 years of age. Lip prints and fingerprints were obtained and classified according to Tsuchihashi's classification and Kücken and Newell's classification, respectively. Mandibular impressions were made and the mandibular canine index was calculated. Type I and Type I' lip prints were predominant in females, and Type IV lip prints were predominant in males. The analysis of fingerprints revealed that the loop fingerprint pattern was predominant in both males and females. The mandibular canine index was not found to be significant in gender identification. The predominant patterns of lip prints were distinct for males and females; conversely, fingerprints were demonstrated to be similar in both genders. Therefore, lip prints hold an increased potential for gender determination, as compared with fingerprints, and the mandibular canine index is not a reliable indicator of gender. PMID:27284316

The ecological and genetic basis of convergent thick-lipped phenotypes in cichlid fishes.

PubMed

Colombo, Marco; Diepeveen, Eveline T; Muschick, Moritz; Santos, M Emilia; Indermaur, Adrian; Boileau, Nicolas; Barluenga, Marta; Salzburger, Walter

2013-02-01

The evolution of convergent phenotypes is one of the most interesting outcomes of replicate adaptive radiations. Remarkable cases of convergence involve the thick-lipped phenotype found across cichlid species flocks in the East African Great Lakes. Unlike most other convergent forms in cichlids, which are restricted to East Africa, the thick-lipped phenotype also occurs elsewhere, for example in the Central American Midas Cichlid assemblage. Here, we use an ecological genomic approach to study the function, the evolution and the genetic basis of this phenotype in two independent cichlid adaptive radiations on two continents. We applied phylogenetic, demographic, geometric morphometric and stomach content analyses to an African (Lobochilotes labiatus) and a Central American (Amphilophus labiatus) thick-lipped species. We found that similar morphological adaptations occur in both thick-lipped species and that the 'fleshy' lips are associated with hard-shelled prey in the form of molluscs and invertebrates. We then used comparative Illumina RNA sequencing of thick vs. normal lip tissue in East African cichlids and identified a set of 141 candidate genes that appear to be involved in the morphogenesis of this trait. A more detailed analysis of six of these genes led to three strong candidates: Actb, Cldn7 and Copb. The function of these genes can be linked to the loose connective tissue constituting the fleshy lips. Similar trends in gene expression between African and Central American thick-lipped species appear to indicate that an overlapping set of genes was independently recruited to build this particular phenotype in both lineages. © 2012 Blackwell Publishing Ltd.

Protein Engineering and Homologous Expression of Serratia marcescens Lipase for Efficient Synthesis of a Pharmaceutically Relevant Chiral Epoxyester.

PubMed

Chen, Ke-Cai; Zheng, Ming-Min; Pan, Jiang; Li, Chun-Xiu; Xu, Jian-He

2017-10-01

The lipase isolated from Serratia marcescens (LipA) is a useful biocatalyst for kinetic resolution of a pharmaceutically relevant epoxyester, (±)-3-(4'-methoxyphenyl) glycidic acid methyl ester [(±)-MPGM], to afford optically pure (-)-MPGM, a key intermediate for the synthesis of diltiazem hydrochloride. Two mutants, LipA L315S and LipA S271F , were identified from the combinatorial saturation mutation library of 14 amino acid residues lining the substrate-binding pocket. LipA L315S , LipA S271F , and their combination LipA L315S/S271F showed 2.6-, 2.2-, and 4.6-fold improvements in their specific activities towards para-nitrophenyl butyrate (pNPB), respectively. Among these positive mutants, LipA S271F displayed a 3.5-fold higher specific activity towards the pharmaco substrate (±)-MPGM. Kinetic study showed that the improvement in catalytic efficiency of LipA S271F against (±)-MPGM was mainly resulted from the enhanced affinity between substrate and enzyme, as indicated by the decrease of K m . Furthermore, to address the insoluble expression issue in Escherichia coli, the homologous expression of LipA gene in S. marcescens was achieved by introducing it into an expression vector pUC18, resulting in ca. 20-fold higher lipase production. The significantly improved volumeric production and specific activity of S. marcescens lipase make it very attractive as a new-generation biocatalyst for more efficient and economical manufacturing of (-)-MPGM.

Effects of early and late cheiloplasty on anterior part of maxillary dental arch development in infants with unilateral complete cleft lip and palate.

PubMed

Valentová-Strenáčiková, Silvia; Malina, Radovan

2016-01-01

Objectives. The objective of this study is to compare the impact of early and late reconstruction of complete unilateral cleft lip and palate on the growth and development of the front of the dentoalveolar arch. Methods. This study was carried out in the years 2012-2015 at the Clinic of Plastic, Reconstructive and Aesthetic Surgery in Banska Bystrica. Infants with unilateral complete cleft lip and palate were divided into 2 groups according to the timing of lip reconstruction. Group A consisted of infants with early lip reconstruction-realised in the first 14 days of life. Group B consisted of infants with later lip reconstruction-realised in the third month of age. Maxillary dental casts were obtained for each child in four periods-in the first 14 days of life, in the third month, in the sixth month and in the age of one year. These were followed by the identification, measurement and evaluation of anthropometric parameters. Results. Significant differences were occurred after the reconstruction of the lips in linear and angle measurements between infants in the A and B groups. Conclusion. The early surgical reconstruction of the lips in the first 14 days of life has a positive effect on the growth and development of the anterior segment of the dentoalveolar arch. Early lip reconstruction forms a continuous pressure on the frontal segment, resulting in the earlier remedy of anatomical properties and creates appropriate conditions for the best development of this area.

Effects of early and late cheiloplasty on anterior part of maxillary dental arch development in infants with unilateral complete cleft lip and palate

PubMed Central

2016-01-01

Objectives. The objective of this study is to compare the impact of early and late reconstruction of complete unilateral cleft lip and palate on the growth and development of the front of the dentoalveolar arch. Methods. This study was carried out in the years 2012–2015 at the Clinic of Plastic, Reconstructive and Aesthetic Surgery in Banska Bystrica. Infants with unilateral complete cleft lip and palate were divided into 2 groups according to the timing of lip reconstruction. Group A consisted of infants with early lip reconstruction–realised in the first 14 days of life. Group B consisted of infants with later lip reconstruction–realised in the third month of age. Maxillary dental casts were obtained for each child in four periods–in the first 14 days of life, in the third month, in the sixth month and in the age of one year. These were followed by the identification, measurement and evaluation of anthropometric parameters. Results. Significant differences were occurred after the reconstruction of the lips in linear and angle measurements between infants in the A and B groups. Conclusion. The early surgical reconstruction of the lips in the first 14 days of life has a positive effect on the growth and development of the anterior segment of the dentoalveolar arch. Early lip reconstruction forms a continuous pressure on the frontal segment, resulting in the earlier remedy of anatomical properties and creates appropriate conditions for the best development of this area. PMID:26893957

Impact of breastfeeding or bottle-feeding on surgical wound dehiscence after cleft lip repair in infants: a systematic review protocol.

PubMed

Matsunaka, Eriko; Ueki, Shingo; Makimoto, Kiyoko

2015-10-01

The objective of this systematic review is to examine the impact of breastfeeding or bottle-feeding on surgical wound dehiscence after cleft lip repair in infants. Immediately after cleft lip repair in infants, breastfeeding and bottle-feeding are generally restricted. Alternative feeding methods such as spoon-feeding are recommended to avoid placing tension on the surgical wound. However, some studies have reported that alternative feeding methods are a source of stress to the infant and cause them to cry incessantly, resulting in postoperative weight loss. This suggests that these alternative feeding methods may have an unfavorable impact on surgical wound healing. However, a consensus on this topic has not been reached. The objective of this systematic review is to examine the impact of breastfeeding or bottle-feeding on surgical wound dehiscence after cleft lip repair in infants.Cleft lip and/or palate is a craniofacial anomaly and one of the most common birth defects. The incidence of cleft lip and/or palate differs among races, ethnic groups and geographical areas. The prevalence of cleft lip and/or palate is highest in South American countries (Bolivia: 22.94 per 10,000 live births; Paraguay: 14.90 per 10,000 live births), followed by Asian countries (China: 13.60 per 10,000 live births; Japan: 16.04 per 10,000 live births). The prevalence is lowest in African countries (3.54 per 10,000 live births). The overall worldwide prevalence is 7.9 per 10,000 births.A cleft lip and/or a cleft palate can occur separately, although they are more likely to occur together early in pregnancy. These anomalies can be surgically repaired. Without proper treatment, patients have aesthetic and functional problems, such as feeding disorders, otitis media and speech difficulties.Patients with cleft lip and/or palate usually undergo a combination of surgical procedures, speech therapy and orthodontic treatment from infancy to young adulthood. Comprehensive treatment is provided with thoughtful consideration of the balance between intervention and growth. Cleft lip repair is carried out first in comprehensive treatment regimens. The aim of cleft lip repair is to create contrast between the lip and external nose and provide good muscular continuity across the cleft without any scarring. It is usually performed from three to six months of age. Surgery is delayed until this age to allow for growth of the lip structure and assessment of the patient for the presence of comorbidities. The ability of newborn patients with cleft lip and/or palate to drink milk is important for proper growth and development.For cleft lip and/or palate patients in the newborn developmental stage, feeding can be an area of great concern and anxiety for their parents. One study found that 32% of newborn patients with cleft lip and/or palate had poor feeding skills. Feeding difficulties lead to poor growth and development in early infancy and increase the burden of care. Therefore, it is important for new parents to learn appropriate feeding techniques. Infants with cleft lip can generally drink milk from the breast through various ways of feeding. In contrast, infants with both cleft lip and palate have difficulty sucking the nipple because of weak intraoral negative pressure, and specially designed nipples are generally used. Although such infants suckle with weakened pressure, these nipples enable them to drink milk by lightly pushing them through their lip. However, after cleft lip repair, infants with cleft lip and/or palate are forced to change their feeding methods (even infants who have managed to drink milk before the repair).Breastfeeding and bottle-feeding are generally restricted immediately after cleft lip repair. Alternative feeding methods such as the use of a spoon, cup or syringe are recommended to avoid placing tension on the surgical incision. The use of a very soft nipple of sufficient size is recommended to provide a dripping milk flow, thus avoiding tension on the operative site. Some authors have recommended that patients with cleft lip and/or palate be spoon-fed for a certain period of time after cleft lip repair to avoid tension on the surgical site. However, management of the surgical site after surgical repair of cleft lip and/or palate varies among countries and healthcare centers. Little evidence-based research is available to guide healthcare staff members through the many treatment protocols for cleft lip and/or palate. No consensus about feeding methods after cleft lip repair has been reached.The above mentioned alternative feeding methods might influence the process of surgical wound healing. Minimizing crying has been considered to be the most important factor in avoiding tension on the surgical wound. In one study, however, 21.7% of infants who were given milk by a spoon on the first day after cleft lip repair resisted feeding by crying and/or moving the head laterally, while all infants fed by the nipple that had been used preoperatively accepted feeding without a major observable response. In another study, infants who were breastfed or bottle-fed after the repair were reportedly more relaxed than spoon-fed or syringe-fed infants. Changes in feeding methods seem to stress the infants and cause them to cry, which places tension on the wound.These alternative feeding methods may also have other impacts on surgical wound healing. One study reported that infants took longer to drink milk using alternative feeding methods than when using traditional feeding methods after the surgery. A systematic review suggested that alternative feeding methods were associated with less postoperative weight gain in patients than traditional feeding methods. Postoperative nutritional intake also influences wound healing. A long duration of feeding milk coupled with weight loss after the surgery suggests unnecessary energy consumption associated with the alternative feeding methods. Wound healing may consequently be inhibited or delayed.Wound healing complications after surgery include wound infection, dehiscence and proliferative scarring. Surgical wound dehiscence has been regarded as a typical complication after cleft lip and/or palate repair, followed by pyrexia. In one case series, post-surgical complications were found in 11 of 2100 infants who underwent surgical cleft lip and/or palate repair during a seven-year period. Wound dehiscence results from tissue failure rather than improper suturing technique. Therefore, alternative feeding methods are recommended to avoid placing tension on the surgical wound. However, no strong evidence has been presented to show that breastfeeding or bottle-feeding after cleft lip repair may cause surgical wound dehiscence among infants with cleft lip.Our initial search failed to find any systematic review examining the impact of breastfeeding or bottle-feeding on surgical wound dehiscence after cleft lip repair using the Cochrane Library, the JBI Database of Systematic Reviews and Implementation Reports, and other bibliographic databases, including MEDLINE and CINAHL. The proposed systematic review will contribute to the understanding of this topic and identify areas for further research. If breastfeeding or bottle-feeding is recommended immediately after cleft lip repair, the patients will experience less stress and crying, placing less tension on the wound than with alternative feeding methods. Breastfeeding or bottle-feeding will result in more weight gain, facilitating wound healing.

Medical care for 4- to 5-year-olds with cleft lip/palate at the Tawanchai Center: geoinformatics study.

PubMed

Pattaranit, Rumpan; Songsung, Chainarong; Simmalee, Krisda; Pradubvong, Suteera; Thanapaisal, Chaiwit

2012-11-01

The incidence of cleft lip and cleft palate in Thailand is based on reports from three hospitals in Northeastern Thailand. There are 2.49 new babies born with cleft lip and cleft palate and craniofacial deformities for every 1,000 babies the highest incidence in the world. Area 7 Office of the National Health Security Office (NHSO) comprises Khon Kaen, Roi Et, Mahasarakam and Kalasin. The number of newborns with cleft lip and palate is an estimated 114 cases/year. A retrospective geoinformatics study was conducted using the medical records of 4- to 5-year-olds with cleft lip and cleft palate registered with the Tawanchai Center Srinagarind Hospital. To study the distribution of 4- to 5-year-olds with cleft lip and palate using geoinformatics. This retrospective study was conducted using data from the medical records, which contains the records of 4- to 5-year-olds with cleft lip and cleft palate admitted to Srinagarind Hospital. The 54-patient sample groups were registered at the Tawanchai Center Faculty of Medicine, Khon Kaen University, under the aegis of the NHSO (Area 7-Khon Kaen). The data were collected using self-administered questionnaires between May and June 2012 and geoinformatics, to study the distribution of patients' vis-a-vis the various parameters. Among the 27 male and 27femalepatients, 51.85% had cleft lip with cleft palate. Most of the cleft lip patients (7 cases; 41.18%) were in Khon Kaen, while 4 (44.44%) of the cleft palate patients were in Roi-Et and 11 (39.29%) of the cleft lip with palate patients were in Khon Kaen. Most cleft lip patients were in Roi-Et province: 1 case in each of four districts. Similarly, most cases of cleft palate were in Roi-Et province: 1 case in each of four districts. Finally, most cases (5; 50%) of cleft lip with cleft palate were found in Roi-Et province, mostly in the central (Muang) district. The use of Arc View software as an instrument for geoinformatics, spatial data collection helped to clarify the district level distribution of patients with CLP; this information is needed for policy planning and resource allocation.

A family with unusual Waardenburg syndrome type I (WSI), cleft lip (palate), and Hirschsprung disease is not linked to PAX 3.

PubMed

Pierpont, J W; St Jacques, D; Seaver, L H; Erickson, R P

1995-03-01

An unusual family with Waardenburg syndrome type 1 (WSI), cleft lip (palate), and Hirschsprung disease is not linked to the PAX 3 gene since there is an obligate crossover which has occurred between PAX 3 DNA markers and the disorder in this family. This family may also have anticipation of the WSI traits as the proband's grandmother is nonpenetrant, his mother has dystopia canthorum, and severe cleft lip (palate), while the proband has dystopia canthorum, severe cleft lip (palate), and Hirschsprung disease. Thus, a locus other than PAX 3 is implicated in this Waardenburg-like syndrome with Hirschsprung disease and cleft lip (palate).

Treatment of gummy smile: Gingival recontouring with the containment of the elevator muscle of the upper lip and wing of nose. A surgery innovation technique.

PubMed

Storrer, Carmen Lucia Mueller; Valverde, Fabiane Kristine Bochenek; Santos, Felipe Rychuv; Deliberador, Tatiana Miranda

2014-09-01

The containment of the elevator muscle of the upper lip and wing of nose was used for the treatment of patients with gummy smile. This technique had corrected esthetic alterations of smile, reducing the upper lip elevation, which results in a smaller gingival display. An upper lip lengthening as well as a reduction in the upper lip shortening when the patient smiled could be observed. The high smile line was corrected without compromising the labial harmony. This study presents an innovative and effective therapeutic option to obtain a natural and harmonious smile. The patient expressed a high degree of satisfaction.

Surgical Tip for Prevention of Lip Injury During Orthognathic and Facial Bone Contouring Surgery.

PubMed

Lee, Tae Sung; Park, Sanghoon

2017-10-01

Iatrogenic lip injury is a rather common complication after facial bone surgery, but is usually treated lightly by the surgeon compared with other more severe functional complications. However, these injuries can have permanent sequelae and can therefore be a reason for patient dissatisfaction, especially after cosmetic surgery. Intraoperative lip injuries during facial bone surgery are usually caused by heat-generating surgical instruments or forced traction on the operative fields. The authors have applied a special technical strategy using a hydrocolloid dressing material to avoid these intraoperative lip injuries. This method does not disturb the operative procedure itself, but efficiently prevents lip injuries and decreases surgical morbidities and postoperative swelling.

An Investigation of the Effects of Nose and Lip Shapes for an Underslung Scoop Inlet at Mach Numbers from 0 to 1.9

NASA Technical Reports Server (NTRS)

Pfyl, Frank A.

1955-01-01

An experimental investigation was conducted to determine the performance characteristics an underslung nose-scoop air-induction system for a supersonic airplane. Five different nose shapes, three lip shapes, and two internal diffusers were investigated. Tests were made at Mach numbers from 0 to 1.9, angles of attack from 0 deg to approximately l5 deg, and mass-flow ratios from 0 to maximum obtainable. It was found that the underslung nose-scoop inlet was able to operate at Mach numbers from 0.6 to 1.9 over a large positive angle-of-attack range without adverse effects on the pressure recovery. Although there was no one inlet configuration that was markedly superior over the entire range of operating variables, the arrangement having a nose designed to give increased supersonic compression at low angles of attack, and a sharp lip (configuration designated N3L3) showed the most favorable performance characteristics over the supersonic Mach number range. Inlets with sizable lip radii gave satisfactory performance up to a Mach number of 1.5; however, as a result of an increase in drag, the performance of such inlets was markedly inferior to the sharp-lip configuration above Mach numbers of 1.5. Throughout the range of test Mach numbers all inlet configurations evidenced stable air-flow characteristics over the mass-flow range for normal engine operation. Analysis of the inlet performance on the basis of a propulsive thrust parameter showed that a fixed inlet area could be used for Mach numbers up to 1.5 with only a small sacrifice in performance.

Two-Piece Extraoral Prosthetic Rehabilitation to a Perineural Invasion Lip Cancer.

PubMed

Şahan, Makbule Heval; Eskiizmir, Görkem; Ateş, Pınar

2018-03-01

Lip cancers can severely affect a person in terms of function, esthetics, and psychological trauma. After surgical resection, lip defects require special rehabilitation. This clinical report describes a neck prosthesis of a male patient diagnosed with lower lip squamous cell carcinoma with perineural involvement. The neck prosthesis was connected to the mandibular complete denture with cobalt samarium magnets. Both prostheses improved the patient's mastication, deglutition, and esthetics. © 2016 by the American College of Prosthodontists.

Randomized, Evaluator-Blinded Study Comparing Safety and Effect of Two Hyaluronic Acid Gels for Lips Enhancement.

PubMed

Hilton, Said; Sattler, Gerhard; Berg, Anna-Karin; Samuelson, Ulf; Wong, Cindy

2018-02-01

Hyaluronic acid (HA) fillers may differ in terms of gel characteristics and ease of use and it is of interest whether this might affect safety and duration of effect. To compare the long-term safety and effect of 2 HA fillers produced by 2 different technologies for lip enhancement. Subjects with very thin to moderately thick lips were randomized and treated with HA-RK (N = 31) or HA-JV (N = 29) to improve lip fullness by ≥ 1 grade on a 5-point scale, using a maximum of 3 mL of product. A smaller volume of HA-RK compared with HA-JV was required to improve lip fullness by ≥ 1 grade (mean: 1.54 mL vs 1.94 mL, p < .001). Despite the smaller volume, lip fullness and global aesthetic improvement were comparably sustained in both groups. At 6 months, 60.0% versus 57.7% of subjects (HA-RK vs HA-JV) had improved lip fullness. At 12 months, 71.4% versus 76.0% had aesthetic improvement (blinded evaluations) and 85.7% versus 86.2% felt more attractive. Both products were well tolerated. Both products achieved durable improvement in lip fullness and aesthetic appearance. A significantly smaller amount of HA-RK was required compared with HA-JV to achieve optimal treatment effect.

Randomized, Evaluator-Blinded Study Comparing Safety and Effect of Two Hyaluronic Acid Gels for Lips Enhancement

PubMed Central

Sattler, Gerhard; Berg, Anna-Karin; Samuelson, Ulf; Wong, Cindy

2018-01-01

BACKGROUND Hyaluronic acid (HA) fillers may differ in terms of gel characteristics and ease of use and it is of interest whether this might affect safety and duration of effect. OBJECTIVE To compare the long-term safety and effect of 2 HA fillers produced by 2 different technologies for lip enhancement. MATERIALS AND METHODS Subjects with very thin to moderately thick lips were randomized and treated with HA-RK (N = 31) or HA-JV (N = 29) to improve lip fullness by ≥ 1 grade on a 5-point scale, using a maximum of 3 mL of product. RESULTS A smaller volume of HA-RK compared with HA-JV was required to improve lip fullness by ≥ 1 grade (mean: 1.54 mL vs 1.94 mL, p < .001). Despite the smaller volume, lip fullness and global aesthetic improvement were comparably sustained in both groups. At 6 months, 60.0% versus 57.7% of subjects (HA-RK vs HA-JV) had improved lip fullness. At 12 months, 71.4% versus 76.0% had aesthetic improvement (blinded evaluations) and 85.7% versus 86.2% felt more attractive. Both products were well tolerated. CONCLUSION Both products achieved durable improvement in lip fullness and aesthetic appearance. A significantly smaller amount of HA-RK was required compared with HA-JV to achieve optimal treatment effect. PMID:29059146

Cloning, expression and characterization of a lipase gene from marine bacterium Pseudoalteromonas lipolytica SCSIO 04301

NASA Astrophysics Data System (ADS)

Su, Hongfei; Mai, Zhimao; Zhang, Si

2016-12-01

A lipase gene, lip1233, isolated from Pseudoalteromonas lipolytica SCSIO 04301, was cloned and expressed in E. coli. The enzyme comprised 810 amino acid residues with a deduced molecular weight of 80 kDa. Lip1233 was grouped into the lipase family X because it contained a highly conserved motif GHSLG. The recombinant enzyme was purified with Ni-NTA affinity chromatography. The optimal temperature and pH value of Lip1233 were 45°C and 8.0, respectively. It retained more than 70% of original activity after being incubated in pH ranging from 6.0 to 9.5 for 30 min. It was stable when the temperature was below 45°C, but was unstable when the temperature was above 55°C. Most metal ions tested had no significant effect on the activity of Lip1233. Lip1233 remained more than original activity in some organic solvents at the concentration of 30% (v/v). It retained more than 30% activity after incubated in pure organic solvents for 12 h, while in hexane the activity was nearly 100%. Additionally, Lip1233 exhibited typical halotolerant characteristic as it was active under 4M NaCl. Lip1233 powder could catalyze efficiently the synthesis of fructose esters in hexane at 40°C. These characteristics demonstrated that Lip1233 is applicable to elaborate food processing and organic synthesis.

Cone Beam Computed Tomographic Evaluation of Mandibular Asymmetry in Patients with Cleft Lip and Palate.

PubMed

Paknahad, Maryam; Shahidi, Shoaleh; Bahrampour, Ehsan; Beladi, Amir Saied; Khojastepour, Leila

2018-01-01

Objective The purpose of the present study was to compare mandibular vertical asymmetry in patients with unilateral and bilateral cleft lip and palate and subjects with normal occlusion. Materials and Methods Cone beam computed tomography scans of three groups consisting of 20 patients with unilateral cleft lip and palate, 20 patients affected by bilateral cleft lip and palate, and a control group of 20 subjects with normal occlusion were analyzed for this study. Condylar, ramal, and condylar plus ramal asymmetry indices were measured for all subjects using the method of Habets et al. Kruskal-Wallis and Mann-Whitney tests were used to determine any significant differences between the groups for all indices at the 95% level of confidence. Results There were no significant differences regarding sex for all mandibular asymmetry indices in all three groups. All Asymmetry indices (condylar, ramal, and condylar plus ramal asymmetry) were significantly higher in the unilateral cleft group compared with the other two groups. Conclusion Cone beam computed tomography images showed that patients with cleft lip and palate suffered from mandibular asymmetry. Subjects with unilateral cleft lip and palate had a more asymmetric mandible compared with the bilateral cleft lip and palate and control groups. Therefore, the mandible appears to be the leading factor in facial asymmetry in subjects with unilateral cleft lip and palate.

Upper lip changes and gingival exposure on smiling: vertical dimension analysis.

PubMed

Miron, Hagai; Calderon, Shlomo; Allon, Dror

2012-01-01

Our objectives were to evaluate and quantify upper lip soft-tissue changes in the vertical dimensions both at rest and at maximum smile, and to examine the correlation between upper labial vestibular attachment height and maxillary gingival exposure on smiling. Seventy-two volunteers (36 men, 36 women) aged 20 to 40 (mean, 30.49 years) were recruited for this study. For each subject, 9 measurements of upper lip position and maxillary incisor crown height at rest and in maximum smile were recorded. A statistically significant sexual dimorphism was apparent in most of the measured variables. Relaxed external upper lip length was 3.1 mm shorter in the women than in the men. The mean maxillary central incisor display at rest was 1.78 mm greater in the women than in the men. A high smile line was 2.5 times more prevalent in the women. The upper lip was shortened by 30% in subjects with a high smile line compared with 23% in subjects with a low smile line. The following findings were observed in subjects with a high smile pattern: (1) short upper lip length, (2) low smiling/resting upper lip length ratio, (3) inferior attachment of the upper labial vestibule, and (4) prominent upper lip vermilion. Copyright © 2012 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

Lip line preference for variant face types.

PubMed

Anwar, Nabila; Fida, Mubassar

2012-06-01

To determine the effect of altered lip line on attractiveness and to find preferred lip line for vertical face types in both genders. Cross-sectional analytical study. The Aga Khan University Hospital, Karachi, from May to July 2009. Photographs of two selected subjects were altered to produce three face types for the same individual with the aim of keeping the frame of the smile constant. Lip line was then altered for both the subjects as: both dentitions visible, upper incisors visible, upper incisors and 2 mm gum and 4 mm gum visible. The pictures were rated by different professionals for attractiveness. Descriptive statistics for the raters and multiple factor ANOVA was used to find the most attractive lip line. The total number of raters was 100 with the mean age of 30.3 ± 8 years. The alterations in the smile parameters produced statistically significant difference in the attractiveness of faces, whereas the perception difference was found to be insignificant amongst raters of different professions. Preferred lip line was the one showing only the upper incisors in dolico and mesofacial male and female genders whereas 2 mm gum show was preferred in brachyfacial subjects. The variability in lip line showed significant difference in the perceived attractiveness. Preferred lip lines as the one showing only the upper incisors in dolico and mesofacial male and female genders whereas 2 mm gum show was preferred in brachyfacial subjects.

Modified Lip Repositioning with Esthetic Crown Lengthening: A Combined Approach to Treating Excessive Gingival Display.

PubMed

Sánchez, Isis M; Gaud-Quintana, Sadja; Stern, Jacob K

Lip repositioning surgery to address excessive gingival display induced by different etiologies has received major attention recently. Several techniques and variations have been reported, including myotomy or repositioning of the levator labii superioris muscle, Le Fort impaction, maxillary gingivectomies, botulinum toxin injections, and lip stabilization. This study reports a case of excessive gingival display treated by a modified combined approach. A 25-year-old woman with a 4- to 8-mm gingival display when smiling caused by a combination of short clinical crowns induced by an altered passive eruption and hypermobility of the upper lip underwent a staged esthetic crown-lengthening procedure followed by a modified lip repositioning technique. A description of the technique and a comparison with other modes of therapy is discussed. This modified approach for treating the hypermobile lip included a bilateral removal of a partial-thickness strip of mucosa from the maxillary buccal vestibule without severing the muscle, leaving the midline frenum intact and suturing the lip mucosa to the mucogingival line. The narrower vestibule and increased tooth length resulted in a symmetric and pleasing gingival display when smiling that remained stable over time. With proper diagnosis and sequence of therapy, modified lip repositioning surgery combined with esthetic crown lengthening can be used predictably to treat excessive gingival display and enhance smile esthetics.

An unexpected presentation of a traumatic wound on the lower lip: a case report

PubMed Central

2014-01-01

Introduction Traumatic lip injuries present major challenges in terms of reconstructive options and the outcome of surgical management. The aetiology of lip injuries includes human bite as interpersonal violence. Bite wounds are always considered to be complex injuries contaminated with unique polymicrobial inoculum. A classification of facial bite injuries has been included and the surgical management of these lesions has also been discussed. We report a rare bite injury on the lower lip that resembled an ulcerative process. Case presentation A 30-year-old African man presented with a severe tissue defect on his lower lip to a Dental and Oral Department in Tanzania. He explained that 12 days ago he had been involved in a fight and someone had bitten his lower lip. An orofacial examination confirmed a serious loss of lip tissue that resembled a chronic ulcerative process. Accurate assessment of the lesion was made by a thorough evaluation of some parameters such as size, depth, presence of granulation tissue, fibrin coverage, wound edges, exudates and/or necrosis. A surgical debridement under local anaesthesia was carried out. Afterwards a layered suture was performed. Eventually the healing was complete and satisfactory. Conclusions A severe bite avulsive wound on the lower lip, despite the elapsed time before treatment, may have an excellent prognosis after a simple surgical procedure. PMID:25196423

The relationship between lignin peroxidase and manganese peroxidase production capacities and cultivation periods of mushrooms

PubMed Central

Xu, Jian Z; Zhang, Jun L; Hu, Kai H; Zhang, Wei G

2013-01-01

Mushrooms are able to secrete lignin peroxidase (LiP) and manganese peroxidase (MnP), and able to use the cellulose as sources of carbon. This article focuses on the relation between peroxidase-secreting capacity and cultivation period of mushrooms with non-laccase activity. Methylene blue and methyl catechol qualitative assay and spectrophotometry quantitative assay show LiP secreting unvaryingly accompanies the MnP secreting in mushroom strains. The growth rates of hyphae are detected by detecting the dry hyphal mass. We link the peroxidase activities to growth rate of mushrooms and then probe into the relationship between them. The results show that there are close relationships between LiP- and/or MnP-secretory capacities and the cultivation periods of mushrooms. The strains with high LiP and MnP activities have short cultivation periods. However, those strains have long cultivation periods because of the low levels of secreted LiP and/or MnP, even no detectable LiP and/or MnP activity. This study provides the first evidence on the imitate relation between the level of secreted LiP and MnP activities and cultivation periods of mushrooms with non-laccase activity. Our study has significantly increased the understanding of the role of LiP and MnP in the growth and development of mushrooms with non-laccase activity. PMID:22966760

Dental and periodontal complications of lip and tongue piercing: prevalence and influencing factors.

