Sample records for probability transition matrix

  1. Convergence of Transition Probability Matrix in CLVMarkov Models

    NASA Astrophysics Data System (ADS)

    Permana, D.; Pasaribu, U. S.; Indratno, S. W.; Suprayogi, S.

    2018-04-01

    A transition probability matrix is an arrangement of transition probability from one states to another in a Markov chain model (MCM). One of interesting study on the MCM is its behavior for a long time in the future. The behavior is derived from one property of transition probabilty matrix for n steps. This term is called the convergence of the n-step transition matrix for n move to infinity. Mathematically, the convergence of the transition probability matrix is finding the limit of the transition matrix which is powered by n where n moves to infinity. The convergence form of the transition probability matrix is very interesting as it will bring the matrix to its stationary form. This form is useful for predicting the probability of transitions between states in the future. The method usually used to find the convergence of transition probability matrix is through the process of limiting the distribution. In this paper, the convergence of the transition probability matrix is searched using a simple concept of linear algebra that is by diagonalizing the matrix.This method has a higher level of complexity because it has to perform the process of diagonalization in its matrix. But this way has the advantage of obtaining a common form of power n of the transition probability matrix. This form is useful to see transition matrix before stationary. For example cases are taken from CLV model using MCM called Model of CLV-Markov. There are several models taken by its transition probability matrix to find its convergence form. The result is that the convergence of the matrix of transition probability through diagonalization has similarity with convergence with commonly used distribution of probability limiting method.

  2. Generating probabilistic Boolean networks from a prescribed transition probability matrix.

    PubMed

    Ching, W-K; Chen, X; Tsing, N-K

    2009-11-01

    Probabilistic Boolean networks (PBNs) have received much attention in modeling genetic regulatory networks. A PBN can be regarded as a Markov chain process and is characterised by a transition probability matrix. In this study, the authors propose efficient algorithms for constructing a PBN when its transition probability matrix is given. The complexities of the algorithms are also analysed. This is an interesting inverse problem in network inference using steady-state data. The problem is important as most microarray data sets are assumed to be obtained from sampling the steady-state.

  3. Projection of postgraduate students flow with a smoothing matrix transition diagram of Markov chain

    NASA Astrophysics Data System (ADS)

    Rahim, Rahela; Ibrahim, Haslinda; Adnan, Farah Adibah

    2013-04-01

    This paper presents a case study of modeling postgraduate students flow at the College of Art and Sciences, Universiti Utara Malaysia. First, full time postgraduate students and the semester they were in are identified. Then administrative data were used to estimate the transitions between these semesters for the year 2001-2005 periods. Markov chain model is developed to calculate the -5 and -10 years projection of postgraduate students flow at the college. The optimization question addressed in this study is 'Which transitions would sustain the desired structure in the dynamic situation such as trend towards graduation?' The smoothed transition probabilities are proposed to estimate the transition probabilities matrix of 16 × 16. The results shows that using smoothed transition probabilities, the projection number of postgraduate students enrolled in the respective semesters are closer to actual than using the conventional steady states transition probabilities.

  4. Efficient Transition Probability Computation for Continuous-Time Branching Processes via Compressed Sensing.

    PubMed

    Xu, Jason; Minin, Vladimir N

    2015-07-01

    Branching processes are a class of continuous-time Markov chains (CTMCs) with ubiquitous applications. A general difficulty in statistical inference under partially observed CTMC models arises in computing transition probabilities when the discrete state space is large or uncountable. Classical methods such as matrix exponentiation are infeasible for large or countably infinite state spaces, and sampling-based alternatives are computationally intensive, requiring integration over all possible hidden events. Recent work has successfully applied generating function techniques to computing transition probabilities for linear multi-type branching processes. While these techniques often require significantly fewer computations than matrix exponentiation, they also become prohibitive in applications with large populations. We propose a compressed sensing framework that significantly accelerates the generating function method, decreasing computational cost up to a logarithmic factor by only assuming the probability mass of transitions is sparse. We demonstrate accurate and efficient transition probability computations in branching process models for blood cell formation and evolution of self-replicating transposable elements in bacterial genomes.

  5. Efficient Transition Probability Computation for Continuous-Time Branching Processes via Compressed Sensing

    PubMed Central

    Xu, Jason; Minin, Vladimir N.

    2016-01-01

    Branching processes are a class of continuous-time Markov chains (CTMCs) with ubiquitous applications. A general difficulty in statistical inference under partially observed CTMC models arises in computing transition probabilities when the discrete state space is large or uncountable. Classical methods such as matrix exponentiation are infeasible for large or countably infinite state spaces, and sampling-based alternatives are computationally intensive, requiring integration over all possible hidden events. Recent work has successfully applied generating function techniques to computing transition probabilities for linear multi-type branching processes. While these techniques often require significantly fewer computations than matrix exponentiation, they also become prohibitive in applications with large populations. We propose a compressed sensing framework that significantly accelerates the generating function method, decreasing computational cost up to a logarithmic factor by only assuming the probability mass of transitions is sparse. We demonstrate accurate and efficient transition probability computations in branching process models for blood cell formation and evolution of self-replicating transposable elements in bacterial genomes. PMID:26949377

  6. Saliency Detection via Absorbing Markov Chain With Learnt Transition Probability.

    PubMed

    Lihe Zhang; Jianwu Ai; Bowen Jiang; Huchuan Lu; Xiukui Li

    2018-02-01

    In this paper, we propose a bottom-up saliency model based on absorbing Markov chain (AMC). First, a sparsely connected graph is constructed to capture the local context information of each node. All image boundary nodes and other nodes are, respectively, treated as the absorbing nodes and transient nodes in the absorbing Markov chain. Then, the expected number of times from each transient node to all other transient nodes can be used to represent the saliency value of this node. The absorbed time depends on the weights on the path and their spatial coordinates, which are completely encoded in the transition probability matrix. Considering the importance of this matrix, we adopt different hierarchies of deep features extracted from fully convolutional networks and learn a transition probability matrix, which is called learnt transition probability matrix. Although the performance is significantly promoted, salient objects are not uniformly highlighted very well. To solve this problem, an angular embedding technique is investigated to refine the saliency results. Based on pairwise local orderings, which are produced by the saliency maps of AMC and boundary maps, we rearrange the global orderings (saliency value) of all nodes. Extensive experiments demonstrate that the proposed algorithm outperforms the state-of-the-art methods on six publicly available benchmark data sets.

  7. Time-Varying Transition Probability Matrix Estimation and Its Application to Brand Share Analysis.

    PubMed

    Chiba, Tomoaki; Hino, Hideitsu; Akaho, Shotaro; Murata, Noboru

    2017-01-01

    In a product market or stock market, different products or stocks compete for the same consumers or purchasers. We propose a method to estimate the time-varying transition matrix of the product share using a multivariate time series of the product share. The method is based on the assumption that each of the observed time series of shares is a stationary distribution of the underlying Markov processes characterized by transition probability matrices. We estimate transition probability matrices for every observation under natural assumptions. We demonstrate, on a real-world dataset of the share of automobiles, that the proposed method can find intrinsic transition of shares. The resulting transition matrices reveal interesting phenomena, for example, the change in flows between TOYOTA group and GM group for the fiscal year where TOYOTA group's sales beat GM's sales, which is a reasonable scenario.

  8. Time-Varying Transition Probability Matrix Estimation and Its Application to Brand Share Analysis

    PubMed Central

    Chiba, Tomoaki; Akaho, Shotaro; Murata, Noboru

    2017-01-01

    In a product market or stock market, different products or stocks compete for the same consumers or purchasers. We propose a method to estimate the time-varying transition matrix of the product share using a multivariate time series of the product share. The method is based on the assumption that each of the observed time series of shares is a stationary distribution of the underlying Markov processes characterized by transition probability matrices. We estimate transition probability matrices for every observation under natural assumptions. We demonstrate, on a real-world dataset of the share of automobiles, that the proposed method can find intrinsic transition of shares. The resulting transition matrices reveal interesting phenomena, for example, the change in flows between TOYOTA group and GM group for the fiscal year where TOYOTA group’s sales beat GM’s sales, which is a reasonable scenario. PMID:28076383

  9. Constraints on scattering amplitudes in multistate Landau-Zener theory

    NASA Astrophysics Data System (ADS)

    Sinitsyn, Nikolai A.; Lin, Jeffmin; Chernyak, Vladimir Y.

    2017-01-01

    We derive a set of constraints, which we will call hierarchy constraints, on scattering amplitudes of an arbitrary multistate Landau-Zener model (MLZM). The presence of additional symmetries can transform such constraints into nontrivial relations between elements of the transition probability matrix. This observation can be used to derive complete solutions of some MLZMs or, for models that cannot be solved completely, to reduce the number of independent elements of the transition probability matrix.

  10. Exact transition probabilities in a 6-state Landau–Zener system with path interference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sinitsyn, Nikolai A.

    2015-04-23

    In this paper, we identify a nontrivial multistate Landau–Zener (LZ) model for which transition probabilities between any pair of diabatic states can be determined analytically and exactly. In the semiclassical picture, this model features the possibility of interference of different trajectories that connect the same initial and final states. Hence, transition probabilities are generally not described by the incoherent successive application of the LZ formula. Finally, we discuss reasons for integrability of this system and provide numerical tests of the suggested expression for the transition probability matrix.

  11. Statistic inversion of multi-zone transition probability models for aquifer characterization in alluvial fans

    DOE PAGES

    Zhu, Lin; Dai, Zhenxue; Gong, Huili; ...

    2015-06-12

    Understanding the heterogeneity arising from the complex architecture of sedimentary sequences in alluvial fans is challenging. This study develops a statistical inverse framework in a multi-zone transition probability approach for characterizing the heterogeneity in alluvial fans. An analytical solution of the transition probability matrix is used to define the statistical relationships among different hydrofacies and their mean lengths, integral scales, and volumetric proportions. A statistical inversion is conducted to identify the multi-zone transition probability models and estimate the optimal statistical parameters using the modified Gauss–Newton–Levenberg–Marquardt method. The Jacobian matrix is computed by the sensitivity equation method, which results in anmore » accurate inverse solution with quantification of parameter uncertainty. We use the Chaobai River alluvial fan in the Beijing Plain, China, as an example for elucidating the methodology of alluvial fan characterization. The alluvial fan is divided into three sediment zones. In each zone, the explicit mathematical formulations of the transition probability models are constructed with optimized different integral scales and volumetric proportions. The hydrofacies distributions in the three zones are simulated sequentially by the multi-zone transition probability-based indicator simulations. Finally, the result of this study provides the heterogeneous structure of the alluvial fan for further study of flow and transport simulations.« less

  12. Constraints on scattering amplitudes in multistate Landau-Zener theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sinitsyn, Nikolai A.; Lin, Jeffmin; Chernyak, Vladimir Y.

    2017-01-30

    Here, we derive a set of constraints, which we will call hierarchy constraints, on scattering amplitudes of an arbitrary multistate Landau-Zener model (MLZM). The presence of additional symmetries can transform such constraints into nontrivial relations between elements of the transition probability matrix. This observation can be used to derive complete solutions of some MLZMs or, for models that cannot be solved completely, to reduce the number of independent elements of the transition probability matrix.

  13. The use of complete sets of orthogonal operators in spectroscopic studies

    NASA Astrophysics Data System (ADS)

    Raassen, A. J. J.; Uylings, P. H. M.

    1996-01-01

    Complete sets of orthogonal operators are used to calculate eigenvalues and eigenvector compositions in complex spectra. The latter are used to transform the LS-transition matrix into realistic intermediate coupling transition probabilities. Calculated transition probabilities for some close lying levels in Ni V and Fe III illustrate the power of the complete orthogonal operator approach.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Lin; Dai, Zhenxue; Gong, Huili

    Understanding the heterogeneity arising from the complex architecture of sedimentary sequences in alluvial fans is challenging. This study develops a statistical inverse framework in a multi-zone transition probability approach for characterizing the heterogeneity in alluvial fans. An analytical solution of the transition probability matrix is used to define the statistical relationships among different hydrofacies and their mean lengths, integral scales, and volumetric proportions. A statistical inversion is conducted to identify the multi-zone transition probability models and estimate the optimal statistical parameters using the modified Gauss–Newton–Levenberg–Marquardt method. The Jacobian matrix is computed by the sensitivity equation method, which results in anmore » accurate inverse solution with quantification of parameter uncertainty. We use the Chaobai River alluvial fan in the Beijing Plain, China, as an example for elucidating the methodology of alluvial fan characterization. The alluvial fan is divided into three sediment zones. In each zone, the explicit mathematical formulations of the transition probability models are constructed with optimized different integral scales and volumetric proportions. The hydrofacies distributions in the three zones are simulated sequentially by the multi-zone transition probability-based indicator simulations. Finally, the result of this study provides the heterogeneous structure of the alluvial fan for further study of flow and transport simulations.« less

  15. The condition of a finite Markov chain and perturbation bounds for the limiting probabilities

    NASA Technical Reports Server (NTRS)

    Meyer, C. D., Jr.

    1979-01-01

    The inequalities bounding the relative error the norm of w- w squiggly/the norm of w are exhibited by a very simple function of E and A. Let T denote the transition matrix of an ergodic chain, C, and let A = I - T. Let E be a perturbation matrix such that T squiggly = T - E is also the transition matrix of an ergodic chain, C squiggly. Let w and w squiggly denote the limiting probability (row) vectors for C and C squiggly. The inequality is the best one possible. This bound can be significant in the numerical determination of the limiting probabilities for an ergodic chain. In addition to presenting a sharp bound for the norm of w-w squiggly/the norm of w an explicit expression for w squiggly will be derived in which w squiggly is given as a function of E, A, w and some other related terms.

  16. Stochastic optimal operation of reservoirs based on copula functions

    NASA Astrophysics Data System (ADS)

    Lei, Xiao-hui; Tan, Qiao-feng; Wang, Xu; Wang, Hao; Wen, Xin; Wang, Chao; Zhang, Jing-wen

    2018-02-01

    Stochastic dynamic programming (SDP) has been widely used to derive operating policies for reservoirs considering streamflow uncertainties. In SDP, there is a need to calculate the transition probability matrix more accurately and efficiently in order to improve the economic benefit of reservoir operation. In this study, we proposed a stochastic optimization model for hydropower generation reservoirs, in which 1) the transition probability matrix was calculated based on copula functions; and 2) the value function of the last period was calculated by stepwise iteration. Firstly, the marginal distribution of stochastic inflow in each period was built and the joint distributions of adjacent periods were obtained using the three members of the Archimedean copulas, based on which the conditional probability formula was derived. Then, the value in the last period was calculated by a simple recursive equation with the proposed stepwise iteration method and the value function was fitted with a linear regression model. These improvements were incorporated into the classic SDP and applied to the case study in Ertan reservoir, China. The results show that the transition probability matrix can be more easily and accurately obtained by the proposed copula function based method than conventional methods based on the observed or synthetic streamflow series, and the reservoir operation benefit can also be increased.

  17. Estimating transition probabilities in unmarked populations --entropy revisited

    USGS Publications Warehouse

    Cooch, E.G.; Link, W.A.

    1999-01-01

    The probability of surviving and moving between 'states' is of great interest to biologists. Robust estimation of these transitions using multiple observations of individually identifiable marked individuals has received considerable attention in recent years. However, in some situations, individuals are not identifiable (or have a very low recapture rate), although all individuals in a sample can be assigned to a particular state (e.g. breeding or non-breeding) without error. In such cases, only aggregate data (number of individuals in a given state at each occasion) are available. If the underlying matrix of transition probabilities does not vary through time and aggregate data are available for several time periods, then it is possible to estimate these parameters using least-squares methods. Even when such data are available, this assumption of stationarity will usually be deemed overly restrictive and, frequently, data will only be available for two time periods. In these cases, the problem reduces to estimating the most likely matrix (or matrices) leading to the observed frequency distribution of individuals in each state. An entropy maximization approach has been previously suggested. In this paper, we show that the entropy approach rests on a particular limiting assumption, and does not provide estimates of latent population parameters (the transition probabilities), but rather predictions of realized rates.

  18. Machine learning in sentiment reconstruction of the simulated stock market

    NASA Astrophysics Data System (ADS)

    Goykhman, Mikhail; Teimouri, Ali

    2018-02-01

    In this paper we continue the study of the simulated stock market framework defined by the driving sentiment processes. We focus on the market environment driven by the buy/sell trading sentiment process of the Markov chain type. We apply the methodology of the Hidden Markov Models and the Recurrent Neural Networks to reconstruct the transition probabilities matrix of the Markov sentiment process and recover the underlying sentiment states from the observed stock price behavior. We demonstrate that the Hidden Markov Model can successfully recover the transition probabilities matrix for the hidden sentiment process of the Markov Chain type. We also demonstrate that the Recurrent Neural Network can successfully recover the hidden sentiment states from the observed simulated stock price time series.

  19. Markov chains: computing limit existence and approximations with DNA.

    PubMed

    Cardona, M; Colomer, M A; Conde, J; Miret, J M; Miró, J; Zaragoza, A

    2005-09-01

    We present two algorithms to perform computations over Markov chains. The first one determines whether the sequence of powers of the transition matrix of a Markov chain converges or not to a limit matrix. If it does converge, the second algorithm enables us to estimate this limit. The combination of these algorithms allows the computation of a limit using DNA computing. In this sense, we have encoded the states and the transition probabilities using strands of DNA for generating paths of the Markov chain.

  20. Impulsive synchronization of Markovian jumping randomly coupled neural networks with partly unknown transition probabilities via multiple integral approach.

    PubMed

    Chandrasekar, A; Rakkiyappan, R; Cao, Jinde

    2015-10-01

    This paper studies the impulsive synchronization of Markovian jumping randomly coupled neural networks with partly unknown transition probabilities via multiple integral approach. The array of neural networks are coupled in a random fashion which is governed by Bernoulli random variable. The aim of this paper is to obtain the synchronization criteria, which is suitable for both exactly known and partly unknown transition probabilities such that the coupled neural network is synchronized with mixed time-delay. The considered impulsive effects can be synchronized at partly unknown transition probabilities. Besides, a multiple integral approach is also proposed to strengthen the Markovian jumping randomly coupled neural networks with partly unknown transition probabilities. By making use of Kronecker product and some useful integral inequalities, a novel Lyapunov-Krasovskii functional was designed for handling the coupled neural network with mixed delay and then impulsive synchronization criteria are solvable in a set of linear matrix inequalities. Finally, numerical examples are presented to illustrate the effectiveness and advantages of the theoretical results. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Optoelectronics of inverted type-I CdS/CdSe core/crown quantum ring

    NASA Astrophysics Data System (ADS)

    Bose, Sumanta; Fan, Weijun; Zhang, Dao Hua

    2017-10-01

    Inverted type-I heterostructure core/crown quantum rings (QRs) are quantum-efficient luminophores, whose spectral characteristics are highly tunable. Here, we study the optoelectronic properties of type-I core/crown CdS/CdSe QRs in the zincblende phase—over contrasting lateral size and crown width. For this, we inspect their strain profiles, transition energies, transition matrix elements, spatial charge densities, electronic bandstructures, band-mixing probabilities, optical gain spectra, maximum optical gains, and differential optical gains. Our framework uses an effective-mass envelope function theory based on the 8-band k ṡ p method employing the valence force field model for calculating the atomic strain distributions. The gain calculations are based on the density-matrix equation and take into consideration the excitonic effects with intraband scattering. Variations in the QR lateral size and relative widths of core and crown (ergo the composition) affect their energy levels, band-mixing probabilities, optical transition matrix elements, emission wavelengths/intensities, etc. The optical gain of QRs is also strongly dimension and composition dependent with further dependency on the injection carrier density causing the band-filling effect. They also affect the maximum and differential gain at varying dimensions and compositions.

  2. Direct calculation of liquid-vapor phase equilibria from transition matrix Monte Carlo simulation

    NASA Astrophysics Data System (ADS)

    Errington, Jeffrey R.

    2003-06-01

    An approach for directly determining the liquid-vapor phase equilibrium of a model system at any temperature along the coexistence line is described. The method relies on transition matrix Monte Carlo ideas developed by Fitzgerald, Picard, and Silver [Europhys. Lett. 46, 282 (1999)]. During a Monte Carlo simulation attempted transitions between states along the Markov chain are monitored as opposed to tracking the number of times the chain visits a given state as is done in conventional simulations. Data collection is highly efficient and very precise results are obtained. The method is implemented in both the grand canonical and isothermal-isobaric ensemble. The main result from a simulation conducted at a given temperature is a density probability distribution for a range of densities that includes both liquid and vapor states. Vapor pressures and coexisting densities are calculated in a straightforward manner from the probability distribution. The approach is demonstrated with the Lennard-Jones fluid. Coexistence properties are directly calculated at temperatures spanning from the triple point to the critical point.

  3. Relativistic many-body calculations of excitation energies, oscillator strengths, transition rates, and lifetimes in samarium like ions

    NASA Astrophysics Data System (ADS)

    Safronova, Ulyana; Safronova, Alla; Beiersdorfer, Peter

    2013-05-01

    Excitation energies, oscillator strengths, transition probabilities, and lifetimes are calculated for (5s2 + 5p2 + 5d2 + 5 s 5 d + 5 s 5 g + 5 p 5 f) - (5 s 5 p + 5 s 5 f + 5 p 5 d + 5 p 5 g) electric dipole transitions in Sm-like ions with nuclear charge Z ranging from 74 to 100. Relativistic many-body perturbation theory (RMBPT), including the Breit interaction, is used to evaluate retarded E1 matrix elements in length and velocity forms. The calculations start from a 1s2 2s2 2p6 3s2 3p6 3d10 4s2 4p6 4d10 4f14 Dirac-Fock potential. First-order perturbation theory is used to obtain intermediate coupling coefficients, and the second-order RMBPT is used to determine the matrix elements. The contributions from negative-energy states are included in the second-order E1 matrix elements to achieve agreement between length-form and velocity-form amplitudes. The resulting transition energies and transition probabilities, and lifetimes for Sm-like W12+ are compared with results obtained by the relativistic Hartree-Fock approximation (COWAN code) to estimate contribution of the 4 f -core-excited states. Trends of excitation energies and oscillator strengths as function of nuclear charge Z are shown graphically for selected states and transitions. This work provides a number of yet unmeasured properti. This research was sponsored by the grant DE-FG02-08ER54951.

  4. A stochastic Markov chain model to describe lung cancer growth and metastasis.

    PubMed

    Newton, Paul K; Mason, Jeremy; Bethel, Kelly; Bazhenova, Lyudmila A; Nieva, Jorge; Kuhn, Peter

    2012-01-01

    A stochastic Markov chain model for metastatic progression is developed for primary lung cancer based on a network construction of metastatic sites with dynamics modeled as an ensemble of random walkers on the network. We calculate a transition matrix, with entries (transition probabilities) interpreted as random variables, and use it to construct a circular bi-directional network of primary and metastatic locations based on postmortem tissue analysis of 3827 autopsies on untreated patients documenting all primary tumor locations and metastatic sites from this population. The resulting 50 potential metastatic sites are connected by directed edges with distributed weightings, where the site connections and weightings are obtained by calculating the entries of an ensemble of transition matrices so that the steady-state distribution obtained from the long-time limit of the Markov chain dynamical system corresponds to the ensemble metastatic distribution obtained from the autopsy data set. We condition our search for a transition matrix on an initial distribution of metastatic tumors obtained from the data set. Through an iterative numerical search procedure, we adjust the entries of a sequence of approximations until a transition matrix with the correct steady-state is found (up to a numerical threshold). Since this constrained linear optimization problem is underdetermined, we characterize the statistical variance of the ensemble of transition matrices calculated using the means and variances of their singular value distributions as a diagnostic tool. We interpret the ensemble averaged transition probabilities as (approximately) normally distributed random variables. The model allows us to simulate and quantify disease progression pathways and timescales of progression from the lung position to other sites and we highlight several key findings based on the model.

  5. S-matrix decomposition, natural reaction channels, and the quantum transition state approach to reactive scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Manthe, Uwe, E-mail: uwe.manthe@uni-bielefeld.de; Ellerbrock, Roman, E-mail: roman.ellerbrock@uni-bielefeld.de

    2016-05-28

    A new approach for the quantum-state resolved analysis of polyatomic reactions is introduced. Based on the singular value decomposition of the S-matrix, energy-dependent natural reaction channels and natural reaction probabilities are defined. It is shown that the natural reaction probabilities are equal to the eigenvalues of the reaction probability operator [U. Manthe and W. H. Miller, J. Chem. Phys. 99, 3411 (1993)]. Consequently, the natural reaction channels can be interpreted as uniquely defined pathways through the transition state of the reaction. The analysis can efficiently be combined with reactive scattering calculations based on the propagation of thermal flux eigenstates. Inmore » contrast to a decomposition based straightforwardly on thermal flux eigenstates, it does not depend on the choice of the dividing surface separating reactants from products. The new approach is illustrated studying a prototypical example, the H + CH{sub 4} → H{sub 2} + CH{sub 3} reaction. The natural reaction probabilities and the contributions of the different vibrational states of the methyl product to the natural reaction channels are calculated and discussed. The relation between the thermal flux eigenstates and the natural reaction channels is studied in detail.« less

  6. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  7. Oscillator strengths and branching fractions of 4d75p-4d75s Rh II transitions

    NASA Astrophysics Data System (ADS)

    Bouazza, Safa

    2017-01-01

    This work reports semi-empirical determination of oscillator strengths, transition probabilities and branching fractions for Rh II 4d75p-4d75s transitions in a wide wavelength range. The angular coefficients of the transition matrix, beforehand obtained in pure SL coupling with help of Racah algebra are transformed into intermediate coupling using eigenvector amplitudes of these two configuration levels determined for this purpose; The transition integral was treated as free parameter in the least squares fit to experimental oscillator strength (gf) values found in literature. The extracted value: <4d75s|r1|4d75p> =2.7426 ± 0.0007 is slightly smaller than that computed by means of ab-initio method. Subsequently to oscillator strength evaluations, transition probabilities and branching fractions were deduced and compared to those obtained experimentally or through another approach like pseudo-relativistic Hartree-Fock model including core-polarization effects.

  8. Theoretical study on the low-lying excited states of the phosphorus monoiodide (PI) including the spin-orbit coupling

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaomei; Liu, Xiaoting; Liang, Guiying; Li, Rui; Xu, Haifeng; Yan, Bing

    2016-01-01

    The potential energy curves (PECs) of the 22 Λ-S states of the phosphorus monoiodide (PI) molecule have been calculated at the level of MRCI+Q method with correlation-consistent quadruple-ζ quality basis set. The spectroscopic constants of the bound states are determined, which well reproduce the available measurements. The metastable a1Δ state has been reported for the first time, which lies between the X3Σ- and b1Σ+ states and have much deeper well than the ground state. The R-dependent spin-orbit (SO) matrix elements are calculated with the full-electron Breit-Pauli operator. Based on the SO matrix elements, the perturbations that the 23Π state may suffer from are analyzed in detail. The SOC effect makes the original Λ-S states split into 51 Ω states. In the zero-field splitting of the ground state X3Σ-, the spin-spin coupling contribution (2.23 cm-1) is found to be much smaller compared to the spin-orbit coupling contribution (50 cm-1). The avoided crossings between the Ω states lead to much shallower potential wells and the change of dissociation relationships of the states. The Ω-state wavefunctions are analyzed depending on their Λ-S compositions, showing the strong interactions among several quasidegenerate Λ-S states of the same total SO symmetry. The transition properties including electric dipole (E1), magnetic dipole (M1), and electric quadrupole (E2) transition moments (TMs), the Franck-Condon factors, the transition probabilities and the radiative lifetimes are computed for the transitions between Ω components of a1Δ and b1Σ+ states and ground state. The transition probabilities induced by the E1, E2, and M1 transitions are evaluated. The E2 makes little effect on transition probabilities. In contrast, the E1 transition makes the main contribution to the transition probability and the M1 transition also brings the influence that cannot be neglected. Finally, the radiative lifetimes are determined with the transition moments including E1 and M1. The lifetime of transition (2)0+-X10+ is evaluated at the level of millisecond, much smaller than that of the transition (2)0+-X21.

  9. Exact numerical calculation of fixation probability and time on graphs.

    PubMed

    Hindersin, Laura; Möller, Marius; Traulsen, Arne; Bauer, Benedikt

    2016-12-01

    The Moran process on graphs is a popular model to study the dynamics of evolution in a spatially structured population. Exact analytical solutions for the fixation probability and time of a new mutant have been found for only a few classes of graphs so far. Simulations are time-expensive and many realizations are necessary, as the variance of the fixation times is high. We present an algorithm that numerically computes these quantities for arbitrary small graphs by an approach based on the transition matrix. The advantage over simulations is that the calculation has to be executed only once. Building the transition matrix is automated by our algorithm. This enables a fast and interactive study of different graph structures and their effect on fixation probability and time. We provide a fast implementation in C with this note (Hindersin et al., 2016). Our code is very flexible, as it can handle two different update mechanisms (Birth-death or death-Birth), as well as arbitrary directed or undirected graphs. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Covariate adjustment of event histories estimated from Markov chains: the additive approach.

    PubMed

    Aalen, O O; Borgan, O; Fekjaer, H

    2001-12-01

    Markov chain models are frequently used for studying event histories that include transitions between several states. An empirical transition matrix for nonhomogeneous Markov chains has previously been developed, including a detailed statistical theory based on counting processes and martingales. In this article, we show how to estimate transition probabilities dependent on covariates. This technique may, e.g., be used for making estimates of individual prognosis in epidemiological or clinical studies. The covariates are included through nonparametric additive models on the transition intensities of the Markov chain. The additive model allows for estimation of covariate-dependent transition intensities, and again a detailed theory exists based on counting processes. The martingale setting now allows for a very natural combination of the empirical transition matrix and the additive model, resulting in estimates that can be expressed as stochastic integrals, and hence their properties are easily evaluated. Two medical examples will be given. In the first example, we study how the lung cancer mortality of uranium miners depends on smoking and radon exposure. In the second example, we study how the probability of being in response depends on patient group and prophylactic treatment for leukemia patients who have had a bone marrow transplantation. A program in R and S-PLUS that can carry out the analyses described here has been developed and is freely available on the Internet.

  11. Sensitivity of peptide conformational dynamics on clustering of a classical molecular dynamics trajectory

    NASA Astrophysics Data System (ADS)

    Jensen, Christian H.; Nerukh, Dmitry; Glen, Robert C.

    2008-03-01

    We investigate the sensitivity of a Markov model with states and transition probabilities obtained from clustering a molecular dynamics trajectory. We have examined a 500ns molecular dynamics trajectory of the peptide valine-proline-alanine-leucine in explicit water. The sensitivity is quantified by varying the boundaries of the clusters and investigating the resulting variation in transition probabilities and the average transition time between states. In this way, we represent the effect of clustering using different clustering algorithms. It is found that in terms of the investigated quantities, the peptide dynamics described by the Markov model is sensitive to the clustering; in particular, the average transition times are found to vary up to 46%. Moreover, inclusion of nonphysical sparsely populated clusters can lead to serious errors of up to 814%. In the investigation, the time step used in the transition matrix is determined by the minimum time scale on which the system behaves approximately Markovian. This time step is found to be about 100ps. It is concluded that the description of peptide dynamics with transition matrices should be performed with care, and that using standard clustering algorithms to obtain states and transition probabilities may not always produce reliable results.

  12. Spatio-Temporal Pattern Recognition Using Hidden Markov Models

    DTIC Science & Technology

    1994-06-01

    Jersey, 1982. 5. H. B . Barlow and W. R. Levick . The mechanism of directionally selective units in rabbit’s retina. Journal of Physiology (London), 178:477...108 A.2.2 Re-estimate of .. .. ................... .110 A.2.3 Re-estimate of B ...... ................... 110 A.3 Logarithmic Form of the Baum-Welch...19 a0 Transition Probability from State i to State j ................ 19 B Observation Probability Matrix

  13. Human Inferences about Sequences: A Minimal Transition Probability Model

    PubMed Central

    2016-01-01

    The brain constantly infers the causes of the inputs it receives and uses these inferences to generate statistical expectations about future observations. Experimental evidence for these expectations and their violations include explicit reports, sequential effects on reaction times, and mismatch or surprise signals recorded in electrophysiology and functional MRI. Here, we explore the hypothesis that the brain acts as a near-optimal inference device that constantly attempts to infer the time-varying matrix of transition probabilities between the stimuli it receives, even when those stimuli are in fact fully unpredictable. This parsimonious Bayesian model, with a single free parameter, accounts for a broad range of findings on surprise signals, sequential effects and the perception of randomness. Notably, it explains the pervasive asymmetry between repetitions and alternations encountered in those studies. Our analysis suggests that a neural machinery for inferring transition probabilities lies at the core of human sequence knowledge. PMID:28030543

  14. Camera-Model Identification Using Markovian Transition Probability Matrix

    NASA Astrophysics Data System (ADS)

    Xu, Guanshuo; Gao, Shang; Shi, Yun Qing; Hu, Ruimin; Su, Wei

    Detecting the (brands and) models of digital cameras from given digital images has become a popular research topic in the field of digital forensics. As most of images are JPEG compressed before they are output from cameras, we propose to use an effective image statistical model to characterize the difference JPEG 2-D arrays of Y and Cb components from the JPEG images taken by various camera models. Specifically, the transition probability matrices derived from four different directional Markov processes applied to the image difference JPEG 2-D arrays are used to identify statistical difference caused by image formation pipelines inside different camera models. All elements of the transition probability matrices, after a thresholding technique, are directly used as features for classification purpose. Multi-class support vector machines (SVM) are used as the classification tool. The effectiveness of our proposed statistical model is demonstrated by large-scale experimental results.

  15. Dynamical Epidemic Suppression Using Stochastic Prediction and Control

    DTIC Science & Technology

    2004-10-28

    initial probability density function (PDF), p: D C R2 -- R, is defined by the stochastic Frobenius - Perron For deterministic systems, normal methods of...induced chaos. To analyze the qualitative change, we apply the technique of the stochastic Frobenius - Perron operator [L. Billings et al., Phys. Rev. Lett...transition matrix describing the probability of transport from one region of phase space to another, which approximates the stochastic Frobenius - Perron

  16. A nonstationary Markov transition model for computing the relative risk of dementia before death

    PubMed Central

    Yu, Lei; Griffith, William S.; Tyas, Suzanne L.; Snowdon, David A.; Kryscio, Richard J.

    2010-01-01

    This paper investigates the long-term behavior of the k-step transition probability matrix for a nonstationary discrete time Markov chain in the context of modeling transitions from intact cognition to dementia with mild cognitive impairment (MCI) and global impairment (GI) as intervening cognitive states. The authors derive formulas for the following absorption statistics: (1) the relative risk of absorption between competing absorbing states, and (2) the mean and variance of the number of visits among the transient states before absorption. Since absorption is not guaranteed, sufficient conditions are discussed to ensure that the substochastic matrix associated with transitions among transient states converges to zero in limit. Results are illustrated with an application to the Nun Study, a cohort of 678 participants, 75 to 107 years of age, followed longitudinally with up to ten cognitive assessments over a fifteen-year period. PMID:20087848

  17. Fractional quantum mechanics on networks: Long-range dynamics and quantum transport

    NASA Astrophysics Data System (ADS)

    Riascos, A. P.; Mateos, José L.

    2015-11-01

    In this paper we study the quantum transport on networks with a temporal evolution governed by the fractional Schrödinger equation. We generalize the dynamics based on continuous-time quantum walks, with transitions to nearest neighbors on the network, to the fractional case that allows long-range displacements. By using the fractional Laplacian matrix of a network, we establish a formalism that combines a long-range dynamics with the quantum superposition of states; this general approach applies to any type of connected undirected networks, including regular, random, and complex networks, and can be implemented from the spectral properties of the Laplacian matrix. We study the fractional dynamics and its capacity to explore the network by means of the transition probability, the average probability of return, and global quantities that characterize the efficiency of this quantum process. As a particular case, we explore analytically these quantities for circulant networks such as rings, interacting cycles, and complete graphs.

  18. Fractional quantum mechanics on networks: Long-range dynamics and quantum transport.

    PubMed

    Riascos, A P; Mateos, José L

    2015-11-01

    In this paper we study the quantum transport on networks with a temporal evolution governed by the fractional Schrödinger equation. We generalize the dynamics based on continuous-time quantum walks, with transitions to nearest neighbors on the network, to the fractional case that allows long-range displacements. By using the fractional Laplacian matrix of a network, we establish a formalism that combines a long-range dynamics with the quantum superposition of states; this general approach applies to any type of connected undirected networks, including regular, random, and complex networks, and can be implemented from the spectral properties of the Laplacian matrix. We study the fractional dynamics and its capacity to explore the network by means of the transition probability, the average probability of return, and global quantities that characterize the efficiency of this quantum process. As a particular case, we explore analytically these quantities for circulant networks such as rings, interacting cycles, and complete graphs.

  19. Implementation of real-time energy management strategy based on reinforcement learning for hybrid electric vehicles and simulation validation

    PubMed Central

    Kong, Zehui; Liu, Teng

    2017-01-01

    To further improve the fuel economy of series hybrid electric tracked vehicles, a reinforcement learning (RL)-based real-time energy management strategy is developed in this paper. In order to utilize the statistical characteristics of online driving schedule effectively, a recursive algorithm for the transition probability matrix (TPM) of power-request is derived. The reinforcement learning (RL) is applied to calculate and update the control policy at regular time, adapting to the varying driving conditions. A facing-forward powertrain model is built in detail, including the engine-generator model, battery model and vehicle dynamical model. The robustness and adaptability of real-time energy management strategy are validated through the comparison with the stationary control strategy based on initial transition probability matrix (TPM) generated from a long naturalistic driving cycle in the simulation. Results indicate that proposed method has better fuel economy than stationary one and is more effective in real-time control. PMID:28671967

  20. Implementation of real-time energy management strategy based on reinforcement learning for hybrid electric vehicles and simulation validation.

    PubMed

    Kong, Zehui; Zou, Yuan; Liu, Teng

    2017-01-01

    To further improve the fuel economy of series hybrid electric tracked vehicles, a reinforcement learning (RL)-based real-time energy management strategy is developed in this paper. In order to utilize the statistical characteristics of online driving schedule effectively, a recursive algorithm for the transition probability matrix (TPM) of power-request is derived. The reinforcement learning (RL) is applied to calculate and update the control policy at regular time, adapting to the varying driving conditions. A facing-forward powertrain model is built in detail, including the engine-generator model, battery model and vehicle dynamical model. The robustness and adaptability of real-time energy management strategy are validated through the comparison with the stationary control strategy based on initial transition probability matrix (TPM) generated from a long naturalistic driving cycle in the simulation. Results indicate that proposed method has better fuel economy than stationary one and is more effective in real-time control.

  1. Principles of Quantum Mechanics

    NASA Astrophysics Data System (ADS)

    Landé, Alfred

    2013-10-01

    Preface; Introduction: 1. Observation and interpretation; 2. Difficulties of the classical theories; 3. The purpose of quantum theory; Part I. Elementary Theory of Observation (Principle of Complementarity): 4. Refraction in inhomogeneous media (force fields); 5. Scattering of charged rays; 6. Refraction and reflection at a plane; 7. Absolute values of momentum and wave length; 8. Double ray of matter diffracting light waves; 9. Double ray of matter diffracting photons; 10. Microscopic observation of ρ (x) and σ (p); 11. Complementarity; 12. Mathematical relation between ρ (x) and σ (p) for free particles; 13. General relation between ρ (q) and σ (p); 14. Crystals; 15. Transition density and transition probability; 16. Resultant values of physical functions; matrix elements; 17. Pulsating density; 18. General relation between ρ (t) and σ (є); 19. Transition density; matrix elements; Part II. The Principle of Uncertainty: 20. Optical observation of density in matter packets; 21. Distribution of momenta in matter packets; 22. Mathematical relation between ρ and σ; 23. Causality; 24. Uncertainty; 25. Uncertainty due to optical observation; 26. Dissipation of matter packets; rays in Wilson Chamber; 27. Density maximum in time; 28. Uncertainty of energy and time; 29. Compton effect; 30. Bothe-Geiger and Compton-Simon experiments; 31. Doppler effect; Raman effect; 32. Elementary bundles of rays; 33. Jeans' number of degrees of freedom; 34. Uncertainty of electromagnetic field components; Part III. The Principle of Interference and Schrödinger's equation: 35. Physical functions; 36. Interference of probabilities for p and q; 37. General interference of probabilities; 38. Differential equations for Ψp (q) and Xq (p); 39. Differential equation for фβ (q); 40. The general probability amplitude Φβ' (Q); 41. Point transformations; 42. General theorem of interference; 43. Conjugate variables; 44. Schrödinger's equation for conservative systems; 45. Schrödinger's equation for non-conservative systems; 46. Pertubation theory; 47. Orthogonality, normalization and Hermitian conjugacy; 48. General matrix elements; Part IV. The Principle of Correspondence: 49. Contact transformations in classical mechanics; 50. Point transformations; 51. Contact transformations in quantum mechanics; 52. Constants of motion and angular co-ordinates; 53. Periodic orbits; 54. De Broglie and Schrödinger function; correspondence to classical mechanics; 55. Packets of probability; 56. Correspondence to hydrodynamics; 57. Motion and scattering of wave packets; 58. Formal correspondence between classical and quantum mechanics; Part V. Mathematical Appendix: Principle of Invariance: 59. The general theorem of transformation; 60. Operator calculus; 61. Exchange relations; three criteria for conjugacy; 62. First method of canonical transformation; 63. Second method of canonical transformation; 64. Proof of the transformation theorem; 65. Invariance of the matrix elements against unitary transformations; 66. Matrix mechanics; Index of literature; Index of names and subjects.

  2. Radiative, nonradiative, and mixed-decay transitions of rare-earth ions in dielectric media

    NASA Astrophysics Data System (ADS)

    Burshtein, Zeev

    2010-09-01

    We present and discuss in a comprehensive, deductive, and simplified manner, issues of nonradiative transitions involvement in fluorescence of ions embedded in dielectric solid matrices. The semiclassical approach is favored over a full quantum description, and empiric quantities are introduced from the start. One issue is nonradiative single-phonon transitions when the energy gap between the adjacent electronic ion states is smaller than the cutoff matrix phonon energy. Another issue is transitions in a complex energy scheme, where some visible and near-visible transitions are radiative and others are nonradiative. A refined Füchtbauer-Ladenburg recipe for calculation of the stimulated emission spectrum on the basis of measurable absorption and fluorescence emission spectra is worked out. The last issue is multiphonon nonradiative transitions occurring when the energy gap between adjacent electronic ion states is larger than the cutoff matrix phonon energy. Transition probabilities were calculated on the basis of anharmonicity of the effective potential supporting the internal atomic basis vibrations. An expression in a closed form is obtained, similar to the empiric ``energy gap'' law, however, with parameters related to specific host material properties and the actual transition in the ion. Comparison to existing experimental evidence is presented and discussed in detail.

  3. The Feynman-Vernon Influence Functional Approach in QED

    NASA Astrophysics Data System (ADS)

    Biryukov, Alexander; Shleenkov, Mark

    2016-10-01

    In the path integral approach we describe evolution of interacting electromagnetic and fermionic fields by the use of density matrix formalism. The equation for density matrix and transitions probability for fermionic field is obtained as average of electromagnetic field influence functional. We obtain a formula for electromagnetic field influence functional calculating for its various initial and final state. We derive electromagnetic field influence functional when its initial and final states are vacuum. We present Lagrangian for relativistic fermionic field under influence of electromagnetic field vacuum.

  4. Solving inverse problem for Markov chain model of customer lifetime value using flower pollination algorithm

    NASA Astrophysics Data System (ADS)

    Al-Ma'shumah, Fathimah; Permana, Dony; Sidarto, Kuntjoro Adji

    2015-12-01

    Customer Lifetime Value is an important and useful concept in marketing. One of its benefits is to help a company for budgeting marketing expenditure for customer acquisition and customer retention. Many mathematical models have been introduced to calculate CLV considering the customer retention/migration classification scheme. A fairly new class of these models which will be described in this paper uses Markov Chain Models (MCM). This class of models has the major advantage for its flexibility to be modified to several different cases/classification schemes. In this model, the probabilities of customer retention and acquisition play an important role. From Pfeifer and Carraway, 2000, the final formula of CLV obtained from MCM usually contains nonlinear form of the transition probability matrix. This nonlinearity makes the inverse problem of CLV difficult to solve. This paper aims to solve this inverse problem, yielding the approximate transition probabilities for the customers, by applying metaheuristic optimization algorithm developed by Yang, 2013, Flower Pollination Algorithm. The major interpretation of obtaining the transition probabilities are to set goals for marketing teams in keeping the relative frequencies of customer acquisition and customer retention.

  5. Probabilistic sensitivity analysis for decision trees with multiple branches: use of the Dirichlet distribution in a Bayesian framework.

    PubMed

    Briggs, Andrew H; Ades, A E; Price, Martin J

    2003-01-01

    In structuring decision models of medical interventions, it is commonly recommended that only 2 branches be used for each chance node to avoid logical inconsistencies that can arise during sensitivity analyses if the branching probabilities do not sum to 1. However, information may be naturally available in an unconditional form, and structuring a tree in conditional form may complicate rather than simplify the sensitivity analysis of the unconditional probabilities. Current guidance emphasizes using probabilistic sensitivity analysis, and a method is required to provide probabilistic probabilities over multiple branches that appropriately represents uncertainty while satisfying the requirement that mutually exclusive event probabilities should sum to 1. The authors argue that the Dirichlet distribution, the multivariate equivalent of the beta distribution, is appropriate for this purpose and illustrate its use for generating a fully probabilistic transition matrix for a Markov model. Furthermore, they demonstrate that by adopting a Bayesian approach, the problem of observing zero counts for transitions of interest can be overcome.

  6. Electron Impact Exciation of Fe IX

    NASA Astrophysics Data System (ADS)

    Tayal, Swaraj; Zatsarinny, Oleg

    2015-05-01

    Transition probabilities and electron impact excitation collision strengths and rates for astrophysically important extreme ultraviolet lines of Fe IX are calculated. The 322 fine-structure levels of the 3s2 3p6 , 3s2 3p5 3 d , 3 s 3p6 3 d , 3s2 3p5 4 s , and 3s2 3p4 3d2 configurations are included in our calculations. The collision strengths have been calculated using the B-spline Breit-Pauli R-matrix method for all fine-structure transitions among the 322 levels. The mass, Darwin, and spin-orbit relativistic effects are included in the Breit-Pauli Hamiltonian in the scattering calculation. The one-body and two-body relativistic operators are included in the multi-configuration Hartree-Fock calculations of transition probabilities. Several sets of non-orthogonal spectroscopic and correlation radial orbitals are used to obtain accurate description of Fe IX levels and to represent the scattering functions. The calculated excitation energies are in very good agreement with experiment and represents an improvement over the previous calculations. The present collision strengths show reasonable agreement with the previously available R-matrix and distorted-wave calculations. This research is supported by NASA grant from the Solar and Heliophysics Program.

  7. Mathematical Analysis of a Multiple-Look Concept Identification Model.

    ERIC Educational Resources Information Center

    Cotton, John W.

    The behavior of focus samples central to the multiple-look model of Trabasso and Bower is examined by three methods. First, exact probabilities of success conditional upon a certain brief history of stimulation are determined. Second, possible states of the organism during the experiment are defined and a transition matrix for those states…

  8. Birth/birth-death processes and their computable transition probabilities with biological applications.

    PubMed

    Ho, Lam Si Tung; Xu, Jason; Crawford, Forrest W; Minin, Vladimir N; Suchard, Marc A

    2018-03-01

    Birth-death processes track the size of a univariate population, but many biological systems involve interaction between populations, necessitating models for two or more populations simultaneously. A lack of efficient methods for evaluating finite-time transition probabilities of bivariate processes, however, has restricted statistical inference in these models. Researchers rely on computationally expensive methods such as matrix exponentiation or Monte Carlo approximation, restricting likelihood-based inference to small systems, or indirect methods such as approximate Bayesian computation. In this paper, we introduce the birth/birth-death process, a tractable bivariate extension of the birth-death process, where rates are allowed to be nonlinear. We develop an efficient algorithm to calculate its transition probabilities using a continued fraction representation of their Laplace transforms. Next, we identify several exemplary models arising in molecular epidemiology, macro-parasite evolution, and infectious disease modeling that fall within this class, and demonstrate advantages of our proposed method over existing approaches to inference in these models. Notably, the ubiquitous stochastic susceptible-infectious-removed (SIR) model falls within this class, and we emphasize that computable transition probabilities newly enable direct inference of parameters in the SIR model. We also propose a very fast method for approximating the transition probabilities under the SIR model via a novel branching process simplification, and compare it to the continued fraction representation method with application to the 17th century plague in Eyam. Although the two methods produce similar maximum a posteriori estimates, the branching process approximation fails to capture the correlation structure in the joint posterior distribution.

  9. Laplacian normalization and random walk on heterogeneous networks for disease-gene prioritization.

    PubMed

    Zhao, Zhi-Qin; Han, Guo-Sheng; Yu, Zu-Guo; Li, Jinyan

    2015-08-01

    Random walk on heterogeneous networks is a recently emerging approach to effective disease gene prioritization. Laplacian normalization is a technique capable of normalizing the weight of edges in a network. We use this technique to normalize the gene matrix and the phenotype matrix before the construction of the heterogeneous network, and also use this idea to define the transition matrices of the heterogeneous network. Our method has remarkably better performance than the existing methods for recovering known gene-phenotype relationships. The Shannon information entropy of the distribution of the transition probabilities in our networks is found to be smaller than the networks constructed by the existing methods, implying that a higher number of top-ranked genes can be verified as disease genes. In fact, the most probable gene-phenotype relationships ranked within top 3 or top 5 in our gene lists can be confirmed by the OMIM database for many cases. Our algorithms have shown remarkably superior performance over the state-of-the-art algorithms for recovering gene-phenotype relationships. All Matlab codes can be available upon email request. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. The effect of stochiastic technique on estimates of population viability from transition matrix models

    USGS Publications Warehouse

    Kaye, T.N.; Pyke, David A.

    2003-01-01

    Population viability analysis is an important tool for conservation biologists, and matrix models that incorporate stochasticity are commonly used for this purpose. However, stochastic simulations may require assumptions about the distribution of matrix parameters, and modelers often select a statistical distribution that seems reasonable without sufficient data to test its fit. We used data from long-term (5a??10 year) studies with 27 populations of five perennial plant species to compare seven methods of incorporating environmental stochasticity. We estimated stochastic population growth rate (a measure of viability) using a matrix-selection method, in which whole observed matrices were selected at random at each time step of the model. In addition, we drew matrix elements (transition probabilities) at random using various statistical distributions: beta, truncated-gamma, truncated-normal, triangular, uniform, or discontinuous/observed. Recruitment rates were held constant at their observed mean values. Two methods of constraining stage-specific survival to a??100% were also compared. Different methods of incorporating stochasticity and constraining matrix column sums interacted in their effects and resulted in different estimates of stochastic growth rate (differing by up to 16%). Modelers should be aware that when constraining stage-specific survival to 100%, different methods may introduce different levels of bias in transition element means, and when this happens, different distributions for generating random transition elements may result in different viability estimates. There was no species effect on the results and the growth rates derived from all methods were highly correlated with one another. We conclude that the absolute value of population viability estimates is sensitive to model assumptions, but the relative ranking of populations (and management treatments) is robust. Furthermore, these results are applicable to a range of perennial plants and possibly other life histories.

  11. Mathematical Analysis of Vehicle Delivery Scale of Bike-Sharing Rental Nodes

    NASA Astrophysics Data System (ADS)

    Zhai, Y.; Liu, J.; Liu, L.

    2018-04-01

    Aiming at the lack of scientific and reasonable judgment of vehicles delivery scale and insufficient optimization of scheduling decision, based on features of the bike-sharing usage, this paper analyses the applicability of the discrete time and state of the Markov chain, and proves its properties to be irreducible, aperiodic and positive recurrent. Based on above analysis, the paper has reached to the conclusion that limit state (steady state) probability of the bike-sharing Markov chain only exists and is independent of the initial probability distribution. Then this paper analyses the difficulty of the transition probability matrix parameter statistics and the linear equations group solution in the traditional solving algorithm of the bike-sharing Markov chain. In order to improve the feasibility, this paper proposes a "virtual two-node vehicle scale solution" algorithm which considered the all the nodes beside the node to be solved as a virtual node, offered the transition probability matrix, steady state linear equations group and the computational methods related to the steady state scale, steady state arrival time and scheduling decision of the node to be solved. Finally, the paper evaluates the rationality and accuracy of the steady state probability of the proposed algorithm by comparing with the traditional algorithm. By solving the steady state scale of the nodes one by one, the proposed algorithm is proved to have strong feasibility because it lowers the level of computational difficulty and reduces the number of statistic, which will help the bike-sharing companies to optimize the scale and scheduling of nodes.

  12. Bidirectional Classical Stochastic Processes with Measurements and Feedback

    NASA Technical Reports Server (NTRS)

    Hahne, G. E.

    2005-01-01

    A measurement on a quantum system is said to cause the "collapse" of the quantum state vector or density matrix. An analogous collapse occurs with measurements on a classical stochastic process. This paper addresses the question of describing the response of a classical stochastic process when there is feedback from the output of a measurement to the input, and is intended to give a model for quantum-mechanical processes that occur along a space-like reaction coordinate. The classical system can be thought of in physical terms as two counterflowing probability streams, which stochastically exchange probability currents in a way that the net probability current, and hence the overall probability, suitably interpreted, is conserved. The proposed formalism extends the . mathematics of those stochastic processes describable with linear, single-step, unidirectional transition probabilities, known as Markov chains and stochastic matrices. It is shown that a certain rearrangement and combination of the input and output of two stochastic matrices of the same order yields another matrix of the same type. Each measurement causes the partial collapse of the probability current distribution in the midst of such a process, giving rise to calculable, but non-Markov, values for the ensuing modification of the system's output probability distribution. The paper concludes with an analysis of a classical probabilistic version of the so-called grandfather paradox.

  13. Scattering and transport statistics at the metal-insulator transition: A numerical study of the power-law banded random-matrix model

    NASA Astrophysics Data System (ADS)

    Méndez-Bermúdez, J. A.; Gopar, Victor A.; Varga, Imre

    2010-09-01

    We study numerically scattering and transport statistical properties of the one-dimensional Anderson model at the metal-insulator transition described by the power-law banded random matrix (PBRM) model at criticality. Within a scattering approach to electronic transport, we concentrate on the case of a small number of single-channel attached leads. We observe a smooth crossover from localized to delocalized behavior in the average-scattering matrix elements, the conductance probability distribution, the variance of the conductance, and the shot noise power by varying b (the effective bandwidth of the PBRM model) from small (b≪1) to large (b>1) values. We contrast our results with analytic random matrix theory predictions which are expected to be recovered in the limit b→∞ . We also compare our results for the PBRM model with those for the three-dimensional (3D) Anderson model at criticality, finding that the PBRM model with bɛ[0.2,0.4] reproduces well the scattering and transport properties of the 3D Anderson model.

  14. Prediction of beta-turns in proteins using the first-order Markov models.

    PubMed

    Lin, Thy-Hou; Wang, Ging-Ming; Wang, Yen-Tseng

    2002-01-01

    We present a method based on the first-order Markov models for predicting simple beta-turns and loops containing multiple turns in proteins. Sequences of 338 proteins in a database are divided using the published turn criteria into the following three regions, namely, the turn, the boundary, and the nonturn ones. A transition probability matrix is constructed for either the turn or the nonturn region using the weighted transition probabilities computed for dipeptides identified from each region. There are two such matrices constructed for the boundary region since the transition probabilities for dipeptides immediately preceding or following a turn are different. The window used for scanning a protein sequence from amino (N-) to carboxyl (C-) terminal is a hexapeptide since the transition probability computed for a turn tetrapeptide is capped at both the N- and C- termini with a boundary transition probability indexed respectively from the two boundary transition matrices. A sum of the averaged product of the transition probabilities of all the hexapeptides involving each residue is computed. This is then weighted with a probability computed from assuming that all the hexapeptides are from the nonturn region to give the final prediction quantity. Both simple beta-turns and loops containing multiple turns in a protein are then identified by the rising of the prediction quantity computed. The performance of the prediction scheme or the percentage (%) of correct prediction is evaluated through computation of Matthews correlation coefficients for each protein predicted. It is found that the prediction method is capable of giving prediction results with better correlation between the percent of correct prediction and the Matthews correlation coefficients for a group of test proteins as compared with those predicted using some secondary structural prediction methods. The prediction accuracy for about 40% of proteins in the database or 50% of proteins in the test set is better than 70%. Such a percentage for the test set is reduced to 30 if the structures of all the proteins in the set are treated as unknown.

  15. Semiclassical S-matrix for black holes

    DOE PAGES

    Bezrukov, Fedor; Levkov, Dmitry; Sibiryakov, Sergey

    2015-12-01

    In this study, we propose a semiclassical method to calculate S-matrix elements for two-stage gravitational transitions involving matter collapse into a black hole and evaporation of the latter. The method consistently incorporates back-reaction of the collapsing and emitted quanta on the metric. We illustrate the method in several toy models describing spherical self-gravitating shells in asymptotically flat and AdS space-times. We find that electrically neutral shells reflect via the above collapse-evaporation process with probability exp(–B), where B is the Bekenstein-Hawking entropy of the intermediate black hole. This is consistent with interpretation of exp(B) as the number of black hole states.more » The same expression for the probability is obtained in the case of charged shells if one takes into account instability of the Cauchy horizon of the intermediate Reissner-Nordström black hole. As a result, our semiclassical method opens a new systematic approach to the gravitational S-matrix in the non-perturbative regime.« less

  16. Information processing in network architecture of genome controlled signal transduction circuit. A proposed theoretical explanation.

    PubMed

    Chakraborty, Chiranjib; Sarkar, Bimal Kumar; Patel, Pratiksha; Agoramoorthy, Govindasamy

    2012-01-01

    In this paper, Shannon information theory has been applied to elaborate cell signaling. It is proposed that in the cellular network architecture, four components viz. source (DNA), transmitter (mRNA), receiver (protein) and destination (another protein) are involved. The message transmits from source (DNA) to transmitter (mRNA) and then passes through a noisy channel reaching finally the receiver (protein). The protein synthesis process is here considered as the noisy channel. Ultimately, signal is transmitted from receiver to destination (another protein). The genome network architecture elements were compared with genetic alphabet L = {A, C, G, T} with a biophysical model based on the popular Shannon information theory. This study found the channel capacity as maximum for zero error (sigma = 0) and at this condition, transition matrix becomes a unit matrix with rank 4. The transition matrix will be erroneous and finally at sigma = 1 channel capacity will be localized maxima with a value of 0.415 due to the increased value at sigma. On the other hand, minima exists at sigma = 0.75, where all transition probabilities become 0.25 and uncertainty will be maximum resulting in channel capacity with the minima value of zero.

  17. Transition probability functions for applications of inelastic electron scattering

    PubMed Central

    Löffler, Stefan; Schattschneider, Peter

    2012-01-01

    In this work, the transition matrix elements for inelastic electron scattering are investigated which are the central quantity for interpreting experiments. The angular part is given by spherical harmonics. For the weighted radial wave function overlap, analytic expressions are derived in the Slater-type and the hydrogen-like orbital models. These expressions are shown to be composed of a finite sum of polynomials and elementary trigonometric functions. Hence, they are easy to use, require little computation time, and are significantly more accurate than commonly used approximations. PMID:22560709

  18. Open Quantum Random Walks on the Half-Line: The Karlin-McGregor Formula, Path Counting and Foster's Theorem

    NASA Astrophysics Data System (ADS)

    Jacq, Thomas S.; Lardizabal, Carlos F.

    2017-11-01

    In this work we consider open quantum random walks on the non-negative integers. By considering orthogonal matrix polynomials we are able to describe transition probability expressions for classes of walks via a matrix version of the Karlin-McGregor formula. We focus on absorbing boundary conditions and, for simpler classes of examples, we consider path counting and the corresponding combinatorial tools. A non-commutative version of the gambler's ruin is studied by obtaining the probability of reaching a certain fortune and the mean time to reach a fortune or ruin in terms of generating functions. In the case of the Hadamard coin, a counting technique for boundary restricted paths in a lattice is also presented. We discuss an open quantum version of Foster's Theorem for the expected return time together with applications.

  19. Stability analysis for virus spreading in complex networks with quarantine and non-homogeneous transition rates

    NASA Astrophysics Data System (ADS)

    Alarcon-Ramos, L. A.; Schaum, A.; Rodríguez Lucatero, C.; Bernal Jaquez, R.

    2014-03-01

    Virus propagations in complex networks have been studied in the framework of discrete time Markov process dynamical systems. These studies have been carried out under the assumption of homogeneous transition rates, yielding conditions for virus extinction in terms of the transition probabilities and the largest eigenvalue of the connectivity matrix. Nevertheless the assumption of homogeneous rates is rather restrictive. In the present study we consider non-homogeneous transition rates, assigned according to a uniform distribution, with susceptible, infected and quarantine states, thus generalizing the previous studies. A remarkable result of this analysis is that the extinction depends on the weakest element in the network. Simulation results are presented for large free-scale networks, that corroborate our theoretical findings.

  20. Wave vector modification of the infinite order sudden approximation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sachs, J.G.; Bowman, J.M.

    1980-10-15

    A simple method is proposed to modify the infinite order sudden approximation (IOS) in order to extend its region of quantitative validity. The method involves modifying the phase of the IOS scattering matrix to include a part calculated at the outgoing relative kinetic energy as well as a part calculated at the incoming kinetic energy. An immediate advantage of this modification is that the resulting S matrix is symmetric. We also present a closely related method in which the relative kinetic energies used in the calculation of the phase are determined from quasiclassical trajectory calculations. A set of trajectories ismore » run with the initial state being the incoming state, and another set is run with the initial state being the outgoing state, and the average final relative kinetic energy of each set is obtained. One part of the S-operator phase is then calculated at each of these kinetic energies. We apply these methods to vibrationally inelastic collinear collisions of an atom and a harmonic oscillator, and calculate transition probabilities P/sub n/1..-->..nf for three model systems. For systems which are sudden, or nearly so, the agreement with exact quantum close-coupling calculations is substantially improved over standard IOS ones when ..delta..n=such thatub f/-n/sub i/ is large, and the corresponding transition probability is small, i.e., less than 0.1. However, the modifications we propose will not improve the accuracy of the IOS transition probabilities for any collisional system unless the standard form of IOS already gives at least qualitative agreement with exact quantal calculations. We also suggest comparisons between some classical quantities and sudden predictions which should help in determining the validity of the sudden approximation. This is useful when exact quantal data is not available for comparison.« less

  1. Wave vector modification of the infinite order sudden approximation

    NASA Astrophysics Data System (ADS)

    Sachs, Judith Grobe; Bowman, Joel M.

    1980-10-01

    A simple method is proposed to modify the infinite order sudden approximation (IOS) in order to extend its region of quantitative validity. The method involves modifying the phase of the IOS scattering matrix to include a part calculated at the outgoing relative kinetic energy as well as a part calculated at the incoming kinetic energy. An immediate advantage of this modification is that the resulting S matrix is symmetric. We also present a closely related method in which the relative kinetic energies used in the calculation of the phase are determined from quasiclassical trajectory calculations. A set of trajectories is run with the initial state being the incoming state, and another set is run with the initial state being the outgoing state, and the average final relative kinetic energy of each set is obtained. One part of the S-operator phase is then calculated at each of these kinetic energies. We apply these methods to vibrationally inelastic collinear collisions of an atom and a harmonic oscillator, and calculate transition probabilities Pn1→nf for three model systems. For systems which are sudden, or nearly so, the agreement with exact quantum close-coupling calculations is substantially improved over standard IOS ones when Δn=‖nf-ni‖ is large, and the corresponding transition probability is small, i.e., less than 0.1. However, the modifications we propose will not improve the accuracy of the IOS transition probabilities for any collisional system unless the standard form of IOS already gives at least qualitative agreement with exact quantal calculations. We also suggest comparisons between some classical quantities and sudden predictions which should help in determining the validity of the sudden approximation. This is useful when exact quantal data is not available for comparison.

  2. A Procedure for Deriving Formulas to Convert Transition Rates to Probabilities for Multistate Markov Models.

    PubMed

    Jones, Edmund; Epstein, David; García-Mochón, Leticia

    2017-10-01

    For health-economic analyses that use multistate Markov models, it is often necessary to convert from transition rates to transition probabilities, and for probabilistic sensitivity analysis and other purposes it is useful to have explicit algebraic formulas for these conversions, to avoid having to resort to numerical methods. However, if there are four or more states then the formulas can be extremely complicated. These calculations can be made using packages such as R, but many analysts and other stakeholders still prefer to use spreadsheets for these decision models. We describe a procedure for deriving formulas that use intermediate variables so that each individual formula is reasonably simple. Once the formulas have been derived, the calculations can be performed in Excel or similar software. The procedure is illustrated by several examples and we discuss how to use a computer algebra system to assist with it. The procedure works in a wide variety of scenarios but cannot be employed when there are several backward transitions and the characteristic equation has no algebraic solution, or when the eigenvalues of the transition rate matrix are very close to each other.

  3. Cross Sections for Electron Impact Excitation of Astrophysically Abundant Atoms and Ions

    NASA Technical Reports Server (NTRS)

    Tayal, S. S.

    2006-01-01

    Electron collisional excitation rates and transition probabilities are important for computing electron temperatures and densities, ionization equilibria, and for deriving elemental abundances from emission lines formed in the collisional and photoionized astrophysical plasmas. Accurate representation of target wave functions that properly account for the important correlation and relaxation effects and inclusion of coupling effects including coupling to the continuum are essential components of a reliable collision calculation. Non-orthogonal orbitals technique in multiconfiguration Hartree-Fock approach is used to calculate oscillator strengths and transition probabilities. The effect of coupling to the continuum spectrum is included through the use of pseudostates which are chosen to account for most of the dipole polarizabilities of target states. The B-spline basis is used in the R-matrix approach to calculate electron excitation collision strengths and rates. Results for oscillator strengths and electron excitation collision strengths for transitions in N I, O I, O II, O IV, S X and Fe XIV have been produced

  4. Data-driven probability concentration and sampling on manifold

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Soize, C., E-mail: christian.soize@univ-paris-est.fr; Ghanem, R., E-mail: ghanem@usc.edu

    2016-09-15

    A new methodology is proposed for generating realizations of a random vector with values in a finite-dimensional Euclidean space that are statistically consistent with a dataset of observations of this vector. The probability distribution of this random vector, while a priori not known, is presumed to be concentrated on an unknown subset of the Euclidean space. A random matrix is introduced whose columns are independent copies of the random vector and for which the number of columns is the number of data points in the dataset. The approach is based on the use of (i) the multidimensional kernel-density estimation methodmore » for estimating the probability distribution of the random matrix, (ii) a MCMC method for generating realizations for the random matrix, (iii) the diffusion-maps approach for discovering and characterizing the geometry and the structure of the dataset, and (iv) a reduced-order representation of the random matrix, which is constructed using the diffusion-maps vectors associated with the first eigenvalues of the transition matrix relative to the given dataset. The convergence aspects of the proposed methodology are analyzed and a numerical validation is explored through three applications of increasing complexity. The proposed method is found to be robust to noise levels and data complexity as well as to the intrinsic dimension of data and the size of experimental datasets. Both the methodology and the underlying mathematical framework presented in this paper contribute new capabilities and perspectives at the interface of uncertainty quantification, statistical data analysis, stochastic modeling and associated statistical inverse problems.« less

  5. Chaotic itinerancy and power-law residence time distribution in stochastic dynamical systems.

    PubMed

    Namikawa, Jun

    2005-08-01

    Chaotic itinerant motion among varieties of ordered states is described by a stochastic model based on the mechanism of chaotic itinerancy. The model consists of a random walk on a half-line and a Markov chain with a transition probability matrix. The stability of attractor ruin in the model is investigated by analyzing the residence time distribution of orbits at attractor ruins. It is shown that the residence time distribution averaged over all attractor ruins can be described by the superposition of (truncated) power-law distributions if the basin of attraction for each attractor ruin has a zero measure. This result is confirmed by simulation of models exhibiting chaotic itinerancy. Chaotic itinerancy is also shown to be absent in coupled Milnor attractor systems if the transition probability among attractor ruins can be represented as a Markov chain.

  6. Quantum Photonics Beyond Conventional Computing

    DTIC Science & Technology

    2015-07-10

    polarisation using a half- wave plate (HWP), the two arms are combined by a polarising beam splitter (PBS). The resulting state is passed through the...phase-matched for Type-I SPDC, creating non -collinear degenerate horizontally polarised photon pairs at 808 nm. After converting one arm to vertical...For the case of non -interacting fermions, the transition probabilities for states under unitary evolution are governed by matrix determinants, which are

  7. Anomalous structural transition of confined hard squares.

    PubMed

    Gurin, Péter; Varga, Szabolcs; Odriozola, Gerardo

    2016-11-01

    Structural transitions are examined in quasi-one-dimensional systems of freely rotating hard squares, which are confined between two parallel walls. We find two competing phases: one is a fluid where the squares have two sides parallel to the walls, while the second one is a solidlike structure with a zigzag arrangement of the squares. Using transfer matrix method we show that the configuration space consists of subspaces of fluidlike and solidlike phases, which are connected with low probability microstates of mixed structures. The existence of these connecting states makes the thermodynamic quantities continuous and precludes the possibility of a true phase transition. However, thermodynamic functions indicate strong tendency for the phase transition and our replica exchange Monte Carlo simulation study detects several important markers of the first order phase transition. The distinction of a phase transition from a structural change is practically impossible with simulations and experiments in such systems like the confined hard squares.

  8. Intra-Urban Human Mobility and Activity Transition: Evidence from Social Media Check-In Data

    PubMed Central

    Wu, Lun; Zhi, Ye; Sui, Zhengwei; Liu, Yu

    2014-01-01

    Most existing human mobility literature focuses on exterior characteristics of movements but neglects activities, the driving force that underlies human movements. In this research, we combine activity-based analysis with a movement-based approach to model the intra-urban human mobility observed from about 15 million check-in records during a yearlong period in Shanghai, China. The proposed model is activity-based and includes two parts: the transition of travel demands during a specific time period and the movement between locations. For the first part, we find the transition probability between activities varies over time, and then we construct a temporal transition probability matrix to represent the transition probability of travel demands during a time interval. For the second part, we suggest that the travel demands can be divided into two classes, locationally mandatory activity (LMA) and locationally stochastic activity (LSA), according to whether the demand is associated with fixed location or not. By judging the combination of predecessor activity type and successor activity type we determine three trip patterns, each associated with a different decay parameter. To validate the model, we adopt the mechanism of an agent-based model and compare the simulated results with the observed pattern from the displacement distance distribution, the spatio-temporal distribution of activities, and the temporal distribution of travel demand transitions. The results show that the simulated patterns fit the observed data well, indicating that these findings open new directions for combining activity-based analysis with a movement-based approach using social media check-in data. PMID:24824892

  9. A multi-state model for sick-leave data applied to a randomized control trial study of low back pain.

    PubMed

    Lie, Stein Atle; Eriksen, Hege R; Ursin, Holger; Hagen, Eli Molde

    2008-05-01

    Analysing and presenting data on different outcomes after sick-leave is challenging. The use of extended statistical methods supplies additional information and allows further exploitation of data. Four hundred and fifty-seven patients, sick-listed for 8-12 weeks for low back pain, were randomized to intervention (n=237) or control (n=220). Outcome was measured as: "sick-listed'', "returned to work'', or "disability pension''. The individuals shifted between the three states between one and 22 times (mean 6.4 times). In a multi-state model, shifting between the states was set up in a transition intensity matrix. The probability of being in any of the states was calculated as a transition probability matrix. The effects of the intervention were modelled using a non-parametric model. There was an effect of the intervention for leaving the state sick-listed and shifting to returned to work (relative risk (RR)=1.27, 95% confidence interval (CI) 1.09- 1.47). The nonparametric estimates showed an effect of the intervention for leaving sick-listed and shifting to returned to work in the first 6 months. We found a protective effect of the intervention for shifting back to sick-listed between 6 and 18 months. The analyses showed that the probability of staying in the state returned to work was not different between the intervention and control groups at the end of the follow-up (3 years). We demonstrate that these alternative analyses give additional results and increase the strength of the analyses. The simple intervention did not decrease the probability of being on sick-leave in the long term; however, it decreased the time that individuals were on sick-leave.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sinitsyn, Nikolai A.

    In this paper, I identify a nontrivial four-state Landau-Zener model for which transition probabilities between any pair of diabatic states can be determined analytically and exactly. The model describes an experimentally accessible system of two interacting qubits, such as a localized state in a Dirac material with both valley and spin degrees of freedom or a singly charged quantum dot (QD) molecule with spin orbit coupling. Application of the linearly time-dependent magnetic field induces a sequence of quantum level crossings with possibility of interference of different trajectories in a semiclassical picture. I argue that this system satisfies the criteria ofmore » integrability in the multistate Landau-Zener theory, which allows one to derive explicit exact analytical expressions for the transition probability matrix. Finally, I also argue that this model is likely a special case of a larger class of solvable systems, and present a six-state generalization as an example.« less

  11. Ameloblasts express type I collagen during amelogenesis.

    PubMed

    Assaraf-Weill, N; Gasse, B; Silvent, J; Bardet, C; Sire, J Y; Davit-Béal, T

    2014-05-01

    Enamel and enameloid, the highly mineralized tooth-covering tissues in living vertebrates, are different in their matrix composition. Enamel, a unique product of ameloblasts, principally contains enamel matrix proteins (EMPs), while enameloid possesses collagen fibrils and probably receives contributions from both odontoblasts and ameloblasts. Here we focused on type I collagen (COL1A1) and amelogenin (AMEL) gene expression during enameloid and enamel formation throughout ontogeny in the caudate amphibian, Pleurodeles waltl. In this model, pre-metamorphic teeth possess enameloid and enamel, while post-metamorphic teeth possess enamel only. In first-generation teeth, qPCR and in situ hybridization (ISH) on sections revealed that ameloblasts weakly expressed AMEL during late-stage enameloid formation, while expression strongly increased during enamel deposition. Using ISH, we identified COL1A1 transcripts in ameloblasts and odontoblasts during enameloid formation. COL1A1 expression in ameloblasts gradually decreased and was no longer detected after metamorphosis. The transition from enameloid-rich to enamel-rich teeth could be related to a switch in ameloblast activity from COL1A1 to AMEL synthesis. P. waltl therefore appears to be an appropriate animal model for the study of the processes involved during enameloid-to-enamel transition, especially because similar events probably occurred in various lineages during vertebrate evolution.

  12. Decoding and modelling of time series count data using Poisson hidden Markov model and Markov ordinal logistic regression models.

    PubMed

    Sebastian, Tunny; Jeyaseelan, Visalakshi; Jeyaseelan, Lakshmanan; Anandan, Shalini; George, Sebastian; Bangdiwala, Shrikant I

    2018-01-01

    Hidden Markov models are stochastic models in which the observations are assumed to follow a mixture distribution, but the parameters of the components are governed by a Markov chain which is unobservable. The issues related to the estimation of Poisson-hidden Markov models in which the observations are coming from mixture of Poisson distributions and the parameters of the component Poisson distributions are governed by an m-state Markov chain with an unknown transition probability matrix are explained here. These methods were applied to the data on Vibrio cholerae counts reported every month for 11-year span at Christian Medical College, Vellore, India. Using Viterbi algorithm, the best estimate of the state sequence was obtained and hence the transition probability matrix. The mean passage time between the states were estimated. The 95% confidence interval for the mean passage time was estimated via Monte Carlo simulation. The three hidden states of the estimated Markov chain are labelled as 'Low', 'Moderate' and 'High' with the mean counts of 1.4, 6.6 and 20.2 and the estimated average duration of stay of 3, 3 and 4 months, respectively. Environmental risk factors were studied using Markov ordinal logistic regression analysis. No significant association was found between disease severity levels and climate components.

  13. Forecasting extinction risk with nonstationary matrix models.

    PubMed

    Gotelli, Nicholas J; Ellison, Aaron M

    2006-02-01

    Matrix population growth models are standard tools for forecasting population change and for managing rare species, but they are less useful for predicting extinction risk in the face of changing environmental conditions. Deterministic models provide point estimates of lambda, the finite rate of increase, as well as measures of matrix sensitivity and elasticity. Stationary matrix models can be used to estimate extinction risk in a variable environment, but they assume that the matrix elements are randomly sampled from a stationary (i.e., non-changing) distribution. Here we outline a method for using nonstationary matrix models to construct realistic forecasts of population fluctuation in changing environments. Our method requires three pieces of data: (1) field estimates of transition matrix elements, (2) experimental data on the demographic responses of populations to altered environmental conditions, and (3) forecasting data on environmental drivers. These three pieces of data are combined to generate a series of sequential transition matrices that emulate a pattern of long-term change in environmental drivers. Realistic estimates of population persistence and extinction risk can be derived from stochastic permutations of such a model. We illustrate the steps of this analysis with data from two populations of Sarracenia purpurea growing in northern New England. Sarracenia purpurea is a perennial carnivorous plant that is potentially at risk of local extinction because of increased nitrogen deposition. Long-term monitoring records or models of environmental change can be used to generate time series of driver variables under different scenarios of changing environments. Both manipulative and natural experiments can be used to construct a linking function that describes how matrix parameters change as a function of the environmental driver. This synthetic modeling approach provides quantitative estimates of extinction probability that have an explicit mechanistic basis.

  14. A quantum description of linear, and non-linear optical interactions in arrays of plasmonic nanoparticles

    NASA Astrophysics Data System (ADS)

    Arabahmadi, Ehsan; Ahmadi, Zabihollah; Rashidian, Bizhan

    2018-06-01

    A quantum theory for describing the interaction of photons and plasmons, in one- and two-dimensional arrays is presented. Ohmic losses and inter-band transitions are not considered. We use macroscopic approach, and quantum field theory methods including S-matrix expansion, and Feynman diagrams for this purpose. Non-linear interactions are also studied, and increasing the probability of such interactions, and its application are also discussed.

  15. Architecture of the organic matrix in the sternal CaCO3 deposits of Porcellio scaber (Crustacea, Isopoda).

    PubMed

    Fabritius, Helge; Walther, Paul; Ziegler, Andreas

    2005-05-01

    Before the molt terrestrial isopods resorb calcium from the posterior cuticle and store it in large deposits within the first four anterior sternites. In Porcellio scaber the deposits consist of three structurally distinct layers consisting of amorphous CaCO3 (ACC) and an organic matrix that consists of concentric and radial elements. It is thought that the organic matrix plays a role in the structural organization of deposits and in the stabilization of ACC, which is unstable in vitro. In this paper, we present a thorough analysis of the ultrastructure of the organic matrix in the CaCO3 deposits using high-resolution field-emission scanning electron microscopy. The spherules and the homogeneous layer contain an elaborate organic matrix with similar structural organization consisting of concentric reticules and radial strands. The decalcification experiments reveal an inhomogeneous solubility of ACC within the spherules probably caused by variations in the stabilizing properties of matrix components. The transition between the three layers can be explained by changes in the number of spherule nucleation sites.

  16. Theory of Stochastic Laplacian Growth

    NASA Astrophysics Data System (ADS)

    Alekseev, Oleg; Mineev-Weinstein, Mark

    2017-07-01

    We generalize the diffusion-limited aggregation by issuing many randomly-walking particles, which stick to a cluster at the discrete time unit providing its growth. Using simple combinatorial arguments we determine probabilities of different growth scenarios and prove that the most probable evolution is governed by the deterministic Laplacian growth equation. A potential-theoretical analysis of the growth probabilities reveals connections with the tau-function of the integrable dispersionless limit of the two-dimensional Toda hierarchy, normal matrix ensembles, and the two-dimensional Dyson gas confined in a non-uniform magnetic field. We introduce the time-dependent Hamiltonian, which generates transitions between different classes of equivalence of closed curves, and prove the Hamiltonian structure of the interface dynamics. Finally, we propose a relation between probabilities of growth scenarios and the semi-classical limit of certain correlation functions of "light" exponential operators in the Liouville conformal field theory on a pseudosphere.

  17. Random Matrix Theory and the Anderson Model

    NASA Astrophysics Data System (ADS)

    Bellissard, Jean

    2004-08-01

    This paper is devoted to a discussion of possible strategies to prove rigorously the existence of a metal-insulator Anderson transition for the Anderson model in dimension d≥3. The possible criterions used to define such a transition are presented. It is argued that at low disorder the lowest order in perturbation theory is described by a random matrix model. Various simplified versions for which rigorous results have been obtained in the past are discussed. It includes a free probability approach, the Wegner n-orbital model and a class of models proposed by Disertori, Pinson, and Spencer, Comm. Math. Phys. 232:83-124 (2002). At last a recent work by Magnen, Rivasseau, and the author, Markov Process and Related Fields 9:261-278 (2003) is summarized: it gives a toy modeldescribing the lowest order approximation of Anderson model and it is proved that, for d=2, its density of states is given by the semicircle distribution. A short discussion of its extension to d≥3 follows.

  18. ENSO Dynamics and Trends, AN Alternate View

    NASA Astrophysics Data System (ADS)

    Rojo Hernandez, J. D.; Lall, U.; Mesa, O. J.

    2017-12-01

    El Niño - Southern Oscillation (ENSO) is the most important inter-annual climate fluctuation on a planetary level with great effects on the hydrological cycle, agriculture, ecosystems, health and society. This work demonstrates the use of the Non-Homogeneus hidden Markov Models (NHMM) to characterize ENSO using a set of discrete states with variable transition probabilities matrix using the data of sea surface temperature anomalies (SSTA) of the Kaplan Extended SST v2 between 120E -90W, 15N-15S from Jan-1856 to Dec-2016. ENSO spatial patterns, their temporal distribution, the transition probabilities between patterns and their temporal evolution are the main results of the NHHMM applied to ENSO. The five "hidden" states found appear to represent the different "Flavors" described in the literature: the Canonical El Niño, Central El Niño, a Neutral state, Central La Niña and the Canonical Niña. Using the whole record length of the SSTA it was possible to identify trends in the dynamic system, with a decrease in the probability of occurrence of the cold events and a significant increase of the warm events, in particular of Central El Niño events whose probability of occurrence has increased Dramatically since 1960 coupled with increases in global temperature.

  19. Entanglement transitions induced by large deviations

    NASA Astrophysics Data System (ADS)

    Bhosale, Udaysinh T.

    2017-12-01

    The probability of large deviations of the smallest Schmidt eigenvalue for random pure states of bipartite systems, denoted as A and B , is computed analytically using a Coulomb gas method. It is shown that this probability, for large N , goes as exp[-β N2Φ (ζ ) ] , where the parameter β is the Dyson index of the ensemble, ζ is the large deviation parameter, while the rate function Φ (ζ ) is calculated exactly. Corresponding equilibrium Coulomb charge density is derived for its large deviations. Effects of the large deviations of the extreme (largest and smallest) Schmidt eigenvalues on the bipartite entanglement are studied using the von Neumann entropy. Effect of these deviations is also studied on the entanglement between subsystems 1 and 2, obtained by further partitioning the subsystem A , using the properties of the density matrix's partial transpose ρ12Γ. The density of states of ρ12Γ is found to be close to the Wigner's semicircle law with these large deviations. The entanglement properties are captured very well by a simple random matrix model for the partial transpose. The model predicts the entanglement transition across a critical large deviation parameter ζ . Log negativity is used to quantify the entanglement between subsystems 1 and 2. Analytical formulas for it are derived using the simple model. Numerical simulations are in excellent agreement with the analytical results.

  20. Entanglement transitions induced by large deviations.

    PubMed

    Bhosale, Udaysinh T

    2017-12-01

    The probability of large deviations of the smallest Schmidt eigenvalue for random pure states of bipartite systems, denoted as A and B, is computed analytically using a Coulomb gas method. It is shown that this probability, for large N, goes as exp[-βN^{2}Φ(ζ)], where the parameter β is the Dyson index of the ensemble, ζ is the large deviation parameter, while the rate function Φ(ζ) is calculated exactly. Corresponding equilibrium Coulomb charge density is derived for its large deviations. Effects of the large deviations of the extreme (largest and smallest) Schmidt eigenvalues on the bipartite entanglement are studied using the von Neumann entropy. Effect of these deviations is also studied on the entanglement between subsystems 1 and 2, obtained by further partitioning the subsystem A, using the properties of the density matrix's partial transpose ρ_{12}^{Γ}. The density of states of ρ_{12}^{Γ} is found to be close to the Wigner's semicircle law with these large deviations. The entanglement properties are captured very well by a simple random matrix model for the partial transpose. The model predicts the entanglement transition across a critical large deviation parameter ζ. Log negativity is used to quantify the entanglement between subsystems 1 and 2. Analytical formulas for it are derived using the simple model. Numerical simulations are in excellent agreement with the analytical results.

  1. Manpower Modeling in the Airborne Community of the United States Army.

    DTIC Science & Technology

    1984-09-01

    Inventories for CMIF 51 . . . 103 27. Authorizations and Inventories for CMF 54 . . . 104 28. Authorizations and Inventories for CMF 55 . 105 29...81 ........ 144 C.24 Transition Matrix for CMF 84 ......... 145 10 .. - C.25 Transition Matrix for CMiF 91 .... 145 C. 26 Transition matrix for CNF...150 C. 30 Transition Matrix for CM1F 97 ....... . 151 C. 31 Transition Matrix for CMiF 98 .. . .152 I. I._IRODUCTION In the last two decades, with the

  2. Solvable four-state Landau-Zener model of two interacting qubits with path interference

    DOE PAGES

    Sinitsyn, Nikolai A.

    2015-11-30

    In this paper, I identify a nontrivial four-state Landau-Zener model for which transition probabilities between any pair of diabatic states can be determined analytically and exactly. The model describes an experimentally accessible system of two interacting qubits, such as a localized state in a Dirac material with both valley and spin degrees of freedom or a singly charged quantum dot (QD) molecule with spin orbit coupling. Application of the linearly time-dependent magnetic field induces a sequence of quantum level crossings with possibility of interference of different trajectories in a semiclassical picture. I argue that this system satisfies the criteria ofmore » integrability in the multistate Landau-Zener theory, which allows one to derive explicit exact analytical expressions for the transition probability matrix. Finally, I also argue that this model is likely a special case of a larger class of solvable systems, and present a six-state generalization as an example.« less

  3. Markov chain model for demersal fish catch analysis in Indonesia

    NASA Astrophysics Data System (ADS)

    Firdaniza; Gusriani, N.

    2018-03-01

    As an archipelagic country, Indonesia has considerable potential fishery resources. One of the fish resources that has high economic value is demersal fish. Demersal fish is a fish with a habitat in the muddy seabed. Demersal fish scattered throughout the Indonesian seas. Demersal fish production in each Indonesia’s Fisheries Management Area (FMA) varies each year. In this paper we have discussed the Markov chain model for demersal fish yield analysis throughout all Indonesia’s Fisheries Management Area. Data of demersal fish catch in every FMA in 2005-2014 was obtained from Directorate of Capture Fisheries. From this data a transition probability matrix is determined by the number of transitions from the catch that lie below the median or above the median. The Markov chain model of demersal fish catch data was an ergodic Markov chain model, so that the limiting probability of the Markov chain model can be determined. The predictive value of demersal fishing yields was obtained by calculating the combination of limiting probability with average catch results below the median and above the median. The results showed that for 2018 and long-term demersal fishing results in most of FMA were below the median value.

  4. Toward efficiency in heterogeneous multispecies reactive transport modeling: A particle-tracking solution for first-order network reactions

    NASA Astrophysics Data System (ADS)

    Henri, Christopher; Fernàndez-Garcia, Daniel

    2015-04-01

    Modeling multi-species reactive transport in natural systems with strong heterogeneities and complex biochemical reactions is a major challenge for assessing groundwater polluted sites with organic and inorganic contaminants. A large variety of these contaminants react according to serial-parallel reaction networks commonly simplified by a combination of first-order kinetic reactions. In this context, a random-walk particle tracking method is presented. This method is capable of efficiently simulating the motion of particles affected by first-order network reactions in three-dimensional systems, which are represented by spatially variable physical and biochemical coefficients described at high resolution. The approach is based on the development of transition probabilities that describe the likelihood that particles belonging to a given species and location at a given time will be transformed into and moved to another species and location afterwards. These probabilities are derived from the solution matrix of the spatial moments governing equations. The method is fully coupled with reactions, free of numerical dispersion and overcomes the inherent numerical problems stemming from the incorporation of heterogeneities to reactive transport codes. In doing this, we demonstrate that the motion of particles follows a standard random walk with time-dependent effective retardation and dispersion parameters that depend on the initial and final chemical state of the particle. The behavior of effective parameters develops as a result of differential retardation effects among species. Moreover, explicit analytic solutions of the transition probability matrix and related particle motions are provided for serial reactions. An example of the effect of heterogeneity on the dechlorination of organic solvents in a three-dimensional random porous media shows that the power-law behavior typically observed in conservative tracers breakthrough curves can be largely compromised by the effect of biochemical reactions.

  5. Toward efficiency in heterogeneous multispecies reactive transport modeling: A particle-tracking solution for first-order network reactions

    NASA Astrophysics Data System (ADS)

    Henri, Christopher V.; Fernàndez-Garcia, Daniel

    2014-09-01

    Modeling multispecies reactive transport in natural systems with strong heterogeneities and complex biochemical reactions is a major challenge for assessing groundwater polluted sites with organic and inorganic contaminants. A large variety of these contaminants react according to serial-parallel reaction networks commonly simplified by a combination of first-order kinetic reactions. In this context, a random-walk particle tracking method is presented. This method is capable of efficiently simulating the motion of particles affected by first-order network reactions in three-dimensional systems, which are represented by spatially variable physical and biochemical coefficients described at high resolution. The approach is based on the development of transition probabilities that describe the likelihood that particles belonging to a given species and location at a given time will be transformed into and moved to another species and location afterward. These probabilities are derived from the solution matrix of the spatial moments governing equations. The method is fully coupled with reactions, free of numerical dispersion and overcomes the inherent numerical problems stemming from the incorporation of heterogeneities to reactive transport codes. In doing this, we demonstrate that the motion of particles follows a standard random walk with time-dependent effective retardation and dispersion parameters that depend on the initial and final chemical state of the particle. The behavior of effective parameters develops as a result of differential retardation effects among species. Moreover, explicit analytic solutions of the transition probability matrix and related particle motions are provided for serial reactions. An example of the effect of heterogeneity on the dechlorination of organic solvents in a three-dimensional random porous media shows that the power-law behavior typically observed in conservative tracers breakthrough curves can be largely compromised by the effect of biochemical reactions.

  6. Rényi entropy of the totally asymmetric exclusion process

    NASA Astrophysics Data System (ADS)

    Wood, Anthony J.; Blythe, Richard A.; Evans, Martin R.

    2017-11-01

    The Rényi entropy is a generalisation of the Shannon entropy that is sensitive to the fine details of a probability distribution. We present results for the Rényi entropy of the totally asymmetric exclusion process (TASEP). We calculate explicitly an entropy whereby the squares of configuration probabilities are summed, using the matrix product formalism to map the problem to one involving a six direction lattice walk in the upper quarter plane. We derive the generating function across the whole phase diagram, using an obstinate kernel method. This gives the leading behaviour of the Rényi entropy and corrections in all phases of the TASEP. The leading behaviour is given by the result for a Bernoulli measure and we conjecture that this holds for all Rényi entropies. Within the maximal current phase the correction to the leading behaviour is logarithmic in the system size. Finally, we remark upon a special property of equilibrium systems whereby discontinuities in the Rényi entropy arise away from phase transitions, which we refer to as secondary transitions. We find no such secondary transition for this nonequilibrium system, supporting the notion that these are specific to equilibrium cases.

  7. On the mixing time in the Wang-Landau algorithm

    NASA Astrophysics Data System (ADS)

    Fadeeva, Marina; Shchur, Lev

    2018-01-01

    We present preliminary results of the investigation of the properties of the Markov random walk in the energy space generated by the Wang-Landau probability. We build transition matrix in the energy space (TMES) using the exact density of states for one-dimensional and two-dimensional Ising models. The spectral gap of TMES is inversely proportional to the mixing time of the Markov chain. We estimate numerically the dependence of the mixing time on the lattice size, and extract the mixing exponent.

  8. The growth mechanism of grain boundary carbide in Alloy 690

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Hui, E-mail: huili@shu.edu.cn; Institute of Materials, Shanghai University, Shanghai 200072; Xia, Shuang

    2013-07-15

    The growth mechanism of grain boundary M{sub 23}C{sub 6} carbides in nickel base Alloy 690 after aging at 715 °C was investigated by high resolution transmission electron microscopy. The grain boundary carbides have coherent orientation relationship with only one side of the matrix. The incoherent phase interface between M{sub 23}C{sub 6} and matrix was curved, and did not lie on any specific crystal plane. The M{sub 23}C{sub 6} carbide transforms from the matrix phase directly at the incoherent interface. The flat coherent phase interface generally lies on low index crystal planes, such as (011) and (111) planes. The M{sub 23}C{submore » 6} carbide transforms from a transition phase found at curved coherent phase interface. The transition phase has a complex hexagonal crystal structure, and has coherent orientation relationship with matrix and M{sub 23}C{sub 6}: (111){sub matrix}//(0001){sub transition}//(111){sub carbide}, <112{sup ¯}>{sub matrix}//<21{sup ¯}10>{sub transition}//<112{sup ¯}>{sub carbide}. The crystal lattice constants of transition phase are c{sub transition}=√(3)×a{sub matrix} and a{sub transition}=√(6)/2×a{sub matrix}. Based on the experimental results, the growth mechanism of M{sub 23}C{sub 6} and the formation mechanism of transition phase are discussed. - Highlights: • A transition phase was observed at the coherent interfaces of M{sub 23}C{sub 6} and matrix. • The transition phase has hexagonal structure, and is coherent with matrix and M{sub 23}C{sub 6}. • The M{sub 23}C{sub 6} transforms from the matrix directly at the incoherent phase interface.« less

  9. Spatial and temporal dynamics of fucoid populations (Ascophyllum nodosum and Fucus serratus): a comparison between central and range edge populations.

    PubMed

    Araújo, Rita M; Serrão, Ester A; Sousa-Pinto, Isabel; Åberg, Per

    2014-01-01

    Persistence of populations at range edges relies on local population dynamics and fitness, in the case of geographically isolated populations of species with low dispersal potential. Focusing on spatial variations in demography helps to predict the long-term capability for persistence of populations across the geographical range of species' distribution. The demography of two ecological and phylogenetically close macroalgal species with different life history characteristics was investigated by using stochastic, stage-based matrix models. Populations of Ascophyllum nodosum and Fucus serratus were sampled for up to 4 years at central locations in France and at their southern range limits in Portugal. The stochastic population growth rate (λ(s)) of A. nodosum was lower and more variable in central than in southern sites whilst for F. serratus this trend was reversed with λ(s) much lower and more variable in southern than in central populations. Individuals were larger in central than in southern populations for both species, which was reflected in the lower transition probabilities of individuals to larger size classes and higher probability of shrinkage in the southern populations. In both central and southern populations elasticity analysis (proportional sensitivity) of population growth rate showed that fertility elements had a small contribution to λ(s) that was more sensitive to changes in matrix transitions corresponding to survival. The highest elasticities were found for loop transitions in A. nodosum and for growth to larger size classes in F. serratus. Sensitivity analysis showed high selective pressure on individual growth for both species at both locations. The results of this study highlight the deterministic role of species-specific life-history traits in population demography across the geographical range of species. Additionally, this study demonstrates that individuals' life-transitions differ in vulnerability to environmental variability and shows the importance of vegetative compared to reproductive stages for the long-term persistence of populations.

  10. Transfer-matrix study of a hard-square lattice gas with two kinds of particles and density anomaly

    NASA Astrophysics Data System (ADS)

    Oliveira, Tiago J.; Stilck, Jürgen F.

    2015-09-01

    Using transfer matrix and finite-size scaling methods, we study the thermodynamic behavior of a lattice gas with two kinds of particles on the square lattice. Only excluded volume interactions are considered, so that the model is athermal. Large particles exclude the site they occupy and its four first neighbors, while small particles exclude only their site. Two thermodynamic phases are found: a disordered phase where large particles occupy both sublattices with the same probability and an ordered phase where one of the two sublattices is preferentially occupied by them. The transition between these phases is continuous at small concentrations of the small particles and discontinuous at larger concentrations, both transitions are separated by a tricritical point. Estimates of the central charge suggest that the critical line is in the Ising universality class, while the tricritical point has tricritical Ising (Blume-Emery-Griffiths) exponents. The isobaric curves of the total density as functions of the fugacity of small or large particles display a minimum in the disordered phase.

  11. Effect of carbon nanotube dispersion on glass transition in cross-linked epoxy-carbon nanotube nanocomposites: role of interfacial interactions.

    PubMed

    Khare, Ketan S; Khare, Rajesh

    2013-06-20

    We have used atomistic molecular simulations to study the effect of nanofiller dispersion on the glass transition behavior of cross-linked epoxy-carbon nanotube (CNT) nanocomposites. Specific chemical interactions at the interface of CNTs and cross-linked epoxy create an interphase region, whose impact on the properties of their nanocomposites increases with an increasing extent of dispersion. To investigate this aspect, we have compared the volumetric, structural, and dynamical properties of three systems: neat cross-linked epoxy, cross-linked epoxy nanocomposite containing dispersed CNTs, and cross-linked epoxy nanocomposite containing aggregated CNTs. We find that the nanocomposite containing dispersed CNTs shows a depression in the glass transition temperature (Tg) by ~66 K as compared to the neat cross-linked epoxy, whereas such a large depression is absent in the nanocomposite containing aggregated CNTs. Our results suggest that the poor interfacial interactions between the CNTs and the cross-linked epoxy matrix lead to a more compressible interphase region between the CNTs and the bulk matrix. An analysis of the resulting dynamic heterogeneity shows that the probability of percolation of immobile domains becomes unity near the Tg calculated from volumetric properties. Our observations also lend support to the conceptual analogy between polymer nanocomposites and the nanoconfinement of polymer thin films.

  12. Prevalence and co-occurrence of addictive behaviors among former alternative high school youth: A longitudinal follow-up study.

    PubMed

    Sussman, Steve; Pokhrel, Pallav; Sun, Ping; Rohrbach, Louise A; Spruijt-Metz, Donna

    2015-09-01

    Recent work has studied addictions using a matrix measure, which taps multiple addictions through single responses for each type. This is the first longitudinal study using a matrix measure. We investigated the use of this approach among former alternative high school youth (average age = 19.8 years at baseline; longitudinal n = 538) at risk for addictions. Lifetime and last 30-day prevalence of one or more of 11 addictions reviewed in other work was the primary focus (i.e., cigarettes, alcohol, hard drugs, shopping, gambling, Internet, love, sex, eating, work, and exercise). These were examined at two time-points one year apart. Latent class and latent transition analyses (LCA and LTA) were conducted in Mplus. Prevalence rates were stable across the two time-points. As in the cross-sectional baseline analysis, the 2-class model (addiction class, non-addiction class) fit the data better at follow-up than models with more classes. Item-response or conditional probabilities for each addiction type did not differ between time-points. As a result, the LTA model utilized constrained the conditional probabilities to be equal across the two time-points. In the addiction class, larger conditional probabilities (i.e., 0.40-0.49) were found for love, sex, exercise, and work addictions; medium conditional probabilities (i.e., 0.17-0.27) were found for cigarette, alcohol, other drugs, eating, Internet and shopping addiction; and a small conditional probability (0.06) was found for gambling. Persons in an addiction class tend to remain in this addiction class over a one-year period.

  13. Generalized self-consistent method for predicting the effective elastic properties of composites with random hybrid structures

    NASA Astrophysics Data System (ADS)

    Pan'kov, A. A.

    1997-05-01

    The feasibility of using a generalized self-consistent method for predicting the effective elastic properties of composites with random hybrid structures has been examined. Using this method, the problem is reduced to solution of simpler special averaged problems for composites with single inclusions and corresponding transition layers in the medium examined. The dimensions of the transition layers are defined by correlation radii of the composite random structure of the composite, while the heterogeneous elastic properties of the transition layers take account of the probabilities for variation of the size and configuration of the inclusions using averaged special indicator functions. Results are given for a numerical calculation of the averaged indicator functions and analysis of the effect of the micropores in the matrix-fiber interface region on the effective elastic properties of unidirectional fiberglass—epoxy using the generalized self-consistent method and compared with experimental data and reported solutions.

  14. Stochastic simulation of human pulmonary blood flow and transit time frequency distribution based on anatomic and elasticity data.

    PubMed

    Huang, Wei; Shi, Jun; Yen, R T

    2012-12-01

    The objective of our study was to develop a computing program for computing the transit time frequency distributions of red blood cell in human pulmonary circulation, based on our anatomic and elasticity data of blood vessels in human lung. A stochastic simulation model was introduced to simulate blood flow in human pulmonary circulation. In the stochastic simulation model, the connectivity data of pulmonary blood vessels in human lung was converted into a probability matrix. Based on this model, the transit time of red blood cell in human pulmonary circulation and the output blood pressure were studied. Additionally, the stochastic simulation model can be used to predict the changes of blood flow in human pulmonary circulation with the advantage of the lower computing cost and the higher flexibility. In conclusion, a stochastic simulation approach was introduced to simulate the blood flow in the hierarchical structure of a pulmonary circulation system, and to calculate the transit time distributions and the blood pressure outputs.

  15. The transition from isolated patches to a metapopulation in the eastern collared lizard in response to prescribed fires.

    PubMed

    Templeton, Alan R; Brazeal, Hilary; Neuwald, Jennifer L

    2011-09-01

    Habitat fragmentation often arises from human-induced alterations to the matrix that reduce or eliminate dispersal between habitat patches. Elimination of dispersal increases local extinction and decreases recolonization. These phenomena were observed in the eastern collared lizard (Crotaphytus collaris collaris), which lives in the mid-continental highland region of the Ozarks (Missouri, USA) on glades: habitats of exposed bedrock that form desert-like habitats imbedded in a woodland matrix. With the onset of woodland fire suppression, glade habitats degenerated and the woodland matrix was altered to create a strong barrier to dispersal. By 1980, lizard populations in the Ozarks were rapidly going extinct. In response to this decline, some glades were restored by clearing and burning. Starting in 1984, collared lizard populations were translocated onto these restored habitats. The translocated populations persisted but did not colonize nearby glades or disperse among one another. In 1994 prescribed woodland fires were initiated, which unleashed much dispersal and colonizing behavior. Dispersal was highly nonrandom by both intrinsic variables (age, gender) and extrinsic variables (overall demography, glade population sizes, glade areas, landscape features), resulting in different classes of lizards being dominant in creating demographic cohesiveness among glades, colonizing new glades on a mountain, and colonizing new mountain systems. A dramatic transition was documented from isolated fragments, to a nonequilibrium colonizing metapopulation, and finally to a stable metapopulation. This transition is characterized by the convergence of rates of extinction and recolonization and a major alteration of dispersal probabilities and pattern in going from the nonequilibrium to stable metapopulation states.

  16. The photon-plasmon transitions and diagnostics of the space plasma turbulence

    NASA Astrophysics Data System (ADS)

    Glushkov, Alexander; Glushkov, Alexander; Khetselius, Olga

    We present a new approach to treating the space plasma turbulence, based on using to make diagnostic data regarding the photon-plasmon transitions. The theoretical definition of characteristics for these transitions is caried out within consistent theoretical approach, based on the Gell-Mann and Low formalism (energy approach in QED theory).We apply it to calculation of such transitions (Ps) with emission of photon and Langmuir quanta. It is well known that the hfs states of positronium Ps Ps differ in spin S, life time t and mode of annihilation. As a rule, probabilities of the cascade radiation transitions are more than the annihilation probability. The ortho-Ps atom has a metastable state 23s1 and probability of two-photon radiation transition from this state into 13s1 state (1.8•10(-3) 1/s) is significantly less than probability of the three-photon annihilation directly from 23s1level 8.9•10(5) s(-1), i.e. it is usually supposed that the ortho-Ps annihilates from 23s1state. Another situation may take place in plasma, where it is arisen the competition process of destruction of the metastable level - the photonplasmon transition 23s1-13s1with emission of photon and Langmuir quanta. In this paper we carried out the calculation of the probability of the Ps photon-plasmon transition and propose tu use it for diagnostics of the space plasma (dusty one etc.).Standard S-matrix calculation with using an expression for tensor of dielectric permeability of the isotropic space plasma and dispersion relationships for transverse and Langmuir waves [3] allows getting the corresponding probability P(ph-pl). Numerical value of P(ph-pl) is 5.2•10(6)•UL(s-1), where UL is density of the Langmuir waves energy. Our value is correlated with estimate, available in literature [3]: P(phpl)= 6•10(6)•UL (s-1). Comparison of the obtained probability with the life time t(3) allows getting the condition of predominance of the photon-plasmon transition over three-photon annihilation. It is demonstrated how the considered transition may control the population of 23s1 level and search of the long-lived Ps state that is further used for diagnostics of the space plasma turbulence. At last the experimental realization of the indicated methodics is discussed. References: 1. L.N.Ivanov, V.S.Letokhov, Com.Mod.Phys.D: At.Mol.Phys. 4,169 (1985); A.V.Glushkov, L.N.Ivanov, Phys.Lett.A,170, 36 (1992); Preprint of Institute for Specteroscopy of RAS, N AS-2, Troitsk (1992); L.N.Ivanov,E.P.Ivanova, L.V.Knight, Phys.Rev.A 48 4365 (1993); A.V.Glushkov,E.P.Ivanova, J.Quant.Spectr.Rad.Tr.(US) 36,127 (1986); 2. A.V.Glushkov,S.V.Malin etal, Bound Vol. Paris-Meudon Observ.,1995; J.Techn.Phys. 38 211, 219 (1997); In: New projects and new lines of research in nuclear physics. Eds. G.Fazio and F.Hanappe, Singapore : World Scientific.-2003.- P.242-250 ; Int.J.Quant.Chem. 99, 889 (2004); 104, 512 (2005). 3. V.I.Gol'dansky, Physical Chemistry of Positron and Positronium.-N.-Y., 1976;S.A.Kaplan, V.N.Tsytoivich, Plasma astrophysics.-Moscow, 1987; V.I.Gol'dansky, V.S.Letokhov, JETP 67, 533 (1974).

  17. Analysis and design of a second-order digital phase-locked loop

    NASA Technical Reports Server (NTRS)

    Blasche, P. R.

    1979-01-01

    A specific second-order digital phase-locked loop (DPLL) was modeled as a first-order Markov chain with alternatives. From the matrix of transition probabilities of the Markov chain, the steady-state phase error of the DPLL was determined. In a similar manner the loop's response was calculated for a fading input. Additionally, a hardware DPLL was constructed and tested to provide a comparison to the results obtained from the Markov chain model. In all cases tested, good agreement was found between the theoretical predictions and the experimental data.

  18. Enhancement of Markov chain model by integrating exponential smoothing: A case study on Muslims marriage and divorce

    NASA Astrophysics Data System (ADS)

    Jamaluddin, Fadhilah; Rahim, Rahela Abdul

    2015-12-01

    Markov Chain has been introduced since the 1913 for the purpose of studying the flow of data for a consecutive number of years of the data and also forecasting. The important feature in Markov Chain is obtaining the accurate Transition Probability Matrix (TPM). However to obtain the suitable TPM is hard especially in involving long-term modeling due to unavailability of data. This paper aims to enhance the classical Markov Chain by introducing Exponential Smoothing technique in developing the appropriate TPM.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Donangelo, R.J.

    An integral representation for the classical limit of the quantum mechanical S-matrix is developed and applied to heavy-ion Coulomb excitation and Coulomb-nuclear interference. The method combines the quantum principle of superposition with exact classical dynamics to describe the projectile-target system. A detailed consideration of the classical trajectories and of the dimensionless parameters that characterize the system is carried out. The results are compared, where possible, to exact quantum mechanical calculations and to conventional semiclassical calculations. It is found that in the case of backscattering the classical limit S-matrix method is able to almost exactly reproduce the quantum-mechanical S-matrix elements, andmore » therefore the transition probabilities, even for projectiles as light as protons. The results also suggest that this approach should be a better approximation for heavy-ion multiple Coulomb excitation than earlier semiclassical methods, due to a more accurate description of the classical orbits in the electromagnetic field of the target nucleus. Calculations using this method indicate that the rotational excitation probabilities in the Coulomb-nuclear interference region should be very sensitive to the details of the potential at the surface of the nucleus, suggesting that heavy-ion rotational excitation could constitute a sensitive probe of the nuclear potential in this region. The application to other problems as well as the present limits of applicability of the formalism are also discussed.« less

  20. Wetting-Dewetting and Dispersion-Aggregation Transitions Are Distinct for Polymer Grafted Nanoparticles in Chemically Dissimilar Polymer Matrix.

    PubMed

    Martin, Tyler B; Mongcopa, Katrina Irene S; Ashkar, Rana; Butler, Paul; Krishnamoorti, Ramanan; Jayaraman, Arthi

    2015-08-26

    Simulations and experiments are conducted on mixtures containing polymer grafted nanoparticles in a chemically distinct polymer matrix, where the graft and matrix polymers exhibit attractive enthalpic interactions at low temperatures that become progressively repulsive as temperature is increased. Both coarse-grained molecular dynamics simulations, and X-ray scattering and neutron scattering experiments with deuterated polystyrene (dPS) grafted silica and poly(vinyl methyl ether) PVME matrix show that the sharp phase transition from (mixed) dispersed to (demixed) aggregated morphologies due to the increasingly repulsive effective interactions between the blend components is distinct from the continuous wetting-dewetting transition. Strikingly, this is unlike the extensively studied chemically identical graft-matrix composites, where the two transitions have been considered to be synonymous, and is also unlike the free (ungrafted) blends of the same graft and matrix homopolymers, where the wetting-dewetting is a sharp transition coinciding with the macrophase separation.

  1. Exact results for models of multichannel quantum nonadiabatic transitions

    DOE PAGES

    Sinitsyn, N. A.

    2014-12-11

    We consider nonadiabatic transitions in explicitly time-dependent systems with Hamiltonians of the form Hˆ(t)=Aˆ+Bˆt+Cˆ/t, where t is time and Aˆ,Bˆ,Cˆ are Hermitian N × N matrices. We show that in any model of this type, scattering matrix elements satisfy nontrivial exact constraints that follow from the absence of the Stokes phenomenon for solutions with specific conditions at t→–∞. This allows one to continue such solutions analytically to t→+∞, and connect their asymptotic behavior at t→–∞ and t→+∞. This property becomes particularly useful when a model shows additional discrete symmetries. Specifically, we derive a number of simple exact constraints and explicitmore » expressions for scattering probabilities in such systems.« less

  2. Prevalence and co-occurrence of addictive behaviors among former alternative high school youth: A longitudinal follow-up study

    PubMed Central

    Sussman, Steve; Pokhrel, Pallav; Sun, Ping; Rohrbach, Louise A.; Spruijt-Metz, Donna

    2015-01-01

    Background and Aims Recent work has studied addictions using a matrix measure, which taps multiple addictions through single responses for each type. This is the first longitudinal study using a matrix measure. Methods We investigated the use of this approach among former alternative high school youth (average age = 19.8 years at baseline; longitudinal n = 538) at risk for addictions. Lifetime and last 30-day prevalence of one or more of 11 addictions reviewed in other work was the primary focus (i.e., cigarettes, alcohol, hard drugs, shopping, gambling, Internet, love, sex, eating, work, and exercise). These were examined at two time-points one year apart. Latent class and latent transition analyses (LCA and LTA) were conducted in Mplus. Results Prevalence rates were stable across the two time-points. As in the cross-sectional baseline analysis, the 2-class model (addiction class, non-addiction class) fit the data better at follow-up than models with more classes. Item-response or conditional probabilities for each addiction type did not differ between time-points. As a result, the LTA model utilized constrained the conditional probabilities to be equal across the two time-points. In the addiction class, larger conditional probabilities (i.e., 0.40−0.49) were found for love, sex, exercise, and work addictions; medium conditional probabilities (i.e., 0.17−0.27) were found for cigarette, alcohol, other drugs, eating, Internet and shopping addiction; and a small conditional probability (0.06) was found for gambling. Discussion and Conclusions Persons in an addiction class tend to remain in this addiction class over a one-year period. PMID:26551909

  3. Random walks with long-range steps generated by functions of Laplacian matrices

    NASA Astrophysics Data System (ADS)

    Riascos, A. P.; Michelitsch, T. M.; Collet, B. A.; Nowakowski, A. F.; Nicolleau, F. C. G. A.

    2018-04-01

    In this paper, we explore different Markovian random walk strategies on networks with transition probabilities between nodes defined in terms of functions of the Laplacian matrix. We generalize random walk strategies with local information in the Laplacian matrix, that describes the connections of a network, to a dynamic determined by functions of this matrix. The resulting processes are non-local allowing transitions of the random walker from one node to nodes beyond its nearest neighbors. We find that only two types of Laplacian functions are admissible with distinct behaviors for long-range steps in the infinite network limit: type (i) functions generate Brownian motions, type (ii) functions Lévy flights. For this asymptotic long-range step behavior only the lowest non-vanishing order of the Laplacian function is relevant, namely first order for type (i), and fractional order for type (ii) functions. In the first part, we discuss spectral properties of the Laplacian matrix and a series of relations that are maintained by a particular type of functions that allow to define random walks on any type of undirected connected networks. Once described general properties, we explore characteristics of random walk strategies that emerge from particular cases with functions defined in terms of exponentials, logarithms and powers of the Laplacian as well as relations of these dynamics with non-local strategies like Lévy flights and fractional transport. Finally, we analyze the global capacity of these random walk strategies to explore networks like lattices and trees and different types of random and complex networks.

  4. Plant calendar pattern based on rainfall forecast and the probability of its success in Deli Serdang regency of Indonesia

    NASA Astrophysics Data System (ADS)

    Darnius, O.; Sitorus, S.

    2018-03-01

    The objective of this study was to determine the pattern of plant calendar of three types of crops; namely, palawija, rice, andbanana, based on rainfall in Deli Serdang Regency. In the first stage, we forecasted rainfall by using time series analysis, and obtained appropriate model of ARIMA (1,0,0) (1,1,1)12. Based on the forecast result, we designed a plant calendar pattern for the three types of plant. Furthermore, the probability of success in the plant types following the plant calendar pattern was calculated by using the Markov process by discretizing the continuous rainfall data into three categories; namely, Below Normal (BN), Normal (N), and Above Normal (AN) to form the probability transition matrix. Finally, the combination of rainfall forecasting models and the Markov process were used to determine the pattern of cropping calendars and the probability of success in the three crops. This research used rainfall data of Deli Serdang Regency taken from the office of BMKG (Meteorologist Climatology and Geophysics Agency), Sampali Medan, Indonesia.

  5. Modeling Driver Behavior near Intersections in Hidden Markov Model

    PubMed Central

    Li, Juan; He, Qinglian; Zhou, Hang; Guan, Yunlin; Dai, Wei

    2016-01-01

    Intersections are one of the major locations where safety is a big concern to drivers. Inappropriate driver behaviors in response to frequent changes when approaching intersections often lead to intersection-related crashes or collisions. Thus to better understand driver behaviors at intersections, especially in the dilemma zone, a Hidden Markov Model (HMM) is utilized in this study. With the discrete data processing, the observed dynamic data of vehicles are used for the inference of the Hidden Markov Model. The Baum-Welch (B-W) estimation algorithm is applied to calculate the vehicle state transition probability matrix and the observation probability matrix. When combined with the Forward algorithm, the most likely state of the driver can be obtained. Thus the model can be used to measure the stability and risk of driver behavior. It is found that drivers’ behaviors in the dilemma zone are of lower stability and higher risk compared with those in other regions around intersections. In addition to the B-W estimation algorithm, the Viterbi Algorithm is utilized to predict the potential dangers of vehicles. The results can be applied to driving assistance systems to warn drivers to avoid possible accidents. PMID:28009838

  6. Symmetry of Isoscalar Matrix Elements and Systematics in the sd and beginning of fp shells

    NASA Astrophysics Data System (ADS)

    Orce, J. N.; Petkov, P.; Velázquez, V.; McKay, C. J.; Lesher, S. R.; Choudry, S.; Mynk, M.; Linnemann, A.; Jolie, J.; von Brentano, P.; Werner, V.; Yates, S. W.; McEllistrem, M. T.

    2006-03-01

    A careful determination of the lifetime and measurement of the branching ratio for decay of the first 2T=1+ state in 42Sc has allowed an accurate experimental test of charge independence in the A = 42 isobaric triplet. A lifetime of 69(17) fs was measured at the University of Kentucky, while relative intensities for the 975 keV and 1586 keV transitions depopulating the first 2T=1+ state have been determined at the University of Cologne as 100(1) and 8(1), respectively. Both measurements give an isoscalar matrix element, M0, of 6.4(9) (W.u.)1/2. This result confirms charge independence for the A=42 isobaric triplet. Shell model calculations have been carried out for understanding the global trend of M0 values for A = 4n + 2 isobaric triplets ranging from A = 18 to A = 42. The 21 (T=1)+ → 01 (T=1)+ transition energies, reduced transition probabilities and M0 values are reproduced to a high degree of accuracy. The trend of M0 strength along the sd shell is interpreted in terms of the shell structure. Certain discrepancies arise at the extremes of the sd shell, for the A = 18 and A = 38 isobaric triplets, which might be explained in terms of the low valence space at the extremes of the sd shell.

  7. Avoided crossings: A study of the nonadiabatic transition probabilities

    NASA Astrophysics Data System (ADS)

    Desouter-Lecomte, M.; Leyh-Nihant, B.; Praet, M. T.; Lorquet, J. C.

    1987-06-01

    An approximate solution to the problem of constructing a pair of diabatic states exists only if certain requirements are fulfilled, for example, when the nonadiabatic coupling results from an interaction between two electronic configurations which are doubly excited with respect to one another. It is then possible to build up a model in which the series expansion of the elements of the Hamiltonian matrix is truncated after the first nonzero term. This leads to several conclusions concerning the nonadiabatic transition probability which differentiate conical intersections from avoided crossings. For the latter, the nonadiabatic coupling matrix elements (which are Lorentzians with an area equal to π/2) reach their maximum at the nuclear geometry for which ΔE (the energy gap between adiabatic surfaces) is a minimum. The loci along which the angle θ of the orthogonal transformation which relates adiabatic and diabatic wave functions keeps a constant value are a set of parallel straight lines which coincides with the loci along which ΔE remains constant. This reference direction in the configuration space corresponds to nuclear trajectories which are unable to bring about a nonadiabatic transition. In the case of avoided crossings, there exists only one nuclear degree of freedom which gives rise to surface hopping. Conical intersections, on the other hand, have two such active degrees of freedom. This creates a qualitative difference between the two cases which makes conical intersections more efficient as funnels than avoided crossings. A two-dimensional extension of the Landau-Zener formula is derived for avoided crossings. It contains a factor of anisotropy. It is possible, at least in favorable cases, to extract approximate diabatic quantities from ab initio calculations and to compare them with the predictions of these models. This has been done for two 2A1 electronic states of the CH+2 ion. The results are found to agree with the predictions of the model, at least in a restricted range of internuclear distances.

  8. Combining multistate capture-recapture data with tag recoveries to estimate demographic parameters

    USGS Publications Warehouse

    Kendall, W.L.; Conn, P.B.; Hines, J.E.

    2006-01-01

    Matrix population models that allow an animal to occupy more than one state over time are important tools for population and evolutionary ecologists. Definition of state can vary, including location for metapopulation models and breeding state for life history models. For populations whose members can be marked and subsequently re-encountered, multistate mark-recapture models are available to estimate the survival and transition probabilities needed to construct population models. Multistate models have proved extremely useful in this context, but they often require a substantial amount of data and restrict estimation of transition probabilities to those areas or states subjected to formal sampling effort. At the same time, for many species, there are considerable tag recovery data provided by the public that could be modeled in order to increase precision and to extend inference to a greater number of areas or states. Here we present a statistical model for combining multistate capture-recapture data (e.g., from a breeding ground study) with multistate tag recovery data (e.g., from wintering grounds). We use this method to analyze data from a study of Canada Geese (Branta canadensis) in the Atlantic Flyway of North America. Our analysis produced marginal improvement in precision, due to relatively few recoveries, but we demonstrate how precision could be further improved with increases in the probability that a retrieved tag is reported.

  9. Use of residence time distribution for evaluation of gaseous pollutant volatilization from stored swine manure.

    PubMed

    Liao, C M

    1997-01-01

    A quantification analysis for evaluation of gaseous pollutant volatilization as a result of mass transfer from stored swine manure is presented from the viewpoint of residence time distribution. The method is based on evaluating the moments of concentration vs. time curves of both air and gaseous pollutants. The concept of moments of concentration histories is applicable to characterize the dispersal of the supplied air or gaseous pollutant in a ventilated system. The mean age or residence time of airflow can be calculated from an inverse system state matrix [B]-1 of a linear dynamic equation describing the dynamics of gaseous pollutant in a ventilated airspace. The sum elements in an arbitrary row i in matrix [B]-1 is equal to the mean age of airflow in airspace i. The mean age of gaseous pollutant in airspace i can be obtained from the area under the concentration profile divided by the equilibrium concentration reading in that space caused by gaseous pollutant sources. Matrix [B]-1 can also be represented in terms of the inverse local airflow rate matrix ([W]-1), transition probability matrix ([P]), and air volume matrix ([V]) as, [B]-1 = [W]-1[P][V]. Finally the mean age of airflow in a ventilated airspace can be interpreted by the physical characteristics of matrices [W] and [P]. The practical use of the concepts is also applied in a typical pig unit.

  10. Excitation rate coefficients and line ratios for the optical and ultraviolet transitions in S II

    NASA Technical Reports Server (NTRS)

    Cai, Wei; Pradhan, Anil K.

    1993-01-01

    New calculations are reported for electron excitation collision strengths, rate coefficients, transition probabilities, and line ratios for the astrophysically important optical and UV lines in S II. The collision strengths are calculated in the close coupling approximation using the R-matrix method. The present calculations are more extensive than previous ones, including all transitions among the 12 lowest LS terms and the corresponding 28 fine-structure levels in the collisional-radiative model for S II. While the present rate coefficients for electron impact excitation are within 10-30 percent of the previous values for the low-lying optical transitions employed as density diagnostics of H II regions and nebulae, the excitation rates for the UV transitions 4S super 0 sub 3/2 - 4Psub 1/2,3/2,5/2 differ significantly from earlier calculations, by up to factor of 2. We describe temperature and density sensitive flux ratios for a number of UV lines. The present UV results are likely to be of interest in a more accurate interpretation of S II emission from the Io plasma torus in the magnetosphere of Jupiter, as well as other UV sources observed from the IUE, ASTRO 1, and the HST.

  11. Generating constrained randomized sequences: item frequency matters.

    PubMed

    French, Robert M; Perruchet, Pierre

    2009-11-01

    All experimental psychologists understand the importance of randomizing lists of items. However, randomization is generally constrained, and these constraints-in particular, not allowing immediately repeated items-which are designed to eliminate particular biases, frequently engender others. We describe a simple Monte Carlo randomization technique that solves a number of these problems. However, in many experimental settings, we are concerned not only with the number and distribution of items but also with the number and distribution of transitions between items. The algorithm mentioned above provides no control over this. We therefore introduce a simple technique that uses transition tables for generating correctly randomized sequences. We present an analytic method of producing item-pair frequency tables and item-pair transitional probability tables when immediate repetitions are not allowed. We illustrate these difficulties and how to overcome them, with reference to a classic article on word segmentation in infants. Finally, we provide free access to an Excel file that allows users to generate transition tables with up to 10 different item types, as well as to generate appropriately distributed randomized sequences of any length without immediately repeated elements. This file is freely available from http://leadserv.u-bourgogne.fr/IMG/xls/TransitionMatrix.xls.

  12. Effects of tour boats on dolphin activity examined with sensitivity analysis of Markov chains.

    PubMed

    Dans, Silvana Laura; Degrati, Mariana; Pedraza, Susana Noemí; Crespo, Enrique Alberto

    2012-08-01

    In Patagonia, Argentina, watching dolphins, especially dusky dolphins (Lagenorhynchus obscurus), is a new tourist activity. Feeding time decreases and time to return to feeding after feeding is abandoned and time it takes a group of dolphins to feed increase in the presence of boats. Such effects on feeding behavior may exert energetic costs on dolphins and thus reduce an individual's survival and reproductive capacity or maybe associated with shifts in distribution. We sought to predict which behavioral changes modify the activity pattern of dolphins the most. We modeled behavioral sequences of dusky dolphins with Markov chains. We calculated transition probabilities from one activity to another and arranged them in a stochastic matrix model. The proportion of time dolphins dedicated to a given activity (activity budget) and the time it took a dolphin to resume that activity after it had been abandoned (recurrence time) were calculated. We used a sensitivity analysis of Markov chains to calculate the sensitivity of the time budget and the activity-resumption time to changes in behavioral transition probabilities. Feeding-time budget was most sensitive to changes in the probability of dolphins switching from traveling to feeding behavior and of maintaining feeding behavior. Thus, an increase in these probabilities would be associated with the largest reduction in the time dedicated to feeding. A reduction in the probability of changing from traveling to feeding would also be associated with the largest increases in the time it takes dolphins to resume feeding. To approach dolphins when they are traveling would not affect behavior less because presence of the boat may keep dolphins from returning to feeding. Our results may help operators of dolphin-watching vessels minimize negative effects on dolphins. ©2012 Society for Conservation Biology.