PubMed

Plessas, A; Pepelassi, E

2012-03-01

The aim of this study was to compare the prevalence of lip and tongue piercing complications and explore the effect of ornament time wear period, habits, ornament morphology and periodontal biotype on the development of complications. One hundred and ten subjects with 110 lip and 51 tongue piercings were assessed for abnormal toothwear and/or tooth chipping/cracking (dental defects), gingival recession, clinical attachment loss and probing depth of teeth adjacent to the pierced site. Piercing habits (biting, rolling, stroking, sucking) were recorded. Wear time and habits significantly affected the prevalence of dental defects and gingival recession. Pierced site significantly affected dental defects prevalence, with greater prevalence for tongue than lip piercing. Wear time significantly affected attachment loss and probing depth. Attachment loss and probing depth did not significantly differ between tongue and lip piercings. Gingival recession was significantly associated with ornament height closure and stem length of tongue ornaments. Periodontal biotype was not significantly associated with gingival recession, attachment loss and probing depth. Dental defects prevalence is greater for tongue than lip piercing. Gingival recession is similar for tongue and lip piercing. Longer wear time of tongue and lip piercing is associated with greater prevalence of dental defects and gingival recession, as well as greater attachment loss and probing depth of teeth adjacent to pierced sites. Ornament morphology affects gingival recession prevalence. © 2012 Australian Dental Association.

Activation of p38 MAPK participates in brain ischemic tolerance induced by limb ischemic preconditioning by up-regulating HSP 70.

PubMed

Sun, Xiao-Cai; Xian, Xiao-Hui; Li, Wen-Bin; Li, Li; Yan, Cai-Zhen; Li, Qing-Jun; Zhang, Min

2010-08-01

This study investigates whether activation of p38 MAPK by the up-regulation of HSP 70 participates in the induction of brain ischemic tolerance by limb ischemic preconditioning (LIP). Western blot and immunohistochemical assays indicated that p38 MAPK activation occurred earlier than HSP 70 induction in the CA1 region of the hippocampus after LIP. P-p38 MAPK expression was up-regulated at 6h and reached its peak 12h after LIP, while HSP 70 expression was not significantly increased until 1 day and peaked 2 days after LIP. Neuropathological evaluation by thionin staining showed that quercetin (4 ml/kg, 50mg/kg, intraperitoneal injection), an inhibitor of HSP 70, blocked the protective effect of LIP against delayed neuronal death that is normally induced by lethal brain ischemic insult, indicating that HSP 70 participates in the induction of brain ischemic tolerance by LIP. Furthermore, SB 203580, an inhibitor of HSP 70, inhibited HSP 70 activation in the CA1 region of the hippocampus induced by LIP either with or without the presence of subsequent brain ischemic insult. Based on the above results, it can be concluded that activation of p38 MAPK participates in the brain ischemic tolerance induced by LIP at least partly by the up-regulation of HSP 70 expression. (c) 2010 Elsevier Inc. All rights reserved.

Elemental analysis of urinary calculi by laser induced plasma spectroscopy.

PubMed

Fang, Xiao; Ahmad, S Rafi; Mayo, Mike; Iqbal, Syed

2005-12-01

Laser induced plasma spectroscopy (LIPS) has been applied to analyse and identify elemental constituents of urinary calculi. Measurements on seven different urinary stone samples were conducted and the concentrations of some key elemental species were estimated. The elements detected with the present system were: Calcium, Magnesium, Sodium, Samarium, Potassium and Lead. Absolute concentrations of the species were derived from pre-calibration of the system for each element. Their concentrations were found to be widely different in different samples. It was observed that the samples containing a significant amount of lead have large proportion of calcium. It has been established that LIPS would allow real time clinic measurements of elemental contents and the concentrations in the biomaterials without sample preparation. The technique has the potential for routine clinic applications in urological disorder diagnosis.

An experimental evaluation of S-duct inlet-diffuser configurations for turboprop offset gearbox applications

NASA Technical Reports Server (NTRS)

Mcdill, Paul L.

1986-01-01

A test program, utilizing a large scale model, was run in the NASA Lewis Research Center 10- by 10-ft wind tunnel to examine the influence on performance of design parameters of turboprop S-duct inlet/diffuser systems. The parametric test program investigated inlet lip thickness, inlet/diffuser cross-sectional geometry, throat design Mach number, and shaft fairing shape. The test program was run at angles of attack to 15 deg and tunnel Mach numbers to 0.35. Results of the program indicate that current design techniques can be used to design inlet/diffuser systems with acceptable total pressure recovery, but several of the design parameters, notably lip thickness (contraction ratio) and shaft fairing cross section, must be optimized to prevent excessive distortion at the compressor face.

Expert system application for prioritizing preventive actions for shift work: shift expert.

PubMed

Esen, Hatice; Hatipoğlu, Tuğçen; Cihan, Ahmet; Fiğlali, Nilgün

2017-09-19

Shift patterns, work hours, work arrangements and worker motivations have increasingly become key factors for job performance. The main objective of this article is to design an expert system that identifies the negative effects of shift work and prioritizes mitigation efforts according to their importance in preventing these negative effects. The proposed expert system will be referred to as the shift expert. A thorough literature review is conducted to determine the effects of shift work on workers. Our work indicates that shift work is linked to demographic variables, sleepiness and fatigue, health and well-being, and social and domestic conditions. These parameters constitute the sections of a questionnaire designed to focus on 26 important issues related to shift work. The shift expert is then constructed to provide prevention advice at the individual and organizational levels, and it prioritizes this advice using a fuzzy analytic hierarchy process model, which considers comparison matrices provided by users during the prioritization process. An empirical study of 61 workers working on three rotating shifts is performed. After administering the questionnaires, the collected data are analyzed statistically, and then the shift expert produces individual and organizational recommendations for these workers.

Cognitive models of pilot categorization and prioritization of flight-deck information

NASA Technical Reports Server (NTRS)

Jonsson, Jon E.; Ricks, Wendell R.

1995-01-01

In the past decade, automated systems on modern commercial flight decks have increased dramatically. Pilots now regularly interact and share tasks with these systems. This interaction has led human factors research to direct more attention to the pilot's cognitive processing and mental model of the information flow occurring on the flight deck. The experiment reported herein investigated how pilots mentally represent and process information typically available during flight. Fifty-two commercial pilots participated in tasks that required them to provide similarity ratings for pairs of flight-deck information and to prioritize this information under two contextual conditions. Pilots processed the information along three cognitive dimensions. These dimensions included the flight function and the flight action that the information supported and how frequently pilots refer to the information. Pilots classified the information as aviation, navigation, communications, or systems administration information. Prioritization results indicated a high degree of consensus among pilots, while scaling results revealed two dimensions along which information is prioritized. Pilot cognitive workload for flight-deck tasks and the potential for using these findings to operationalize cognitive metrics are evaluated. Such measures may be useful additions for flight-deck human performance evaluation.

Epidemiology of appendicitis and appendectomy for the low-income population in Taiwan, 2003-2011.

PubMed

Lin, Kai-Biao; Chan, Chien-Lung; Yang, Nan-Ping; Lai, Robert K; Liu, Yuan-Hung; Zhu, Shun-Zhi; Pan, Ren-Hao

2015-02-13

Although numerous epidemiological studies on appendicitis have been conducted worldwide, only a few studies have paid attention to the effect of socioeconomic status on appendicitis, particularly studies focusing on the low-income population (LIP). We analyzed the epidemiological features of appendicitis in Taiwan using data from the National Health Insurance Research Database from 2003 to 2011. All cases diagnosed as appendicitis were enrolled. Between 2003 and 2011, 2,916 patients from the LIP and 209,206 patients from the normal population (NP) were diagnosed with appendicitis. Our finding revealed that the ratios of comorbidities, complicated appendicitis, and readmissions in LIP patients were slightly higher than those of NP patients. LIP patients were more likely to live in suburban and rural areas, and hence a higher proportion of them were hospitalized in a district or regional hospital compared with NP patients. The crucially finding was that the overall incidence ratios of appendicitis, acute appendicitis, and perforated appendicitis in the LIP were substantially higher than those in the NP (36.25%, 35.33%, and 37.28%, respectively). The mean LOS in LIP patients was longer than that of NP patients. The overall case-fatality ratio of appendectomy in the LIP was higher when compared with the NP (0.41% versus 0.12%, p < 0.05). We also observed that appendicitis was occurred frequently in male patients, with a higher incidence for those aged 15-29 years in both the LIP and NP. The incidences of incidental appendectomy showed a decreasing trend in both the LIP and NP. Finally, a valuable discovery was that the total hospital cost was comparable between the laparoscopic appendectomy (LA) and open appendectomy (OA) (1,178 ± 13 USD versus 1,191 ± 19 USD, p < 0.05) in LIP patients because they saved more hospitalization costs than NP patients when the previous one chose the LA. This study confirmed that a lower socioeconomic status has significantly negative impact on the occurrence and treatment of appendicitis and appendectomy. In terms of hospital costs and LOS, LIP patients benefit more from the LA approach than they do from the OA approach in the treatment of appendicitis.

Cheiloscopy and dactyloscopy: Do they dictate personality patterns?

PubMed

Abidullah, Mohammed; Kumar, M Naveen; Bhorgonde, Kavita D; Reddy, D Shyam Prasad

2015-01-01

Cheiloscopy and dactyloscopy, both are well-established forensic tools used in individual identification in any scenario be it a crime scene or civil cause. Like finger prints, lip prints are unique and distinguishable for every individual. But their relationship to personality types has not been established excepting the hypothesis stating that finger prints could explain these personality patterns. The study was aimed to record and correlate the lip and finger prints with that of character/personality of a person. The lip and finger prints and character of a person were recorded and the data obtained was subjected for statistical analysis, especially for Pearson's Chi-square test and correlation/association between the groups was also studied. The study sample comprised of 200 subjects, 100 males and 100 females, aged between 18 and 30 years. For recording lip prints, brown/pink-colored lipstick was applied on the lips and the subjects were asked to spread uniformly over the lips. Lip prints were traced in the normal rest position on a plain white bond paper. For recording the finger prints, imprints of the fingers were taken on a plain white bond paper using ink pad. The collected prints were visualized using magnifying lens. To record the character of person, a pro forma manual for multivariable personality inventory by Dr. BC Muthayya was used. Data obtained was subjected for statistical analysis, especially for Pearson's Chi-square test and correlation/association between the groups was also studied. In males, predominant lip pattern recorded was Type I with whorls-type finger pattern and the character being ego ideal, pessimism, introvert, and dogmatic; whereas in females, predominant lip pattern recorded was Type II with loops-type finger pattern and the character being neurotic, need achievers, and dominant. Many studies on lip pattern, finger pattern, palatal rugae, etc., for individual identification and gender determination exist, but correlative studies are scanty. This is the first study done on correlating patterns, that is, lip and finger pattern with the character of a person. With this study we conclude that this correlation can be used as an adjunct in the investigatory process in forensic sciences.

Evaluation of a 3D stereophotogrammetric technique to measure the stone casts of patients with unilateral cleft lip and palate.

PubMed

Sforza, Chiarella; De Menezes, Marcio; Bresciani, Elena; Cerón-Zapata, Ana M; López-Palacio, Ana M; Rodriguez-Ardila, Myriam J; Berrio-Gutiérrez, Lina M

2012-07-01

To assess a three-dimensional stereophotogrammetric method for palatal cast digitization of children with unilateral cleft lip and palate. As part of a collaboration between the University of Milan (Italy) and the University CES of Medellin (Colombia), 96 palatal cast models obtained from neonatal patients with unilateral cleft lip and palate were obtained and digitized using a three-dimensional stereophotogrammetric imaging system. Three-dimensional measurements (cleft width, depth, length) were made separately for the longer and shorter cleft segments on the digital dental cast surface between landmarks, previously marked. Seven linear measurements were computed. Systematic and random errors between operators' tracings, and accuracy on geometric objects of known size were calculated. In addition, mean measurements from three-dimensional stereophotographs were compared statistically with those from direct anthropometry. The three-dimensional method presented good accuracy error (<0.9%) on measuring geometric objects. No systematic errors between operators' measurements were found (p > .05). Statistically significant differences (p < 5%) were noted for different methods (caliper versus stereophotogrammetry) for almost all distances analyzed, with mean absolute difference values ranging between 0.22 and 3.41 mm. Therefore, rates for the technical error of measurement and relative error magnitude were scored as moderate for Ag-Am and poor for Ag-Pg and Am-Pm distances. Generally, caliper values were larger than three-dimensional stereophotogrammetric values. Three-dimensional stereophotogrammetric systems have some advantages over direct anthropometry, and therefore the method could be sufficiently precise and accurate on palatal cast digitization with unilateral cleft lip and palate. This would be useful for clinical analyses in maxillofacial, plastic, and aesthetic surgery.

A 3D analysis of Caucasian and African American facial morphologies in a US population.

PubMed

Talbert, Leslie; Kau, Chung How; Christou, Terpsithea; Vlachos, Christos; Souccar, Nada

2014-03-01

This study aimed to compare facial morphologies of an adult African-American population to an adult Caucasian-American population using three-dimensional (3D) surface imaging. The images were captured using a stereophotogrammetric system (3dMDface(TM) system). Subjects were aged 19-30 years, with normal body mass index and no gross craniofacial anomalies. Images were aligned and combined using RF6 Plus Pack 2 software to produce a male and female facial average for each population. The averages were superimposed and the differences were assessed. The most distinct differences were in the forehead, alar base and perioricular regions. The average difference between African-American and Caucasian-American females was 1·18±0·98 mm. The African-American females had a broader face, wider alar base and more protrusive lips. The Caucasian-American females had a more prominent chin, malar region and lower forehead. The average difference between African-American and Caucasian-American males was 1·11±1·04 mm. The African-American males had a more prominent upper forehead and periocular region, wider alar base and more protrusive lips. No notable difference occurred between chin points of the two male populations. Average faces were created from 3D photographs, and the facial morphological differences between populations and genders were compared. African-American males had a more prominent upper forehead and periocular region, wider alar base and more protrusive lips. Caucasian-American males showed a more prominent nasal tip and malar area. African-American females had broader face, wider alar base and more protrusive lips. Caucasian-American females showed a more prominent chin point, malar region and lower forehead.

Luminescent Immunoprecipitation System (LIPS) for Detection of Autoantibodies Against ATP4A and ATP4B Subunits of Gastric Proton Pump H+,K+-ATPase in Atrophic Body Gastritis Patients

PubMed Central

Lahner, Edith; Brigatti, Cristina; Marzinotto, Ilaria; Carabotti, Marilia; Scalese, Giulia; Davidson, Howard W; Wenzlau, Janet M; Bosi, Emanuele; Piemonti, Lorenzo; Annibale, Bruno; Lampasona, Vito

2017-01-01

Objectives: Circulating autoantibodies targeting the H+/K+-ATPase proton pump of gastric parietal cells are considered markers of autoimmune gastritis, whose diagnostic accuracy in atrophic body gastritis, the pathological lesion of autoimmune gastritis, remains unknown. This study aimed to assess autoantibodies against ATP4A and ATP4B subunits of parietal cells H+, K+-ATPase in atrophic body gastritis patients and controls. Methods: One-hundred and four cases with atrophic body gastritis and 205 controls were assessed for serological autoantibodies specific for ATP4A or ATP4B subunits using luminescent immunoprecipitation system (LIPS). Recombinant luciferase-reporter-fused-antigens were expressed by in vitro transcription-translation (ATP4A) or after transfection in Expi293F cells (ATP4B), incubated with test sera, and immune complexes recovered using protein-A-sepharose. LIPS assays were compared with a commercial enzyme immunoassay (EIA) for parietal cell autoantibodies. Results: ATP4A and ATP4B autoantibody titers were higher in cases compared to controls (P<0.0001). The area under the receiver-operating characteristic curve was 0.98 (95% CI 0.965–0.996) for ATP4A, and 0.99 (95% CI 0.979–1.000) for ATP4B, both higher as compared with that of EIA: 0.86 (95% CI 0.809–0.896), P<0.0001. Sensitivity-specificity were 100–89% for ATP4A and 100–90% for ATP4B assay. Compared with LIPS, EIA for parietal cell autoantibodies showed a lower sensitivity (72%, P<0.0001) at a similar specificity (92%, P=0.558). Conclusions: Positivity to both, ATP4A and ATP4B autoantibodies is closely associated with atrophic body gastritis. Both assays had the highest sensitivity, at the cost of diagnostic accuracy (89 and 90% specificity), outperforming traditional EIA. Once validated, these LIPS assays should be valuable screening tools for detecting biomarkers of damaged atrophic oxyntic mucosa. PMID:28102858

A vulnerability assessment of 300 species in Florida: threats from sea level rise, land use, and climate change.

PubMed

Reece, Joshua Steven; Noss, Reed F; Oetting, Jon; Hoctor, Tom; Volk, Michael

2013-01-01

Species face many threats, including accelerated climate change, sea level rise, and conversion and degradation of habitat from human land uses. Vulnerability assessments and prioritization protocols have been proposed to assess these threats, often in combination with information such as species rarity; ecological, evolutionary or economic value; and likelihood of success. Nevertheless, few vulnerability assessments or prioritization protocols simultaneously account for multiple threats or conservation values. We applied a novel vulnerability assessment tool, the Standardized Index of Vulnerability and Value, to assess the conservation priority of 300 species of plants and animals in Florida given projections of climate change, human land-use patterns, and sea level rise by the year 2100. We account for multiple sources of uncertainty and prioritize species under five different systems of value, ranging from a primary emphasis on vulnerability to threats to an emphasis on metrics of conservation value such as phylogenetic distinctiveness. Our results reveal remarkable consistency in the prioritization of species across different conservation value systems. Species of high priority include the Miami blue butterfly (Cyclargus thomasi bethunebakeri), Key tree cactus (Pilosocereus robinii), Florida duskywing butterfly (Ephyriades brunnea floridensis), and Key deer (Odocoileus virginianus clavium). We also identify sources of uncertainty and the types of life history information consistently missing across taxonomic groups. This study characterizes the vulnerabilities to major threats of a broad swath of Florida's biodiversity and provides a system for prioritizing conservation efforts that is quantitative, flexible, and free from hidden value judgments.

Congenital Median Upper Lip Fistula

PubMed Central

al Aithan, Bandar

2012-01-01

Congenital median upper lip fistula (MULF) is an extremely rare condition resulting from abnormal fusion of embryologic structures. We present a new case of congenital medial upper lip fistula located in the midline of the philtrum of a 6 year old girl. PMID:22953305

Rational evolution of the unusual Y-type oxyanion hole of Rhodococcus sp. CR53 lipase LipR.

PubMed

Infanzón, Belén; Sotelo, Pablo H; Martínez, Josefina; Diaz, Pilar

2018-01-01

Rhodococcus sp CR-53 lipase LipR was the first characterized member of bacterial lipase family X. Interestingly, LipR displays some similarity with α/β-hydrolases of the C. antartica lipase A (CAL-A)-like superfamily (abH38), bearing a Y-type oxyanion hole, never found before among bacterial lipases. In order to explore this unusual Y-type oxyanion hole, and to improve LipR performance, two modification strategies based on site directed or saturation mutagenesis were addressed. Initially, a small library of mutants was designed to convert LipR Y-type oxyanion hole (YDS) into one closer to those most frequently found in bacteria (GGG(X)). However, activity was completely lost in all mutants obtained, indicating that the Y-type oxyanion hole of LipR is required for activity. A second approach was addressed to modify the two main oxyanion hole residues Tyr 110 and Asp 111 , previously described for CAL-A as the most relevant amino acids involved in stabilization of the enzyme-substrate complex. A saturation mutagenesis library was prepared for each residue (Tyr 110 and Asp 111 ), and activity of the resulting variants was assayed on different chain length substrates. No functional LipR variants could be obtained when Tyr 110 was replaced by any other amino acids, indicating that this is a crucial residue for catalysis. However, among the Asp 111 variants obtained, LipR D111G produced a functional enzyme. Interestingly, this LipR-YGS variant showed less activity than wild type LipR on short- or mid- chain substrates but displayed a 5.6-fold increased activity on long chain length substrates. Analysis of the 3D model and in silico docking studies of this enzyme variant suggest that substitution of Asp by Gly produces a wider entrance tunnel that would allow for a better and tight accommodation of larger substrates, thus justifying the experimental results obtained. Copyright © 2017 Elsevier Inc. All rights reserved.

European survey on the content of lead in lip products.

PubMed

Piccinini, Paola; Piecha, Małgorzata; Torrent, Salvador Fortaner

2013-03-25

223 lip articles (representing 55 brands) were purchased in 15 European Union Member States and analysed for lead content. Various lip products (lipsticks and lip glosses), shades (red, brown, purple and pink) and price ranges (3 categories) were investigated. The analytical method employed a microwave-assisted acid digestion followed by ICP-MS determination. The results revealed that 49 samples (22%) contained lead at a level higher than 1mg/kg, representing 31% of the tested lipsticks and 4% of the lip glosses. On average, the lead content found in lipsticks (0.75mg/kg) was nearly double that found in lip glosses (0.38mg/kg) and this difference was judged statistically significant at 95% probability. Apart from brown, statistically significant higher levels of lead were also found when comparing the average lead contents in lipsticks and lip glosses of the same shade: pink (0.81 and 0.38mg/kg), purple (0.88 and 0.37mg/kg) and red (0.58 and 0.25mg/kg). The influence of price on lead content was studied on the two lip product types separately. In the case of lip glosses no differences were found. In the case of lipsticks, the more expensive items (price category III) contained a significantly lower quantity of lead in comparison to the cheapest articles (price category I). The lipsticks containing the highest levels of lead belonged to the price category II. In all cases, however, the actual lead concentration measured in the finished products is far below the recommended limits for Germany (20mg/kg) or Canada (10mg/kg). The outcome of this work delivers information about the current situation on the European market and provides information to policy-makers about the quantities of lead in lip articles and technically achievable levels. Copyright © 2012 Elsevier B.V. All rights reserved.

Hepatocyte-targeted delivery using ph-sensitive liposomes loaded with lactosylnorcantharidin phospholipid complex: preparation, characterization, and therapeutic evaluation in vivo and in vitro.

PubMed

Qiao-ling, Z; Yi, Z; Min, G; Di-jia, Y; Xiao-feng, Z; Yang, L; Jing-yu, X; Ying, W; Zong-lin, G; Kong-lang, X; Ai-jun, Z; Wei-liang, C; Lin-sen, S; Xue-nong, Z; Qiang, Z

2012-01-01

Liposomes loaded with lactosyl-norcantharidin phospholipid complex (LPC) were prepared, in which soybean phosphatidylcholine was used to improve the liposolubility of lactosyl-norcantharidin (Lac-NCTD). The pH-sensitive LPC liposomes (pH-LPC-lips) were obtained by electrostatic adsorption of the carboxymethyl chitosan onto the surface of the liposomes. The in vitro drug release of pH-LPC-lips and LPC-lips was investigated in dissolution media with pH ranging from 1.0 to 8.0. The in vitro antitumor activity and cellular uptake of Lac-NCTD and its liposomes to HepG2 cells were studied. The pH-LPC-lips demonstrated strong cytotoxicity against the cells and easily permeated the cell membrane. The in vivo antitumor activities of Lac-NCTD and its liposomes were evaluated in mice bearing H22 liver tumors. The pH-LPC-lips displayed the best tumor inhibitory effect. The optical imaging results indicated that Cy7- labeled pH-LPC-lips showed excellent hepatocyte specificity in H22 tumor-bearing mice. Therefore, pH-LPC-lips can be regarded as liver-targeting agents that combine targeting and active releasing.

A case of labio-facial necrotizing fasciitis complicating acne.

PubMed

Eltayeb, Amel Salah; Ahmad, Abdelnasir Gafar; Elbeshir, Elnour Ibrahim

2016-04-23

Facial necrotizing fasciitis is extremely rare. Most of the cases reported in literature are related to dental, sinus, tonsillar and salivary glands causes, but rarely as consequence of skin infection. We report a unique case of lower lip cellulitis, which was initially misdiagnosed as angioedema and subsequently progressed into lower lip necrotizing fasciitis. This is a case report of necrotizing fasciitis involving the lower lip as a consequence of infected skin acne in a 19 year old black female. The patient had been diagnosed earlier as a case of angioedema by a physician and treated accordingly. She was mildly anemic, hyponatremic and hypokalemic. Treatment was started immediately by incision, drainage and full debridement of the whole necrotic tissue. Triple antibiotic therapy was administered and daily irrigation and dressing were performed until full recovery. Complete healing occurred within a month by secondary intention. This case demonstrates the misdiagnosis of a lip swelling leading to the development of labiofacial necrotizing fasciitis, a serious and life threatening condition. Lip angioedema is a common condition; however, lip fasciitis is rare. A broad differential diagnosis in case of lower lip swelling is essential to avoid inappropriate treatment delay.

Lip Movement Exaggerations During Infant-Directed Speech

PubMed Central

Green, Jordan R.; Nip, Ignatius S. B.; Wilson, Erin M.; Mefferd, Antje S.; Yunusova, Yana

2011-01-01

Purpose Although a growing body of literature has indentified the positive effects of visual speech on speech and language learning, oral movements of infant-directed speech (IDS) have rarely been studied. This investigation used 3-dimensional motion capture technology to describe how mothers modify their lip movements when talking to their infants. Method Lip movements were recorded from 25 mothers as they spoke to their infants and other adults. Lip shapes were analyzed for differences across speaking conditions. The maximum fundamental frequency, duration, acoustic intensity, and first and second formant frequency of each vowel also were measured. Results Lip movements were significantly larger during IDS than during adult-directed speech, although the exaggerations were vowel specific. All of the vowels produced during IDS were characterized by an elevated vocal pitch and a slowed speaking rate when compared with vowels produced during adult-directed speech. Conclusion The pattern of lip-shape exaggerations did not provide support for the hypothesis that mothers produce exemplar visual models of vowels during IDS. Future work is required to determine whether the observed increases in vertical lip aperture engender visual and acoustic enhancements that facilitate the early learning of speech. PMID:20699342

Evaluation of recovery in lip closing pressure and occlusal force and contact area after orthognathic surgery.

PubMed

Ueki, Koichiro; Moroi, Akinori; Sotobori, Megumi; Ishihara, Yuri; Marukawa, Kohei; Iguchi, Ran; Kosaka, Akihiko; Ikawa, Hiroumi; Nakazawa, Ryuichi; Higuchi, Masatoshi

2014-10-01

The purpose of this study was to evaluate the relationship between lip closing force, occlusal contact area and occlusal force after orthognathic surgery in skeletal Class III patients. The subjects consisted of 54 patients (28 female and 26 male) diagnosed with mandibular prognathism who underwent sagittal split ramus osteotomy with and without Le Fort I osteotomy. Maximum and minimum lip closing forces, occlusal contact area and occlusal force were measured pre-operatively, 6 months and 1 year post-operative. Maximum and minimum lip closing forces, occlusal contact area and occlusal force increased with time after surgery, however a significant increase was not found in the occlusal contact area in women. In increased ratio (6 months/pre-operative and 1 year/pre-operative), the maximum lip closing force was significantly correlated with the occlusal contact area (P < 0.0001). This study suggested that orthognathic surgery could improve the occlusal force, contact area and lip closing force, and an increase ratio in maximum lip closing force was associated with an increased ratio in occlusal contact area. Copyright © 2014 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Prevalence and evaluation of environmental risk factors associated with cleft lip and palate in a central Indian population.

PubMed

Kalaskar, Ritesh; Kalaskar, Ashita; Naqvi, Fatama Sana; Tawani, Gopal S; Walke, Damayanti R

2013-01-01

Cleft lip and palate, the most common developmental deformity seen worldwide, may be either genetic or environmental in origin. Recent research clearly shows the inter-relationship between environmental risk factors and development of oral clefts. The purpose of this study was to determine the prevalence of cleft lip and palate in the Nagpur region of India and to evaluate environmental risk factors associated with the occurrence of this orofacial abnormality. The parents of infants born with or without cleft lip and palate were subjected to questionnaires that elicited sociodemographic profiles and histories of maternal dietary, medical, and environmental risk factors as well family histories of cleft. A multifactorial comparison of environmental risk factors associated with this deformity was performed. The prevalence of cleft lip and palate and cleft palate was found to be 0.66% and 0.27%, respectively, in the Nagpur region. The results demonstrated a positive association between cleft lip and palate and the environmental risk factors of nutritional deficiency, anemia, and self-administered medications. Several environmental risk factors appear to play an important role in the development of cleft lip and palate in a Central Indian population of low socioeconomic status.