  13. Phase transitions in the distribution of the Andreev conductance of superconductor-metal junctions with multiple transverse modes.

    PubMed

    Damle, Kedar; Majumdar, Satya N; Tripathi, Vikram; Vivo, Pierpaolo

    2011-10-21

    We compute analytically the full distribution of Andreev conductance G(NS) of a metal-superconductor interface with a large number N(c) of transverse modes, using a random matrix approach. The probability distribution P(G(NS),N(c) in the limit of large N(c) displays a Gaussian behavior near the average value =(2-√2)N(c) and asymmetric power-law tails in the two limits of very small and very large G(NS). In addition, we find a novel third regime sandwiched between the central Gaussian peak and the power-law tail for large G(NS). Weakly nonanalytic points separate these four regimes-these are shown to be consequences of three phase transitions in an associated Coulomb gas problem. © 2011 American Physical Society

  14. Adapting Covariance Propagation to Account for the Presence of Modeled and Unmodeled Maneuvers

    NASA Technical Reports Server (NTRS)

    Schiff, Conrad

    2006-01-01

    This paper explores techniques that can be used to adapt the standard linearized propagation of an orbital covariance matrix to the case where there is a maneuver and an associated execution uncertainty. A Monte Carlo technique is used to construct a final orbital covariance matrix for a 'prop-burn-prop' process that takes into account initial state uncertainty and execution uncertainties in the maneuver magnitude. This final orbital covariance matrix is regarded as 'truth' and comparisons are made with three methods using modified linearized covariance propagation. The first method accounts for the maneuver by modeling its nominal effect within the state transition matrix but excludes the execution uncertainty by omitting a process noise matrix from the computation. The second method does not model the maneuver but includes a process noise matrix to account for the uncertainty in its magnitude. The third method, which is essentially a hybrid of the first two, includes the nominal portion of the maneuver via the state transition matrix and uses a process noise matrix to account for the magnitude uncertainty. The first method is unable to produce the final orbit covariance except in the case of zero maneuver uncertainty. The second method yields good accuracy for the final covariance matrix but fails to model the final orbital state accurately. Agreement between the simulated covariance data produced by this method and the Monte Carlo truth data fell within 0.5-2.5 percent over a range of maneuver sizes that span two orders of magnitude (0.1-20 m/s). The third method, which yields a combination of good accuracy in the computation of the final covariance matrix and correct accounting for the presence of the maneuver in the nominal orbit, is the best method for applications involving the computation of times of closest approach and the corresponding probability of collision, PC. However, applications for the two other methods exist and are briefly discussed. Although the process model ("prop-burn-prop") that was studied is very simple - point-mass gravitational effects due to the Earth combined with an impulsive delta-V in the velocity direction for the maneuver - generalizations to more complex scenarios, including high fidelity force models, finite duration maneuvers, and maneuver pointing errors, are straightforward and are discussed in the conclusion.

  15. Location Prediction Based on Transition Probability Matrices Constructing from Sequential Rules for Spatial-Temporal K-Anonymity Dataset

    PubMed Central

    Liu, Zhao; Zhu, Yunhong; Wu, Chenxue

    2016-01-01

    Spatial-temporal k-anonymity has become a mainstream approach among techniques for protection of users’ privacy in location-based services (LBS) applications, and has been applied to several variants such as LBS snapshot queries and continuous queries. Analyzing large-scale spatial-temporal anonymity sets may benefit several LBS applications. In this paper, we propose two location prediction methods based on transition probability matrices constructing from sequential rules for spatial-temporal k-anonymity dataset. First, we define single-step sequential rules mined from sequential spatial-temporal k-anonymity datasets generated from continuous LBS queries for multiple users. We then construct transition probability matrices from mined single-step sequential rules, and normalize the transition probabilities in the transition matrices. Next, we regard a mobility model for an LBS requester as a stationary stochastic process and compute the n-step transition probability matrices by raising the normalized transition probability matrices to the power n. Furthermore, we propose two location prediction methods: rough prediction and accurate prediction. The former achieves the probabilities of arriving at target locations along simple paths those include only current locations, target locations and transition steps. By iteratively combining the probabilities for simple paths with n steps and the probabilities for detailed paths with n-1 steps, the latter method calculates transition probabilities for detailed paths with n steps from current locations to target locations. Finally, we conduct extensive experiments, and correctness and flexibility of our proposed algorithm have been verified. PMID:27508502

  16. A theoretical approach to the photochemical activation of matrix isolated aluminum atoms and their reaction with methane

    NASA Astrophysics Data System (ADS)

    Pacheco-Blas, M. A.; Novaro, O. A.; Pacheco-Sánchez, J. H.

    2010-11-01

    The photochemical activation of Al atoms in cryogenic matrices to induce their reaction with methane has been experimentally studied before. Here, a theoretical study of the nonadiabatic transition probabilities for the ground (P2:3s23p1) and the lowest excited states (S2:3s24s1 and D2:3s23d1) of an aluminum atom interacting with a methane molecule (CH4) was carried out through ab initio Hartree-Fock self-consistent field calculations. This was followed by a multiconfigurational study of the correlation energy obtained by extensive variational and perturbational configuration interaction analyses using the CIPSI program. The D2 state is readily inserted into a C-H bond, this being a prelude to a sequence of avoided crossings with the initially repulsive (to CH4) lower lying states P2 and S2. We then use a direct extension of the Landau-Zener theory to obtain transition probabilities at each avoided crossing, allowing the formation of an HAlCH3 intermediate that eventually leads to the final pair of products H+AlCH3 and HAl+CH3.

  17. Transition probability spaces in loop quantum gravity

    NASA Astrophysics Data System (ADS)

    Guo, Xiao-Kan

    2018-03-01

    We study the (generalized) transition probability spaces, in the sense of Mielnik and Cantoni, for spacetime quantum states in loop quantum gravity. First, we show that loop quantum gravity admits the structures of transition probability spaces. This is exemplified by first checking such structures in covariant quantum mechanics and then identifying the transition probability spaces in spin foam models via a simplified version of general boundary formulation. The transition probability space thus defined gives a simple way to reconstruct the discrete analog of the Hilbert space of the canonical theory and the relevant quantum logical structures. Second, we show that the transition probability space and in particular the spin foam model are 2-categories. Then we discuss how to realize in spin foam models two proposals by Crane about the mathematical structures of quantum gravity, namely, the quantum topos and causal sites. We conclude that transition probability spaces provide us with an alternative framework to understand various foundational questions of loop quantum gravity.

  18. Rupture in cemented granular media: application to wheat endosperm

    NASA Astrophysics Data System (ADS)

    Topin, V.; Delenne, J.-Y.; Radjai, F.

    2009-06-01

    The mechanical origin of the wheat hardness used to classify wheat flours is an open issue. Wheat endosperm can be considered as a cemented granular material, consisting of densely packed solid particles (the starch granules) and a pore-filling solid matrix (the protein) sticking to the particles. We use the lattice element method to investigate cemented granular materials with a texture close to that of wheat endosperm and with variable matrix volume fraction and particle-matrix adherence. From the shape of the probability density of vertical stresses we distinguish weak, intermediate and strong stresses. The large stresses occur mostly at the contact zones as in noncohesive granular media with a decreasing exponential distribution. The weak forces reflect the arching effect. The intermediate stresses belong mostly to the bulk of the particles and their distribution is well fit to a Gaussian distribution. We also observe that the stress chains are essentially guided by the cementing matrix in tension and by the particulate backbone in compression. Crack formation is analyzed in terms of particle damage as a function of matrix volume fraction and particle-matrix adherence. Our data provide evidence for three regimes of crack propagation depending on the crack path through the material. We find that particle damage scales well with the relative toughness of the particle-matrix interface. The interface toughness appears therefore to be strongly correlated with particle damage and determines transition from soft to hard behavior in wheat endosperm.

  19. Estimation of State Transition Probabilities: A Neural Network Model

    NASA Astrophysics Data System (ADS)

    Saito, Hiroshi; Takiyama, Ken; Okada, Masato

    2015-12-01

    Humans and animals can predict future states on the basis of acquired knowledge. This prediction of the state transition is important for choosing the best action, and the prediction is only possible if the state transition probability has already been learned. However, how our brains learn the state transition probability is unknown. Here, we propose a simple algorithm for estimating the state transition probability by utilizing the state prediction error. We analytically and numerically confirmed that our algorithm is able to learn the probability completely with an appropriate learning rate. Furthermore, our learning rule reproduced experimentally reported psychometric functions and neural activities in the lateral intraparietal area in a decision-making task. Thus, our algorithm might describe the manner in which our brains learn state transition probabilities and predict future states.

  20. Uncertainties in nuclear transition matrix elements for neutrinoless {beta}{beta} decay

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rath, P. K.

    Uncertainties in nuclear transition matrix elements M{sup (0{nu})} and M{sub N}{sup (0{nu})} due to the exchange of light and heavy Majorana neutrinos, respectively have been estimated by calculating sets of twelve nuclear transition matrix elements for the neutrinoless {beta}{beta} decay of {sup 94,96}Zr, {sup 98,100}Mo, {sup 104}Ru, {sup 110}Pd, {sup 128,130}Te and {sup 150}Nd isotopes in the case of 0{sup +}{yields}0{sup +} transition by considering four different parameterizations of a Hamiltonian with pairing plus multipolar effective two-body interaction and three different parameterizations of Jastrow short range correlations. Exclusion of nuclear transition matrix elements calculated with the Miller-Spencer parametrization reduces themore » uncertainties by 10%-15%.« less

  1. Influence of gamma irradiation on carbon nanotube-reinforced polypropylene.

    PubMed

    Castell, P; Medel, F J; Martinez, M T; Puértolas, J A

    2009-10-01

    Single walled carbon nanotubes (SWNT) have been incorporated into a polypropylene (PP) matrix in different concentrations (range: 0.25-2.5 wt%). The nanotubes were blended with PP particles (approximately 500 microm in size) before mixing in an extruder. Finally, rectangular plates were obtained by compression moulding. PP-SWNT composites were gamma irradiated at different doses, 10 and 20 kGy, to promote crosslinking in the matrix and potentially enhance the interaction between nanotubes and PP. Extensive thermal, structural and mechanical characterization was conducted by means of DSC, X-ray diffraction, Raman spectroscopy, uniaxial tensile tests and dynamic mechanical thermal (DMTA) techniques. DSC thermograms reflected higher crystallinity with increasing nanotube concentration. XRD analysis confirmed the only presence of a monoclinic crystals and proved unambiguously that CNTs generated a preferred orientation. Raman spectroscopy confirmed that the intercalation of the polymer between bundles is favored at low CNTs contents. Elastic modulus results confirmed the reinforcement of the polypropylene matrix with increasing SWNT concentration, although stiffness saturation was observed at the highest concentration. Loss tangent DMTA curves showed three transitions for raw polypropylene. While gamma relaxation remained practically unchanged in all the samples, beta relaxation temperatures showed an increase with increasing CNT content due to the reduced mobility of the system. Gamma-irradiated PP exhibited an increase in the beta relaxation temperature, associated with changes in glass transition due to radiation-induced crosslinking. On the contrary, gamma-irradiated nanocomposites did not show this effect probably due to the reaction of radiative free radicals with CNTs.

  2. An Analytical State Transition Matrix for Orbits Perturbed by an Oblate Spheroid

    NASA Technical Reports Server (NTRS)

    Mueller, A. C.

    1977-01-01

    An analytical state transition matrix and its inverse, which include the short period and secular effects of the second zonal harmonic, were developed from the nonsingular PS satellite theory. The fact that the independent variable in the PS theory is not time is in no respect disadvantageous, since any explicit analytical solution must be expressed in the true or eccentric anomaly. This is shown to be the case for the simple conic matrix. The PS theory allows for a concise, accurate, and algorithmically simple state transition matrix. The improvement over the conic matrix ranges from 2 to 4 digits accuracy.

  3. The Plausibility of a String Quartet Performance in Virtual Reality.

    PubMed

    Bergstrom, Ilias; Azevedo, Sergio; Papiotis, Panos; Saldanha, Nuno; Slater, Mel

    2017-04-01

    We describe an experiment that explores the contribution of auditory and other features to the illusion of plausibility in a virtual environment that depicts the performance of a string quartet. 'Plausibility' refers to the component of presence that is the illusion that the perceived events in the virtual environment are really happening. The features studied were: Gaze (the musicians ignored the participant, the musicians sometimes looked towards and followed the participant's movements), Sound Spatialization (Mono, Stereo, Spatial), Auralization (no sound reflections, reflections corresponding to a room larger than the one perceived, reflections that exactly matched the virtual room), and Environment (no sound from outside of the room, birdsong and wind corresponding to the outside scene). We adopted the methodology based on color matching theory, where 20 participants were first able to assess their feeling of plausibility in the environment with each of the four features at their highest setting. Then five times participants started from a low setting on all features and were able to make transitions from one system configuration to another until they matched their original feeling of plausibility. From these transitions a Markov transition matrix was constructed, and also probabilities of a match conditional on feature configuration. The results show that Environment and Gaze were individually the most important factors influencing the level of plausibility. The highest probability transitions were to improve Environment and Gaze, and then Auralization and Spatialization. We present this work as both a contribution to the methodology of assessing presence without questionnaires, and showing how various aspects of a musical performance can influence plausibility.

  4. Modeling Drinking Behavior Progression in Youth: a Non-identified Probability Discrete Event System Using Cross-sectional Data

    PubMed Central

    Hu, Xingdi; Chen, Xinguang; Cook, Robert L.; Chen, Ding-Geng; Okafor, Chukwuemeka

    2016-01-01

    Background The probabilistic discrete event systems (PDES) method provides a promising approach to study dynamics of underage drinking using cross-sectional data. However, the utility of this approach is often limited because the constructed PDES model is often non-identifiable. The purpose of the current study is to attempt a new method to solve the model. Methods A PDES-based model of alcohol use behavior was developed with four progression stages (never-drinkers [ND], light/moderate-drinker [LMD], heavy-drinker [HD], and ex-drinker [XD]) linked with 13 possible transition paths. We tested the proposed model with data for participants aged 12–21 from the 2012 National Survey on Drug Use and Health (NSDUH). The Moore-Penrose (M-P) generalized inverse matrix method was applied to solve the proposed model. Results Annual transitional probabilities by age groups for the 13 drinking progression pathways were successfully estimated with the M-P generalized inverse matrix approach. Result from our analysis indicates an inverse “J” shape curve characterizing pattern of experimental use of alcohol from adolescence to young adulthood. We also observed a dramatic increase for the initiation of LMD and HD after age 18 and a sharp decline in quitting light and heavy drinking. Conclusion Our findings are consistent with the developmental perspective regarding the dynamics of underage drinking, demonstrating the utility of the M-P method in obtaining a unique solution for the partially-observed PDES drinking behavior model. The M-P approach we tested in this study will facilitate the use of the PDES approach to examine many health behaviors with the widely available cross-sectional data. PMID:26511344

  5. Transition probabilities of Ce I obtained from Boltzmann analysis of visible and near-infrared emission spectra

    NASA Astrophysics Data System (ADS)

    Nitz, D. E.; Curry, J. J.; Buuck, M.; DeMann, A.; Mitchell, N.; Shull, W.

    2018-02-01

    We report radiative transition probabilities for 5029 emission lines of neutral cerium within the wavelength range 417-1110 nm. Transition probabilities for only 4% of these lines have been previously measured. These results are obtained from a Boltzmann analysis of two high resolution Fourier transform emission spectra used in previous studies of cerium, obtained from the digital archives of the National Solar Observatory at Kitt Peak. The set of transition probabilities used for the Boltzmann analysis are those published by Lawler et al (2010 J. Phys. B: At. Mol. Opt. Phys. 43 085701). Comparisons of branching ratios and transition probabilities for lines common to the two spectra provide important self-consistency checks and test for the presence of self-absorption effects. Estimated 1σ uncertainties for our transition probability results range from 10% to 18%.

  6. Transition and Electron Impact Excitation Collision Rates for O III

    NASA Astrophysics Data System (ADS)

    Tayal, S. S.; Zatsarinny, O.

    2017-12-01

    Transition probabilities, electron excitation collision strengths, and rate coefficients for a large number of O III lines over a broad wavelength range, from the infrared to ultraviolet, have been reported. The collision strengths have been calculated in the close-coupling approximation using the B-spline Breit-Pauli R-matrix method. The multiconfiguration Hartree-Fock method in combination with B-spline expansions is employed for an accurate representation of the target wave functions. The close-coupling expansion contains 202 O2+ fine-structure levels of the 2{s}22{p}2,2s2{p}3, 2{p}4,2{s}22p3s,3p,3d, 4s,4p,4d,4f,5s, and 2s2{p}33s,3p,3d configurations. The effective collision strengths are obtained by averaging electron excitation collision strengths over a Maxwellian distribution of velocities at electron temperatures ranging from 100 to 100,000 K. The calculated effective collision strengths have been reported for the 20,302 transitions between all 202 fine-structure levels. There is an overall good agreement with the recent R-matrix calculations by Storey et al. for the transitions between all levels of the ground 2{s}22{p}2 configuration, but significant discrepancies have been found with Palay et al. for transitions to the 2{s}22{p}2 1 S 0 level. Line intensity ratios between the optical lines arising from the 2{s}22{p}2{}3{P}{0,1,2} - 1 D 2 transitions have been compared with other calculations and observations from the photoionized gaseous nebulae, and good agreement is found. The present calculations provide the most complete and accurate data sets, which should allow a more detailed treatment of the available measured spectra from different ground and space observatories.

  7. Site-percolation threshold of carbon nanotube fibers-Fast inspection of percolation with Markov stochastic theory

    NASA Astrophysics Data System (ADS)

    Xu, Fangbo; Xu, Zhiping; Yakobson, Boris I.

    2014-08-01

    We present a site-percolation model based on a modified FCC lattice, as well as an efficient algorithm of inspecting percolation which takes advantage of the Markov stochastic theory, in order to study the percolation threshold of carbon nanotube (CNT) fibers. Our Markov-chain based algorithm carries out the inspection of percolation by performing repeated sparse matrix-vector multiplications, which allows parallelized computation to accelerate the inspection for a given configuration. With this approach, we determine that the site-percolation transition of CNT fibers occurs at pc=0.1533±0.0013, and analyze the dependence of the effective percolation threshold (corresponding to 0.5 percolation probability) on the length and the aspect ratio of a CNT fiber on a finite-size-scaling basis. We also discuss the aspect ratio dependence of percolation probability with various values of p (not restricted to pc).

  8. Fine structure transitions in Fe XIV

    NASA Astrophysics Data System (ADS)

    Nahar, Sultana N.

    2013-07-01

    Results are reported for Fe XIV energy levels and transitions obtained from the ab initio relativistic Breit-Pauli R-matrix (BPRM) method. BPRM method developed under the Iron Project is capable of calculating very large number of fine structure energy levels and corresponding transitions. However, unlike in the atomic structure calculations, where levels are identified spectroscopically based on the leading percentage contributions of configurations, BPRM is incapable of such identification of the levels and hence the transitions. The main reason for it is that the percentage contributions can not be determined exactly from the large number of channels in the R-matrix space. The present report describes an identification method that uses considerations of quantum defects of channels, contributions of channel from outer regions, Hund's rule, and angular momenta algebra for addition and completeness of fine structure components. The present calculations are carried out using a close coupling wave function expansion that included 26 core excitations from configurations 2s22p63s2, 2s22p63s3p,2s22p63p2,2s22p63s3d, and 2s22p63p3d. A total of 1002 fine structure levels with n ⩽ 10, l⩽9, and 0.5 ⩽J⩽ 9.5 with even and odd parities and the corresponding 130,520 electric dipole allowed (E1) fine structure transitions, a most complete set for astrophysical modelings of spectral analysis and opacities, is presented. Large number of new energy levels are found and identified. The energies agree very well, mostly in less than 1% with the highest being 1.9%, with the 68 observed fine structure levels. While the high lying levels may have some uncertainty, an overall accuracy of energy levels should be within 10%. BPRM transitions have been benchmarked with the existing most accurate calculated transition probabilities with very good agreement for most cases. Based on the accuracy of the method and comparisons, most of the transitions can be rated with A (⩽10%) to C (⩽30%).

  9. Laser transit anemometer software development program

    NASA Technical Reports Server (NTRS)

    Abbiss, John B.

    1989-01-01

    Algorithms were developed for the extraction of two components of mean velocity, standard deviation, and the associated correlation coefficient from laser transit anemometry (LTA) data ensembles. The solution method is based on an assumed two-dimensional Gaussian probability density function (PDF) model of the flow field under investigation. The procedure consists of transforming the data ensembles from the data acquisition domain (consisting of time and angle information) to the velocity space domain (consisting of velocity component information). The mean velocity results are obtained from the data ensemble centroid. Through a least squares fitting of the transformed data to an ellipse representing the intersection of a plane with the PDF, the standard deviations and correlation coefficient are obtained. A data set simulation method is presented to test the data reduction process. Results of using the simulation system with a limited test matrix of input values is also given.

  10. Solution to urn models of pairwise interaction with application to social, physical, and biological sciences

    NASA Astrophysics Data System (ADS)

    Pickering, William; Lim, Chjan

    2017-07-01

    We investigate a family of urn models that correspond to one-dimensional random walks with quadratic transition probabilities that have highly diverse applications. Well-known instances of these two-urn models are the Ehrenfest model of molecular diffusion, the voter model of social influence, and the Moran model of population genetics. We also provide a generating function method for diagonalizing the corresponding transition matrix that is valid if and only if the underlying mean density satisfies a linear differential equation and express the eigenvector components as terms of ordinary hypergeometric functions. The nature of the models lead to a natural extension to interaction between agents in a general network topology. We analyze the dynamics on uncorrelated heterogeneous degree sequence networks and relate the convergence times to the moments of the degree sequences for various pairwise interaction mechanisms.

  11. Immunocytochemical and autoradiographic studies on the process of keratinization in avian epidermis suggests absence of keratohyalin.

    PubMed

    Alibardi, Lorenzo

    2004-02-01

    The process of keratinization in apteric avian epidermis and in scutate scales of some avian species has been studied by autoradiography for histidine and immunohistochemistry for keratins and other epidermal proteins. Acidic or basic alpha-keratins are present in basal, spinosus, and transitional layers, but are not seen in the corneous layer. Keratinization-specific alpha-keratins (AE2-positive) are observed in the corneous layer of apteric epidermis but not in that of scutate scales, which contain mainly beta-keratin. Alpha-keratin bundles accumulate along the plasma membrane of transitional cells of apteric epidermis. In contrast to the situation in scutate scales, in the transitional layer and in the lowermost part of the corneous layer of apteric epidermis, filaggrin-like, loricrin-like, and transglutaminase immunoreactivities are present. The lack of isopeptide bond immunoreactivity suggests that undetectable isopeptide bonds are present in avian keratinocytes. Using immunogold ultrastructural immunocytochemistry a low but localized loricrin-like and, less, filaggrin-like labeling is seen over round-oval granules or vesicles among keratin bundles of upper spinosus and transitional keratinocytes of apteric epidermis. Filaggrin-and loricrin-labeling are absent in alpha-keratin bundles localized along the plasma membrane and in the corneous layer, formerly considered keratohyalin. Using ultrastructural autoradiography for tritiated histidine, occasional trace grains are seen among these alpha-keratin bundles. A different mechanism of redistribution of matrix and corneous cell envelope proteins probably operates in avian keratinocytes as compared to that of mammals. Keratin bundles are compacted around the lipid-core of apteric epidermis keratinocytes, which do not form complex chemico/mechanical-resistant corneous cell envelopes as in mammalian keratinocytes. These observations suggest that low amounts of matrix proteins are present among keratin bundles of avian keratinocytes and that keratohyalin granules are absent. Copyright 2003 Wiley-Liss, Inc.

  12. New Accurate Oscillator Strengths and Electron Excitation Collision Strengths for N I

    NASA Astrophysics Data System (ADS)

    Tayal, S. S.

    2006-03-01

    The nonorthogonal orbitals technique in a multiconfiguration Hartree-Fock approach is used to calculate oscillator strengths and transition probabilities of N I lines. The relativistic effects are allowed by means of Breit-Pauli operators. The length and velocity forms of oscillator strengths show good agreement for most transitions. The B-spline R-matrix with pseudostates approach has been used to calculate electron excitation collision strengths and rates. The nonorthogonal orbitals are used for an accurate description of both target wave functions and the R-matrix basis functions. The 24 spectroscopic bound and autoionizing states together with 15 pseudostates are included in the close-coupling expansion. The collision strengths for transitions between fine-structure levels are calculated by transforming the LS-coupled K-matrices to K-matrices in an intermediate coupling scheme. Thermally averaged collision strengths have been determined by integrating collision strengths over a Maxwellian distribution of electron energies over a temperature range suitable for the modeling of astrophysical plasmas. The oscillator strengths and thermally averaged collision strengths are presented for transitions between the fine-structure levels of the 2s22p3 4So, 2Do, 2Po, 2s2p4 4P, 2s22p23s 4P, and 2P terms and from these levels to the levels of the 2s22p23p 2So, 4Do, 4Po, 4So, 2Do, 2Po, 2s22p23s 2D, 2s22p24s 4P, 2P, 2s22p23d 2P, 4F, 2F, 4P, 4D, and 2D terms. Thermally averaged collision strengths are tabulated over a temperature range from 500 to 50,000 K.

  13. Probability distributions for Markov chain based quantum walks

    NASA Astrophysics Data System (ADS)

    Balu, Radhakrishnan; Liu, Chaobin; Venegas-Andraca, Salvador E.

    2018-01-01

    We analyze the probability distributions of the quantum walks induced from Markov chains by Szegedy (2004). The first part of this paper is devoted to the quantum walks induced from finite state Markov chains. It is shown that the probability distribution on the states of the underlying Markov chain is always convergent in the Cesaro sense. In particular, we deduce that the limiting distribution is uniform if the transition matrix is symmetric. In the case of a non-symmetric Markov chain, we exemplify that the limiting distribution of the quantum walk is not necessarily identical with the stationary distribution of the underlying irreducible Markov chain. The Szegedy scheme can be extended to infinite state Markov chains (random walks). In the second part, we formulate the quantum walk induced from a lazy random walk on the line. We then obtain the weak limit of the quantum walk. It is noted that the current quantum walk appears to spread faster than its counterpart-quantum walk on the line driven by the Grover coin discussed in literature. The paper closes with an outlook on possible future directions.

  14. Twelve years of succession on sandy substrates in a post-mining landscape: a Markov chain analysis.

    PubMed

    Baasch, Annett; Tischew, Sabine; Bruelheide, Helge

    2010-06-01

    Knowledge of succession rates and pathways is crucial for devising restoration strategies for highly disturbed ecosystems such as surface-mined land. As these processes have often only been described in qualitative terms, we used Markov models to quantify transitions between successional stages. However, Markov models are often considered not attractive for some reasons, such as model assumptions (e.g., stationarity in space and time, or the high expenditure of time required to estimate successional transitions in the field). Here we present a solution for converting multivariate ecological time series into transition matrices and demonstrate the applicability of this approach for a data set that resulted from monitoring the succession of sandy dry grassland in a post-mining landscape. We analyzed five transition matrices, four one-step matrices referring to specific periods of transition (1995-1998, 1998-2001, 2001-2004, 2004-2007), and one matrix for the whole study period (stationary model, 1995-2007). Finally, the stationary model was enhanced to a partly time-variable model. Applying the stationary and the time-variable models, we started a prediction well outside our calibration period, beginning with 100% bare soil in 1974 as the known start of the succession, and generated the coverage of 12 predefined vegetation types in three-year intervals. Transitions among vegetation types changed significantly in space and over time. While the probability of colonization was almost constant over time, the replacement rate tended to increase, indicating that the speed of succession accelerated with time or fluctuations became stronger. The predictions of both models agreed surprisingly well with the vegetation data observed more than two decades later. This shows that our dry grassland succession in a post-mining landscape can be adequately described by comparably simple types of Markov models, although some model assumptions have not been fulfilled and within-plot transitions have not been observed with point exactness. The major achievement of our proposed way to convert vegetation time series into transition matrices is the estimation of probability of events--a strength not provided by other frequently used statistical methods in vegetation science.

  15. Dynamic pressurization induces transition of notochordal cells to a mature phenotype while retaining production of important patterning ligands from development

    PubMed Central

    2013-01-01

    Introduction Notochordal cells (NCs) pattern aneural and avascular intervertebral discs (IVDs), and their disappearance, is associated with onset of IVD degeneration. This study induced and characterized the maturation of nucleus pulposus (NP) tissue from a gelatinous NC-rich structure to a matrix-rich structure populated by small NP cells using dynamic pressurization in an ex vivo culture model, and also identified soluble factors from NCs with therapeutic potential. Methods Porcine NC-rich NP tissue was cultured and loaded with hydrostatic pressure (0.5 to 2 MPa at 0.1 Hz for 2 hours) either Daily, for 1 Dose, or Control (no pressurization) groups for up to eight days. Cell phenotype and tissue maturation was characterized with measurements of cell viability, cytomorphology, nitric oxide, metabolic activity, matrix composition, gene expression, and proteomics. Results Daily pressurization induced transition of NCs to small NP cells with 73.8%, 44%, and 28% NCs for Control, 1 Dose and Daily groups, respectively (P < 0.0002) and no relevant cell death. Dynamic loading matured NP tissue by significantly increasing metabolic activity and accumulating Safranin-O-stained matrix. Load-induced maturation was also apparent from the significantly decreased glycolytic, cytoskeletal (Vimentin) and stress-inducible (HSP70) proteins assessed with proteomics. Loading increased the production of bioactive proteins Sonic Hedgehog (SHH) and Noggin, and maintained Semaphorin3A (Sema3A). Discussion NP tissue maturation was induced from dynamic hydrostatic pressurization in a controlled ex vivo environment without influence from systemic effects or surrounding structures. NCs transitioned into small nonvacuolated NP cells probably via differentiation as evidenced by high cell viability, lack of nitric oxide and downregulation of stress-inducible and cytoskeletal proteins. SHH, Sema3A, and Noggin, which have patterning and neurovascular-inhibiting properties, were produced in both notochordal and matured porcine NP. Results therefore provide an important piece of evidence suggesting the transition of NCs to small NP cells is a natural part of aging and not the initiation of degeneration. Bioactive candidates identified from young porcine IVDs may be isolated and harnessed for therapies to target discogenic back pain. PMID:24427812

  16. Dynamic pressurization induces transition of notochordal cells to a mature phenotype while retaining production of important patterning ligands from development.

    PubMed

    Purmessur, Devina; Guterl, Clare C; Cho, Samuel K; Cornejo, Marisa C; Lam, Ying W; Ballif, Bryan A; Laudier, James C Iatridis; Iatridis, James C

    2013-01-01

    Notochordal cells (NCs) pattern aneural and avascular intervertebral discs (IVDs), and their disappearance, is associated with onset of IVD degeneration. This study induced and characterized the maturation of nucleus pulposus (NP) tissue from a gelatinous NC-rich structure to a matrix-rich structure populated by small NP cells using dynamic pressurization in an ex vivo culture model, and also identified soluble factors from NCs with therapeutic potential. Porcine NC-rich NP tissue was cultured and loaded with hydrostatic pressure (0.5 to 2 MPa at 0.1 Hz for 2 hours) either Daily, for 1 Dose, or Control (no pressurization) groups for up to eight days. Cell phenotype and tissue maturation was characterized with measurements of cell viability, cytomorphology, nitric oxide, metabolic activity, matrix composition, gene expression, and proteomics. Daily pressurization induced transition of NCs to small NP cells with 73.8%, 44%, and 28% NCs for Control, 1 Dose and Daily groups, respectively (P < 0.0002) and no relevant cell death. Dynamic loading matured NP tissue by significantly increasing metabolic activity and accumulating Safranin-O-stained matrix. Load-induced maturation was also apparent from the significantly decreased glycolytic, cytoskeletal (Vimentin) and stress-inducible (HSP70) proteins assessed with proteomics. Loading increased the production of bioactive proteins Sonic Hedgehog (SHH) and Noggin, and maintained Semaphorin3A (Sema3A). NP tissue maturation was induced from dynamic hydrostatic pressurization in a controlled ex vivo environment without influence from systemic effects or surrounding structures. NCs transitioned into small nonvacuolated NP cells probably via differentiation as evidenced by high cell viability, lack of nitric oxide and downregulation of stress-inducible and cytoskeletal proteins. SHH, Sema3A, and Noggin, which have patterning and neurovascular-inhibiting properties, were produced in both notochordal and matured porcine NP. Results therefore provide an important piece of evidence suggesting the transition of NCs to small NP cells is a natural part of aging and not the initiation of degeneration. Bioactive candidates identified from young porcine IVDs may be isolated and harnessed for therapies to target discogenic back pain.

  17. Judd-Ofelt analysis and spectral properties of Dy3+ ions doped niobium containing tellurium calcium zinc borate glasses

    NASA Astrophysics Data System (ADS)

    Ravi, O.; Reddy, C. Madhukar; Reddy, B. Sudhakar; Deva Prasad Raju, B.

    2014-02-01

    Niobium containing tellurium calcium zinc borate (TCZNB) glasses doped with different concentrations of Dy3+ ions were prepared by the melt quenching method and their optical properties have been studied. The Judd-Ofelt (J-O) intensity parameters Ωt (t=2, 4 and 6) were calculated using the least square fit method. Based on the magnitude of Ω2 parameter the hypersensitivity of 6H15/2→6F11/2 has also been discussed. From the evaluated J-O intensity parameters as well as from the emission and lifetime measurements, radiative transition properties such as radiative transition probability rates and branching ratios were calculated for 4F9/2 excited level. It is found that for Dy3+ ion, the transition 4F9/2→6H13/2 shows highest emission cross-section at 1.0 mol% TCZNB glass matrix. From the visible luminescence spectra, yellow to blue (Y/B) intensity ratios and chromaticity color coordinates were also estimated. The TCZNB glasses exhibit good luminescence properties and are suitable for generation of white light.

  18. SYMBMAT: Symbolic computation of quantum transition matrix elements

    NASA Astrophysics Data System (ADS)

    Ciappina, M. F.; Kirchner, T.

    2012-08-01

    We have developed a set of Mathematica notebooks to compute symbolically quantum transition matrices relevant for atomic ionization processes. The utilization of a symbolic language allows us to obtain analytical expressions for the transition matrix elements required in charged-particle and laser induced ionization of atoms. Additionally, by using a few simple commands, it is possible to export these symbolic expressions to standard programming languages, such as Fortran or C, for the subsequent computation of differential cross sections or other observables. One of the main drawbacks in the calculation of transition matrices is the tedious algebraic work required when initial states other than the simple hydrogenic 1s state need to be considered. Using these notebooks the work is dramatically reduced and it is possible to generate exact expressions for a large set of bound states. We present explicit examples of atomic collisions (in First Born Approximation and Distorted Wave Theory) and laser-matter interactions (within the Dipole and Strong Field Approximations and different gauges) using both hydrogenic wavefunctions and Slater-Type Orbitals with arbitrary nlm quantum numbers as initial states. Catalogue identifier: AEMI_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEMI_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC license, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 71 628 No. of bytes in distributed program, including test data, etc.: 444 195 Distribution format: tar.gz Programming language: Mathematica Computer: Single machines using Linux or Windows (with cores with any clock speed, cache memory and bits in a word) Operating system: Any OS that supports Mathematica. The notebooks have been tested under Windows and Linux and with versions 6.x, 7.x and 8.x Classification: 2.6 Nature of problem: The notebooks generate analytical expressions for quantum transition matrix elements required in diverse atomic processes: ionization by ion, electron, or photon impact and ionization within the framework of strong field physics. In charged-particle collisions approaches based on perturbation theory enjoy widespread utilization. Accordingly, we have chosen the First Born Approximation and Distorted Wave theories as examples. In light-matter interactions, the main ingredient for many types of calculations is the dipole transition matrix in its different formulations, i.e. length, velocity, and acceleration gauges. In all these cases the transitions of interest occur between a bound state and a continuum state which can be described in different ways. With the notebooks developed in the present work it is possible to calculate transition matrix elements analytically for any set of quantum numbers nlm of initial hydrogenic states or Slater-Type Orbitals and for plane waves or Coulomb waves as final continuum states. Solution method: The notebooks employ symbolic computation to generate analytical expressions for transition matrix elements used in both collision and light-matter interaction physics. fba_hyd.nb - This notebook computes analytical expressions for the transition matrix of collision-induced ionization in the First Born Approximation (FBA). The transitions considered are from a bound hydrogenic state with arbitrary quantum numbers nlm to a continuum state represented by a plane wave (PW) or a Coulomb wave (CW). distorted_hyd.nb - This notebook computes analytical expressions for the transition matrix of collision-induced ionization in Distorted Wave (DW) theories. The transitions considered are from a (distorted) bound hydrogenic state with arbitrary quantum numbers nlm to a distorted-wave continuum state. The computations are based on scalar and vectorial integrals (see the text for details). dipoleLength_hyd.nb - This notebook computes analytical expressions for the dipole transition matrix in length gauge. The transitions considered are from a bound hydrogenic state with arbitrary quantum numbers nlm to a continuum state represented by a PW (the Strong Field Approximation (SFA)) or a CW (the Coulomb-Volkov Approximation (CVA)). dipoleVelocity_hyd.nb - This notebook computes analytical expressions for the dipole transition matrix in velocity gauge. The transitions considered are from a bound hydrogenic state with arbitrary quantum numbers nlm to a continuum state represented by a PW (the SFA) or a CW (the CVA). dipoleAcceleration_hyd.nb - This notebook computes analytical expressions for the dipole transition matrix in acceleration gauge. The transitions considered are from a bound hydrogenic state with arbitrary quantum numbers nlm to a continuum state represented by a PW (the SFA). For the case of the CVA we only include the transition from the 1s state to a continuum state represented by a CW. fba_STO.nb - This notebook computes analytical expressions for the transition matrix of collision-induced ionization in the FBA. The transitions considered are from a Slater-Type Orbital (STO) with arbitrary quantum numbers nlm to a continuum state represented by a PW or a CW. distorted_STO.nb - This notebook computes analytical expressions for the transition matrix of collision-induced ionization in DW theories. The transitions considered are from a (distorted) STO with arbitrary quantum numbers nlm to a distorted-wave continuum state. The computations are based on scalar and vectorial integrals (see the text for details). dipoleLength_STO.nb - This notebook computes analytical expressions for the dipole transition matrix in length gauge. The transitions considered are from an STO with arbitrary quantum numbers nlm to a continuum state represented by a PW (the SFA) or a CW (the CVA). dipoleVelocity_STO.nb - This notebook computes analytical expressions for the dipole transition matrix in velocity gauge. The transitions considered are from an STO with arbitrary quantum numbers nlm to a continuum state represented by a PW (the SFA) or a CW (the CVA). dipoleAcceleration_STO.nb - This notebook computes analytical expressions for the dipole transition matrix in acceleration gauge. The transitions considered are from an STO with arbitrary quantum numbers nlm to a continuum state represented by a PW (the SFA). The symbolic expressions obtained within each notebook can be exported to standard programming languages such as Fortran or C using the Format.m package (see the text and Ref. Sofroniou (1993) [16] for details). Running time: Computational times vary according to the transition matrix selected and quantum numbers nlm of the initial state used. The typical running time is several minutes, but it will take longer for large values of nlm.

  19. Transition probabilities of health states for workers in Malaysia using a Markov chain model

    NASA Astrophysics Data System (ADS)

    Samsuddin, Shamshimah; Ismail, Noriszura

    2017-04-01

    The aim of our study is to estimate the transition probabilities of health states for workers in Malaysia who contribute to the Employment Injury Scheme under the Social Security Organization Malaysia using the Markov chain model. Our study uses four states of health (active, temporary disability, permanent disability and death) based on the data collected from the longitudinal studies of workers in Malaysia for 5 years. The transition probabilities vary by health state, age and gender. The results show that men employees are more likely to have higher transition probabilities to any health state compared to women employees. The transition probabilities can be used to predict the future health of workers in terms of a function of current age, gender and health state.

  20. A Taxonomy of Latent Structure Assumptions for Probability Matrix Decomposition Models.

    ERIC Educational Resources Information Center

    Meulders, Michel; De Boeck, Paul; Van Mechelen, Iven

    2003-01-01

    Proposed a taxonomy of latent structure assumptions for probability matrix decomposition (PMD) that includes the original PMD model and a three-way extension of the multiple classification latent class model. Simulation study results show the usefulness of the taxonomy. (SLD)

  1. Global Analysis of a-, b-, and c-Type Transitions Involving Tunneling Components of K= 0 and 1 States of the Methanol Dimer

    NASA Astrophysics Data System (ADS)

    Lugez, C. L.; Lovas, F. J.; Hougen, J. T.; Ohashi, N.

    1999-03-01

    Spectral data onK= 0 and 1 levels of the methanol dimer available from previous and present Fourier transform microwave measurements have been interpreted globally, using a group-theoretically derived effective Hamiltonian and corresponding tunneling matrix elements to describe the splittings arising from a large number of tunneling motions. In the present work, 302 new measurements (40K= 1-1 and 262K= 1-0 transitions) were added to the previous data set to give a total of 584 assigned transitions withJ≤ 6. As a result of the rather completeK= 0, 1 data set forJ≤ 4, the lone-pair exchange tunneling splittings were obtained experimentally. Matrix element expansions inJ(J+ 1) used in the previousK= 0 formalism were modified to apply toK> 0, essentially by making a number of real coefficients complex, as required by the generalized internal-axis-method tunneling formalism. To reduce the number of adjustable parameters to an acceptable level in both theK= 0 andK= 1 effective Hamiltonians (used in separateK= 0 andK= 1 least-squares fits), a rather large number of assumptions concerning probably negligible parameters had to be made. The present fitting results should thus be considered as providing assurance of the group-theoretical line assignments as well as a nearly quantitative global interpretation of the tunneling splittings, even though they do not yet unambiguously determine the relative contributions from all 25 group-theoretically inequivalent tunneling motions in this complex, nor do they permit quantitative extrapolation to higherKlevels.

  2. A Limited Comparison of the Thermal Durability of Polyimide Candidate Matrix Polymers with PMR-15

    NASA Technical Reports Server (NTRS)

    Bowles, Kenneth J.; Papadopoulos, Demetrios S.; Scheiman, Daniel A.; Inghram, Linda L.; McCorkle, Linda S.; Klans, Ojars V.

    2003-01-01

    Studies were conducted with six different candidate high-temperature neat matrix resin specimens of varied geometric shapes to investigate the mechanisms involved in the thermal degradation of polyimides like PMR-15. The metrics for assessing the quality of these candidates were chosen to be glass transition temperature (T(sub g)), thermo-oxidative stability, dynamic mechanical properties, microstructural changes, and dimensional stability. The processing and mechanical properties were not investigated in the study reported herein. The dimensional changes and surface layer growth were measured and recorded. The data were in agreement with earlier published data. An initial weight increase reaction was observed to be dominating at the lower temperatures. However, at the more elevated temperatures, the weight loss reactions were prevalent and probably masked the weight gain reaction. These data confirmed the findings of the existence of an initial weight gain reaction previously reported. Surface- and core-dependent weight losses were shown to control the polymer degradation at the higher temperatures.

  3. A quarter of a century of job transitions in Germany☆

    PubMed Central

    Kattenbach, Ralph; Schneidhofer, Thomas M.; Lücke, Janine; Latzke, Markus; Loacker, Bernadette; Schramm, Florian; Mayrhofer, Wolfgang

    2014-01-01

    By examining trends in intra-organizational and inter-organizational job transition probabilities among professional and managerial employees in Germany, we test the applicability of mainstream career theory to a specific context and challenge its implied change assumption. Drawing on data from the German Socio-Economic Panel (GSOEP), we apply linear probability models to show the influence of time, economic cycle and age on the probability of job transitions between 1984 and 2010. Results indicate a slight negative trend in the frequency of job transitions during the analyzed time span, owing to a pronounced decrease in intra-organizational transitions, which is only partly offset by a comparatively weaker positive trend towards increased inter-organizational transitions. The latter is strongly influenced by fluctuations in the economic cycle. Finally, the probability of job transitions keeps declining steadily through the course of one's working life. In contrast to inter-organizational transitions, however, this age effect for intra-organizational transitions has decreased over time. PMID:24493876

  4. A quarter of a century of job transitions in Germany.

    PubMed

    Kattenbach, Ralph; Schneidhofer, Thomas M; Lücke, Janine; Latzke, Markus; Loacker, Bernadette; Schramm, Florian; Mayrhofer, Wolfgang

    2014-02-01

    By examining trends in intra-organizational and inter-organizational job transition probabilities among professional and managerial employees in Germany, we test the applicability of mainstream career theory to a specific context and challenge its implied change assumption. Drawing on data from the German Socio-Economic Panel (GSOEP), we apply linear probability models to show the influence of time, economic cycle and age on the probability of job transitions between 1984 and 2010. Results indicate a slight negative trend in the frequency of job transitions during the analyzed time span, owing to a pronounced decrease in intra-organizational transitions, which is only partly offset by a comparatively weaker positive trend towards increased inter-organizational transitions. The latter is strongly influenced by fluctuations in the economic cycle. Finally, the probability of job transitions keeps declining steadily through the course of one's working life. In contrast to inter-organizational transitions, however, this age effect for intra-organizational transitions has decreased over time.

  5. Transition and Damping of Collective Modes in a Trapped Fermi Gas between BCS and Unitary Limits near the Phase Transition

    PubMed Central

    Dong, Hang; Zhang, Wenyuan; Zhou, Li; Ma, Yongli

    2015-01-01

    We investigate the transition and damping of low-energy collective modes in a trapped unitary Fermi gas by solving the Boltzmann-Vlasov kinetic equation in a scaled form, which is combined with both the T-matrix fluctuation theory in normal phase and the mean-field theory in order phase. In order to connect the microscopic and kinetic descriptions of many-body Feshbach scattering, we adopt a phenomenological two-fluid physical approach, and derive the coupling constants in the order phase. By solving the Boltzmann-Vlasov steady-state equation in a variational form, we calculate two viscous relaxation rates with the collision probabilities of fermion’s scattering including fermions in the normal fluid and fermion pairs in the superfluid. Additionally, by considering the pairing and depairing of fermions, we get results of the frequency and damping of collective modes versus temperature and s-wave scattering length. Our theoretical results are in a remarkable agreement with the experimental data, particularly for the sharp transition between collisionless and hydrodynamic behaviour and strong damping between BCS and unitary limits near the phase transition. The sharp transition originates from the maximum of viscous relaxation rate caused by fermion-fermion pair collision at the phase transition point when the fermion depair, while the strong damping due to the fast varying of the frequency of collective modes from BCS limit to unitary limit. PMID:26522094

  6. Optimal clinical trial design based on a dichotomous Markov-chain mixed-effect sleep model.

    PubMed

    Steven Ernest, C; Nyberg, Joakim; Karlsson, Mats O; Hooker, Andrew C

    2014-12-01

    D-optimal designs for discrete-type responses have been derived using generalized linear mixed models, simulation based methods and analytical approximations for computing the fisher information matrix (FIM) of non-linear mixed effect models with homogeneous probabilities over time. In this work, D-optimal designs using an analytical approximation of the FIM for a dichotomous, non-homogeneous, Markov-chain phase advanced sleep non-linear mixed effect model was investigated. The non-linear mixed effect model consisted of transition probabilities of dichotomous sleep data estimated as logistic functions using piecewise linear functions. Theoretical linear and nonlinear dose effects were added to the transition probabilities to modify the probability of being in either sleep stage. D-optimal designs were computed by determining an analytical approximation the FIM for each Markov component (one where the previous state was awake and another where the previous state was asleep). Each Markov component FIM was weighted either equally or by the average probability of response being awake or asleep over the night and summed to derive the total FIM (FIM(total)). The reference designs were placebo, 0.1, 1-, 6-, 10- and 20-mg dosing for a 2- to 6-way crossover study in six dosing groups. Optimized design variables were dose and number of subjects in each dose group. The designs were validated using stochastic simulation/re-estimation (SSE). Contrary to expectations, the predicted parameter uncertainty obtained via FIM(total) was larger than the uncertainty in parameter estimates computed by SSE. Nevertheless, the D-optimal designs decreased the uncertainty of parameter estimates relative to the reference designs. Additionally, the improvement for the D-optimal designs were more pronounced using SSE than predicted via FIM(total). Through the use of an approximate analytic solution and weighting schemes, the FIM(total) for a non-homogeneous, dichotomous Markov-chain phase advanced sleep model was computed and provided more efficient trial designs and increased nonlinear mixed-effects modeling parameter precision.

  7. Convergence in High Probability of the Quantum Diffusion in a Random Band Matrix Model

    NASA Astrophysics Data System (ADS)

    Margarint, Vlad

    2018-06-01

    We consider Hermitian random band matrices H in d ≥slant 1 dimensions. The matrix elements H_{xy}, indexed by x, y \\in Λ \\subset Z^d, are independent, uniformly distributed random variable if |x-y| is less than the band width W, and zero otherwise. We update the previous results of the converge of quantum diffusion in a random band matrix model from convergence of the expectation to convergence in high probability. The result is uniformly in the size |Λ| of the matrix.

  8. Transition Probabilities for Hydrogen-Like Atoms

    NASA Astrophysics Data System (ADS)

    Jitrik, Oliverio; Bunge, Carlos F.

    2004-12-01

    E1, M1, E2, M2, E3, and M3 transition probabilities for hydrogen-like atoms are calculated with point-nucleus Dirac eigenfunctions for Z=1-118 and up to large quantum numbers l=25 and n=26, increasing existing data more than a thousandfold. A critical evaluation of the accuracy shows a higher reliability with respect to previous works. Tables for hydrogen containing a subset of the results are given explicitly, listing the states involved in each transition, wavelength, term energies, statistical weights, transition probabilities, oscillator strengths, and line strengths. The complete results, including 1 863 574 distinct transition probabilities, lifetimes, and branching fractions are available at http://www.fisica.unam.mx/research/tables/spectra/1el

  9. Forbidden transition probabilities for ground terms of ions with p or p5 configurations. [for solar atmosphere

    NASA Technical Reports Server (NTRS)

    Kastner, S. O.

    1976-01-01

    Forbidden transition probabilities are given for ground term transitions of ions in the isoelectronic sequences with outer configurations 2s2 2p (B I), 2p5 (F I), 3s2 3p (Al I), and 3p5 (Cl I). Tables give, for each ion, the ground term interval, the associated wavelength, the quadrupole radial integral, the electric quadrupole transition probability, and the magnetic dipole transition probability. Coronal lines due to some of these ions have been observed, while others are yet to be observed. The tales for the Al I and Cl I sequences include elements up to germanium.

  10. Bit Error Probability for Maximum Likelihood Decoding of Linear Block Codes

    NASA Technical Reports Server (NTRS)

    Lin, Shu; Fossorier, Marc P. C.; Rhee, Dojun

    1996-01-01

    In this paper, the bit error probability P(sub b) for maximum likelihood decoding of binary linear codes is investigated. The contribution of each information bit to P(sub b) is considered. For randomly generated codes, it is shown that the conventional approximation at high SNR P(sub b) is approximately equal to (d(sub H)/N)P(sub s), where P(sub s) represents the block error probability, holds for systematic encoding only. Also systematic encoding provides the minimum P(sub b) when the inverse mapping corresponding to the generator matrix of the code is used to retrieve the information sequence. The bit error performances corresponding to other generator matrix forms are also evaluated. Although derived for codes with a generator matrix randomly generated, these results are shown to provide good approximations for codes used in practice. Finally, for decoding methods which require a generator matrix with a particular structure such as trellis decoding or algebraic-based soft decision decoding, equivalent schemes that reduce the bit error probability are discussed.

  11. Nanostructured transition metal oxides useful for water oxidation catalysis

    DOEpatents

    Frei, Heinz M; Jiao, Feng

    2013-12-24

    The present invention provides for a composition comprising a nanostructured transition metal oxide capable of oxidizing two H.sub.2O molecules to obtain four protons. In some embodiments of the invention, the composition further comprises a porous matrix wherein the nanocluster of the transition metal oxide is embedded on and/or in the porous matrix.

  12. Hydrogeologic unit flow characterization using transition probability geostatistics.

    PubMed

    Jones, Norman L; Walker, Justin R; Carle, Steven F

    2005-01-01

    This paper describes a technique for applying the transition probability geostatistics method for stochastic simulation to a MODFLOW model. Transition probability geostatistics has some advantages over traditional indicator kriging methods including a simpler and more intuitive framework for interpreting geologic relationships and the ability to simulate juxtapositional tendencies such as fining upward sequences. The indicator arrays generated by the transition probability simulation are converted to layer elevation and thickness arrays for use with the new Hydrogeologic Unit Flow package in MODFLOW 2000. This makes it possible to preserve complex heterogeneity while using reasonably sized grids and/or grids with nonuniform cell thicknesses.

  13. Free energy and phase transition of the matrix model on a plane wave

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hadizadeh, Shirin; Ramadanovic, Bojan; Semenoff, Gordon W.

    2005-03-15

    It has recently been observed that the weakly coupled plane-wave matrix model has a density of states which grows exponentially at high energy. This implies that the model has a phase transition. The transition appears to be of first order. However, its exact nature is sensitive to interactions. In this paper, we analyze the effect of interactions by computing the relevant parts of the effective potential for the Polyakov loop operator in the finite temperature plane-wave matrix model to three-loop order. We show that the phase transition is indeed of first order. We also compute the correction to the Hagedornmore » temperature to order two loops.« less

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sinitsyn, N. A.

    We consider nonadiabatic transitions in explicitly time-dependent systems with Hamiltonians of the form Hˆ(t)=Aˆ+Bˆt+Cˆ/t, where t is time and Aˆ,Bˆ,Cˆ are Hermitian N × N matrices. We show that in any model of this type, scattering matrix elements satisfy nontrivial exact constraints that follow from the absence of the Stokes phenomenon for solutions with specific conditions at t→–∞. This allows one to continue such solutions analytically to t→+∞, and connect their asymptotic behavior at t→–∞ and t→+∞. This property becomes particularly useful when a model shows additional discrete symmetries. Specifically, we derive a number of simple exact constraints and explicitmore » expressions for scattering probabilities in such systems.« less

  15. Spectroscopic properties of 130Sb, 132Te and 134I nuclei in 100-132Sn magic cores

    NASA Astrophysics Data System (ADS)

    Benrachi, Fatima; Khiter, Meriem; Laouet, Nadjet

    2017-09-01

    We have performed shell model calculations by means of Oxbash nuclear structure code using recent experimental single particle (spes) and single hole (shes) energies with valence space models above the 100sn and 132sn doubly magic cores. The two-body matrix elements (tbme) of original CD-Bonn realistic interaction are introduced after have been modified taking into account the three-body forces. We have focused our study on spectroscopic properties evaluation of 130Sb, 132Te and 134I nuclei, in particular their energy spectra, transition probabilities and moments have been determined. The getting spectra are in reasonable agreement with the experimental data.

  16. Thouless energy and multifractality across the many-body localization transition

    NASA Astrophysics Data System (ADS)

    Serbyn, Maksym; Papić, Z.; Abanin, Dmitry A.

    2017-09-01

    Thermal and many-body localized phases are separated by a dynamical phase transition of a new kind. We analyze the distribution of off-diagonal matrix elements of local operators across this transition in two different models of disordered spin chains. We show that the behavior of matrix elements can be used to characterize the breakdown of thermalization and to extract the many-body Thouless energy. We find that upon increasing the disorder strength the system enters a critical region around the many-body localization transition. The properties of the system in this region are: (i) the Thouless energy becomes smaller than the level spacing, (ii) the matrix elements show critical dependence on the energy difference, and (iii) the matrix elements, viewed as amplitudes of a fictitious wave function, exhibit strong multifractality. This critical region decreases with the system size, which we interpret as evidence for a diverging correlation length at the many-body localization transition. Our findings show that the correlation length becomes larger than the accessible system sizes in a broad range of disorder strength values and shed light on the critical behavior near the many-body localization transition.

  17. Modeling and Computing of Stock Index Forecasting Based on Neural Network and Markov Chain

    PubMed Central

    Dai, Yonghui; Han, Dongmei; Dai, Weihui

    2014-01-01

    The stock index reflects the fluctuation of the stock market. For a long time, there have been a lot of researches on the forecast of stock index. However, the traditional method is limited to achieving an ideal precision in the dynamic market due to the influences of many factors such as the economic situation, policy changes, and emergency events. Therefore, the approach based on adaptive modeling and conditional probability transfer causes the new attention of researchers. This paper presents a new forecast method by the combination of improved back-propagation (BP) neural network and Markov chain, as well as its modeling and computing technology. This method includes initial forecasting by improved BP neural network, division of Markov state region, computing of the state transition probability matrix, and the prediction adjustment. Results of the empirical study show that this method can achieve high accuracy in the stock index prediction, and it could provide a good reference for the investment in stock market. PMID:24782659

  18. Finding exact constants in a Markov model of Zipfs law generation

    NASA Astrophysics Data System (ADS)

    Bochkarev, V. V.; Lerner, E. Yu.; Nikiforov, A. A.; Pismenskiy, A. A.

    2017-12-01

    According to the classical Zipfs law, the word frequency is a power function of the word rank with an exponent -1. The objective of this work is to find multiplicative constant in a Markov model of word generation. Previously, the case of independent letters was mathematically strictly investigated in [Bochkarev V V and Lerner E Yu 2017 International Journal of Mathematics and Mathematical Sciences Article ID 914374]. Unfortunately, the methods used in this paper cannot be generalized in case of Markov chains. The search of the correct formulation of the Markov generalization of this results was performed using experiments with different ergodic matrices of transition probability P. Combinatory technique allowed taking into account all the words with probability of more than e -300 in case of 2 by 2 matrices. It was experimentally proved that the required constant in the limit is equal to the value reciprocal to conditional entropy of matrix row P with weights presenting the elements of the vector π of the stationary distribution of the Markov chain.

  19. The first experimental investigation of the KLL Auger spectrum of Ni generated in the electron capture decay of radioactive 64Cu in a solid state matrix

    NASA Astrophysics Data System (ADS)

    Inoyatov, A. Kh.; Perevoshchikov, L. L.; Kovalík, A.; Filosofov, D. V.; Gorozhankin, V. M.; Ryšavý, M.

    2012-09-01

    The KLL Auger spectrum of Ni generated in the electron capture decay of radioactive 64Cu in a solid state matrix was measured for the first time using a combined electrostatic electron spectrometer adjusted to a 7 eV instrumental resolution. Energies and relative intensities of the all nine basic spectrum components were determined and compared with data obtained from X-ray induced spectra of metallic Ni and with theoretical results as well. Absolute energy of 6562.5 ± 1.3 eV (related to the Fermi level) measured for the dominant KL2L3(1D2) than a value obtained from the X-ray induced spectra which is probably caused by the effects of chemical bonding and physico-chemical environment. Moreover, it is higher by 20.4 eV (16 σ) than a prediction of the semi-empirical calculations by Larkins which indicates an influence of the "atomic structure effect" on absolute energies of the Auger transitions following the electron capture decay and, possibly, some imperfections in the calculations. Good agreement of the measured and predicted KL1L2(3P0/1P1) transition intensity ratios indicates perceptible influence of the relativistic effects on the KLL Auger spectrum even at Z = 28.

  20. Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.

    PubMed

    Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran

    2017-08-01

    We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Exploring the Connection Between Sampling Problems in Bayesian Inference and Statistical Mechanics

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrew

    2006-01-01

    The Bayesian and statistical mechanical communities often share the same objective in their work - estimating and integrating probability distribution functions (pdfs) describing stochastic systems, models or processes. Frequently, these pdfs are complex functions of random variables exhibiting multiple, well separated local minima. Conventional strategies for sampling such pdfs are inefficient, sometimes leading to an apparent non-ergodic behavior. Several recently developed techniques for handling this problem have been successfully applied in statistical mechanics. In the multicanonical and Wang-Landau Monte Carlo (MC) methods, the correct pdfs are recovered from uniform sampling of the parameter space by iteratively establishing proper weighting factors connecting these distributions. Trivial generalizations allow for sampling from any chosen pdf. The closely related transition matrix method relies on estimating transition probabilities between different states. All these methods proved to generate estimates of pdfs with high statistical accuracy. In another MC technique, parallel tempering, several random walks, each corresponding to a different value of a parameter (e.g. "temperature"), are generated and occasionally exchanged using the Metropolis criterion. This method can be considered as a statistically correct version of simulated annealing. An alternative approach is to represent the set of independent variables as a Hamiltonian system. Considerab!e progress has been made in understanding how to ensure that the system obeys the equipartition theorem or, equivalently, that coupling between the variables is correctly described. Then a host of techniques developed for dynamical systems can be used. Among them, probably the most powerful is the Adaptive Biasing Force method, in which thermodynamic integration and biased sampling are combined to yield very efficient estimates of pdfs. The third class of methods deals with transitions between states described by rate constants. These problems are isomorphic with chemical kinetics problems. Recently, several efficient techniques for this purpose have been developed based on the approach originally proposed by Gillespie. Although the utility of the techniques mentioned above for Bayesian problems has not been determined, further research along these lines is warranted

  2. On the zigzagging causility model of EPR correlations and on the interpretation of quantum mechanics

    NASA Astrophysics Data System (ADS)

    de Beauregard, O. Costa

    1988-09-01

    Being formalized inside the S-matrix scheme, the zigzagging causility model of EPR correlations has full Lorentz and CPT invariance. EPR correlations, proper or reversed, and Wheeler's smoky dragon metaphor are respectively pictured in spacetime or in the momentum-energy space, as V-shaped, A-shaped, or C-shaped ABC zigzags, with a summation at B over virtual states |B>

  3. Electron impact excitation of NeIII intercombination lines

    NASA Astrophysics Data System (ADS)

    Daw, Adrian; McLaughlin, Brendan M.; Bell, Kenneth L.

    2000-06-01

    Observations on the spectra of doubly ionized neon (NeIII) have been recently recorded below 25O Å(A. E. Livington, R. Buttner, A. S. Zacarias, B. Kraus, K-H Schartner, F. Folkmann and P. H. Mokler, J. Opt. Soc. Am. B 14) 522-525 (1997).. This work together with previous studies give line intensies which may be used as density diagnostics but required accurate collision strengths and transition probabilities for their interpretation. Recent studies on electron collisions with NeIII ions using the R-matrix approach (B. M. McLaughlin and K. L. Bell, J. Phys. B. 33), 597 (2000). for Δ n=0 transitions, illustrated the importance of including n=3 and 4 levels in the calculations compared to previous work. (K. Butler and C. Mendoza, Mon. Not. R. Astr. Soc. 208), 17 (1984). Particular emphasis is now placed on transitions to the intercombination 2s^22p^3[^4S^o]3s ^3,5S^o levels and to the other n=3 levels where comparison can be made with previous distorted-wave work. The calculations of fine-structure transitions by electron impact, to and within these multiplets of NeIII provide much needed accurate data for astrophysical models. Further details and a comprehensive set of results will be presented at the meeting.

  4. Localization of soft modes at the depinning transition

    NASA Astrophysics Data System (ADS)

    Cao, Xiangyu; Bouzat, Sebastian; Kolton, Alejandro B.; Rosso, Alberto

    2018-02-01

    We characterize the soft modes of the dynamical matrix at the depinning transition, and compare the matrix with the properties of the Anderson model (and long-range generalizations). The density of states at the edge of the spectrum displays a universal linear tail, different from the Lifshitz tails. The eigenvectors are instead very similar in the two matrix ensembles. We focus on the ground state (soft mode), which represents the epicenter of avalanche instabilities. We expect it to be localized in all finite dimensions, and make a clear connection between its localization length and the Larkin length of the depinning model. In the fully connected model, we show that the weak-strong pinning transition coincides with a peculiar localization transition of the ground state.

  5. Direct evidence of octupole deformation in neutron-rich 144Ba

    DOE PAGES

    Bucher, B.; Zhu, S.; Wu, C. Y.; ...

    2016-03-17

    Here, the neutron-rich nucleus 144Ba (t 1/2 = 11.5 s) is expected to exhibit some of the strongest octupole correlations among nuclei with mass numbers A less than 200. Until now, indirect evidence for such strong correlations has been inferred from observations such as enhanced E1 transitions and interleaving positive- and negative-parity levels in the ground-state band. In this experiment, the octupole strength was measured directly by sub-barrier, multistep Coulomb excitation of a post-accelerated 650-MeV 144Ba beam on a 1.0–mg/cm 2 208Pb target. The measured value of the matrix element, < 3 1–∥M(E3)∥0 1 + >= 0.65( +17 –23) ebmore » 3/2, corresponds to a reduced B(E3) transition probability of 48( +25 –34) W.u. This result represents an unambiguous determination of the octupole collectivity, is larger than any available theoretical prediction, and is consistent with octupole deformation.« less

  6. The gas phase structure of transition metal dihydrides

    NASA Astrophysics Data System (ADS)

    Demuynck, Jean; Schaefer, Henry F.

    1980-01-01

    ESR and infrared spectroscopic measurements on matrix isolated MnH2 and CrH2 have recently suggested that these simple molecules may be bent. This result would be the opposite of that found experimentally for the transition metal dihalides MX2, known to be linear. Here the geometrical structure of MnH2 has been investigated by molecular electronic structure theory. A large contracted Gaussian basis set [Mn(14s11p6p/9s8p3d), H(5s1p/3s1p)] was used in conjunction with self-consistent field and configuration interaction methods. These suggest that the 6A1 ground state of MnH2 is linear. Further studies of the 3A1 state (one of several low-lying states) of TiH2 also favor linearity, although this potential energy surface is extremely flat with respect to bending. Thus it appears probable that most MH2 molecules, like the related MX2 family, are linear.

  7. Gender Classification Based on Eye Movements: A Processing Effect During Passive Face Viewing

    PubMed Central

    Sammaknejad, Negar; Pouretemad, Hamidreza; Eslahchi, Changiz; Salahirad, Alireza; Alinejad, Ashkan

    2017-01-01

    Studies have revealed superior face recognition skills in females, partially due to their different eye movement strategies when encoding faces. In the current study, we utilized these slight but important differences and proposed a model that estimates the gender of the viewers and classifies them into two subgroups, males and females. An eye tracker recorded participant’s eye movements while they viewed images of faces. Regions of interest (ROIs) were defined for each face. Results showed that the gender dissimilarity in eye movements was not due to differences in frequency of fixations in the ROI s per se. Instead, it was caused by dissimilarity in saccade paths between the ROIs. The difference enhanced when saccades were towards the eyes. Females showed significant increase in transitions from other ROI s to the eyes. Consequently, the extraction of temporal transient information of saccade paths through a transition probability matrix, similar to a first order Markov chain model, significantly improved the accuracy of the gender classification results. PMID:29071007

  8. Gender Classification Based on Eye Movements: A Processing Effect During Passive Face Viewing.

    PubMed

    Sammaknejad, Negar; Pouretemad, Hamidreza; Eslahchi, Changiz; Salahirad, Alireza; Alinejad, Ashkan

    2017-01-01

    Studies have revealed superior face recognition skills in females, partially due to their different eye movement strategies when encoding faces. In the current study, we utilized these slight but important differences and proposed a model that estimates the gender of the viewers and classifies them into two subgroups, males and females. An eye tracker recorded participant's eye movements while they viewed images of faces. Regions of interest (ROIs) were defined for each face. Results showed that the gender dissimilarity in eye movements was not due to differences in frequency of fixations in the ROI s per se. Instead, it was caused by dissimilarity in saccade paths between the ROIs. The difference enhanced when saccades were towards the eyes. Females showed significant increase in transitions from other ROI s to the eyes. Consequently, the extraction of temporal transient information of saccade paths through a transition probability matrix, similar to a first order Markov chain model, significantly improved the accuracy of the gender classification results.

  9. Cross sections and rate coefficients for inner-shell excitation of Li-like ions with 6 < Z < 42

    NASA Astrophysics Data System (ADS)

    Safronova, U. I.; Safronova, M. S.; Kato, T.

    1996-07-01

    Excitation cross sections and rate coefficients by electron impact were calculated for the 1s22s-1s2s2p, 1s22s-1s2s2 and 1s22s-1s2p2 transitions of the Li-like ions (C IV, N V, O VI, Ne VIII, Mg X, Al XI, Si XII, S XIV, Ar XVI, Ca XVIII, Ti XX, Fe XXIV, Ni XXVI, Zn XXVIII, Ge XXX, Se XXXII, Kr XXXIV and Mo XXXX) in the Coulomb-Born approximation with exchange including relativistic effects and configuration interaction. Level energies, mixing coefficients and transition wavelengths and probabilities were also computed. Calculations performed by the 1/Z perturbation theory and Coulomb-Born approximation are compared with the R-matrix method and the distorted-wave approximation were Z is the nuclear charge. Formulae obtained for the angular factors of n-electron atomic system allow one to generalize this method to an arbitrary system of highly charged ions.

  10. Material wear and failure mode analysis of breakfast cereal extruder barrels and screw elements

    NASA Astrophysics Data System (ADS)

    Mastio, Michael Joseph, Jr.

    2005-11-01

    Nearly seventy-five years ago, the single screw extruder was introduced as a means to produce metal products. Shortly after that, the extruder found its way into the plastics industry. Today much of the world's polymer industry utilizes extruders to produce items such as soda bottles, PVC piping, and toy figurines. Given the significant economical advantages of extruders over conventional batch flow systems, extruders have also migrated into the food industry. Food applications include the meat, pet food, and cereal industries to name just a few. Cereal manufacturers utilize extruders to produce various forms of Ready-to-Eat (RTE) cereals. These cereals are made from grains such as rice, oats, wheat, and corn. The food industry has been incorrectly viewed as an extruder application requiring only minimal energy control and performance capability. This misconception has resulted in very little research in the area of material wear and failure mode analysis of breakfast cereal extruders. Breakfast cereal extruder barrels and individual screw elements are subjected to the extreme pressures and temperatures required to shear and cook the cereal ingredients, resulting in excessive material wear and catastrophic failure of these components. Therefore, this project focuses on the material wear and failure mode analysis of breakfast cereal extruder barrels and screw elements, modeled as a Discrete Time Markov Chain (DTMC) process in which historical data is used to predict future failures. Such predictive analysis will yield cost savings opportunities by providing insight into extruder maintenance scheduling and interchangeability of screw elements. In this DTMC wear analysis, four states of wear are defined and a probability transition matrix is determined based upon 24,041 hours of operational data. This probability transition matrix is used to predict when an extruder component will move to the next state of wear and/or failure. This information can be used to determine maintenance schedules and screw element interchangeability.

  11. Video Shot Boundary Detection Using QR-Decomposition and Gaussian Transition Detection

    NASA Astrophysics Data System (ADS)

    Amiri, Ali; Fathy, Mahmood

    2010-12-01

    This article explores the problem of video shot boundary detection and examines a novel shot boundary detection algorithm by using QR-decomposition and modeling of gradual transitions by Gaussian functions. Specifically, the authors attend to the challenges of detecting gradual shots and extracting appropriate spatiotemporal features that affect the ability of algorithms to efficiently detect shot boundaries. The algorithm utilizes the properties of QR-decomposition and extracts a block-wise probability function that illustrates the probability of video frames to be in shot transitions. The probability function has abrupt changes in hard cut transitions, and semi-Gaussian behavior in gradual transitions. The algorithm detects these transitions by analyzing the probability function. Finally, we will report the results of the experiments using large-scale test sets provided by the TRECVID 2006, which has assessments for hard cut and gradual shot boundary detection. These results confirm the high performance of the proposed algorithm.

  12. Absolute Transition Probabilities of Lines in the Spectra of Astrophysical Atoms, Molecules, and Ions

    NASA Technical Reports Server (NTRS)

    Parkinson, W. H.; Smith, P. L.; Yoshino, K.

    1984-01-01

    Progress in the investigation of absolute transition probabilities (A-values or F values) for ultraviolet lines is reported. A radio frequency ion trap was used for measurement of transition probabilities for intersystem lines seen in astronomical spectra. The intersystem line at 2670 A in Al II, which is seen in pre-main sequence stars and symbiotic stars, was studied.

  13. Efficient Geometric Probabilities of Multi-transiting Systems, Circumbinary Planets, and Exoplanet Mutual Events

    NASA Astrophysics Data System (ADS)

    Brakensiek, Joshua; Ragozzine, D.

    2012-10-01

    The transit method for discovering extra-solar planets relies on detecting regular diminutions of light from stars due to the shadows of planets passing in between the star and the observer. NASA's Kepler Mission has successfully discovered thousands of exoplanet candidates using this technique, including hundreds of stars with multiple transiting planets. In order to estimate the frequency of these valuable systems, our research concerns the efficient calculation of geometric probabilities for detecting multiple transiting extrasolar planets around the same parent star. In order to improve on previous studies that used numerical methods (e.g., Ragozzine & Holman 2010, Tremaine & Dong 2011), we have constructed an efficient, analytical algorithm which, given a collection of conjectured exoplanets orbiting a star, computes the probability that any particular group of exoplanets are transiting. The algorithm applies theorems of elementary differential geometry to compute the areas bounded by circular curves on the surface of a sphere (see Ragozzine & Holman 2010). The implemented algorithm is more accurate and orders of magnitude faster than previous algorithms, based on comparison with Monte Carlo simulations. Expanding this work, we have also developed semi-analytical methods for determining the frequency of exoplanet mutual events, i.e., the geometric probability two planets will transit each other (Planet-Planet Occultation) and the probability that this transit occurs simultaneously as they transit their star (Overlapping Double Transits; see Ragozzine & Holman 2010). The latter algorithm can also be applied to calculating the probability of observing transiting circumbinary planets (Doyle et al. 2011, Welsh et al. 2012). All of these algorithms have been coded in C and will be made publicly available. We will present and advertise these codes and illustrate their value for studying exoplanetary systems.

  14. Statistical physics approaches to quantifying sleep-stage transitions

    NASA Astrophysics Data System (ADS)

    Lo, Chung-Chuan

    Sleep can be viewed as a sequence of transitions in a very complex neuronal system. Traditionally, studies of the dynamics of sleep control have focused on the circadian rhythm of sleep-wake transitions or on the ultradian rhythm of the sleep cycle. However, very little is known about the mechanisms responsible for the time structure or even the statistics of the rapid sleep-stage transitions that appear without periodicity. I study the time dynamics of sleep-wake transitions for different species, including humans, rats, and mice, and find that the wake and sleep episodes exhibit completely different behaviors: the durations of wake episodes are characterized by a scale-free power-law distribution, while the durations of sleep episodes have an exponential distribution with a characteristic time scale. The functional forms of the distributions of the sleep and wake durations hold for human subjects of different ages and for subjects with sleep apnea. They also hold for all the species I investigate. Surprisingly, all species have the same power-law exponent for the distribution of wake durations, but the exponential characteristic time of the distribution of sleep durations changes across species. I develop a stochastic model which accurately reproduces our empirical findings. The model suggests that the difference between the dynamics of the sleep and wake states arises from the constraints on the number of microstates in the sleep-wake system. I develop a measure of asymmetry in sleep-stage transitions using a transition probability matrix. I find that both normal and sleep apnea subjects are characterized by two types of asymmetric sleep-stage transition paths, and that the sleep apnea group exhibits less asymmetry in the sleep-stage transitions.

  15. Quantum Monte Carlo calculations of electromagnetic transitions in $^8$Be with meson-exchange currents derived from chiral effective field theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pastore, S.; Wiringa, Robert B.; Pieper, Steven C.

    2014-08-01

    We report quantum Monte Carlo calculations of electromagnetic transitions inmore » $^8$Be. The realistic Argonne $$v_{18}$$ two-nucleon and Illinois-7 three-nucleon potentials are used to generate the ground state and nine excited states, with energies that are in excellent agreement with experiment. A dozen $M1$ and eight $E2$ transition matrix elements between these states are then evaluated. The $E2$ matrix elements are computed only in impulse approximation, with those transitions from broad resonant states requiring special treatment. The $M1$ matrix elements include two-body meson-exchange currents derived from chiral effective field theory, which typically contribute 20--30\\% of the total expectation value. Many of the transitions are between isospin-mixed states; the calculations are performed for isospin-pure states and then combined with the empirical mixing coefficients to compare to experiment. In general, we find that transitions between states that have the same dominant spatial symmetry are in decent agreement with experiment, but those transitions between different spatial symmetries are often significantly underpredicted.« less

  16. Markov state models from short non-equilibrium simulations—Analysis and correction of estimation bias

    NASA Astrophysics Data System (ADS)

    Nüske, Feliks; Wu, Hao; Prinz, Jan-Hendrik; Wehmeyer, Christoph; Clementi, Cecilia; Noé, Frank

    2017-03-01

    Many state-of-the-art methods for the thermodynamic and kinetic characterization of large and complex biomolecular systems by simulation rely on ensemble approaches, where data from large numbers of relatively short trajectories are integrated. In this context, Markov state models (MSMs) are extremely popular because they can be used to compute stationary quantities and long-time kinetics from ensembles of short simulations, provided that these short simulations are in "local equilibrium" within the MSM states. However, over the last 15 years since the inception of MSMs, it has been controversially discussed and not yet been answered how deviations from local equilibrium can be detected, whether these deviations induce a practical bias in MSM estimation, and how to correct for them. In this paper, we address these issues: We systematically analyze the estimation of MSMs from short non-equilibrium simulations, and we provide an expression for the error between unbiased transition probabilities and the expected estimate from many short simulations. We show that the unbiased MSM estimate can be obtained even from relatively short non-equilibrium simulations in the limit of long lag times and good discretization. Further, we exploit observable operator model (OOM) theory to derive an unbiased estimator for the MSM transition matrix that corrects for the effect of starting out of equilibrium, even when short lag times are used. Finally, we show how the OOM framework can be used to estimate the exact eigenvalues or relaxation time scales of the system without estimating an MSM transition matrix, which allows us to practically assess the discretization quality of the MSM. Applications to model systems and molecular dynamics simulation data of alanine dipeptide are included for illustration. The improved MSM estimator is implemented in PyEMMA of version 2.3.

  17. Calculating Relativistic Transition Matrix Elements for Hydrogenic Atoms Using Monte Carlo Methods

    NASA Astrophysics Data System (ADS)

    Alexander, Steven; Coldwell, R. L.

    2015-03-01

    The nonrelativistic transition matrix elements for hydrogen atoms can be computed exactly and these expressions are given in a number of classic textbooks. The relativistic counterparts of these equations can also be computed exactly but these expressions have been described in only a few places in the literature. In part, this is because the relativistic equations lack the elegant simplicity of the nonrelativistic equations. In this poster I will describe how variational Monte Carlo methods can be used to calculate the energy and properties of relativistic hydrogen atoms and how the wavefunctions for these systems can be used to calculate transition matrix elements.

  18. 49 CFR 173.50 - Class 1-Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... insensitive that there is very little probability of initiation or of transition from burning to detonation under normal conditions of transport. 1 The probability of transition from burning to detonation is... contain only extremely insensitive detonating substances and which demonstrate a negligible probability of...

  19. An analysis of the wear behavior of SiC whisker reinforced alumina from 25 to 1200 C

    NASA Technical Reports Server (NTRS)

    Dellacorte, Christopher

    1991-01-01

    A model is described for predicting the wear behavior of whisker reinforced ceramics. The model was successfully applied to a silicon carbide whisker reinforced alumina ceramic composite subjected to sliding contact. The model compares the friction forces on the whiskers due to sliding, which act to pull or push them out of the matrix, to the clamping or compressive forces on the whiskers due to the matrix, which act to hold the whiskers in the composite. At low temperatures, the whiskers are held strongly in the matrix and are fractured into pieces during the wear process along with the matrix. At elevated temperatures differential thermal expansion between the whiskers and matrix can cause loosening of the whiskers and lead to pullout during the wear process and to higher wear. The model, which represents the combination of elastic stress analysis and a friction heating analysis, predicts a transition temperature at which the strength of the whiskers equals the clamping force holding them in the matrix. Above the transition the whiskers are pulled out of the matrix during sliding, and below the transition the whiskers are simply fractured. The existence of the transition gives rise to a dual wear mode or mechanism behavior for this material which was observed in laboratory experiments. The results from this model correlate well with experimentally observed behavior indicating that the model may be useful in obtaining a better understanding of material behavior and in making material improvements.

  20. An analysis of the wear behavior of SiC whisker-reinforced alumina from 25 to 1200 C

    NASA Technical Reports Server (NTRS)

    Dellacorte, Christopher

    1993-01-01

    A model is described for predicting the wear behavior of whisker reinforced ceramics. The model was successfully applied to a silicon carbide whisker reinforced alumina ceramic composite subjected to sliding contact. The model compares the friction forces on the whiskers due to sliding, which act to pull or push them out of the matrix, to the clamping or compressive forces on the whiskers due to the matrix, which act to hold the whiskers in the composite. At low temperatures, the whiskers are held strongly in the matrix and are fractured into pieces during the wear process along with the matrix. At elevated temperatures differential thermal expansion between the whiskers and matrix can cause loosening of the whiskers and lead to pullout during the wear process and to higher wear. The model, which represents the combination of elastic stress analysis and a friction heating analysis, predicts a transition temperature at which the strength of the whiskers equals the clamping force holding them in the matrix. Above the transition the whiskers are pulled out of the matrix during sliding, and below the transition the whiskers are simply fractured. The existence of the transition gives rise to a dual wear mode or mechanism behavior for this material which was observed in laboratory experiments. The results from this model correlate well with experimentally observed behavior indicating that the model may be useful in obtaining a better understanding of material behavior and in making material improvements.

  1. Generating an Empirical Probability Distribution for the Andrews-Pregibon Statistic.

    ERIC Educational Resources Information Center

    Jarrell, Michele G.

    A probability distribution was developed for the Andrews-Pregibon (AP) statistic. The statistic, developed by D. F. Andrews and D. Pregibon (1978), identifies multivariate outliers. It is a ratio of the determinant of the data matrix with an observation deleted to the determinant of the entire data matrix. Although the AP statistic has been used…

  2. Leaf optical system modeled as a stochastic process. [solar radiation interaction with terrestrial vegetation

    NASA Technical Reports Server (NTRS)

    Tucker, C. J.; Garratt, M. W.

    1977-01-01

    A stochastic leaf radiation model based upon physical and physiological properties of dicot leaves has been developed. The model accurately predicts the absorbed, reflected, and transmitted radiation of normal incidence as a function of wavelength resulting from the leaf-irradiance interaction over the spectral interval of 0.40-2.50 micron. The leaf optical system has been represented as Markov process with a unique transition matrix at each 0.01-micron increment between 0.40 micron and 2.50 micron. Probabilities are calculated at every wavelength interval from leaf thickness, structure, pigment composition, and water content. Simulation results indicate that this approach gives accurate estimations of actual measured values for dicot leaf absorption, reflection, and transmission as a function of wavelength.

  3. Transition probabilities for general birth-death processes with applications in ecology, genetics, and evolution

    PubMed Central

    Crawford, Forrest W.; Suchard, Marc A.

    2011-01-01

    A birth-death process is a continuous-time Markov chain that counts the number of particles in a system over time. In the general process with n current particles, a new particle is born with instantaneous rate λn and a particle dies with instantaneous rate μn. Currently no robust and efficient method exists to evaluate the finite-time transition probabilities in a general birth-death process with arbitrary birth and death rates. In this paper, we first revisit the theory of continued fractions to obtain expressions for the Laplace transforms of these transition probabilities and make explicit an important derivation connecting transition probabilities and continued fractions. We then develop an efficient algorithm for computing these probabilities that analyzes the error associated with approximations in the method. We demonstrate that this error-controlled method agrees with known solutions and outperforms previous approaches to computing these probabilities. Finally, we apply our novel method to several important problems in ecology, evolution, and genetics. PMID:21984359

  4. Hydrogeologic Unit Flow Characterization Using Transition Probability Geostatistics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jones, N L; Walker, J R; Carle, S F

    2003-11-21

    This paper describes a technique for applying the transition probability geostatistics method for stochastic simulation to a MODFLOW model. Transition probability geostatistics has several advantages over traditional indicator kriging methods including a simpler and more intuitive framework for interpreting geologic relationships and the ability to simulate juxtapositional tendencies such as fining upwards sequences. The indicator arrays generated by the transition probability simulation are converted to layer elevation and thickness arrays for use with the new Hydrogeologic Unit Flow (HUF) package in MODFLOW 2000. This makes it possible to preserve complex heterogeneity while using reasonably sized grids. An application of themore » technique involving probabilistic capture zone delineation for the Aberjona Aquifer in Woburn, Ma. is included.« less

  5. Reduced probabilities for E2 transitions between excited collective states of triaxial even–even nuclei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nadyrbekov, M. S., E-mail: nodirbekov@inp.uz; Bozarov, O. A.

    Reduced probabilities for intra- and interband E2 transitions in excited collective states of even–even lanthanide and actinide nuclei are analyzed on the basis of a model that admits an arbitrary triaxiality. They are studied in detail in the energy spectra of {sup 154}Sm, {sup 156}Gd, {sup 158}Dy, {sup 162,164}Er, {sup 230,232}Th, and {sup 232,234,236,238}U even–even nuclei. Theoretical and experimental values of the reduced probabilities for the respective E2 transitions are compared. This comparison shows good agreement for all states, including high-spin ones. The ratios of the reduced probabilities for the E2 transitions in question are compared with results following frommore » the Alaga rules. These comparisons make it possible to assess the sensitivity of the probabilities being considered to the presence of quadrupole deformations.« less

  6. Multilevel selection in a resource-based model.

    PubMed

    Ferreira, Fernando Fagundes; Campos, Paulo R A

    2013-07-01

    In the present work we investigate the emergence of cooperation in a multilevel selection model that assumes limiting resources. Following the work by R. J. Requejo and J. Camacho [Phys. Rev. Lett. 108, 038701 (2012)], the interaction among individuals is initially ruled by a prisoner's dilemma (PD) game. The payoff matrix may change, influenced by the resource availability, and hence may also evolve to a non-PD game. Furthermore, one assumes that the population is divided into groups, whose local dynamics is driven by the payoff matrix, whereas an intergroup competition results from the nonuniformity of the growth rate of groups. We study the probability that a single cooperator can invade and establish in a population initially dominated by defectors. Cooperation is strongly favored when group sizes are small. We observe the existence of a critical group size beyond which cooperation becomes counterselected. Although the critical size depends on the parameters of the model, it is seen that a saturation value for the critical group size is achieved. The results conform to the thought that the evolutionary history of life repeatedly involved transitions from smaller selective units to larger selective units.

  7. A network of discrete events for the representation and analysis of diffusion dynamics.

    PubMed

    Pintus, Alberto M; Pazzona, Federico G; Demontis, Pierfranco; Suffritti, Giuseppe B

    2015-11-14

    We developed a coarse-grained description of the phenomenology of diffusive processes, in terms of a space of discrete events and its representation as a network. Once a proper classification of the discrete events underlying the diffusive process is carried out, their transition matrix is calculated on the basis of molecular dynamics data. This matrix can be represented as a directed, weighted network where nodes represent discrete events, and the weight of edges is given by the probability that one follows the other. The structure of this network reflects dynamical properties of the process of interest in such features as its modularity and the entropy rate of nodes. As an example of the applicability of this conceptual framework, we discuss here the physics of diffusion of small non-polar molecules in a microporous material, in terms of the structure of the corresponding network of events, and explain on this basis the diffusivity trends observed. A quantitative account of these trends is obtained by considering the contribution of the various events to the displacement autocorrelation function.

  8. VizieR Online Data Catalog: KOI transit probabilities of multi-planet syst. (Brakensiek+, 2016)

    NASA Astrophysics Data System (ADS)

    Brakensiek, J.; Ragozzine, D.

    2016-06-01

    Using CORBITS, we computed the transit probabilities of all the KOIs with at least three candidate or confirmed transiting planets and report the results in Table 2 for a variety of inclination distributions. See section 4.6. (1 data file).

  9. Geometry in transition in four dimensions: A model of emergent geometry in the early universe

    NASA Astrophysics Data System (ADS)

    Ydri, Badis; Khaled, Ramda; Ahlam, Rouag

    2016-10-01

    We study a six matrix model with global S O (3 )×S O (3 ) symmetry containing at most quartic powers of the matrices. This theory exhibits a phase transition from a geometrical phase at low temperature to a Yang-Mills matrix phase with no background geometrical structure at high temperature. This is an exotic phase transition in the same universality class as the three matrix model but with important differences. The geometrical phase is determined dynamically, as the system cools, and is given by a fuzzy sphere background SN2×SN2, with an Abelian gauge field which is very weakly coupled to two normal scalar fields.

  10. On Schrödinger's bridge problem

    NASA Astrophysics Data System (ADS)

    Friedland, S.

    2017-11-01

    In the first part of this paper we generalize Georgiou-Pavon's result that a positive square matrix can be scaled uniquely to a column stochastic matrix which maps a given positive probability vector to another given positive probability vector. In the second part we prove that a positive quantum channel can be scaled to another positive quantum channel which maps a given positive definite density matrix to another given positive definite density matrix using Brouwer's fixed point theorem. This result proves the Georgiou-Pavon conjecture for two positive definite density matrices, made in their recent paper. We show that the fixed points are unique for certain pairs of positive definite density matrices. Bibliography: 15 titles.

  11. Discretized torsional dynamics and the folding of an RNA chain.

    PubMed

    Fernández, A; Salthú, R; Cendra, H

    1999-08-01

    The aim of this work is to implement a discrete coarse codification of local torsional states of the RNA chain backbone in order to explore the long-time limit dynamics and ultimately obtain a coarse solution to the RNA folding problem. A discrete representation of the soft-mode dynamics is turned into an algorithm for a rough structure prediction. The algorithm itself is inherently parallel, as it evaluates concurrent folding possibilities by pattern recognition, but it may be implemented in a personal computer as a chain of perturbation-translation-renormalization cycles performed on a binary matrix of local topological constraints. This requires suitable representational tools and a periodic quenching of the dynamics for system renormalization. A binary coding of local topological constraints associated with each structural motif is introduced, with each local topological constraint corresponding to a local torsional state. This treatment enables us to adopt a computation time step far larger than hydrodynamic drag time scales. Accordingly, the solvent is no longer treated as a hydrodynamic drag medium. Instead we incorporate its capacity for forming local conformation-dependent dielectric domains. Each translation of the matrix of local topological constraints (LTM's) depends on the conformation-dependent local dielectric created by a confined solvent. Folding pathways are resolved as transitions between patterns of locally encoded structural signals which change within the 1 ns-100 ms time scale range. These coarse folding pathways are generated by a search at regular intervals for structural patterns in the LTM. Each pattern is recorded as a base-pairing pattern (BPP) matrix, a consensus-evaluation operation subject to a renormalization feedback loop. Since several mutually conflicting consensus evaluations might occur at a given time, the need arises for a probabilistic approach appropriate for an ensemble of RNA molecules. Thus, a statistical dynamics of consensus formation is determined by the time evolution of the base pairing probability matrix. These dynamics are generated for a functional RNA molecule, a representative of the so-called group I ribozymes, in order to test the model. The resulting ensemble of conformations is sharply peaked and the most probable structure features the predominance of all phylogenetically conserved intrachain helices tantamount to ribozyme function. Furthermore, the magnesium-aided cooperativity that leads to the shaping of the catalytic core is elucidated. Once the predictive folding algorithm has been implemented, the validity of the so-called "adiabatic approximation" is tested. This approximation requires that conformational microstates be lumped up into BPP's which are treated as quasiequilibrium states, while folding pathways are coarsely represented as sequences of BPP transitions. To test the validity of this adiabatic ansatz, a computation of the coarse Shannon information entropy sigma associated to the specific partition of conformation space into BPP's is performed taking into account the LTM evolution and contrasted with the adiabatic computation. The results reveal a subordination of torsional microstate dynamics to BPP transitions within time scales relevant to folding. This adiabatic entrainment in the long-time limit is thus identified as responsible for the expediency of the folding process.

  12. Method of determining lanthanidies in a transition element host

    DOEpatents

    De Kalb, Edward L.; Fassel, Velmer A.

    1976-02-03

    A phosphor composition contains a lanthanide activator element within a host matrix having a transition element as a major component. The host matrix is composed of certain rare earth phosphates or vanadates such as YPO.sub.4 with a portion of the rare earth replaced with one or more of the transition elements. On X-ray or other electromagnetic excitation, trace lanthanide impurities or additives within the phosphor are spectrometrically determined from their characteristic luminescence.

  13. Tables of stark level transition probabilities and branching ratios in hydrogen-like atoms

    NASA Technical Reports Server (NTRS)

    Omidvar, K.

    1980-01-01

    The transition probabilities which are given in terms of n prime k prime and n k are tabulated. No additional summing or averaging is necessary. The electric quantum number k plays the role of the angular momentum quantum number l in the presence of an electric field. The branching ratios between stark levels are also tabulated. Necessary formulas for the transition probabilities and branching ratios are given. Symmetries are discussed and selection rules are given. Some disagreements for some branching ratios are found between the present calculation and the measurement of Mark and Wierl. The transition probability multiplied by the statistical weight of the initial state is called the static intensity J sub S, while the branching ratios are called the dynamic intensity J sub D.

  14. Transition probability, dynamic regimes, and the critical point of financial crisis

    NASA Astrophysics Data System (ADS)

    Tang, Yinan; Chen, Ping

    2015-07-01

    An empirical and theoretical analysis of financial crises is conducted based on statistical mechanics in non-equilibrium physics. The transition probability provides a new tool for diagnosing a changing market. Both calm and turbulent markets can be described by the birth-death process for price movements driven by identical agents. The transition probability in a time window can be estimated from stock market indexes. Positive and negative feedback trading behaviors can be revealed by the upper and lower curves in transition probability. Three dynamic regimes are discovered from two time periods including linear, quasi-linear, and nonlinear patterns. There is a clear link between liberalization policy and market nonlinearity. Numerical estimation of a market turning point is close to the historical event of the US 2008 financial crisis.

  15. Current recommendations on the estimation of transition probabilities in Markov cohort models for use in health care decision-making: a targeted literature review.

    PubMed

    Olariu, Elena; Cadwell, Kevin K; Hancock, Elizabeth; Trueman, David; Chevrou-Severac, Helene

    2017-01-01

    Although Markov cohort models represent one of the most common forms of decision-analytic models used in health care decision-making, correct implementation of such models requires reliable estimation of transition probabilities. This study sought to identify consensus statements or guidelines that detail how such transition probability matrices should be estimated. A literature review was performed to identify relevant publications in the following databases: Medline, Embase, the Cochrane Library, and PubMed. Electronic searches were supplemented by manual-searches of health technology assessment (HTA) websites in Australia, Belgium, Canada, France, Germany, Ireland, Norway, Portugal, Sweden, and the UK. One reviewer assessed studies for eligibility. Of the 1,931 citations identified in the electronic searches, no studies met the inclusion criteria for full-text review, and no guidelines on transition probabilities in Markov models were identified. Manual-searching of the websites of HTA agencies identified ten guidelines on economic evaluations (Australia, Belgium, Canada, France, Germany, Ireland, Norway, Portugal, Sweden, and UK). All identified guidelines provided general guidance on how to develop economic models, but none provided guidance on the calculation of transition probabilities. One relevant publication was identified following review of the reference lists of HTA agency guidelines: the International Society for Pharmacoeconomics and Outcomes Research taskforce guidance. This provided limited guidance on the use of rates and probabilities. There is limited formal guidance available on the estimation of transition probabilities for use in decision-analytic models. Given the increasing importance of cost-effectiveness analysis in the decision-making processes of HTA bodies and other medical decision-makers, there is a need for additional guidance to inform a more consistent approach to decision-analytic modeling. Further research should be done to develop more detailed guidelines on the estimation of transition probabilities.

  16. Random matrix theory for transition strengths: Applications and open questions

    NASA Astrophysics Data System (ADS)

    Kota, V. K. B.

    2017-12-01

    Embedded random matrix ensembles are generic models for describing statistical properties of finite isolated interacting quantum many-particle systems. A finite quantum system, induced by a transition operator, makes transitions from its states to the states of the same system or to those of another system. Examples are electromagnetic transitions (then the initial and final systems are same), nuclear beta and double beta decay (then the initial and final systems are different) and so on. Using embedded ensembles (EE), there are efforts to derive a good statistical theory for transition strengths. With m fermions (or bosons) in N mean-field single particle levels and interacting via two-body forces, we have with GOE embedding, the so called EGOE(1+2). Now, the transition strength density (transition strength multiplied by the density of states at the initial and final energies) is a convolution of the density generated by the mean-field one-body part with a bivariate spreading function due to the two-body interaction. Using the embedding U(N) algebra, it is established, for a variety of transition operators, that the spreading function, for sufficiently strong interactions, is close to a bivariate Gaussian. Also, as the interaction strength increases, the spreading function exhibits a transition from bivariate Breit-Wigner to bivariate Gaussian form. In appropriate limits, this EE theory reduces to the polynomial theory of Draayer, French and Wong on one hand and to the theory due to Flambaum and Izrailev for one-body transition operators on the other. Using spin-cutoff factors for projecting angular momentum, the theory is applied to nuclear matrix elements for neutrinoless double beta decay (NDBD). In this paper we will describe: (i) various developments in the EE theory for transition strengths; (ii) results for nuclear matrix elements for 130Te and 136Xe NDBD; (iii) important open questions in the current form of the EE theory.

  17. Transition probabilities of Br II

    NASA Technical Reports Server (NTRS)

    Bengtson, R. D.; Miller, M. H.

    1976-01-01

    Absolute transition probabilities of the three most prominent visible Br II lines are measured in emission. Results compare well with Coulomb approximations and with line strengths extrapolated from trends in homologous atoms.

  18. Corrigendum to ;Relativistic calculations for M1-type transitions in 4dN configurations of W29+ - W37+ ions; [At. Data Nucl. Data Tables 98 (2012) 19-42

    NASA Astrophysics Data System (ADS)

    Jonauskas, V.; Gaigalas, G.; Kučas, S.

    2018-01-01

    In the original paper [1], some minor misprints have occurred in Table 3 for wavelengths of the W32+ and W34+ ions. Furthermore, from the FAC calculations, the emission probabilities instead ofabsorption probabilities were presented (Table 3). The wavelengths, transition probabilities and oscillator strengths of magnetic dipole transitions were misprinted for W31+, W32+, W33+, and W34+ in Table 4.

  19. Structural, mechanical and corrosion studies of Cr-rich inclusions in 152 cladding of dissimilar metal weld joint

    NASA Astrophysics Data System (ADS)

    Li, Yifeng; Wang, Jianqiu; Han, En-Hou; Yang, Chengdong

    2018-01-01

    Cr-rich inclusions were discovered in 152 cladding at the inner wall of domestic dissimilar metal weld joint, and their morphologies, microstructures, mechanical properties and corrosion behaviors were systematically characterized by SEM, TEM, nanoindentation and FIB. The results indicate that the Cr-rich inclusions originate from large-size Cr particles in 152 welding electrode flux, and they are 50-150 μm in size in most cases, and there is a continuous transition zone of 2-5 μm in width between the Cr inclusion core and 152 cladding matrix, and the transition zone consists of Ni & Fe-rich dendritic austenite and Cr23C6 and Cr matrix. The transition zone has the highest nanoindentation hardness (7.66 GPa), which is much harder than the inclusion core (5.14 GPa) and 152 cladding (3.71 GPa). In-situ microscopic tensile tests show that cracks initialize preferentially in transition zone, and then propagate into the inclusion core, and creep further into 152 cladding after penetrating the core area. The inclusion core and its transition zone both share similar oxide film structure with nickel-base 152 cladding matrix in simulated primary water, while those two parts present better general corrosion resistance than 152 cladding matrix due to higher Cr concentration.

  20. Deterioration and cost information for bridge management.

    DOT National Transportation Integrated Search

    2012-05-01

    This study applies contract bid tabulations and elementlevel condition records to develop elementlevel actions, : costs for actions, transition probabilities for models of deterioration of bridge elements, and transition probabilities : for imp...

  1. Activated phosphors having matrices of yttrium-transition metal compound

    DOEpatents

    De Kalb, E.L.; Fassel, V.A.

    1975-07-01

    A method is described for preparing a phosphor composition containing a lanthanide activator element with a host matrix having a transition element as a major component. The host matrix is composed of certain rare earth phosphates or vanadates such as YPO$sub 4$ with a portion of the rare earth replaced with one or more of the transition elements. On x-ray or other electromagnetic excitation, trace lanthanide impurities or additives within the phosphor are spectrometrically determined from their characteristic luminescence. (auth)

  2. Closed-form integrator for the quaternion (euler angle) kinematics equations

    NASA Technical Reports Server (NTRS)

    Whitmore, Stephen A. (Inventor)

    2000-01-01

    The invention is embodied in a method of integrating kinematics equations for updating a set of vehicle attitude angles of a vehicle using 3-dimensional angular velocities of the vehicle, which includes computing an integrating factor matrix from quantities corresponding to the 3-dimensional angular velocities, computing a total integrated angular rate from the quantities corresponding to a 3-dimensional angular velocities, computing a state transition matrix as a sum of (a) a first complementary function of the total integrated angular rate and (b) the integrating factor matrix multiplied by a second complementary function of the total integrated angular rate, and updating the set of vehicle attitude angles using the state transition matrix. Preferably, the method further includes computing a quanternion vector from the quantities corresponding to the 3-dimensional angular velocities, in which case the updating of the set of vehicle attitude angles using the state transition matrix is carried out by (a) updating the quanternion vector by multiplying the quanternion vector by the state transition matrix to produce an updated quanternion vector and (b) computing an updated set of vehicle attitude angles from the updated quanternion vector. The first and second trigonometric functions are complementary, such as a sine and a cosine. The quantities corresponding to the 3-dimensional angular velocities include respective averages of the 3-dimensional angular velocities over plural time frames. The updating of the quanternion vector preserves the norm of the vector, whereby the updated set of vehicle attitude angles are virtually error-free.

  3. Prospective prediction of children's smoking transitions: role of parents' and older siblings' smoking.

    PubMed

    Bricker, Jonathan B; Peterson, Arthur V; Leroux, Brian G; Andersen, M Robyn; Rajan, K Bharat; Sarason, Irwin G

    2006-01-01

    To use a novel social epidemic probability model to investigate longitudinally the extent to which parents' and older siblings' smoking predict children's smoking transitions. Parents' and older siblings' smoking status was assessed when children were in 3rd grade (baseline). Three smoking transitions were assessed over the period of child/adolescent smoking acquisition (up to 12th grade): (1) transition from never smoking to trying smoking, (2) transition from trying to monthly smoking and (3) transition from monthly to daily smoking. Forty Washington State school districts participating in the long term Hutchinson Smoking Prevention Project (HSPP). Participants were the 5520 families for whom data on both parents' and older siblings' baseline smoking status, as well as on children's smoking transitions, were available. The probability that a smoking parent influenced their child to make the first transition to trying smoking was 32% (95% CI: 27%, 36%); to make the second transition from trying to monthly smoking, 15% (95% CI: 10%, 19%); and to make the third transition from monthly to daily smoking, 28% (95% CI: 21%, 34%). The probability that an older sibling influenced a child to make the first transition to trying smoking was 29% (95% CI: 17%, 39%); to make the second transition from trying to monthly smoking, 0% (95% CI: 0%, 8%); and to make the third transition from monthly to daily smoking, 20% (95% CI: 4%, 33%). In contrast to previous research, the results provide new evidence suggesting that family smoking influences both initiation and escalation of children's smoking. Results also quantify, in terms of probabilities, the importance of parents' and older siblings' smoking on children's three major smoking transitions. Parents' smoking, as well as older siblings' smoking, are important behaviors to target in preventing adolescents from making smoking transitions.

  4. Radiative one- and two-electron transitions into the empty K shell of He-like ions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kadrekar, Riddhi; Natarajan, L.

    2011-12-15

    The branching ratios between the single and double electron radiative transitions to empty K shell in He-like ions with 2s2p configuration are evaluated for 15 ions with 4{<=}Z{<=}26 using fully relativistic multiconfiguration Dirac-Fock wavefunctions in the active space approximation. The effects of configuration interaction and Breit contributions on the transition parameters have been analyzed in detail. Though the influence of Breit interaction on the electric dipole allowed one-electron radiative transitions is negligible, it substantially changes the spin-forbidden rates and the two-electron one-photon transition probabilities. Also, while the single electron transition rates are gauge independent, the correlated double-electron probabilities are foundmore » to be gauge sensitive. The probable uncertainties in the computed transition rates have been evaluated by considering the line strengths and the differences between the calculated and experimental transition energies as accuracy indicators. The present results are compared with other available experimental and theoretical data.« less

  5. Multipartite entanglement characterization of a quantum phase transition

    NASA Astrophysics Data System (ADS)

    Costantini, G.; Facchi, P.; Florio, G.; Pascazio, S.

    2007-07-01

    A probability density characterization of multipartite entanglement is tested on the one-dimensional quantum Ising model in a transverse field. The average and second moment of the probability distribution are numerically shown to be good indicators of the quantum phase transition. We comment on multipartite entanglement generation at a quantum phase transition.

  6. Mining Top K Spread Sources for a Specific Topic and a Given Node.

    PubMed

    Liu, Weiwei; Deng, Zhi-Hong; Cao, Longbing; Xu, Xiaoran; Liu, He; Gong, Xiuwen

    2015-11-01

    In social networks, nodes (or users) interested in specific topics are often influenced by others. The influence is usually associated with a set of nodes rather than a single one. An interesting but challenging task for any given topic and node is to find the set of nodes that represents the source or trigger for the topic and thus identify those nodes that have the greatest influence on the given node as the topic spreads. We find that it is an NP-hard problem. This paper proposes an effective framework to deal with this problem. First, the topic propagation is represented as the Bayesian network. We then construct the propagation model by a variant of the voter model. The probability transition matrix (PTM) algorithm is presented to conduct the probability inference with the complexity O(θ(3)log2θ), while θ is the number nodes in the given graph. To evaluate the PTM algorithm, we conduct extensive experiments on real datasets. The experimental results show that the PTM algorithm is both effective and efficient.

  7. Exact representation of the asymptotic drift speed and diffusion matrix for a class of velocity-jump processes

    NASA Astrophysics Data System (ADS)

    Mascia, Corrado

    2016-01-01

    This paper examines a class of linear hyperbolic systems which generalizes the Goldstein-Kac model to an arbitrary finite number of speeds vi with transition rates μij. Under the basic assumptions that the transition matrix is symmetric and irreducible, and the differences vi -vj generate all the space, the system exhibits a large-time behavior described by a parabolic advection-diffusion equation. The main contribution is to determine explicit formulas for the asymptotic drift speed and diffusion matrix in term of the kinetic parameters vi and μij, establishing a complete connection between microscopic and macroscopic coefficients. It is shown that the drift speed is the arithmetic mean of the velocities vi. The diffusion matrix has a more complicate representation, based on the graph with vertices the velocities vi and arcs weighted by the transition rates μij. The approach is based on an exhaustive analysis of the dispersion relation and on the application of a variant of the Kirchoff's matrix tree Theorem from graph theory.

  8. Photoinduced dynamics to photoluminescence in Ln3+ (Ln = Ce, Pr) doped β-NaYF4 nanocrystals computed in basis of non-collinear spin DFT with spin-orbit coupling

    NASA Astrophysics Data System (ADS)

    Han, Yulun; Vogel, Dayton J.; Inerbaev, Talgat M.; May, P. Stanley; Berry, Mary T.; Kilin, Dmitri S.

    2018-03-01

    In this work, non-collinear spin DFT + U approaches with spin-orbit coupling (SOC) are applied to Ln3+ doped β-NaYF4 (Ln = Ce, Pr) nanocrystals in Vienna ab initio Simulation Package taking into account unpaired spin configurations using the Perdew-Burke-Ernzerhof functional in a plane wave basis set. The calculated absorption spectra from non-collinear spin DFT + U approaches are compared with that from spin-polarised DFT + U approaches. The spectral difference indicates the importance of spin-flip transitions of Ln3+ ions. Suite of codes for nonadiabatic dynamics has been developed for 2-component spinor orbitals. On-the-fly nonadiabatic coupling calculations provide transition probabilities facilitated by nuclear motion. Relaxation rates of electrons and holes are calculated using Redfield theory in the reduced density matrix formalism cast in the basis of non-collinear spin DFT + U with SOC. The emission spectra are calculated using the time-integrated method along the excited state trajectories based on nonadiabatic couplings.

  9. Calculation of transmission probability by solving an eigenvalue problem

    NASA Astrophysics Data System (ADS)

    Bubin, Sergiy; Varga, Kálmán

    2010-11-01

    The electron transmission probability in nanodevices is calculated by solving an eigenvalue problem. The eigenvalues are the transmission probabilities and the number of nonzero eigenvalues is equal to the number of open quantum transmission eigenchannels. The number of open eigenchannels is typically a few dozen at most, thus the computational cost amounts to the calculation of a few outer eigenvalues of a complex Hermitian matrix (the transmission matrix). The method is implemented on a real space grid basis providing an alternative to localized atomic orbital based quantum transport calculations. Numerical examples are presented to illustrate the efficiency of the method.

  10. Electronic spectroscopy of diatomic molecules

    NASA Technical Reports Server (NTRS)

    Partridge, Harry; Langhoff, Stephen R.; Bauschlicher, Charles W., Jr.

    1994-01-01

    This article provides an overview of the principal computational approaches and their accuracy for the study of electronic spectroscopy of diatomic molecules. We include a number of examples from our work that illustrate the range of application. We show how full configuration interaction benchmark calculations were instrumental in improving the understanding of the computational requirements for obtaining accurate results for diatomic spectroscopy. With this understanding it is now possible to compute radiative lifetimes accurate to within 10% for systems involving first- and second-row atoms. We consider the determination of the infrared vibrational transition probabilities for the ground states of SiO and NO, based on a globally accurate dipole moment function. We show how we were able to assign the a(sup "5)II state of CO as the upper state in the recently observed emission bands of CO in an Ar matrix. We next discuss the assignment of the photoelectron detachment spectra of NO and the alkali oxide negative ions. We then present several examples illustrating the state-of-the-art in determining radiative lifetimes for valence-valence and valence-Rydberg transitions. We next compare the molecular spectroscopy of the valence isoelectronic B2, Al2, and AlB molecules. The final examples consider systems involving transition metal atoms, which illustrate the difficulty in describing states with different numbers of d electrons.

  11. Optical absorption and photoluminescence properties of Nd3+ doped mixed alkali phosphate glasses-spectroscopic investigations.

    PubMed

    Ratnakaram, Y C; Srihari, N V; Kumar, A Vijaya; Naidu, D Thirupathi; Chakradhar, R P S

    2009-02-01

    Spectroscopic investigations were performed on 68NH(4)H(2)PO(4).xLi(2)CO(3)(30-x)K(2)CO(3) and 68NH(4)H(2)PO(4).xNa(2)CO(3)(30-x)K(2)CO(3) (where x=5, 10, 15, 20 and 25) glasses containing 2 mol% Nd(2)O(3). Various spectroscopic parameters (Racah (E(1), E(2), E(3)), spin-orbit (xi(4f)) and configuration interaction (alpha)) are reported. Judd-Ofelt intensity parameters (Omega(2), Omega(4), Omega(6)) are calculated for Nd(3+) doped two mixed alkali phosphate glass matrices. From the magnitude of Judd-Ofelt parameters, covalency is studied as a function of x in the glass matrix. Using Judd-Ofelt intensity parameters, total radiative transition probabilities (A(T)), radiative lifetimes (tau(R)), branching ratios (beta) and integrated absorption cross sections (Sigma) have been computed for certain excited states of Nd(3+) in these mixed alkali phosphate glasses. Emission cross sections (sigma(P)) are calculated for the two transitions, (4)G(7/2)-->(4)I(11/2) and (4)G(7/2)-->(4)I(13/2) of Nd(3+) in these mixed alkali phosphate glasses. Optical band gaps (E(opt)) for direct and indirect transitions are reported.

  12. Hanle-Zeeman Scattering Matrix for Magnetic Dipole Transitions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Megha, A.; Sampoorna, M.; Nagendra, K. N.

    2017-06-01

    The polarization of the light that is scattered by the coronal ions is influenced by the anisotropic illumination from the photosphere and the magnetic field structuring in the solar corona. The properties of the coronal magnetic fields can be well studied by understanding the polarization properties of coronal forbidden emission lines that arise from magnetic dipole ( M 1) transitions in the highly ionized atoms that are present in the corona. We present the classical scattering theory of the forbidden lines for a more general case of arbitrary-strength magnetic fields. We derive the scattering matrix for M 1 transitions usingmore » the classical magnetic dipole model of Casini and Lin and applying the scattering matrix approach of Stenflo. We consider a two-level atom model and neglect collisional effects. The scattering matrix so derived is used to study the Stokes profiles formed in coronal conditions in those regions where the radiative excitations dominate collisional excitations. To this end, we take into account the integration over a cone of an unpolarized radiation from the solar disk incident on the scattering atoms. Furthermore, we also integrate along the line of sight to calculate the emerging polarized line profiles. We consider radial and dipole magnetic field configurations and spherically symmetric density distributions. For our studies we adopt the atomic parameters corresponding to the [Fe xiii] 10747 Å coronal forbidden line. We also discuss the nature of the scattering matrix for M 1 transitions and compare it with that for the electric dipole ( E 1) transitions.« less

  13. Reliability analysis of redundant systems. [a method to compute transition probabilities

    NASA Technical Reports Server (NTRS)

    Yeh, H. Y.

    1974-01-01

    A method is proposed to compute the transition probability (the probability of partial or total failure) of parallel redundant system. The effect of geometry of the system, the direction of load, and the degree of redundancy on the probability of complete survival of parachute-like system are also studied. The results show that the probability of complete survival of three-member parachute-like system is very sensitive to the variation of horizontal angle of the load. However, it becomes very insignificant as the degree of redundancy increases.

  14. Parameter retrieval of chiral metamaterials based on the state-space approach.

    PubMed

    Zarifi, Davoud; Soleimani, Mohammad; Abdolali, Ali

    2013-08-01

    This paper deals with the introduction of an approach for the electromagnetic characterization of homogeneous chiral layers. The proposed method is based on the state-space approach and properties of a 4×4 state transition matrix. Based on this, first, the forward problem analysis through the state-space method is reviewed and properties of the state transition matrix of a chiral layer are presented and proved as two theorems. The formulation of a proposed electromagnetic characterization method is then presented. In this method, scattering data for a linearly polarized plane wave incident normally on a homogeneous chiral slab are combined with properties of a state transition matrix and provide a powerful characterization method. The main difference with respect to other well-established retrieval procedures based on the use of the scattering parameters relies on the direct computation of the transfer matrix of the slab as opposed to the conventional calculation of the propagation constant and impedance of the modes supported by the medium. The proposed approach allows avoiding nonlinearity of the problem but requires getting enough equations to fulfill the task which was provided by considering some properties of the state transition matrix. To demonstrate the applicability and validity of the method, the constitutive parameters of two well-known dispersive chiral metamaterial structures at microwave frequencies are retrieved. The results show that the proposed method is robust and reliable.

  15. Correlation of structural properties with energy transfer of Eu-doped ZnO thin films prepared by sol-gel process and magnetron reactive sputtering

    PubMed Central

    Petersen, Julien; Brimont, Christelle; Gallart, Mathieu; Schmerber, Guy; Gilliot, Pierre; Ulhaq-Bouillet, Corinne; Rehspringer, Jean-Luc; Colis, Silviu; Becker, Claude; Slaoui, Abdelillah; Dinia, Aziz

    2010-01-01

    We investigated the structural and optical properties of Eu-doped ZnO thin films made by sol-gel technique and magnetron reactive sputtering on Si (100) substrate. The films elaborated by sol-gel process are polycrystalline while the films made by sputtering show a strongly textured growth along the c-axis. X-ray diffraction patterns and transmission electron microscopy analysis show that all samples are free of spurious phases. The presence of Eu2+ and Eu3+ into the ZnO matrix has been confirmed by x-ray photoemission spectroscopy. This means that a small fraction of Europium substitutes Zn2+ as Eu2+ into the ZnO matrix; the rest of Eu being in the trivalent state. This is probably due to the formation of Eu2O3 oxide at the surface of ZnO particles. This is at the origin of the strong photoluminescence band observed at 2 eV, which is characteristic of the 5D0→7F2 Eu3+ transition. In addition the photoluminescence excitonic spectra showed efficient energy transfer from the ZnO matrix to the Eu3+ ion, which is qualitatively similar for both films although the sputtered films have a better structural quality compared to the sol-gel process grown films. PMID:20644657

  16. Random Matrix Approach to Quantum Adiabatic Evolution Algorithms

    NASA Technical Reports Server (NTRS)

    Boulatov, Alexei; Smelyanskiy, Vadier N.

    2004-01-01

    We analyze the power of quantum adiabatic evolution algorithms (Q-QA) for solving random NP-hard optimization problems within a theoretical framework based on the random matrix theory (RMT). We present two types of the driven RMT models. In the first model, the driving Hamiltonian is represented by Brownian motion in the matrix space. We use the Brownian motion model to obtain a description of multiple avoided crossing phenomena. We show that the failure mechanism of the QAA is due to the interaction of the ground state with the "cloud" formed by all the excited states, confirming that in the driven RMT models. the Landau-Zener mechanism of dissipation is not important. We show that the QAEA has a finite probability of success in a certain range of parameters. implying the polynomial complexity of the algorithm. The second model corresponds to the standard QAEA with the problem Hamiltonian taken from the Gaussian Unitary RMT ensemble (GUE). We show that the level dynamics in this model can be mapped onto the dynamics in the Brownian motion model. However, the driven RMT model always leads to the exponential complexity of the algorithm due to the presence of the long-range intertemporal correlations of the eigenvalues. Our results indicate that the weakness of effective transitions is the leading effect that can make the Markovian type QAEA successful.

  17. Efficient cooperative compressive spectrum sensing by identifying multi-candidate and exploiting deterministic matrix

    NASA Astrophysics Data System (ADS)

    Li, Jia; Wang, Qiang; Yan, Wenjie; Shen, Yi

    2015-12-01

    Cooperative spectrum sensing exploits the spatial diversity to improve the detection of occupied channels in cognitive radio networks (CRNs). Cooperative compressive spectrum sensing (CCSS) utilizing the sparsity of channel occupancy further improves the efficiency by reducing the number of reports without degrading detection performance. In this paper, we firstly and mainly propose the referred multi-candidate orthogonal matrix matching pursuit (MOMMP) algorithms to efficiently and effectively detect occupied channels at fusion center (FC), where multi-candidate identification and orthogonal projection are utilized to respectively reduce the number of required iterations and improve the probability of exact identification. Secondly, two common but different approaches based on threshold and Gaussian distribution are introduced to realize the multi-candidate identification. Moreover, to improve the detection accuracy and energy efficiency, we propose the matrix construction based on shrinkage and gradient descent (MCSGD) algorithm to provide a deterministic filter coefficient matrix of low t-average coherence. Finally, several numerical simulations validate that our proposals provide satisfactory performance with higher probability of detection, lower probability of false alarm and less detection time.

  18. ZnFe2O4 nanoparticles dispersed in a highly porous silica aerogel matrix: a magnetic study.

    PubMed

    Bullita, S; Casu, A; Casula, M F; Concas, G; Congiu, F; Corrias, A; Falqui, A; Loche, D; Marras, C

    2014-03-14

    We report the detailed structural characterization and magnetic investigation of nanocrystalline zinc ferrite nanoparticles supported on a silica aerogel porous matrix which differ in size (in the range 4-11 nm) and the inversion degree (from 0.4 to 0.2) as compared to bulk zinc ferrite which has a normal spinel structure. The samples were investigated by zero-field-cooling-field-cooling, thermo-remnant DC magnetization measurements, AC magnetization investigation and Mössbauer spectroscopy. The nanocomposites are superparamagnetic at room temperature; the temperature of the superparamagnetic transition in the samples decreases with the particle size and therefore it is mainly determined by the inversion degree rather than by the particle size, which would give an opposite effect on the blocking temperature. The contribution of particle interaction to the magnetic behavior of the nanocomposites decreases significantly in the sample with the largest particle size. The values of the anisotropy constant give evidence that the anisotropy constant decreases upon increasing the particle size of the samples. All these results clearly indicate that, even when dispersed with low concentration in a non-magnetic and highly porous and insulating matrix, the zinc ferrite nanoparticles show a magnetic behavior similar to that displayed when they are unsupported or dispersed in a similar but denser matrix, and with higher loading. The effective anisotropy measured for our samples appears to be systematically higher than that measured for supported zinc ferrite nanoparticles of similar size, indicating that this effect probably occurs as a consequence of the high inversion degree.

  19. Oscillation properties of active and sterile neutrinos and neutrino anomalies at short distances

    NASA Astrophysics Data System (ADS)

    Khruschov, V. V.; Fomichev, S. V.; Titov, O. A.

    2016-09-01

    A generalized phenomenological (3 + 2 + 1) model featuring three active and three sterile neutrinos that is intended for calculating oscillation properties of neutrinos for the case of a normal activeneutrino mass hierarchy and a large splitting between the mass of one sterile neutrino and the masses of the other two sterile neutrinos is considered. A new parametrization and a specific form of the general mixing matrix are proposed for active and sterile neutrinos with allowance for possible CP violation in the lepton sector, and test values are chosen for the neutrino masses and mixing parameters. The probabilities for the transitions between different neutrino flavors are calculated, and graphs representing the probabilities for the disappearance of muon neutrinos/antineutrinos and the appearance of electron neutrinos/antineutrinos in a beam of muon neutrinos/antineutrinos versus the distance from the neutrino source for various values of admissible model parameters at neutrino energies not higher than 50 MeV, as well as versus the ratio of this distance to the neutrino energy, are plotted. It is shown that the short-distance accelerator anomaly in neutrino data (LNSD anomaly) can be explained in the case of a specific mixing matrix for active and sterile neutrinos (which belongs to the a 2 type) at the chosen parameter values. The same applies to the short-distance reactor and gallium anomalies. The theoretical results obtained in the present study can be used to interpret and predict the results of ground-based neutrino experiments aimed at searches for sterile neutrinos, as well as to analyze some astrophysical observational data.

  20. Synthetic Division and Matrix Factorization

    ERIC Educational Resources Information Center

    Barabe, Samuel; Dubeau, Franc

    2007-01-01

    Synthetic division is viewed as a change of basis for polynomials written under the Newton form. Then, the transition matrices obtained from a sequence of changes of basis are used to factorize the inverse of a bidiagonal matrix or a block bidiagonal matrix.

  1. Dipole moments and transition probabilities of the a 3Sigma(+)g - b 3Sigma(+)u system of molecular hydrogen

    NASA Technical Reports Server (NTRS)

    Guberman, S.; Dalgarno, A.; Posen, A.; Kwok, T. L.

    1986-01-01

    Multiconfiguration variational calculations of the electronic wave functions of the a 3Sigma(+)g and b 3Sigma(+)u states of molecular hydrogen are presented, and the electric dipole transition moment between them (of interest in connection with stellar atmospheres and the UV spectrum of the Jovian planets) is obtained. The dipole moment is used to calculate the probabilities of radiative transitions from the discrete vibrational levels of the a 3Sigma(+)g state to the vibrational continuum of the repulsive b 3Sigma(+)u state as functions of the wavelength of the emitted photons. The total transition probabilities and radiative lifetimes of the levels v prime = 0-20 are presented.

  2. Anomalous expansion of Nb nanowires in a NiTi matrix under high pressure

    DOE PAGES

    Yu, Cun; Ren, Yang; Cui, Lishan; ...

    2016-10-17

    Under high pressure, materials usually shrink during compression as described by an equation of state. Here, we present the anomalous volume expansion behavior of a one-dimensional Nb nanowire embedded in a NiTi transforming matrix, while the matrix undergoes a pressure-induced martensitic transformation. The Nb volume expansion depends on the NiTi transition pressure range from the matrix, which is controlled by the shear strain induced by different pressure transmitting media. The transformation-induced interfacial stresses between Nb and NiTi may play a major role in this anomaly. In conclusion, our discovery sheds new light on the nano-interfacial effect on mechanical anomalies inmore » heterogeneous systems during a pressure-induced phase transition.« less

  3. The reduced transition probabilities for excited states of rare-earths and actinide even-even nuclei

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghumman, S. S.