Photodynamic Therapy With HPPH in Treating Patients With Squamous Cell Carcinoma of the Oral Cavity

ClinicalTrials.gov

2016-04-19

Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Recurrent Squamous Cell Carcinoma of the Oropharynx; Recurrent Verrucous Carcinoma of the Oral Cavity; Stage I Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage I Squamous Cell Carcinoma of the Oropharynx; Stage I Verrucous Carcinoma of the Oral Cavity; Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Squamous Cell Carcinoma of the Oropharynx; Stage II Verrucous Carcinoma of the Oral Cavity; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Verrucous Carcinoma of the Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Oropharynx; Stage IVA Verrucous Carcinoma of the Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Oropharynx; Stage IVB Verrucous Carcinoma of the Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Oropharynx; Stage IVC Verrucous Carcinoma of the Oral Cavity

7 CFR 54.1 - Meaning of words.

Code of Federal Regulations, 2013 CFR

2013-01-01

... such organs and parts as livers, kidneys, sweetbreads, brains, lungs, spleens, stomachs, tripe, lips... effectuate use of such quality systems to meet contractual requirements, or as a marketing tool. Service...

7 CFR 54.1 - Meaning of words.

Code of Federal Regulations, 2014 CFR

2014-01-01

... such organs and parts as livers, kidneys, sweetbreads, brains, lungs, spleens, stomachs, tripe, lips... effectuate use of such quality systems to meet contractual requirements, or as a marketing tool. Service...

7 CFR 54.1 - Meaning of words.

Code of Federal Regulations, 2012 CFR

2012-01-01

... such organs and parts as livers, kidneys, sweetbreads, brains, lungs, spleens, stomachs, tripe, lips... effectuate use of such quality systems to meet contractual requirements, or as a marketing tool. Service...

Lower Lip Suspension Using Bilateral Temporalis Muscle Flaps and Fascia Lata Grafts

DTIC Science & Technology

2012-01-01

from recurrent lower lip drooping, mani- fested as drooling, dribbling, and speech problems, and it is a cause of much social embarrassment. The ideal...to simulate the lower lip in repose , erring on the tight side with the expectation that some laxity will result postoperatively (Fig. 2). Fig. 1. A...lower lip in repose , erring on the tight side with the expec- tation that some laxity will result postoperatively. Fig. 3. A 16-year-old girl

Two-Dimensional Bifurcated Inlet Variable Cowl Lip Test Completed in 10- by 10-Foot Supersonic Wind Tunnel

NASA Technical Reports Server (NTRS)

Hoffman, T. R.

2000-01-01

Researchers at the NASA Glenn Research Center at Lewis Field successfully tested a variable cowl lip inlet at simulated takeoff conditions in Glenn s 10- by 10-Foot Supersonic Wind Tunnel (10x10 SWT) as part of the High-Speed Research Program. The test was a follow-on to the Two-Dimensional Bifurcated (2DB) Inlet/Engine test. At the takeoff condition for a High-Speed Civil Transport aircraft, the inlet must provide adequate airflow to the engine with an acceptable distortion level and high-pressure recovery. The test was conducted to study the effectiveness of installing two rotating lips on the 2DB Inlet cowls to increase mass flow rate and eliminate or reduce boundary layer flow separation near the lips. Hardware was mounted vertically in the test section so that it extended through the tunnel ceiling and that the 2DB Inlet was exposed to the atmosphere above the test section. The tunnel was configured in the aerodynamic mode, and exhausters were used to pump down the tunnel to vacuum levels and to provide a maximum flow rate of approximately 58 lb/sec. The test determined the (1) maximum flow in the 2DB Inlet for each variable cowl lip, (2) distortion level and pressure recovery for each lip configuration, (3) boundary layer conditions near variable lips inside the 2DB Inlet, (4) effects of a wing structure adjacent to the 2DB Inlet, and (5) effects of different 2DB Inlet exit configurations. It also employed flow visualization to generate enough qualitative data on variable lips to optimize the variable lip concept. This test was a collaborative effort between the Boeing Company and Glenn. Extensive inhouse support at Glenn contributed significantly to the progress and accomplishment of this test.

Nasal Airway Dysfunction in Children with Cleft Lip and Cleft Palate: Results of a Cross-Sectional Population-Based Study, with Anatomical and Surgical Considerations.

PubMed

Sobol, Danielle L; Allori, Alexander C; Carlson, Anna R; Pien, Irene J; Watkins, Stephanie E; Aylsworth, Arthur S; Meyer, Robert E; Pimenta, Luiz A; Strauss, Ronald P; Ramsey, Barry L; Raynor, Eileen; Marcus, Jeffrey R

2016-12-01

The aesthetic aspects of the cleft lip nasal deformity have been appreciated for over a century, but the functional implications have remained largely underappreciated or misunderstood. This study describes the frequency and severity of nasal obstructive symptoms among children with cleft lip and/or cleft palate, addressing the hypotheses that age, cleft type, and severity are associated with the development of nasal obstructive symptoms. Children with nonsyndromic cleft lip and/or cleft palate and a comparison group of unaffected children born from 1997 to 2003 were identified through the North Carolina Birth Defects Monitoring Program and birth certificates. Nasal airway obstruction was measured using the validated Nasal Obstruction Symptom Evaluation scale. The survey was completed by parental proxy for 176 children with cleft lip and/or cleft palate and 333 unaffected children. Nasal obstructive symptoms were more frequently reported in cleft lip with cleft palate compared with unaffected children (p < 0.0001); children who had isolated cleft lip with or without alveolus and isolated cleft palate were not statistically different from unaffected children. Patients with unilateral cleft lip with cleft palate were found to be more severely affected than bilateral cases. Nasal obstruction was observed in early childhood, although severity worsened in adolescence. This population-based study reports a high prevalence of nasal obstructive symptoms in children with cleft lip and/or cleft palate based on type and severity of the cleft. The authors encourage cleft teams to consider using this or similar screening methods to identify which children may benefit from functional rhinoplasty. Risk, I.

Behavioral Signs of (Central) Auditory Processing Disorder in Children With Nonsyndromic Cleft Lip and/or Palate: A Parental Questionnaire Approach.

PubMed

Ma, Xiaoran; McPherson, Bradley; Ma, Lian

2016-03-01

Objective Children with nonsyndromic cleft lip and/or palate often have a high prevalence of middle ear dysfunction. However, there are also indications that they may have a higher prevalence of (central) auditory processing disorder. This study used Fisher's Auditory Problems Checklist for caregivers to determine whether children with nonsyndromic cleft lip and/or palate have potentially more auditory processing difficulties compared with craniofacially normal children. Methods Caregivers of 147 school-aged children with nonsyndromic cleft lip and/or palate were recruited for the study. This group was divided into three subgroups: cleft lip, cleft palate, and cleft lip and palate. Caregivers of 60 craniofacially normal children were recruited as a control group. Hearing health tests were conducted to evaluate peripheral hearing. Caregivers of children who passed this assessment battery completed Fisher's Auditory Problems Checklist, which contains 25 questions related to behaviors linked to (central) auditory processing disorder. Results Children with cleft palate showed the lowest scores on the Fisher's Auditory Problems Checklist questionnaire, consistent with a higher index of suspicion for (central) auditory processing disorder. There was a significant difference in the manifestation of (central) auditory processing disorder-linked behaviors between the cleft palate and the control groups. The most common behaviors reported in the nonsyndromic cleft lip and/or palate group were short attention span and reduced learning motivation, along with hearing difficulties in noise. Conclusion A higher occurrence of (central) auditory processing disorder-linked behaviors were found in children with nonsyndromic cleft lip and/or palate, particularly cleft palate. Auditory processing abilities should not be ignored in children with nonsyndromic cleft lip and/or palate, and it is necessary to consider assessment tests for (central) auditory processing disorder when an auditory diagnosis is made for this population.

Perceptual distortion of face deletion by local anaesthesia of the human lips and teeth.

PubMed

Türker, Kemal S; Yeo, Purdee L M; Gandevia, Simon C

2005-08-01

As visual guidance of facial movements is impossible, accurate movements for speech and mastication require an established body image that is formed via the information from mechanoreceptors in the skin, mucosa, periodontium, and proprioceptors in the facial and masticatory muscles and in the jaw joints. In this study we aimed to investigate how the acute deafferentation of lips and teeth alters the established image of lips, teeth and the thumb. We used a psychophysical method to determine whether the perceived sizes of the upper lip and front teeth change when the sensory input from the lips and front teeth is fully blocked. We also examined the perceived size of the thumb to test for acute interactions between the thumb and facial structures. Local anaesthetic blocking of upper lip and upper front teeth significantly increased the perceived size of the upper lip by as much as 100% (range 21-100%) in ten out of eleven subjects tested (overall mean 52%; p=0.001). The perceived size of the upper teeth also significantly increased by as much as 155% (range 30-155%) in eight of the eleven subjects during anaesthesia (overall mean 41%; p=0.035). When the region of anaesthesia was increased and both upper and lower teeth and lips were anaesthetised, the perceived size of the upper lip again increased, by 53% (p=0.040), but the change in perceived size of the upper front teeth (18%) was not significant (p=0.206). In both studies there was no change in perceived size of the thumb. The results illustrate the labile central interaction between sensory inputs and the importance of feedback from peripheral afferents in generating the subjective facial image. The timing, level, and area of anaesthesia may be important modifiers of these interactions.

A Comparative Cost Analysis of Cleft Lip Adhesion and Nasoalveolar Molding before Formal Cleft Lip Repair.

PubMed

Shay, Paul L; Goldstein, Jesse A; Paliga, J Thomas; Wink, Jason; Jackson, Oksana A; Low, David; Bartlett, Scott P; Taylor, Jesse A

2015-12-01

Patients with complete cleft lip and palate may benefit from cleft lip adhesion or nasoalveolar molding before formal cleft lip repair. The authors compared the relative costs to insurers of these two treatment modalities and the burden of care to families. A retrospective analysis was performed of cleft lip and palate patients treated with nasoalveolar molding or cleft lip adhesion at The Children's Hospital of Philadelphia between January of 2007 and June of 2012. Demographic, appointment, and surgical data were reviewed; surgical, inpatient hospital, and orthodontic charges and costs were obtained. Multivariate linear regression and two-sample, two-tailed independent t tests were performed to compare cost and appointment data between groups. Forty-two cleft adhesion and 35 nasoalveolar molding patients met inclusion criteria. Mean costs for nasoalveolar molding were $3550.24 ± $667.27. Cleft adhesion costs, consisting of both hospital and surgical costs, were $9370.55 ± $1691.79. Analysis of log costs demonstrated a significant difference between the groups, with the mean total cost for nasoalveolar molding significantly lower than that for adhesion (p < 0.0001). Nasoalveolar molding patients had significantly more made, cancelled, no-show, and missed visits and a higher missed percentage than adhesion patients (p < 0.0001) for all except no-show appointments, (p = 0.0199), indicating a higher burden of care to families. Nasoalveolar molding may cost less before formal cleft lip repair treatment than cleft lip adhesion. Third-party payers who cover adhesion and not nasoalveolar molding may not be acting in their own best interest. Nasoalveolar molding places a higher burden of care on families, and this fact should be considered in planning treatment.

Parsing parallel evolution: ecological divergence and differential gene expression in the adaptive radiations of thick-lipped Midas cichlid fishes from Nicaragua.

PubMed

Manousaki, Tereza; Hull, Pincelli M; Kusche, Henrik; Machado-Schiaffino, Gonzalo; Franchini, Paolo; Harrod, Chris; Elmer, Kathryn R; Meyer, Axel

2013-02-01

The study of parallel evolution facilitates the discovery of common rules of diversification. Here, we examine the repeated evolution of thick lips in Midas cichlid fishes (the Amphilophus citrinellus species complex)-from two Great Lakes and two crater lakes in Nicaragua-to assess whether similar changes in ecology, phenotypic trophic traits and gene expression accompany parallel trait evolution. Using next-generation sequencing technology, we characterize transcriptome-wide differential gene expression in the lips of wild-caught sympatric thick- and thin-lipped cichlids from all four instances of repeated thick-lip evolution. Six genes (apolipoprotein D, myelin-associated glycoprotein precursor, four-and-a-half LIM domain protein 2, calpain-9, GTPase IMAP family member 8-like and one hypothetical protein) are significantly underexpressed in the thick-lipped morph across all four lakes. However, other aspects of lips' gene expression in sympatric morphs differ in a lake-specific pattern, including the magnitude of differentially expressed genes (97-510). Generally, fewer genes are differentially expressed among morphs in the younger crater lakes than in those from the older Great Lakes. Body shape, lower pharyngeal jaw size and shape, and stable isotopes (δ(13)C and δ(15)N) differ between all sympatric morphs, with the greatest differentiation in the Great Lake Nicaragua. Some ecological traits evolve in parallel (those related to foraging ecology; e.g. lip size, body and head shape) but others, somewhat surprisingly, do not (those related to diet and food processing; e.g. jaw size and shape, stable isotopes). Taken together, this case of parallelism among thick- and thin-lipped cichlids shows a mosaic pattern of parallel and nonparallel evolution. © 2012 Blackwell Publishing Ltd.

Image-guided thermal therapy with a dual-contrast magnetic nanoparticle formulation: A feasibility study

PubMed Central

Attaluri, Anilchandra; Seshadri, Madhav; Mirpour, Sahar; Wabler, Michele; Marinho, Thomas; Furqan, Muhammad; Zhou, Haoming; De Paoli, Silvia; Gruettner, Cordula; Gilson, Wesley; DeWeese, Theodore; Garcia, Monica; Ivkov, Robert; Liapi, Eleni

2016-01-01

Purpose/objective The aim of this study was to develop and investigate the properties of a magnetic iron oxide nanoparticle–ethiodised oil formulation for image-guided thermal therapy of liver cancer. Materials and methods The formulation comprises bionised nano-ferrite (BNF) nanoparticles suspended in ethiodised oil, emulsified with polysorbate 20 (BNF-lip). Nanoparticle size was measured via photon correlation spectroscopy and transmission electron microscopy. In vivo thermal therapy capability was tested in two groups of male Foxn1nu mice bearing subcutaneous HepG2 xenograft tumours. Group I (n =12) was used to screen conditions for group II (n =48). In group II, mice received one of BNF-lip (n =18), BNF alone (n =16), or PBS (n =14), followed by alternating magnetic field (AMF) hyperthermia, with either varied duration (15 or 20 min) or amplitude (0, 16, 20, or 24 kA/m). Image-guided fluoroscopic intra-arterial injection of BNF-lip was tested in New Zealand white rabbits (n =10), bearing liver VX2 tumours. The animals were subsequently imaged with CT and 3 T MRI, up to 7 days post-injection. The tumours were histopathologically evaluated for distribution of BNF-lip. Results The BNF showed larger aggregate diameters when suspended in BNF-lip, compared to clear solution. The BNF-lip formulation produced maximum tumour temperatures with AMF >20 kA/m and showed positive X-ray visibility and substantial shortening of T1 and T2 relaxation time, with sustained intratumoural retention up to 7 days post-injection. On pathology, intratumoural BNF-lip distribution correlated well with CT imaging of intratumoural BNF-lip distribution. Conclusion The BNF-lip formulation has favourable thermal and dual imaging capabilities for image-guided thermal therapy of liver cancer, suggesting further exploration for clinical applications. PMID:27151045

Self-esteem, coping styles, and quality of life in polish adolescents and young adults with unilateral cleft lip and palate.

PubMed

Pisula, Ewa; Lukowska, Ewa; Fudalej, Piotr S

2014-05-01

Objectives : To evaluate self-esteem, coping styles, and health-related quality of life and their relationships in Polish adolescents and young adults with unilateral complete cleft lip and palate and related sex differences. Design and Participants : Self-report questionnaires measuring self-esteem (Multidimensional Self-Esteem Inventory), coping styles (Coping Inventory for Stressful Situations), and health-related quality of life (WHOQOL-BREF) were completed by 48 participants with cleft lip and palate (age, 16 to 23 years; 31 males, 17 females) and 48 controls without cleft lip and palate (age, 16 to 23 years; 28 males, 20 females) matched for age, place of residence, and socioeconomic status. Results : Regarding self-esteem, individuals with cleft lip and palate scored higher on body functioning (P < .01) and defensive self-enhancement (P < .05). Self-control showed an interaction effect: Females with cleft lip and palate scored higher than controls, but males did not differ between groups (P < .05). Males with cleft lip and palate scored lower than controls in personal power but higher in body functioning (P < .05); females showed no differences between groups. The groups did not differ with regard to coping styles or quality of life, but several correlations were found between self-esteem and coping styles, and quality of life (P < .01). Conclusions : Late adolescents and young adults with and without cleft lip and palate differed little in terms of psychological adjustment measures. The higher scores in defensive self-enhancement of individuals with cleft lip and palate suggest the need for instruments measuring social approval in psychosocial adjustment research involving this group.

Novel Strategy of Using Methyl Esters as Slow Release Methanol Source during Lipase Expression by mut+ Pichia pastoris X33

PubMed Central

Kumari, Arti; Gupta, Rani

2014-01-01

One of the major issues with heterologous production of proteins in Pichia pastoris X33 under AOX1 promoter is repeated methanol induction. To obviate repeated methanol induction, methyl esters were used as a slow release source of methanol in lipase expressing mut+ recombinant. Experimental design was based on the strategy that in presence of lipase, methyl esters can be hydrolysed to release their products as methanol and fatty acid. Hence, upon break down of methyl esters by lipase, first methanol will be used as a carbon source and inducer. Then P. pastoris can switch over to fatty acid as a carbon source for multiplication and biomass maintenance till further induction by methyl esters. We validated this strategy using recombinant P. pastoris expressing Lip A, Lip C from Trichosporon asahii and Lip11 from Yarrowia lipolytica. We found that the optimum lipase yield under repeated methanol induction after 120 h was 32866 U/L, 28271 U/L and 21978 U/L for Lip C, Lip A and Lip 11 respectively. In addition, we found that a single dose of methyl ester supported higher production than repeated methanol induction. Among various methyl esters tested, methyl oleate (0.5%) caused 1.2 fold higher yield for LipA and LipC and 1.4 fold for Lip11 after 120 h of induction. Sequential utilization of methanol and oleic acid by P. pastoris was observed and was supported by differential peroxisome proliferation studies by transmission electron microscopy. Our study identifies a novel strategy of using methyl esters as slow release methanol source during lipase expression. PMID:25170843

Potential economic benefit of cleft lip and palate repair in sub-Saharan Africa.

PubMed

Alkire, Blake; Hughes, Christopher D; Nash, Katherine; Vincent, Jeffrey R; Meara, John G

2011-06-01

Acceptance of basic surgical care as an essential element of any properly functioning health system is growing. To justify investment in surgical interventions, donors require estimates of the economic benefit of treating surgical disease. The present study aimed to establish a methodology for valuing the potential economic benefit of surgical intervention using cleft lip and palate (CLP) in sub-Saharan Africa (SSA) as a model. Economic modeling of cleft lip and cleft palate (CLP) in SSA was performed with retrospective demographic and economic data from 2008. The total number of Disability-Adjusted Life-Years (DALYs) secondary to CLP in 2008 was calculated from accepted clefting incidence rates and disability weights taken from the Global Burden of Disease Project. DALYs were then converted to monetary terms ($US), using both a human capital approach and Value of a Statistical Life (VSL) approach. With the human capital approach, the potential economic benefit if all incident cases of CLP in SSA in 2008 were repaired at birth ranged from $252 million to $441 million. With VSL, the potential economic benefit of the same CLP repair would range from $5.4 billion to $9.7 billion. Cleft lip and cleft palate can have a substantial impact on the economic health of countries in the developing world. Further studies should be directed at quantifying the economic benefit of surgical interventions and quantifying their costs with an economically sound approach.

Changes in nasorespiratory function in association with maxillary distraction osteogenesis in subjects with cleft lip and palate.

PubMed

Saito, Kiyo; Ono, Takashi; Mochida, Masumi; Ohyama, Kimie

2006-01-01

The current study aimed to determine how nasorespiratory function changes in association with maxillary distraction osteogenesis (DO). Furthermore, with regard to impaired nasorespiratory function, the possibility of a relationship between the cleft side and laterality and any effect of maxillary distraction osteogenesis was investigated. In this descriptive, prospective clinical report, subjective and objective data regarding nasorespiratory function before and after maxillary distraction osteogenesis were compared. Data from 13 subjects with cleft lip and palate were used. Subjects had a severe maxillary deficiency and underwent distraction osteogenesis using a rigid external device system. The subjective measure was the score on a questionnaire regarding nasorespiratory function using a visual analog scale. The objective measure was nasal resistance. The visual analog scale score for two items significantly decreased just after distraction osteogenesis. Nasal resistance also significantly decreased 1 year after distraction osteogenesis. Moreover, nasal resistance on the cleft side was significantly greater than that on the noncleft side just before and 1 year after distraction osteogenesis. There was a significant positive correlation between changes in the visual analog scale score and nasal resistance. These results suggest that nasorespiratory function changes in association with maxillary distraction osteogenesis in subjects with cleft lip and palate. Moreover, it appears that nasal obstruction on the cleft side does not change in subjects with unilateral cleft lip and palate.

Visual words for lip-reading

NASA Astrophysics Data System (ADS)

Hassanat, Ahmad B. A.; Jassim, Sabah

2010-04-01

In this paper, the automatic lip reading problem is investigated, and an innovative approach to providing solutions to this problem has been proposed. This new VSR approach is dependent on the signature of the word itself, which is obtained from a hybrid feature extraction method dependent on geometric, appearance, and image transform features. The proposed VSR approach is termed "visual words". The visual words approach consists of two main parts, 1) Feature extraction/selection, and 2) Visual speech feature recognition. After localizing face and lips, several visual features for the lips where extracted. Such as the height and width of the mouth, mutual information and the quality measurement between the DWT of the current ROI and the DWT of the previous ROI, the ratio of vertical to horizontal features taken from DWT of ROI, The ratio of vertical edges to horizontal edges of ROI, the appearance of the tongue and the appearance of teeth. Each spoken word is represented by 8 signals, one of each feature. Those signals maintain the dynamic of the spoken word, which contains a good portion of information. The system is then trained on these features using the KNN and DTW. This approach has been evaluated using a large database for different people, and large experiment sets. The evaluation has proved the visual words efficiency, and shown that the VSR is a speaker dependent problem.

Differential in vivo gene expression of major Leptospira proteins in resistant or susceptible animal models.

PubMed

Matsui, Mariko; Soupé, Marie-Estelle; Becam, Jérôme; Goarant, Cyrille

2012-09-01

Transcripts of Leptospira 16S rRNA, FlaB, LigB, LipL21, LipL32, LipL36, LipL41, and OmpL37 were quantified in the blood of susceptible (hamsters) and resistant (mice) animal models of leptospirosis. We first validated adequate reference genes and then evaluated expression patterns in vivo compared to in vitro cultures. LipL32 expression was downregulated in vivo and differentially regulated in resistant and susceptible animals. FlaB expression was also repressed in mice but not in hamsters. In contrast, LigB and OmpL37 were upregulated in vivo. Thus, we demonstrated that a virulent strain of Leptospira differentially adapts its gene expression in the blood of infected animals.

Interaction Between Spatial and Feature Attention in Posterior Parietal Cortex

PubMed Central

Ibos, Guilhem; Freedman, David J.

2016-01-01

Summary Lateral intraparietal (LIP) neurons encode a vast array of sensory and cognitive variables. Recently, we proposed that the flexibility of feature representations in LIP reflect the bottom-up integration of sensory signals, modulated by feature-based attention (FBA), from upstream feature-selective cortical neurons. Moreover, LIP activity is also strongly modulated by the position of space-based attention (SBA). However, the mechanisms by which SBA and FBA interact to facilitate the representation of task-relevant spatial and non-spatial features in LIP remain unclear. We recorded from LIP neurons during performance of a task which required monkeys to detect specific conjunctions of color, motion-direction, and stimulus position. Here we show that FBA and SBA potentiate each other’s effect in a manner consistent with attention gating the flow of visual information along the cortical visual pathway. Our results suggest that linear bottom-up integrative mechanisms allow LIP neurons to emphasize task-relevant spatial and non-spatial features. PMID:27499082

C/EBPβ LIP augments cell death by inducing osteoglycin.

PubMed

Wassermann-Dozorets, Rina; Rubinstein, Menachem

2017-04-06

Many types of tumor cell are devoid of the extracellular matrix proteoglycan osteoglycin (Ogn), but its role in tumor biology is poorly studied. Here we show that RNAi of Ogn attenuates stress-triggered cell death, whereas its overexpression increases cell death. We found that the transcription factor C/EBPβ regulates the expression of Ogn. C/EBPβ is expressed as a full-length, active form (LAP) and as a truncated, dominant-negative form (LIP), and the LIP/LAP ratio is positively correlated with the extent of cell death under stress. For example, we reported that drug-resistant tumor cells lack LIP altogether, and its supplementation abolished their resistance to chemotherapy and to endoplasmic reticulum (ER) stress. Here we further show that elevated LIP/LAP ratio robustly increased Ogn expression and cell death under stress by modulating the mitogen-activated protein kinase/activator protein 1 pathway (MAPK/AP-1). Our findings suggest that LIP deficiency renders tumor cell resistant to ER stress by preventing the induction of Ogn.

Liquid nitrogen cryotherapy for lip mucous membrane venous malformation in infants.

PubMed

Zhang, Da-Ming; Wang, You-Yuan; Lin, Zhao-Yu; Yang, Zhao-Hui; Chen, Wei-Liang

2015-03-01

Lip mucous membrane venous malformations are common benign lesions in infants. This clinical study evaluates the efficacy and safety of liquid nitrogen cryotherapy used to treat this condition. A total of 84 pediatric patients undergoing liquid nitrogen cryotherapy for venous malformations involving the lips were reviewed, with 45 males and 39 females treated. The overall median age at mucous membrane venous malformation diagnosis was 5.6 months (range 2-18 months). The venous malformations involved the vermilion of the lower lip in 44 cases, the vermilion of the upper lip in 31 cases, and both vermilions in 9 cases. No complications due to anesthesia occurred. After a follow-up period of 2-38 months (mean 25 months), 65 lesions (77.4 %) were completely involuted, 14 lesions (16.7 %) were mostly involuted, and 5 lesions (5.9 %) were partially involuted; no lesions showed a minor amount of involution. Liquid nitrogen cryotherapy is an effective, simple, and safe management tool for mucous membrane venous malformations of the lip in infants.

Prevalence of cleft lip and cleft palate in rural north-central guatemala.

PubMed

Matute, Jorge; Lydick, Elaine A; Torres, Olga R; Owen, Karen K; Jacobsen, Kathryn H

2015-05-01

To estimate the number of new cases of cleft lip and cleft palate in the department (state) of Alta Verapaz, Guatemala, in 2012. Cross-sectional survey of midwives from communities identified through a two-stage cluster-sampling process. Midwives were asked how many babies they had delivered in the past year and how many of those newborns had various types of birth defects, as illustrated in pictures. Indigenous Mayan communities in rural north-central Guatemala. Midwives (n = 129) who had delivered babies in the previous year. Reports of babies born with cleft lip and cleft palate. A 1-year prevalence rate of 18.9 per 10,000 for cleft lip and 4.7 per 10,000 for cleft palate was estimated for Alta Verapaz. None of the cases of cleft lip also had cleft palate. The indigenous communities in north-central Guatemala might have a relatively high cleft lip prevalence rate compared with the global average.

Interaction between Spatial and Feature Attention in Posterior Parietal Cortex.

PubMed

Ibos, Guilhem; Freedman, David J

2016-08-17

Lateral intraparietal (LIP) neurons encode a vast array of sensory and cognitive variables. Recently, we proposed that the flexibility of feature representations in LIP reflect the bottom-up integration of sensory signals, modulated by feature-based attention (FBA), from upstream feature-selective cortical neurons. Moreover, LIP activity is also strongly modulated by the position of space-based attention (SBA). However, the mechanisms by which SBA and FBA interact to facilitate the representation of task-relevant spatial and non-spatial features in LIP remain unclear. We recorded from LIP neurons during performance of a task that required monkeys to detect specific conjunctions of color, motion direction, and stimulus position. Here we show that FBA and SBA potentiate each other's effect in a manner consistent with attention gating the flow of visual information along the cortical visual pathway. Our results suggest that linear bottom-up integrative mechanisms allow LIP neurons to emphasize task-relevant spatial and non-spatial features. Copyright © 2016 Elsevier Inc. All rights reserved.

Lip movements entrain the observers’ low-frequency brain oscillations to facilitate speech intelligibility

PubMed Central

Park, Hyojin; Kayser, Christoph; Thut, Gregor; Gross, Joachim

2016-01-01

During continuous speech, lip movements provide visual temporal signals that facilitate speech processing. Here, using MEG we directly investigated how these visual signals interact with rhythmic brain activity in participants listening to and seeing the speaker. First, we investigated coherence between oscillatory brain activity and speaker’s lip movements and demonstrated significant entrainment in visual cortex. We then used partial coherence to remove contributions of the coherent auditory speech signal from the lip-brain coherence. Comparing this synchronization between different attention conditions revealed that attending visual speech enhances the coherence between activity in visual cortex and the speaker’s lips. Further, we identified a significant partial coherence between left motor cortex and lip movements and this partial coherence directly predicted comprehension accuracy. Our results emphasize the importance of visually entrained and attention-modulated rhythmic brain activity for the enhancement of audiovisual speech processing. DOI: http://dx.doi.org/10.7554/eLife.14521.001 PMID:27146891

Lu-Hf isotope constraints on plume-lithosphere interaction during emplacement of the Bushveld Large Igneous Province at 2.06 Ga: Implications for the structure and evolution of the Kaapvaal Craton's lithospheric mantle

NASA Astrophysics Data System (ADS)

Zirakparvar, N. A.; Mathez, E. A.; Rajesh, H.; Vervoort, J. D.; Choe, S.