    The theoretical B(E2) ratios have been calculated on DF, DR and Krutov models. A simple method based on the work of Arima and Iachello is used to calculate the reduced transition probabilities within SU(3) limit of IBA-I framework. The reduced E2 transition probabilities from second excited states of rare-earths and actinide even–even nuclei calculated from experimental energies and intensities from recent data, have been found to compare better with those calculated on the Krutov model and the SU(3) limit of IBA than the DR and DF models.

  4. [Succession caused by beaver (Castor fiber L.) life activity: I. What is learnt from the calibration of a simple Markov model].

    PubMed

    Logofet, D O; Evstigneev, O I; Aleĭnikov, A A; Morozova, A O

    2014-01-01

    A homogeneous Markov chain of three aggregated states "pond--swamp--wood" is proposed as a model of cyclic zoogenic successions caused by beaver (Castor fiber L.) life activity in a forest biogeocoenosis. To calibrate the chain transition matrix, the data have appeared sufficient that were gained from field studies undertaken in "Bryanskii Les" Reserve in the years of 2002-2008. Major outcomes of the calibrated model ensue from the formulae of finite homogeneous Markov chain theory: the stationary probability distribution of states, thematrix (T) of mean first passage times, and the mean durations (M(j)) of succession stages. The former illustrates the distribution of relative areas under succession stages if the current trends and transition rates of succession are conserved in the long-term--it has appeared close to the observed distribution. Matrix T provides for quantitative characteristics of the cyclic process, specifying the ranges the experts proposed for the duration of stages in the conceptual scheme of succession. The calculated values of M(j) detect potential discrepancies between empirical data, the expert knowledge that summarizes the data, and the postulates accepted in the mathematical model. The calculated M2 value falls outside the expert range, which gives a reason to doubt the validity of expert estimation proposed, the aggregation mode chosen for chain states, or/and the accuracy-of data available, i.e., to draw certain "lessons" from partially successful calibration. Refusal to postulate the time homogeneity or the Markov property of the chain is also discussed among possible ways to improve the model.

  5. Computational modelling of large deformations in layered-silicate/PET nanocomposites near the glass transition

    NASA Astrophysics Data System (ADS)

    Figiel, Łukasz; Dunne, Fionn P. E.; Buckley, C. Paul

    2010-01-01

    Layered-silicate nanoparticles offer a cost-effective reinforcement for thermoplastics. Computational modelling has been employed to study large deformations in layered-silicate/poly(ethylene terephthalate) (PET) nanocomposites near the glass transition, as would be experienced during industrial forming processes such as thermoforming or injection stretch blow moulding. Non-linear numerical modelling was applied, to predict the macroscopic large deformation behaviour, with morphology evolution and deformation occurring at the microscopic level, using the representative volume element (RVE) approach. A physically based elasto-viscoplastic constitutive model, describing the behaviour of the PET matrix within the RVE, was numerically implemented into a finite element solver (ABAQUS) using an UMAT subroutine. The implementation was designed to be robust, for accommodating large rotations and stretches of the matrix local to, and between, the nanoparticles. The nanocomposite morphology was reconstructed at the RVE level using a Monte-Carlo-based algorithm that placed straight, high-aspect ratio particles according to the specified orientation and volume fraction, with the assumption of periodicity. Computational experiments using this methodology enabled prediction of the strain-stiffening behaviour of the nanocomposite, observed experimentally, as functions of strain, strain rate, temperature and particle volume fraction. These results revealed the probable origins of the enhanced strain stiffening observed: (a) evolution of the morphology (through particle re-orientation) and (b) early onset of stress-induced pre-crystallization (and hence lock-up of viscous flow), triggered by the presence of particles. The computational model enabled prediction of the effects of process parameters (strain rate, temperature) on evolution of the morphology, and hence on the end-use properties.

  6. Non-adiabatic dynamics around a conical intersection with surface-hopping coupled coherent states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de

    A surface-hopping extension of the coupled coherent states-method [D. Shalashilin and M. Child, Chem. Phys. 304, 103-120 (2004)] for simulating non-adiabatic dynamics with quantum effects of the nuclei is put forward. The time-dependent Schrödinger equation for the motion of the nuclei is solved in a moving basis set. The basis set is guided by classical trajectories, which can hop stochastically between different electronic potential energy surfaces. The non-adiabatic transitions are modelled by a modified version of Tully’s fewest switches algorithm. The trajectories consist of Gaussians in the phase space of the nuclei (coherent states) combined with amplitudes for an electronicmore » wave function. The time-dependent matrix elements between different coherent states determine the amplitude of each trajectory in the total multistate wave function; the diagonal matrix elements determine the hopping probabilities and gradients. In this way, both interference effects and non-adiabatic transitions can be described in a very compact fashion, leading to the exact solution if convergence with respect to the number of trajectories is achieved and the potential energy surfaces are known globally. The method is tested on a 2D model for a conical intersection [A. Ferretti, J. Chem. Phys. 104, 5517 (1996)], where a nuclear wavepacket encircles the point of degeneracy between two potential energy surfaces and interferes with itself. These interference effects are absent in classical trajectory-based molecular dynamics but can be fully incorpo rated if trajectories are replaced by surface hopping coupled coherent states.« less

  7. Financial Distress Prediction Using Discrete-time Hazard Model and Rating Transition Matrix Approach

    NASA Astrophysics Data System (ADS)

    Tsai, Bi-Huei; Chang, Chih-Huei

    2009-08-01

    Previous studies used constant cut-off indicator to distinguish distressed firms from non-distressed ones in the one-stage prediction models. However, distressed cut-off indicator must shift according to economic prosperity, rather than remains fixed all the time. This study focuses on Taiwanese listed firms and develops financial distress prediction models based upon the two-stage method. First, this study employs the firm-specific financial ratio and market factors to measure the probability of financial distress based on the discrete-time hazard models. Second, this paper further focuses on macroeconomic factors and applies rating transition matrix approach to determine the distressed cut-off indicator. The prediction models are developed by using the training sample from 1987 to 2004, and their levels of accuracy are compared with the test sample from 2005 to 2007. As for the one-stage prediction model, the model in incorporation with macroeconomic factors does not perform better than that without macroeconomic factors. This suggests that the accuracy is not improved for one-stage models which pool the firm-specific and macroeconomic factors together. In regards to the two stage models, the negative credit cycle index implies the worse economic status during the test period, so the distressed cut-off point is adjusted to increase based on such negative credit cycle index. After the two-stage models employ such adjusted cut-off point to discriminate the distressed firms from non-distressed ones, their error of misclassification becomes lower than that of one-stage ones. The two-stage models presented in this paper have incremental usefulness in predicting financial distress.

  8. Finite-time scaling at the Anderson transition for vibrations in solids

    NASA Astrophysics Data System (ADS)

    Beltukov, Y. M.; Skipetrov, S. E.

    2017-11-01

    A model in which a three-dimensional elastic medium is represented by a network of identical masses connected by springs of random strengths and allowed to vibrate only along a selected axis of the reference frame exhibits an Anderson localization transition. To study this transition, we assume that the dynamical matrix of the network is given by a product of a sparse random matrix with real, independent, Gaussian-distributed nonzero entries and its transpose. A finite-time scaling analysis of the system's response to an initial excitation allows us to estimate the critical parameters of the localization transition. The critical exponent is found to be ν =1.57 ±0.02 , in agreement with previous studies of the Anderson transition belonging to the three-dimensional orthogonal universality class.

  9. Easing the Transition to School: Administrators' Descriptions of Transition to School Activities

    ERIC Educational Resources Information Center

    Noel, Andrea

    2011-01-01

    This paper details the early childhood transition activities of three schools in southern Queensland, Australia, as reported by school administrators. The transition programs were analysed using the categories of the Transition to School Matrix of the New South Wales (NSW) Department of Education. Activities fell into the first four categories…

  10. The General Necessary Condition for the Validity of Dirac's Transition Perturbation Theory

    NASA Technical Reports Server (NTRS)

    Quang, Nguyen Vinh

    1996-01-01

    For the first time, from the natural requirements for the successive approximation the general necessary condition of validity of the Dirac's method is explicitly established. It is proved that the conception of 'the transition probability per unit time' is not valid. The 'super-platinium rules' for calculating the transition probability are derived for the arbitrarily strong time-independent perturbation case.

  11. New Accurate Oscillator Strengths and Electron Excitation Collision Strengths for N1

    NASA Technical Reports Server (NTRS)

    Tayal, S. S.

    2006-01-01

    The nonorthogonal orbitals technique in a multiconfiguration Hartree-Fock approach is used to calculate oscillator strengths and transition probabilities of N(I) lines. The relativistic effects are allowed by means of Breit-Pauli operators. The length and velocity forms of oscillator strengths show good agreement for most transitions. The B-spline R-matrix with pseudostates approach has been used to calculate electron excitation collision strengths and rates. The nonorthogonal orbitals are used for an accurate description of both target wave functions and the R-matrix basis functions. The 24 spectroscopic bound and autoionizing states together with 15 pseudostates are included in the close-coupling expansion. The collision strengths for transitions between fine-structure levels are calculated by transforming the LS-coupled K-matrices to K-matrices in an intermediate coupling scheme. Thermally averaged collision strengths have been determined by integrating collision strength over a Maxwellian distribution of electron energies over a temperature range suitable for the modeling of astrophysical plasmas. The oscillator strengths and thermally averaged collision strengths are presented for transitions between the fine-structure levels of the 2s(sup 2)p(sup 3) (sup 4)S(sup 0), (sup 2)D(sup 0), (sup 2)P(sup 0), 2s2p(sup 4) (sup 4)P, 2s(sup 2)2p(sup 2)3s (sup 4)P, and (sup 2)P terms and from these levels to the levels of the 2s(sup 2)2p(sup 2)3p (sup 2)S(sup 0), (sup 4)D(sup 0), (sup 4)P(sup 0), (sup 4)S(sup 0), (sup 2)D(sup 0), (sup 2)P(sup 0),2s(sup 2)2p(sup 2)3s(sup 2)D, 2s(sup 2)2p(sup 2)4s(sup 4)P, (sup 2)P, 2s(sup 2)2p(sup 2)3d(sup 2)P, (sup 4)F,(sup 2)F,(sup 4)P, (sup 4)D, and (sup 2)D terms. Thermally averaged collision strengths are tabulated over a temperature range from 500 to 50,000 K.

  12. E-O Sensor Signal Recognition Simulation: Computer Code SPOT I.

    DTIC Science & Technology

    1978-10-01

    scattering phase function PDCO , defined at the specified wavelength, given for each of the scattering angles defined. Currently, a maximum of sixty-four...PHASE MATRIX DATA IS DEFINED PDCO AVERAGE PROBABILITY FOR PHASE MATRIX DEFINITION NPROB PROBLEM NUMBER 54 Fig. 12. FLOWCHART for the SPOT Computer Code...El0.1 WLAM(N) Wavelength at which the aerosol single-scattering phase function set is defined (microns) 3 8El0.1 PDCO (N,I) Average probability for

  13. Multilevel selection in a resource-based model

    NASA Astrophysics Data System (ADS)

    Ferreira, Fernando Fagundes; Campos, Paulo R. A.

    2013-07-01

    In the present work we investigate the emergence of cooperation in a multilevel selection model that assumes limiting resources. Following the work by R. J. Requejo and J. Camacho [Phys. Rev. Lett.0031-900710.1103/PhysRevLett.108.038701 108, 038701 (2012)], the interaction among individuals is initially ruled by a prisoner's dilemma (PD) game. The payoff matrix may change, influenced by the resource availability, and hence may also evolve to a non-PD game. Furthermore, one assumes that the population is divided into groups, whose local dynamics is driven by the payoff matrix, whereas an intergroup competition results from the nonuniformity of the growth rate of groups. We study the probability that a single cooperator can invade and establish in a population initially dominated by defectors. Cooperation is strongly favored when group sizes are small. We observe the existence of a critical group size beyond which cooperation becomes counterselected. Although the critical size depends on the parameters of the model, it is seen that a saturation value for the critical group size is achieved. The results conform to the thought that the evolutionary history of life repeatedly involved transitions from smaller selective units to larger selective units.

  14. Phase transitions of amorphous solid acetone in confined geometry investigated by reflection absorption infrared spectroscopy.

    PubMed

    Shin, Sunghwan; Kang, Hani; Kim, Jun Soo; Kang, Heon

    2014-11-26

    We investigated the phase transformations of amorphous solid acetone under confined geometry by preparing acetone films trapped in amorphous solid water (ASW) or CCl4. Reflection absorption infrared spectroscopy (RAIRS) and temperature-programmed desorption (TPD) were used to monitor the phase changes of the acetone sample with increasing temperature. An acetone film trapped in ASW shows an abrupt change in the RAIRS features of the acetone vibrational bands during heating from 80 to 100 K, which indicates the transformation of amorphous solid acetone to a molecularly aligned crystalline phase. Further heating of the sample to 140 K produces an isotropic solid phase, and eventually a fluid phase near 157 K, at which the acetone sample is probably trapped in a pressurized, superheated condition inside the ASW matrix. Inside a CCl4 matrix, amorphous solid acetone crystallizes into a different, isotropic structure at ca. 90 K. We propose that the molecularly aligned crystalline phase formed in ASW is created by heterogeneous nucleation at the acetone-water interface, with resultant crystal growth, whereas the isotropic crystalline phase in CCl4 is formed by homogeneous crystal growth starting from the bulk region of the acetone sample.

  15. Finite-temperature phase transitions of third and higher order in gauge theories at large N

    DOE PAGES

    Nishimura, Hiromichi; Pisarski, Robert D.; Skokov, Vladimir V.

    2018-02-15

    We study phase transitions in SU(∞) gauge theories at nonzero temperature using matrix models. Our basic assumption is that the effective potential is dominated by double trace terms for the Polyakov loops. As a function of the various parameters, related to terms linear, quadratic, and quartic in the Polyakov loop, the phase diagram exhibits a universal structure. In a large region of this parameter space, there is a continuous phase transition whose order is larger than second. This is a generalization of the phase transition of Gross, Witten, and Wadia (GWW). Depending upon the detailed form of the matrix model,more » the eigenvalue density and the behavior of the specific heat near the transition differ drastically. Here, we speculate that in the pure gauge theory, that although the deconfining transition is thermodynamically of first order, it can be nevertheless conformally symmetric at infnite N.« less

  16. Finite-temperature phase transitions of third and higher order in gauge theories at large N

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishimura, Hiromichi; Pisarski, Robert D.; Skokov, Vladimir V.

    We study phase transitions in SU(∞) gauge theories at nonzero temperature using matrix models. Our basic assumption is that the effective potential is dominated by double trace terms for the Polyakov loops. As a function of the various parameters, related to terms linear, quadratic, and quartic in the Polyakov loop, the phase diagram exhibits a universal structure. In a large region of this parameter space, there is a continuous phase transition whose order is larger than second. This is a generalization of the phase transition of Gross, Witten, and Wadia (GWW). Depending upon the detailed form of the matrix model,more » the eigenvalue density and the behavior of the specific heat near the transition differ drastically. Here, we speculate that in the pure gauge theory, that although the deconfining transition is thermodynamically of first order, it can be nevertheless conformally symmetric at infnite N.« less

  17. Racial and Ethnic Variation in the Relationship Between Student Loan Debt and the Transition to First Birth.

    PubMed

    Min, Stella; Taylor, Miles G

    2018-02-01

    The present study employs discrete-time hazard regression models to investigate the relationship between student loan debt and the probability of transitioning to either marital or nonmarital first childbirth using the 1997 National Longitudinal Survey of Youth (NLSY97). Accounting for nonrandom selection into student loans using propensity scores, our study reveals that the effect of student loan debt on the transition to motherhood differs among white, black, and Hispanic women. Hispanic women holding student loans experience significant declines in the probability of transitioning to both marital and nonmarital motherhood, whereas black women with student loans are significantly more likely to transition to any first childbirth. Indebted white women experience only a decrease in the probability of a marital first birth. The results from this study suggest that student loans will likely play a key role in shaping future demographic patterns and behaviors.

  18. Examining Spillovers between Long and Short Repeated Prisoner's Dilemma Games Played in the Laboratory.

    PubMed

    Arechar, Antonio A; Kouchaki, Maryam; Rand, David G

    2018-03-01

    We had participants play two sets of repeated Prisoner's Dilemma (RPD) games, one with a large continuation probability and the other with a small continuation probability, as well as Dictator Games (DGs) before and after the RPDs. We find that, regardless of which is RPD set is played first, participants typically cooperate when the continuation probability is large and defect when the continuation probability is small. However, there is an asymmetry in behavior when transitioning from one continuation probability to the other. When switching from large to small, transient higher levels of cooperation are observed in the early games of the small continuation set. Conversely, when switching from small to large, cooperation is immediately high in the first game of the large continuation set. We also observe that response times increase when transitioning between sets of RPDs, except for altruistic participants transitioning into the set of RPDs with long continuation probabilities. These asymmetries suggest a bias in favor of cooperation. Finally, we examine the link between altruism and RPD play. We find that small continuation probability RPD play is correlated with giving in DGs played before and after the RPDs, whereas high continuation probability RPD play is not.

  19. Precision measurement of transition matrix elements via light shift cancellation.

    PubMed

    Herold, C D; Vaidya, V D; Li, X; Rolston, S L; Porto, J V; Safronova, M S

    2012-12-14

    We present a method for accurate determination of atomic transition matrix elements at the 10(-3) level. Measurements of the ac Stark (light) shift around "magic-zero" wavelengths, where the light shift vanishes, provide precise constraints on the matrix elements. We make the first measurement of the 5s - 6p matrix elements in rubidium by measuring the light shift around the 421 and 423 nm zeros through diffraction of a condensate off a sequence of standing wave pulses. In conjunction with existing theoretical and experimental data, we find 0.3235(9)ea(0) and 0.5230(8)ea(0) for the 5s - 6p(1/2) and 5s - 6p(3/2) elements, respectively, an order of magnitude more accurate than the best theoretical values. This technique can provide needed, accurate matrix elements for many atoms, including those used in atomic clocks, tests of fundamental symmetries, and quantum information.

  20. The technology of obtaining multipotent spheroids from limbal mesenchymal stromal cells for reparation of injured eye tissues.

    PubMed

    Kosheleva, N V; Saburina, I N; Zurina, I M; Gorkun, A A; Borzenok, S A; Nikishin, D A; Kolokoltsova, T D; Ustinova, E E; Repin, V S

    2016-01-01

    It is known that stem and progenitor cells open new possibilities for restoring injured eye tissues. Limbal eye zone, formed mainly by derivatives of neural crest, is the main source of stem cells for regeneration. The current study considers development of innovative technology for obtaining 3D spheroids from L-MMSC. It was shown that under 3D conditions L-MMSC due to compactization and mesenchymal-epithelial transition self-organize into cellular reparative modules. Formed L-MMSC spheroids retain and promote undifferentiated population of stem and progenitor limbal cells, as supported by expression of pluripotency markers - Oct4, Sox2, Nanog. Extracellular matrix synthetized by cells in spheroids allows retaining the functional potential of L-MMSC that are involved in regeneration of both anterior and, probably, posterior eye segment.

  1. On reliable control system designs. Ph.D. Thesis; [actuators

    NASA Technical Reports Server (NTRS)

    Birdwell, J. D.

    1978-01-01

    A mathematical model for use in the design of reliable multivariable control systems is discussed with special emphasis on actuator failures and necessary actuator redundancy levels. The model consists of a linear time invariant discrete time dynamical system. Configuration changes in the system dynamics are governed by a Markov chain that includes transition probabilities from one configuration state to another. The performance index is a standard quadratic cost functional, over an infinite time interval. The actual system configuration can be deduced with a one step delay. The calculation of the optimal control law requires the solution of a set of highly coupled Riccati-like matrix difference equations. Results can be used for off-line studies relating the open loop dynamics, required performance, actuator mean time to failure, and functional or identical actuator redundancy, with and without feedback gain reconfiguration strategies.

  2. H theorem for generalized entropic forms within a master-equation framework

    NASA Astrophysics Data System (ADS)

    Casas, Gabriela A.; Nobre, Fernando D.; Curado, Evaldo M. F.

    2016-03-01

    The H theorem is proven for generalized entropic forms, in the case of a discrete set of states. The associated probability distributions evolve in time according to a master equation, for which the corresponding transition rates depend on these entropic forms. An important equation describing the time evolution of the transition rates and probabilities in such a way as to drive the system towards an equilibrium state is found. In the particular case of Boltzmann-Gibbs entropy, it is shown that this equation is satisfied in the microcanonical ensemble only for symmetric probability transition rates, characterizing a single path to the equilibrium state. This equation fulfils the proof of the H theorem for generalized entropic forms, associated with systems characterized by complex dynamics, e.g., presenting nonsymmetric probability transition rates and more than one path towards the same equilibrium state. Some examples considering generalized entropies of the literature are discussed, showing that they should be applicable to a wide range of natural phenomena, mainly those within the realm of complex systems.

  3. The regolith history of 14307. [lunar breccia

    NASA Technical Reports Server (NTRS)

    Bernatowicz, T.; Hohenberg, C. M.; Morgan, C. J.; Podosek, F. A.; Drozd, R. J.; Lugmair, G.

    1977-01-01

    Noble gas and trace element analyses of matrix and a clast from breccia 14307 are reported. This sample was exposed to a large neutron fluence, as seen by an elevated Sm-150/Sm-149 ratio and by noble gases, particularly Xe-136 from neutron fission of U-235. Strong constraints on the exposure history result from combined consideration of Sm-150, Xe-136, and spallation noble gases. Both clast and matrix were irradiated for about 1 AE under substantial shielding beginning at least 2 AE ago, probably more than 3 AE ago. The manifestations of soil exposure seen in the matrix - solar wind gases, glass formation, etc. - thus must have been acquired in an ancient epoch. The matrix has had a longer exposure to cosmic rays than the clast, presumably during its prebrecciation history as a soil. Brecciation probably occurred more than 1 AE ago, perhaps more than 3 AE ago, but at least 0.4 AE after the formation of the matrix constituents.

  4. Blackmail propagation on small-world networks

    NASA Astrophysics Data System (ADS)

    Shao, Zhi-Gang; Jian-Ping Sang; Zou, Xian-Wu; Tan, Zhi-Jie; Jin, Zhun-Zhi

    2005-06-01

    The dynamics of the blackmail propagation model based on small-world networks is investigated. It is found that for a given transmitting probability λ the dynamical behavior of blackmail propagation transits from linear growth type to logistical growth one with the network randomness p increases. The transition takes place at the critical network randomness pc=1/N, where N is the total number of nodes in the network. For a given network randomness p the dynamical behavior of blackmail propagation transits from exponential decrease type to logistical growth one with the transmitting probability λ increases. The transition occurs at the critical transmitting probability λc=1/, where is the average number of the nearest neighbors. The present work will be useful for understanding computer virus epidemics and other spreading phenomena on communication and social networks.

  5. Dynamics of Sleep Stage Transitions in Health and Disease

    NASA Astrophysics Data System (ADS)

    Kishi, Akifumi; Struzik, Zbigniew R.; Natelson, Benjamin H.; Togo, Fumiharu; Yamamoto, Yoshiharu

    2007-07-01

    Sleep dynamics emerges from complex interactions between neuronal populations in many brain regions. Annotated sleep stages from electroencephalography (EEG) recordings could potentially provide a non-invasive way to obtain valuable insights into the mechanisms of these interactions, and ultimately into the very nature of sleep regulation. However, to date, sleep stage analysis has been restricted, only very recently expanding the scope of the traditional descriptive statistics to more dynamical concepts of the duration of and transitions between vigilance states and temporal evaluation of transition probabilities among different stages. Physiological and/or pathological implications of the dynamics of sleep stage transitions have, to date, not been investigated. Here, we study detailed duration and transition statistics among sleep stages in healthy humans and patients with chronic fatigue syndrome, known to be associated with disturbed sleep. We find that the durations of waking and non-REM sleep, in particular deep sleep (Stages III and IV), during the nighttime, follow a power-law probability distribution function, while REM sleep durations follow an exponential function, suggestive of complex underlying mechanisms governing the onset of light sleep. We also find a substantial number of REM to non-REM transitions in humans, while this transition is reported to be virtually non-existent in rats. Interestingly, the probability of this REM to non-REM transition is significantly lower in the patients than in controls, resulting in a significantly greater REM to awake, together with Stage I to awake, transition probability. This might potentially account for the reported poor sleep quality in the patients because the normal continuation of sleep after either the lightest or REM sleep is disrupted. We conclude that the dynamical transition analysis of sleep stages is useful for elucidating yet-to-be-determined human sleep regulation mechanisms with a pathophysiological implication.

  6. Survival modeling for the estimation of transition probabilities in model-based economic evaluations in the absence of individual patient data: a tutorial.

    PubMed

    Diaby, Vakaramoko; Adunlin, Georges; Montero, Alberto J

    2014-02-01

    Survival modeling techniques are increasingly being used as part of decision modeling for health economic evaluations. As many models are available, it is imperative for interested readers to know about the steps in selecting and using the most suitable ones. The objective of this paper is to propose a tutorial for the application of appropriate survival modeling techniques to estimate transition probabilities, for use in model-based economic evaluations, in the absence of individual patient data (IPD). An illustration of the use of the tutorial is provided based on the final progression-free survival (PFS) analysis of the BOLERO-2 trial in metastatic breast cancer (mBC). An algorithm was adopted from Guyot and colleagues, and was then run in the statistical package R to reconstruct IPD, based on the final PFS analysis of the BOLERO-2 trial. It should be emphasized that the reconstructed IPD represent an approximation of the original data. Afterwards, we fitted parametric models to the reconstructed IPD in the statistical package Stata. Both statistical and graphical tests were conducted to verify the relative and absolute validity of the findings. Finally, the equations for transition probabilities were derived using the general equation for transition probabilities used in model-based economic evaluations, and the parameters were estimated from fitted distributions. The results of the application of the tutorial suggest that the log-logistic model best fits the reconstructed data from the latest published Kaplan-Meier (KM) curves of the BOLERO-2 trial. Results from the regression analyses were confirmed graphically. An equation for transition probabilities was obtained for each arm of the BOLERO-2 trial. In this paper, a tutorial was proposed and used to estimate the transition probabilities for model-based economic evaluation, based on the results of the final PFS analysis of the BOLERO-2 trial in mBC. The results of our study can serve as a basis for any model (Markov) that needs the parameterization of transition probabilities, and only has summary KM plots available.

  7. Acceleration of intensity-modulated radiotherapy dose calculation by importance sampling of the calculation matrices.

    PubMed

    Thieke, Christian; Nill, Simeon; Oelfke, Uwe; Bortfeld, Thomas

    2002-05-01

    In inverse planning for intensity-modulated radiotherapy, the dose calculation is a crucial element limiting both the maximum achievable plan quality and the speed of the optimization process. One way to integrate accurate dose calculation algorithms into inverse planning is to precalculate the dose contribution of each beam element to each voxel for unit fluence. These precalculated values are stored in a big dose calculation matrix. Then the dose calculation during the iterative optimization process consists merely of matrix look-up and multiplication with the actual fluence values. However, because the dose calculation matrix can become very large, this ansatz requires a lot of computer memory and is still very time consuming, making it not practical for clinical routine without further modifications. In this work we present a new method to significantly reduce the number of entries in the dose calculation matrix. The method utilizes the fact that a photon pencil beam has a rapid radial dose falloff, and has very small dose values for the most part. In this low-dose part of the pencil beam, the dose contribution to a voxel is only integrated into the dose calculation matrix with a certain probability. Normalization with the reciprocal of this probability preserves the total energy, even though many matrix elements are omitted. Three probability distributions were tested to find the most accurate one for a given memory size. The sampling method is compared with the use of a fully filled matrix and with the well-known method of just cutting off the pencil beam at a certain lateral distance. A clinical example of a head and neck case is presented. It turns out that a sampled dose calculation matrix with only 1/3 of the entries of the fully filled matrix does not sacrifice the quality of the resulting plans, whereby the cutoff method results in a suboptimal treatment plan.

  8. First order phase transitions resulted from collective Jahn-Teller effect

    NASA Astrophysics Data System (ADS)

    Rosenfeld, E. V.

    2018-01-01

    Generally, in case of the collective Jahn-Teller effect, a high-symmetry structure of a matrix in which quantum systems with degenerate ground state are inserted becomes distorted. This usually smooth transition can become abrupt only if the matrix by itself is a trigger and JTE merely activates its switching. It is shown in this paper that proper insertion into matrix of quantum systems with the singlet ground state and degenerate excited state leads to the formation of a new metastable state of the whole system and a stepwise appearance of JTE. Using nanotechnology, a matrix of any nature can be transformed into trigger in this way if one manages to synthesize and insert into it proper quantity of quantum JT-active centers with appropriate energy spectrum.

  9. Analysis of a semiclassical model for rotational transition probabilities. [in highly nonequilibrium flow of diatomic molecules

    NASA Technical Reports Server (NTRS)

    Deiwert, G. S.; Yoshikawa, K. K.

    1975-01-01

    A semiclassical model proposed by Pearson and Hansen (1974) for computing collision-induced transition probabilities in diatomic molecules is tested by the direct-simulation Monte Carlo method. Specifically, this model is described by point centers of repulsion for collision dynamics, and the resulting classical trajectories are used in conjunction with the Schroedinger equation for a rigid-rotator harmonic oscillator to compute the rotational energy transition probabilities necessary to evaluate the rotation-translation exchange phenomena. It is assumed that a single, average energy spacing exists between the initial state and possible final states for a given collision.

  10. Probability distributions of linear statistics in chaotic cavities and associated phase transitions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vivo, Pierpaolo; Majumdar, Satya N.; Bohigas, Oriol

    2010-03-01

    We establish large deviation formulas for linear statistics on the N transmission eigenvalues (T{sub i}) of a chaotic cavity, in the framework of random matrix theory. Given any linear statistics of interest A=SIGMA{sub i=1}{sup N}a(T{sub i}), the probability distribution P{sub A}(A,N) of A generically satisfies the large deviation formula lim{sub N-}>{sub i}nfinity[-2 log P{sub A}(Nx,N)/betaN{sup 2}]=PSI{sub A}(x), where PSI{sub A}(x) is a rate function that we compute explicitly in many cases (conductance, shot noise, and moments) and beta corresponds to different symmetry classes. Using these large deviation expressions, it is possible to recover easily known results and to produce newmore » formulas, such as a closed form expression for v(n)=lim{sub N-}>{sub i}nfinity var(T{sub n}) (where T{sub n}=SIGMA{sub i}T{sub i}{sup n}) for arbitrary integer n. The universal limit v*=lim{sub n-}>{sub i}nfinity v(n)=1/2pibeta is also computed exactly. The distributions display a central Gaussian region flanked on both sides by non-Gaussian tails. At the junction of the two regimes, weakly nonanalytical points appear, a direct consequence of phase transitions in an associated Coulomb gas problem. Numerical checks are also provided, which are in full agreement with our asymptotic results in both real and Laplace space even for moderately small N. Part of the results have been announced by Vivo et al. [Phys. Rev. Lett. 101, 216809 (2008)].« less

  11. A Markov Environment-dependent Hurricane Intensity Model and Its Comparison with Multiple Dynamic Models

    NASA Astrophysics Data System (ADS)

    Jing, R.; Lin, N.; Emanuel, K.; Vecchi, G. A.; Knutson, T. R.

    2017-12-01

    A Markov environment-dependent hurricane intensity model (MeHiM) is developed to simulate the climatology of hurricane intensity given the surrounding large-scale environment. The model considers three unobserved discrete states representing respectively storm's slow, moderate, and rapid intensification (and deintensification). Each state is associated with a probability distribution of intensity change. The storm's movement from one state to another, regarded as a Markov chain, is described by a transition probability matrix. The initial state is estimated with a Bayesian approach. All three model components (initial intensity, state transition, and intensity change) are dependent on environmental variables including potential intensity, vertical wind shear, midlevel relative humidity, and ocean mixing characteristics. This dependent Markov model of hurricane intensity shows a significant improvement over previous statistical models (e.g., linear, nonlinear, and finite mixture models) in estimating the distributions of 6-h and 24-h intensity change, lifetime maximum intensity, and landfall intensity, etc. Here we compare MeHiM with various dynamical models, including a global climate model [High-Resolution Forecast-Oriented Low Ocean Resolution model (HiFLOR)], a regional hurricane model (Geophysical Fluid Dynamics Laboratory (GFDL) hurricane model), and a simplified hurricane dynamic model [Coupled Hurricane Intensity Prediction System (CHIPS)] and its newly developed fast simulator. The MeHiM developed based on the reanalysis data is applied to estimate the intensity of simulated storms to compare with the dynamical-model predictions under the current climate. The dependences of hurricanes on the environment under current and future projected climates in the various models will also be compared statistically.

  12. Multistate modeling of habitat dynamics: Factors affecting Florida scrub transition probabilities

    USGS Publications Warehouse

    Breininger, D.R.; Nichols, J.D.; Duncan, B.W.; Stolen, Eric D.; Carter, G.M.; Hunt, D.K.; Drese, J.H.

    2010-01-01

    Many ecosystems are influenced by disturbances that create specific successional states and habitat structures that species need to persist. Estimating transition probabilities between habitat states and modeling the factors that influence such transitions have many applications for investigating and managing disturbance-prone ecosystems. We identify the correspondence between multistate capture-recapture models and Markov models of habitat dynamics. We exploit this correspondence by fitting and comparing competing models of different ecological covariates affecting habitat transition probabilities in Florida scrub and flatwoods, a habitat important to many unique plants and animals. We subdivided a large scrub and flatwoods ecosystem along central Florida's Atlantic coast into 10-ha grid cells, which approximated average territory size of the threatened Florida Scrub-Jay (Aphelocoma coerulescens), a management indicator species. We used 1.0-m resolution aerial imagery for 1994, 1999, and 2004 to classify grid cells into four habitat quality states that were directly related to Florida Scrub-Jay source-sink dynamics and management decision making. Results showed that static site features related to fire propagation (vegetation type, edges) and temporally varying disturbances (fires, mechanical cutting) best explained transition probabilities. Results indicated that much of the scrub and flatwoods ecosystem was resistant to moving from a degraded state to a desired state without mechanical cutting, an expensive restoration tool. We used habitat models parameterized with the estimated transition probabilities to investigate the consequences of alternative management scenarios on future habitat dynamics. We recommend this multistate modeling approach as being broadly applicable for studying ecosystem, land cover, or habitat dynamics. The approach provides maximum-likelihood estimates of transition parameters, including precision measures, and can be used to assess evidence among competing ecological models that describe system dynamics. ?? 2010 by the Ecological Society of America.

  13. Collisional Dynamics of the Cesium D1 and D2 Transitions

    DTIC Science & Technology

    2010-09-01

    37 14. Comparison of Phase Changing Probability and Polarizability ...Phase Changing Probability and Polarizability for D2 Transition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60 25...theoretically determined the values for broadening and shift rates for cesium with Argon , Krypton, and Xenon from the interatomic potentials [27]. The rates

  14. Finding a Hadamard matrix by simulated annealing of spin vectors

    NASA Astrophysics Data System (ADS)

    Bayu Suksmono, Andriyan

    2017-05-01

    Reformulation of a combinatorial problem into optimization of a statistical-mechanics system enables finding a better solution using heuristics derived from a physical process, such as by the simulated annealing (SA). In this paper, we present a Hadamard matrix (H-matrix) searching method based on the SA on an Ising model. By equivalence, an H-matrix can be converted into a seminormalized Hadamard (SH) matrix, whose first column is unit vector and the rest ones are vectors with equal number of -1 and +1 called SH-vectors. We define SH spin vectors as representation of the SH vectors, which play a similar role as the spins on Ising model. The topology of the lattice is generalized into a graph, whose edges represent orthogonality relationship among the SH spin vectors. Starting from a randomly generated quasi H-matrix Q, which is a matrix similar to the SH-matrix without imposing orthogonality, we perform the SA. The transitions of Q are conducted by random exchange of {+, -} spin-pair within the SH-spin vectors that follow the Metropolis update rule. Upon transition toward zeroth energy, the Q-matrix is evolved following a Markov chain toward an orthogonal matrix, at which the H-matrix is said to be found. We demonstrate the capability of the proposed method to find some low-order H-matrices, including the ones that cannot trivially be constructed by the Sylvester method.

  15. Identification of key ancestors of modern germplasm in a breeding program of maize.

    PubMed

    Technow, F; Schrag, T A; Schipprack, W; Melchinger, A E

    2014-12-01

    Probabilities of gene origin computed from the genomic kinships matrix can accurately identify key ancestors of modern germplasms Identifying the key ancestors of modern plant breeding populations can provide valuable insights into the history of a breeding program and provide reference genomes for next generation whole genome sequencing. In an animal breeding context, a method was developed that employs probabilities of gene origin, computed from the pedigree-based additive kinship matrix, for identifying key ancestors. Because reliable and complete pedigree information is often not available in plant breeding, we replaced the additive kinship matrix with the genomic kinship matrix. As a proof-of-concept, we applied this approach to simulated data sets with known ancestries. The relative contribution of the ancestral lines to later generations could be determined with high accuracy, with and without selection. Our method was subsequently used for identifying the key ancestors of the modern Dent germplasm of the public maize breeding program of the University of Hohenheim. We found that the modern germplasm can be traced back to six or seven key ancestors, with one or two of them having a disproportionately large contribution. These results largely corroborated conjectures based on early records of the breeding program. We conclude that probabilities of gene origin computed from the genomic kinships matrix can be used for identifying key ancestors in breeding programs and estimating the proportion of genes contributed by them.

  16. Decision analysis with cumulative prospect theory.

    PubMed

    Bayoumi, A M; Redelmeier, D A

    2000-01-01

    Individuals sometimes express preferences that do not follow expected utility theory. Cumulative prospect theory adjusts for some phenomena by using decision weights rather than probabilities when analyzing a decision tree. The authors examined how probability transformations from cumulative prospect theory might alter a decision analysis of a prophylactic therapy in AIDS, eliciting utilities from patients with HIV infection (n = 75) and calculating expected outcomes using an established Markov model. They next focused on transformations of three sets of probabilities: 1) the probabilities used in calculating standard-gamble utility scores; 2) the probabilities of being in discrete Markov states; 3) the probabilities of transitioning between Markov states. The same prophylaxis strategy yielded the highest quality-adjusted survival under all transformations. For the average patient, prophylaxis appeared relatively less advantageous when standard-gamble utilities were transformed. Prophylaxis appeared relatively more advantageous when state probabilities were transformed and relatively less advantageous when transition probabilities were transformed. Transforming standard-gamble and transition probabilities simultaneously decreased the gain from prophylaxis by almost half. Sensitivity analysis indicated that even near-linear probability weighting transformations could substantially alter quality-adjusted survival estimates. The magnitude of benefit estimated in a decision-analytic model can change significantly after using cumulative prospect theory. Incorporating cumulative prospect theory into decision analysis can provide a form of sensitivity analysis and may help describe when people deviate from expected utility theory.

  17. Discrete particle swarm optimization to solve multi-objective limited-wait hybrid flow shop scheduling problem

    NASA Astrophysics Data System (ADS)

    Santosa, B.; Siswanto, N.; Fiqihesa

    2018-04-01

    This paper proposes a discrete Particle Swam Optimization (PSO) to solve limited-wait hybrid flowshop scheduing problem with multi objectives. Flow shop schedulimg represents the condition when several machines are arranged in series and each job must be processed at each machine with same sequence. The objective functions are minimizing completion time (makespan), total tardiness time, and total machine idle time. Flow shop scheduling model always grows to cope with the real production system accurately. Since flow shop scheduling is a NP-Hard problem then the most suitable method to solve is metaheuristics. One of metaheuristics algorithm is Particle Swarm Optimization (PSO), an algorithm which is based on the behavior of a swarm. Originally, PSO was intended to solve continuous optimization problems. Since flow shop scheduling is a discrete optimization problem, then, we need to modify PSO to fit the problem. The modification is done by using probability transition matrix mechanism. While to handle multi objectives problem, we use Pareto Optimal (MPSO). The results of MPSO is better than the PSO because the MPSO solution set produced higher probability to find the optimal solution. Besides the MPSO solution set is closer to the optimal solution

  18. Structure-correlated diffusion anisotropy in nanoporous channel networks by Monte Carlo simulations and percolation theory

    NASA Astrophysics Data System (ADS)

    Kondrashova, Daria; Valiullin, Rustem; Kärger, Jörg; Bunde, Armin

    2017-07-01

    Nanoporous silicon consisting of tubular pores imbedded in a silicon matrix has found many technological applications and provides a useful model system for studying phase transitions under confinement. Recently, a model for mass transfer in these materials has been elaborated [Kondrashova et al., Sci. Rep. 7, 40207 (2017)], which assumes that adjacent channels can be connected by "bridges" (with probability pbridge) which allows diffusion perpendicular to the channels. Along the channels, diffusion can be slowed down by "necks" which occur with probability pneck. In this paper we use Monte-Carlo simulations to study diffusion along the channels and perpendicular to them, as a function of pbridge and pneck, and find remarkable correlations between the diffusivities in longitudinal and radial directions. For clarifying the diffusivity in radial direction, which is governed by the concentration of bridges, we applied percolation theory. We determine analytically how the critical concentration of bridges depends on the size of the system and show that it approaches zero in the thermodynamic limit. Our analysis suggests that the critical properties of the model, including the diffusivity in radial direction, are in the universality class of two-dimensional lattice percolation, which is confirmed by our numerical study.

  19. Phased models for evaluating the performability of computing systems

    NASA Technical Reports Server (NTRS)

    Wu, L. T.; Meyer, J. F.

    1979-01-01

    A phase-by-phase modelling technique is introduced to evaluate a fault tolerant system's ability to execute different sets of computational tasks during different phases of the control process. Intraphase processes are allowed to differ from phase to phase. The probabilities of interphase state transitions are specified by interphase transition matrices. Based on constraints imposed on the intraphase and interphase transition probabilities, various iterative solution methods are developed for calculating system performability.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Orce, J. N.; McKay, C. J.; Lesher, S. R.

    A careful determination of the lifetime and measurement of the branching ratio for decay of the first 2{sub T=1}{sup +} state in 42Sc has allowed an accurate experimental test of charge independence in the A = 42 isobaric triplet. A lifetime of 69(17) fs was measured at the University of Kentucky, while relative intensities for the 975 keV and 1586 keV transitions depopulating the first 2{sub T=1}{sup +} state have been determined at the University of Cologne as 100(1) and 8(1), respectively. Both measurements give an isoscalar matrix element, M0, of 6.4(9) (W.u.)1/2. This result confirms charge independence for themore » A=42 isobaric triplet. Shell model calculations have been carried out for understanding the global trend of M0 values for A = 4n + 2 isobaric triplets ranging from A = 18 to A = 42. The 2{sub 1(T=1)}{sup +} {yields} 0{sub 1(T=1)}{sup +} transition energies, reduced transition probabilities and M0 values are reproduced to a high degree of accuracy. The trend of M0 strength along the sd shell is interpreted in terms of the shell structure. Certain discrepancies arise at the extremes of the sd shell, for the A = 18 and A 38 isobaric triplets, which might be explained in terms of the low valence space at the extremes of the sd shell.« less

  1. Stochastic approach to plasticity and yield in amorphous solids.

    PubMed

    Hentschel, H G E; Jaiswal, Prabhat K; Procaccia, Itamar; Sastry, Srikanth

    2015-12-01

    We focus on the probability distribution function (PDF) P(Δγ;γ) where Δγ are the measured strain intervals between plastic events in a athermal strained amorphous solids, and γ measures the accumulated strain. The tail of this distribution as Δγ→0 (in the thermodynamic limit) scales like Δγ(η). The exponent η is related via scaling relations to the tail of the PDF of the eigenvalues of the plastic modes of the Hessian matrix P(λ) which scales like λ(θ), η=(θ-1)/2. The numerical values of η or θ can be determined easily in the unstrained material and in the yielded state of plastic flow. Special care is called for in the determination of these exponents between these states as γ increases. Determining the γ dependence of the PDF P(Δγ;γ) can shed important light on plasticity and yield. We conclude that the PDF's of both Δγ and λ are not continuous functions of γ. In slowly quenched amorphous solids they undergo two discontinuous transitions, first at γ=0(+) and then at the yield point γ=γ(Y) to plastic flow. In quickly quenched amorphous solids the second transition is smeared out due to the nonexisting stress peak before yield. The nature of these transitions and scaling relations with the system size dependence of 〈Δγ〉 are discussed.

  2. Ho3+-doped strontium-aluminium-bismuth-borate glasses for green light emission.

    PubMed

    Rajesh, D; Dhamodhara Naidu, M; Ratnakaram, Y C; Balakrishna, A

    2014-11-01

    Strontium-aluminium-bismuth-borate glasses (SAlBiB) doped with different concentrations of Ho(3+) were prepared using conventional melt quenching technique and their structural and optical properties investigated. X-ray diffraction and scanning electron microscopy analysis were used to study the structural properties. Optical properties were studied by measuring the optical absorption and visible luminescence spectra. The Judd-Ofelt (J-O) theory was applied to evaluate J-O intensity parameters, Ω(λ) (λ = 2, 4 and 6). Using J-O intensity parameters, radiative properties such as spontaneous transition probabilities (A(R)), branching ratios (β(R)) and radiative lifetimes (τ(R)) were determined. From the emission spectra, a strong green emission nearly at 549 nm corresponding to the transition, (5)S2 ((5)F4)→(5)I(8) was observed. Emission peak positions (λ(P)), effective bandwidths (Δλ(eff)) and stimulated emission cross-sections (σ(p)) were calculated for the observed emission transitions, (5)F3 →(5)I(8), (5)S2((5)F4)→(5)I(8) and (5)F5 →(5)I(8) of Ho(3+) in all the glass matrices. Chromaticity color coordinates were calculated using the emission spectra. The experimental results suggest that SAlBiB glass matrix with 1.5 mol% of Ho(3+) has better emission properties. Copyright © 2014 John Wiley & Sons, Ltd.

  3. Formula for the Transition Probability Induced by Long-range Potential Terms Varying as R-8 and R-10 for Atom-dimer Collisions

    NASA Astrophysics Data System (ADS)

    Matthews, N. F.; Robson, D.; Grant, M. A.

    1990-12-01

    An explicit formula is derived for the transition probability between two different states of the atom-dimer collisional system governed by second-order long-range interaction potential terms varying as R-8 and R-10.

  4. Learning in Reverse: Eight-Month-Old Infants Track Backward Transitional Probabilities

    ERIC Educational Resources Information Center

    Pelucchi, Bruna; Hay, Jessica F.; Saffran, Jenny R.

    2009-01-01

    Numerous recent studies suggest that human learners, including both infants and adults, readily track sequential statistics computed between adjacent elements. One such statistic, transitional probability, is typically calculated as the likelihood that one element predicts another. However, little is known about whether listeners are sensitive to…

  5. Anticipating abrupt shifts in temporal evolution of probability of eruption

    NASA Astrophysics Data System (ADS)

    Rohmer, J.; Loschetter, A.

    2016-04-01

    Estimating the probability of eruption by jointly accounting for different sources of monitoring parameters over time is a key component for volcano risk management. In the present study, we are interested in the transition from a state of low-to-moderate probability value to a state of high probability value. By using the data of MESIMEX exercise at the Vesuvius volcano, we investigated the potential for time-varying indicators related to the correlation structure or to the variability of the probability time series for detecting in advance this critical transition. We found that changes in the power spectra and in the standard deviation estimated over a rolling time window both present an abrupt increase, which marks the approaching shift. Our numerical experiments revealed that the transition from an eruption probability of 10-15% to > 70% could be identified up to 1-3 h in advance. This additional lead time could be useful to place different key services (e.g., emergency services for vulnerable groups, commandeering additional transportation means, etc.) on a higher level of alert before the actual call for evacuation.

  6. Propensity, Probability, and Quantum Theory

    NASA Astrophysics Data System (ADS)

    Ballentine, Leslie E.

    2016-08-01

    Quantum mechanics and probability theory share one peculiarity. Both have well established mathematical formalisms, yet both are subject to controversy about the meaning and interpretation of their basic concepts. Since probability plays a fundamental role in QM, the conceptual problems of one theory can affect the other. We first classify the interpretations of probability into three major classes: (a) inferential probability, (b) ensemble probability, and (c) propensity. Class (a) is the basis of inductive logic; (b) deals with the frequencies of events in repeatable experiments; (c) describes a form of causality that is weaker than determinism. An important, but neglected, paper by P. Humphreys demonstrated that propensity must differ mathematically, as well as conceptually, from probability, but he did not develop a theory of propensity. Such a theory is developed in this paper. Propensity theory shares many, but not all, of the axioms of probability theory. As a consequence, propensity supports the Law of Large Numbers from probability theory, but does not support Bayes theorem. Although there are particular problems within QM to which any of the classes of probability may be applied, it is argued that the intrinsic quantum probabilities (calculated from a state vector or density matrix) are most naturally interpreted as quantum propensities. This does not alter the familiar statistical interpretation of QM. But the interpretation of quantum states as representing knowledge is untenable. Examples show that a density matrix fails to represent knowledge.

  7. Investigating rare events with nonequilibrium work measurements. I. Nonequilibrium transition path probabilities

    NASA Astrophysics Data System (ADS)

    Moradi, Mahmoud; Sagui, Celeste; Roland, Christopher

    2014-01-01

    We have developed a formalism for investigating transition pathways and transition probabilities for rare events in biomolecular systems. In this paper, we set the theoretical framework for employing nonequilibrium work relations to estimate the relative reaction rates associated with different classes of transition pathways. Particularly, we derive an extension of Crook's transient fluctuation theorem, which relates the relative transition rates of driven systems in the forward and reverse directions, and allows for the calculation of these relative rates using work measurements (e.g., in Steered Molecular Dynamics). The formalism presented here can be combined with Transition Path Theory to relate the equilibrium and driven transition rates. The usefulness of this framework is illustrated by means of a Gaussian model and a driven proline dimer.

  8. Two-photon decay in gold atoms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dunford, R. W.; Kanter, E. P.; Kraessig, B.

    2006-07-15

    We have measured the energy differential transition probabilities for the two-photon decay of K vacancies in gold atoms (nuclear charge Z=79). This is the heaviest atom for which this information has been obtained, and so is most sensitive to relativistic effects. The experiment determined the shape of the continuum radiation for the transitions 2s{yields}1s, 3s{yields}1s, 3d{yields}1s, and (4s+4d){yields}1s at an emission pair opening angle {theta}={pi}/2. Our results for 3d{yields}1s and (4s+4d){yields}1s extend to energies above and below the region of the intermediate state resonances. No relativistic calculations exist for Au, so we compare with calculations by Mu and Crasemann andmore » Tong et al. for Ag (Z=47) and Xe (Z=54). For equal-energy, back-to-back two-photon decay, the calculations show an increase in transition probability with Z for the 2s{yields}1s and 3d{yields}1s transitions. In contrast, our data, at Z=79, corrected for the angular distribution, give a smaller transition probability than the lower-Z experimental results of Ilakovac et al. and Mokler et al. for Ag and Xe. The shapes of the two-photon continua in our data are in general agreement with theory except that we find anomalously high values for the differential two-photon transition probability for the 3s{yields}1s transition near y=0.35, where y is the fraction of the transition energy carried by the lower-energy photon.« less

  9. Transition Dipole Moments and Transition Probabilities of the CN Radical

    NASA Astrophysics Data System (ADS)

    Yin, Yuan; Shi, Deheng; Sun, Jinfeng; Zhu, Zunlue

    2018-04-01

    This paper studies the transition probabilities of electric dipole transitions between 10 low-lying states of the CN radical. These states are X2Σ+, A2Π, B2Σ+, a4Σ+, b4Π, 14Σ‑, 24Π, 14Δ, 16Σ+, and 16Π. The potential energy curves are calculated using the CASSCF method, which is followed by the icMRCI approach with the Davidson correction. The transition dipole moments between different states are calculated. To improve the accuracy of potential energy curves, core–valence correlation and scalar relativistic corrections, as well as the extrapolation of potential energies to the complete basis set limit are included. The Franck–Condon factors and Einstein coefficients of emissions are calculated. The radiative lifetimes are determined for the vibrational levels of the A2Π, B2Σ+, b4Π, 14Σ‑, 24Π, 14Δ, and 16Π states. According to the transition probabilities and radiative lifetimes, some guidelines for detecting these states spectroscopically are proposed. The spin–orbit coupling effect on the spectroscopic and vibrational properties is evaluated. The splitting energy in the A2Π state is determined to be 50.99 cm‑1, which compares well with the experimental ones. The potential energy curves, transition dipole moments, spectroscopic parameters, and transition probabilities reported in this paper can be considered to be very reliable. The results obtained here can be used as guidelines for detecting these transitions, in particular those that have not been measured in previous experiments or have not been observed in the Sun, comets, stellar atmospheres, dark interstellar clouds, and diffuse interstellar clouds.

  10. The phase transition of matrix recovery from Gaussian measurements matches the minimax MSE of matrix denoising.

    PubMed

    Donoho, David L; Gavish, Matan; Montanari, Andrea

    2013-05-21

    Let X(0) be an unknown M by N matrix. In matrix recovery, one takes n < MN linear measurements y(1),…,y(n) of X(0), where y(i) = Tr(A(T)iX(0)) and each A(i) is an M by N matrix. A popular approach for matrix recovery is nuclear norm minimization (NNM): solving the convex optimization problem min ||X||*subject to y(i) =Tr(A(T)(i)X) for all 1 ≤ i ≤ n, where || · ||* denotes the nuclear norm, namely, the sum of singular values. Empirical work reveals a phase transition curve, stated in terms of the undersampling fraction δ(n,M,N) = n/(MN), rank fraction ρ=rank(X0)/min {M,N}, and aspect ratio β=M/N. Specifically when the measurement matrices Ai have independent standard Gaussian random entries, a curve δ*(ρ) = δ*(ρ;β) exists such that, if δ > δ*(ρ), NNM typically succeeds for large M,N, whereas if δ < δ*(ρ), it typically fails. An apparently quite different problem is matrix denoising in Gaussian noise, in which an unknown M by N matrix X(0) is to be estimated based on direct noisy measurements Y =X(0) + Z, where the matrix Z has independent and identically distributed Gaussian entries. A popular matrix denoising scheme solves the unconstrained optimization problem min|| Y-X||(2)(F)/2+λ||X||*. When optimally tuned, this scheme achieves the asymptotic minimax mean-squared error M(ρ;β) = lim(M,N → ∞)inf(λ)sup(rank(X) ≤ ρ · M)MSE(X,X(λ)), where M/N → . We report extensive experiments showing that the phase transition δ*(ρ) in the first problem, matrix recovery from Gaussian measurements, coincides with the minimax risk curve M(ρ)=M(ρ;β) in the second problem, matrix denoising in Gaussian noise: δ*(ρ)=M(ρ), for any rank fraction 0 < ρ < 1 (at each common aspect ratio β). Our experiments considered matrices belonging to two constraint classes: real M by N matrices, of various ranks and aspect ratios, and real symmetric positive-semidefinite N by N matrices, of various ranks.

  11. Changes in EEG activity and hypothalamic temperature as indices for non-REM sleep to REM sleep transitions.

    PubMed

    Capitani, Paolo; Cerri, Matteo; Amici, Roberto; Baracchi, Francesca; Jones, Christine Ann; Luppi, Marco; Perez, Emanuele; Parmeggiani, Pier Luigi; Zamboni, Giovanni

    A shift of physiological regulations from a homeostatic to a non-homeostatic modality characterizes the passage from non-NREM sleep (NREMS) to REM sleep (REMS). In the rat, an EEG index which allows the automatic scoring of transitions from NREMS to REMS has been proposed: the NREMS to REMS transition indicator value, NIV [J.H. Benington et al., Sleep 17 (1994) 28-36]. However, such transitions are not always followed by a REMS episode, but are often followed by an awakening. In the present study, the relationship between changes in EEG activity and hypothalamic temperature (Thy), taken as an index of autonomic activity, was studied within a window consisting of the 60s which precedes a state change from a consolidated NREMS episode. Furthermore, the probability that a transition would lead to REMS or wake was analysed. The results showed that, within this time window, both a modified NIV (NIV(60)) and the difference between Thy at the limits of the window (Thy(D)) were related to the probability of REMS onset. Both the relationship between the indices and the probability of REMS onset was sigmoid, the latter of which saturated at a probability level around 50-60%. The efficacy for the prediction of successful transitions from NREMS to REMS found using Thy(D) as an index supports the view that such a transition is a dynamic process where the physiological risk to enter REMS is weighted at a central level.

  12. Structural and luminescence studies of Ho{sup 3+}-doped zinc-aluminium-sodium-phosphate (ZANP) glasses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brahmachary, K.; Rajesh, D.; Ratnakaram, Y. C., E-mail: ratnakaramsvu@gmail.com

    Trivalent holmium doped zinc-aluminium-sodium-phosphate (ZANP) glasses were prepared by conventional melt-quenching technique and characterized for their structural and luminescence properties. The amorphous nature, elemental analysis and thermal stability of the glasses were studied by using X-ray diffraction, energy dispersive spectrum and differential scanning calorimetry analysis, respectively. The absorption and fluorescence spectra have been recorded at room temperature. Based on the absorption spectra, the Judd-Ofelt parameters and radiative parameters such as spontaneous transition probabilities (A{sub R}), branching ratios (β{sub R}), radiative lifetimes (τ{sub R}) were calculated and discussed. From the emission spectra emission peak positions (λ{sub P}), effective bandwidths (Δλ{sub eff})more » and stimulated emission cross-sections (σ{sub P}) were calculated for the observed emission transitions,{sup 5}S{sub 2} ({sup 5}F{sub 4}→{sup 5}I{sub 8}) and {sup 5}F{sub 5}→{sup 5}I{sub 8} in all the glass samples. The stimulated emission cross-section is higher for ZANPHo10 glass matrix and so it may be useful for laser excitation.« less

  13. Entropy, complexity, and Markov diagrams for random walk cancer models.

    PubMed

    Newton, Paul K; Mason, Jeremy; Hurt, Brian; Bethel, Kelly; Bazhenova, Lyudmila; Nieva, Jorge; Kuhn, Peter

    2014-12-19

    The notion of entropy is used to compare the complexity associated with 12 common cancers based on metastatic tumor distribution autopsy data. We characterize power-law distributions, entropy, and Kullback-Liebler divergence associated with each primary cancer as compared with data for all cancer types aggregated. We then correlate entropy values with other measures of complexity associated with Markov chain dynamical systems models of progression. The Markov transition matrix associated with each cancer is associated with a directed graph model where nodes are anatomical locations where a metastatic tumor could develop, and edge weightings are transition probabilities of progression from site to site. The steady-state distribution corresponds to the autopsy data distribution. Entropy correlates well with the overall complexity of the reduced directed graph structure for each cancer and with a measure of systemic interconnectedness of the graph, called graph conductance. The models suggest that grouping cancers according to their entropy values, with skin, breast, kidney, and lung cancers being prototypical high entropy cancers, stomach, uterine, pancreatic and ovarian being mid-level entropy cancers, and colorectal, cervical, bladder, and prostate cancers being prototypical low entropy cancers, provides a potentially useful framework for viewing metastatic cancer in terms of predictability, complexity, and metastatic potential.

  14. Entropy, complexity, and Markov diagrams for random walk cancer models

    NASA Astrophysics Data System (ADS)

    Newton, Paul K.; Mason, Jeremy; Hurt, Brian; Bethel, Kelly; Bazhenova, Lyudmila; Nieva, Jorge; Kuhn, Peter

    2014-12-01

    The notion of entropy is used to compare the complexity associated with 12 common cancers based on metastatic tumor distribution autopsy data. We characterize power-law distributions, entropy, and Kullback-Liebler divergence associated with each primary cancer as compared with data for all cancer types aggregated. We then correlate entropy values with other measures of complexity associated with Markov chain dynamical systems models of progression. The Markov transition matrix associated with each cancer is associated with a directed graph model where nodes are anatomical locations where a metastatic tumor could develop, and edge weightings are transition probabilities of progression from site to site. The steady-state distribution corresponds to the autopsy data distribution. Entropy correlates well with the overall complexity of the reduced directed graph structure for each cancer and with a measure of systemic interconnectedness of the graph, called graph conductance. The models suggest that grouping cancers according to their entropy values, with skin, breast, kidney, and lung cancers being prototypical high entropy cancers, stomach, uterine, pancreatic and ovarian being mid-level entropy cancers, and colorectal, cervical, bladder, and prostate cancers being prototypical low entropy cancers, provides a potentially useful framework for viewing metastatic cancer in terms of predictability, complexity, and metastatic potential.

  15. Density functional calculations of multiphonon capture cross sections at defects in semiconductors

    NASA Astrophysics Data System (ADS)

    Barmparis, Georgios D.; Puzyrev, Yevgeniy S.; Zhang, X.-G.; Pantelides, Sokrates T.

    2014-03-01

    The theory of electron capture cross sections by multiphonon processes in semiconductors has a long and controversial history. Here we present a comprehensive theory and describe its implementation for realistic calculations. The Born-Oppenheimer and the Frank-Condon approximations are employed. The transition probability of an incoming electron is written as a product of an instantaneous electronic transition in the initial defect configuration and the line shape function (LSF) that describes the multiphonon processes that lead to lattice relaxation. The electronic matrix elements are calculated using the Projector Augmented Wave (PAW) method which yields the true wave functions while still employing a plane-wave basis. The LSF is calculated by employing a Monte Carlo method and the real phonon modes of the defect, calculated using density functional theory in the PAW scheme. Initial results of the capture cross section for a prototype system, namely a triply hydrogenated vacancy in Si are presented. The results are relevant for modeling device degradation by hot electron effects. This work is supported in part by the Samsung Advanced Institute of Technology (SAIT)'s Global Research Outreach (GRO) Program and by the LDRD program at ORNL.

  16. Examining Spillovers between Long and Short Repeated Prisoner’s Dilemma Games Played in the Laboratory

    PubMed Central

    Arechar, Antonio A.; Kouchaki, Maryam; Rand, David G.

    2018-01-01

    We had participants play two sets of repeated Prisoner’s Dilemma (RPD) games, one with a large continuation probability and the other with a small continuation probability, as well as Dictator Games (DGs) before and after the RPDs. We find that, regardless of which is RPD set is played first, participants typically cooperate when the continuation probability is large and defect when the continuation probability is small. However, there is an asymmetry in behavior when transitioning from one continuation probability to the other. When switching from large to small, transient higher levels of cooperation are observed in the early games of the small continuation set. Conversely, when switching from small to large, cooperation is immediately high in the first game of the large continuation set. We also observe that response times increase when transitioning between sets of RPDs, except for altruistic participants transitioning into the set of RPDs with long continuation probabilities. These asymmetries suggest a bias in favor of cooperation. Finally, we examine the link between altruism and RPD play. We find that small continuation probability RPD play is correlated with giving in DGs played before and after the RPDs, whereas high continuation probability RPD play is not. PMID:29809199

  17. Modelling of OPNMR phenomena using photon energy-dependent 〈Sz〉 in GaAs and InP

    NASA Astrophysics Data System (ADS)

    Wheeler, Dustin D.; Willmering, Matthew M.; Sesti, Erika L.; Pan, Xingyuan; Saha, Dipta; Stanton, Christopher J.; Hayes, Sophia E.

    2016-12-01

    We have modified the model for optically-pumped NMR (OPNMR) to incorporate a revised expression for the expectation value of the z-projection of the electron spin, 〈Sz 〉 and apply this model to both bulk GaAs and a new material, InP. This expression includes the photon energy dependence of the electron polarization when optically pumping direct-gap semiconductors in excess of the bandgap energy, Eg . Rather than using a fixed value arising from coefficients (the matrix elements) for the optical transitions at the k = 0 bandedge, we define a new parameter, Sopt (Eph) . Incorporating this revised element into the expression for 〈Sz 〉 , we have simulated the photon energy dependence of the OPNMR signals from bulk semi-insulating GaAs and semi-insulating InP. In earlier work, we matched calculations of electron spin polarization (alone) to features in a plot of OPNMR signal intensity versus photon energy for optical pumping (Ramaswamy et al., 2010). By incorporating an electron spin polarization which varies with pump wavelength into the penetration depth model of OPNMR signal, we are able to model features in both III-V semiconductors. The agreement between the OPNMR data and the corresponding model demonstrates that fluctuations in the OPNMR intensity have particular sensitivity to light hole-to-conduction band transitions in bulk systems. We provide detailed plots of the theoretical predictions for optical pumping transition probabilities with circularly-polarized light for both helicities of light, broken down into illustrative plots of optical magnetoabsorption and spin polarization, shown separately for heavy-hole and light-hole transitions. These plots serve as an effective roadmap of transitions, which are helpful to other researchers investigating optical pumping effects.

  18. Modelling of OPNMR phenomena using photon energy-dependent 〈Sz〉 in GaAs and InP.

    PubMed

    Wheeler, Dustin D; Willmering, Matthew M; Sesti, Erika L; Pan, Xingyuan; Saha, Dipta; Stanton, Christopher J; Hayes, Sophia E

    2016-12-01

    We have modified the model for optically-pumped NMR (OPNMR) to incorporate a revised expression for the expectation value of the z-projection of the electron spin, 〈S z 〉 and apply this model to both bulk GaAs and a new material, InP. This expression includes the photon energy dependence of the electron polarization when optically pumping direct-gap semiconductors in excess of the bandgap energy, E g . Rather than using a fixed value arising from coefficients (the matrix elements) for the optical transitions at the k=0 bandedge, we define a new parameter, S opt (E ph ). Incorporating this revised element into the expression for 〈S z 〉, we have simulated the photon energy dependence of the OPNMR signals from bulk semi-insulating GaAs and semi-insulating InP. In earlier work, we matched calculations of electron spin polarization (alone) to features in a plot of OPNMR signal intensity versus photon energy for optical pumping (Ramaswamy et al., 2010). By incorporating an electron spin polarization which varies with pump wavelength into the penetration depth model of OPNMR signal, we are able to model features in both III-V semiconductors. The agreement between the OPNMR data and the corresponding model demonstrates that fluctuations in the OPNMR intensity have particular sensitivity to light hole-to-conduction band transitions in bulk systems. We provide detailed plots of the theoretical predictions for optical pumping transition probabilities with circularly-polarized light for both helicities of light, broken down into illustrative plots of optical magnetoabsorption and spin polarization, shown separately for heavy-hole and light-hole transitions. These plots serve as an effective roadmap of transitions, which are helpful to other researchers investigating optical pumping effects. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Parity-violating electric-dipole transitions in helium

    NASA Technical Reports Server (NTRS)

    Hiller, J.; Sucher, J.; Bhatia, A. K.; Feinberg, G.

    1980-01-01

    The paper examines parity-violating electric-dipole transitions in He in order to gain insight into the reliability of approximate calculations which are carried out for transitions in many-electron atoms. The contributions of the nearest-lying states are computed with a variety of wave functions, including very simple product wave functions, Hartree-Fock functions and Hylleraas-type wave functions with up to 84 parameters. It is found that values of the matrix elements of the parity-violating interaction can differ considerably from the values obtained from the good wave functions, even when these simple wave functions give accurate values for the matrix elements in question

  20. Temperature profile and equipartition law in a Langevin harmonic chain

    NASA Astrophysics Data System (ADS)

    Kim, Sangrak

    2017-09-01

    Temperature profile in a Langevin harmonic chain is explicitly derived and the validity of the equipartition law is checked. First, we point out that the temperature profile in previous studies does not agree with the equipartition law: In thermal equilibrium, the temperature profile deviates from the same temperature distribution against the equipartition law, particularly at the ends of the chain. The matrix connecting temperatures of the heat reservoirs and the temperatures of the harmonic oscillators turns out to be a probability matrix. By explicitly calculating the power spectrum of the probability matrix, we will show that the discrepancy comes from the neglect of the power spectrum in higher frequency ω, which is in decay mode, and related with the imaginary number of wave number q.

  1. Psychological and Social Risk Factors in Adolescent Smoking Transitions: A Population-Based Longitudinal Study

    PubMed Central

    Bricker, Jonathan B.; Rajan, K. Bharat; Zalewski, Maureen; Andersen, M. Robyn; Ramey, Madelaine; Peterson, Arthur V.

    2009-01-01

    Objective This study longitudinally investigated psychological and social risk factors consistent with the Theory of Triadic Influence (TTI) as predictors of adolescent smoking transitions. Design Among 4218 adolescents, five psychological risk factors (i.e., parent-noncompliance, friend-compliance, rebelliousness, low achievement motivation, and thrill seeking) were assessed in 9th grade (age 14), two social influence risk factors (i.e., parents’ and close friends’ smoking) were assessed in grades 3 (age 8) and 9 (age 14), respectively. Main Outcome Measures Adolescent smoking transitions occurring between the 9th and 12th (ages 14–17) grade interval. Results There was a 22–27% probability contributed by scoring high on each of these psychological risk factors to the overall probability that an adolescent would try smoking. For predicting trying smoking, the probability contributed by these psychological factors was greater than the probability contributed by each parent’s and close friend’s smoking. Parent-compliance had a higher contribution to the probability of trying smoking when an adolescent’s parent smoked (p < .05), while friend-compliance had a higher contribution to the probability of trying smoking when an adolescent’s friend smoked (p<.001). Conclusion These psychological and social factors have an important influence on adolescent smoking transitions. Implications for TTI and smoking prevention interventions are discussed. PMID:19594268

  2. Predicting critical transitions in dynamical systems from time series using nonstationary probability density modeling.

    PubMed

    Kwasniok, Frank

    2013-11-01

    A time series analysis method for predicting the probability density of a dynamical system is proposed. A nonstationary parametric model of the probability density is estimated from data within a maximum likelihood framework and then extrapolated to forecast the future probability density and explore the system for critical transitions or tipping points. A full systematic account of parameter uncertainty is taken. The technique is generic, independent of the underlying dynamics of the system. The method is verified on simulated data and then applied to prediction of Arctic sea-ice extent.

  3. Forecasting client transitions in British Columbia's Long-Term Care Program.

    PubMed Central

    Lane, D; Uyeno, D; Stark, A; Gutman, G; McCashin, B

    1987-01-01

    This article presents a model for the annual transitions of clients through various home and facility placements in a long-term care program. The model, an application of Markov chain analysis, is developed, tested, and applied to over 9,000 clients (N = 9,483) in British Columbia's Long Term Care Program (LTC) over the period 1978-1983. Results show that the model gives accurate forecasts of the progress of groups of clients from state to state in the long-term care system from time of admission until eventual death. Statistical methods are used to test the modeling hypothesis that clients' year-over-year transitions occur in constant proportions from state to state within the long-term care system. Tests are carried out by examining actual year-over-year transitions of each year's new admission cohort (1978-1983). Various subsets of the available data are analyzed and, after accounting for clear differences among annual cohorts, the most acceptable model of the actual client transition data occurred when clients were separated into male and female groups, i.e., the transition behavior of each group is describable by a different Markov model. To validate the model, we develop model estimates for the numbers of existing clients in each state of the long-term care system for the period (1981-1983) for which actual data are available. When these estimates are compared with the actual data, total weighted absolute deviations do not exceed 10 percent of actuals. Finally, we use the properties of the Markov chain probability transition matrix and simulation methods to develop three-year forecasts with prediction intervals for the distribution of the existing total clients into each state of the system. The tests, forecasts, and Markov model supplemental information are contained in a mechanized procedure suitable for a microcomputer. The procedure provides a powerful, efficient tool for decision makers planning facilities and services in response to the needs of long-term care clients. PMID:3121537

  4. Method of self-consistent evaluation of absolute emission probabilities of particles and gamma rays

    NASA Astrophysics Data System (ADS)

    Badikov, Sergei; Chechev, Valery

    2017-09-01

    In assumption of well installed decay scheme the method provides a) exact balance relationships, b) lower (compared to the traditional techniques) uncertainties of recommended absolute emission probabilities of particles and gamma rays, c) evaluation of correlations between the recommended emission probabilities (for the same and different decay modes). Application of the method for the decay data evaluation for even curium isotopes led to paradoxical results. The multidimensional confidence regions for the probabilities of the most intensive alpha transitions constructed on the basis of present and the ENDF/B-VII.1, JEFF-3.1, DDEP evaluations are inconsistent whereas the confidence intervals for the evaluated probabilities of single transitions agree with each other.

  5. An algorithm for minimum-cost set-point ordering in a cryogenic wind tunnel

    NASA Technical Reports Server (NTRS)

    Tripp, J. S.

    1981-01-01

    An algorithm for minimum cost ordering of set points in a cryogenic wind tunnel is developed. The procedure generates a matrix of dynamic state transition costs, which is evaluated by means of a single-volume lumped model of the cryogenic wind tunnel and the use of some idealized minimum-costs, which is evaluated by means of a single-volume lumped model of the cryogenic wind tunnel and the use of some idealized minimum-cost state-transition control strategies. A branch and bound algorithm is employed to determine the least costly sequence of state transitions from the transition-cost matrix. Some numerical results based on data for the National Transonic Facility are presented which show a strong preference for state transitions that consume to coolant. Results also show that the choice of the terminal set point in an open odering can produce a wide variation in total cost.

  6. Capture-recapture studies for multiple strata including non-markovian transitions

    USGS Publications Warehouse

    Brownie, C.; Hines, J.E.; Nichols, J.D.; Pollock, K.H.; Hestbeck, J.B.

    1993-01-01

    We consider capture-recapture studies where release and recapture data are available from each of a number of strata on every capture occasion. Strata may, for example, be geographic locations or physiological states. Movement of animals among strata occurs with unknown probabilities, and estimation of these unknown transition probabilities is the objective. We describe a computer routine for carrying out the analysis under a model that assumes Markovian transitions and under reduced parameter versions of this model. We also introduce models that relax the Markovian assumption and allow 'memory' to operate (i.e., allow dependence of the transition probabilities on the previous state). For these models, we sugg st an analysis based on a conditional likelihood approach. Methods are illustrated with data from a large study on Canada geese (Branta canadensis) banded in three geographic regions. The assumption of Markovian transitions is rejected convincingly for these data, emphasizing the importance of the more general models that allow memory.

  7. Exact solution for four-order acousto-optic Bragg diffraction with arbitrary initial conditions.

    PubMed

    Pieper, Ron; Koslover, Deborah; Poon, Ting-Chung

    2009-03-01

    An exact solution to the four-order acousto-optic (AO) Bragg diffraction problem with arbitrary initial conditions compatible with exact Bragg angle incident light is developed. The solution, obtained by solving a 4th-order differential equation, is formalized into a transition matrix operator predicting diffracted light orders at the exit of the AO cell in terms of the same diffracted light orders at the entrance. It is shown that the transition matrix is unitary and that this unitary matrix condition is sufficient to guarantee energy conservation. A comparison of analytical solutions with numerical predictions validates the formalism. Although not directly related to the approach used to obtain the solution, it was discovered that all four generated eigenvalues from the four-order AO differential matrix operator are expressed simply in terms of Euclid's Divine Proportion.

  8. Under the hood of statistical learning: A statistical MMN reflects the magnitude of transitional probabilities in auditory sequences.

    PubMed

    Koelsch, Stefan; Busch, Tobias; Jentschke, Sebastian; Rohrmeier, Martin

    2016-02-02

    Within the framework of statistical learning, many behavioural studies investigated the processing of unpredicted events. However, surprisingly few neurophysiological studies are available on this topic, and no statistical learning experiment has investigated electroencephalographic (EEG) correlates of processing events with different transition probabilities. We carried out an EEG study with a novel variant of the established statistical learning paradigm. Timbres were presented in isochronous sequences of triplets. The first two sounds of all triplets were equiprobable, while the third sound occurred with either low (10%), intermediate (30%), or high (60%) probability. Thus, the occurrence probability of the third item of each triplet (given the first two items) was varied. Compared to high-probability triplet endings, endings with low and intermediate probability elicited an early anterior negativity that had an onset around 100 ms and was maximal at around 180 ms. This effect was larger for events with low than for events with intermediate probability. Our results reveal that, when predictions are based on statistical learning, events that do not match a prediction evoke an early anterior negativity, with the amplitude of this mismatch response being inversely related to the probability of such events. Thus, we report a statistical mismatch negativity (sMMN) that reflects statistical learning of transitional probability distributions that go beyond auditory sensory memory capabilities.

  9. Mid-Term Probabilistic Forecast of Oil Spill Trajectories

    NASA Astrophysics Data System (ADS)

    Castanedo, S.; Abascal, A. J.; Cardenas, M.; Medina, R.; Guanche, Y.; Mendez, F. J.; Camus, P.

    2012-12-01

    There is increasing concern about the threat posed by oil spills to the coastal environment. This is reflected in the promulgation of various national and international standards among which are those that require companies whose activities involves oil spill risk, to have oil pollution emergency plans or similar arrangements for responding promptly and effectively to oil pollution incidents. Operational oceanography systems (OOS) that provide decision makers with oil spill trajectory forecasting, have demonstrated their usefulness in recent accidents (Castanedo et al., 2006). In recent years, many national and regional OOS have been setup focusing on short-term oil spill forecast (up to 5 days). However, recent accidental marine oil spills (Prestige in Spain, Deep Horizon in Gulf of Mexico) have revealed the importance of having larger prediction horizons (up to 15 days) in regional-scale areas. In this work, we have developed a methodology to provide probabilistic oil spill forecast based on numerical modelling and statistical methods. The main components of this approach are: (1) Use of high resolution long-term (1948-2009) historical hourly data bases of wind, wind-induced currents and astronomical tide currents obtained using state-of-the-art numerical models; (2) classification of representative wind field patterns (n=100) using clustering techniques based on PCA and K-means algorithms (Camus et al., 2011); (3) determination of the cluster occurrence probability and the stochastic matrix (matrix of transition of probability or Markov matrix), p_ij, (probability of moving from a cluster "i" to a cluster "j" in one time step); (4) Initial state for mid-term simulations is obtained from available wind forecast using nearest-neighbors analog method; (5) 15-days Stochastic Markov Chain simulations (m=1000) are launched; (6) Corresponding oil spill trajectories are carried out by TESEO Lagrangian transport model (Abascal et al., 2009); (7) probability maps are delivered using an user friendly Web App. The application of the method to the Gulf of Biscay (North Spain) will show the ability of this approach. References Abascal, A.J., Castanedo, S., Mendez, F.J., Medina, R., Losada, I.J., 2009. Calibration of a Lagrangian transport model using drifting buoys deployed during the Prestige oil spill. J. Coast. Res. 25 (1), 80-90.. Camus, P., Méndez, F.J., Medina, R., 2011. Analysis of clustering and selection algorithms for the study of multivariate wave climate. Coastal Engineering, doi:10.1016/j.coastaleng.2011.02.003. Castanedo, S., Medina, R., Losada, I.J., Vidal, C., Méndez, F.J., Osorio, A., Juanes, J.A., Puente, A., 2006. The Prestige oil spill in Cantabria (Bay of Biscay). Part I: operational forecasting system for quick response, risk assessment and protection of natural resources. J. Coast. Res. 22 (6), 1474-1489.

  10. Application of nanoindentation testing to study of the interfacial transition zone in steel fiber reinforced mortar

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Xiaohui; Jacobsen, Stefan; He Jianying

    2009-08-15

    The characteristics of the profiles of elastic modulus and hardness of the steel fiber-matrix and fiber-matrix-aggregate interfacial zones in steel fiber reinforced mortars have been investigated by using nanoindentation and Scanning Electron Microscopy (SEM), where two sets of parameters, i.e. water/binder ratio and content of silica fume were considered. Different interfacial bond conditions in the interfacial transition zones (ITZ) are discussed. For sample without silica fume, efficient interfacial bonds across the steel fiber-matrix and fiber-matrix-aggregate interfaces are shown in low water/binder ratio mortar; while in high water/binder ratio mortar, due to the discontinuous bleeding voids underneath the fiber, the fiber-matrixmore » bond is not very good. On the other hand, for sample with silica fume, the addition of 10% silica fume leads to no distinct presence of weak ITZ in the steel fiber-matrix interface; but the effect of the silica fume on the steel fiber-matrix-aggregate interfacial zone is not obvious due to voids in the vicinity of steel fiber.« less

  11. The Association of Trip Distance With Walking To Reach Public Transit: Data from the California Household Travel Survey.

    PubMed

    Durand, Casey P; Tang, Xiaohui; Gabriel, Kelley P; Sener, Ipek N; Oluyomi, Abiodun O; Knell, Gregory; Porter, Anna K; Oelscher, Deanna M; Kohl, Harold W

    2016-06-01

    Use of public transit is cited as a way to help individuals incorporate regular physical activity into their day. As a novel research topic, however, there is much we do not know. The aim of this analysis was to identify the correlation between distance to a transit stop and the probability it will be accessed by walking. We also sought to understand if this relation was moderated by trip, personal or household factors. Data from the 2012 California Household Travel Survey was used for this cross-sectional analysis. 2,573 individuals were included, representing 6,949 transit trips. Generalized estimating equations modeled the probability of actively accessing public transit as a function of distance from origin to transit stop, and multiple trip, personal and household variables. Analyses were conducted in 2014 and 2015. For each mile increase in distance from the point of origin to the transit stop, the probability of active access decreased by 12%. With other factors held equal, at two miles from a transit stop there is a 50% chance someone will walk to a stop versus non-active means. The distance-walking relation was modified by month the trips were taken. Individuals appear to be willing to walk further to reach transit than existing guidelines indicate. This implies that for any given transit stop, the zone of potential riders who will walk to reach transit is relatively large. Future research should clarify who transit-related walkers are, and why some are more willing to walk longer distances to transit than others.

  12. The Association of Trip Distance With Walking To Reach Public Transit: Data from the California Household Travel Survey

    PubMed Central

    Durand, Casey P.; Tang, Xiaohui; Gabriel, Kelley P.; Sener, Ipek N.; Oluyomi, Abiodun O.; Knell, Gregory; Porter, Anna K.; oelscher, Deanna M.; Kohl, Harold W.

    2015-01-01

    Introduction Use of public transit is cited as a way to help individuals incorporate regular physical activity into their day. As a novel research topic, however, there is much we do not know. The aim of this analysis was to identify the correlation between distance to a transit stop and the probability it will be accessed by walking. We also sought to understand if this relation was moderated by trip, personal or household factors. Methods Data from the 2012 California Household Travel Survey was used for this cross-sectional analysis. 2,573 individuals were included, representing 6,949 transit trips. Generalized estimating equations modeled the probability of actively accessing public transit as a function of distance from origin to transit stop, and multiple trip, personal and household variables. Analyses were conducted in 2014 and 2015. Results For each mile increase in distance from the point of origin to the transit stop, the probability of active access decreased by 12%. With other factors held equal, at two miles from a transit stop there is a 50% chance someone will walk to a stop versus non-active means. The distance-walking relation was modified by month the trips were taken. Conclusions Individuals appear to be willing to walk further to reach transit than existing guidelines indicate. This implies that for any given transit stop, the zone of potential riders who will walk to reach transit is relatively large. Future research should clarify who transit-related walkers are, and why some are more willing to walk longer distances to transit than others. PMID:27429905

  13. A Deep Stochastic Model for Detecting Community in Complex Networks

    NASA Astrophysics Data System (ADS)

    Fu, Jingcheng; Wu, Jianliang

    2017-01-01

    Discovering community structures is an important step to understanding the structure and dynamics of real-world networks in social science, biology and technology. In this paper, we develop a deep stochastic model based on non-negative matrix factorization to identify communities, in which there are two sets of parameters. One is the community membership matrix, of which the elements in a row correspond to the probabilities of the given node belongs to each of the given number of communities in our model, another is the community-community connection matrix, of which the element in the i-th row and j-th column represents the probability of there being an edge between a randomly chosen node from the i-th community and a randomly chosen node from the j-th community. The parameters can be evaluated by an efficient updating rule, and its convergence can be guaranteed. The community-community connection matrix in our model is more precise than the community-community connection matrix in traditional non-negative matrix factorization methods. Furthermore, the method called symmetric nonnegative matrix factorization, is a special case of our model. Finally, based on the experiments on both synthetic and real-world networks data, it can be demonstrated that our algorithm is highly effective in detecting communities.

  14. Effects of Contextual Predictability and Transitional Probability on Eye Movements During Reading

    ERIC Educational Resources Information Center

    Frisson, Steven; Rayner, Keith; Pickering, Martin J.

    2005-01-01

    In 2 eye-movement experiments, the authors tested whether transitional probability (the statistical likelihood that a word precedes or follows another word) affects reading times and whether this occurs independently from contextual predictability effects. Experiment 1 showed early effects of predictability, replicating S. A. McDonald and R. C.…

  15. Using optimal transport theory to estimate transition probabilities in metapopulation dynamics

    USGS Publications Warehouse

    Nichols, Jonathan M.; Spendelow, Jeffrey A.; Nichols, James D.

    2017-01-01

    This work considers the estimation of transition probabilities associated with populations moving among multiple spatial locations based on numbers of individuals at each location at two points in time. The problem is generally underdetermined as there exists an extremely large number of ways in which individuals can move from one set of locations to another. A unique solution therefore requires a constraint. The theory of optimal transport provides such a constraint in the form of a cost function, to be minimized in expectation over the space of possible transition matrices. We demonstrate the optimal transport approach on marked bird data and compare to the probabilities obtained via maximum likelihood estimation based on marked individuals. It is shown that by choosing the squared Euclidean distance as the cost, the estimated transition probabilities compare favorably to those obtained via maximum likelihood with marked individuals. Other implications of this cost are discussed, including the ability to accurately interpolate the population's spatial distribution at unobserved points in time and the more general relationship between the cost and minimum transport energy.

  16. Computer Simulation Results for the Two-Point Probability Function of Composite Media

    NASA Astrophysics Data System (ADS)

    Smith, P.; Torquato, S.

    1988-05-01

    Computer simulation results are reported for the two-point matrix probability function S2 of two-phase random media composed of disks distributed with an arbitrary degree of impenetrability λ. The novel technique employed to sample S2( r) (which gives the probability of finding the endpoints of a line segment of length r in the matrix) is very accurate and has a fast execution time. Results for the limiting cases λ = 0 (fully penetrable disks) and λ = 1 (hard disks), respectively, compare very favorably with theoretical predictions made by Torquato and Beasley and by Torquato and Lado. Results are also reported for several values of λ. that lie between these two extremes: cases which heretofore have not been examined.

  17. Thermotropic phase transitions in model membranes of the outer skin layer based on ceramide 6

    NASA Astrophysics Data System (ADS)

    Gruzinov, A. Yu.; Kiselev, M. A.; Ermakova, E. V.; Zabelin, A. V.

    2014-01-01

    The lipid intercellular matrix stratum corneum of the outer skin layer is a multilayer membrane consisting of a complex mixture of different lipids: ceramides, fatty acids, cholesterol, and its derivatives. The basis of the multilayer membrane is the lipid bilayer, i.e., a two-dimensional liquid crystal. Currently, it is known that the main way of substance penetration through the skin is the lipid matrix. The complexity of the actual biological system does not allow reliable direct study of its properties; therefore, system modeling is often used. Phase transitions in the lipid system whose composition simulates the native lipid matrix are studied by the X-ray synchrotron radiation diffraction method.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Cun; Ren, Yang; Cui, Lishan

    Under high pressure, materials usually shrink during compression as described by an equation of state. Here, we present the anomalous volume expansion behavior of a one-dimensional Nb nanowire embedded in a NiTi transforming matrix, while the matrix undergoes a pressure-induced martensitic transformation. The Nb volume expansion depends on the NiTi transition pressure range from the matrix, which is controlled by the shear strain induced by different pressure transmitting media. The transformation-induced interfacial stresses between Nb and NiTi may play a major role in this anomaly. In conclusion, our discovery sheds new light on the nano-interfacial effect on mechanical anomalies inmore » heterogeneous systems during a pressure-induced phase transition.« less

  19. Composite material reinforced with atomized quasicrystalline particles and method of making same

    DOEpatents

    Biner, Suleyman B.; Sordelet, Daniel J.; Lograsso, Barbara K.; Anderson, Iver E.

    1998-12-22

    A composite material comprises an aluminum or aluminum alloy matrix having generally spherical, atomized quasicrystalline aluminum-transition metal alloy reinforcement particles disposed in the matrix to improve mechanical properties. A composite article can be made by consolidating generally spherical, atomized quaiscrystalline aluminum-transition metal alloy particles and aluminum or aluminum alloy particles to form a body that is cold and/or hot reduced to form composite products, such as composite plate or sheet, with interfacial bonding between the quasicrystalline particles and the aluminum or aluminum alloy matrix without damage (e.g. cracking or shape change) of the reinforcement particles. The cold and/or hot worked compositehibits substantially improved yield strength, tensile strength, Young's modulus (stiffness).

  20. Poverty dynamics, poverty thresholds and mortality: An age-stage Markovian model

    PubMed Central

    Rehkopf, David; Tuljapurkar, Shripad; Horvitz, Carol C.

    2018-01-01

    Recent studies have examined the risk of poverty throughout the life course, but few have considered how transitioning in and out of poverty shape the dynamic heterogeneity and mortality disparities of a cohort at each age. Here we use state-by-age modeling to capture individual heterogeneity in crossing one of three different poverty thresholds (defined as 1×, 2× or 3× the “official” poverty threshold) at each age. We examine age-specific state structure, the remaining life expectancy, its variance, and cohort simulations for those above and below each threshold. Survival and transitioning probabilities are statistically estimated by regression analyses of data from the Health and Retirement Survey RAND data-set, and the National Longitudinal Survey of Youth. Using the results of these regression analyses, we parameterize discrete state, discrete age matrix models. We found that individuals above all three thresholds have higher annual survival than those in poverty, especially for mid-ages to about age 80. The advantage is greatest when we classify individuals based on 1× the “official” poverty threshold. The greatest discrepancy in average remaining life expectancy and its variance between those above and in poverty occurs at mid-ages for all three thresholds. And fewer individuals are in poverty between ages 40-60 for all three thresholds. Our findings are consistent with results based on other data sets, but also suggest that dynamic heterogeneity in poverty and the transience of the poverty state is associated with income-related mortality disparities (less transience, especially of those above poverty, more disparities). This paper applies the approach of age-by-stage matrix models to human demography and individual poverty dynamics. In so doing we extend the literature on individual poverty dynamics across the life course. PMID:29768416

  1. Scattering of particles in the presence of harmonic confinement perturbed by a complex absorbing potential

    NASA Astrophysics Data System (ADS)

    Maghari, A.; Kermani, M. M.

    2018-04-01

    A system of two interacting atoms confined in 1D harmonic trap and perturbed by an absorbing boundary potential is studied using the Lippmann-Schwinger formalism. The atom-atom interaction potential was considered as a nonlocal separable model. The perturbed absorbing boundary potential was also assumed in the form of Scarf II complex absorbing potential. The model is used for the study of 1D optical lattices that support the trapping of a pair atom within a unit cell. Moreover, it allows to describe the scattering particles in a tight smooth trapping surface and to analyze the bound and resonance states. The analytical expressions for wavefunctions and transition matrix as well as the absorption probabilities are calculated. A demonstration of how the complex absorbing potential affecting the bound states and resonances of particles confined in a harmonic trap is described.

  2. Stability Analysis of Multi-Sensor Kalman Filtering over Lossy Networks

    PubMed Central

    Gao, Shouwan; Chen, Pengpeng; Huang, Dan; Niu, Qiang

    2016-01-01

    This paper studies the remote Kalman filtering problem for a distributed system setting with multiple sensors that are located at different physical locations. Each sensor encapsulates its own measurement data into one single packet and transmits the packet to the remote filter via a lossy distinct channel. For each communication channel, a time-homogeneous Markov chain is used to model the normal operating condition of packet delivery and losses. Based on the Markov model, a necessary and sufficient condition is obtained, which can guarantee the stability of the mean estimation error covariance. Especially, the stability condition is explicitly expressed as a simple inequality whose parameters are the spectral radius of the system state matrix and transition probabilities of the Markov chains. In contrast to the existing related results, our method imposes less restrictive conditions on systems. Finally, the results are illustrated by simulation examples. PMID:27104541

  3. Studying the Global Bifurcation Involving Wada Boundary Metamorphosis by a Method of Generalized Cell Mapping with Sampling-Adaptive Interpolation

    NASA Astrophysics Data System (ADS)

    Liu, Xiao-Ming; Jiang, Jun; Hong, Ling; Tang, Dafeng

    In this paper, a new method of Generalized Cell Mapping with Sampling-Adaptive Interpolation (GCMSAI) is presented in order to enhance the efficiency of the computation of one-step probability transition matrix of the Generalized Cell Mapping method (GCM). Integrations with one mapping step are replaced by sampling-adaptive interpolations of third order. An explicit formula of interpolation error is derived for a sampling-adaptive control to switch on integrations for the accuracy of computations with GCMSAI. By applying the proposed method to a two-dimensional forced damped pendulum system, global bifurcations are investigated with observations of boundary metamorphoses including full to partial and partial to partial as well as the birth of fully Wada boundary. Moreover GCMSAI requires a computational time of one thirtieth up to one fiftieth compared to that of the previous GCM.

  4. An Evaluation of Two Methods for Generating Synthetic HL7 Segments Reflecting Real-World Health Information Exchange Transactions

    PubMed Central

    Mwogi, Thomas S.; Biondich, Paul G.; Grannis, Shaun J.

    2014-01-01

    Motivated by the need for readily available data for testing an open-source health information exchange platform, we developed and evaluated two methods for generating synthetic messages. The methods used HL7 version 2 messages obtained from the Indiana Network for Patient Care. Data from both methods were analyzed to assess how effectively the output reflected original ‘real-world’ data. The Markov Chain method (MCM) used an algorithm based on transitional probability matrix while the Music Box model (MBM) randomly selected messages of particular trigger type from the original data to generate new messages. The MBM was faster, generated shorter messages and exhibited less variation in message length. The MCM required more computational power, generated longer messages with more message length variability. Both methods exhibited adequate coverage, producing a high proportion of messages consistent with original messages. Both methods yielded similar rates of valid messages. PMID:25954458

  5. Constructing 1/omegaalpha noise from reversible Markov chains.

    PubMed

    Erland, Sveinung; Greenwood, Priscilla E

    2007-09-01

    This paper gives sufficient conditions for the output of 1/omegaalpha noise from reversible Markov chains on finite state spaces. We construct several examples exhibiting this behavior in a specified range of frequencies. We apply simple representations of the covariance function and the spectral density in terms of the eigendecomposition of the probability transition matrix. The results extend to hidden Markov chains. We generalize the results for aggregations of AR1-processes of C. W. J. Granger [J. Econometrics 14, 227 (1980)]. Given the eigenvalue function, there is a variety of ways to assign values to the states such that the 1/omegaalpha condition is satisfied. We show that a random walk on a certain state space is complementary to the point process model of 1/omega noise of B. Kaulakys and T. Meskauskas [Phys. Rev. E 58, 7013 (1998)]. Passing to a continuous state space, we construct 1/omegaalpha noise which also has a long memory.

  6. Stochastic Optimal Control via Bellman's Principle

    NASA Technical Reports Server (NTRS)

    Crespo, Luis G.; Sun, Jian Q.

    2003-01-01

    This paper presents a method for finding optimal controls of nonlinear systems subject to random excitations. The method is capable to generate global control solutions when state and control constraints are present. The solution is global in the sense that controls for all initial conditions in a region of the state space are obtained. The approach is based on Bellman's Principle of optimality, the Gaussian closure and the Short-time Gaussian approximation. Examples include a system with a state-dependent diffusion term, a system in which the infinite hierarchy of moment equations cannot be analytically closed, and an impact system with a elastic boundary. The uncontrolled and controlled dynamics are studied by creating a Markov chain with a control dependent transition probability matrix via the Generalized Cell Mapping method. In this fashion, both the transient and stationary controlled responses are evaluated. The results show excellent control performances.

  7. Estimation of transition probabilities of credit ratings

    NASA Astrophysics Data System (ADS)

    Peng, Gan Chew; Hin, Pooi Ah

    2015-12-01

    The present research is based on the quarterly credit ratings of ten companies over 15 years taken from the database of the Taiwan Economic Journal. The components in the vector mi (mi1, mi2,⋯, mi10) may first be used to denote the credit ratings of the ten companies in the i-th quarter. The vector mi+1 in the next quarter is modelled to be dependent on the vector mi via a conditional distribution which is derived from a 20-dimensional power-normal mixture distribution. The transition probability Pkl (i ,j ) for getting mi+1,j = l given that mi, j = k is then computed from the conditional distribution. It is found that the variation of the transition probability Pkl (i ,j ) as i varies is able to give indication for the possible transition of the credit rating of the j-th company in the near future.

  8. NIST Databases on Atomic Spectra

    NASA Astrophysics Data System (ADS)

    Reader, J.; Wiese, W. L.; Martin, W. C.; Musgrove, A.; Fuhr, J. R.

    2002-11-01

    The NIST atomic and molecular spectroscopic databases now available on the World Wide Web through the NIST Physics Laboratory homepage include Atomic Spectra Database, Ground Levels and Ionization Energies for the Neutral Atoms, Spectrum of Platinum Lamp for Ultraviolet Spectrograph Calibration, Bibliographic Database on Atomic Transition Probabilities, Bibliographic Database on Atomic Spectral Line Broadening, and Electron-Impact Ionization Cross Section Database. The Atomic Spectra Database (ASD) [1] offers evaluated data on energy levels, wavelengths, and transition probabilities for atoms and atomic ions. Data are given for some 950 spectra and 70,000 energy levels. About 91,000 spectral lines are included, with transition probabilities for about half of these. Additional data resulting from our ongoing critical compilations will be included in successive new versions of ASD. We plan to include, for example, our recently published data for some 16,000 transitions covering most ions of the iron-group elements, as well as Cu, Kr, and Mo [2]. Our compilations benefit greatly from experimental and theoretical atomic-data research being carried out in the NIST Atomic Physics Division. A new compilation covering spectra of the rare gases in all stages of ionization, for example, revealed a need for improved data in the infrared. We have thus measured these needed data with our high-resolution Fourier transform spectrometer [3]. An upcoming new database will give wavelengths and intensities for the stronger lines of all neutral and singly-ionized atoms, along with energy levels and transition probabilities for the persistent lines [4]. A critical compilation of the transition probabilities of Ba I and Ba II [5] has been completed and several other compilations of atomic transition probabilities are nearing completion. These include data for all spectra of Na, Mg, Al, and Si [6]. Newly compiled data for selected ions of Ne, Mg, Si and S, will form the basis for a new database intended to assist interpretation of soft x-ray astronomical spectra, such as from the Chandra X-ray Observatory. These data will be available soon on the World Wide Web [7].

  9. Use of Mental Health Services in Transition Age Youth with Bipolar Disorder

    PubMed Central

    Hower, Heather; Case, Brady G.; Hoeppner, Bettina; Yen, Shirley; Goldstein, Tina; Goldstein, Benjamin; Birmaher, Boris; Weinstock, Lauren; Topor, David; Hunt, Jeffrey; Strober, Michael; Ryan, Neal; Axelson, David; Gill, Mary Kay; Keller, Martin B.

    2013-01-01

    Objectives There is concern that treatment of serious mental illness in the United States declines precipitously following legal emancipation at age 18 years and transition from specialty youth clinical settings. We examined age transition effects on treatment utilization in a sample of youth with bipolar disorder. Methods Youth with bipolar disorder (N = 413) 7–18 years of age were assessed approximately twice per year (mean interval 8.2 months) for at least 4 years. Annual use of any individual, group, and family therapy, psychopharmacology visits, and hospitalization at each year of age, and monthly use from ages 17 through 19 years, were examined. The effect of age transition to 18 years on monthly visit probability was tested in the subsample with observed transitions (n = 204). Putative sociodemographic moderators and the influence of clinical course were assessed. Results Visit probabilities for the most common modalities—psychopharmacology, individual psychotherapy, and home-based care— generally fell from childhood to young adulthood. For example, the annual probability of at least one psychopharmacology visit was 97% at age 8, 75% at age 17, 60% at age 19, and 46% by age 22. Treatment probabilities fell in transition-age youth from age 17 through 19, but a specific transition effect at age 18 was not found. Declines did not vary based on sociodemographic characteristics and were not explained by changing severity of the bipolar illness or functioning. Conclusions Mental health treatment declined with age in this sample of youth with bipolar disorder, but reductions were not concentrated during or after the transition to age 18 years. Declines were unrelated to symptom severity or impairment. PMID:24241500

  10. Constrained low-rank matrix estimation: phase transitions, approximate message passing and applications

    NASA Astrophysics Data System (ADS)

    Lesieur, Thibault; Krzakala, Florent; Zdeborová, Lenka

    2017-07-01

    This article is an extended version of previous work of Lesieur et al (2015 IEEE Int. Symp. on Information Theory Proc. pp 1635-9 and 2015 53rd Annual Allerton Conf. on Communication, Control and Computing (IEEE) pp 680-7) on low-rank matrix estimation in the presence of constraints on the factors into which the matrix is factorized. Low-rank matrix factorization is one of the basic methods used in data analysis for unsupervised learning of relevant features and other types of dimensionality reduction. We present a framework to study the constrained low-rank matrix estimation for a general prior on the factors, and a general output channel through which the matrix is observed. We draw a parallel with the study of vector-spin glass models—presenting a unifying way to study a number of problems considered previously in separate statistical physics works. We present a number of applications for the problem in data analysis. We derive in detail a general form of the low-rank approximate message passing (Low-RAMP) algorithm, that is known in statistical physics as the TAP equations. We thus unify the derivation of the TAP equations for models as different as the Sherrington-Kirkpatrick model, the restricted Boltzmann machine, the Hopfield model or vector (xy, Heisenberg and other) spin glasses. The state evolution of the Low-RAMP algorithm is also derived, and is equivalent to the replica symmetric solution for the large class of vector-spin glass models. In the section devoted to result we study in detail phase diagrams and phase transitions for the Bayes-optimal inference in low-rank matrix estimation. We present a typology of phase transitions and their relation to performance of algorithms such as the Low-RAMP or commonly used spectral methods.

  11. The FERRUM Project: Experimental Transition Probabilities of [Fe II] and Astrophysical Applications

    NASA Technical Reports Server (NTRS)

    Hartman, H.; Derkatch, A.; Donnelly, M. P.; Gull, T.; Hibbert, A.; Johannsson, S.; Lundberg, H.; Mannervik, S.; Norlin, L. -O.; Rostohar, D.

    2002-01-01

    We report on experimental transition probabilities for thirteen forbidden [Fe II] lines originating from three different metastable Fe II levels. Radiative lifetimes have been measured of two metastable states by applying a laser probing technique on a stored ion beam. Branching ratios for the radiative decay channels, i.e. M1 and E2 transitions, are derived from observed intensity ratios of forbidden lines in astrophysical spectra and compared with theoretical data. The lifetimes and branching ratios are combined to derive absolute transition probabilities, A-values. We present the first experimental lifetime values for the two Fe II levels a(sup 4)G(sub 9/2) and b(sup 2)H(sub 11/2) and A-values for 13 forbidden transitions from a(sup 6)S(sub 5/2), a(sup 4)G(sub 9/2) and b(sup 4)D(sub 7/2) in the optical region. A discrepancy between the measured and calculated values of the lifetime for the b(sup 2)H(sub 11/2) level is discussed in terms of level mixing. We have used the code CIV3 to calculate transition probabilities of the a(sup 6)D-a(sup 6)S transitions. We have also studied observational branching ratios for lines from 5 other metastable Fe II levels and compared them to calculated values. A consistency in the deviation between calibrated observational intensity ratios and theoretical branching ratios for lines in a wider wavelength region supports the use of [Fe II] lines for determination of reddening.

  12. scEpath: Energy landscape-based inference of transition probabilities and cellular trajectories from single-cell transcriptomic data.

    PubMed

    Jin, Suoqin; MacLean, Adam L; Peng, Tao; Nie, Qing

    2018-02-05

    Single-cell RNA-sequencing (scRNA-seq) offers unprecedented resolution for studying cellular decision-making processes. Robust inference of cell state transition paths and probabilities is an important yet challenging step in the analysis of these data. Here we present scEpath, an algorithm that calculates energy landscapes and probabilistic directed graphs in order to reconstruct developmental trajectories. We quantify the energy landscape using "single-cell energy" and distance-based measures, and find that the combination of these enables robust inference of the transition probabilities and lineage relationships between cell states. We also identify marker genes and gene expression patterns associated with cell state transitions. Our approach produces pseudotemporal orderings that are - in combination - more robust and accurate than current methods, and offers higher resolution dynamics of the cell state transitions, leading to new insight into key transition events during differentiation and development. Moreover, scEpath is robust to variation in the size of the input gene set, and is broadly unsupervised, requiring few parameters to be set by the user. Applications of scEpath led to the identification of a cell-cell communication network implicated in early human embryo development, and novel transcription factors important for myoblast differentiation. scEpath allows us to identify common and specific temporal dynamics and transcriptional factor programs along branched lineages, as well as the transition probabilities that control cell fates. A MATLAB package of scEpath is available at https://github.com/sqjin/scEpath. qnie@uci.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press.

  13. The transition probability and the probability for the left-most particle's position of the q-totally asymmetric zero range process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Korhonen, Marko; Lee, Eunghyun

    2014-01-15

    We treat the N-particle zero range process whose jumping rates satisfy a certain condition. This condition is required to use the Bethe ansatz and the resulting model is the q-boson model by Sasamoto and Wadati [“Exact results for one-dimensional totally asymmetric diffusion models,” J. Phys. A 31, 6057–6071 (1998)] or the q-totally asymmetric zero range process (TAZRP) by Borodin and Corwin [“Macdonald processes,” Probab. Theory Relat. Fields (to be published)]. We find the explicit formula of the transition probability of the q-TAZRP via the Bethe ansatz. By using the transition probability we find the probability distribution of the left-most particle'smore » position at time t. To find the probability for the left-most particle's position we find a new identity corresponding to identity for the asymmetric simple exclusion process by Tracy and Widom [“Integral formulas for the asymmetric simple exclusion process,” Commun. Math. Phys. 279, 815–844 (2008)]. For the initial state that all particles occupy a single site, the probability distribution of the left-most particle's position at time t is represented by the contour integral of a determinant.« less

  14. Effect of Interfacial Bonding on Interphase Properties in SiO2/Epoxy Nanocomposite: A Molecular Dynamics Simulation Study.

    PubMed

    Wang, Zhikun; Lv, Qiang; Chen, Shenghui; Li, Chunling; Sun, Shuangqing; Hu, Songqing

    2016-03-23

    Atomistic molecular dynamics simulations have been performed to explore the effect of interfacial bonding on the interphase properties of a nanocomposite system that consists of a silica nanoparticle and the highly cross-linked epoxy matrix. For the structural properties, results show that interfacial covalent bonding can broaden the interphase region by increasing the radial effect range of fluctuated mass density and oriented chains, as well as strengthen the interphase region by improving the thermal stability of interfacial van der Waals excluded volume and reducing the proportion of cis conformers of epoxy segments. The improved thermal stability of the interphase region in the covalently bonded model results in an increase of ∼21 K in the glass transition temperature (Tg) compared to that of the pure epoxy. It is also found that interfacial covalent bonding mainly restricts the volume thermal expansion of the model at temperatures near or larger than Tg. Furthermore, investigations from mean-square displacement and fraction of immobile atoms point out that interfacial covalent and noncovalent bonding induces lower and higher mobility of interphase atoms than that of the pure epoxy, respectively. The obtained critical interfacial bonding ratio when the interphase and matrix atoms have the same mobility is 5.8%. These results demonstrate that the glass transitions of the interphase and matrix will be asynchronous when the interfacial bonding ratio is not 5.8%. Specifically, the interphase region will trigger the glass transition of the matrix when the ratio is larger than 5.8%, whereas it restrains the glass transition of the matrix when the ratio is smaller than 5.8%.

  15. Multiple transitions in sick leave, disability benefits, and return to work. - A 4-year follow-up of patients participating in a work-related rehabilitation program.

    PubMed

    Oyeflaten, Irene; Lie, Stein Atle; Ihlebæk, Camilla M; Eriksen, Hege R

    2012-09-06

    Return to work (RTW) after long-term sick leave can be a long-lasting process where the individual may shift between work and receiving different social security benefits, as well as between part-time and full-time work. This is a challenge in the assessment of RTW outcomes after rehabilitation interventions. The aim of this study was to analyse the probability for RTW, and the probabilities of transitions between different benefits during a 4-year follow-up, after participating in a work-related rehabilitation program. The sample consisted of 584 patients (66% females), mean age 44 years (sd = 9.3). Mean duration on various types of sick leave benefits at entry to the rehabilitation program was 9.3 months (sd = 3.4)]. The patients had mental (47%), musculoskeletal (46%), or other diagnoses (7%). Official national register data over a 4-year follow-up period was analysed. Extended statistical tools for multistate models were used to calculate transition probabilities between the following eight states; working, partial sick leave, full-time sick leave, medical rehabilitation, vocational rehabilitation, and disability pension; (partial, permanent and time-limited). During the follow-up there was an increased probability for working, a decreased probability for being on sick leave, and an increased probability for being on disability pension. The probability of RTW was not related to the work and benefit status at departure from the rehabilitation clinic. The patients had an average of 3.7 (range 0-18) transitions between work and the different benefits. The process of RTW or of receiving disability pension was complex, and may take several years, with multiple transitions between work and different benefits. Access to reliable register data and the use of a multistate RTW model, makes it possible to describe the developmental nature and the different levels of the recovery and disability process.

  16. Multiple transitions in sick leave, disability benefits, and return to work. - A 4-year follow-up of patients participating in a work-related rehabilitation program

    PubMed Central

    2012-01-01

    Background Return to work (RTW) after long-term sick leave can be a long-lasting process where the individual may shift between work and receiving different social security benefits, as well as between part-time and full-time work. This is a challenge in the assessment of RTW outcomes after rehabilitation interventions. The aim of this study was to analyse the probability for RTW, and the probabilities of transitions between different benefits during a 4-year follow-up, after participating in a work-related rehabilitation program. Methods The sample consisted of 584 patients (66% females), mean age 44 years (sd = 9.3). Mean duration on various types of sick leave benefits at entry to the rehabilitation program was 9.3 months (sd = 3.4)]. The patients had mental (47%), musculoskeletal (46%), or other diagnoses (7%). Official national register data over a 4-year follow-up period was analysed. Extended statistical tools for multistate models were used to calculate transition probabilities between the following eight states; working, partial sick leave, full-time sick leave, medical rehabilitation, vocational rehabilitation, and disability pension; (partial, permanent and time-limited). Results During the follow-up there was an increased probability for working, a decreased probability for being on sick leave, and an increased probability for being on disability pension. The probability of RTW was not related to the work and benefit status at departure from the rehabilitation clinic. The patients had an average of 3.7 (range 0–18) transitions between work and the different benefits. Conclusions The process of RTW or of receiving disability pension was complex, and may take several years, with multiple transitions between work and different benefits. Access to reliable register data and the use of a multistate RTW model, makes it possible to describe the developmental nature and the different levels of the recovery and disability process. PMID:22954254

  17. Scalar pair production in a magnetic field in de Sitter universe

    NASA Astrophysics Data System (ADS)

    Băloi, Mihaela-Andreea; Crucean, Cosmin; Popescu, Diana

    2018-05-01

    The production of scalar particles by the dipole magnetic field in de Sitter expanding universe is analyzed. The amplitude and probability of transition are computed using perturbative methods. A graphical study of the transition probability is performed obtaining that the rate of pair production is important in the early universe. Our results prove that in the process of pair production by the external magnetic field the momentum conservation law is broken. We also found that the probabilities are maximum when the particles are emitted perpendicular to the direction of magnetic dipole momentum. The total probability is computed and is analysed in terms of the angle between particles momenta.

  18. Relativistic, model-independent, multichannel 2 → 2 transition amplitudes in a finite volume

    DOE PAGES

    Briceno, Raul A.; Hansen, Maxwell T.

    2016-07-13

    We derive formalism for determining 2 + J → 2 infinite-volume transition amplitudes from finite-volume matrix elements. Specifically, we present a relativistic, model-independent relation between finite-volume matrix elements of external currents and the physically observable infinite-volume matrix elements involving two-particle asymptotic states. The result presented holds for states composed of two scalar bosons. These can be identical or non-identical and, in the latter case, can be either degenerate or non-degenerate. We further accommodate any number of strongly-coupled two-scalar channels. This formalism will, for example, allow future lattice QCD calculations of themore » $$\\rho$$-meson form factor, in which the unstable nature of the $$\\rho$$ is rigorously accommodated. In conclusion, we also discuss how this work will impact future extractions of nuclear parity and hadronic long-range matrix elements from lattice QCD.« less

  19. A Computational Model of Word Segmentation from Continuous Speech Using Transitional Probabilities of Atomic Acoustic Events

    ERIC Educational Resources Information Center

    Rasanen, Okko

    2011-01-01

    Word segmentation from continuous speech is a difficult task that is faced by human infants when they start to learn their native language. Several studies indicate that infants might use several different cues to solve this problem, including intonation, linguistic stress, and transitional probabilities between subsequent speech sounds. In this…

  20. Implicit Segmentation of a Stream of Syllables Based on Transitional Probabilities: An MEG Study

    ERIC Educational Resources Information Center

    Teinonen, Tuomas; Huotilainen, Minna

    2012-01-01

    Statistical segmentation of continuous speech, i.e., the ability to utilise transitional probabilities between syllables in order to detect word boundaries, is reflected in the brain's auditory event-related potentials (ERPs). The N1 and N400 ERP components are typically enhanced for word onsets compared to random syllables during active…

  1. On Graph Isomorphism and the PageRank Algorithm

    DTIC Science & Technology

    2008-09-01

    specifies the probability of visiting each node from any other node. The perturbed matrix satisfies the Perron - Frobenius theorem’s conditions. Therefore... Frobenius and Perron theorems establishes the matrix must yield the dominant eigenvalue, one. Normalizing the unique and associated dominant eigenvector...is constructed such that none of its entries equal zero. An arbitrary PageRank matrix, S, is irreducible and satisfies the Perron - Frobenius

  2. A transition matrix approach to the Davenport gryo calibration scheme

    NASA Technical Reports Server (NTRS)

    Natanson, G. A.

    1998-01-01

    The in-flight gyro calibration scheme commonly used by NASA Goddard Space Flight Center (GSFC) attitude ground support teams closely follows an original version of the Davenport algorithm developed in the late seventies. Its basic idea is to minimize the least-squares differences between attitudes gyro- propagated over the course of a maneuver and those determined using post- maneuver sensor measurements. The paper represents the scheme in a recursive form by combining necessary partials into a rectangular matrix, which is propagated in exactly the same way as a Kalman filters square transition matrix. The nontrivial structure of the propagation matrix arises from the fact that attitude errors are not included in the state vector, and therefore their derivatives with respect to estimated a parameters do not appear in the transition matrix gyro defined in the conventional way. In cases when the required accuracy can be achieved by a single iteration, representation of the Davenport gyro calibration scheme in a recursive form allows one to discard each gyro measurement immediately after it was used to propagate the attitude and state transition matrix. Another advantage of the new approach is that it utilizes the same expression for the error sensitivity matrix as that used by the Kalman filter. As a result the suggested modification of the Davenport algorithm made it possible to reuse software modules implemented in the Kalman filter estimator, where both attitude errors and gyro calibration parameters are included in the state vector. The new approach has been implemented in the ground calibration utilities used to support the Tropical Rainfall Measuring Mission (TRMM). The paper analyzes some preliminary results of gyro calibration performed by the TRMM ground attitude support team. It is demonstrated that an effect of the second iteration on estimated values of calibration parameters is negligibly small, and therefore there is no need to store processed gyro data. This opens a promising opportunity for onboard implementation of the suggested recursive procedure by combining, it with the Kalman filter used to obtain necessary attitude solutions at the beginning and end of each maneuver.

  3. On the use of transition matrix methods with extended ensembles.

    PubMed

    Escobedo, Fernando A; Abreu, Charlles R A

    2006-03-14

    Different extended ensemble schemes for non-Boltzmann sampling (NBS) of a selected reaction coordinate lambda were formulated so that they employ (i) "variable" sampling window schemes (that include the "successive umbrella sampling" method) to comprehensibly explore the lambda domain and (ii) transition matrix methods to iteratively obtain the underlying free-energy eta landscape (or "importance" weights) associated with lambda. The connection between "acceptance ratio" and transition matrix methods was first established to form the basis of the approach for estimating eta(lambda). The validity and performance of the different NBS schemes were then assessed using as lambda coordinate the configurational energy of the Lennard-Jones fluid. For the cases studied, it was found that the convergence rate in the estimation of eta is little affected by the use of data from high-order transitions, while it is noticeably improved by the use of a broader window of sampling in the variable window methods. Finally, it is shown how an "elastic" window of sampling can be used to effectively enact (nonuniform) preferential sampling over the lambda domain, and how to stitch the weights from separate one-dimensional NBS runs to produce a eta surface over a two-dimensional domain.

  4. Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

    PubMed

    Gulubova, M V

    1996-07-01

    Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

  5. Statistical significance test for transition matrices of atmospheric Markov chains

    NASA Technical Reports Server (NTRS)

    Vautard, Robert; Mo, Kingtse C.; Ghil, Michael

    1990-01-01

    Low-frequency variability of large-scale atmospheric dynamics can be represented schematically by a Markov chain of multiple flow regimes. This Markov chain contains useful information for the long-range forecaster, provided that the statistical significance of the associated transition matrix can be reliably tested. Monte Carlo simulation yields a very reliable significance test for the elements of this matrix. The results of this test agree with previously used empirical formulae when each cluster of maps identified as a distinct flow regime is sufficiently large and when they all contain a comparable number of maps. Monte Carlo simulation provides a more reliable way to test the statistical significance of transitions to and from small clusters. It can determine the most likely transitions, as well as the most unlikely ones, with a prescribed level of statistical significance.

  6. Intersubband Transitions in InAs/AlSb Quantum Wells

    NASA Technical Reports Server (NTRS)

    Li, J.; Koloklov, K.; Ning, C. Z.; Larraber, D. C.; Khodaparast, G. A.; Kono, J.; Ueda, K.; Nakajima, Y.; Sasa, S.; Inoue, M.

    2003-01-01

    We have studied intersubband transitions in InAs/AlSb quantum wells experimentally and theoretically. Experimentally, we performed polarization-resolved infrared absorption spectroscopy to measure intersubband absorption peak frequencies and linewidths as functions of temperature (from 4 K to room temperature) and quantum well width (from a few nm to 10 nm). To understand experimental results, we performed a self-consistent 8-band k-p band-structure calculation including spatial charge separation. Based on the calculated band structure, we developed a set of density matrix equations to compute TE and TM optical transitions self-consistently, including both interband and intersubband channels. This density matrix formalism is also ideal for the inclusion of various many-body effects, which are known to be important for intersubband transitions. Detailed comparison between experimental data and theoretical simulations is presented.

  7. First-order transitions and thermodynamic properties in the 2D Blume-Capel model: the transfer-matrix method revisited

    NASA Astrophysics Data System (ADS)

    Jung, Moonjung; Kim, Dong-Hee

    2017-12-01

    We investigate the first-order transition in the spin-1 two-dimensional Blume-Capel model in square lattices by revisiting the transfer-matrix method. With large strip widths increased up to the size of 18 sites, we construct the detailed phase coexistence curve which shows excellent quantitative agreement with the recent advanced Monte Carlo results. In the deep first-order area, we observe the exponential system-size scaling of the spectral gap of the transfer matrix from which linearly increasing interfacial tension is deduced with decreasing temperature. We find that the first-order signature at low temperatures is strongly pronounced with much suppressed finite-size influence in the examined thermodynamic properties of entropy, non-zero spin population, and specific heat. It turns out that the jump at the transition becomes increasingly sharp as it goes deep into the first-order area, which is in contrast to the Wang-Landau results where finite-size smoothing gets more severe at lower temperatures.

  8. Quantum Markov chains

    NASA Astrophysics Data System (ADS)

    Gudder, Stanley

    2008-07-01

    A new approach to quantum Markov chains is presented. We first define a transition operation matrix (TOM) as a matrix whose entries are completely positive maps whose column sums form a quantum operation. A quantum Markov chain is defined to be a pair (G,E) where G is a directed graph and E =[Eij] is a TOM whose entry Eij labels the edge from vertex j to vertex i. We think of the vertices of G as sites that a quantum system can occupy and Eij is the transition operation from site j to site i in one time step. The discrete dynamics of the system is obtained by iterating the TOM E. We next consider a special type of TOM called a transition effect matrix. In this case, there are two types of dynamics, a state dynamics and an operator dynamics. Although these two types are not identical, they are statistically equivalent. We next give examples that illustrate various properties of quantum Markov chains. We conclude by showing that our formalism generalizes the usual framework for quantum random walks.

  9. Radiative transition of hydrogen-like ions in quantum plasma

    NASA Astrophysics Data System (ADS)

    Hu, Hongwei; Chen, Zhanbin; Chen, Wencong

    2016-12-01

    At fusion plasma electron temperature and number density regimes of 1 × 103-1 × 107 K and 1 × 1028-1 × 1031/m3, respectively, the excited states and radiative transition of hydrogen-like ions in fusion plasmas are studied. The results show that quantum plasma model is more suitable to describe the fusion plasma than the Debye screening model. Relativistic correction to bound-state energies of the low-Z hydrogen-like ions is so small that it can be ignored. The transition probability decreases with plasma density, but the transition probabilities have the same order of magnitude in the same number density regime.

  10. On Connected Diagrams and Cumulants of Erdős-Rényi Matrix Models

    NASA Astrophysics Data System (ADS)

    Khorunzhiy, O.

    2008-08-01

    Regarding the adjacency matrices of n-vertex graphs and related graph Laplacian we introduce two families of discrete matrix models constructed both with the help of the Erdős-Rényi ensemble of random graphs. Corresponding matrix sums represent the characteristic functions of the average number of walks and closed walks over the random graph. These sums can be considered as discrete analogues of the matrix integrals of random matrix theory. We study the diagram structure of the cumulant expansions of logarithms of these matrix sums and analyze the limiting expressions as n → ∞ in the cases of constant and vanishing edge probabilities.

  11. Langevin Dynamics, Large Deviations and Instantons for the Quasi-Geostrophic Model and Two-Dimensional Euler Equations

    NASA Astrophysics Data System (ADS)

    Bouchet, Freddy; Laurie, Jason; Zaboronski, Oleg

    2014-09-01

    We investigate a class of simple models for Langevin dynamics of turbulent flows, including the one-layer quasi-geostrophic equation and the two-dimensional Euler equations. Starting from a path integral representation of the transition probability, we compute the most probable fluctuation paths from one attractor to any state within its basin of attraction. We prove that such fluctuation paths are the time reversed trajectories of the relaxation paths for a corresponding dual dynamics, which are also within the framework of quasi-geostrophic Langevin dynamics. Cases with or without detailed balance are studied. We discuss a specific example for which the stationary measure displays either a second order (continuous) or a first order (discontinuous) phase transition and a tricritical point. In situations where a first order phase transition is observed, the dynamics are bistable. Then, the transition paths between two coexisting attractors are instantons (fluctuation paths from an attractor to a saddle), which are related to the relaxation paths of the corresponding dual dynamics. For this example, we show how one can analytically determine the instantons and compute the transition probabilities for rare transitions between two attractors.

  12. Composite material reinforced with atomized quasicrystalline particles and method of making same

    DOEpatents

    Biner, S.B.; Sordelet, D.J.; Lograsso, B.K.; Anderson, I.E.

    1998-12-22

    A composite material comprises an aluminum or aluminum alloy matrix having generally spherical, atomized quasicrystalline aluminum-transition metal alloy reinforcement particles disposed in the matrix to improve mechanical properties. A composite article can be made by consolidating generally spherical, atomized quasicrystalline aluminum-transition metal alloy particles and aluminum or aluminum alloy particles to form a body that is cold and/or hot reduced to form composite products, such as composite plate or sheet, with interfacial bonding between the quasicrystalline particles and the aluminum or aluminum alloy matrix without damage (e.g. cracking or shape change) of the reinforcement particles. The cold and/or hot worked composite exhibits substantially improved yield strength, tensile strength, Young`s modulus (stiffness). 3 figs.

  13. The Effect of the Spin-Forbidden Co((sup 1) Sigma plus) plus O((sup 3) P) Yields CO2 (1 Sigma (sub G) plus) Recombination Reaction on Afterbody Heating of Mars Entry Vehicles

    NASA Technical Reports Server (NTRS)

    Xu, Lu T.; Jaffe, Richard L.; Schwenke, David W.; Panesi, Marco

    2017-01-01

    Vibrationally excited CO2, formed by two-body recombination from CO((sup 1) sigma plus) and O((sup 3) P) in the wake behind spacecraft entering the Martian atmosphere reaction, is potentially responsible for the higher than anticipated radiative heating of the backshell, compared to pre-flight predictions. This process involves a spin-forbidden transition of the transient triplet CO2 molecule to the longer-lived singlet. To accurately predict the singlet-triplet transition probability and estimate the thermal rate coefficient of the recombination reaction, ab initio methods were used to compute the first singlet and three lowest triplet CO2 potential energy surfaces and the spin-orbit coupling matrix elements between these states. Analytical fits to these four potential energy surfaces were generated for surface hopping trajectory calculations, using Tully's fewest switches surface hopping algorithm. Preliminary results for the trajectory calculations are presented. The calculated probability of a CO((sup 1) sigma plus) and O((sup 3) P) collision leading to singlet CO2 formation is on the order of 10 (sup -4). The predicted flowfield conditions for various Mars entry scenarios predict temperatures in the range of 1000 degrees Kelvin - 4000 degrees Kelvin and pressures in the range of 300-2500 pascals at the shoulder and in the wake, which is consistent with a heavy-particle collision frequency of 10 (sup 6) to 10 (sup 7) per second. Owing to this low collision frequency, it is likely that CO((sup 1) sigma plus) molecules formed by this mechanism will mostly be frozen in a highly nonequilibrium rovibrational energy state until they relax by photoemission.