2016-12-01

The Bushveld Large Igneous Province (B-LIP) comprises a diverse array of >30 magma bodies that intruded the Kaapvaal Craton at 2.06 Ga. In this talk we use zircon and bulk-rock Lu-Hf isotope data to show that the B-LIP formed in response to the arrival of a plume(s) from the deep mantle. New zircon Hf isotope compositions for four B-LIP bodies yield intrusion-specific average ɛHf (2.06 Ga) values that range from -20.7 ± 2.8 to -2.7 ± 2.8, largely consistent with literature zircon data for other B-LIP intrusions. Bulk-rock solution ɛHf (2.06 Ga) values for a variety of B-LIP intrusions range from -2.1 ± 0.2 to -10.6 ± 0.2. Because the most radiogenic Hf isotope compositions across the entire B-LIP are nearly primordial with an ɛHf (2.06 Ga) close to 0, it is likely that the heat source of the B-LIP was a plume(s) from deep mantle. The Hf isotope data further suggests that individual intrusions in the B-LIP can be grouped into four categories based on their ultimate sources: 1) melts generated in subduction and plume modified continental lithospheric mantle; 2) melts generated by melting of a mafic-ultramafic reservoir composed of older ( 2.7 Ga) plume-related material trapped in the Kaapvaal lithosphere; 3) melts generated in the mid- to upper crust; and 4) melts generated from the 2.06 Ga mantle plume itself. The presence of 2.7 Ga mafic-ultramafic material in the Kaapvaal lithosphere may have acted to strengthen the lithosphere so that it was able to resist being dispered by the arrival of the B-LIP plume at 2.06 Ga. Because the B-LIP extends into a 2.7 Ga aged suture zone between the Kaapvaal and Zimbabwe cratons, it is also possible to understand the role of the lithospheric mantle in producing the Lu-Hf signatures observed in the various B-LIP intrusions as a function of two different types of the continental lithosphere: The very old lithosphere comprising the Kaapvaal Craton and the somewhat younger lithosphere comprising the suture zone. A basic observation is that the Hf isotope signature of the plume source is only directly expressed in B-LIP bodies that intruded the suture zone, providing further evidence that the craton was already underlain by thick lithospheric mantle at the time of B-LIP magmatism.

In vivo oral imaging with integrated portable photoacoustic microscopy and optical coherence tomography

NASA Astrophysics Data System (ADS)

Qin, Wei; Qi, Weizhi; Jin, Tian; Guo, Heng; Xi, Lei

2017-12-01

Oral diseases, especially oral cancers, are becoming serious health problems in humans. To image vasculatures and structures simultaneously in the human oral cavity which are tightly associated with various oral diseases, we develop a dual-modality portable optical resolution photoacoustic microscopy (ORPAM) and optical coherence tomography (OCT) system. This system utilizes a new rotary scanning mechanism and a compact design of the imaging head, making it portable and free of translation of the imaging interface or samples. Through the phantom experiments, both modalities yield high lateral resolutions of 8.1 μm (ORPAM) and 8.56 μm (OCT), respectively. The axial resolutions are measured to be 116.5 μm for ORPAM and 6.1 μm for OCT. In vivo imaging of a mouse ear was carried out to evaluate the performance of the system in biological tissues. In addition, in vivo oral imaging of a healthy human lip and monitoring recovery progress of a lip ulcer demonstrate the clinical potential of this system.

Evaluation of 5-year-old children with complete cleft lip and palate: Multicenter study. Part 1: Lip and nose aesthetic results.

PubMed

Dissaux, Caroline; Bodin, Frédéric; Grollemund, Bruno; Picard, Arnaud; Vazquez, Marie-Paule; Morand, Béatrice; James, Isabelle; Kauffmann, Isabelle; Bruant-Rodier, Catherine

2015-12-01

Cleft surgery is marked by all the controversies and the multiplication of protocols, as it has been shown by the Eurocleft study. The objective of this pilot study is to start a comparison and analyzing procedure between primary surgical protocols in French centers. Four French centers with different primary surgical protocols for cleft lip and palate repair, have accepted to be involved in this retrospective study. In each center, 20 consecutive patients with complete cleft lip and palate (10 UCLP and 10 BCLP per center), non syndromic, have been evaluated at a mean age of 5 [4,6]. In this first part, the aesthetic results of nose and lip repair were assessed based on the scale established by Mortier et al. (1997). Considering nose outcome, primary cleft repair surgery including a nasal dissection gives a statistically significant benefit in terms of septum deviation. Considering lip result, muscular dehiscence rate is significantly higher in BCLP patients with a two-stage lip closure. The centers using Millard one-stage lip closure do not have uniform results. For UCLP patients, the quality of scar is not statistically different between Skoog and Millard techniques. Primary results based on a simple, reproducible evaluation protocol. Extension to other centers required. Therapeutic study. Level III/retrospective multicenter comparative study. Copyright © 2015 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

The Effectiveness of Psychosocial Intervention for Individuals With Cleft Lip and/or Palate.

PubMed

Norman, Alyson; Persson, Martin; Stock, Nicola; Rumsey, Nichola; Sandy, Jonathan; Waylen, Andrea; Edwards, Zoe; Hammond, Vanessa; Partridge, Lucy; Ness, Andy

2015-05-01

The aim of this review was to assess the effectiveness of different psychological interventions for children and adults with cleft lip and/or palate and their parents. We searched six databases including MEDLINE and EMBASE to June 2013 and checked bibliographies. We included research that evaluated any psychological intervention in studies in which at least 90% of the participants had cleft lip and/or palate or were parents of those with cleft lip and/or palate. Studies containing less than 90% were excluded unless they reported results separately for those with cleft lip and/or palate, or raw data were available upon request from the authors. Inclusion assessment, data extraction, and risk of bias assessment were carried out independently by two reviewers. Seven studies were identified as inclusions, with only two studies being included in the full data analysis (one of which failed to meet the full inclusion criteria). The five remaining studies were included only in a narrative synthesis because data were available for people or parents of those with cleft lip and/or palate only. This highlights a distinct dearth of research into psychological intervention within the field of cleft lip and/or palate. The review found no evidence to support any specific intervention. Key uncertainties need to be identified and addressed. Adequately powered, methodologically rigorous randomized controlled trials are needed to provide a secure evidence base for psychological intervention techniques in participants with cleft lip and/or palate and their parents.

Inhibition of adipose tissue PPARγ prevents increased adipocyte expansion after lipectomy and exacerbates a glucose-intolerant phenotype.

PubMed

Booth, A D; Magnuson, A M; Cox-York, K A; Wei, Y; Wang, D; Pagliassotti, M J; Foster, M T

2017-04-01

Adipose tissue plays a fundamental role in glucose homeostasis. For example, fat removal (lipectomy, LipX) in lean mice, resulting in a compensatory 50% increase in total fat mass, is associated with significant improvement in glucose tolerance. This study was designed to further examine the link between fat removal, adipose tissue compensation and glucose homeostasis using a peroxisome proliferator-activated receptor γ (PPAR γ; activator of adipogenesis) knockout mouse. The study involved PPARγ knockout (FKOγ) or control mice (CON), subdivided into groups that received LipX or Sham surgery. We reasoned that as the ability of adipose tissue to expand in response to LipX would be compromised in FKOγ mice, so would improvements in glucose homeostasis. In CON mice, LipX increased total adipose depot mass (~60%), adipocyte number (~45%) and changed adipocyte distribution to smaller cells. Glucose tolerance was improved (~30%) in LipX CON mice compared to Shams. In FKOγ mice, LipX did not result in any significant changes in adipose depot mass, adipocyte number or distribution. LipX FKOγ mice were also characterized by reduction of glucose tolerance (~30%) compared to shams. Inhibition of adipose tissue PPARγ prevented LipX-induced increases in adipocyte expansion and produced a glucose-intolerant phenotype. These data support the notion that adipose tissue expansion is critical to maintain and/or improvement in glucose homeostasis. © 2016 John Wiley & Sons Ltd.

Facial Anthropometric Evaluation of Unilateral Cleft Lip and Palate Patients: Infancy Through Adolescence.

PubMed

Dehghani, Mahboobe; Jahanbin, Arezoo; Omidkhoda, Maryam; Entezari, Mostafa; Shadkam, Elaheh

2018-03-01

Craniofacial anthropometric studies measure the differences in humans' craniofacial dimensions. The aim of this study was to determine facial anthropometric dimensions of newborn to 12-year-old girls with nonsyndromic unilateral cleft lip and palate (UCLP). In this cross-sectional analytical study, data was collected from 65 infant to 12-year old girls with UCLP. Digital frontal and profile facial photographs were transferred to a computer and desired anthropometric landmarks were traced on each image. Fifteen anthropometric parameters were measured which were the angles of facial, nasofacial, nasomental, Z, nasolabial, inclination of nasal base and labial fissure, nasal deviation, mentocervical, facial convexity and also ratios of nasal prominence relative to nasal height, middle to lower facial third, upper lip to lower lip height, columellar length relative to upper lip, and incisal show relative to incisal width. Pearson coefficient and linear regression were used for statistical analysis. Upper lip to lower lip height ratio and angles of nasofacial, nasolabial, and facial convexity decreased with the age of the patients. In contrast, nasomental angle and the ratios of columellar length to upper lip length, middle facial height to lower facial height, and incisal show relative to incisal width increased. Other parameters studied did not appear to have any significant correlation with age. In the girls with UCLP, various craniofacial dimensions have different growth rates with some parts growing slower than others. Some of the parameters studied were significantly correlated with age, thus growth-related curves and equations were obtained and presented.

A novel technique for performing a tongue-lip adhesion-the tongue suspension technique.

PubMed

Mann, Robert J; Neaman, Keith C; Hill, Brian; Bajnrauh, Robert; Martin, Matthew D

2012-01-01

The tongue-lip adhesion has undergone several modifications in an attempt to reduce surgical complications and failure rates. Current techniques rely on the use of a button at the tongue base for suspension, which raises concerns about possible aspiration and interference with oral motor function and bottle-feeding. A new technique for tongue-lip adhesion is proposed that adds a tongue suspension to the standard surgical adhesion. A total of 22 patients with Pierre Robin sequence who received a tongue-lip adhesion via a tongue suspension technique were reviewed. The surgical technique differs from the standard surgical approach by the use of a suture weave across the base of the tongue instead of a standard button to suspend the tongue anteriorly. Average age at the time of tongue-lip adhesion was 13.9 days, with a mean operative time of 88.8 minutes. A marked improvement in postoperative oxygenation was seen in the majority of patients. One dehiscence occurred secondary to a traumatic postoperative extubation, eventually requiring a tracheostomy for subglottic stenosis. A technical innovation for performing a tongue-lip adhesion using a tongue suspension in conjunction with a standard transverse adhesion of the lip is described. The advantage of the tongue-lip adhesion with suspension includes immediate postoperative extubation, as well as removal of concerns regarding button aspiration and possible interference in early developmental oral motor function and bottle-feeding. This technique is reproducible, expanding the craniofacial surgeon's armamentarium for the management of difficult airways in Pierre Robin sequence.

The psychosocial effects of cleft lip and palate in non-Anglo populations: a cross-cultural meta-analysis.

PubMed

Hutchinson, Kathleen; Wellman, Maria A; Noe, Douglas A; Kahn, Alice

2011-09-01

A meta-analytic study was conducted to examine the cross-cultural psychosocial impact of cleft lip and/or palate in non-Anglo populations. A total of 333 citations were initially identified for review using electronic and hand-search strategies. Of the six studies that met inclusion criteria, two were later excluded due to insufficient data. The four remaining studies represented a combined sample size of 2276 adolescents and adults with cleft lip and/or palate from China, Hong Kong, Taiwan, and Norway. Effect size using Cohen's d and confidence intervals were estimated using data from four studies of empirical, controlled study designs. The magnitude of effect sizes indicated that men (d = -0.75) with cleft lip and/or palate in non-Anglo cultures are more prone to psychosocial issues than women (d = -0.33). Adults (d = -0.50) are more impacted than adolescents (d = -0.04). Overall, regardless of age, gender, or culture, individuals with cleft lip and/or palate have lower psychosocial development than individuals without cleft lip and/or palate (d = -0.42). The effects for the cross-cultural comparisons were moderated by the age group and gender of the participants; however, most studies resulted in negative effect sizes. Health care teams for cleft lip and/or palate should recognize the importance of psychological intervention and family support in the treatment of all patients with cleft lip and/or palate throughout the life span.

The relationship between lignin peroxidase and manganese peroxidase production capacities and cultivation periods of mushrooms.

PubMed

Xu, Jian Z; Zhang, Jun L; Hu, Kai H; Zhang, Wei G

2013-05-01

Mushrooms are able to secrete lignin peroxidase (LiP) and manganese peroxidase (MnP), and able to use the cellulose as sources of carbon. This article focuses on the relation between peroxidase-secreting capacity and cultivation period of mushrooms with non-laccase activity. Methylene blue and methyl catechol qualitative assay and spectrophotometry quantitative assay show LiP secreting unvaryingly accompanies the MnP secreting in mushroom strains. The growth rates of hyphae are detected by detecting the dry hyphal mass. We link the peroxidase activities to growth rate of mushrooms and then probe into the relationship between them. The results show that there are close relationships between LiP- and/or MnP-secretory capacities and the cultivation periods of mushrooms. The strains with high LiP and MnP activities have short cultivation periods. However, those strains have long cultivation periods because of the low levels of secreted LiP and/or MnP, even no detectable LiP and/or MnP activity. This study provides the first evidence on the imitate relation between the level of secreted LiP and MnP activities and cultivation periods of mushrooms with non-laccase activity. Our study has significantly increased the understanding of the role of LiP and MnP in the growth and development of mushrooms with non-laccase activity. © 2012 The Authors. Microbial Biotechnology © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

The impact of a single surgical intervention for patients with a cleft lip living in rural Ethiopia.

PubMed

Fell, Matthew J; Hoyle, Tom; Abebe, Mekonen E; Kebede, Yegeremu; Medhin, Yohannes D; Hiwot, Fikre A; Cifeta, Taye H; Ali, Ibrahim M; McGurk, Mark

2014-09-01

Humanitarian organisations commonly provide reconstructive treatment for patients with cleft lip within developing countries, but follow-up is often non-existent, particularly for those living in rural areas. This study aimed to assess whether a single surgical intervention was sufficient to produce an observable change to the life of a patient with cleft lip living in rural Hararghe in eastern Ethiopia. 356 patients with isolated cleft lips, who received a single surgical treatment at least 6 months previously, were evaluated in 21 rural health centres. Patients and their families expressed unhappiness before treatment, mainly because the society reacted negatively towards the deformities, isolating the patients from community activities. Postoperatively, the percentage of school-aged children participating in education increased from 46% to 79%, some older patients were able to marry, but employment was unaffected. The prevalence of wound dehiscence in the lip repair was 3% and occurred more frequently in patients with a bilateral cleft lip compared to a unilateral cleft lip (p < 0.001, RR 49.25, 95% CI 6.7-1037.35). We demonstrated that follow-up can be achieved by charitable organisations treating rural patients and that the majority of patients report a positive impact following surgical intervention. We recommend that bilateral cleft lips have a more intense rural aftercare. Copyright © 2014 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

Neuronal pattern separation of motion-relevant input in LIP activity

PubMed Central

Berberian, Nareg; MacPherson, Amanda; Giraud, Eloïse; Richardson, Lydia

2016-01-01

In various regions of the brain, neurons discriminate sensory stimuli by decreasing the similarity between ambiguous input patterns. Here, we examine whether this process of pattern separation may drive the rapid discrimination of visual motion stimuli in the lateral intraparietal area (LIP). Starting with a simple mean-rate population model that captures neuronal activity in LIP, we show that overlapping input patterns can be reformatted dynamically to give rise to separated patterns of neuronal activity. The population model predicts that a key ingredient of pattern separation is the presence of heterogeneity in the response of individual units. Furthermore, the model proposes that pattern separation relies on heterogeneity in the temporal dynamics of neural activity and not merely in the mean firing rates of individual neurons over time. We confirm these predictions in recordings of macaque LIP neurons and show that the accuracy of pattern separation is a strong predictor of behavioral performance. Overall, results propose that LIP relies on neuronal pattern separation to facilitate decision-relevant discrimination of sensory stimuli. NEW & NOTEWORTHY A new hypothesis is proposed on the role of the lateral intraparietal (LIP) region of cortex during rapid decision making. This hypothesis suggests that LIP alters the representation of ambiguous inputs to reduce their overlap, thus improving sensory discrimination. A combination of computational modeling, theoretical analysis, and electrophysiological data shows that the pattern separation hypothesis links neural activity to behavior and offers novel predictions on the role of LIP during sensory discrimination. PMID:27881719

[Psychosocial adjustment in children with a cleft lip and/or palate].

PubMed

Hoek, Ineke H C; Kraaimaat, Floris W; Admiraal, Ronald J C; Kuijpers-Jagtman, Anne Marie; Verhaak, Christianne M

2009-01-01

To gain insight into the psychosocial health of children aged 9 to 12 years with a cleft lip and/or palate; to determine the relation between their health and the nature and severity of the cleft as well as other individual characteristics. Descriptive, cross-sectional study. Questionnaires completed by parents, teachers and children were used to obtain information about the psychosocial health, nature and severity of the cleft lip and/or palate, and individual characteristics of 80 children. The interrelationship between these parameters was assessed using chi-square tests, single-factor analysis of variance and correlational analysis. In general, the psychosocial health of children with a cleft lip and/or palate did not differ from that of the norm groups. Parents of children with a cleft lip/and or palate reported more withdrawn or depressive behaviour in their child than parents from the norm groups. Children with a cleft lip and/or palate exhibited less rule-breaking behaviour. Teachers reported relatively more social problems. One-third of the children had learning problems. A better psychosocial health was associated with fewer speech problems but not with a more or less abnormal physical appearance. Self-image showed a negative correlation with psychosocial health problems, while learning problems showed a positive correlation. In general, the psychosocial health of children with a cleft lip and/or palate does not differ from children without this condition. However, children with a cleft lip and/or palate do exhibit more learning problems.

Ear Infection in Isolated Cleft Lip: Etiological Implications

PubMed Central

Ruegg, Teresa A.; Cooper, Margaret E.; Leslie, Elizabeth J.; Ford, Matthew D.; Wehby, George L.; Deleyiannis, Frederic W.B.; Czeizel, Andrew E.; Hecht, Jacqueline T.; Marazita, Mary L.; Weinberg, Seth M.

2015-01-01

Background and Hypothesis Chronic ear infections are a common occurrence in children with orofacial clefts involving the secondary palate. Less is known about the middle ear status of individuals with isolated clefts of the lip, although several studies have reported elevated rates of ear infection in this group. The purpose of this retrospective study was to test the hypothesis that chronic ear infections occur more frequently in isolated cleft lip cases (n=94) compared with controls (n=183). Methods A questionnaire was used to obtain information on history of chronic ear infection. The association between ear infection status (present/absent) and cleft lip status (cleft lip case/control) was tested using both chi-square and logistic regression. Results and Conclusions The reported occurrence of chronic ear infection was significantly greater in cleft lipcases (31%) compared to unaffected controls (11%). After adjusting for age and sex, having a cleft lip increased the odds of being positive for ear infection by a factor greater than three (OR=3.698; 95%CI=1.91–7.14). Within cleft lipcases, there was no difference in the occurrence of ear infection by defect laterality or by the type of clefting present in the family history. Although velopharyngeal insufficiency was present in 18.4% of our cleft lip sample, there was no statistical association between ear infection and abnormal speech patterns. These results may have potential implications both for the clinical management of isolated cleft lip cases and for understanding the etiology of orofacial clefting. PMID:26153759

A PROCESS OF PRIORITIZING TOPICS FOR HEALTH TECHNOLOGY ASSESSMENT IN KAZAKHSTAN.

PubMed

Kosherbayeva, Lyazzat; Hailey, David; Kurakbaev, Kural; Tabarov, Adlet; Kumar, Ainur; Gutzskaya, Gulnara; Stepkina, Elena

2016-01-01

The aim of this study was to develop criteria for the prioritization of topics for health technology assessment (HTA) in the healthcare system of Kazakhstan. Initial proposals for criteria were suggested through consultation with Ministry of Health (MoH) policy areas. These were refined through a workshop attended by HTA department staff, persons from medical universities and research institutes, and MoH policy makers. The workshop included discussion on methods used in international HTA practice. Opinions of participants on selection of criteria from those specified in a review of prioritization processes were used to define a list for inclusion in an instrument for routine use. A scoring system was established in later discussion. Selected criteria for HTA prioritization were burden of disease, availability of alternative technology, clinical effectiveness, economic efficiency, budget impact, and ethical, legal, and/or psychosocial aspects. For each criterion, a health technology under consideration is given a score from 3 (High) to 1 (Low). The total score determines whether the technology is of high to medium priority or of low priority. Determination of priorities for assessment, using the instrument, should be carried out by an expert group appointed by the MoH. The process was applied in 2014 to a selection of topics, and three health technologies were chosen for full assessments. Criteria for prioritization have evolved with development of the HTA program in Kazakhstan. A method for HTA prioritization has been developed that is easy to apply, requires comparatively few resources, and is compatible with processes required by the MoH.

Association of single nucleotide polymorphisms in WNT genes with the risk of nonsyndromic cleft lip with or without cleft palate.

PubMed

Rafighdoost, Houshang; Hashemi, Mohammad; Asadi, Hossein; Bahari, Gholamreza

2018-01-22

Nonsyndromic cleft lip with or without cleft palate is a common congenital deformity worldwide with multifaceted etiology. Interaction of genes and environmental factors has been indicated to be related with susceptibility to nonsyndromic cleft lip with or without cleft palate. Some WNT genes which are involved in craniofacial embryogenesis may play a key role in the pathogenesis of nonsyndromic cleft lip with or without cleft palate. In the present study, we aimed to inspect the relationship between WNT3 (rs3809857 and rs9890413), WNT3A (rs752107 and rs3121310), and WNT10a rs201002930 (c.392 C>T) polymorphisms and nonsyndromic cleft lip with or without cleft palate in an Iranian population. The present case-control study was carried out on 120 unrelated nonsyndromic cleft lip with or without cleft palate patients and 112 healthy subjects. The variants were genotyped by polymerase chain reaction-restriction fragment length polymorphism method. The findings suggest that the rs3809857 polymorphism significantly decreased the risk of nonsyndromic cleft lip with or without cleft palate in codominant (odds ratio = 0.16, 95% confidence interval = 0.03-0.75, P = 0.020, TT vs GG), recessive (odds ratio = 0.16, 95% confidence interval = 0.03-0.72, P = 0.009, TT vs GG + GT) inheritance models. The rs9890413 variant marginally decreased the risk of nonsyndromic cleft lip with or without cleft palate in codominant (odds ratio = 0.41, 95% confidence interval = 0.17-0.99, P = 0.047, AG vs AA) model. Regarding C392T variant, the findings revealed that this variant significantly decreased the risk of nonsyndromic cleft lip with or without cleft palate in codominant (odds ratio = 0.24, 95% confidence interval = 0.10-0.58, P = 0.002, CT vs CC) and allele (odds ratio = 0.26, 95% confidence interval = 0.11-0.62, P = 0.002, T vs C) models. No significant association was observed between the rs752107 and rs3121310 variants and risk/protection of nonsyndromic cleft lip with or without cleft palate. Stratified analysis showed that WNT10a rs201002930 (c.392 C>T) significantly decreased the risk of cleft lip with cleft palate and cleft palate only. In summary, the results suggest an association between WNT genes polymorphisms and the risk nonsyndromic cleft lip with or without cleft palate in a sample of the southeast Iranian population. © 2018 Japanese Teratology Society.

Goal-Prioritization for Teachers, Coaches, and Students: A Developmental Model

ERIC Educational Resources Information Center

Symonds, Matthew L.; Tapps, Tyler

2016-01-01

The objective of this article is to provide background on types of goals, a system for writing goals, and a framework for goal-prioritization that can be implemented in classroom and/or sport settings. Goal-setting is the process of developing a desired outcome to serve as the purpose of one's actions.

Development of human factors guidelines for advanced traveler information systems and commercial vehicle operations : definition and prioritization of research studies

DOT National Transportation Integrated Search

1997-03-01

The goal of the activities documented in this report was to produce a prioritized list of candidate studies and issues that would guide data acquisition in this project. This goal was accomplished in three steps. First, 91 issues were compiled from e...

Vaccine delivery to the oral cavity using coated microneedles induces systemic and mucosal immunity

PubMed Central

Ma, Yunzhe; Tao, Wenqian; Krebs, Shelly J.; Sutton, William F.; Haigwood, Nancy L.; Gill, Harvinder S.

2014-01-01

Purpose The objective of this study is to evaluate the feasibility of using coated microneedles to deliver vaccines into the oral cavity to induce systemic and mucosal immune responses. Method Microneedles were coated with sulforhodamine, ovalbumin and two HIV antigens. Coated microneedles were inserted into the inner lower lip and dorsal surface of the tongue of rabbits. Histology was used to confirm microneedle insertion, and systemic and mucosal immune responses were characterized by measuring antigen-specific immunoglobulin G (IgG) in serum and immunoglobulin A (IgA) in saliva, respectively. Results Histological evaluation of tissues shows that coated microneedles can penetrate the lip and tongue to deliver coatings. Using ovalbumin as a model antigen it was found that the lip and the tongue are equally immunogenic sites for vaccination. Importantly, both sites also induced a significant (p < 0.05) secretory IgA in saliva compared to pre-immune saliva. Microneedle-based oral cavity vaccination was also compared to the intramuscular route using two HIV antigens, a virus-like particle and a DNA vaccine. Microneedle-based delivery to the oral cavity and the intramuscular route exhibited similar (p > 0.05) yet significant (p < 0.05) levels of antigen-specific IgG in serum. However, only the microneedle-based oral cavity vaccination group stimulated a significantly higher (p < 0.05) antigen-specific IgA response in saliva, but not intramuscular injection. Conclusion In conclusion, this study provides a novel method using microneedles to induce systemic IgG and secretory IgA in saliva, and could offer a versatile technique for oral mucosal vaccination. PMID:24623480

Effectiveness of hyperbaric oxygen for experimental treatment of schistosomiasis mansoni using praziquantel-free and encapsulated into liposomes: assay in adult worms and oviposition.

PubMed

Frezza, Tarsila Ferraz; de Souza, Ana Luiza Ribeiro; Prado, César Corat Ribeiro; de Oliveira, Claudineide Nascimento Fernandes; Gremião, Maria Palmira Daflon; Giorgio, Selma; Dolder, Mary Anne Heidi; Joazeiro, Paulo Pinto; Allegretti, Silmara Marques

2015-10-01

The treatment of schistosomiasis depends on a single drug: praziquantel (PZQ). However, this treatment presents limitations such as low and/or erratic bioavailability that can contribute to cases of tolerance. Improvements to the available drug are urgently needed and studies with a controlled system of drug release, like liposomes, have been gaining prominence. The present study evaluated the activity and synergy between liposomal-praziquantel (lip.PZQ) and hyperbaric oxygen therapy (HBO). Mice received doses of 60 or 100mg/kg PZQ or lip.PZQ, 50 days post-infection, and after the treatment, were exposed to HBO (3 atmosphere absolute - ATA) for 1h. The viability of adult worms and oviposition were analyzed, by necropsy and Kato-Katz examination performed after 15 days of treatment. A concentration of 100mg/kg of lip.PZQ+HBO was more effective (48.0% reduction of worms, 83.3% reduction of eggs/gram of feces) and 100% of the mice had altered of oograms (indicating interruption of oviposition) compared to other treatments and to the Control group (infected and untreated). It is known that PZQ requires participation of the host immune system to complete its antischistosomal activity and that HBO is able to stimulate the immune system. The drug became more available in the body when incorporated into liposomes and, used with HBO, the HBO worked as an adjuvant. This explains the decreases of oviposition and worms recovered form hepatic portal system. Copyright © 2015 Elsevier B.V. All rights reserved.

Vehicle-based Methane Mapping Helps Find Natural Gas Leaks and Prioritize Leak Repairs

NASA Astrophysics Data System (ADS)

von Fischer, J. C.; Weller, Z.; Roscioli, J. R.; Lamb, B. K.; Ferrara, T.

2017-12-01

Recently, mobile methane sensing platforms have been developed to detect and locate natural gas (NG) leaks in urban distribution systems and to estimate their size. Although this technology has already been used in targeted deployment for prioritization of NG pipeline infrastructure repair and replacement, one open question regarding this technology is how effective the resulting data are for prioritizing infrastructure repair and replacement. To answer this question we explore the accuracy and precision of the natural gas leak location and emission estimates provided by methane sensors placed on Google Street View (GSV) vehicles. We find that the vast majority (75%) of methane emitting sources detected by these mobile platforms are NG leaks and that the location estimates are effective at identifying the general location of leaks. We also show that the emission rate estimates from mobile detection platforms are able to effectively rank NG leaks for prioritizing leak repair. Our findings establish that mobile sensing platforms are an efficient and effective tool for improving the safety and reducing the environmental impacts of low-pressure NG distribution systems by reducing atmospheric methane emissions.

Computer Aided Lip Reading Training Tool

ERIC Educational Resources Information Center

Sarmasik, Gamze; Dalkilic, Gokhan; Kut, Alp; Cebi, Yalcin; Serbetcioglu, Bulent

2007-01-01

Worldwide auditory-verbal education is becoming widespread for deaf children. But many prelingually, late-diagnosed deaf children and adults may utilize neither hearing aids nor cochlear implants and needed the support of lip-reading. Therefore, lip-reading skill remains to be important for oral education programmes of hearing impaired. The…

Toxoplasma gondii antibodies in wild white-lipped peccary (Tayassu pecari) from Peru

USDA-ARS?s Scientific Manuscript database

In the Peruvian Amazon, the white-lipped peccary (Tayassu pecari) is a desirable game and is important for local rural economy. Blood samples from 101 white-lipped peccary from Peru were collected from 3 different conservation areas located in the municipalities of Manu and Tambopata, southeastern r...

7 CFR 3201.26 - Lip care products.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 15 2012-01-01 2012-01-01 false Lip care products. 3201.26 Section 3201.26 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF PROCUREMENT AND PROPERTY MANAGEMENT, DEPARTMENT OF AGRICULTURE GUIDELINES FOR DESIGNATING BIOBASED PRODUCTS FOR FEDERAL PROCUREMENT Designated Items § 3201.26 Lip care products. (a...

7 CFR 3201.26 - Lip care products.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 15 2013-01-01 2013-01-01 false Lip care products. 3201.26 Section 3201.26 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF PROCUREMENT AND PROPERTY MANAGEMENT, DEPARTMENT OF AGRICULTURE GUIDELINES FOR DESIGNATING BIOBASED PRODUCTS FOR FEDERAL PROCUREMENT Designated Items § 3201.26 Lip care products. (a...

7 CFR 3201.26 - Lip care products.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 15 2014-01-01 2014-01-01 false Lip care products. 3201.26 Section 3201.26 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF PROCUREMENT AND PROPERTY MANAGEMENT, DEPARTMENT OF AGRICULTURE GUIDELINES FOR DESIGNATING BIOBASED PRODUCTS FOR FEDERAL PROCUREMENT Designated Items § 3201.26 Lip care products. (a...

Salivary duct cyst on lower lip: A rare entity and literature review

PubMed Central

Tandon, Ankita; Sircar, Keya; Chowdhry, Aman; Bablani, Deepika

2014-01-01

Mucocele forms because of salivary gland mucous extravasation or retention and is usually related to trauma in the area of the lower lips. Salivary duct cyst, however, is a type of mucous retention cyst which is almost never located on the lower lip. The aim of this paper is to report this extremely rare salivary duct cyst present on the lower lip and to critically review the literature to build important concepts that would help clinicians in the diagnosis and treatment of this pathology. PMID:25364168

Salivary duct cyst on lower lip: A rare entity and literature review.

PubMed

Tandon, Ankita; Sircar, Keya; Chowdhry, Aman; Bablani, Deepika

2014-09-01

Mucocele forms because of salivary gland mucous extravasation or retention and is usually related to trauma in the area of the lower lips. Salivary duct cyst, however, is a type of mucous retention cyst which is almost never located on the lower lip. The aim of this paper is to report this extremely rare salivary duct cyst present on the lower lip and to critically review the literature to build important concepts that would help clinicians in the diagnosis and treatment of this pathology.

Experimental model of developing and analysis of lip prints in atypical surface: A metallic straw (bombilla)

PubMed Central

Fonseca, Gabriel M.; Bonfigli, Esteban; Cantín, Mario

2014-01-01

Background: The interaction between the offender and the victim produces visible or latent prints on objects and utensils. The study of lip prints has reportedly stayed away from the basic cinematic concept of the lip-to-surface relationship. Materials and Methods: Three regular powders were used to reveal the latent lip prints on a typical metallic straw called bombilla, and the revealed prints were photographed, preserved, and analyzed. Results: Better definition was observed in the lower lip print, and nine anatomical patterns were identified, but a higher definition of wrinkles was observed with indestructible white powder. Conclusion: Knowledge of labial dynamics, the real value of the processed surfaces, and the need for testing in field conditions are discussed. PMID:25125921

Repair of bilateral cleft lip and its variants

PubMed Central

Mulliken, John B.

2009-01-01

The surgeon who lifts a scalpel to repair a bilateral cleft lip and nasal deformity is accountable for: 1) precise craftsmanship based on three-dimensional features and four-dimensional changes; 2) periodic assessment throughout the child's growth; and 3) technical modifications during primary closure based on knowledge gained from long-term follow-up evaluation. These children should not have to endure the stares prompted by nasolabial stigmata that result from outdated concepts and technical misadventures. The principles for repair of bilateral complete cleft lip have evolved to such a level that the child's appearance should be equivalent to, or surpass, that of a unilateral complete cleft lip. These same principles also apply to the repair of the variants of bilateral cleft lip, although strategies and execution differ slightly. PMID:19884685

Differential In Vivo Gene Expression of Major Leptospira Proteins in Resistant or Susceptible Animal Models

PubMed Central

Matsui, Mariko; Soupé, Marie-Estelle; Becam, Jérôme

2012-01-01

Transcripts of Leptospira 16S rRNA, FlaB, LigB, LipL21, LipL32, LipL36, LipL41, and OmpL37 were quantified in the blood of susceptible (hamsters) and resistant (mice) animal models of leptospirosis. We first validated adequate reference genes and then evaluated expression patterns in vivo compared to in vitro cultures. LipL32 expression was downregulated in vivo and differentially regulated in resistant and susceptible animals. FlaB expression was also repressed in mice but not in hamsters. In contrast, LigB and OmpL37 were upregulated in vivo. Thus, we demonstrated that a virulent strain of Leptospira differentially adapts its gene expression in the blood of infected animals. PMID:22729538

Long-pulsed neodymium:yttrium-aluminum-garnet laser treatment for hypertrophic port-wine stains on the lips.

PubMed

Kono, Taro; Frederick Groff, William; Chan, Henry H; Sakurai, Hiroyuki; Yamaki, Takashi

2009-03-01

Pulsed dye laser (PDL) treatment of hypertrophic port-wine stains (PWSs) on the lips has demonstrated poor efficacy and a potential risk of dyspigmentation. PDL-resistant hypertrophic PWS may require treatment with deeper penetrating lasers such as a 1064-nm neodymium:yttrium-aluminum-garnet (Nd:YAG) laser. The objective of this clinical study was to evaluate the efficacy and safety of a Nd:YAG laser for the treatment of hypertrophic PWSs on the lips. Ten patients (four were male and six were female) with hypertrophic PWSs on the lips were recruited in this study. Eight patients showed good to excellent improvement without complications. In conclusion, the Nd:YAG laser is safe and effective for treating hypertrophic PWSs on the lips.

Evaluation of unilateral cleft lip and palate using anthropometry measurements post-alveolar bone grafting

NASA Astrophysics Data System (ADS)

Simorangkir, H. J.; Hak, M. S.; Tofani, I.

2017-08-01

Rehabilitation of patients with unilateral cleft lip and palate (UCLP) requires multiple steps and coordination of multidisciplinary sciences to produce optimal results. Alveolar bone-grafting (ABG) is an important procedure in the treatment of such patients because it influences the eruption of teeth and stabilizes the maxilla. To evaluate the effect and suitability of alveolar bone grafting procedure at Cleft Center Harapan Kita Maternal and Child Hospital on nasal deformity from anthropometry with photogrammetry and aesthetic proportional in patients with unilateral cleft lip and palate with UCLP. Patients with UCLP were evaluated post-ABG using anthropometry and photogrammetry to investigate the results anteriorly, laterally, and basally. Anthropometric measurements taken photogrammetrically used 14 points and 11 distance items. Evaluations were made of upper lip length, upper lip projection, and nostril sill elevation for both the cleft and non-cleft sides of patients’ faces. A t-test showed that the values for upper lip length and projection were significantly increased, and a correction test using a Fisher exam gave a value of 1. The ABG treatment protocol for patients with UCLP at the Cleft Lip and Palate Unit at Harapan Kita Maternal and Child Hospital is suitable to be performed; it aesthetically satisfies patients and their families.

Prepare to Care, A Supported Self-Management Intervention for Head and Neck Cancer CaregiversHead and Neck Cancer

ClinicalTrials.gov

2018-04-26

Caregiver; Malignant Head and Neck Neoplasm; Paranasal Sinus Squamous Cell Carcinoma; Salivary Gland Squamous Cell Carcinoma; Stage I Hypopharyngeal Squamous Cell Carcinoma; Stage I Laryngeal Squamous Cell Carcinoma; Stage I Lip and Oral Cavity Squamous Cell Carcinoma; Stage I Oropharyngeal Squamous Cell Carcinoma; Stage II Hypopharyngeal Squamous Cell Carcinoma; Stage II Laryngeal Squamous Cell Carcinoma; Stage II Lip and Oral Cavity Squamous Cell Carcinoma; Stage II Oropharyngeal Squamous Cell Carcinoma; Stage III Hypopharyngeal Squamous Cell Carcinoma; Stage III Laryngeal Squamous Cell Carcinoma; Stage III Lip and Oral Cavity Squamous Cell Carcinoma; Stage III Oropharyngeal Squamous Cell Carcinoma; Stage IV Hypopharyngeal Squamous Cell Carcinoma; Stage IV Laryngeal Squamous Cell Carcinoma; Stage IV Lip and Oral Cavity Squamous Cell Carcinoma; Stage IV Oropharyngeal Squamous Cell Carcinoma; Stage IVA Hypopharyngeal Squamous Cell Carcinoma; Stage IVA Laryngeal Squamous Cell Carcinoma; Stage IVA Lip and Oral Cavity Squamous Cell Carcinoma; Stage IVA Oropharyngeal Squamous Cell Carcinoma; Stage IVB Hypopharyngeal Squamous Cell Carcinoma; Stage IVB Laryngeal Squamous Cell Carcinoma; Stage IVB Lip and Oral Cavity Squamous Cell Carcinoma; Stage IVB Oropharyngeal Squamous Cell Carcinoma; Stage IVC Hypopharyngeal Squamous Cell Carcinoma; Stage IVC Laryngeal Squamous Cell Carcinoma; Stage IVC Lip and Oral Cavity Squamous Cell Carcinoma; Stage IVC Oropharyngeal Squamous Cell Carcinoma

Integrity and stability of oral liposomes containing bile salts studied in simulated and ex vivo gastrointestinal media.

PubMed

Hu, Shunwen; Niu, Mengmeng; Hu, Fuqiang; Lu, Yi; Qi, Jianping; Yin, Zongning; Wu, Wei

2013-01-30

The objective of this study was to investigate the integrtity and stability of oral liposomes containing glycocholate (SGC-Lip) in simulated gastrointestinal (GI) media and ex vivo GI media from rats in comparison with conventional liposomes (CH-Lip) composed of soybean phosphatidylcholine and cholesterol. Membrane integrity of liposomes was evaluated by monitoring calcein release, particle size and distribution in different simulated GI media. The stability of liposomes encapsulating insulin was investigated in simulated GI fluids containing pepsin or pancreatin and ex vivo GI enzyme fluids. Simulated GI media with low pH or physiological bile salts resulted in significant increase in calcein release, but dynamic laser scattering data showed that the size and distribution were generally stable. SGC-Lip retained the major amount of the initially encapsulated insulin as compared with CH-Lip in simulated GI fluids (SGF, FaSSGF, SIF and FeSSIF-V2). SGC-Lip retained respectively 17.1% and 20.5% of the initially encapsulated insulin in ex vivo GI fluid, which were also significantly more than CH-Lip. These results suggested that SGC-Lip could protect insulin from degradation to some degree during their transit through the gastrointestinal tract and contributed to enhanced oral absorption. Copyright © 2012 Elsevier B.V. All rights reserved.

Spelling Processes of Children With Nonsyndromic Cleft Lip and/or Palate: A Preliminary Study.

PubMed

Lee, Karen Shi Mei; Young, Selena Ee-Li; Liow, Susan Jane Rickard; Purcell, Alison Anne

2015-01-01

Objective :  To compare the cognitive-linguistic processes underlying spelling performance of children with cleft lip and/or palate with those of typically developing children. Design :  An assessment battery including tests of hearing, articulation, verbal short-term and working memory, and phonological awareness, as well as word and nonword spelling, was administered to both groups. Participants :  A total of 15 children with nonsyndromic cleft lip and/or palate were case-matched by age and sex to 15 typically developing children. The children were aged between 6 and 8 years and were bilingual, with English the dominant language. Results :  Wilcoxon signed-rank tests revealed that the performance of children with cleft lip and/or palate was significantly poorer on phoneme deletion and nonword spelling (P < .05) compared with typically developing children. Spearman correlation analyses revealed different relationships between the cognitive-linguistic and spelling measures for the cleft lip and/or palate and typically developing groups. Conclusions :  Children with cleft lip and/or palate underachieve in phonological awareness and spelling skills. To facilitate early intervention for literacy problems, speech-language pathologists should routinely assess the cognitive-linguistic processing of children with cleft lip and/or palate, especially phonological awareness, as part of their case management protocols.

[Pursed Lips Inspiration for Vocal Cord Dysfunction].

PubMed

Maruyama, Yumiko; Tsukada, Yayoi; Hirai, Nobuyuki; Nakanishi, Yosuke; Yoshizaki, Tomokazu

2015-01-01

Paradoxical vocal cord motion (PVCM) during vocal cord dysfunction (VCD) generally occurs spasmodically and transiently. After we had experienced 36 cases of VCD and successfully treated with conservative treatment including "pursed lips inspiration" method, we experienced a boy who had persistent PVCM. It was observed his PVCM vanished when he breathed in through pursed lips, while it appeared again when he stopped pursed lips inspiration. An airway reflex has been reported where the negative pressure in the subglottic space resulting from the inspiratory effort against a narrowed glottis activates the vocal cord adductor. VCD is considered to have both acceleration of laryngeal closure reflex against airway stimuli and active adductive movement of vocal cords against negative pressure in the subglottic space as underlying factors. The pursed lips inspiration method enables VCD patients not only to accomplish slow and light breathing but also to decrease the difference in the pressure between the supra--and subglottic space by occluding the nasal cavity and voluntary puckering up of the mouth which generate negative pressure in the supraglottic space. This is the first report of the pursed lips inspiration method as a treatment for VCD. Pursed lips inspiration is a simple method which is easy to perform anytime, anywhere without any special equipment, and is considered to be worth trying for VCD.

Cheiloscopy and dactyloscopy: Do they dictate personality patterns?

PubMed Central

Abidullah, Mohammed; Kumar, M. Naveen; Bhorgonde, Kavita D.; Reddy, D. Shyam Prasad

2015-01-01

Context: Cheiloscopy and dactyloscopy, both are well-established forensic tools used in individual identification in any scenario be it a crime scene or civil cause. Like finger prints, lip prints are unique and distinguishable for every individual. But their relationship to personality types has not been established excepting the hypothesis stating that finger prints could explain these personality patterns. Aims: The study was aimed to record and correlate the lip and finger prints with that of character/personality of a person. Settings and Design: The lip and finger prints and character of a person were recorded and the data obtained was subjected for statistical analysis, especially for Pearson's Chi-square test and correlation/association between the groups was also studied. Materials and Methods: The study sample comprised of 200 subjects, 100 males and 100 females, aged between 18 and 30 years. For recording lip prints, brown/pink-colored lipstick was applied on the lips and the subjects were asked to spread uniformly over the lips. Lip prints were traced in the normal rest position on a plain white bond paper. For recording the finger prints, imprints of the fingers were taken on a plain white bond paper using ink pad. The collected prints were visualized using magnifying lens. To record the character of person, a pro forma manual for multivariable personality inventory by Dr. BC Muthayya was used. Statistical Analysis Used: Data obtained was subjected for statistical analysis, especially for Pearson's Chi-square test and correlation/association between the groups was also studied. Results: In males, predominant lip pattern recorded was Type I with whorls-type finger pattern and the character being ego ideal, pessimism, introvert, and dogmatic; whereas in females, predominant lip pattern recorded was Type II with loops-type finger pattern and the character being neurotic, need achievers, and dominant. Conclusion: Many studies on lip pattern, finger pattern, palatal rugae, etc., for individual identification and gender determination exist, but correlative studies are scanty. This is the first study done on correlating patterns, that is, lip and finger pattern with the character of a person. With this study we conclude that this correlation can be used as an adjunct in the investigatory process in forensic sciences. PMID:26005299

A Vulnerability Assessment of 300 Species in Florida: Threats from Sea Level Rise, Land Use, and Climate Change

PubMed Central

Reece, Joshua Steven; Noss, Reed F.; Oetting, Jon; Hoctor, Tom; Volk, Michael

2013-01-01

Species face many threats, including accelerated climate change, sea level rise, and conversion and degradation of habitat from human land uses. Vulnerability assessments and prioritization protocols have been proposed to assess these threats, often in combination with information such as species rarity; ecological, evolutionary or economic value; and likelihood of success. Nevertheless, few vulnerability assessments or prioritization protocols simultaneously account for multiple threats or conservation values. We applied a novel vulnerability assessment tool, the Standardized Index of Vulnerability and Value, to assess the conservation priority of 300 species of plants and animals in Florida given projections of climate change, human land-use patterns, and sea level rise by the year 2100. We account for multiple sources of uncertainty and prioritize species under five different systems of value, ranging from a primary emphasis on vulnerability to threats to an emphasis on metrics of conservation value such as phylogenetic distinctiveness. Our results reveal remarkable consistency in the prioritization of species across different conservation value systems. Species of high priority include the Miami blue butterfly (Cyclargus thomasi bethunebakeri), Key tree cactus (Pilosocereus robinii), Florida duskywing butterfly (Ephyriades brunnea floridensis), and Key deer (Odocoileus virginianus clavium). We also identify sources of uncertainty and the types of life history information consistently missing across taxonomic groups. This study characterizes the vulnerabilities to major threats of a broad swath of Florida’s biodiversity and provides a system for prioritizing conservation efforts that is quantitative, flexible, and free from hidden value judgments. PMID:24260447

ASSESSING THE HYDROGEOLOGIC CLASSIFICATION SYSTEM IN MID-ATLANTIC COASTAL PLAIN STREAMS USING BENTHIC MACROINVERTEBRATES

EPA Science Inventory

Assessing classification systems that describe natural variation across regions is an important first step for developing indicators. We evaluated a hydrogeologic framework for first order streams in the mid-Atlantic Coastal Plain as part of the LIPS-MACS (Landscape Indicators f...

Multimodal fusion of polynomial classifiers for automatic person recgonition

NASA Astrophysics Data System (ADS)

Broun, Charles C.; Zhang, Xiaozheng

2001-03-01

With the prevalence of the information age, privacy and personalization are forefront in today's society. As such, biometrics are viewed as essential components of current evolving technological systems. Consumers demand unobtrusive and non-invasive approaches. In our previous work, we have demonstrated a speaker verification system that meets these criteria. However, there are additional constraints for fielded systems. The required recognition transactions are often performed in adverse environments and across diverse populations, necessitating robust solutions. There are two significant problem areas in current generation speaker verification systems. The first is the difficulty in acquiring clean audio signals in all environments without encumbering the user with a head- mounted close-talking microphone. Second, unimodal biometric systems do not work with a significant percentage of the population. To combat these issues, multimodal techniques are being investigated to improve system robustness to environmental conditions, as well as improve overall accuracy across the population. We propose a multi modal approach that builds on our current state-of-the-art speaker verification technology. In order to maintain the transparent nature of the speech interface, we focus on optical sensing technology to provide the additional modality-giving us an audio-visual person recognition system. For the audio domain, we use our existing speaker verification system. For the visual domain, we focus on lip motion. This is chosen, rather than static face or iris recognition, because it provides dynamic information about the individual. In addition, the lip dynamics can aid speech recognition to provide liveness testing. The visual processing method makes use of both color and edge information, combined within Markov random field MRF framework, to localize the lips. Geometric features are extracted and input to a polynomial classifier for the person recognition process. A late integration approach, based on a probabilistic model, is employed to combine the two modalities. The system is tested on the XM2VTS database combined with AWGN in the audio domain over a range of signal-to-noise ratios.

A Quantitative Approach to Determining the Ideal Female Lip Aesthetic and Its Effect on Facial Attractiveness.

PubMed

Popenko, Natalie A; Tripathi, Prem B; Devcic, Zlatko; Karimi, Koohyar; Osann, Kathryn; Wong, Brian J F

2017-07-01

Aesthetic proportions of the lips and their effect on facial attractiveness are poorly defined. Established guidelines would aid practitioners in achieving optimal aesthetic outcomes during cosmetic augmentation. To assess the most attractive lip dimensions of white women based on attractiveness ranking of surface area, ratio of upper to lower lip, and dimensions of the lip surface area relative to the lower third of the face. In phase 1 of this study, synthetic morph frontal digital images of the faces of 20 white women ages 18 to 25 years old were used to generate 5 varied lip surface areas for each face. These 100 faces were cardinally ranked by attractiveness through our developed conventional and internet-based focus groups by 150 participants. A summed ranking score of each face was plotted to quantify the most attractive surface area. In phase 2 of the study, 4 variants for each face were created with 15 of the most attractive images manipulating upper to lower lip ratios while maintaining the most attractive surface area from phase 1. A total of 60 faces were created, and each ratio was ranked by attractiveness by 428 participants (internet-based focus groups). In phase 3, the surface area from the most attractive faces was used to determine the total lip surface area relative to the lower facial third. Data were collected from March 1 to November 31, 2010, and analyzed from June 1 to October 31, 2016. Most attractive lip surface area, ratio of upper to lower lip, and dimension of the lips relative to the lower facial third. In phase 1, all 100 faces were cardinally ranked by 150 individuals (internet-based focus groups [n = 130] and raters from conventional focus groups [conventional raters] [n = 20]). In phase 2, all 60 faces were cardinally ranked by 428 participants (internet-based focus groups [n = 408] and conventional raters [n = 20]). The surface area that corresponded to the range of 2.0 to 2.5 × 104 pixels represented the highest summed rank, generating a pool of 14 images. This surface area was determined to be the most attractive and corresponded to a 53.5% increase in surface area from the original image. With the highest mean and highest proportions of most attractive rankings, the 1:2 ratio was deemed most attractive. Conversely, the ratio of 2:1 was deemed least attractive, having the lowest mean at 1.61 and the highest proportion of ranks within 1 with 310 votes (72.3%). Using a robust sample size, this study found that the most attractive lip surface area represents a 53.5% increase from baseline, an upper to lower lip ratio of 1:2, and a surface area equal to 9.6% of the lower third of the face. Lip dimensions and ratios derived in this study may provide guidelines in improving overall facial aesthetics and have clinical relevance to the field of facial plastic surgery. NA.

A prioritized set of physiological measurements for future spaceflight experiments

NASA Technical Reports Server (NTRS)

1978-01-01

A set of desired experimental measurements to be obtained in future spaceflights in four areas of physiological investigation are identified. The basis for identifying the measurements was the physiological systems analysis performed on Skylab data and related ground-based studies. An approach for prioritizing the measurement list is identified and discussed with the use of examples. A prioritized measurement list is presented for each of the following areas; cardiopulmonary, fluid-renal and electrolyte, hematology and immunology, and musculoskeletal. Also included is a list of interacting stresses and other factors present in spaceflight experiments whose effects may need to be quantified.

Presurgical Nasoalveolar Molding for Correction of Cleft Lip Nasal Deformity: Experience From Northern India

PubMed Central

Mishra, Brijesh; Singh, Arun K.; Zaidi, Javed; Singh, G. K.; Agrawal, Rajiv; Kumar, Vijay

2010-01-01

Context: The cleft lip type nasal deformity presents one of the most complex surgical challenges. The long-term postoperative results are still not satisfactory despite an emphasis on primary nasal correction. This is attributed to tissue memory and healing. Nasoalveolar molding is used effectively to reshape the nasal cartilage and to mold the maxillary arch before cleft lip repair. Aims: This study was undertaken to evaluate the role of presurgical nasoalveolar molding in correction of cleft lip nasal deformity for patients with unilateral and bilateral clefts of the lip. Settings and Design: Twenty-three cases of clefts of lip and palate with nasal deformity were subjected to present study from May 2004 to May 2006. These cases were initially treated on outpatient basis, and they were admitted at the time of operation. All of these patients were children of less than 1 year of age, belonging to north Indian population. Material and Methods: Study consisted of patients of cleft lip and palate who were given presurgical nasoalveolar splints at early age. Lip repair was done after at least 2 months of molding. These patients along with control group (without presurgical nasoalveolar molding) were followed up for 1 year. Measurements were taken at different intervals in study over dental cast and on patients. Data obtained from comparison of 2 groups were analyzed using “MSTAT” analysis software (developed by Dr Russel Freed, Professor & Director, Crop & Soil Sciences Department, Michigan State University, East Lansing, Michigan). Results: In our study, we found that nostril height was more in patients of experimental group (P = .18), while nostril width and alar perimeter were not changed significantly. Children with nasoalveolar molding had significant lengthening of columella (P = .02). Patients of unilateral cleft lip had more reduction in alveolar gap (P = .08) than bilateral group (P = .15). Conclusions: Nasoalveolar molding can be a useful adjunct for treatment of cleft lip nasal deformity. It is a cost-effective technique that can reduce the number of future surgeries such as alveolar bone grafting and secondary rhinoplasties. PMID:20694165

Post-translational Modification of LipL32 during Leptospira interrogans Infection

PubMed Central

Witchell, Timothy D.; Eshghi, Azad; Nally, Jarlath E.; Hof, Rebecca; Boulanger, Martin J.; Wunder, Elsio A.; Ko, Albert I.; Haake, David A.; Cameron, Caroline E.

2014-01-01

Background Leptospirosis, a re-emerging disease of global importance caused by pathogenic Leptospira spp., is considered the world's most widespread zoonotic disease. Rats serve as asymptomatic carriers of pathogenic Leptospira and are critical for disease spread. In such reservoir hosts, leptospires colonize the kidney, are shed in the urine, persist in fresh water and gain access to a new mammalian host through breaches in the skin. Methodology/Principal Findings Previous studies have provided evidence for post-translational modification (PTM) of leptospiral proteins. In the current study, we used proteomic analyses to determine the presence of PTMs on the highly abundant leptospiral protein, LipL32, from rat urine-isolated L. interrogans serovar Copenhageni compared to in vitro-grown organisms. We observed either acetylation or tri-methylation of lysine residues within multiple LipL32 peptides, including peptides corresponding to regions of LipL32 previously identified as epitopes. Intriguingly, the PTMs were unique to the LipL32 peptides originating from in vivo relative to in vitro grown leptospires. The identity of each modified lysine residue was confirmed by fragmentation pattern analysis of the peptide mass spectra. A synthetic peptide containing an identified tri-methylated lysine, which corresponds to a previously identified LipL32 epitope, demonstrated significantly reduced immunoreactivity with serum collected from leptospirosis patients compared to the peptide version lacking the tri-methylation. Further, a subset of the identified PTMs are in close proximity to the established calcium-binding and putative collagen-binding sites that have been identified within LipL32. Conclusions/Significance The exclusive detection of PTMs on lysine residues within LipL32 from in vivo-isolated L. interrogans implies that infection-generated modification of leptospiral proteins may have a biologically relevant function during the course of infection. Although definitive determination of the role of these PTMs must await further investigations, the reduced immune recognition of a modified LipL32 epitope suggests the intriguing possibility that LipL32 modification represents a novel mechanism of immune evasion within Leptospira. PMID:25356675

Outpatient versus Inpatient Primary Cleft Lip and Palate Surgery: Analysis of Early Complications.

PubMed

Kantar, Rami S; Cammarata, Michael J; Rifkin, William J; Plana, Natalie M; Diaz-Siso, J Rodrigo; Flores, Roberto L

2018-05-01

Fiscal constraints are driving shorter hospital lengths of stay. Outpatient primary cleft lip surgery has been shown to be safe, but outpatient primary cleft palate surgery remains controversial. This study evaluates outcomes following outpatient versus inpatient primary cleft lip and palate surgery. The American College of Surgeons National Surgical Quality Improvement Program Pediatric database was used to identify patients undergoing primary cleft lip and palate surgery between 2012 and 2015. Patient clinical factors and 30-day complications were compared for outpatient versus inpatient primary cleft lip and palate surgery. Univariate and multivariate analyses were performed. Three thousand one hundred forty-two patients were included in the primary cleft lip surgery group and 4191 in the primary cleft palate surgery group. Patients in the cleft lip surgery group with structural pulmonary abnormalities had a significantly longer hospital length of stay (β, 4.94; p = 0.001). Patients undergoing outpatient surgery had a significantly higher risk of superficial (OR, 1.99; p = 0.01) and deep wound dehiscence (OR, 2.22; p = 0.01), and were at a significantly lower risk of reoperation (OR, 0.36; p = 0.04) and readmission (OR, 0.52; p = 0.02). Outpatient primary cleft lip surgery is safe and has a complication profile similar to that of inpatient surgery. Outpatient primary cleft palate surgery is common practice in many U.S. hospitals and has a significantly higher rate of wound complications, and lower rates of reoperation and readmission. In properly selected patients, outpatient palatoplasty can be performed safely. Therapeutic, III.

Esthetic composition of smile in individuals with cleft lip, alveolus, and palate: visibility of the periodontium and the esthetics of smile.

PubMed

Esper, Luis Augusto; Sbrana, Michyele Cristhiane; Cunha, Mércia Jussara da Silva; Moreira, Guilherme Santos; de Almeida, Ana Lúcia Pompéia Fraga

2012-01-01

Objective. To evaluate characteristics of smile related to visibility in individuals with cleft lip, alveolus, and palate. Design. Cross-sectional. Setting. HRAC/USP, Brazil. Patients. Individuals with repaired complete unilateral cleft lip and palate (n = 45), aged 15-30 years. Interventions. Frontal facial photographs were obtained in natural and forced smiles (n = 135). Six specialists in periodontics evaluated the photographs as to the smile line, thickness, and curve of the upper lip. Main Outcome Measures. The cleft area was compared with the contralateral region. Results were expressed as percentages and means. The findings were compared between groups of periodontists. Results. Statistically significant relationship was observed in the smile line between examiners and between natural and forced smiles, regardless of the association with the cleft side. The lip was thicker at rest and thinner in the forced smile, as also evaluated by the group not experienced with cleft care. The curve of the upper lip in natural and forced smiles was considered as close to straight by both groups, regardless of the cleft. Conclusion. The smile in individuals with clefts was regarded as average for both cleft and noncleft sides. The thickness was characterized as average to thin, being thinner in forced smile and when analyzed by the group not experienced with cleft care. In the average, the curve of the upper lip was considered as straight. The present study elucidates some characteristics related to the smile in individuals with repaired unilateral cleft lip, alveolus, and palate.