  14. Estimation for general birth-death processes

    PubMed Central

    Crawford, Forrest W.; Minin, Vladimir N.; Suchard, Marc A.

    2013-01-01

    Birth-death processes (BDPs) are continuous-time Markov chains that track the number of “particles” in a system over time. While widely used in population biology, genetics and ecology, statistical inference of the instantaneous particle birth and death rates remains largely limited to restrictive linear BDPs in which per-particle birth and death rates are constant. Researchers often observe the number of particles at discrete times, necessitating data augmentation procedures such as expectation-maximization (EM) to find maximum likelihood estimates. For BDPs on finite state-spaces, there are powerful matrix methods for computing the conditional expectations needed for the E-step of the EM algorithm. For BDPs on infinite state-spaces, closed-form solutions for the E-step are available for some linear models, but most previous work has resorted to time-consuming simulation. Remarkably, we show that the E-step conditional expectations can be expressed as convolutions of computable transition probabilities for any general BDP with arbitrary rates. This important observation, along with a convenient continued fraction representation of the Laplace transforms of the transition probabilities, allows for novel and efficient computation of the conditional expectations for all BDPs, eliminating the need for truncation of the state-space or costly simulation. We use this insight to derive EM algorithms that yield maximum likelihood estimation for general BDPs characterized by various rate models, including generalized linear models. We show that our Laplace convolution technique outperforms competing methods when they are available and demonstrate a technique to accelerate EM algorithm convergence. We validate our approach using synthetic data and then apply our methods to cancer cell growth and estimation of mutation parameters in microsatellite evolution. PMID:25328261

  15. Estimation for general birth-death processes.

    PubMed

    Crawford, Forrest W; Minin, Vladimir N; Suchard, Marc A

    2014-04-01

    Birth-death processes (BDPs) are continuous-time Markov chains that track the number of "particles" in a system over time. While widely used in population biology, genetics and ecology, statistical inference of the instantaneous particle birth and death rates remains largely limited to restrictive linear BDPs in which per-particle birth and death rates are constant. Researchers often observe the number of particles at discrete times, necessitating data augmentation procedures such as expectation-maximization (EM) to find maximum likelihood estimates. For BDPs on finite state-spaces, there are powerful matrix methods for computing the conditional expectations needed for the E-step of the EM algorithm. For BDPs on infinite state-spaces, closed-form solutions for the E-step are available for some linear models, but most previous work has resorted to time-consuming simulation. Remarkably, we show that the E-step conditional expectations can be expressed as convolutions of computable transition probabilities for any general BDP with arbitrary rates. This important observation, along with a convenient continued fraction representation of the Laplace transforms of the transition probabilities, allows for novel and efficient computation of the conditional expectations for all BDPs, eliminating the need for truncation of the state-space or costly simulation. We use this insight to derive EM algorithms that yield maximum likelihood estimation for general BDPs characterized by various rate models, including generalized linear models. We show that our Laplace convolution technique outperforms competing methods when they are available and demonstrate a technique to accelerate EM algorithm convergence. We validate our approach using synthetic data and then apply our methods to cancer cell growth and estimation of mutation parameters in microsatellite evolution.

  16. Pulmonary lung surfactant synthetic peptide concentration-dependent modulation of DPPC and POPG acyl chain order in a DPPC:POPG:palmitic acid lipid mixture.

    PubMed

    Krill, S L; Gupta, S L; Smith, T

    1994-05-06

    Lung surfactant-associated protein interaction with lipid matrices and the effects on lipid thermotropic phase behavior are areas of active research. Many studies limit the lipids to a single or two-component system. The current investigation utilizes a three-lipid component matrix (DPPC:POPG:palmitic acid) to investigate the impact of a synthetic surfactant protein B fragment (SP-B 53-78 DiACM) on the dynamic surface activity of the lipid admixture as measured by a Wilhelmy surface balance. Also, the modulation of the individual lipid acyl chain order by the peptide within the lipid matrix is studied through the use of thermal perturbation FTIR spectroscopy. The data clearly demonstrate a concentration-dependent effect of the peptide on the surface activity with an improvement in the dynamic surface tension diagram characteristics (decreased surface tension and increased collapse plateau) especially at low, 0.36 M%, peptide concentrations. These effects are diminished upon further addition of the peptide. FTIR spectral data demonstrate that the peptide addition results in a significant increase in the acyl chain order of the DPPC and POPG components as measured by the position of the methylene stretching vibrational bands. DPPC is most sensitive to the peptide presence, while the palmitic acid is least affected. The transition temperatures of the individual lipids are also increased with the addition of the peptide. The presence of POPG in the matrix achieves the surface activity similarly seen with natural lung surfactant relative to a DPPC/palmitic acid lipid matrix alone. Its presence increases the sensitivity of the DPPC acyl chains to the presence of the peptide. These effects on the chain order are most probably related to the increased acyl chain fluidity which POPG imparts to the lipid matrix because of the presence of the cis double bond. The phosphatidylglycerol headgroup also adds a negative charge to the lipid matrix which enhances the peptide-lipid interaction. Although the palmitic acid is minimally affected by the peptide, its presence, as suggested by surface balance measurements, results in the establishment of a stable lipid film with DPPC, capable of achieving low surface tension values.

  17. Comparative Controller Design for a Marine Gas Turbine Propulsion Plant

    DTIC Science & Technology

    1988-09-01

    ADDRESS (City State, and ZIP Code) ,onterey, California 93943-5000 Monterey, California 93943-5000 Sa. NAME OF FUNDING/SPONSORING 8b OFFICE SYMBOL 9 ...155 7. A21 MATRIX COEFFICIENT CORRELATION DATA ----------- 156 8. A22 MATRIX COEFFICIENT CORRELATION DATA ----------- 157 9 . A23 MATRIX...Flowchart of VRD Algorithm ----------------------- 29 8. Steady State Convergence Map --------------------- 34 9 . Smoothed Dynamic Transition Map

  18. Computer models of social processes: the case of migration.

    PubMed

    Beshers, J M

    1967-06-01

    The demographic model is a program for representing births, deaths, migration, and social mobility as social processes in a non-stationary stochastic process (Markovian). Transition probabilities for each age group are stored and then retrieved at the next appearance of that age cohort. In this way new transition probabilities can be calculated as a function of the old transition probabilities and of two successive distribution vectors.Transition probabilities can be calculated to represent effects of the whole age-by-state distribution at any given time period, too. Such effects as saturation or queuing may be represented by a market mechanism; for example, migration between metropolitan areas can be represented as depending upon job supplies and labor markets. Within metropolitan areas, migration can be represented as invasion and succession processes with tipping points (acceleration curves), and the market device has been extended to represent this phenomenon.Thus, the demographic model makes possible the representation of alternative classes of models of demographic processes. With each class of model one can deduce implied time series (varying parame-terswithin the class) and the output of the several classes can be compared to each other and to outside criteria, such as empirical time series.

  19. A pedagogical derivation of the matrix element method in particle physics data analysis

    NASA Astrophysics Data System (ADS)

    Sumowidagdo, Suharyo

    2018-03-01

    The matrix element method provides a direct connection between the underlying theory of particle physics processes and detector-level physical observables. I am presenting a pedagogically-oriented derivation of the matrix element method, drawing from elementary concepts in probability theory, statistics, and the process of experimental measurements. The level of treatment should be suitable for beginning research student in phenomenology and experimental high energy physics.

  20. Critically Evaluated Energy Levels, Spectral Lines, Transition Probabilities, and Intensities of Neutral Vanadium (V i)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saloman, Edward B.; Kramida, Alexander

    2017-08-01

    The energy levels, observed spectral lines, and transition probabilities of the neutral vanadium atom, V i, have been compiled. Also included are values for some forbidden lines that may be of interest to the astrophysical community. Experimental Landé g -factors and leading percentage compositions for the levels are included where available, as well as wavelengths calculated from the energy levels (Ritz wavelengths). Wavelengths are reported for 3985 transitions, and 549 energy levels are determined. The observed relative intensities normalized to a common scale are provided.

  1. The Spitzer search for the transits of HARPS low-mass planets. II. Null results for 19 planets

    NASA Astrophysics Data System (ADS)

    Gillon, M.; Demory, B.-O.; Lovis, C.; Deming, D.; Ehrenreich, D.; Lo Curto, G.; Mayor, M.; Pepe, F.; Queloz, D.; Seager, S.; Ségransan, D.; Udry, S.

    2017-05-01

    Short-period super-Earths and Neptunes are now known to be very frequent around solar-type stars. Improving our understanding of these mysterious planets requires the detection of a significant sample of objects suitable for detailed characterization. Searching for the transits of the low-mass planets detected by Doppler surveys is a straightforward way to achieve this goal. Indeed, Doppler surveys target the most nearby main-sequence stars, they regularly detect close-in low-mass planets with significant transit probability, and their radial velocity data constrain strongly the ephemeris of possible transits. In this context, we initiated in 2010 an ambitious Spitzer multi-Cycle transit search project that targeted 25 low-mass planets detected by radial velocity, focusing mainly on the shortest-period planets detected by the HARPS spectrograph. We report here null results for 19 targets of the project. For 16 planets out of 19, a transiting configuration is strongly disfavored or firmly rejected by our data for most planetary compositions. We derive a posterior probability of 83% that none of the probed 19 planets transits (for a prior probability of 22%), which still leaves a significant probability of 17% that at least one of them does transit. Globally, our Spitzer project revealed or confirmed transits for three of its 25 targeted planets, and discarded or disfavored the transiting nature of 20 of them. Our light curves demonstrate for Warm Spitzer excellent photometric precisions: for 14 targets out of 19, we were able to reach standard deviations that were better than 50 ppm per 30 min intervals. Combined with its Earth-trailing orbit, which makes it capable of pointing any star in the sky and to monitor it continuously for days, this work confirms Spitzer as an optimal instrument to detect sub-mmag-deep transits on the bright nearby stars targeted by Doppler surveys. The photometric and radial velocity time series used in this work are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/601/A117

  2. Analysis of morphological characteristics and expression levels of extracellular matrix proteins in skin wounds to determine wound age in living subjects in forensic medicine.

    PubMed

    Fronczek, Judith; Lulf, Ronald; Korkmaz, H Ibrahim; Witte, Birgit I; van de Goot, Franklin R W; Begieneman, Mark P V; Krijnen, Paul A J; Rozendaal, Lawrence; Niessen, Hans W M; Reijnders, Udo J L

    2015-01-01

    Wound age determination in living subjects is important in routine diagnostics in forensic medicine. Macroscopical description of a wound to determine wound age however is inadequate. The aim of this study was to assess whether it would be feasible to determine wound age via analysis of morphological characteristics and extracellular matrix proteins in skin biopsies of living subjects referred to a forensic outpatient clinic. Skin biopsies (n=101), representing the border area of the wound, were taken from skin injuries of known wound age (range: 4.5h-25 days) in living subjects. All biopsies were analyzed for 3 morphological features (ulceration, parakeratosis and hemorrhage) and 3 extracellular matrix markers (collagen III, collagen IV and α-SMA). For quantification, biopsies were subdivided in 4 different timeframes: 0.2-2 days, 2-4 days, 4-10 days and 10-25 days old wounds. Subsequently, a probability scoring system was developed. For hemorrhage, collagen III, collagen IV and α-SMA expression no relation with wound age was found. Ulceration was only found in wounds of 0.2-2, 2-4 and 4-10 days old, implying that the probability that a wound was more than 10 days old in case of ulceration is equal to 0%. Also parakeratosis was almost exclusively found in wounds of 0.2-2, 2-4 and 4-10 days old, except for one case with a wound age of 15 days old. The probability scoring system of all analyzed markers, as depicted above, however can be used to calculate individual wound age probabilities in biopsies of skin wounds of living subjects. We have developed a probability scoring system, analysing morphological characteristics and extracellular matrix proteins in superficial skin biopsies of wounds in living subjects that can be applied in forensic medicine for wound age determination. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. Improved log(gf ) Values of Selected Lines in Mn I and Mn II for Abundance Determinations in FGK Dwarfs and Giants

    NASA Astrophysics Data System (ADS)

    Den Hartog, E. A.; Lawler, J. E.; Sobeck, J. S.; Sneden, C.; Cowan, J. J.

    2011-06-01

    The goal of the present work is to produce transition probabilities with very low uncertainties for a selected set of multiplets of Mn I and Mn II. Multiplets are chosen based upon their suitability for stellar abundance analysis. We report on new radiative lifetime measurements for 22 levels of Mn I from the e 8 D, z 6 P, z 6 D, z 4 F, e 8 S, and e 6 S terms and six levels of Mn II from the z 5 P and z 7 P terms using time-resolved laser-induced fluorescence on a slow atom/ion beam. New branching fractions for transitions from these levels, measured using a Fourier-transform spectrometer, are reported. When combined, these measurements yield transition probabilities for 47 transitions of Mn I and 15 transitions of Mn II. Comparisons are made to data from the literature and to Russell-Saunders (LS) theory. In keeping with the goal of producing a set of transition probabilities with the highest possible accuracy and precision, we recommend a weighted mean result incorporating our measurements on Mn I and II as well as independent measurements or calculations that we view as reliable and of a quality similar to ours. In a forthcoming paper, these Mn I/II transition probability data will be utilized to derive the Mn abundance in stars with spectra from both space-based and ground-based facilities over a 4000 Å wavelength range. With the employment of a local thermodynamic equilibrium line transfer code, the Mn I/II ionization balance will be determined for stars of different evolutionary states.

  4. Information matrix estimation procedures for cognitive diagnostic models.

    PubMed

    Liu, Yanlou; Xin, Tao; Andersson, Björn; Tian, Wei

    2018-03-06

    Two new methods to estimate the asymptotic covariance matrix for marginal maximum likelihood estimation of cognitive diagnosis models (CDMs), the inverse of the observed information matrix and the sandwich-type estimator, are introduced. Unlike several previous covariance matrix estimators, the new methods take into account both the item and structural parameters. The relationships between the observed information matrix, the empirical cross-product information matrix, the sandwich-type covariance matrix and the two approaches proposed by de la Torre (2009, J. Educ. Behav. Stat., 34, 115) are discussed. Simulation results show that, for a correctly specified CDM and Q-matrix or with a slightly misspecified probability model, the observed information matrix and the sandwich-type covariance matrix exhibit good performance with respect to providing consistent standard errors of item parameter estimates. However, with substantial model misspecification only the sandwich-type covariance matrix exhibits robust performance. © 2018 The British Psychological Society.

  5. Near-optimal matrix recovery from random linear measurements.

    PubMed

    Romanov, Elad; Gavish, Matan

    2018-06-25

    In matrix recovery from random linear measurements, one is interested in recovering an unknown M-by-N matrix [Formula: see text] from [Formula: see text] measurements [Formula: see text], where each [Formula: see text] is an M-by-N measurement matrix with i.i.d. random entries, [Formula: see text] We present a matrix recovery algorithm, based on approximate message passing, which iteratively applies an optimal singular-value shrinker-a nonconvex nonlinearity tailored specifically for matrix estimation. Our algorithm typically converges exponentially fast, offering a significant speedup over previously suggested matrix recovery algorithms, such as iterative solvers for nuclear norm minimization (NNM). It is well known that there is a recovery tradeoff between the information content of the object [Formula: see text] to be recovered (specifically, its matrix rank r) and the number of linear measurements n from which recovery is to be attempted. The precise tradeoff between r and n, beyond which recovery by a given algorithm becomes possible, traces the so-called phase transition curve of that algorithm in the [Formula: see text] plane. The phase transition curve of our algorithm is noticeably better than that of NNM. Interestingly, it is close to the information-theoretic lower bound for the minimal number of measurements needed for matrix recovery, making it not only state of the art in terms of convergence rate, but also near optimal in terms of the matrices it successfully recovers. Copyright © 2018 the Author(s). Published by PNAS.

  6. Weak interaction probes of light nuclei

    NASA Astrophysics Data System (ADS)

    Towner, I. S.

    1986-03-01

    Experimental evidence for pion enhancement in axial charge transitions as predicted by softpion theorems is reviewed. Corrections from non-soft-pion terms seem to be limited. For transitions involving the space part of the axial-vector current, soft-pion theorems are powerless. Meson-exchange currents then involve a complicated interplay among competing process. Explicit calculations in the hard-pion model for closed-shell-plus (or minus)-one nuclei, A=15 and A= =17, are in reasonable agreement with experiment. Quenching in the off-diagonal spin-flip matrix element is larger than in the diagonal matrix element.

  7. Stress as an order parameter for the glass transition

    NASA Astrophysics Data System (ADS)

    Visscher, P. B.; Logan, W. T.

    1990-09-01

    The stress tensor has been considered as a possible order parameter for the liquid-glass transition, and its autocorrelation matrix (elements of which are the integrands in the Green-Kubo formulas for bulk and shear viscosity) have been measured in simulations. However, only the k=0 spatial Fourier component has apparently been previously measured. We have measured four Fourier components of all matrix elements of the stress-stress correlation function, and we find that some of those with nonzero wave vector are significantly more persistent (slower decaying) than the k=0 component.

  8. Connection between the conformation and emission properties of poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] single molecules during thermal annealing

    NASA Astrophysics Data System (ADS)

    Ou, Jiemei; Yang, Yuzhao; Lin, Wensheng; Yuan, Zhongke; Gan, Lin; Lin, Xiaofeng; Chen, Xudong; Chen, Yujie

    2015-03-01

    We investigated the transitions of conformations and their effects on emission properties of poly[2-methoxy-5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] (MEH-PPV) single molecules in PMMA matrix during thermal annealing process. Total internal reflection fluorescence microscopy measurements reveal the transformation from collapsed conformations to extended, highly ordered rod-like structures of MEH-PPV single molecules during thermal annealing. The blue shifts in the ensemble single molecule PL spectra support our hypnosis. The transition occurs as the annealing temperature exceeds 100 °C, implying that an annealing temperature near the glass transition temperature Tg of matrix is ideal for the control and optimization of blend polymer films.

  9. Dynamic Algorithms for Transition Matrix Generation

    NASA Astrophysics Data System (ADS)

    Yevick, David; Lee, Yong Hwan

    The methods of [D. Yevick, Int. J. Mod. Phys. C, 1650041] for constructing transition matrices are applied to the two dimensional Ising model. Decreasing the system temperature during the acquisition of the matrix elements yields a reasonably precise specific heat curve for a 32x32 spin system for a limited number (50-100M) of realizations. If the system is instead evolved to first higher and then lower energies within a restricted interval that is steadily displaced in energy as the computation proceeds, a modification which permits backward displacements up to a certain lower bound for each forward step ensures acceptable accuracy. Additional constraints on the transition rule are also investigated. The Natural Sciences and Engineering Research Council of Canada (NSERC) and CIENA are acknowledged for financial support.

  10. Bivariate- distribution for transition matrix elements in Breit-Wigner to Gaussian domains of interacting particle systems.

    PubMed

    Kota, V K B; Chavda, N D; Sahu, R

    2006-04-01

    Interacting many-particle systems with a mean-field one-body part plus a chaos generating random two-body interaction having strength lambda exhibit Poisson to Gaussian orthogonal ensemble and Breit-Wigner (BW) to Gaussian transitions in level fluctuations and strength functions with transition points marked by lambda = lambda c and lambda = lambda F, respectively; lambda F > lambda c. For these systems a theory for the matrix elements of one-body transition operators is available, as valid in the Gaussian domain, with lambda > lambda F, in terms of orbital occupation numbers, level densities, and an integral involving a bivariate Gaussian in the initial and final energies. Here we show that, using a bivariate-t distribution, the theory extends below from the Gaussian regime to the BW regime up to lambda = lambda c. This is well tested in numerical calculations for 6 spinless fermions in 12 single-particle states.

  11. Time delay and long-range connection induced synchronization transitions in Newman-Watts small-world neuronal networks.

    PubMed

    Qian, Yu

    2014-01-01

    The synchronization transitions in Newman-Watts small-world neuronal networks (SWNNs) induced by time delay τ and long-range connection (LRC) probability P have been investigated by synchronization parameter and space-time plots. Four distinct parameter regions, that is, asynchronous region, transition region, synchronous region, and oscillatory region have been discovered at certain LRC probability P = 1.0 as time delay is increased. Interestingly, desynchronization is observed in oscillatory region. More importantly, we consider the spatiotemporal patterns obtained in delayed Newman-Watts SWNNs are the competition results between long-range drivings (LRDs) and neighboring interactions. In addition, for moderate time delay, the synchronization of neuronal network can be enhanced remarkably by increasing LRC probability. Furthermore, lag synchronization has been found between weak synchronization and complete synchronization as LRC probability P is a little less than 1.0. Finally, the two necessary conditions, moderate time delay and large numbers of LRCs, are exposed explicitly for synchronization in delayed Newman-Watts SWNNs.

  12. Time Delay and Long-Range Connection Induced Synchronization Transitions in Newman-Watts Small-World Neuronal Networks

    PubMed Central

    Qian, Yu

    2014-01-01

    The synchronization transitions in Newman-Watts small-world neuronal networks (SWNNs) induced by time delay and long-range connection (LRC) probability have been investigated by synchronization parameter and space-time plots. Four distinct parameter regions, that is, asynchronous region, transition region, synchronous region, and oscillatory region have been discovered at certain LRC probability as time delay is increased. Interestingly, desynchronization is observed in oscillatory region. More importantly, we consider the spatiotemporal patterns obtained in delayed Newman-Watts SWNNs are the competition results between long-range drivings (LRDs) and neighboring interactions. In addition, for moderate time delay, the synchronization of neuronal network can be enhanced remarkably by increasing LRC probability. Furthermore, lag synchronization has been found between weak synchronization and complete synchronization as LRC probability is a little less than 1.0. Finally, the two necessary conditions, moderate time delay and large numbers of LRCs, are exposed explicitly for synchronization in delayed Newman-Watts SWNNs. PMID:24810595

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Hang, E-mail: hangchen@mit.edu; Thill, Peter; Cao, Jianshu

    In biochemical systems, intrinsic noise may drive the system switch from one stable state to another. We investigate how kinetic switching between stable states in a bistable network is influenced by dynamic disorder, i.e., fluctuations in the rate coefficients. Using the geometric minimum action method, we first investigate the optimal transition paths and the corresponding minimum actions based on a genetic toggle switch model in which reaction coefficients draw from a discrete probability distribution. For the continuous probability distribution of the rate coefficient, we then consider two models of dynamic disorder in which reaction coefficients undergo different stochastic processes withmore » the same stationary distribution. In one, the kinetic parameters follow a discrete Markov process and in the other they follow continuous Langevin dynamics. We find that regulation of the parameters modulating the dynamic disorder, as has been demonstrated to occur through allosteric control in bistable networks in the immune system, can be crucial in shaping the statistics of optimal transition paths, transition probabilities, and the stationary probability distribution of the network.« less

  14. Probabilistic Micromechanics and Macromechanics for Ceramic Matrix Composites

    NASA Technical Reports Server (NTRS)

    Murthy, Pappu L. N.; Mital, Subodh K.; Shah, Ashwin R.

    1997-01-01

    The properties of ceramic matrix composites (CMC's) are known to display a considerable amount of scatter due to variations in fiber/matrix properties, interphase properties, interphase bonding, amount of matrix voids, and many geometry- or fabrication-related parameters, such as ply thickness and ply orientation. This paper summarizes preliminary studies in which formal probabilistic descriptions of the material-behavior- and fabrication-related parameters were incorporated into micromechanics and macromechanics for CMC'S. In this process two existing methodologies, namely CMC micromechanics and macromechanics analysis and a fast probability integration (FPI) technique are synergistically coupled to obtain the probabilistic composite behavior or response. Preliminary results in the form of cumulative probability distributions and information on the probability sensitivities of the response to primitive variables for a unidirectional silicon carbide/reaction-bonded silicon nitride (SiC/RBSN) CMC are presented. The cumulative distribution functions are computed for composite moduli, thermal expansion coefficients, thermal conductivities, and longitudinal tensile strength at room temperature. The variations in the constituent properties that directly affect these composite properties are accounted for via assumed probabilistic distributions. Collectively, the results show that the present technique provides valuable information about the composite properties and sensitivity factors, which is useful to design or test engineers. Furthermore, the present methodology is computationally more efficient than a standard Monte-Carlo simulation technique; and the agreement between the two solutions is excellent, as shown via select examples.

  15. Determining Optimal Evacuation Decision Policies for Disasters

    DTIC Science & Technology

    2012-03-01

    18 3.3 Calculating the Hit Probability ( Phit ) . . . . . . . . . . . . . . . . . . 20 3.4 Phit versus Vertical...23 Figure 3.13 Large Probability Matrix (Map) . . . . . . . . . . . . . . . . . . . . . 24 Figure 3.14 Particle Trajectory with Phit data...26 Figure 3.15 Phit versus Vertical Volatility . . . . . . . . . . . . . . . . . . . . . . 27 Figure 4.1 Cost-To

  16. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  17. Kepler Reliability and Occurrence Rates

    NASA Astrophysics Data System (ADS)

    Bryson, Steve

    2016-10-01

    The Kepler mission has produced tables of exoplanet candidates (``KOI table''), as well as tables of transit detections (``TCE table''), hosted at the Exoplanet Archive (http://exoplanetarchive.ipac.caltech.edu). Transit detections in the TCE table that are plausibly due to a transiting object are selected for inclusion in the KOI table. KOI table entries that have not been identified as false positives (FPs) or false alarms (FAs) are classified as planet candidates (PCs, Mullally et al. 2015). A subset of PCs have been confirmed as planetary transits with greater than 99% probability, but most PCs have <99% probability of being true planets. The fraction of PCs that are true transiting planets is the PC reliability rate. The overall PC population is believed to have a reliability rate >90% (Morton & Johnson 2011).

  18. Potential for Rabies Control through Dog Vaccination in Wildlife-Abundant Communities of Tanzania

    PubMed Central

    Fitzpatrick, Meagan C.; Hampson, Katie; Cleaveland, Sarah; Meyers, Lauren Ancel; Townsend, Jeffrey P.; Galvani, Alison P.

    2012-01-01

    Canine vaccination has been successful in controlling rabies in diverse settings worldwide. However, concerns remain that coverage levels which have previously been sufficient might be insufficient in systems where transmission occurs both between and within populations of domestic dogs and other carnivores. To evaluate the effectiveness of vaccination targeted at domestic dogs when wildlife also contributes to transmission, we applied a next-generation matrix model based on contract tracing data from the Ngorongoro and Serengeti Districts in northwest Tanzania. We calculated corresponding values of R 0, and determined, for policy purposes, the probabilities that various annual vaccination targets would control the disease, taking into account the empirical uncertainty in our field data. We found that transition rate estimates and corresponding probabilities of vaccination-based control indicate that rabies transmission in this region is driven by transmission within domestic dogs. Different patterns of rabies transmission between the two districts exist, with wildlife playing a more important part in Ngorongoro and leading to higher recommended coverage levels in that district. Nonetheless, our findings indicate that an annual dog vaccination campaign achieving the WHO-recommended target of 70% will control rabies in both districts with a high level of certainty. Our results support the feasibility of controlling rabies in Tanzania through dog vaccination. PMID:22928056

  19. The consequences of improperly describing oscillator strengths beyond the electric dipole approximation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lestrange, Patrick J.; Egidi, Franco; Li, Xiaosong, E-mail: xsli@uw.edu

    2015-12-21

    The interaction between a quantum mechanical system and plane wave light is usually modeled within the electric dipole approximation. This assumes that the intensity of the incident field is constant over the length of the system and transition probabilities are described in terms of the electric dipole transition moment. For short wavelength spectroscopies, such as X-ray absorption, the electric dipole approximation often breaks down. Higher order multipoles are then included to describe transition probabilities. The square of the magnetic dipole and electric quadrupole are often included, but this results in an origin-dependent expression for the oscillator strength. The oscillator strengthmore » can be made origin-independent if all terms through the same order in the wave vector are retained. We will show the consequences and potential pitfalls of using either of these two expressions. It is shown that the origin-dependent expression may violate the Thomas-Reiche-Kuhn sum rule and the origin-independent expression can result in negative transition probabilities.« less

  20. The consequences of improperly describing oscillator strengths beyond the electric dipole approximation.

    PubMed

    Lestrange, Patrick J; Egidi, Franco; Li, Xiaosong

    2015-12-21

    The interaction between a quantum mechanical system and plane wave light is usually modeled within the electric dipole approximation. This assumes that the intensity of the incident field is constant over the length of the system and transition probabilities are described in terms of the electric dipole transition moment. For short wavelength spectroscopies, such as X-ray absorption, the electric dipole approximation often breaks down. Higher order multipoles are then included to describe transition probabilities. The square of the magnetic dipole and electric quadrupole are often included, but this results in an origin-dependent expression for the oscillator strength. The oscillator strength can be made origin-independent if all terms through the same order in the wave vector are retained. We will show the consequences and potential pitfalls of using either of these two expressions. It is shown that the origin-dependent expression may violate the Thomas-Reiche-Kuhn sum rule and the origin-independent expression can result in negative transition probabilities.

  1. The consequences of improperly describing oscillator strengths beyond the electric dipole approximation

    NASA Astrophysics Data System (ADS)

    Lestrange, Patrick J.; Egidi, Franco; Li, Xiaosong

    2015-12-01

    The interaction between a quantum mechanical system and plane wave light is usually modeled within the electric dipole approximation. This assumes that the intensity of the incident field is constant over the length of the system and transition probabilities are described in terms of the electric dipole transition moment. For short wavelength spectroscopies, such as X-ray absorption, the electric dipole approximation often breaks down. Higher order multipoles are then included to describe transition probabilities. The square of the magnetic dipole and electric quadrupole are often included, but this results in an origin-dependent expression for the oscillator strength. The oscillator strength can be made origin-independent if all terms through the same order in the wave vector are retained. We will show the consequences and potential pitfalls of using either of these two expressions. It is shown that the origin-dependent expression may violate the Thomas-Reiche-Kuhn sum rule and the origin-independent expression can result in negative transition probabilities.

  2. Dipole moments and transition probabilities of the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u systems of molecular hydrogen

    NASA Technical Reports Server (NTRS)

    Guberman, Steven L.; Dalgarno, A.

    1992-01-01

    Bonn-Oppenheimer-based ab initio calculations of dipole moments from the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u transitions of H2 have been conducted, to yield a tabulation of the dipole transition probabilities and Franck-Condon factors. These factors are given for transitions originating in the lowest vibrational level of the ground X 1Sigma(+) sub g state.

  3. PROJECTED POPULATION-LEVEL EFFECTS OF THIOBENCARB EXPOSURE ON THE MYSID, AMERICAMYSIS BAHIA, AND EXTINCTION PROBABILITY IN A CONCENTRATION-DECAY EXPOSURE SYSTEM

    EPA Science Inventory



    Population-level effects of the mysid, Americamysis bahia, exposed to varying thiobencarb concentrations were estimated using stage-structured matrix models. A deterministic density-independent matrix model estimated the decrease in population growth rate, l, with increas...

  4. A matrix-based approach to solving the inverse Frobenius-Perron problem using sequences of density functions of stochastically perturbed dynamical systems

    NASA Astrophysics Data System (ADS)

    Nie, Xiaokai; Coca, Daniel

    2018-01-01

    The paper introduces a matrix-based approach to estimate the unique one-dimensional discrete-time dynamical system that generated a given sequence of probability density functions whilst subjected to an additive stochastic perturbation with known density.

  5. A matrix-based approach to solving the inverse Frobenius-Perron problem using sequences of density functions of stochastically perturbed dynamical systems.

    PubMed

    Nie, Xiaokai; Coca, Daniel

    2018-01-01

    The paper introduces a matrix-based approach to estimate the unique one-dimensional discrete-time dynamical system that generated a given sequence of probability density functions whilst subjected to an additive stochastic perturbation with known density.

  6. Weak Measurement and Quantum Smoothing of a Superconducting Qubit

    NASA Astrophysics Data System (ADS)

    Tan, Dian

    In quantum mechanics, the measurement outcome of an observable in a quantum system is intrinsically random, yielding a probability distribution. The state of the quantum system can be described by a density matrix rho(t), which depends on the information accumulated until time t, and represents our knowledge about the system. The density matrix rho(t) gives probabilities for the outcomes of measurements at time t. Further probing of the quantum system allows us to refine our prediction in hindsight. In this thesis, we experimentally examine a quantum smoothing theory in a superconducting qubit by introducing an auxiliary matrix E(t) which is conditioned on information obtained from time t to a final time T. With the complete information before and after time t, the pair of matrices [rho(t), E(t)] can be used to make smoothed predictions for the measurement outcome at time t. We apply the quantum smoothing theory in the case of continuous weak measurement unveiling the retrodicted quantum trajectories and weak values. In the case of strong projective measurement, while the density matrix rho(t) with only diagonal elements in a given basis |n〉 may be treated as a classical mixture, we demonstrate a failure of this classical mixture description in determining the smoothed probabilities for the measurement outcome at time t with both diagonal rho(t) and diagonal E(t). We study the correlations between quantum states and weak measurement signals and examine aspects of the time symmetry of continuous quantum measurement. We also extend our study of quantum smoothing theory to the case of resonance fluorescence of a superconducting qubit with homodyne measurement and observe some interesting effects such as the modification of the excited state probabilities, weak values, and evolution of the predicted and retrodicted trajectories.

  7. Methodologies For A Physically Based Rockfall Hazard Assessment

    NASA Astrophysics Data System (ADS)

    Agliardi, F.; Crosta, G. B.; Guzzetti, F.; Marian, M.

    Rockfall hazard assessment is an important land planning tool in alpine areas, where settlements progressively expand across rockfall prone areas, rising the vulnerability of the elements at risk, the worth of potential losses and the restoration costs. Nev- ertheless, hazard definition is not simple to achieve in practice and sound, physically based assessment methodologies are still missing. In addition, the high mobility of rockfalls implies a more difficult hazard definition with respect to other slope insta- bilities for which runout is minimal. When coping with rockfalls, hazard assessment involves complex definitions for "occurrence probability" and "intensity". The local occurrence probability must derive from the combination of the triggering probability (related to the geomechanical susceptibility of rock masses to fail) and the transit or impact probability at a given location (related to the motion of falling blocks). The intensity (or magnitude) of a rockfall is a complex function of mass, velocity and fly height of involved blocks that can be defined in many different ways depending on the adopted physical description and "destructiveness" criterion. This work is an attempt to evaluate rockfall hazard using the results of numerical modelling performed by an original 3D rockfall simulation program. This is based on a kinematic algorithm and allows the spatially distributed simulation of rockfall motions on a three-dimensional topography described by a DTM. The code provides raster maps portraying the max- imum frequency of transit, velocity and height of blocks at each model cell, easily combined in a GIS in order to produce physically based rockfall hazard maps. The results of some three dimensional rockfall models, performed at both regional and lo- cal scale in areas where rockfall related problems are well known, have been used to assess rockfall hazard, by adopting an objective approach based on three-dimensional matrixes providing a positional "hazard index". Different hazard maps have been ob- tained combining and classifying variables in different ways. The performance of the different hazard maps has been evaluated on the basis of past rockfall events and com- pared to the results of existing methodologies. The sensitivity of the hazard index with respect to the included variables and their combinations is discussed in order to constrain as objective as possible assessment criteria.

  8. Disruption of Methicillin-resistant Staphylococcus aureus Biofilms with Enzymatic Therapeutics

    DTIC Science & Technology

    2015-04-29

    polysaccharide matrix and bacteria from the growth surface. α-Amylase, bromelain, and papain caused removal of most of the polysaccharide matrix...biofilm EPS matrix, including polysaccharides , proteins, and bacterial/host DNA [21]. While these enzymes have been utilized clinically since the 1940s...clinically or can easily transition to the clinical setting. These enzymes included an anti- polysaccharide agent, α-amylase, an anti-peptidoglycan agent

  9. Accurate potential energy curves, spectroscopic parameters, transition dipole moments, and transition probabilities of 21 low-lying states of the CO+ cation

    NASA Astrophysics Data System (ADS)

    Xing, Wei; Shi, Deheng; Zhang, Jicai; Sun, Jinfeng; Zhu, Zunlue

    2018-05-01

    This paper calculates the potential energy curves of 21 Λ-S and 42 Ω states, which arise from the first two dissociation asymptotes of the CO+ cation. The calculations are conducted using the complete active space self-consistent field method, which is followed by the valence internally contracted multireference configuration interaction approach with the Davidson correction. To improve the reliability and accuracy of the potential energy curves, core-valence correlation and scalar relativistic corrections, as well as the extrapolation of potential energies to the complete basis set limit are taken into account. The spectroscopic parameters and vibrational levels are determined. The spin-orbit coupling effect on the spectroscopic parameters and vibrational levels is evaluated. To better study the transition probabilities, the transition dipole moments are computed. The Franck-Condon factors and Einstein coefficients of some emissions are calculated. The radiative lifetimes are determined for a number of vibrational levels of several states. The transitions between different Λ-S states are evaluated. Spectroscopic routines for observing these states are proposed. The spectroscopic parameters, vibrational levels, transition dipole moments, and transition probabilities reported in this paper can be considered to be very reliable and can be used as guidelines for detecting these states in an appropriate spectroscopy experiment, especially for the states that were very difficult to observe or were not detected in previous experiments.

  10. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  11. Magnetic field-induced modification of selection rules for Rb D 2 line monitored by selective reflection from a vapor nanocell

    NASA Astrophysics Data System (ADS)

    Klinger, Emmanuel; Sargsyan, Armen; Tonoyan, Ara; Hakhumyan, Grant; Papoyan, Aram; Leroy, Claude; Sarkisyan, David

    2017-08-01

    Magnetic field-induced giant modification of the probabilities of five transitions of 5S1 / 2,Fg = 2 → 5P3 / 2,Fe = 4 of 85Rb and three transitions of 5S1 / 2,Fg = 1 → 5P3 / 2,Fe = 3 of 87Rb forbidden by selection rules for zero magnetic field has been observed experimentally and described theoretically for the first time. For the case of excitation with circularly-polarized (σ+) laser radiation, the probability of Fg = 2,mF = - 2 → Fe = 4,mF = - 1 transition becomes the largest among the seventeen transitions of 85Rb Fg = 2 → Fe = 1,2,3,4 group, and the probability of Fg = 1, mF = - 1 → Fe = 3,mF = 0 transition becomes the largest among the nine transitions of 87Rb Fg = 1 → Fe = 0,1,2,3 group, in a wide range of magnetic field 200-1000 G. Complete frequency separation of individual Zeeman components was obtained by implementation of derivative selective reflection technique with a 300 nm-thick nanocell filled with Rb, allowing formation of narrow optical resonances. Possible applications are addressed. The theoretical model is well consistent with the experimental results.

  12. Theoretical Study of Energy Levels and Transition Probabilities of Boron Atom

    NASA Astrophysics Data System (ADS)

    Tian Yi, Zhang; Neng Wu, Zheng

    2009-08-01

    Full Text PDF Though the electrons configuration for boron atom is simple and boron atom has long been of interest for many researchers, the theoretical studies for properties of BI are not systematic, there are only few results reported on energy levels of high excited states of boron, and transition measurements are generally restricted to transitions involving ground states and low excited states without considering fine structure effects, provided only multiplet results, values for transitions between high excited states are seldom performed. In this article, by using the scheme of the weakest bound electron potential model theory calculations for energy levels of five series are performed and with the same method we give the transition probabilities between excited states with considering fine structure effects. The comprehensive set of calculations attempted in this paper could be of some value to workers in the field because of the lack of published calculations for the BI systems. The perturbations coming from foreign perturbers are taken into account in studying the energy levels. Good agreement between our results and the accepted values taken from NIST has been obtained. We also reported some values of energy levels and transition probabilities not existing on the NIST data bases.

  13. Radiative lifetimes and transition probabilities for electric-dipole delta n equals zero transitions in highly stripped sulfur ions

    NASA Technical Reports Server (NTRS)

    Pegg, D. J.; Elston, S. B.; Griffin, P. M.; Forester, J. P.; Thoe, R. S.; Peterson, R. S.; Sellin, I. A.; Hayden, H. C.

    1976-01-01

    The beam-foil time-of-flight method has been used to investigate radiative lifetimes and transition rates involving allowed intrashell transitions within the L shell of highly ionized sulfur. The results for these transitions, which can be particularly correlation-sensitive, are compared with current calculations based upon multiconfigurational models.

  14. Homologous peptide of connective tissue growth factor ameliorates epithelial to mesenchymal transition of tubular epithelial cells.

    PubMed

    Shi, Yujun; Tu, Zhidan; Wang, Wei; Li, Qing; Ye, Feng; Wang, Jinjing; Qiu, Jing; Zhang, Li; Bu, Hong; Li, Youping

    2006-10-01

    The hallmark of failing renal transplants is tubular atrophy and interstitial fibrosis. The cytokine connective tissue growth factor (CTGF or CCN2) plays an important role in epithelial-mesenchymal transition (EMT) of tubular epithelial cells (TECs). A unique domain within CTGF (IRTPKISKPIKFELSG) which binds to its potential receptor integrin alpha v beta3 has been identified. This study was carried out to further characterize a synthetic hexadeca-peptide (P2) homologous to this domain and to determine its effect on CTGF-mediated solid phase cell adhesion, EMT induction and fibrogenesis in rat renal NRK-52E cells. Results showed that both P2 and recombinant CTGF bound to NRK-52E cells. Unlike CTGF, P2 had little effect on EMT induction including cytoskeleton remodeling and expression of alpha-smooth muscle actin (alpha-SMA) and E-cadherin, nor did it have effect on fibrogenic induction including alternation of extracellular matrix (ECM) proteins, collagen type I and IV at gene and protein levels. All data showed that P2 bound preferably on the surface of NRK-52E cells and inhibited the effect of CTGF on EMT induction and cell fibrogenesis, probably by occupying the binding sites of CTGF within its potential receptors. Therefore, P2 may be used as a potential anti-fibrotic agent.

  15. Entropy, complexity, and Markov diagrams for random walk cancer models

    PubMed Central

    Newton, Paul K.; Mason, Jeremy; Hurt, Brian; Bethel, Kelly; Bazhenova, Lyudmila; Nieva, Jorge; Kuhn, Peter

    2014-01-01

    The notion of entropy is used to compare the complexity associated with 12 common cancers based on metastatic tumor distribution autopsy data. We characterize power-law distributions, entropy, and Kullback-Liebler divergence associated with each primary cancer as compared with data for all cancer types aggregated. We then correlate entropy values with other measures of complexity associated with Markov chain dynamical systems models of progression. The Markov transition matrix associated with each cancer is associated with a directed graph model where nodes are anatomical locations where a metastatic tumor could develop, and edge weightings are transition probabilities of progression from site to site. The steady-state distribution corresponds to the autopsy data distribution. Entropy correlates well with the overall complexity of the reduced directed graph structure for each cancer and with a measure of systemic interconnectedness of the graph, called graph conductance. The models suggest that grouping cancers according to their entropy values, with skin, breast, kidney, and lung cancers being prototypical high entropy cancers, stomach, uterine, pancreatic and ovarian being mid-level entropy cancers, and colorectal, cervical, bladder, and prostate cancers being prototypical low entropy cancers, provides a potentially useful framework for viewing metastatic cancer in terms of predictability, complexity, and metastatic potential. PMID:25523357

  16. Unravelling the temporal association between lameness and body condition score in dairy cattle using a multistate modelling approach.

    PubMed

    Lim, P Y; Huxley, J N; Willshire, J A; Green, M J; Othman, A R; Kaler, J

    2015-03-01

    Recent studies have reported associations between lameness and body condition score (BCS) in dairy cattle, however the impact of change in the dynamics of BCS on both lameness occurrence and recovery is currently unknown. The aim of this longitudinal study was to investigate the effect of change in BCS on the transitions from the non-lame to lame, and lame to non-lame states. A total of 731 cows with 6889 observations from 4 UK herds were included in the study. Mobility score (MS) and body condition score (BCS) were recorded every 13-15 days from July 2010 until December 2011. A multilevel multistate discrete time event history model was built to investigate the transition of lameness over time. There were 1042 non-lame episodes and 593 lame episodes of which 50% (519/1042) of the non-lame episodes transitioned to the lame state and 81% (483/593) of the lame episodes ended with a transition to the non-lame state. Cows with a lower BCS at calving (BCS Group 1 (1.00-1.75) and Group 2 (2.00-2.25)) had a higher probability of transition from non-lame to lame and a lower probability of transition from lame to non-lame compared to cows with BCS 2.50-2.75, i.e. they were more likely to become lame and if lame, they were less likely to recover. Similarly, cows who suffered a greater decrease in BCS (compared to their BCS at calving) had a higher probability of becoming lame and a lower probability of recovering in the next 15 days. An increase in BCS from calving was associated with the converse effect, i.e. a lower probability of cows moving from the non-lame to the lame state and higher probability of transition from lame to non-lame. Days in lactation, quarters of calving and parity were associated with both lame and non-lame transitions and there was evidence of heterogeneity among cows in lameness occurrence and recovery. This study suggests loss of BCS and increase of BCS could influence the risk of becoming lame and the chance of recovery from lameness. Regular monitoring and maintenance of BCS on farms could be a key tool for reducing lameness. Further work is urgently needed in this area to allow a better understanding of the underlying mechanisms behind these relationships. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. VizieR Online Data Catalog: Ba V, Ba VI, and Ba VII oscillator strengths (Rauch+, 2014)

    NASA Astrophysics Data System (ADS)

    Rauch, T.; Werner, K.; Quinet, P.; Kruk, J. W.

    2014-04-01

    table1.dat contains calculated HFR oscillator strengths (loggf) and transition probabilities (gA, in 1/s) in Ba V. CF is the cancellation factor as defined by Cowan (1981). In columns 3 and 6, e is written for even and o for odd. table2.dat contains calculated HFR oscillator strengths (loggf) and transition probabilities (gA, in 1/s) in Ba VI. CF is the cancellation factor as defined by Cowan (1981). In columns 3 and 6, e is written for even and o for odd. table3.dat contains calculated HFR oscillator strengths (loggf) and transition probabilities (gA, in 1/s) in Ba VII. CF is the cancellation factor as defined by Cowan (1981). In columns 3 and 6, e is written for even and o for odd. (3 data files).

  18. Double Gamow-Teller Transitions and its Relation to Neutrinoless β β Decay

    NASA Astrophysics Data System (ADS)

    Shimizu, Noritaka; Menéndez, Javier; Yako, Kentaro

    2018-04-01

    We study the double Gamow-Teller (DGT) strength distribution of 48Ca with state-of-the-art large-scale nuclear shell model calculations. Our analysis shows that the centroid energy of the DGT giant resonance depends mostly on the isovector pairing interaction, while the resonance width is more sensitive to isoscalar pairing. Pairing correlations are also key in neutrinoless β β (0 ν β β ) decay. We find a simple relation between the centroid energy of the 48Ca DGT giant resonance and the 0 ν β β decay nuclear matrix element. More generally, we observe a very good linear correlation between the DGT transition to the ground state of the final nucleus and the 0 ν β β decay matrix element. The correlation, which originates on the dominant short-range character of both transitions, extends to heavier systems including several β β emitters and also holds in energy-density functional results. Our findings suggest that DGT experiments can be a very valuable tool to obtain information on the value of 0 ν β β decay nuclear matrix elements.

  19. Quantum transition probabilities during a perturbing pulse: Differences between the nonadiabatic results and Fermi's golden rule forms

    NASA Astrophysics Data System (ADS)

    Mandal, Anirban; Hunt, Katharine L. C.

    2018-05-01

    For a perturbed quantum system initially in the ground state, the coefficient ck(t) of excited state k in the time-dependent wave function separates into adiabatic and nonadiabatic terms. The adiabatic term ak(t) accounts for the adjustment of the original ground state to form the new ground state of the instantaneous Hamiltonian H(t), by incorporating excited states of the unperturbed Hamiltonian H0 without transitions; ak(t) follows the adiabatic theorem of Born and Fock. The nonadiabatic term bk(t) describes excitation into another quantum state k; bk(t) is obtained as an integral containing the time derivative of the perturbation. The true transition probability is given by |bk(t)|2, as first stated by Landau and Lifshitz. In this work, we contrast |bk(t)|2 and |ck(t)|2. The latter is the norm-square of the entire excited-state coefficient which is used for the transition probability within Fermi's golden rule. Calculations are performed for a perturbing pulse consisting of a cosine or sine wave in a Gaussian envelope. When the transition frequency ωk0 is on resonance with the frequency ω of the cosine wave, |bk(t)|2 and |ck(t)|2 rise almost monotonically to the same final value; the two are intertwined, but they are out of phase with each other. Off resonance (when ωk0 ≠ ω), |bk(t)|2 and |ck(t)|2 differ significantly during the pulse. They oscillate out of phase and reach different maxima but then fall off to equal final values after the pulse has ended, when ak(t) ≡ 0. If ωk0 < ω, |bk(t)|2 generally exceeds |ck(t)|2, while the opposite is true when ωk0 > ω. While the transition probability is rising, the midpoints between successive maxima and minima fit Gaussian functions of the form a exp[-b(t - d)2]. To our knowledge, this is the first analysis of nonadiabatic transition probabilities during a perturbing pulse.

  20. Probability density functions for CP-violating rephasing invariants

    NASA Astrophysics Data System (ADS)

    Fortin, Jean-François; Giasson, Nicolas; Marleau, Luc

    2018-05-01

    The implications of the anarchy principle on CP violation in the lepton sector are investigated. A systematic method is introduced to compute the probability density functions for the CP-violating rephasing invariants of the PMNS matrix from the Haar measure relevant to the anarchy principle. Contrary to the CKM matrix which is hierarchical, it is shown that the Haar measure, and hence the anarchy principle, are very likely to lead to the observed PMNS matrix. Predictions on the CP-violating Dirac rephasing invariant |jD | and Majorana rephasing invariant |j1 | are also obtained. They correspond to 〈 |jD | 〉 Haar = π / 105 ≈ 0.030 and 〈 |j1 | 〉 Haar = 1 / (6 π) ≈ 0.053 respectively, in agreement with the experimental hint from T2K of | jDexp | ≈ 0.032 ± 0.005 (or ≈ 0.033 ± 0.003) for the normal (or inverted) hierarchy.

  1. Measurement of K to L shell vacancy transfer probabilities for the elements 46≤ Z≤55 by photoionization

    NASA Astrophysics Data System (ADS)

    Şimşek, Ö.; Karagöz, D.; Ertugrul, M.

    2003-10-01

    The K to L shell vacancy transfer probabilities for nine elements in the atomic region 46≤ Z≤55 were determined by measuring the L X-ray yields from targets excited by 5.96 and 59.5 keV photons and using the theoretical K and L shell photoionization cross-sections. The L X-rays from different targets were detected with an Ultra-LEGe detector with very thin polymer window. Present experimental results were compared with the semi empirical values tabulated by Rao et al. [Atomic vacancy distributions product by inner shellionization, Phys. Rev. A 5 (1972) 997-1002] and theoretically calculated values using radiative and radiationless transitions. The radiative transitions of these elements were observed from the relativistic Hartree-Slater model, which was proposed by Scofield [Relativistic Hartree-Slater values for K and L shell X-ray emission rates, At. Data Nucl. Data Tables 14 (1974) 121-137]. The radiationless transitions were observed from the Dirac-Hartree-Slater model, which was proposed by Chen et al. [Relativistic radiationless transition probabilities for atomic K- and L-shells, At. Data Nucl. Data Tables 24 (1979) 13-37]. To the best of our knowledge, these vacancy transfer probabilities are reported for the first time.

  2. Lotka-Volterra competition models for sessile organisms.

    PubMed

    Spencer, Matthew; Tanner, Jason E

    2008-04-01

    Markov models are widely used to describe the dynamics of communities of sessile organisms, because they are easily fitted to field data and provide a rich set of analytical tools. In typical ecological applications, at any point in time, each point in space is in one of a finite set of states (e.g., species, empty space). The models aim to describe the probabilities of transitions between states. In most Markov models for communities, these transition probabilities are assumed to be independent of state abundances. This assumption is often suspected to be false and is rarely justified explicitly. Here, we start with simple assumptions about the interactions among sessile organisms and derive a model in which transition probabilities depend on the abundance of destination states. This model is formulated in continuous time and is equivalent to a Lotka-Volterra competition model. We fit this model and a variety of alternatives in which transition probabilities do not depend on state abundances to a long-term coral reef data set. The Lotka-Volterra model describes the data much better than all models we consider other than a saturated model (a model with a separate parameter for each transition at each time interval, which by definition fits the data perfectly). Our approach provides a basis for further development of stochastic models of sessile communities, and many of the methods we use are relevant to other types of community. We discuss possible extensions to spatially explicit models.

  3. Some Factor Analytic Approximations to Latent Class Structure.

    ERIC Educational Resources Information Center

    Dziuban, Charles D.; Denton, William T.

    Three procedures, alpha, image, and uniqueness rescaling, were applied to a joint occurrence probability matrix. That matrix was the basis of a well-known latent class structure. The values of the recurring subscript elements were varied as follows: Case 1 - The known elements were input; Case 2 - The upper bounds to the recurring subscript…

  4. Glass transition behavior of polystyrene/silica nanocomposites.

    NASA Astrophysics Data System (ADS)

    Xie, Yuping; Sen, Sudeepto; Kumar, Sanat; Bansal, Amitabh

    2006-03-01

    The change in thermomechanical properties of nano-filled polymers is of considerable scientific and technological interest. The interaction between the nanofillers and the matrix polymer controls the nanocomposite properties. We will present the results from recent and ongoing DSC experiments on polystyrene/silica nanocomposites. Polystyrene of different molecular weights (and from different sources) and silica nanoparticles 10-15 nm in diameter (both as received from Nissan and surface modified by grafted or physisorbed polystyrene) are being used to process the nanocomposites. We are studying trends in the glass transition behavior by changing the matrix molecular weights and the silica weight fractions. Recent data indicate that the glass transition temperature can both decrease and increase depending on the polymer-nanofiller combination as well as the thermal treatment of the nanocomposites prior to the DSC runs.

  5. Effect of inclusions on heterogeneous crack nucleation in nanocomposites

    NASA Astrophysics Data System (ADS)

    Gutkin, M. Yu.; Ovid'Ko, I. A.; Skiba, N. V.

    2007-02-01

    A two-dimensional theoretical model is proposed for the heterogeneous nucleation of a grain-boundary nanocrack in a nanocomposite consisting of a nanocrystalline matrix and nanoinclusions whose elastic moduli are identical to those of the matrix. The inclusions have the form of rods with a rectangular cross section and undergo dilatation eigenstrain induced by the differences in the lattice parameters and thermal expansion coefficients of the matrix and inclusions. In terms of the model, a mode-I-II nanocrack nucleates at the negative disclination of a biaxial dipole consisting of wedge grain-boundary (or junction) disclinations; then, the nanocrack opens along a grain boundary and reaches an inclusion boundary. Depending on the relative positions and orientations of the initial segment of the nanocrack and the inclusion, the nanocrack can either penetrate into the inclusion or bypass it along the matrix-inclusion interface. The nanocrack nucleation probability increases near an inclusion with negative (compressive) dilatation eigenstrain. A decrease in the inclusion size decreases (increases) the probability of a crack opening along the interface if the dilatation eigenstrain is negative (positive).

  6. New Critical Compilations of Atomic Transition Probabilities for Neutral and Singly Ionized Carbon, Nitrogen, and Iron

    NASA Technical Reports Server (NTRS)

    Wiese, Wolfgang L.; Fuhr, J. R.

    2006-01-01

    We have undertaken new critical assessments and tabulations of the transition probabilities of important lines of these spectra. For Fe I and Fe II, we have carried out a complete re-assessment and update, and we have relied almost exclusively on the literature of the last 15 years. Our updates for C I, C II and N I, N II primarily address the persistent lower transitions as well as a greatly expanded number of forbidden lines (M1, M2, and E2). For these transitions, sophisticated multiconfiguration Hartree-Fock (MCHF) calculations have been recently carried out, which have yielded data considerably improved and often appreciably different from our 1996 NIST compilation.

  7. On the use of the energy probability distribution zeros in the study of phase transitions

    NASA Astrophysics Data System (ADS)

    Mól, L. A. S.; Rodrigues, R. G. M.; Stancioli, R. A.; Rocha, J. C. S.; Costa, B. V.

    2018-04-01

    This contribution is devoted to cover some technical aspects related to the use of the recently proposed energy probability distribution zeros in the study of phase transitions. This method is based on the partial knowledge of the partition function zeros and has been shown to be extremely efficient to precisely locate phase transition temperatures. It is based on an iterative method in such a way that the transition temperature can be approached at will. The iterative method will be detailed and some convergence issues that has been observed in its application to the 2D Ising model and to an artificial spin ice model will be shown, together with ways to circumvent them.

  8. DNA binding sites characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, Alexandre; Vallverdu, Montserrat; Claria, Francesc; Soria, José Manuel; Caminal, Pere

    2006-01-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measure such as Renyi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency based Renyi measures. Results are reported in this manuscript comparing transition frequencies (i.e. dinucelotides) and base frequencies for Shannon and parametric Renyi for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that, for the evaluated datasets, the information provided by both approaches is not redundant, as they evolve differently under increasing Renyi orders.

  9. Monolayer phosphorene under time-dependent magnetic field

    NASA Astrophysics Data System (ADS)

    Nascimento, J. P. G.; Aguiar, V.; Guedes, I.

    2018-02-01

    We obtain the exact wave function of a monolayer phosphorene under a low-intensity time-dependent magnetic field using the dynamical invariant method. We calculate the quantum-mechanical energy expectation value and the transition probability for a constant and an oscillatory magnetic field. For the former we observe that the Landau level energy varies linearly with the quantum numbers n and m and the magnetic field intensity B0. No transition takes place. For the latter, we observe that the energy oscillates in time, increasing linearly with the Landau level n and m and nonlinearly with the magnetic field. The (k , l) →(n , m) transitions take place only for l = m. We investigate the (0,0) →(n , 0) and (1 , l) and (2 , l) probability transitions.

  10. Role of the site of synaptic competition and the balance of learning forces for Hebbian encoding of probabilistic Markov sequences

    PubMed Central

    Bouchard, Kristofer E.; Ganguli, Surya; Brainard, Michael S.

    2015-01-01

    The majority of distinct sensory and motor events occur as temporally ordered sequences with rich probabilistic structure. Sequences can be characterized by the probability of transitioning from the current state to upcoming states (forward probability), as well as the probability of having transitioned to the current state from previous states (backward probability). Despite the prevalence of probabilistic sequencing of both sensory and motor events, the Hebbian mechanisms that mold synapses to reflect the statistics of experienced probabilistic sequences are not well understood. Here, we show through analytic calculations and numerical simulations that Hebbian plasticity (correlation, covariance, and STDP) with pre-synaptic competition can develop synaptic weights equal to the conditional forward transition probabilities present in the input sequence. In contrast, post-synaptic competition can develop synaptic weights proportional to the conditional backward probabilities of the same input sequence. We demonstrate that to stably reflect the conditional probability of a neuron's inputs and outputs, local Hebbian plasticity requires balance between competitive learning forces that promote synaptic differentiation and homogenizing learning forces that promote synaptic stabilization. The balance between these forces dictates a prior over the distribution of learned synaptic weights, strongly influencing both the rate at which structure emerges and the entropy of the final distribution of synaptic weights. Together, these results demonstrate a simple correspondence between the biophysical organization of neurons, the site of synaptic competition, and the temporal flow of information encoded in synaptic weights by Hebbian plasticity while highlighting the utility of balancing learning forces to accurately encode probability distributions, and prior expectations over such probability distributions. PMID:26257637

  11. Nuclear transition matrix elements for neutrinoless double-β decay of 76Ge and 82Se isotopes

    NASA Astrophysics Data System (ADS)

    Rath, P. K.

    2017-10-01

    Within mechanisms involving light and heavy Majorana neutrinos, the nuclear transition matrix elements (NTMEs) for the neutrinoless double-β decay of 76Ge and 82Se isotopes are calculated. Uncertainties in the average NTMEs M¯ (0 v ) and M¯ (0 N ) due to the exchange of light and heavy Majorana neutrinos, respectively, turn out to be about 10% and 37%, respectively. Limits on the effective mass of light Majorana neutrino , heavy Majorana neutrino and Majoron-neutrino coupling constant of classical Majoron model are extracted.

  12. Markov Analysis of Sleep Dynamics

    NASA Astrophysics Data System (ADS)

    Kim, J. W.; Lee, J.-S.; Robinson, P. A.; Jeong, D.-U.

    2009-05-01

    A new approach, based on a Markov transition matrix, is proposed to explain frequent sleep and wake transitions during sleep. The matrix is determined by analyzing hypnograms of 113 obstructive sleep apnea patients. Our approach shows that the statistics of sleep can be constructed via a single Markov process and that durations of all states have modified exponential distributions, in contrast to recent reports of a scale-free form for the wake stage and an exponential form for the sleep stage. Hypnograms of the same subjects, but treated with Continuous Positive Airway Pressure, are analyzed and compared quantitatively with the pretreatment ones, suggesting potential clinical applications.

  13. Tunable Graphitic Carbon Nano-Onions Development in Carbon Nanofibers for Multivalent Energy Storage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schwarz, Haiqing L.

    2016-01-01

    We developed a novel porous graphitic carbon nanofiber material using a synthesis strategy combining electrospinning and catalytic graphitization. RF hydrogel was used as carbon precursors, transition metal ions were successfully introduced into the carbon matrix by binding to the carboxylate groups of a resorcinol derivative. Transition metal particles were homogeneously distributed throughout the carbon matrix, which are used as in-situ catalysts to produce graphitic fullerene-like nanostructures surrounding the metals. The success design of graphitic carbons with enlarged interlayer spacing will enable the multivalent ion intercalation for the development of multivalent rechargeable batteries.

  14. A Time Integration Algorithm Based on the State Transition Matrix for Structures with Time Varying and Nonlinear Properties

    NASA Technical Reports Server (NTRS)

    Bartels, Robert E.