Esthetic Composition of Smile in Individuals with Cleft Lip, Alveolus, and Palate: Visibility of the Periodontium and the Esthetics of Smile

PubMed Central

Esper, Luis Augusto; Sbrana, Michyele Cristhiane; Cunha, Mércia Jussara da Silva; Moreira, Guilherme Santos; de Almeida, Ana Lúcia Pompéia Fraga

2012-01-01

Objective. To evaluate characteristics of smile related to visibility in individuals with cleft lip, alveolus, and palate. Design. Cross-sectional. Setting. HRAC/USP, Brazil. Patients. Individuals with repaired complete unilateral cleft lip and palate (n = 45), aged 15–30 years. Interventions. Frontal facial photographs were obtained in natural and forced smiles (n = 135). Six specialists in periodontics evaluated the photographs as to the smile line, thickness, and curve of the upper lip. Main Outcome Measures. The cleft area was compared with the contralateral region. Results were expressed as percentages and means. The findings were compared between groups of periodontists. Results. Statistically significant relationship was observed in the smile line between examiners and between natural and forced smiles, regardless of the association with the cleft side. The lip was thicker at rest and thinner in the forced smile, as also evaluated by the group not experienced with cleft care. The curve of the upper lip in natural and forced smiles was considered as close to straight by both groups, regardless of the cleft. Conclusion. The smile in individuals with clefts was regarded as average for both cleft and noncleft sides. The thickness was characterized as average to thin, being thinner in forced smile and when analyzed by the group not experienced with cleft care. In the average, the curve of the upper lip was considered as straight. The present study elucidates some characteristics related to the smile in individuals with repaired unilateral cleft lip, alveolus, and palate. PMID:23227326

Playing jigsaw with Large Igneous Provinces—A plate tectonic reconstruction of Ontong Java Nui, West Pacific

NASA Astrophysics Data System (ADS)

Hochmuth, Katharina; Gohl, Karsten; Uenzelmann-Neben, Gabriele

2015-11-01

The three largest Large Igneous Provinces (LIP) of the western Pacific—Ontong Java, Manihiki, and Hikurangi Plateaus—were emplaced during the Cretaceous Normal Superchron and show strong similarities in their geochemistry and petrology. The plate tectonic relationship between those LIPs, herein referred to as Ontong Java Nui, is uncertain, but a joined emplacement was proposed by Taylor (2006). Since this hypothesis is still highly debated and struggles to explain features such as the strong differences in crustal thickness between the different plateaus, we revisited the joined emplacement of Ontong Java Nui in light of new data from the Manihiki Plateau. By evaluating seismic refraction/wide-angle reflection data along with seismic reflection records of the margins of the proposed "Super"-LIP, a detailed scenario for the emplacement and the initial phase of breakup has been developed. The LIP is a result of an interaction of the arriving plume head with the Phoenix-Pacific spreading ridge in the Early Cretaceous. The breakup of the LIP shows a complicated interplay between multiple microplates and tectonic forces such as rifting, shearing, and rotation. Our plate kinematic model of the western Pacific incorporates new evidence from the breakup margins of the LIPs, the tectonic fabric of the seafloor, as well as previously published tectonic concepts such as the rotation of the LIPs. The updated rotation poles of the western Pacific allow a detailed plate tectonic reconstruction of the region during the Cretaceous Normal Superchron and highlight the important role of LIPs in the plate tectonic framework.

Vaginal orgasm is more prevalent among women with a prominent tubercle of the upper lip.

PubMed

Brody, Stuart; Costa, Rui Miguel

2011-10-01

Recent studies have uncovered multiple markers of vaginal orgasm history (unblocked pelvic movement during walking, less use of immature psychological defense mechanisms, greater urethrovaginal space). Other markers (perhaps of prenatal origin) even without obvious mechanistic roles in vaginal orgasm might exist, and a clinical observation led to the novel hypothesis that a prominent tubercle of the upper lip is such a marker. To examine the hypothesis that a prominent tubercle of the upper lip is associated specifically with greater likelihood of experiencing vaginal orgasm (orgasm elicited by penile-vaginal intercourse [PVI] without concurrent masturbation). Women (N = 258, predominantly Scottish) completed an online survey reporting their frequencies of various sexual activities and corresponding orgasms, age, and the prominence of the tubercle of their upper lip. Social desirability response bias was also assessed. Multivariate associations of lip tubercle prominence with vaginal orgasm (ever and past month consistency) and with orgasm by other means. RESULTS.: A prominent and sharply raised lip tubercle was associated with greater odds (odds ratio = 12.3) of ever having a vaginal orgasm, and also with greater past month vaginal orgasm consistency (an effect driven by the women who never had a vaginal orgasm), than less prominent lip tubercle categories. Lip tubercle was not associated with social desirability responding, or with orgasm triggered by masturbation during PVI, solitary or partner clitoral or vaginal masturbation, vibrator, or cunnilingus. The results are discussed in light of the unique nature of vaginal orgasm and the possibility of prenatal developmental influences. © 2011 International Society for Sexual Medicine.

Loss of cytokeratin 10 indicates malignant transformation in actinic cheilitis.

PubMed

Garcia, Natália Galvão; Oliveira, Denise Tostes; Lauris, José Roberto Pereira; Domingues, Maria Aparecida Custódio; Minicucci, Eliana Maria; Soares, Cléverson Teixeira

2016-05-01

The aim of this study was to investigate the relationship the expression of cytokeratins (CK10 and CK13) and the cell proliferation index determined by Ki-67 of lip squamous cell carcinoma and actinic cheilitis with different degrees of dysplasia. Forty-five paraffin-embedded actinic cheilitis with and without dysplasia and 20 lip squamous cell carcinoma were analyzed by immunohistochemistry using anti-human anti-CK10, anti-CK13, and anti-Ki-67 antibodies. The majority of actinic cheilitis showed immunopositivity for CK10 and CK13 with decrease or loss of expression in dysplastic areas. In lip squamous cell carcinoma of the lip, heterogeneous expression of CK13 and immunonegativity for CK10 were observed. There was a statistically significant difference between CK10 expression in lip squamous cell carcinoma and in actinic cheilitis with or without dysplasia (p < 0.001). The cell proliferation index was higher in actinic cheilitis with dysplasia and lip squamous cell carcinoma than in actinic cheilitis without epithelial dysplasia. A significant correlation was found between the intensity of the epithelial dysplasia and the cell proliferation index (p < 0.001). These results provide evidence that there is a downregulation of CK10 expression in dysplastic areas of patients with actinic cheilitis and in those with lip squamous cell carcinoma (LSCC) and that the index of cell proliferation, determined by Ki-67, is directly correlated with the intensity of the epithelial dysplasia. Altogether, these results suggest that CK10 expression and the epithelial cell proliferation index can help to identify malignant transformation in the lip region.

High azathioprine dose and lip cancer risk in liver, heart, and lung transplant recipients: A population-based cohort study.

PubMed

Na, Renhua; Laaksonen, Maarit A; Grulich, Andrew E; Meagher, Nicola S; McCaughan, Geoffrey W; Keogh, Anne M; Vajdic, Claire M

2016-06-01

Iatrogenic immunosuppression is a risk factor for lip cancer but the determinants are unknown. We sought to quantify the association between the type, dose, and duration of iatrogenic immunosuppression and lip cancer risk in solid organ transplant recipients. We conducted a population-based cohort study of all adult Australian liver, heart, and lung transplant recipients from 1984 to 2006 (n = 4141). We abstracted longitudinal data from medical records and ascertained incident lip cancer (n = 58) and deaths (n = 1434) by linkage with national registries. We estimated multivariable hazard ratios (HR) for lip cancer using the Fine and Gray proportional subdistribution hazards model, accounting for death as a competing risk. Lip cancer risk (n = 58) increased with high mean daily dose of azathioprine (HR 2.28, 95% confidence interval [CI] 1.18-4.38), longer duration of immunosuppression (HR 9.86, 95% CI 2.10-46.3), increasing year of age at transplantation (HR 1.14, 95% CI 1.04-1.25), earlier transplantation era (HR 8.73, 95% CI 1.11-68.7), and history of smoking (HR 2.71, 95% CI 1.09-6.70). Data on potential confounders such as personal solar ultraviolet radiation exposure were not available. Higher doses of azathioprine increase lip cancer risk, with implications for managing immunosuppressed populations and our understanding of the relationship between solar ultraviolet radiation and lip cancer. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

Cheiloscopy and dermatoglyphics as genetic markers in the transmission of cleft lip and palate: A case-control study.

PubMed

Saujanya, K; Prasad, M Ghanashyam; Sushma, B; Kumar, J Raghavendra; Reddy, Y S N; Niranjani, K

2016-01-01

Determining the relative risk of cleft lip and palate (CL[P]) on the basis of lip prints and dermatoglyphics as genetic background may be useful for genetic counseling, and the development of future preventive measures. (1) To analyze the various pattern types of lip prints and dermatoglyphics in parents of CL(P) children and to detect if any specific type can be contemplated as a genetic marker in the transmission of CL(P). (2) To compare these patterns with that of parents of unaffected children. 31 parents of children with CL(P) as a study group, and 31 parents of unaffected children as control group were included. Lip prints and finger prints were collected from all subjects and analysis of both patterns was carried out followed by a comparison of the patterns of unaffected parents with the controls statistically. Among the mothers of the study group, type O followed by type IIa lip patterns were found to be significantly higher in upper and lower lips, and in fathers type IIa followed by type O were significantly higher. In the control group, type IIb followed by type III were higher in both fathers and mothers. Dermatoglyphic analysis of palm and finger prints revealed no significant difference in the pattern types and total ridge counts, but the Atd angle asymmetry was found to be significant between study and control group. Types IIa and O lip patterns, asymmetry of Atd angles can be considered as genetic markers for the transmission of CL(P) deformity to offsprings.

Patients' views on priority setting in neurosurgery: A qualitative study.

PubMed

Gunaratnam, Caroline; Bernstein, Mark

2016-01-01

Accountability for Reasonableness is an ethical framework which has been implemented in various health care systems to improve and evaluate the fairness of priority setting. This framework is grounded on four mandatory conditions: relevance, publicity, appeals, and enforcement. There have been few studies which have evaluated the patient stakeholders' acceptance of this framework; certainly no studies have been done on patients' views on the prioritization system for allocating patients for operating time in a system with pressure on the resource of inpatient beds. The aim of this study is to examine neurosurgical patients' views on the prioritization of patients for operating theater (OT) time on a daily basis at a tertiary and quaternary referral neurosurgery center. Semi-structured face-to-face interviews were conducted with thirty-seven patients, recruited from the neurosurgery clinic at Toronto Western Hospital. Family members and friends who accompanied the patient to their clinic visit were encouraged to contribute to the discussion. Interviews were audio recorded, transcribed verbatim, and subjected to thematic analysis using open and axial coding. Overall, patients are supportive of the concept of a priority-setting system based on fairness, but felt that a few changes would help to improve the fairness of the current system. These changes include lowering the level of priority given to volume-funded cases and providing scheduled surgeries that were previously canceled a higher level of prioritization. Good communication, early notification, and rescheduling canceled surgeries as soon as possible were important factors that directly reflected the patients' confidence level in their doctor, the hospital, and the health care system. This study is the first clinical qualitative study of patients' perspective on a prioritization system used for allocating neurosurgical patients for OT time on a daily basis in a socialized not-for-profit health care system with fixed resources.

CLEFT PALATE. FOUNDATIONS OF SPEECH PATHOLOGY SERIES.

ERIC Educational Resources Information Center

RUTHERFORD, DAVID; WESTLAKE, HAROLD

DESIGNED TO PROVIDE AN ESSENTIAL CORE OF INFORMATION, THIS BOOK TREATS NORMAL AND ABNORMAL DEVELOPMENT, STRUCTURE, AND FUNCTION OF THE LIPS AND PALATE AND THEIR RELATIONSHIPS TO CLEFT LIP AND CLEFT PALATE SPEECH. PROBLEMS OF PERSONAL AND SOCIAL ADJUSTMENT, HEARING, AND SPEECH IN CLEFT LIP OR CLEFT PALATE INDIVIDUALS ARE DISCUSSED. NASAL RESONANCE…

Coupling Dynamics Interlip Coordination in Lower Lip Load Compensation

ERIC Educational Resources Information Center

van Lieshout, Pascal; Neufeld, Chris

2014-01-01

Purpose: To study the effects of lower lip loading on lower and upper lip movements and their coordination to test predictions on coupling dynamics derived from studies in limb control. Method: Movement data were acquired using electromagnetic midsagittal articulography under 4 conditions: (a) without restrictions, serving as a baseline; (b) with…

7 CFR 760.102 - Administration of ELAP, LFP, LIP, SURE, and TAP.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 7 2011-01-01 2011-01-01 false Administration of ELAP, LFP, LIP, SURE, and TAP. 760.102 Section 760.102 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE... Supplemental Agricultural Disaster Assistance Programs § 760.102 Administration of ELAP, LFP, LIP, SURE, and...

7 CFR 760.108 - Payment limitation.

Code of Federal Regulations, 2011 CFR

2011-01-01

...,000 total for the 2008 program year under ELAP, LFP, LIP, and SURE combined or (2) $100,000 for the... receive, directly or indirectly, more than: (1) $100,000 per program year total under ELAP, LFP, LIP, and..., LIP, SURE, and TAP if the individual's or entity's average adjusted gross income (AGI) exceeds $2.5...

Bright Promise for Your Child with Cleft Lip and Cleft Palate. Revised Edition.

ERIC Educational Resources Information Center

McDonald, Eugene T.; Berlin, Asa J.

Intended for parents of children with cleft lip and cleft palate, the booklet provides an overview of the condition. Addressed are the following topics (sample subtopics in parentheses): prenatal development and birth defects (facial development); possible causes of cleft lip/cleft palate (common misconceptions, genetic factors, environmental…

7 CFR 2902.26 - Lip care products.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 15 2011-01-01 2011-01-01 false Lip care products. 2902.26 Section 2902.26 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF ENERGY POLICY AND NEW USES, DEPARTMENT OF AGRICULTURE GUIDELINES FOR DESIGNATING BIOBASED PRODUCTS FOR FEDERAL PROCUREMENT Designated Items § 2902.26 Lip care products. (a)...

[Clinical effect of functional repair of bilateral cleft lip in 66 patients].

PubMed

Li, Ming; Jiang, Hong-bing; Yuan, Hua; DU, Yi-fei; Wu, Yu-nong; Wan, Lin-zhong

2014-10-01

To explore the clinical effect of functional repair for bilateral cleft lip using modified Mulliken method. Sixty-six patients with bilateral cleft lip were selected and assigned to receive modified Mulliken method. During the operation, the prolabium was kept as narrow "tie" shape, the orbicularis oris was anatomically repositioned, and the orbicularis oris ring was re-built. Vermilion tubercle was reconstructed with the lateral red vermillion. The nasal deformity was preliminarily repaired. and the nasal columella was elongated at the same time. All the patients were followed-up for 0.5-2 years, there was no "trisection upper lip". The symmetry and natural shape of Cupid's bow were obtained in more than 80% patients. The width of philtrum was similar to normal children. Full vermilion of the lips, moderate-size vermilion tubercles and good dynamic and static shape were obtained without whistle deformities. Normal width of nasal base and nostril symmetry were gained. The columella was elongated. Satisfactory contour of the nasal tip was achieved. Modified Mulliken method could functionally repair bilateral cleft lip and effectively correct nasolabial deformities. It is worthy of wide clinical application.

Freeze-Dried Black Raspberries in Preventing Oral Cancer Recurrence in High-Risk Appalachian Patients Previously Treated With Surgery For Oral Cancer

ClinicalTrials.gov

2018-03-04

Stage I Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage I Squamous Cell Carcinoma of the Oropharynx; Stage I Verrucous Carcinoma of the Oral Cavity; Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Squamous Cell Carcinoma of the Oropharynx; Stage II Verrucous Carcinoma of the Oral Cavity; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Verrucous Carcinoma of the Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Oropharynx; Stage IVA Verrucous Carcinoma of the Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Oropharynx; Stage IVB Verrucous Carcinoma of the Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Oropharynx; Stage IVC Verrucous Carcinoma of the Oral Cavity; Tongue Cancer

Lip movements affect infants' audiovisual speech perception.

PubMed

Yeung, H Henny; Werker, Janet F

2013-05-01

Speech is robustly audiovisual from early in infancy. Here we show that audiovisual speech perception in 4.5-month-old infants is influenced by sensorimotor information related to the lip movements they make while chewing or sucking. Experiment 1 consisted of a classic audiovisual matching procedure, in which two simultaneously displayed talking faces (visual [i] and [u]) were presented with a synchronous vowel sound (audio /i/ or /u/). Infants' looking patterns were selectively biased away from the audiovisual matching face when the infants were producing lip movements similar to those needed to produce the heard vowel. Infants' looking patterns returned to those of a baseline condition (no lip movements, looking longer at the audiovisual matching face) when they were producing lip movements that did not match the heard vowel. Experiment 2 confirmed that these sensorimotor effects interacted with the heard vowel, as looking patterns differed when infants produced these same lip movements while seeing and hearing a talking face producing an unrelated vowel (audio /a/). These findings suggest that the development of speech perception and speech production may be mutually informative.

C/EBPβ LIP and c-Jun synergize to regulate expression of the murine progesterone receptor.

PubMed

Wang, Weizhong; Do, Han Ngoc; Aupperlee, Mark D; Durairaj, Srinivasan; Flynn, Emily E; Miksicek, Richard J; Haslam, Sandra Z; Schwartz, Richard C

2018-06-02

CCAAT/enhancer binding protein β (C/EBPβ) is required for murine mammary ductal morphogenesis and alveologenesis. Progesterone is critical for proliferation and alveologenesis in adult mammary glands, and there is a similar requirement for progesterone receptor isoform B (PRB) in alveologenesis. We examined C/EBPβ regulation of PR expression. All three C/EBPβ isoforms, including typically inhibitory LIP, transactivated the PR promoter. LIP, particularly, strongly synergized with c-Jun to drive PR transcription. Endogenous C/EBPβ and c-Jun stimulated a PR promoter-reporter and these two factors showed promoter occupancy on the endogenous PR gene. Additionally, LIP overexpression elevated endogenous PR protein expression. In pregnancy, both PRB and the relative abundance of LIP among C/EBPβ isoforms increase. Consistent with a role in PRB expression, in vivo C/EBPβ and PR isoform A expression showed mutually exclusive localization in mammary epithelium, while C/EBPβ and PRB largely co-localized. We suggest a critical role for C/EBPβ, particularly LIP, in PRB expression. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Low speed test of a high-bypass-ratio propulsion system with an asymmetric inlet designed for a tilt-nacelle V/STOL airplane

NASA Technical Reports Server (NTRS)

Syberg, J.

1978-01-01

A large scale model of a lift/cruise fan inlet designed for a tilt nacelle V/STOL airplane was tested with a high bypass ratio turbofan. Testing was conducted at low freestream velocities with inlet angles of attack ranging from 0 deg to 120 deg. The operating limits for the nacelle were found to be related to inlet boundary layer separation. Small separations originating in the inlet diffuser cause little or no performance degradation. However, at sufficiently severe freestream conditions the separation changes abruptly to a lip separation. This change is associated with a significant reduction in nacelle net thrust as well as a sharp increase in fan blade vibratory stresses. Consequently, the onset of lip separation is regarded as the nacelle operating limit. The test verified that the asymmetric inlet design will provide high performance and stable operation at the design forward speed and angle of attack conditions. At some of these, however, operation near the lower end of the design inlet airflow range is not feasible due to the occurrence of lip separation.

Use of modified lip repositioning technique associated with esthetic crown lengthening for treatment of excessive gingival display: A case report of multiple etiologies

PubMed Central

Mantovani, Matheus Bortoluzzi; Souza, Eduardo Clemente; Marson, Fabiano Carlos; Corrêa, Giovani Oliveira; Progiante, Patrícia Saram; Silva, Cléverson Oliveira

2016-01-01

Excessive gingival display during smile can result in compromised esthetics. This study aims to report a case of excessive gingival display with multiple etiologies treated by means of modified lip repositioning technique associated with esthetic crown lengthening. A 23-year-old female patient, with 5-mm gingival display during smile caused by altered passive eruption and hypermobility of the upper lip, underwent the modified lip repositioning technique associated with gingivectomy followed by flap elevation and ostectomy/osteoplasty. Seven months after the second procedure, the patient had her esthetic complaint solved appearing stable in the observation period. The modified lip repositioning technique is an effective procedure employed to reduce gingival display and when associated with esthetic clinical crown lengthening, can appropriately treat cases of gummy smile. PMID:27041845

Maxillary distraction in patients with cleft deformity using a rigid external distraction device: a pilot study on the distraction ratio of the maxilla to the device.

PubMed

Harada, Kiyoshi; Sato, Masaru; Omura, Ken

2004-01-01

We examined the ratio between actual maxillary distraction and the distraction of the rigid external distraction device (Rigid external distraction (RED) system) used for maxillary distraction in patients with a cleft deformity. Twelve patients were examined. The amount of maxillary advancement was measured on lateral cephalograms and divided by the activation amount on the RED system. The value obtained was represented as the distraction ratio of the maxilla to the system. The mean ratio in 10 patients with complete cleft lip, palate, and alveolus (complete cleft) was 0.24. However, the ratios in two patients with cleft lip and alveolus or soft cleft palate (incomplete cleft) were considerably higher than the mean ratios in patients with complete cleft. When the maxilla is distracted in patients with complete cleft using the RED system, the amount of activation on the system needs to be about four times the amount of planned maxillary distraction. However, the distraction ratio may be affected by the type of cleft.

One-Stage Cleft Lip and Palate Repair in an Older Population.

PubMed

Guneren, Ethem; Canter, Halil Ibrahim; Yildiz, Kemalettin; Kayan, Resit Burak; Ozpur, Mustafa Aykut; Baygol, Emre Gonenc; Sagir, Haci Omer; Kuzu, Ismail Melih; Akman, Onur; Arslan, Serap

2015-07-01

In underdeveloped countries one-stage definitive repair of cleft lip and palate is considered for late-presenting patients. A total of 25 patients with unoperated cleft lip and palate more than 2 years of age were enrolled in this study for one-stage simultaneous repair of cleft lip and palate. According to Veau-Wardill-Kilner push-back technique, 2 flap palatoplasties were performed for palatal repairs; all of the lips were repaired with the Millard II rotation-advancement technique. The authors experienced no perioperative or postoperative life-threatening complications. With respect to the registered operation periods, longer times were required to perform these double operations, but this elongation is shorter than the sum of the periods if the 2 operations had been performed separately. Although the authors were unable to evaluate the late postoperative results because the authors could not follow-up the patients after they were discharged the day after surgery, the early results related to the success of the operation without any surgical complication were prone to meet the parents' and patients' expectations. The authors presented their experiences with many volunteer cleft lip and palate trips to third world countries; however the structure of this article is not a new hypothesis and data based to support a scientific study, but observations are objective to get a conclusion. To perform one-stage definitive repair of the cleft lip and palate in late-presented patients was the reality that they had only 1 chance to undergo these operations. According to the terms and conditions of this challenging operation, one-stage simultaneous repair of cleft lip and palate is a more demanding and time-consuming procedure than is isolated cleft lip repair or cleft palate repair. Although technically challenging, single-stage repair of the whole deformity in late-presenting patients is a feasible, reliable, successful, and safe procedure in authors' experience.

Parental satisfaction in Ugandan children with cleft lip and palate following synchronous lip and palatal repair.

PubMed

Luyten, Anke; D'haeseleer, Evelien; Budolfsen, Dorte; Hodges, Andrew; Galiwango, George; Vermeersch, Hubert; Van Lierde, Kristiane

2013-01-01

The purpose of the present case control study was to assess parental satisfaction with speech and facial appearance in Ugandan children with complete unilateral or bilateral cleft lip and palate (CLP), who underwent a synchronous lip and palatal closure. The results are compared with an age- and gender-matched control group. The experimental group consisted of the parents or guardians of 44 Ugandan patients (21 males, 23 females) with complete unilateral or bilateral CLP (mean age: 3;1 years). The control group included the foster mothers of 44 orphan children matched by age and gender (mean age: 3;7 years). A survey based on the Cleft Evaluation Profile was used to assess the perceived satisfaction for individual features related to cleft care. Overall high levels of satisfaction were observed in the experimental group for all features (range: 56-100%). No significant differences could be established regarding age, gender, age of lip and palatal closure, cleft type or maternal vs. paternal judgments. In participants who were dissatisfied with the appearance of the lip, the time period between the cleft closure and the survey was significantly larger compared with satisfied participants. Furthermore, significantly lower levels of satisfaction were observed in the cleft group for speech and the appearance of the teeth and the nose compared with the control group. Satisfaction with speech and facial appearance in Ugandan children with cleft lip and/or palate is important since normal esthetics and speech predominantly determine the children's social acceptance in the Ugandan society. As a result of reading this manuscript, the reader will be able to explain the attitudes of parents toward the surgical repair of their children's cleft lip and palate. As a result of reading this manuscript, the reader will be able to identify differences in parental attitudes toward synchronous lip and palate repair. Copyright © 2013 Elsevier Inc. All rights reserved.

The use of throat packs in pediatric cleft lip/palate surgery: a retrospective study.

PubMed

Smarius, B J A; Guillaume, C H A L; Jonker, G; van der Molen, A B Mink; Breugem, C C

2018-02-22

Throat packs are commonly used to prevent ingestion or aspiration of blood and other debris during cleft lip/palate surgery. However, dislodgement or (partial) retainment after extubation could have serious consequences. The aim of the present study was to investigate the effect of omitting pharyngeal packing during cleft lip/palate surgery on the incidence of early postoperative complications in children. A retrospective study was performed on all children who underwent cleft lip/palate surgery at the Wilhelmina Children's Hospital. This study compared the period January 2010 through December 2012 when pharyngeal packing was applied according to local protocol (group A) with the period January 2013 till December 2015 when pharyngeal packing was no longer applied after removal from the protocol (group B). Data were collected for sex, age at operation, cleft lip/palate type, type of repair, lateral incisions, length of hospital stay, and complications in the first 6 weeks after surgery. Early complications included wound dehiscence, postoperative bleeding, infection, fever, upper respiratory tract infection (URTI), and lower respiratory tract infection (LRTI). This study included 489 cleft lip/palate operations (group A n = 246, group B n = 243). A total of 39 (15.9%) early complications were recorded in group A and a total of 40 (16.5%) in group B. There were no significant differences (P = 0.902) in complications between the two groups; however, there was a significant difference (P < 0.001) in length of hospital stay between the two groups (group A 3.6 days vs group B 3.2 days). Omitting routine placement of throat packs in cleft lip/palate surgery was not associated with an increased early postoperative complication rate. Therefore, the traditional, routine placement of a throat pack during cleft lip/palate surgery can be questioned. The traditional, routine placement of a throat pack during cleft lip/palate surgery can be questioned.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

Relationship between tongue strength, lip strength, and nutrition-related sarcopenia in older rehabilitation inpatients: a cross-sectional study

PubMed Central

Sakai, Kotomi; Nakayama, Enri; Tohara, Haruka; Kodama, Keiji; Takehisa, Takahiro; Takehisa, Yozo; Ueda, Koichiro

2017-01-01

Objective The objective of this study was to clarify the relationship between tongue strength, lip strength, and nutrition-related sarcopenia (NRS). Patients and methods A total of 201 older inpatients aged ≥65 years (70 men, median age: 84 years, interquartile range: 79–89 years) consecutively admitted for rehabilitation were included in this cross-sectional study. The main factors evaluated were the presence of NRS diagnosed by malnutrition using the Mini-Nutrition Assessment – Short Form, sarcopenia based on the criteria of the Asian Working Group for Sarcopenia, tongue strength, and lip strength. Other factors such as age, sex, comorbidity, physical function, cognitive function, and oral intake level were also assessed. Results In all, 78 (38.8%) patients were allocated to the NRS group, and 123 (61.2%) patients were allocated to the non-NRS group. The median tongue strength and lip strength (interquartile range) were significantly lower in the NRS group (tongue: 22.9 kPa [17.7–27.7 kPa] and lip: 7.2 N [5.6–9.8 N]) compared with the non-NRS group (tongue: 29.7 kPa [24.8–35.1 kPa] and lip: 9.9 N [8.4–12.3 N], P<0.001 for both). Multivariable logistic regression analysis showed that NRS was independently associated with tongue strength (odds ratio [OR] =0.93, 95% confidence interval [CI] 0.87–0.98, P=0.012) and lip strength (OR =0.76, 95% CI 0.66–0.88, P<0.001), even after adjusting for age, sex, comorbidity, physical function, cognitive function, and oral intake level. Conclusion The likelihood of occurrence of NRS decreased when tongue strength or lip strength increased. Tongue strength and lip strength may be important factors for preventing and improving NRS, regardless of the presence of low oral intake level in older rehabilitation inpatients. PMID:28814847

Regression equations for sex and population detection using the lip print pattern among Egyptian and Malaysian adult.

PubMed

Abdel Aziz, Manal H; Badr El Dine, Fatma M M; Saeed, Nourhan M M

2016-11-01

Identification of sex and ethnicity has always been a challenge in the fields of forensic medicine and criminal investigations. Fingerprinting and DNA comparisons are probably the most common techniques used in this context. However, since they cannot always be used, it is necessary to apply different and less known techniques such as lip prints. Is to study the pattern of lip print in Egyptian and Malaysian populations and its relation to sex and populations difference. Also, to develop equations for sex and populations detection using lip print pattern by different populations (Egyptian and Malaysian). The sample comprised of 120 adults volunteers divided into two ethnic groups; sixty adult Egyptians (30 males and 30 females) and sixty adult Malaysians (30 males and 30 females). The lip prints were collected on a white paper. Each lip print was divided into four compartments and were classified and scored according to Suzuki and Tsuchihashi classification. Data were statistically analyzed. The results showed that type III lip print pattern (intersected grooves) was the predominant type in both the Egyptian and Malaysian populations. Type II and III were the most frequent in Egyptian males (28.3% each), while in Egyptian females type III pattern was predominant (46.7%). As regards Malaysian males, type III lip print pattern was the predominant one (41.7%), while type II lip print pattern was predominant (30.8%) in Malaysian females. Statistical analysis of different quadrants showed significant differences between males and females in the Egyptian population in the third and fourth quadrants. On the other hand, significant differences were detected only in the second quadrant between Malaysian males and females. Also, a statistically significant difference was present in the second quadrant between Egyptian and Malaysian males. Using the regression analysis, four regression equations were obtained. Copyright © 2016 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

A De Novo Floral Transcriptome Reveals Clues into Phalaenopsis Orchid Flower Development

PubMed Central

Huang, Jian-Zhi; Lin, Chih-Peng; Cheng, Ting-Chi; Chang, Bill Chia-Han; Cheng, Shu-Yu; Chen, Yi-Wen; Lee, Chen-Yu; Chin, Shih-Wen; Chen, Fure-Chyi

2015-01-01

Phalaenopsis has a zygomorphic floral structure, including three outer tepals, two lateral inner tepals and a highly modified inner median tepal called labellum or lip; however, the regulation of its organ development remains unelucidated. We generated RNA-seq reads with the Illumina platform for floral organs of the Phalaenopsis wild-type and peloric mutant with a lip-like petal. A total of 43,552 contigs were obtained after de novo assembly. We used differentially expressed gene profiling to compare the transcriptional changes in floral organs for both the wild-type and peloric mutant. Pair-wise comparison of sepals, petals and labellum between peloric mutant and its wild-type revealed 1,838, 758 and 1,147 contigs, respectively, with significant differential expression. PhAGL6a (CUFF.17763), PhAGL6b (CUFF.17763.1), PhMADS1 (CUFF.36625.1), PhMADS4 (CUFF.25909) and PhMADS5 (CUFF.39479.1) were significantly upregulated in the lip-like petal of the peloric mutant. We used real-time PCR analysis of lip-like petals, lip-like sepals and the big lip of peloric mutants to confirm the five genes’ expression patterns. PhAGL6a, PhAGL6b and PhMADS4 were strongly expressed in the labellum and significantly upregulated in lip-like petals and lip-like sepals of peloric-mutant flowers. In addition, PhAGL6b was significantly downregulated in the labellum of the big lip mutant, with no change in expression of PhAGL6a. We provide a comprehensive transcript profile and functional analysis of Phalaenopsis floral organs. PhAGL6a PhAGL6b, and PhMADS4 might play crucial roles in the development of the labellum in Phalaenopsis. Our study provides new insights into how the orchid labellum differs and why the petal or sepal converts to a labellum in Phalaenopsis floral mutants. PMID:25970572

Retinal and anterior eye compartments derive from a common progenitor pool in the avian optic cup

PubMed Central

Venters, Sara J.; Cuenca, Paulina D.

2011-01-01

Purpose The optic cup is created through invagination of the optic vesicle. The morphogenetic rearrangement creates a double-layered cup, with a hinge (the Optic Cup Lip) where the epithelium bends back upon itself. Shortly after the optic cup forms, it is thought to be sub-divided into separate lineages: i) pigmented epithelium in the outer layer; ii) presumptive iris and ciliary body at the most anterior aspect of the inner layer; and iii) presumptive neural retina in the remainder of the inner layer. We test the native developmental potential of the anterior cup to determine if it normally contributes to the retina. Methods Vital dye and green fluorescent protein (GFP) expressing replication-incompetent retroviral vectors were used to label cells in the nascent optic cup and follow their direct progeny throughout development. Label was applied to either the optic cup lip (n=40), or to the domain just posterior to the lip (n=20). Retroviral labeling is a permanent lineage marker and enabled the analysis of advanced stages of development. Results Labeling within the optic cup gave rise to labeled progeny in the posterior optic cup that differentiated as neural retina (20 of 20). In contrast, labeling cells in the optic cup lip gave rise to progeny of labeled cells arrayed in a linear progression, from the lip into the neural retina (36 of 40). Label was retained in cells at the optic cup lip, regardless of age at examination. In older embryos, labeled progeny delaminated from the optic cup lip to differentiate as muscle of the pupillary margin. Conclusions The data show that the cells at the optic cup lip are a common progenitor population for pigmented epithelium, anterior eye tissues (ciliary body, iris, and pupillary muscle) and retinal neurons. The findings are supportive of an interpretation where the optic cup lip is a specialized niche containing a multipotent progenitor population. PMID:22219630

Jewelry cleaners

MedlinePlus

... swelling (may also cause breathing difficulty) EYES, EARS, NOSE, AND THROAT Severe pain in the throat Severe pain or burning in the nose, eyes, ears, lips, or tongue Vision loss GASTROINTESTINAL SYSTEM ... pain (severe) Bloody stools Burns and possible holes of ...

Prioritizing preferable locations for increasing urban tree canopy in New York City

Treesearch

Dexter Locke; J. Morgan Grove; Jacqueline W.T. Lu; Austin Troy; Jarlath P.M. O' Neil-Dunne; Brian Beck

2010-01-01

This paper presents a set of Geographic Information System (GIS) methods for identifying and prioritizing tree planting sites in urban environments. It uses an analytical approach created by a University of Vermont service-learning class called "GIS Analysis of New York City's Ecology" that was designed to provide research support to the MillionTreesNYC...

Nasoalveolar molding in a case of incomplete cleft lip: Is it worth doing?

PubMed

Esenlik, Elçin; Aydin, Mustafa Asim

2015-01-01

The purpose of this study was to evaluate the effects of presurgical nasoalveolar molding in an infant with incomplete cleft lip and alveolar notch. The patient was a 15-day-old female infant with a two-thirds vertical separation of the left side of the upper lip, with an intact nasal sill. A modified molding appliance was made to improve nasal esthetics and correct the alveolar notch. Although the nasal and alveolar region abnormalities were not serious, the molding appliance improved the nasal and lip esthetics and was stable during the 4-year follow-up.

Status Report on Speech Research. A Report on the Status and Progress of Studies on the Nature of Speech, Instrumentation for Its Investigation, and Practical Applications.

DTIC Science & Technology

1986-01-01

1984). La segmentacion fonologica y silabica en ninos de preescolar y primer grado. Lectura y Vida, 5, 4-13. "-:" " Marcel, A. (1980). Phonological...vaibe (L i rtuin A-li prue r xrse Figuent fo. B ilabial sks:tA. tok sacen th.Cld ie dimninflpaentue ( LA )arabe (LP lip protrusion, LAP) Lip aperture...beutioen (7) copetans alontan selip yaicpraees, and gi rtuinb h orinthe movements for the bitabiar-onstridction og the dimesions loe lips prur ( LA ) ande lip

Van der Woude syndrome: Management in the mixed dentition.

PubMed

Agarwal, Sonahita; Dinesh, M R; Dharma, R M; Amarnath, B C

2013-01-01

This article presents the case of a patient with Van der Woude syndrome treated with orthodontic and orthopedic intervention in the mixed dentition stage. The patient had a bilateral cleft of the lip and alveolus accompanied by lip pits on the lower lip. Intra-orally, there was bilateral anterior and posterior cross-bite with a collapsed maxilla. The maxillary transverse deficiency was managed with orthopedic expansion and the second phase of treatment involved secondary alveolar bone grafting followed by retention with functional regulator-3. The mild maxillary retrognathia and deficient lip support was managed with dental compensation.

Van der Woude syndrome: Management in the mixed dentition

PubMed Central

Agarwal, Sonahita; Dinesh, M. R.; Dharma, R. M.; Amarnath, B. C.

2013-01-01

This article presents the case of a patient with Van der Woude syndrome treated with orthodontic and orthopedic intervention in the mixed dentition stage. The patient had a bilateral cleft of the lip and alveolus accompanied by lip pits on the lower lip. Intra-orally, there was bilateral anterior and posterior cross-bite with a collapsed maxilla. The maxillary transverse deficiency was managed with orthopedic expansion and the second phase of treatment involved secondary alveolar bone grafting followed by retention with functional regulator-3. The mild maxillary retrognathia and deficient lip support was managed with dental compensation. PMID:23853466

Lip colour affects perceived sex typicality and attractiveness of human faces.

PubMed

Stephen, Ian D; McKeegan, Angela M

2010-01-01

The luminance contrast between facial features and facial skin is greater in women than in men, and women's use of make-up enhances this contrast. In black-and-white photographs, increased luminance contrast enhances femininity and attractiveness in women's faces, but reduces masculinity and attractiveness in men's faces. In Caucasians, much of the contrast between the lips and facial skin is in redness. Red lips have been considered attractive in women in geographically and temporally diverse cultures, possibly because they mimic vasodilation associated with sexual arousal. Here, we investigate the effects of lip luminance and colour contrast on the attractiveness and sex typicality (masculinity/femininity) of human faces. In a Caucasian sample, we allowed participants to manipulate the colour of the lips in colour-calibrated face photographs along CIELab L* (light--dark), a* (red--green), and b* (yellow--blue) axes to enhance apparent attractiveness and sex typicality. Participants increased redness contrast to enhance femininity and attractiveness of female faces, but reduced redness contrast to enhance masculinity of men's faces. Lip blueness was reduced more in female than male faces. Increased lightness contrast enhanced the attractiveness of both sexes, and had little effect on perceptions of sex typicality. The association between lip colour contrast and attractiveness in women's faces may be attributable to its association with oxygenated blood perfusion indicating oestrogen levels, sexual arousal, and cardiac and respiratory health.

Occlusal Classification in Relation to Original Cleft Width in Patients With Unilateral Cleft Lip and Palate.

PubMed

Huang, Andrew H; Patel, Kamlesh B; Maschhoff, Clayton W; Huebener, Donald V; Skolnick, Gary B; Naidoo, Sybill D; Woo, Albert S

2015-09-01

To determine a correlation between the width of the cleft palate measured at the time of lip adhesion, definitive lip repair, and palatoplasty and the subsequent occlusal classification of patients born with unilateral cleft lip and palate. Retrospective, observational study. Referral, urban, children's hospital Participants : Dental models and records of 270 patients were analyzed. None. Angle occlusion classification. The mean age at which occlusal classification was determined was 11 ± 0.3 years. Of the children studies, 84 were diagnosed with Class I or II occlusion, 67 were diagnosed with Class III occlusion, and 119 were lost to follow up or transferred care. Mean cleft widths were significantly larger in subjects with Class III occlusion for all measures at time of lip adhesion and definitive lip repair (P < .02). At time of palatoplasty, cleft widths were significantly greater at the alveolus (P = .025) but not at the midportion of the hard palate (P = .35) or posterior hard palate (P = .10). Cleft widths from the lip through to the posterior hard palate are generally greater in children who are diagnosed with Class III occlusion later in life. Notably, the alveolar cleft width is significantly greater at each time point for patients who went on to develop Class III occlusion. There were no significant differences in cleft widths between patients diagnosed later with Class I and Class II occlusions.

Characterisation and Expression Analysis of MrLip1, a Class 3 Family Lipase of Malassezia restricta.

PubMed

Park, Minji; Jung, Won Hee; Han, Song Hee; Lee, Young Hoon; Lee, Yang Won

2015-11-01

The genus Malassezia is associated with a wide range of skin diseases and is the predominant fungal genus isolated from human skin. Of the 14 Malassezia species identified, M. restricta is the most abundant fungal species found from both healthy and diseased skin. Emerging evidences have suggested that extracellular lipases of Malassezia play a critical role in its survival on the host skin surface. This study aimed to characterise the lipase 1 homologue (MrLip1) in M. restricta and to analyse its expression under different environmental conditions. The full sequence of the gene encoding MrLip1 was determined by rapid amplification of cDNA ends, and it was then heterologously expressed in Pichia pastoris. MrLip1 protein was successfully purified and used for lipase assay and specific antibody generation for use in expression analysis. The optimum pH and temperature for the activity of purified MrLip1 were pH 5.0 and 34 °C respectively. Furthermore, the expression of MrLip1 peaked at a similar pH and temperature, suggesting that the optimal conditions for MrLip1 protein activity and expression are similar to that found on the human skin surface. This study provides data to improve our understanding of the role and characteristics of lipase 1 in M. restricta. © 2015 Blackwell Verlag GmbH.

A study of distribution, sex differences and stability of lip print patterns in an Indian population.

PubMed

Kapoor, Neeti; Badiye, Ashish

2017-09-01

Lip prints are very useful in forensic investigations. The objective of this study is to determine predominant lip print pattern found among a central Indian population, to evaluate whether any sex difference exists and to study the permanence of the pattern over a 6 month duration. This study included 200 healthy adult subjects comprising of 100 males and 100 females in the age group of 18-25 years. A convenient and easier method of data collection i.e., digital photography was used instead of the traditional lipstick methods. Lip prints were then divided into four quadrants and recognized as per Suzuki and Tsuchihashi's classification. Type I (30.63%) was found to be most predominant overall in the Marathi population. Type I (29.75%) and Type III (35.75%) were found most prevalent in males and females respectively. Applying the Chi-Square test, statistically significant differences ( p  < 0.05) were observed between male and female lip print patterns in each of the quadrants individually and all quadrants taken together. The lip print patterns remained stable over a period of six-months. Being stable and with significant sex differences, lip prints can be effectively used as an important tool in forensic investigations for individualization as well as identification of sex of the donor, thus, narrowing down the scope of investigation to almost half.

Tongue-lip adhesion and tongue repositioning for obstructive sleep apnoea in Pierre Robin sequence: A systematic review and meta-analysis.

PubMed

Camacho, M; Noller, M W; Zaghi, S; Reckley, L K; Fernandez-Salvador, C; Ho, E; Dunn, B; Chan, D K

2017-05-01

To search for studies on tongue-lip adhesion and tongue repositioning used as isolated treatments for obstructive sleep apnoea in children with Pierre Robin sequence. A systematic literature search of PubMed/Medline and three additional databases, from inception through to 8 July 2016, was performed by two authors. Seven studies with 90 patients (59 tongue-lip adhesion and 31 tongue repositioning patients) met the inclusion criteria. Tongue-lip adhesion reduced the mean (± standard deviation) apnoea/hypopnoea index from 30.8 ± 22.3 to 15.4 ± 18.9 events per hour (50 per cent reduction). The apnoea/hypopnoea index mean difference for tongue-lip adhesion was -15.28 events per hour (95 per cent confidence interval = -30.70 to 0.15; p = 0.05). Tongue-lip adhesion improved the lowest oxygen saturation from 75.8 ± 6.8 to 84.4 ± 7.3 per cent. Tongue repositioning reduced the apnoea/hypopnoea index from 46.5 to 17.4 events per hour (62.6 per cent reduction). Tongue repositioning improved the mean oxygen saturation from 90.8 ± 1.2 to 95.0 ± 0.5 per cent. Tongue-lip adhesion and tongue repositioning can improve apnoea/hypopnoea index and oxygenation parameters in children with Pierre Robin sequence and obstructive sleep apnoea.

[Analysis of psychological conditions of parents of children with cleft lip and palate by using psychological scales before and after psychological treatment].

PubMed

Gong, Cai-xia; Zheng, Qian; Shi, Bing

2011-02-01

To evaluate the psychological conditions of parents of children with cleft lip and palate, and to discuss the clinical psychological treatment methods of these parents. 100 parents of children with cleft lip and palate were selected as the parents of children with cleft lip and palate group, and 34 normal adults were selected as the control group. Two groups were tested by the life event scale (LES) and self-rating anxiety scale (SAS) to analyze their psychological states. After the study group was treated by psychological counseling, two groups were tested by the LES and SAS again. The LES total scores of the patients of children with cleft lip and palate had significant differences compared with the normal adults (P < 0.05) before and after psychological counseling, and the LES scores of negative life event of these patients also significantly decreased before and after psychological counseling (P < 0.05). While the SAS total scores of the patients of children with cleft lip and palate had no significant differences compared with the normal adults before and after psychological counseling (P > 0.05). Analyzing the psychological conditions of parents of children with cleft lip and palate by using psychological scales and then treating them by counseling, is an effective psychological treatment method.

Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee

2007-08-01

The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positivemore » tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.« less

Peripheral facial palsy: Speech, communication and oral motor function.

PubMed

Movérare, T; Lohmander, A; Hultcrantz, M; Sjögreen, L

2017-02-01

The aim of the present study was to examine the effect of acquired unilateral peripheral facial palsy on speech, communication and oral functions and to study the relationship between the degree of facial palsy and articulation, saliva control, eating ability and lip force. In this descriptive study, 27 patients (15 men and 12 women, mean age 48years) with unilateral peripheral facial palsy were included if they were graded under 70 on the Sunnybrook Facial Grading System. The assessment was carried out in connection with customary visits to the ENT Clinic and comprised lip force, articulation and intelligibility, together with perceived ability to communicate and ability to eat and control saliva conducted through self-response questionnaires. The patients with unilateral facial palsy had significantly lower lip force, poorer articulation and ability to eat and control saliva compared with reference data in healthy populations. The degree of facial palsy correlated significantly with lip force but not with articulation, intelligibility, perceived communication ability or reported ability to eat and control saliva. Acquired peripheral facial palsy may affect communication and the ability to eat and control saliva. Physicians should be aware that there is no direct correlation between the degree of facial palsy and the possible effect on communication, eating ability and saliva control. Physicians are therefore recommended to ask specific questions relating to problems with these functions during customary medical visits and offer possible intervention by a speech-language pathologist or a physiotherapist. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Skeletal anchorage for orthodontic correction of severe maxillary protrusion after previous orthodontic treatment.

PubMed

Tanaka, Eiji; Nishi-Sasaki, Akiko; Hasegawa, Takuro; Nishio, Clarice; Kawai, Nobuhiko; Tanne, Kazuo

2008-01-01

The correction of a severe maxillary protrusion in an adult by distal movement of the maxillary molars has been one of the most difficult biomechanical problems in orthodontics. This article reports on the treatment of an adult case of severe maxillary protrusion and a large overjet treated with a skeletal anchorage system. A female patient, age 22 years and 3 months, complained of the difficulty of lip closure due to severe maxillary protrusion with a gummy smile. Overjet and overbite were +7.6 mm and -0.9 mm, respectively. She had a history of orthodontic treatment in which her maxillary first premolars were extracted. In order to conduct distal movement of the maxillary molars, anchor plates were placed in the zygomatic process. After achieving a Class I molar relationship, retraction and intrusion of the maxillary incisors were performed. After a 2-year treatment, an acceptable occlusion was achieved with a Class I molar relationship. Her convex facial profile with upper lip protrusion was considerably improved, and the lips showed less tension in lip closure. After a 2-year retention period, an acceptable occlusion was maintained without recurrence of maxillary protrusion, indicating a stability of the occlusion. The result of this treatment indicated that skeletal anchorage is of great importance as a remedy for achieving intrusion and retraction of the maxillary incisors in cases of severe maxillary protrusion with a patient who had previous orthodontic treatment.

Stereophotogrammetric analysis of nasolabial morphology among Asian Malays: influence of age and sex.

PubMed

Al-Khatib, Ali R; Rajion, Zainul A; Masudi, Sam'an M; Hassan, Rozita; Anderson, Peter J; Townsend, Grant C

2012-07-01

It is clear that population-specific norms should be used when planning plastic and reconstructive surgery for selected patients. In this study, we aimed to generate nasal and labial reference values by applying a stereophotogrammetric technique. A further aim was to investigate the effect of sexual dimorphism, age-related changes, and the interrelation between nasal and labial morphology. Cross-sectional study. The data were collected from different locations on the Malaysian peninsula. A total of 276 Asian Malays (138 males and 138 females) were included in this study, and a three-dimensional system was used for capturing data. The sample was divided into three age groups: 13 to 14, 15 to 17, and 18 to 36 years. Twenty-five dimensions of the nose and lips were measured and analyzed separately in males and females. Significant differences between males and females were identified in 11 distances, and significant effects of age were found in most of the dimensions (p < .05). Significant correlations between the nasal and labial dimensions were recorded, particularly between lateral lip height and width of the ala insertion. A principal component analysis showed interrelationships between the nasal width distances and upper lip height. This study has provided a new three-dimensional database for nose and lip morphology in Malays and demonstrated patterns of variation that can be used by surgeons to make comparisons within and between different human populations and also to develop treatment plans for their patients.

Visualizing mushroom body response to a conditioned odor in honeybees

NASA Astrophysics Data System (ADS)

Faber, Till; Menzel, Randolf

2001-11-01

Combining differential conditioning with optophysiological recordings of bee brain activity allows the investigation of learning-related changes in complex neural systems. In this study we focused on the mushroom bodies of the bee brain. Presenting different odors to the animal leads to significant activation of the mushroom body lips. After differential conditioning, the rewarded odor leads to stronger activation than it did before training. Activation by the unrewarded odor remains unchanged. These results resemble findings in the bee's antennal lobes, which are the first olfactory relay station in the insect brain. As an integrative neural network, enhanced activation of the mushroom body lip may carry additional information, i.e., for processing odor concentrations.

Macular pigmentation complicating irritant contact dermatitis and viral warts in Laugier-Hunziker syndrome.

PubMed

Bhoyrul, B; Paulus, J

2016-04-01

Laugier-Hunziker syndrome (LHS) is a rare acquired disorder characterized by macu-lar pigmentation of the lips and oral mucosa, with frequent longitudinal melanonychia. Involvement of other areas, such as the genitalia and fingers, has rarely been described. LHS is a benign condition with no known systemic manifestations. We report the case of a woman who developed melanotic macules on her fingers and elbow 16 years after the onset of pigmentation of her lips. This unusual feature of LHS in our patient was associated with irritant contact dermatitis and viral warts. Only two cases of an association with an inflammatory dermatosis have been reported previously in the literature. © 2015 British Association of Dermatologists.

LIP: The Livermore Interpolation Package, Version 1.6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fritsch, F. N.

2016-01-04

This report describes LIP, the Livermore Interpolation Package. LIP was totally rewritten from the package described in [1]. In particular, the independent variables are now referred to as x and y, since it is a general-purpose package that need not be restricted to equation of state data, which uses variables ρ (density) and T (temperature).

Prioritizing critical success factors for reverse logistics implementation using fuzzy-TOPSIS methodology

NASA Astrophysics Data System (ADS)

Agrawal, Saurabh; Singh, Rajesh K.; Murtaza, Qasim

2016-03-01

Electronics industry is one of the fastest growing industries in the world. In India also, there are high turnovers and growing demand of electronics product especially after post liberalization in early nineties. These products generate e-waste which has become big environmental issue. Industries can handle these e-waste and product returns efficiently by developing reverse logistics (RL) system. A thorough study of critical success factors (CSFs) and their ordered implementation is essential for successful RL implementation. The aim of the study is to review the CSFs, and to prioritize them for RL implementation in Indian electronics industry. Twelve CSFs were identified through literature review, and discussion with the experts from the Indian electronics industry. Fuzzy-Technique for Order Preference by Similarity to Ideal Solution (TOPSIS) approach is proposed for prioritizing these CSFs. Perusal of literature indicates that fuzzy-TOPSIS has not been applied earlier for prioritization of CSFs in Indian electronics industry. Five Indian electronics companies were selected for evaluation of this methodology. Results indicate that most of the identified factors are crucial for the RL implementation. Top management awareness, resource management, economic factors, and contracts terms and conditions are top four prioritized factor, and process capabilities and skilled workers is the least prioritized factor. The findings will be useful for successful RL implementation in Indian electronics industry.

Measuring lip force by oral screens. Part 1: Importance of screen size and individual variability.

PubMed

Wertsén, Madeleine; Stenberg, Manne

2017-06-01

To reduce drooling and facilitate food transport in rehabilitation of patients with oral motor dysfunction, lip force can be trained using an oral screen. Longitudinal studies evaluating the effect of training require objective methods. The aim of this study was to evaluate a method for measuring lip strength, to investigate normal values and fluctuation of lip force in healthy adults on 1 occasion and over time, to study how the size of the screen affects the force, to evaluate the most appropriate measure of reliability, and to identify force performed in relation to gender. Three different sizes of oral screens were used to measure the lip force for 24 healthy adults on 3 different occasions, during a period of 6 months, using an apparatus based on strain gauge. The maximum lip force as evaluated with this method depends on the area of the screen size. By calculating the projected area of the screen, the lip force could be normalized to an oral screen pressure quantity expressed in kPa, which can be used for comparing measurements from screens with different sizes. Both the mean value and standard deviation were shown to vary between individuals. The study showed no differences regarding gender and only small variation with age. Normal variation over time (months) may be up to 3 times greater than the standard error of measurement at a certain occasion. The lip force increases in relation to the projected area of the screen. No general standard deviation can be assigned to the method and all measurements should be analyzed individually based on oral screen pressure to compensate for different screen sizes.

Internationally adopted children with cleft lip and/or palate: A retrospective cohort study.

PubMed

Werker, C L; de Wilde, H; Mink van der Molen, A B; Breugem, C C

2017-12-01

The treatment approach for internationally adopted children with cleft lip and/or palate differs from locally born children with cleft lip and/or palate. They are older at initial presentation, may have had treatment abroad of different quality, and are establishing new and still fragile relationships with their adoptive parents. The aim of this study was to describe the characteristics and initial care and treatment of this group. A retrospective cohort study was performed including all internationally adopted children with cleft lip and/or palate presenting to the cleft team outpatient clinic in the Wilhelmina Children's Hospital between January 1994 and December 2014. Medical records of all patients were reviewed; information concerning demographic characteristics, characteristics at initial presentation, and treatment were obtained. A total number of 132 adopted patients were included: 15% had cleft lip, 7% had cleft palate, and 78% had cleft lip and palate. The average age at the time of adoption was 26.5 months. In most cases, China was the country of origin. Seventy-eight percent had surgery in their country of origin, primarily lip repair. Fistulae in need of revision surgery were found in 8% of the patients. Pharyngoplasty was needed in 48% of the patients. No significant differences were found for mean age at adoption, gender, cleft type, and one- or two-stage palatal closure. Internationally adopted children with cleft lip and/or palate are a very diverse group of patients with challenging treatment. These children undergo surgery late and frequently need additional surgery. Copyright © 2017 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

Comparative Assessment of the Cleft Profile by Patients with Cleft Lip and Palate, Cleft Surgeons, and Lay People.

PubMed

Meng, Tian; Ma, Lian; Wang, Zhi

2015-10-01

This cross-sectional study aimed to compare subjective assessments among patients with cleft lip and palate (CLP), cleft surgeons, and lay people regarding the soft tissue lateral profile of CLP patients. We also investigated the correlations between subjective assessments and photogrammetric measurements. A total of 150 CLP patients who wished to have treatment for their unattractive appearance were randomly selected. A standard lateral profile color photograph was taken. Panels of three cleft surgeons, ten CLP patients, and ten lay people were selected to be assessors. They rated nasal tip projection, nasolabial esthetics, upper and lower lip esthetics, and the profile for each photograph. Three angular measurements (nasal prominence angle, nasolabial angle, and lip angle) were measured for each photograph. Kendall's coefficient of concordance and logistic regression were used for statistical analysis. Kendall's coefficient of concordance of nasal tip projection, nasolabial esthetics, upper and lower lip esthetics, and the profile were 0.734, 0.683, 0.828, and 0.747, respectively (p < 0.001). Lip angle was associated with the profile scores for cleft surgeons and CLP patients (p < 0.001). The nasal prominence angle and lip angle were associated with the profile scores for lay people (p < 0.001). CLP patients, cleft surgeons, and lay people have similar attitudes to the appearance of CLP patients. Upper and lower lip esthetics is associated with the assessment of the cleft profile that is provided by CLP patients, cleft surgeons, and lay people. In addition, nasal tip projection is another determining factor for lay people. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

Analysis of dynamic smile and upper lip curvature in young Chinese

PubMed Central

Liang, Ling-Zhi; Hu, Wen-Jie; Zhang, Yan-Ling; Chung, Kwok-Hung

2013-01-01

During smile evaluation and anterior esthetic construction, the anatomic and racial variations should be considered in order to achieve better matching results. The aims of this study were to validate an objective method for recording spontaneous smile process and to categorize the smile and upper lip curvature of Chinese Han-nationality youth. One hundred and eighty-eight Chinese Han-nationality youths (88 males and 100 females) ranged from 20 to 35 years of age were selected. Spontaneous smiles were elicited by watching comical movies and the dynamics of the spontaneous smile were captured continuously with a digital video camera. All subjects' smiles were categorized into three types: commissure, cuspid and gummy smile based on video editing software and final images. Subjects' upper lip curvatures were also measured and divided into three groups: upward, straight and downward. Reliability analysis was conducted to obtain intra-rater reliabilities on twice measurements. The Pearson Chi-square test was used to compare differences for each parameters (α=0.05). In smile classification, 60.6% commissure smile, 33.5% cuspid smile and 5.9% gummy smile were obtained. In upper lip measurement, 26.1% upward, 39.9% straight and 34.0% downward upper lip curvature were determined. The commissure smile group showed statistically significant higher percentage of straight (46.5%) and upward (40.4%) in upper lip curvatures (P<0.05), while cuspid smile group (65.1%) and gummy smile group (72.7%) showed statistically significant higher frequency in downward upper lip curvature (P<0.05). It is evident that differences in upper lip curvature and smile classification exist based on race, when comparing Chinese subjects with those of Caucasian descent, and gender. PMID:23558343

Pre Surgical Nasoalveolar Molding: Changing Paradigms in Early Cleft Lip and Palate Rehabilitation

PubMed Central

Murthy, Prashanth Sadashiva; Deshmukh, Seema; Bhagyalakshmi, A; Srilatha, KT

2013-01-01

Background: Alveolar and nasal reconstruction for patients with cleft lip and palate is a challenge for the reconstructive surgeon. Various procedures have been attempted to reduce the cleft gap so as to obtain esthetic results post surgically. Yet there is need of continuous exploration of newer and better methods. Rehabilitation of cleft lip and palate generally requires a team approach with paedodontists playing a major role of performing nasoalveolar molding. Presurgical Nasoalveolar Molding (PNAM) was introduced to reshape the alveolar and nasal segments prior to surgical repair. Over the time there have been changes in the concepts of the same. To assess these changing concepts a pubmed search was performed with different related terminologies and articles over a period of 30 years were obtained. Among the articles retrieved, studies performed over different concepts in early management of cleft lip and palate was selected for the systematic review. Aims This paper describes the changing paradigms in the management of patients with cleft lip and palate, focuses on the current concept of Presurgical nasoalveolar molding(PNAM) and discusses the long term benefits of the same. Conclusion The concept of the management of cleft lip and palate has changed over the time with more emphasis on the nasal and alveolar molding prior to the primary lip repair. This molding reduces the number reconstructive surgeries performed later for the purpose of esthetics. How to cite this article: Murthy P S, Deshmukh S, Bhagyalakshmi A, Srilatha K T. Pre Surgical Nasoalveolar Molding: Changing Paradigms in Early Cleft Lip and Palate Rehabilitation. J Int Oral Health 2013; 5(2):76-86. PMID:24155594

Exposure of Cleft Lip and Palate Patients to Toxic Elements Released during Orthodontic Treatment in the Study of Non-Invasive Matrices

PubMed Central

Mikulewicz, Marcin; Kachniarz, Krzysztof; Chojnacka, Katarzyna

2015-01-01

The Objective The aim of the study was evaluation of metal ions (nickel and chromium) released from orthodontic appliances in cleft lip and palate patients and the usefulness of non-invasive matrices (saliva and hair). Materials and Methods The material studied consisted of 100 individuals, including 59 females and 41 males of 5 to 16 years of age, which were divided into 3 groups: experimental–patients with cleft lip and palate (36 individuals, the average treatment time 5.74 years); control group–patients without cleft lip and palate, during orthodontic treatment (32 individuals, the average treatment time 1.78 years) and the control group patients without cleft lip and palate, without any orthodontic appliances (32 individuals). Samples (saliva, hair) were collected and subjects underwent a survey by questionnaire. Multi-elemental analyses of the composition of non-invasive matrices was conducted in an accredited laboratory by inductively coupled plasma spectrometry technique ICP-OES. The results were reported as mean contents of particular elements (Cd, Cr, Cu, Fe, Mn, Mo, Ni, Si) in hair and in saliva. Results The concentration of Cr, Ni, Fe and Cu ions in saliva of cleft lip and palate patients were several times higher as compared with not treated orthodontically control groups and higher than in the group with orthodontic appliances. Among the assessed matrices, hair of cleft lip and palate patients seem to be not a meaningful biomarker. Conclusion It was found that orthodontic appliances used in long-term treatment of cleft lip and palate patients do not release toxic levels of Cr and Ni ions. PMID:26544176

A 12-year anthropometric evaluation of the nose in bilateral cleft lip-cleft palate patients following nasoalveolar molding and cutting bilateral cleft lip and nose reconstruction.

PubMed

Garfinkle, Judah S; King, Timothy W; Grayson, Barry H; Brecht, Lawrence E; Cutting, Court B

2011-04-01

Patients with bilateral cleft lip-cleft palate have nasal deformities including reduced nasal tip projection, widened ala base, and a deficient or absent columella. The authors compare the nasal morphology of patients treated with presurgical nasoalveolar molding followed by primary lip/nasal reconstruction with age-matched noncleft controls. A longitudinal, retrospective review of 77 nonsyndromic patients with bilateral cleft lip-cleft palate was performed. Nasal tip protrusion, alar base width, alar width, columella length, and columella width were measured at five time points spanning 12.5 years. A one-sample t test was used for statistical comparison to an age-matched noncleft population published by Farkas. All five measurements demonstrated parallel, proportional growth in the treatment group relative to the noncleft group. The nasal tip protrusion, alar base width, alar width, columella length, and columella width were not statistically different from those of the noncleft, age-matched control group at age 12.5 years. The nasal tip protrusion also showed no difference in length at 7 and 12.5 years. The alar width and alar base width were significantly wider at the first four time points. This is the first study to describe nasal morphology following nasoalveolar molding and primary surgical repair in patients with bilateral cleft lip-cleft palate through the age of 12.5 years. In this investigation, the authors have shown that patients with bilateral cleft lip-cleft palate treated at their institution with nasoalveolar molding and primary nasal reconstruction, performed at the time of their lip repair, attained nearly normal nasal morphology through 12.5 years of age.

Enhanced fluorescence diffuse optical tomography with indocyanine green-encapsulating liposomes targeted to receptors for vascular endothelial growth factor in tumor vasculature.

PubMed

Zanganeh, Saeid; Xu, Yan; Hamby, Carl V; Backer, Marina V; Backer, Joseph M; Zhu, Quing

2013-12-01

To develop an indocyanine green (ICG) tracer with slower clearance kinetics, we explored ICG-encapsulating liposomes (Lip) in three different formulations: untargeted (Lip/ICG), targeted to vascular endothelial growth factor (VEGF) receptors (scVEGF-Lip/ICG) by the receptor-binding moiety single-chain VEGF (scVEGF), or decorated with inactivated scVEGF (inactive-Lip/ICG) that does not bind to VEGF receptors. Experiments were conducted with tumor-bearing mice that were placed in a scattering medium with tumors located at imaging depths of either 1.5 or 2.0 cm. Near-infrared fluorescence diffuse optical tomography that provides depth-resolved spatial distributions of fluorescence in tumor was used for the detection of postinjection fluorescent signals. All liposome-based tracers, as well as free ICG, were injected intravenously into mice in the amounts corresponding to 5 nmol of ICG/mouse, and the kinetics of increase and decrease of fluorescent signals in tumors were monitored. A signal from free ICG reached maximum at 15-min postinjection and then rapidly declined with t1/2 of ~20 min. The signals from untargeted Lip/ICG and inactive-Lip/ICG also reached maximum at 15-min postinjection, however, declined somewhat slower than free ICG with t1/2 of ~30 min. By contrast, a signal from targeted scVEGF-Lip/ICG grew slower than that of all other tracers, reaching maximum at 30-min postinjection and declined much slower than that of other tracers with t1/2 of ~90 min, providing a more extended observation window. Higher scVEGF-Lip/ICG tumor accumulation was further confirmed by the analysis of fluorescence on cryosections of tumors that were harvested from animals at 400 min after injection with different tracers.

Characterization of dendritic cells in lip and oral cavity squamous cell carcinoma.

PubMed

Costa, Nádia Lago; Gonçalves, Andréia Souza; Martins, Allisson Filipe Lopes; Arantes, Diego Antônio Costa; Silva, Tarcília Aparecida; Batista, Aline Carvalho

2016-07-01

There may be differences in the antitumor immunity induced by dendritic cells (DCs) during the development of squamous cell carcinoma (SCC) located in the lip rather than in the oral cavity. The aim of this study was to evaluate the number of immature and mature DCs in SCC and potentially malignant disorders of the oral cavity and lip. Immunohistochemistry was used to identify the number (cells/mm(2) ) of immature (CD1a(+) ) or mature (CD83(+) ) DCs in samples of oral cavity SCC (OCSCC) (n = 39), lip SCC (LSCC) (n = 23), leukoplakia (LK) (n = 21), actinic cheilitis (AC) (n = 13), and normal mucosa of the oral cavity (OC control, n = 12) and the lip (lip control, n = 11). The number of CD1a(+) cells tended to be higher in the OC control samples compared with the LK (P = 0.04) and OCSCC (P = 0.21). Unlike, this cell population was lower in the lip control than in AC or LSCC (P < 0.05). The number of CD83(+) cells was increased in the LSCC samples compared with the AC and lip control (P = 0.0001) and in OCSCC compared with both the LK (P = 0.001) and OC control (P = 0.0001) samples. LSCC showed an elevated number of CD1a(+) and CD83(+) cells compared with OCSCC (P = 0.03). The population of mature DCs was lower than the population of immature DCs in all of the tested groups (P < 0.05). There were a greater number of both mature and immature DC populations in the LSCC samples than in the OCSCC, which could contribute to establishing a more effective immune antitumor response for this neoplasm. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Comparative effectiveness studies examining patient-reported outcomes among children with cleft lip and/or palate: a systematic review.

PubMed

Ranganathan, Kavitha; Vercler, Christian J; Warschausky, Seth A; MacEachern, Mark P; Buchman, Steven R; Waljee, Jennifer F

2015-01-01

Health care policy makers are increasingly encouraging comparative effectiveness research. Little is known regarding comparative studies among children with cleft lip and/or palate. Cleft lip and/or palate profoundly influences self-perception and social functioning, and patient-reported outcomes provide a unique perspective on the success of reconstruction. The purpose of this study was to systematically review the literature regarding patient-reported outcomes among patients with cleft lip and/or palate. The authors reviewed articles from MEDLINE, Embase, and PsycInfo that examined the use of patient-reported outcome instruments for cleft lip and/or palate. Studies of patients with cleft lip and/or palate across any age that described the use of patient-completed measures in patient and control populations were included. A research librarian confirmed the search, and two independent, blinded reviewers performed full-text review. The authors identified 1979 articles and selected 30 for inclusion. Forty-two different assessment tools were used to analyze factors such as self-esteem, behavior, and social support. The Strengths and Difficulties Questionnaire was most commonly used (n = 7), followed by the Childhood Experience Questionnaire (n = 5), and the Satisfaction with Appearance survey (n = 4). Barriers to analysis included lack of standardization of survey administration, effect of publication bias, and variations in patient populations between individual studies. Comparative studies of patient-reported outcomes among patients with cleft lip and/or palate are infrequent. Many instruments exist to measure patient-reported outcomes in this population, but no specific standard exists. Identifying efficient and targeted forms of instrument selection and administration will enhance comparative studies among children with cleft lip and/or palate. Diagnostic, III.

Monoclonal antibodies against LipL32, the major outer membrane protein of pathogenic Leptospira: production, characterization, and testing in diagnostic applications.

PubMed

Fernandes, Cláudia P H; Seixas, Fabiana K; Coutinho, Mariana L; Vasconcellos, Flávia A; Seyffert, Núbia; Croda, Julio; McBride, Alan J; Ko, Albert I; Dellagostin, Odir A; Aleixo, José A G

2007-02-01

Pathogenic serovars of Leptospira have a wide antigenic diversity attributed mainly to the lipopolysaccharide present in the outer membrane. In contrast, antigens conserved among pathogenic serovars are mainly represented by outer membrane proteins. Surface exposure of a major and highly conserved outer membrane lipoprotein (LipL32) was recently demonstrated on pathogenic Leptospira. LipL32 in its recombinant form (rLipL32) was used to immunize BALB/c mice to develop murine monoclonal antibodies (MAbs). Three MAbs against rLipL32 were produced, isotyped, and evaluated for further use in diagnostic tests of leptospirosis using different approaches. MAbs were conjugated to peroxidase and evaluated in a native protein enzyme-linked immunosorbent assay (ELISA) with intact and heat-treated leptospiral cells, conjugated to fluorescein isothiocyanate (FITC) for indirect immunofluorescence with intact and methanol fixed cells and were used for LipL32 immunoprecipitation from leptospiral cells. rLipL32 MAbs conjugated to peroxidase or used as primary antibody bound to intact and heat-treated cells in ELISA, proving that they could be used in enzyme immunoassays for detection of the native protein. In immunofluorescence assay, MAbs labeled bacterial cells either intact or methanol fixed. Two MAbs were able to immunoprecipitate the native protein from live and motile leptospiral cells and, adsorbed onto magnetic beads, captured intact bacteria from artificially contaminated human sera for detection by polymerase chain reaction (PCR) amplification. Results of this study suggest that the MAbs produced can be useful for the development of diagnostic tests based on detection of LipL32 leptospiral antigen in biological fluids.

Relationship between crown-root angulation (collum angle) of maxillary central incisors in Class II, division 2 malocclusion and lower lip line.

PubMed

Srinivasan, Bhadrinath; Kailasam, Vignesh; Chitharanjan, Arun; Ramalingam, Arthi

2013-01-01

The present study aimed to measure the magnitude of the collum angle (crown-root angulation) of maxillary central incisors present in Class II, division 2 malocclusion and to relate the changes in its magnitude with variations in the lower lip line. A set of 120 conventional lateral cephalograms were selected and divided into three groups of 40 each based on the type of malocclusion presented: Class II, division 2 (group 1); Class II, division 1 (group 2); and Class I (group 3). The collum angle of the maxillary central incisor was measured, and the lower lip line was recorded. Analysis of variance (ANOVA) revealed that the mean collum angle was statistically significantly different in the three groups. The mean collum angle was greatest in Class II, division 2 malocclusion (group 1). The mean collum angles were 3.24 ± 4.69 degrees, 0.95 ± 1.06 degrees, and 1.05 ± 1.50 degrees in groups 1, 2, and 3 respectively. In χ ² test comparison of the location of the lower lip line (incisal, middle, or apical third of the central incisor) among the three groups, the lower lip line was found to contact the middle third of the central incisor most frequently in Class II, division 2 malocclusion. ANOVA followed by Tukey honestly significant difference (HSD) test showed that the mean collum angle is significantly increased when the lower lip is in the middle third (P < .05) of the central incisor. Variations in magnitude of the collum angle with the change in the lower lip line suggest a probable etiologic role of the lower lip line in the development of the collum angle.

The second iteration of the Systems Prioritization Method: A systems prioritization and decision-aiding tool for the Waste Isolation Pilot Plant: Volume 2, Summary of technical input and model implementation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prindle, N.H.; Mendenhall, F.T.; Trauth, K.

1996-05-01

The Systems Prioritization Method (SPM) is a decision-aiding tool developed by Sandia National Laboratories (SNL). SPM provides an analytical basis for supporting programmatic decisions for the Waste Isolation Pilot Plant (WIPP) to meet selected portions of the applicable US EPA long-term performance regulations. The first iteration of SPM (SPM-1), the prototype for SPM< was completed in 1994. It served as a benchmark and a test bed for developing the tools needed for the second iteration of SPM (SPM-2). SPM-2, completed in 1995, is intended for programmatic decision making. This is Volume II of the three-volume final report of the secondmore » iteration of the SPM. It describes the technical input and model implementation for SPM-2, and presents the SPM-2 technical baseline and the activities, activity outcomes, outcome probabilities, and the input parameters for SPM-2 analysis.« less

Prioritizing Genes Related to Nicotine Addiction Via a Multi-source-Based Approach.

PubMed

Liu, Xinhua; Liu, Meng; Li, Xia; Zhang, Lihua; Fan, Rui; Wang, Ju

2015-08-01

Nicotine has a broad impact on both the central and peripheral nervous systems. Over the past decades, an increasing number of genes potentially involved in nicotine addiction have been identified by different technical approaches. However, the molecular mechanisms underlying nicotine addiction remain largely unknown. Under such situation, prioritizing the candidate genes for further investigation is becoming increasingly important. In this study, we presented a multi-source-based gene prioritization approach for nicotine addiction by utilizing the vast amounts of information generated from for nicotine addiction study during the past years. In this approach, we first collected and curated genes from studies in four categories, i.e., genetic association analysis, genetic linkage analysis, high-throughput gene/protein expression analysis, and literature search of single gene/protein-based studies. Based on these resources, the genes were scored and a weight value was determined for each category. Finally, the genes were ranked by their combined scores, and 220 genes were selected as the prioritized nicotine addiction-related genes. Evaluation suggested the prioritized genes were promising targets for further analysis and replication study.

Incorporating evolutionary measures into conservation prioritization.

PubMed

Redding, David W; Mooers, Arne Ø

2006-12-01

Conservation prioritization is dominated by the threat status of candidate species. However, species differ markedly in the shared genetic information they embody, and this information is not taken into account if species are prioritized by threat status alone. We developed a system of prioritization that incorporates both threat status and genetic information and applied it to 9546 species of birds worldwide. We devised a simple measure of a species' genetic value that takes into account the shape of the entire taxonomic tree of birds. This measure approximates the evolutionary history that each species embodies and sums to the phylogenetic diversity of the entire taxonomic tree. We then combined this genetic value with each species' probability of extinction to create a species-specific measure of expected loss of genetic information. The application of our methods to the world's avifauna showed that ranking species by expected loss of genetic information may help preserve bird evolutionary history by upgrading those threatened species with fewer close relatives. We recommend developing a mechanism to incorporate a species' genetic value into the prioritization framework.

P5 HER2/neu-derived peptide conjugated to liposomes containing MPL adjuvant as an effective prophylactic vaccine formulation for breast cancer.

PubMed

Shariat, Sheida; Badiee, Ali; Jalali, Seyed Amir; Mansourian, Mercedeh; Yazdani, Mona; Mortazavi, Seyed Alireza; Jaafari, Mahmoud Reza

2014-12-01

Vaccines containing synthetic peptides derived from tumor-associated antigens (TAA) can elicit potent cytotoxic T lymphocyte (CTL) response if they are formulated in an optimal vaccine delivery system. The aim of this study was to develop a simple and effective lipid-based vaccine delivery system using P5 HER2/neu-derived peptide conjugated to Maleimide-PEG2000-DSPE. The conjugated lipid was then incorporated into liposomes composed of DMPC:DMPG:Chol:DOPE containing Monophosphoryl lipid A (MPL) (Lip-DOPE-P5-MPL). Different liposome formulations were prepared and characterized for their physicochemical properties. To evaluate anti-tumoral efficacy, BALB/c mice were immunized subcutaneously 3 times in two-week intervals and the generated immune response was studied. The results demonstrated that Lip-DOPE-P5-MPL induced a significantly higher IFN-γ production by CD8+ T cells intracellularly which represents higher CTL response in comparison with other control formulations. CTL response induced by this formulation caused the lowest tumor size and the longest survival time in a mice model of TUBO tumor. The encouraging results achieved by Lip-DOPE-P5-MPL formulation could make it a promising candidate in developing effective vaccines against Her2 positive breast cancers. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Actinic prurigo of the lip: Two case reports

PubMed Central

Miranda, Ana MO; Ferrari, Thiago M; Werneck, Juliana T; Junior, Arley Silva; Cunha, Karin S; Dias, Eliane P

2014-01-01

Actinic prurigo is a photodermatosis that can affect the skin, conjunctiva and lips. It is caused by an abnormal reaction to sunlight and is more common in high-altitude living people, mainly in indigenous descendants. The diagnosis of actinic prurigo can be challenging, mainly when lip lesions are the only manifestation, which is not a common clinical presentation. The aim of this article is to report two cases of actinic prurigo showing only lip lesions. The patients were Afro-American and were unaware of possible Indian ancestry. Clinical exam, photographs, videoroscopy examination and biopsy were performed, and the diagnosis of actinic prurigo was established. Topical corticosteroid and lip balm with ultraviolet protection were prescribed with excellent results. The relevance of this report is to show that although some patients may not demonstrate the classical clinical presentation of actinic prurigo, the associated clinical and histological exams are determinants for the correct diagnosis and successful treatment of this disease. PMID:25133153

Lip Repair Surgery for Bilateral Cleft Lip and Palate in a Patient Diagnosed with Trisomy 13 and Holoprosencephaly.

PubMed

Akamatsu, Tadashi; Hanai, Ushio; Nakajima, Serina; Kobayashi, Megumi; Miyasaka, Muneo; Matsuda, Shinichi; Ikegami, Mariko

2015-06-20

We report a case of lip repair surgery performed for bilateral cleft lip and palate in a patient diagnosed with trisomy 13 and holoprosencephaly. At the age of 2 years and 7 months, the surgery was performed using a modified De Hann design under general anesthesia. The operation was completed in 1 h and 21 min without large fluctuations in the child's general condition. The precise measurement of the intraoperative design was omitted, and the operation was completed using minimal skin sutures. It is possible to perform less-invasive and short surgical procedures after careful consideration during the preoperative planning. Considering the recent improvements in the life expectancy of patients with trisomy 13, we conclude that surgical treatments for non-life threatening malformations such as cleft lip and palate should be performed for such patients.

Mesoporous silicas synthesis and application for lignin peroxidase immobilization by covalent binding method.

PubMed

Hu, Zunfang; Xu, Longqian; Wen, Xianghua

2013-01-01

Immobilization of enzymes on mesoporous silicas (MS) allows for good reusability. MS with two-dimensional hexagonal pores in diameter up to 14.13 nm were synthesized using Pluronic P123 as template and 1,3,5-triisopropylbenzene as a swelling agent in acetate buffer. The surface of MS was modified by the silanization reagents 3-aminopropyltriethoxysilane. Lignin peroxidase (LiP) was successfully immobilized on the modified MS through covalent binding method by four agents: glutaraldehyde, 1,4-phenylene diisothiocyanate, cyanotic chloride and water-soluble carbodiimide. Results showed that cyanotic chloride provided the best performance for LIP immobilization. The loaded protein concentration was 12.15 mg/g and the immobilized LiP activity was 812.9 U/L. Immobilized LiP had better pH stability. Acid Orange II was used to examine the reusability of immobilized LiP, showing more than 50% of the dye was decolorized at the fifth cycle.

It's a privilege to smile: impact of cleft lip palate on families.

PubMed

Zeytinoglu, Senem; Davey, Maureen P

2012-09-01

In this article we describe prior cross-sectional and longitudinal research conducted with children who were born with cleft lip and/or palate and their families in the United States and internationally. The findings and clinical implications from different times and cultures are synthesized using the Biopsychosocial Model. Our primary aim is to summarize the attachment styles, cognitive, psychological and social functioning, self-concept, neurological functioning, and speech difficulties prevalent among individuals who are born with cleft lip/palate at different developmental stages (e.g., infancy, toddler, childhood, adolescence). Additionally, bystander reactions to the speech and appearance of individuals coping with cleft lip and/or palate and its effects on the family are described. Finally we examine the diversity of samples from prior clinical research and provide clinical recommendations for more collaborative family-based practice among medical and mental health providers treating families coping with cleft lip and/or palate.

Finite element elastic-plastic-creep and cyclic life analysis of a cowl lip

NASA Technical Reports Server (NTRS)

Arya, Vinod K.; Melis, Matthew E.; Halford, Gary R.

1990-01-01

Results are presented of elastic, elastic-plastic, and elastic-plastic-creep analyses of a test-rig component of an actively cooled cowl lip. A cowl lip is part of the leading edge of an engine inlet of proposed hypersonic aircraft and is subject to severe thermal loadings and gradients during flight. Values of stresses calculated by elastic analysis are well above the yield strength of the cowl lip material. Such values are highly unrealistic, and thus elastic stress analyses are inappropriate. The inelastic (elastic-plastic and elastic-plastic-creep) analyses produce more reasonable and acceptable stress and strain distributions in the component. Finally, using the results from these analyses, predictions are made for the cyclic crack initiation life of a cowl lip. A comparison of predicted cyclic lives shows the cyclic life prediction from the elastic-plastic-creep analysis to be the lowest and, hence, most realistic.

Attention, Intention, and Priority in the Parietal Lobe

PubMed Central

Bisley, James W.; Goldberg, Michael E.

2013-01-01

For many years there has been a debate about the role of the parietal lobe in the generation of behavior. Does it generate movement plans (intention) or choose objects in the environment for further processing? To answer this, we focus on the lateral intraparietal area (LIP), an area that has been shown to play independent roles in target selection for saccades and the generation of visual attention. Based on results from a variety of tasks, we propose that LIP acts as a priority map in which objects are represented by activity proportional to their behavioral priority. We present evidence to show that the priority map combines bottom-up inputs like a rapid visual response with an array of top-down signals like a saccade plan. The spatial location representing the peak of the map is used by the oculomotor system to target saccades and by the visual system to guide visual attention. PMID:20192813

A New Concept of Enhancing Immuno-Chemotherapeutic Effects Against B16F10 Tumor via Systemic Administration by Taking Advantages of the Limitation of EPR Effect

PubMed Central

Yang, Yuting; Tai, Xiaowei; Shi, Kairong; Ruan, Shaobo; Qiu, Yue; Zhang, Zhirong; Xiang, Bing; He, Qin

2016-01-01

The enhanced permeability and retention (EPR) effect has been comfortably accepted, and extensively assumed as a keystone in the research on tumor-targeted drug delivery system. Due to the unsatisfied tumor-targeting efficiency of EPR effect being one conspicuous drawback, nanocarriers that merely relying on EPR effect are difficult to access the tumor tissue and consequently trigger efficient tumor therapy in clinic. In the present contribution, we break up the shackles of EPR effect on nanocarriers thanks to their universal distribution characteristic. We successfully design a paclitaxel (PTX) and alpha-galactosylceramide (αGC) co-loaded TH peptide (AGYLLGHINLHHLAHL(Aib)HHIL-Cys) -modified liposome (PTX/αGC-TH-Lip) and introduce a new concept of immuno-chemotherapy combination via accumulation of these liposomes at both spleen and tumor sites naturally and simultaneously. The PTX-initiated cytotoxicity attacks tumor cells at tumor sites, meanwhile, the αGC-triggered antitumor immune response emerges at spleen tissue. Different to the case that liposomes are loaded with sole drug, in this concept two therapeutic processes effectively reinforce each other, thereby elevating the tumor therapy efficiency significantly. The data demonstrates that the PTX/αGC-TH-Lip not only possess therapeutic effect against highly malignant B16F10 melanoma tumor, but also adjust the in vivo immune status and induce a more remarkable systemic antitumor immunity that could further suppress the growth of tumor at distant site. This work exhibits the capability of the PTX/αGC-TH-Lip in improving immune-chemotherapy against tumor after systemic administration. PMID:27698946

Storage assignment optimization in a multi-tier shuttle warehousing system

NASA Astrophysics Data System (ADS)

Wang, Yanyan; Mou, Shandong; Wu, Yaohua

2016-03-01

The current mathematical models for the storage assignment problem are generally established based on the traveling salesman problem(TSP), which has been widely applied in the conventional automated storage and retrieval system(AS/RS). However, the previous mathematical models in conventional AS/RS do not match multi-tier shuttle warehousing systems(MSWS) because the characteristics of parallel retrieval in multiple tiers and progressive vertical movement destroy the foundation of TSP. In this study, a two-stage open queuing network model in which shuttles and a lift are regarded as servers at different stages is proposed to analyze system performance in the terms of shuttle waiting period (SWP) and lift idle period (LIP) during transaction cycle time. A mean arrival time difference matrix for pairwise stock keeping units(SKUs) is presented to determine the mean waiting time and queue length to optimize the storage assignment problem on the basis of SKU correlation. The decomposition method is applied to analyze the interactions among outbound task time, SWP, and LIP. The ant colony clustering algorithm is designed to determine storage partitions using clustering items. In addition, goods are assigned for storage according to the rearranging permutation and the combination of storage partitions in a 2D plane. This combination is derived based on the analysis results of the queuing network model and on three basic principles. The storage assignment method and its entire optimization algorithm method as applied in a MSWS are verified through a practical engineering project conducted in the tobacco industry. The applying results show that the total SWP and LIP can be reduced effectively to improve the utilization rates of all devices and to increase the throughput of the distribution center.

Evaluating wildland fire danger and prioritizing vegetation and fuels treatments

Treesearch

Paul F. Hessburg; Keith M. Reynolds; Robert E. Keane; Kevin M. James; R. Brion Salter

2008-01-01

We present a decision-support application that evaluates danger of severe wildland fire and prioritizes subwatersheds for vegetation and fuels treatment. We demonstrate the use of the system with an example from the Rocky Mountain region in Utah; a planning area of 4.8 million ha encompassing 575 subwatersheds. In a logic model, we evaluate fire danger as a function of...

Air Force Energy Program Policy Memorandum

DTIC Science & Technology

2009-06-16

Critical Asset Prioritization Methodology ( CAPM ) tool Manage costs. 3.4.2.5. Metrics Percentage of alternative/renewable fuel used for aviation fuel...supporting critical assets residing on military installations Field the Critical Asset Prioritization Methodology ( CAPM ) tool by Spring 2008. This CAPM ...Increase the number of flexible fuel systems • Identify/develop privately financed/operated energy production on Air Bases • Field the Critical

Psychosocial Aspects of Cleft Lip and Palate: Implications for Parental Education. Research Report 138.

ERIC Educational Resources Information Center

Kalland, Mirjam

This study focused on the psychosocial aspects of cleft lip and/or palate on maternal emotional reactions and the family, with emphasis on the effect on the maternal-infant bond. Interviews were conducted with 40 mothers of 1-year-old infants with non-syndromic cleft lip and/or palate. The interviews were analyzed using the phenomenological…

Formation of a tyrosine adduct involved in lignin degradation by Trametopsis cervina lignin peroxidase: a novel peroxidase activation mechanism

Treesearch

Yuta Miki; Rebecca Pogni; Sandra Acebes; Fatima Lucas; Elena Fernandez-Fueyo; Maria Camilla Baratto; Maria I. Fernandez; Vivian De Los Rios; Francisco J. Ruiz-duenas; Adalgisa Sinicropi; Riccardo Basosi; Kenneth E. Hammel; Victor Guallar; Angel T. Martinez

2013-01-01

LiP (lignin peroxidase) from Trametopsis cervina has an exposed catalytic tyrosine residue (Tyr181) instead of the tryptophan conserved in other lignin-degrading peroxidases. Pristine LiP showed a lag period in VA (veratryl alcohol) oxidation. However, VA-LiP (LiP after treatment with H2O2...

An Optimal Set of Flesh Points on Tongue and Lips for Speech-Movement Classification

ERIC Educational Resources Information Center

Wang, Jun; Samal, Ashok; Rong, Panying; Green, Jordan R.

2016-01-01

Purpose: The authors sought to determine an optimal set of flesh points on the tongue and lips for classifying speech movements. Method: The authors used electromagnetic articulographs (Carstens AG500 and NDI Wave) to record tongue and lip movements from 13 healthy talkers who articulated 8 vowels, 11 consonants, a phonetically balanced set of…

EF5 to Evaluate Tumor Hypoxia in Patients With High-Grade Soft Tissue Sarcoma or Mouth Cancer

ClinicalTrials.gov

2013-01-15

Stage I Adult Soft Tissue Sarcoma; Stage I Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Adult Soft Tissue Sarcoma; Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Adult Soft Tissue Sarcoma; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity

Life Is Precious: Views of Adolescents and Their Mothers on Methods to Reduce Suicidal Behavior in Latinas

ERIC Educational Resources Information Center

Humensky, Jennifer L.; Gil, Rosa M.; Mazzula, Silvia; Diaz, Samantha; Lewis-Fernández, Roberto

2017-01-01

Life is Precious (LIP) was developed to help reduce suicidal behavior in Latina adolescents. As part of an external evaluation of the LIP program, we conducted focus groups with adolescent participants and mothers to learn whether participants and families believe that the activities of LIP address risks for suicidal behavior. Four focus groups…

Prioritizing veterinary pharmaceuticals for aquatic environment in Korea.

PubMed

Kim, Younghee; Jung, Jinyong; Kim, Myunghyun; Park, Jeongim; Boxall, Alistair B A; Choi, Kyungho

2008-09-01

Pharmaceutical residues may have serious impacts on nontarget biological organisms in aquatic ecosystems, and have therefore precipitated numerous investigations worldwide. Many pharmaceutical compounds available on the market need to be prioritized based on their potential ecological and human health risks in order to develop sound management decisions. We prioritized veterinary pharmaceuticals in Korea by their usage, potential to enter the environment, and toxicological hazard. Twenty compounds were identified in the top priority class, most of which were antibiotics. Among these compounds, 8 were identified as deserving more immediate attention: amoxicillin, enramycin, fenbendazole, florfenicol, ivermectin, oxytetracycline, tylosin, and virginiamycin. A limitation of this study is that we initially screened veterinary pharmaceuticals by sales tonnage for veterinary use only. However, this is the first attempt to prioritize veterinary pharmaceuticals in Korea, and it provides important concepts for developing environmental risk management plans for such contaminants in aquatic systems. Copyright © 2008 Elsevier B.V. All rights reserved.