    2003-01-01

    A variable order method of integrating the structural dynamics equations that is based on the state transition matrix has been developed. The method has been evaluated for linear time variant and nonlinear systems of equations. When the time variation of the system can be modeled exactly by a polynomial it produces nearly exact solutions for a wide range of time step sizes. Solutions of a model nonlinear dynamic response exhibiting chaotic behavior have been computed. Accuracy of the method has been demonstrated by comparison with solutions obtained by established methods.

  15. Computation of rare transitions in the barotropic quasi-geostrophic equations

    NASA Astrophysics Data System (ADS)

    Laurie, Jason; Bouchet, Freddy

    2015-01-01

    We investigate the theoretical and numerical computation of rare transitions in simple geophysical turbulent models. We consider the barotropic quasi-geostrophic and two-dimensional Navier-Stokes equations in regimes where bistability between two coexisting large-scale attractors exist. By means of large deviations and instanton theory with the use of an Onsager-Machlup path integral formalism for the transition probability, we show how one can directly compute the most probable transition path between two coexisting attractors analytically in an equilibrium (Langevin) framework and numerically otherwise. We adapt a class of numerical optimization algorithms known as minimum action methods to simple geophysical turbulent models. We show that by numerically minimizing an appropriate action functional in a large deviation limit, one can predict the most likely transition path for a rare transition between two states. By considering examples where theoretical predictions can be made, we show that the minimum action method successfully predicts the most likely transition path. Finally, we discuss the application and extension of such numerical optimization schemes to the computation of rare transitions observed in direct numerical simulations and experiments and to other, more complex, turbulent systems.

  16. Universal phase transition in community detectability under a stochastic block model.

    PubMed

    Chen, Pin-Yu; Hero, Alfred O

    2015-03-01

    We prove the existence of an asymptotic phase-transition threshold on community detectability for the spectral modularity method [M. E. J. Newman, Phys. Rev. E 74, 036104 (2006) and Proc. Natl. Acad. Sci. (USA) 103, 8577 (2006)] under a stochastic block model. The phase transition on community detectability occurs as the intercommunity edge connection probability p grows. This phase transition separates a subcritical regime of small p, where modularity-based community detection successfully identifies the communities, from a supercritical regime of large p where successful community detection is impossible. We show that, as the community sizes become large, the asymptotic phase-transition threshold p* is equal to √[p1p2], where pi(i=1,2) is the within-community edge connection probability. Thus the phase-transition threshold is universal in the sense that it does not depend on the ratio of community sizes. The universal phase-transition phenomenon is validated by simulations for moderately sized communities. Using the derived expression for the phase-transition threshold, we propose an empirical method for estimating this threshold from real-world data.

  17. Deterministic matrices matching the compressed sensing phase transitions of Gaussian random matrices

    PubMed Central

    Monajemi, Hatef; Jafarpour, Sina; Gavish, Matan; Donoho, David L.; Ambikasaran, Sivaram; Bacallado, Sergio; Bharadia, Dinesh; Chen, Yuxin; Choi, Young; Chowdhury, Mainak; Chowdhury, Soham; Damle, Anil; Fithian, Will; Goetz, Georges; Grosenick, Logan; Gross, Sam; Hills, Gage; Hornstein, Michael; Lakkam, Milinda; Lee, Jason; Li, Jian; Liu, Linxi; Sing-Long, Carlos; Marx, Mike; Mittal, Akshay; Monajemi, Hatef; No, Albert; Omrani, Reza; Pekelis, Leonid; Qin, Junjie; Raines, Kevin; Ryu, Ernest; Saxe, Andrew; Shi, Dai; Siilats, Keith; Strauss, David; Tang, Gary; Wang, Chaojun; Zhou, Zoey; Zhu, Zhen

    2013-01-01

    In compressed sensing, one takes samples of an N-dimensional vector using an matrix A, obtaining undersampled measurements . For random matrices with independent standard Gaussian entries, it is known that, when is k-sparse, there is a precisely determined phase transition: for a certain region in the (,)-phase diagram, convex optimization typically finds the sparsest solution, whereas outside that region, it typically fails. It has been shown empirically that the same property—with the same phase transition location—holds for a wide range of non-Gaussian random matrix ensembles. We report extensive experiments showing that the Gaussian phase transition also describes numerous deterministic matrices, including Spikes and Sines, Spikes and Noiselets, Paley Frames, Delsarte-Goethals Frames, Chirp Sensing Matrices, and Grassmannian Frames. Namely, for each of these deterministic matrices in turn, for a typical k-sparse object, we observe that convex optimization is successful over a region of the phase diagram that coincides with the region known for Gaussian random matrices. Our experiments considered coefficients constrained to for four different sets , and the results establish our finding for each of the four associated phase transitions. PMID:23277588

  18. A new strategy to analyze possible association structures between dynamic nocturnal hormone activities and sleep alterations in humans.

    PubMed

    Kalus, Stefanie; Kneib, Thomas; Steiger, Axel; Holsboer, Florian; Yassouridis, Alexander

    2009-04-01

    The human sleep process shows dynamic alterations during the night. Methods are needed to examine whether and to what extent such alterations are affected by internal, possibly time-dependent, factors, such as endocrine activity. In an observational study, we examined simultaneously sleep EEG and nocturnal levels of renin, growth hormone (GH), and cortisol (between 2300 and 0700) in 47 healthy volunteers comprising 24 women (41.67 +/- 2.93 yr of age) and 23 men (37.26 +/- 2.85 yr of age). Hormone concentrations were measured every 20 min. Conventional sleep stage scoring at 30-s intervals was applied. Semiparametric multinomial logit models are used to study and quantify possible time-dependent hormone effects on sleep stage transition courses. Results show that increased cortisol levels decrease the probability of transition from rapid-eye-movement (REM) sleep to wakefulness (WAKE) and increase the probability of transition from REM to non-REM (NREM) sleep, irrespective of the time in the night. Via the model selection criterion Akaike's information criterion, it was found that all considered hormone effects on transition probabilities with the initial state WAKE change with time. Similarly, transition from slow-wave sleep (SWS) to light sleep (LS) is affected by a "hormone-time" interaction for cortisol and renin, but not GH. For example, there is a considerable increase in the probability of SWS-LS transition toward the end of the night, when cortisol concentrations are very high. In summary, alterations in human sleep possess dynamic forms and are partially influenced by the endocrine activity of certain hormones. Statistical methods, such as semiparametric multinomial and time-dependent logit regression, can offer ambitious ways to investigate and estimate the association intensities between the nonstationary sleep changes and the time-dependent endocrine activities.

  19. The difference between two random mixed quantum states: exact and asymptotic spectral analysis

    NASA Astrophysics Data System (ADS)

    Mejía, José; Zapata, Camilo; Botero, Alonso

    2017-01-01

    We investigate the spectral statistics of the difference of two density matrices, each of which is independently obtained by partially tracing a random bipartite pure quantum state. We first show how a closed-form expression for the exact joint eigenvalue probability density function for arbitrary dimensions can be obtained from the joint probability density function of the diagonal elements of the difference matrix, which is straightforward to compute. Subsequently, we use standard results from free probability theory to derive a relatively simple analytic expression for the asymptotic eigenvalue density (AED) of the difference matrix ensemble, and using Carlson’s theorem, we obtain an expression for its absolute moments. These results allow us to quantify the typical asymptotic distance between the two random mixed states using various distance measures; in particular, we obtain the almost sure asymptotic behavior of the operator norm distance and the trace distance.

  20. Reflective article having a sacrificial cathodic layer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kabagambe, Benjamin; Buchanan, Michael J.; Scott, Matthew S.

    The present invention relates to reflective articles, such as solar mirrors, that include a sacrificial cathodic layer. The reflective article, more particularly includes a substrate, such as glass, having a multi-layered coating thereon that includes a lead-free sacrificial cathodic layer. The sacrificial cathodic layer includes at least one transition metal, such as a particulate transition metal, which can be in the form of flakes (e.g., zinc flakes). The sacrificial cathodic layer can include an inorganic matrix formed from one or more organo-titanates. Alternatively, the sacrificial cathodic layer can include an organic polymer matrix (e.g., a crosslinked organic polymer matrix formedmore » from an organic polymer and an aminoplast crosslinking agent). The reflective article also includes an outer organic polymer coating, that can be electrodeposited over the sacrificial cathodic layer.« less

  1. PMR-15/Layered Silicate Nanocomposites For Improved Thermal Stability And Mechanical Properties

    NASA Technical Reports Server (NTRS)

    Campbell, Sandi; Scheiman, Daniel; Faile, Michael; Papadopoulos, Demetrios; Gray, Hugh R. (Technical Monitor)

    2002-01-01

    Montmorillonite clay was organically modified by co-exchange of an aromatic diamine and a primary alkyl amine. The clay was dispersed into a PMR (Polymerization of Monomer Reactants)-15 matrix and the glass transition temperature and thermal oxidative stability of the resulting nanocomposites were evaluated. PMR-15/ silicate nanocomposites were also investigated as a matrix material for carbon fabric reinforced composites. Dispersion of the organically modified silicate into the PMR-15 matrix enhanced the thermal oxidative stability, the flexural strength, flexural modulus, and interlaminar shear strength of the polymer matrix composite.

  2. PASTIS: Bayesian extrasolar planet validation - I. General framework, models, and performance

    NASA Astrophysics Data System (ADS)

    Díaz, R. F.; Almenara, J. M.; Santerne, A.; Moutou, C.; Lethuillier, A.; Deleuil, M.

    2014-06-01

    A large fraction of the smallest transiting planet candidates discovered by the Kepler and CoRoT space missions cannot be confirmed by a dynamical measurement of the mass using currently available observing facilities. To establish their planetary nature, the concept of planet validation has been advanced. This technique compares the probability of the planetary hypothesis against that of all reasonably conceivable alternative false positive (FP) hypotheses. The candidate is considered as validated if the posterior probability of the planetary hypothesis is sufficiently larger than the sum of the probabilities of all FP scenarios. In this paper, we present PASTIS, the Planet Analysis and Small Transit Investigation Software, a tool designed to perform a rigorous model comparison of the hypotheses involved in the problem of planet validation, and to fully exploit the information available in the candidate light curves. PASTIS self-consistently models the transit light curves and follow-up observations. Its object-oriented structure offers a large flexibility for defining the scenarios to be compared. The performance is explored using artificial transit light curves of planets and FPs with a realistic error distribution obtained from a Kepler light curve. We find that data support the correct hypothesis strongly only when the signal is high enough (transit signal-to-noise ratio above 50 for the planet case) and remain inconclusive otherwise. PLAnetary Transits and Oscillations of stars (PLATO) shall provide transits with high enough signal-to-noise ratio, but to establish the true nature of the vast majority of Kepler and CoRoT transit candidates additional data or strong reliance on hypotheses priors is needed.

  3. Dielectric, electric and thermal properties of carboxylic functionalized multiwalled carbon nanotubes impregnated polydimethylsiloxane nanocomposite

    NASA Astrophysics Data System (ADS)

    Sagar, Sadia; Iqbal, Nadeem; Maqsood, Asghari

    2013-06-01

    The dielectric, electric and thermal properties of carboxylic functionalized multiwalled carbon nanotubes (F-MWCNT) incorporated into the polydimethylsiloxane (PDMS) were evaluated to determine their potential in the field of electronic materials. Carboxylic functionalization of the pristine multi walled carbon tubes (Ps-MWCNT) was confirmed through Fourier transform infrared spectroscopy, X-ray diffraction patterns for both Ps-MWCNTs and F-MWCNTs elaborated that crystalline behavior did not change with carboxylic moieties. Thermogravimetric and differential thermal analyses were performed to elucidate the thermal stability with increasing weight % addition of F-MWCNTs in the polymer matrix. Crystallization/glass transition / melting temperatures were evaluated using differential scanning calorimeter and it was observed that glass transition and crystallization temperatures were diminished while temperatures of first and second melting transitions were progressed with increasing F-MWCNT concentration in the PDMS matrix. Scanning electron microscopy and energy dispersive x-ray spectroscopy were carried out to confirm the morphology, functionalization, and uniform dispersion of F-MWCNTs in the polymer matrix. Electrical resistivity at temperature range (100-300°C), dielectric loss (tanδ) and dielectric parameters (epsilon/ epsilon//) were measured in the frequency range (1MHz-3GHz). The measured data simulate that the aforementioned properties were influenced by increasing filler contents in the polymer matrix because of the high polarization of conductive F-MWCNTs at the reinforcement/polymer interface.

  4. Demographic matrix model for informing swallow-wort (Vincetoxicum spp.) biological control

    USDA-ARS?s Scientific Manuscript database

    Demographic matrix modeling of plant populations can be a powerful tool to identify key life stage transitions that contribute the most to population growth of an invasive plant and hence should be targeted for disruption (weak links) by biological control and/or other control tactics. Therefore, t...

  5. Higher order Stark effect and transition probabilities on hyperfine structure components of hydrogen like atoms

    NASA Astrophysics Data System (ADS)

    Pal'Chikov, V. G.

    2000-08-01

    A quantum-electrodynamical (QED) perturbation theory is developed for hydrogen and hydrogen-like atomic systems with interaction between bound electrons and radiative field being treated as the perturbation. The dependence of the perturbed energy of levels on hyperfine structure (hfs) effects and on the higher-order Stark effect is investigated. Numerical results have been obtained for the transition probability between the hfs components of hydrogen-like bismuth.

  6. Counterfactual Assessment of Decoherence in Quantum Systems

    NASA Astrophysics Data System (ADS)

    Russo, Onofrio; Jiang, Liang

    2013-03-01

    Quantum Zeno effect occurs when the system is observed for unusually short observation times, t, where the probability of the transition between different quantum states is known to be proportional to t2. This results in a decrease in the probability of transitions between states and the consequent decrease in decoherence. We consider the conditions in which these observations are made counterfactual to assess whether this results in a significant change in decoherence.

  7. Phase transitions in Nowak Sznajd opinion dynamics

    NASA Astrophysics Data System (ADS)

    Wołoszyn, Maciej; Stauffer, Dietrich; Kułakowski, Krzysztof

    2007-05-01

    The Nowak modification of the Sznajd opinion dynamics model on the square lattice assumes that with probability β the opinions flip due to mass-media advertising from down to up, and vice versa. Besides, with probability α the Sznajd rule applies that a neighbour pair agreeing in its two opinions convinces all its six neighbours of that opinion. Our Monte Carlo simulations and mean-field theory find sharp phase transitions in the parameter space.

  8. False Positive Probabilities for all Kepler Objects of Interest: 1284 Newly Validated Planets and 428 Likely False Positives

    NASA Astrophysics Data System (ADS)

    Morton, Timothy D.; Bryson, Stephen T.; Coughlin, Jeffrey L.; Rowe, Jason F.; Ravichandran, Ganesh; Petigura, Erik A.; Haas, Michael R.; Batalha, Natalie M.

    2016-05-01

    We present astrophysical false positive probability calculations for every Kepler Object of Interest (KOI)—the first large-scale demonstration of a fully automated transiting planet validation procedure. Out of 7056 KOIs, we determine that 1935 have probabilities <1% of being astrophysical false positives, and thus may be considered validated planets. Of these, 1284 have not yet been validated or confirmed by other methods. In addition, we identify 428 KOIs that are likely to be false positives, but have not yet been identified as such, though some of these may be a result of unidentified transit timing variations. A side product of these calculations is full stellar property posterior samplings for every host star, modeled as single, binary, and triple systems. These calculations use vespa, a publicly available Python package that is able to be easily applied to any transiting exoplanet candidate.

  9. Rock-avalanche and ocean-resurge deposits in the late Eocene Chesapeake Bay impact structure: Evidence from the ICDP-USGS Eyreville cores, Virginia, USA

    USGS Publications Warehouse

    Gohn, G.S.; Powars, D.S.; Dypvik, H.; Edwards, L.E.

    2009-01-01

    An unusually thick section of sedimentary breccias dominated by target-sediment clasts is a distinctive feature of the late Eocene Chesapeake Bay impact structure. A cored 1766-m-deep section recovered from the central part of this marine-target structure by the International Continental Scientific Drilling Program (ICDP)-U.S. Geological Survey (USGS) drilling project contains 678 m of these breccias and associated sediments and an intervening 275-m-thick granite slab. Two sedimentary breccia units consist almost entirely of Cretaceous nonmarine sediments derived from the lower part of the target sediment layer. These sediments are present as coherent clasts and as autoclastic matrix between the clasts. Primary (Cretaceous) sedimentary structures are well preserved in some clasts, and liquefaction and fluidization structures produced at the site of deposition occur in the clasts and matrix. These sedimentary breccias are interpreted as one or more rock avalanches from the upper part of the transient-cavity wall. The little-deformed, unshocked granite slab probably was transported as part of an extremely large slide or avalanche. Water-saturated Cretaceous quartz sand below the slab was transported into the seafloor crater prior to, or concurrently with, the granite slab. Two sedimentary breccia units consist of polymict diamictons that contain cobbles, boulders, and blocks of Cretaceous nonmarine target sediments and less common shocked-rock and melt ejecta in an unsorted, unstratified, muddy, fossiliferous, glauconitic quartz matrix. Much of the matrix material was derived from Upper Cretaceous and Paleogene marine target sediments. These units are interpreted as the deposits of debris flows initiated by the resurge of ocean water into the seafloor crater. Interlayering of avalanche and debris-flow units indicates a partial temporal overlap of the earlier avalanche and later resurge processes. A thin unit of stratified turbidite deposits and overlying laminated fine-grained deposits at the top of the section represents the transition to normal shelf sedimentation. ?? 2009 The Geological Society of America.

  10. The use of spatio-temporal correlation to forecast critical transitions

    NASA Astrophysics Data System (ADS)

    Karssenberg, Derek; Bierkens, Marc F. P.

    2010-05-01

    Complex dynamical systems may have critical thresholds at which the system shifts abruptly from one state to another. Such critical transitions have been observed in systems ranging from the human body system to financial markets and the Earth system. Forecasting the timing of critical transitions before they are reached is of paramount importance because critical transitions are associated with a large shift in dynamical regime of the system under consideration. However, it is hard to forecast critical transitions, because the state of the system shows relatively little change before the threshold is reached. Recently, it was shown that increased spatio-temporal autocorrelation and variance can serve as alternative early warning signal for critical transitions. However, thus far these second order statistics have not been used for forecasting in a data assimilation framework. Here we show that the use of spatio-temporal autocorrelation and variance in the state of the system reduces the uncertainty in the predicted timing of critical transitions compared to classical approaches that use the value of the system state only. This is shown by assimilating observed spatio-temporal autocorrelation and variance into a dynamical system model using a Particle Filter. We adapt a well-studied distributed model of a logistically growing resource with a fixed grazing rate. The model describes the transition from an underexploited system with high resource biomass to overexploitation as grazing pressure crosses the critical threshold, which is a fold bifurcation. To represent limited prior information, we use a large variance in the prior probability distributions of model parameters and the system driver (grazing rate). First, we show that the rate of increase in spatio-temporal autocorrelation and variance prior to reaching the critical threshold is relatively consistent across the uncertainty range of the driver and parameter values used. This indicates that an increase in spatio-temporal autocorrelation and variance are consistent predictors of a critical transition, even under the condition of a poorly defined system. Second, we perform data assimilation experiments using an artificial exhaustive data set generated by one realization of the model. To mimic real-world sampling, an observational data set is created from this exhaustive data set. This is done by sampling on a regular spatio-temporal grid, supplemented by sampling locations at a short distance. Spatial and temporal autocorrelation in this observational data set is calculated for different spatial and temporal separation (lag) distances. To assign appropriate weights to observations (here, autocorrelation values and variance) in the Particle Filter, the covariance matrix of the error in these observations is required. This covariance matrix is estimated using Monte Carlo sampling, selecting a different random position of the sampling network relative to the exhaustive data set for each realization. At each update moment in the Particle Filter, observed autocorrelation values are assimilated into the model and the state of the model is updated. Using this approach, it is shown that the use of autocorrelation reduces the uncertainty in the forecasted timing of a critical transition compared to runs without data assimilation. The performance of the use of spatial autocorrelation versus temporal autocorrelation depends on the timing and number of observational data. This study is restricted to a single model only. However, it is becoming increasingly clear that spatio-temporal autocorrelation and variance can be used as early warning signals for a large number of systems. Thus, it is expected that spatio-temporal autocorrelation and variance are valuable in data assimilation frameworks in a large number of dynamical systems.

  11. Critically Evaluated Energy Levels, Spectral Lines, Transition Probabilities, and Intensities of Singly Ionized Vanadium (V II)

    NASA Astrophysics Data System (ADS)

    Saloman, Edward B.; Kramida, Alexander

    2017-08-01

    The energy levels, observed spectral lines, and transition probabilities of singly ionized vanadium, V II, have been compiled. The experimentally derived energy levels belong to the configurations 3d 4, 3d 3 ns (n = 4, 5, 6), 3d 3 np, and 3d 3 nd (n = 4, 5), 3d 34f, 3d 24s 2, and 3d 24s4p. Also included are values for some forbidden lines that may be of interest to the astrophysical community. Experimental Landé g-factors and leading percentages for the levels are included when available, as well as Ritz wavelengths calculated from the energy levels. Wavelengths and transition probabilities are reported for 3568 and 1896 transitions, respectively. From the list of observed wavelengths, 407 energy levels are determined. The observed intensities, normalized to a common scale, are provided. From the newly optimized energy levels, a revised value for the ionization energy is derived, 118,030(60) cm-1, corresponding to 14.634(7) eV. This is 130 cm-1 higher than the previously recommended value from Iglesias et al.

  12. Dynamics of a Landau-Zener non-dissipative system with fluctuating energy levels

    NASA Astrophysics Data System (ADS)

    Fai, L. C.; Diffo, J. T.; Ateuafack, M. E.; Tchoffo, M.; Fouokeng, G. C.

    2014-12-01

    This paper considers a Landau-Zener (two-level) system influenced by a three-dimensional Gaussian and non-Gaussian coloured noise and finds a general form of the time dependent diabatic quantum bit (qubit) flip transition probabilities in the fast, intermediate and slow noise limits. The qubit flip probability is observed to mimic (for low-frequencies noise) that of the standard LZ problem. The qubit flip probability is also observed to be the measure of quantum coherence of states. The transition probability is observed to be tailored by non-Gaussian low-frequency noise and otherwise by Gaussian low-frequency coloured noise. Intermediate and fast noise limits are observed to alter the memory of the system in time and found to improve and control quantum information processing.

  13. Optical character recognition of handwritten Arabic using hidden Markov models

    NASA Astrophysics Data System (ADS)

    Aulama, Mohannad M.; Natsheh, Asem M.; Abandah, Gheith A.; Olama, Mohammed M.

    2011-04-01

    The problem of optical character recognition (OCR) of handwritten Arabic has not received a satisfactory solution yet. In this paper, an Arabic OCR algorithm is developed based on Hidden Markov Models (HMMs) combined with the Viterbi algorithm, which results in an improved and more robust recognition of characters at the sub-word level. Integrating the HMMs represents another step of the overall OCR trends being currently researched in the literature. The proposed approach exploits the structure of characters in the Arabic language in addition to their extracted features to achieve improved recognition rates. Useful statistical information of the Arabic language is initially extracted and then used to estimate the probabilistic parameters of the mathematical HMM. A new custom implementation of the HMM is developed in this study, where the transition matrix is built based on the collected large corpus, and the emission matrix is built based on the results obtained via the extracted character features. The recognition process is triggered using the Viterbi algorithm which employs the most probable sequence of sub-words. The model was implemented to recognize the sub-word unit of Arabic text raising the recognition rate from being linked to the worst recognition rate for any character to the overall structure of the Arabic language. Numerical results show that there is a potentially large recognition improvement by using the proposed algorithms.

  14. Optical character recognition of handwritten Arabic using hidden Markov models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aulama, Mohannad M.; Natsheh, Asem M.; Abandah, Gheith A.

    2011-01-01

    The problem of optical character recognition (OCR) of handwritten Arabic has not received a satisfactory solution yet. In this paper, an Arabic OCR algorithm is developed based on Hidden Markov Models (HMMs) combined with the Viterbi algorithm, which results in an improved and more robust recognition of characters at the sub-word level. Integrating the HMMs represents another step of the overall OCR trends being currently researched in the literature. The proposed approach exploits the structure of characters in the Arabic language in addition to their extracted features to achieve improved recognition rates. Useful statistical information of the Arabic language ismore » initially extracted and then used to estimate the probabilistic parameters of the mathematical HMM. A new custom implementation of the HMM is developed in this study, where the transition matrix is built based on the collected large corpus, and the emission matrix is built based on the results obtained via the extracted character features. The recognition process is triggered using the Viterbi algorithm which employs the most probable sequence of sub-words. The model was implemented to recognize the sub-word unit of Arabic text raising the recognition rate from being linked to the worst recognition rate for any character to the overall structure of the Arabic language. Numerical results show that there is a potentially large recognition improvement by using the proposed algorithms.« less

  15. A computational proposal for designing structured RNA pools for in vitro selection of RNAs.

    PubMed

    Kim, Namhee; Gan, Hin Hark; Schlick, Tamar

    2007-04-01

    Although in vitro selection technology is a versatile experimental tool for discovering novel synthetic RNA molecules, finding complex RNA molecules is difficult because most RNAs identified from random sequence pools are simple motifs, consistent with recent computational analysis of such sequence pools. Thus, enriching in vitro selection pools with complex structures could increase the probability of discovering novel RNAs. Here we develop an approach for engineering sequence pools that links RNA sequence space regions with corresponding structural distributions via a "mixing matrix" approach combined with a graph theory analysis. We define five classes of mixing matrices motivated by covariance mutations in RNA; these constructs define nucleotide transition rates and are applied to chosen starting sequences to yield specific nonrandom pools. We examine the coverage of sequence space as a function of the mixing matrix and starting sequence via clustering analysis. We show that, in contrast to random sequences, which are associated only with a local region of sequence space, our designed pools, including a structured pool for GTP aptamers, can target specific motifs. It follows that experimental synthesis of designed pools can benefit from using optimized starting sequences, mixing matrices, and pool fractions associated with each of our constructed pools as a guide. Automation of our approach could provide practical tools for pool design applications for in vitro selection of RNAs and related problems.

  16. Simulating reservoir lithologies by an actively conditioned Markov chain model

    NASA Astrophysics Data System (ADS)

    Feng, Runhai; Luthi, Stefan M.; Gisolf, Dries

    2018-06-01

    The coupled Markov chain model can be used to simulate reservoir lithologies between wells, by conditioning them on the observed data in the cored wells. However, with this method, only the state at the same depth as the current cell is going to be used for conditioning, which may be a problem if the geological layers are dipping. This will cause the simulated lithological layers to be broken or to become discontinuous across the reservoir. In order to address this problem, an actively conditioned process is proposed here, in which a tolerance angle is predefined. The states contained in the region constrained by the tolerance angle will be employed for conditioning in the horizontal chain first, after which a coupling concept with the vertical chain is implemented. In order to use the same horizontal transition matrix for different future states, the tolerance angle has to be small. This allows the method to work in reservoirs without complex structures caused by depositional processes or tectonic deformations. Directional artefacts in the modeling process are avoided through a careful choice of the simulation path. The tolerance angle and dipping direction of the strata can be obtained from a correlation between wells, or from seismic data, which are available in most hydrocarbon reservoirs, either by interpretation or by inversion that can also assist the construction of a horizontal probability matrix.

  17. System for information discovery

    DOEpatents

    Pennock, Kelly A [Richland, WA; Miller, Nancy E [Kennewick, WA

    2002-11-19

    A sequence of word filters are used to eliminate terms in the database which do not discriminate document content, resulting in a filtered word set and a topic word set whose members are highly predictive of content. These two word sets are then formed into a two dimensional matrix with matrix entries calculated as the conditional probability that a document will contain a word in a row given that it contains the word in a column. The matrix representation allows the resultant vectors to be utilized to interpret document contents.

  18. Dynamical quantum phase transitions in discrete time crystals

    NASA Astrophysics Data System (ADS)

    Kosior, Arkadiusz; Sacha, Krzysztof

    2018-05-01

    Discrete time crystals are related to nonequilibrium dynamics of periodically driven quantum many-body systems where the discrete time-translation symmetry of the Hamiltonian is spontaneously broken into another discrete symmetry. Recently, the concept of phase transitions has been extended to nonequilibrium dynamics of time-independent systems induced by a quantum quench, i.e., a sudden change of some parameter of the Hamiltonian. There, the return probability of a system to the ground state reveals singularities in time which are dubbed dynamical quantum phase transitions. We show that the quantum quench in a discrete time crystal leads to dynamical quantum phase transitions where the return probability of a periodically driven system to a Floquet eigenstate before the quench reveals singularities in time. It indicates that dynamical quantum phase transitions are not restricted to time-independent systems and can be also observed in systems that are periodically driven. We discuss how the phenomenon can be observed in ultracold atomic gases.

  19. Large enhancement of second harmonic generation from transition-metal dichalcogenide monolayer on grating near bound states in the continuum.

    PubMed

    Wang, Tiecheng; Zhang, Shihao

    2018-01-08

    Second harmonic generation from the two-layer structure where a transition-metal dichalcogenide monolayer is put on a one-dimensional grating has been studied. This grating supports bound states in the continuum which have no leakage lying within the continuum of radiation modes, we can enhance the second harmonic generation from the transition-metal dichalcogenide monolayer by more than four orders of magnitude based on the critical field enhancement near the bound states in the continuum. In order to complete this calculation, the scattering matrix theory has been extended to include the nonlinear effect and the scattering matrix of a two-dimensional material including nonlinear terms; furthermore, two methods to observe the bound states in the continuum are considered, where one is tuning the thickness of the grating and the other is changing the incident angle of the electromagnetic wave. We have also discussed various modulation of the second harmonic generation enhancement by adjusting the azimuthal angle of the transition-metal dichalcogenide monolayer.

  20. Effect of the glass transition temperature on alpha-amylase activity in a starch matrix.

    PubMed

    Chaudhary, Vinita; Panyoyai, Naksit; Small, Darryl M; Shanks, Robert A; Kasapis, Stefan

    2017-02-10

    This study optimises a protocol for the estimation of α-amylase activity in a condensed starch matrix in the vicinity of the glass transition region. Enzymatic activity on the vitrified starch system was compared with that of a reference substrate, maltodextrin. The activity was assayed as the rate of release of reducing sugar using a dinitrosalicylic acid procedure. The condensed carbohydrate matrices served the dual purpose of acting as a substrate as well as producing a pronounced effect on the ability to enzymatic hydrolysis. Activation energies were estimated throughout the glass transition region of condensed carbohydrate preparations based on the concept of the spectroscopic shift factor. Results were used to demonstrate a considerable moderation by the mechanical glass transition temperature, beyond the expected linear effect of the temperature dependence, on the reaction rate of starch hydrolysis by α-amylase in comparison with the low-molecular weight chain of maltodextrin. Copyright © 2016. Published by Elsevier Ltd.

  1. Control and instanton trajectories for random transitions in turbulent flows

    NASA Astrophysics Data System (ADS)

    Bouchet, Freddy; Laurie, Jason; Zaboronski, Oleg

    2011-12-01

    Many turbulent systems exhibit random switches between qualitatively different attractors. The transition between these bistable states is often an extremely rare event, that can not be computed through DNS, due to complexity limitations. We present results for the calculation of instanton trajectories (a control problem) between non-equilibrium stationary states (attractors) in the 2D stochastic Navier-Stokes equations. By representing the transition probability between two states using a path integral formulation, we can compute the most probable trajectory (instanton) joining two non-equilibrium stationary states. Technically, this is equivalent to the minimization of an action, which can be related to a fluid mechanics control problem.

  2. Precise calculation of a bond percolation transition and survival rates of nodes in a complex network.

    PubMed

    Kawamoto, Hirokazu; Takayasu, Hideki; Jensen, Henrik Jeldtoft; Takayasu, Misako

    2015-01-01

    Through precise numerical analysis, we reveal a new type of universal loopless percolation transition in randomly removed complex networks. As an example of a real-world network, we apply our analysis to a business relation network consisting of approximately 3,000,000 links among 300,000 firms and observe the transition with critical exponents close to the mean-field values taking into account the finite size effect. We focus on the largest cluster at the critical point, and introduce survival probability as a new measure characterizing the robustness of each node. We also discuss the relation between survival probability and k-shell decomposition.

  3. Matrix Interdiction Problem

    NASA Astrophysics Data System (ADS)

    Kasiviswanathan, Shiva Prasad; Pan, Feng

    In the matrix interdiction problem, a real-valued matrix and an integer k is given. The objective is to remove a set of k matrix columns that minimizes in the residual matrix the sum of the row values, where the value of a row is defined to be the largest entry in that row. This combinatorial problem is closely related to bipartite network interdiction problem that can be applied to minimize the probability that an adversary can successfully smuggle weapons. After introducing the matrix interdiction problem, we study the computational complexity of this problem. We show that the matrix interdiction problem is NP-hard and that there exists a constant γ such that it is even NP-hard to approximate this problem within an n γ additive factor. We also present an algorithm for this problem that achieves an (n - k) multiplicative approximation ratio.

  4. Transitions in Prognostic Awareness Among Terminally Ill Cancer Patients in Their Last 6 Months of Life Examined by Multi-State Markov Modeling.

    PubMed

    Hsiu Chen, Chen; Wen, Fur-Hsing; Hou, Ming-Mo; Hsieh, Chia-Hsun; Chou, Wen-Chi; Chen, Jen-Shi; Chang, Wen-Cheng; Tang, Siew Tzuh

    2017-09-01

    Developing accurate prognostic awareness, a cornerstone of preference-based end-of-life (EOL) care decision-making, is a dynamic process involving more prognostic-awareness states than knowing or not knowing. Understanding the transition probabilities and time spent in each prognostic-awareness state can help clinicians identify trigger points for facilitating transitions toward accurate prognostic awareness. We examined transition probabilities in distinct prognostic-awareness states between consecutive time points in 247 cancer patients' last 6 months and estimated the time spent in each state. Prognostic awareness was categorized into four states: (a) unknown and not wanting to know, state 1; (b) unknown but wanting to know, state 2; (c) inaccurate awareness, state 3; and (d) accurate awareness, state 4. Transitional probabilities were examined by multistate Markov modeling. Initially, 59.5% of patients had accurate prognostic awareness, whereas the probabilities of being in states 1-3 were 8.1%, 17.4%, and 15.0%, respectively. Patients' prognostic awareness generally remained unchanged (probabilities of remaining in the same state: 45.5%-92.9%). If prognostic awareness changed, it tended to shift toward higher prognostic-awareness states (probabilities of shifting to state 4 were 23.2%-36.6% for patients initially in states 1-3, followed by probabilities of shifting to state 3 for those in states 1 and 2 [9.8%-10.1%]). Patients were estimated to spend 1.29, 0.42, 0.68, and 3.61 months in states 1-4, respectively, in their last 6 months. Terminally ill cancer patients' prognostic awareness generally remained unchanged, with a tendency to become more aware of their prognosis. Health care professionals should facilitate patients' transitions toward accurate prognostic awareness in a timely manner to promote preference-based EOL decisions. Terminally ill Taiwanese cancer patients' prognostic awareness generally remained stable, with a tendency toward developing higher states of awareness. Health care professionals should appropriately assess patients' readiness for prognostic information and respect patients' reluctance to confront their poor prognosis if they are not ready to know, but sensitively coach them to cultivate their accurate prognostic awareness, provide desired and understandable prognostic information for those who are ready to know, and give direct and honest prognostic information to clarify any misunderstandings for those with inaccurate awareness, thus ensuring that they develop accurate and realistic prognostic knowledge in time to make end-of-life care decisions. © AlphaMed Press 2017.

  5. Constructing 1/ωα noise from reversible Markov chains

    NASA Astrophysics Data System (ADS)

    Erland, Sveinung; Greenwood, Priscilla E.

    2007-09-01

    This paper gives sufficient conditions for the output of 1/ωα noise from reversible Markov chains on finite state spaces. We construct several examples exhibiting this behavior in a specified range of frequencies. We apply simple representations of the covariance function and the spectral density in terms of the eigendecomposition of the probability transition matrix. The results extend to hidden Markov chains. We generalize the results for aggregations of AR1-processes of C. W. J. Granger [J. Econometrics 14, 227 (1980)]. Given the eigenvalue function, there is a variety of ways to assign values to the states such that the 1/ωα condition is satisfied. We show that a random walk on a certain state space is complementary to the point process model of 1/ω noise of B. Kaulakys and T. Meskauskas [Phys. Rev. E 58, 7013 (1998)]. Passing to a continuous state space, we construct 1/ωα noise which also has a long memory.

  6. Neutrino Photoproduction on the Electron of a Hydrogen-Like Atom

    NASA Astrophysics Data System (ADS)

    Skobelev, V. V.

    2017-10-01

    The process of interaction of a photon with the bound electron of a hydrogen-like atom with creation of a neutrino pair γ +{(Ze)}^{\\ast \\ast}\\to \\overline{νν}+{(Ze)}^{\\ast } is considered here for the first time. This process can take place with and without a change in the energy of the pair relative to the energy of the "initial" photon due to atomic transitions. It is shown that in the case when the system of atoms is located in an equilibrium radiation field with temperature T << m e this process can be neglected in comparison with spontaneous emission of the hydrogen-like atom {(Ze)}^{\\ast}\\to (Ze)+ν\\overline{ν} , despite the smaller power of the expansion parameter ( Zα) < < 1, α = e 2/ ℏc ≈ 1/137 in the expressions for the cross sections and probabilities. Calculations have been performed for the first time using the density matrix, introduced in the previous paper, of the electron in the field of the nucleus in the leading approximation in (Zα).

  7. Linear combination of atomic orbitals calculation of the Auger neutralization rate of He{sup +} on Al(111) (100), and (110) surfaces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valdes, Diego; Blanco, J.M.; Monreal, R.C.

    2005-06-15

    We develop a theory of the Auger neutralization rate of ions on solid surfaces in which the matrix elements for the transition are calculated by means of a linear combination of atomic orbitals technique. We apply the theory to the calculation of the Auger rate of He{sup +} on unreconstructed Al(111) (100), and (110) surfaces, assuming He{sup +} to approach these surfaces on high symmetry positions and compare them with the results of the jellium model. Although there are substantial differences between the Auger rates calculated with both kinds of approaches, those differences tend to compensate when evaluating the integralmore » along the ion trajectory and, consequently, are of minor influence in some physical magnitudes like the ion survival probability for perpendicular energies larger than 100 eV. We find that many atoms contribute to the Auger process and small effects of lateral corrugation are registered.« less

  8. The role of community structure on the nature of explosive synchronization.

    PubMed

    Lotfi, Nastaran; Rodrigues, Francisco A; Darooneh, Amir Hossein

    2018-03-01

    In this paper, we analyze explosive synchronization in networks with a community structure. The results of our study indicate that the mesoscopic structure of the networks could affect the synchronization of coupled oscillators. With the variation of three parameters, the degree probability distribution exponent, the community size probability distribution exponent, and the mixing parameter, we could have a fast or slow phase transition. Besides, in some cases, we could have communities which are synchronized inside but not with other communities and vice versa. We also show that there is a limit in these mesoscopic structures which suppresses the transition from the second-order phase transition and results in explosive synchronization. This could be considered as a tuning parameter changing the transition of the system from the second order to the first order.

  9. Recurrence of random walks with long-range steps generated by fractional Laplacian matrices on regular networks and simple cubic lattices

    NASA Astrophysics Data System (ADS)

    Michelitsch, T. M.; Collet, B. A.; Riascos, A. P.; Nowakowski, A. F.; Nicolleau, F. C. G. A.

    2017-12-01

    We analyze a Markovian random walk strategy on undirected regular networks involving power matrix functions of the type L\\frac{α{2}} where L indicates a ‘simple’ Laplacian matrix. We refer to such walks as ‘fractional random walks’ with admissible interval 0<α ≤slant 2 . We deduce probability-generating functions (network Green’s functions) for the fractional random walk. From these analytical results we establish a generalization of Polya’s recurrence theorem for fractional random walks on d-dimensional infinite lattices: The fractional random walk is transient for dimensions d > α (recurrent for d≤slantα ) of the lattice. As a consequence, for 0<α< 1 the fractional random walk is transient for all lattice dimensions d=1, 2, .. and in the range 1≤slantα < 2 for dimensions d≥slant 2 . Finally, for α=2 , Polya’s classical recurrence theorem is recovered, namely the walk is transient only for lattice dimensions d≥slant 3 . The generalization of Polya’s recurrence theorem remains valid for the class of random walks with Lévy flight asymptotics for long-range steps. We also analyze the mean first passage probabilities, mean residence times, mean first passage times and global mean first passage times (Kemeny constant) for the fractional random walk. For an infinite 1D lattice (infinite ring) we obtain for the transient regime 0<α<1 closed form expressions for the fractional lattice Green’s function matrix containing the escape and ever passage probabilities. The ever passage probabilities (fractional lattice Green’s functions) in the transient regime fulfil Riesz potential power law decay asymptotic behavior for nodes far from the departure node. The non-locality of the fractional random walk is generated by the non-diagonality of the fractional Laplacian matrix with Lévy-type heavy tailed inverse power law decay for the probability of long-range moves. This non-local and asymptotic behavior of the fractional random walk introduces small-world properties with the emergence of Lévy flights on large (infinite) lattices.

  10. Epoxy matrix with triaromatic mesogenic unit in dielectric spectroscopy observation

    NASA Astrophysics Data System (ADS)

    Włodarska, Magdalena; Mossety-Leszczak, Beata; Bąk, Grzegorz W.; Kisiel, Maciej; Dłużniewski, Maciej; Okrasa, Lidia

    2018-04-01

    This paper describes the dielectric response of a selected liquid crystal epoxy monomer (plain and in curing systems) in a wide range of frequency and temperature. The dielectric spectroscopy, thanks to its sensitivity, is a very good tool for studying phase transitions, reaction progress, or material properties. This sensitivity is important in the case of liquid crystal epoxy resins, where properties of the final network depend on the choice of monomers, curing agents, curing conditions and post-curing treatment, or applying an external electric or magnetic field during the reaction. In most of the obtained cured products, the collected dielectric data show two relaxation processes. The α-process is related to a structural reorientation; it can usually be linked with the glass transition and the mechanical properties of the material. The β-process can be identified as a molecular motion process, probably associated with the carboxyl groups in the mesogen. A transient Maxwell-Wagner relaxation observed in one of the compositions after the initial curing is removed by post-curing treatment at elevated temperatures. Post-curing is therefore necessary for obtaining uniformly cured products in those cases. In the investigated systems, the choice of a curing agent can change the glass transition temperature by at least 70 °C. The obtained results are in a good agreement with an earlier study employing other techniques. Finally, we assess the influence of the direction of mesogen alignment on the dielectric properties of one selected system, where a global order was induced by applying an external magnetic field in the course of curing.

  11. Demographic responses of Pinguicula ionantha to prescribed fire: a regression-design LTRE approach.

    PubMed

    Kesler, Herbert C; Trusty, Jennifer L; Hermann, Sharon M; Guyer, Craig

    2008-06-01

    This study describes the use of periodic matrix analysis and regression-design life table response experiments (LTRE) to investigate the effects of prescribed fire on demographic responses of Pinguicula ionantha, a federally listed plant endemic to the herb bog/savanna community in north Florida. Multi-state mark-recapture models with dead recoveries were used to estimate survival and transition probabilities for over 2,300 individuals in 12 populations of P. ionantha. These estimates were applied to parameterize matrix models used in further analyses. P. ionantha demographics were found to be strongly dependent on prescribed fire events. Periodic matrix models were used to evaluate season of burn (either growing or dormant season) for fire return intervals ranging from 1 to 20 years. Annual growing and biannual dormant season fires maximized population growth rates for this species. A regression design LTRE was used to evaluate the effect of number of days since last fire on population growth. Maximum population growth rates calculated using standard asymptotic analysis were realized shortly following a burn event (<2 years), and a regression design LTRE showed that short-term fire-mediated changes in vital rates translated into observed increases in population growth. The LTRE identified fecundity and individual growth as contributing most to increases in post-fire population growth. Our analyses found that the current four-year prescribed fire return intervals used at the study sites can be significantly shortened to increase the population growth rates of this rare species. Understanding the role of fire frequency and season in creating and maintaining appropriate habitat for this species may aid in the conservation of this and other rare herb bog/savanna inhabitants.

  12. An Upper Bound on High Speed Satellite Collision Probability When Only One Object has Position Uncertainty Information

    NASA Technical Reports Server (NTRS)

    Frisbee, Joseph H., Jr.

    2015-01-01

    Upper bounds on high speed satellite collision probability, PC †, have been investigated. Previous methods assume an individual position error covariance matrix is available for each object. The two matrices being combined into a single, relative position error covariance matrix. Components of the combined error covariance are then varied to obtain a maximum PC. If error covariance information for only one of the two objects was available, either some default shape has been used or nothing could be done. An alternative is presented that uses the known covariance information along with a critical value of the missing covariance to obtain an approximate but potentially useful Pc upper bound.

  13. Elastic K-means using posterior probability.

    PubMed

    Zheng, Aihua; Jiang, Bo; Li, Yan; Zhang, Xuehan; Ding, Chris

    2017-01-01

    The widely used K-means clustering is a hard clustering algorithm. Here we propose a Elastic K-means clustering model (EKM) using posterior probability with soft capability where each data point can belong to multiple clusters fractionally and show the benefit of proposed Elastic K-means. Furthermore, in many applications, besides vector attributes information, pairwise relations (graph information) are also available. Thus we integrate EKM with Normalized Cut graph clustering into a single clustering formulation. Finally, we provide several useful matrix inequalities which are useful for matrix formulations of learning models. Based on these results, we prove the correctness and the convergence of EKM algorithms. Experimental results on six benchmark datasets demonstrate the effectiveness of proposed EKM and its integrated model.

  14. Estimating state-transition probabilities for unobservable states using capture-recapture/resighting data

    USGS Publications Warehouse

    Kendall, W.L.; Nichols, J.D.

    2002-01-01

    Temporary emigration was identified some time ago as causing potential problems in capture-recapture studies, and in the last five years approaches have been developed for dealing with special cases of this general problem. Temporary emigration can be viewed more generally as involving transitions to and from an unobservable state, and frequently the state itself is one of biological interest (e.g., 'nonbreeder'). Development of models that permit estimation of relevant parameters in the presence of an unobservable state requires either extra information (e.g., as supplied by Pollock's robust design) or the following classes of model constraints: reducing the order of Markovian transition probabilities, imposing a degree of determinism on transition probabilities, removing state specificity of survival probabilities, and imposing temporal constancy of parameters. The objective of the work described in this paper is to investigate estimability of model parameters under a variety of models that include an unobservable state. Beginning with a very general model and no extra information, we used numerical methods to systematically investigate the use of ancillary information and constraints to yield models that are useful for estimation. The result is a catalog of models for which estimation is possible. An example analysis of sea turtle capture-recapture data under two different models showed similar point estimates but increased precision for the model that incorporated ancillary data (the robust design) when compared to the model with deterministic transitions only. This comparison and the results of our numerical investigation of model structures lead to design suggestions for capture-recapture studies in the presence of an unobservable state.

  15. Hyperfine induced transition probabilities from 4{f}^{14}5s5p{}^{3}{{\\rm{P}}}_{0,2}^{o} states in Sm-like ions

    NASA Astrophysics Data System (ADS)

    Zhou, Fuyang; Li, Jiguang; Qu, Yizhi; Wang, Jianguo

    2017-11-01

    The hyperfine induced 4{f}145s5p{}3{{{P}}}0,2o-4{f}145{s}2{}1{{{S}}}0 transition probabilities for highly charged Sm-like ions are calculated within the framework of the multiconfiguration Dirac-Hartree-Fock method. Electron correlation, the Breit interaction and quantum electrodynamical effects are taken into account. For ions ranging from Z = 79 to Z=94,4{f}145s5p{}3{{{P}}}0o is the first excited state, and the hyperfine induced transition (HIT) is a dominant decay channel. For the 4{f}145s5p{}3{{{P}}}2o state, the HIT rates of Sm-like ions with Z=82-94 are reported as well as the magnetic dipole (M1) {}3{{{P}}}2o-{}3{{{P}}}1o, the electric quadrupole (E2) {}3{{{P}}}2o-{}3{{{P}}}0,1o, and the magnetic quadrupole (M2) {}3{{{P}}}2o-{}1{{{S}}}0 transition probabilities. It is found that M1 transition from the 4{f}145s5p{}3{{{P}}}2o state is the most important decay channel in this range on Z≥slant 82.

  16. Perceived Treatment Need and Latent Transitions in Heroin and Methamphetamine Polydrug Use among People who Inject Drugs in Tijuana, Mexico.

    PubMed

    Meacham, Meredith C; Roesch, Scott C; Strathdee, Steffanie A; Gaines, Tommi L

    2018-01-01

    People who inject drugs (PWID) in Tijuana, Mexico, use heroin and/or methamphetamine. While polydrug use is associated with HIV risk behavior, less is known about the stability of polydrug use patterns over time and how polydrug use is related to perceived treatment need. Within a cohort of PWID in Tijuana (N = 735) we sought to (1) characterize subgroups of polydrug and polyroute use from baseline to six months; (2) determine the probabilities of transitioning between subgroups; and (3) examine whether self-reported need for help for drug use modified these transition probabilities. Latent transition analysis (LTA) identified four latent statuses: heroin-only injection (38% at both baseline and follow-up); co-injection of heroin with methamphetamine (3% baseline, 15% follow-up); injection of heroin and methamphetamine (37% baseline, 32% follow-up); and polydrug and polyroute users who injected heroin and both smoked and injected methamphetamine (22% baseline, 14% follow-up). Heroin-only injectors had the highest probability of remaining in the same latent status at follow-up. The majority reported great or urgent need for treatment (51%) and these PWID had greater odds of transitioning to a higher-risk status at follow-up, emphasizing the need for evidence-based drug treatment options for PWID.

  17. Continuum ionization transition probabilities of atomic oxygen

    NASA Technical Reports Server (NTRS)

    Samson, J. A. R.; Petrosky, V. E.

    1974-01-01

    The technique of photoelectron spectroscopy was employed in the investigation. Atomic oxygen was produced in a microwave discharge operating at a power of 40 W and at a pressure of approximately 20 mtorr. The photoelectron spectrum of the oxygen with and without the discharge is shown. The atomic states can be clearly seen. In connection with the measurement of the probability for transitions into the various ionic states, the analyzer collection efficiency was determined as a function of electron energy.

  18. A Multi-Armed Bandit Approach to Following a Markov Chain

    DTIC Science & Technology

    2017-06-01

    focus on the House to Café transition (p1,4). We develop a Multi-Armed Bandit approach for efficiently following this target, where each state takes the...and longitude (each state corresponding to a physical location and a small set of activities). The searcher would then apply our approach on this...the target’s transition probability and the true probability over time. Further, we seek to provide upper bounds (i.e., worst case bounds) on the

  19. Microscopic and histochemical manifestations of hyaline cartilage dynamics.

    PubMed

    Malinin, G I; Malinin, T I

    1999-01-01

    Structure and function of hyaline cartilages has been the focus of many correlative studies for over a hundred years. Much of what is known regarding dynamics and function of cartilage constituents has been derived or inferred from biochemical and electron microscopic investigations. Here we show that in conjunction with ultrastructural, and high-magnification transmission light and polarization microscopy, the well-developed histochemical methods are indispensable for the analysis of cartilage dynamics. Microscopically demonstrable aspects of cartilage dynamics include, but are not limited to, formation of the intracellular liquid crystals, phase transitions of the extracellular matrix and tubular connections between chondrocytes. The role of the interchondrocytic liquid crystals is considered in terms of the tensegrity hypothesis and non-apoptotic cell death. Phase transitions of the extracellular matrix are discussed in terms of self-alignment of chondrons, matrix guidance pathways and cartilage growth in the absence of mitosis. The possible role of nonenzymatic glycation reactions in cartilage dynamics is also reviewed.

  20. Complex Langevin simulation of a random matrix model at nonzero chemical potential

    NASA Astrophysics Data System (ADS)

    Bloch, J.; Glesaaen, J.; Verbaarschot, J. J. M.; Zafeiropoulos, S.

    2018-03-01

    In this paper we test the complex Langevin algorithm for numerical simulations of a random matrix model of QCD with a first order phase transition to a phase of finite baryon density. We observe that a naive implementation of the algorithm leads to phase quenched results, which were also derived analytically in this article. We test several fixes for the convergence issues of the algorithm, in particular the method of gauge cooling, the shifted representation, the deformation technique and reweighted complex Langevin, but only the latter method reproduces the correct analytical results in the region where the quark mass is inside the domain of the eigenvalues. In order to shed more light on the issues of the methods we also apply them to a similar random matrix model with a milder sign problem and no phase transition, and in that case gauge cooling solves the convergence problems as was shown before in the literature.

  1. Microscopic Chain Motion in Polymer Nanocomposites with Dynamically Asymmetric Interphases

    PubMed Central

    Senses, Erkan; Faraone, Antonio; Akcora, Pinar

    2016-01-01

    Dynamics of the interphase region between matrix and bound polymers on nanoparticles is important to understand the macroscopic rheological properties of nanocomposites. Here, we present neutron scattering investigations on nanocomposites with dynamically asymmetric interphases formed by a high-glass transition temperature polymer, poly(methyl methacrylate), adsorbed on nanoparticles and a low-glass transition temperature miscible matrix, poly(ethylene oxide). By taking advantage of selective isotope labeling of the chains, we studied the role of interfacial polymer on segmental and collective dynamics of the matrix chains from subnanoseconds to 100 nanoseconds. Our results show that the Rouse relaxation remains unchanged in a weakly attractive composite system while the dynamics significantly slows down in a strongly attractive composite. More importantly, the chains disentangle with a remarkable increase of the reptation tube size when the bound polymer is vitreous. The glassy and rubbery states of the bound polymer as temperature changes underpin the macroscopic stiffening of nanocomposites. PMID:27457056

  2. Transit visibility zones of the Solar system planets

    NASA Astrophysics Data System (ADS)

    Wells, R.; Poppenhaeger, K.; Watson, C. A.; Heller, R.

    2018-01-01

    The detection of thousands of extrasolar planets by the transit method naturally raises the question of whether potential extrasolar observers could detect the transits of the Solar system planets. We present a comprehensive analysis of the regions in the sky from where transit events of the Solar system planets can be detected. We specify how many different Solar system planets can be observed from any given point in the sky, and find the maximum number to be three. We report the probabilities of a randomly positioned external observer to be able to observe single and multiple Solar system planet transits; specifically, we find a probability of 2.518 per cent to be able to observe at least one transiting planet, 0.229 per cent for at least two transiting planets, and 0.027 per cent for three transiting planets. We identify 68 known exoplanets that have a favourable geometric perspective to allow transit detections in the Solar system and we show how the ongoing K2 mission will extend this list. We use occurrence rates of exoplanets to estimate that there are 3.2 ± 1.2 and 6.6^{+1.3}_{-0.8} temperate Earth-sized planets orbiting GK and M dwarf stars brighter than V = 13 and 16, respectively, that are located in the Earth's transit zone.

  3. Pre-release biological control agent recommendations for swallow-wort (Vincetoxicum spp.) informed by demographic matrix models

    USDA-ARS?s Scientific Manuscript database

    Weed biological control workers have advocated for the advance assessment of agent efficacy in order to minimize the release of host-specific but ineffective agents. One method involves demographic matrix modeling of target weed populations in order to identify plant life stage transitions that cont...

  4. Phase Diagram of Planar Matrix Quantum Mechanics, Tensor, and Sachdev-Ye-Kitaev Models.

    PubMed

    Azeyanagi, Tatsuo; Ferrari, Frank; Massolo, Fidel I Schaposnik

    2018-02-09

    We study the Schwinger-Dyson equations of a fermionic planar matrix quantum mechanics [or tensor and Sachdev-Ye-Kitaev (SYK) models] at leading melonic order. We find two solutions describing a high entropy, SYK black-hole-like phase and a low entropy one with trivial IR behavior. There is a line of first order phase transitions that terminates at a new critical point. Critical exponents are nonmean field and differ on the two sides of the transition. Interesting phenomena are also found in unstable and stable bosonic models, including Kazakov critical points and inconsistency of SYK-like solutions of the IR limit.

  5. Quantifying Complexity in Quantum Phase Transitions via Mutual Information Complex Networks

    NASA Astrophysics Data System (ADS)

    Valdez, Marc Andrew; Jaschke, Daniel; Vargas, David L.; Carr, Lincoln D.

    2017-12-01

    We quantify the emergent complexity of quantum states near quantum critical points on regular 1D lattices, via complex network measures based on quantum mutual information as the adjacency matrix, in direct analogy to quantifying the complexity of electroencephalogram or functional magnetic resonance imaging measurements of the brain. Using matrix product state methods, we show that network density, clustering, disparity, and Pearson's correlation obtain the critical point for both quantum Ising and Bose-Hubbard models to a high degree of accuracy in finite-size scaling for three classes of quantum phase transitions, Z2, mean field superfluid to Mott insulator, and a Berzinskii-Kosterlitz-Thouless crossover.

  6. A Numerical Scheme for Ordinary Differential Equations Having Time Varying and Nonlinear Coefficients Based on the State Transition Matrix

    NASA Technical Reports Server (NTRS)

    Bartels, Robert E.

    2002-01-01

    A variable order method of integrating initial value ordinary differential equations that is based on the state transition matrix has been developed. The method has been evaluated for linear time variant and nonlinear systems of equations. While it is more complex than most other methods, it produces exact solutions at arbitrary time step size when the time variation of the system can be modeled exactly by a polynomial. Solutions to several nonlinear problems exhibiting chaotic behavior have been computed. Accuracy of the method has been demonstrated by comparison with an exact solution and with solutions obtained by established methods.

  7. Open-Ended Recursive Approach for the Calculation of Multiphoton Absorption Matrix Elements

    PubMed Central

    2015-01-01

    We present an implementation of single residues for response functions to arbitrary order using a recursive approach. Explicit expressions in terms of density-matrix-based response theory for the single residues of the linear, quadratic, cubic, and quartic response functions are also presented. These residues correspond to one-, two-, three- and four-photon transition matrix elements. The newly developed code is used to calculate the one-, two-, three- and four-photon absorption cross sections of para-nitroaniline and para-nitroaminostilbene, making this the first treatment of four-photon absorption in the framework of response theory. We find that the calculated multiphoton absorption cross sections are not very sensitive to the size of the basis set as long as a reasonably large basis set with diffuse functions is used. The choice of exchange–correlation functional, however, significantly affects the calculated cross sections of both charge-transfer transitions and other transitions, in particular, for the larger para-nitroaminostilbene molecule. We therefore recommend the use of a range-separated exchange–correlation functional in combination with the augmented correlation-consistent double-ζ basis set aug-cc-pVDZ for the calculation of multiphoton absorption properties. PMID:25821415

  8. Bayesian block-diagonal variable selection and model averaging

    PubMed Central

    Papaspiliopoulos, O.; Rossell, D.

    2018-01-01

    Summary We propose a scalable algorithmic framework for exact Bayesian variable selection and model averaging in linear models under the assumption that the Gram matrix is block-diagonal, and as a heuristic for exploring the model space for general designs. In block-diagonal designs our approach returns the most probable model of any given size without resorting to numerical integration. The algorithm also provides a novel and efficient solution to the frequentist best subset selection problem for block-diagonal designs. Posterior probabilities for any number of models are obtained by evaluating a single one-dimensional integral, and other quantities of interest such as variable inclusion probabilities and model-averaged regression estimates are obtained by an adaptive, deterministic one-dimensional numerical integration. The overall computational cost scales linearly with the number of blocks, which can be processed in parallel, and exponentially with the block size, rendering it most adequate in situations where predictors are organized in many moderately-sized blocks. For general designs, we approximate the Gram matrix by a block-diagonal matrix using spectral clustering and propose an iterative algorithm that capitalizes on the block-diagonal algorithms to explore efficiently the model space. All methods proposed in this paper are implemented in the R library mombf. PMID:29861501

  9. Respiratory uncoupling by increased H(+) or K(+) flux is beneficial for heart mitochondrial turnover of reactive oxygen species but not for permeability transition.

    PubMed

    Morota, Saori; Piel, Sarah; Hansson, Magnus J

    2013-09-22

    Ischemic preconditioning has been proposed to involve changes in mitochondrial H(+) and K(+) fluxes, in particular through activation of uncoupling proteins and ATP-sensitive K(+) channels (MitoKATP). The objectives of the present study were to explore how increased H(+) and K(+) fluxes influence heart mitochondrial physiology with regard to production and scavenging of reactive oxygen species (ROS), volume changes and resistance to calcium-induced mitochondrial permeability transition (mPT). Isolated rat heart mitochondria were exposed to a wide concentration range of the protonophore CCCP or the potassium ionophore valinomycin to induce increased H(+) and K(+) conductance, respectively. Simultaneous monitoring of mitochondrial respiration and calcium retention capacity (CRC) demonstrated that the relative increase in respiration caused by valinomycin or CCCP correlated with a decrease in CRC, and that no level of respiratory uncoupling was associated with enhanced resistance to mPT. Mitochondria suspended in hyperosmolar buffer demonstrated a dose-dependent reduction in CRC with increasing osmolarity. However, mitochondria in hypoosmolar buffer to increase matrix volume did not display increased CRC. ROS generation was reduced by both K(+)- and H(+)-mediated respiratory uncoupling. The ability of heart mitochondria to detoxify H2O2 was substantially greater than the production rate. The H2O2 detoxification was dependent on respiratory substrates and was dramatically decreased following calcium-induced mPT, but was unaffected by uncoupling via increased K(+) and H(+) conductance. It is concluded that respiratory uncoupling is not directly beneficial to rat heart mitochondrial resistance to calcium overload irrespective of whether H(+) or K(+) conductance is increased. The negative effects of respiratory uncoupling thus probably outweigh the reduction in ROS generation and a potential positive effect by increased matrix volume, resulting in a net sensitization of heart mitochondria to mPT activation.

  10. Isospin symmetry of Tz =±3/2→±1/2 Gamow-Teller transitions in A=41 nuclei

    NASA Astrophysics Data System (ADS)

    Fujita, Y.; Shimbara, Y.; Adachi, T.; Berg, G. P.; Brown, B. A.; Fujita, H.; Hatanaka, K.; Kamiya, J.; Nakanishi, K.; Sakemi, Y.; Sasaki, S.; Shimizu, Y.; Tameshige, Y.; Uchida, M.; Wakasa, T.; Yosoi, M.

    2004-11-01

    Under the assumption that isospin T is a good quantum number, isobaric analog states and various analogous transitions are expected in isobars with mass number A . The strengths of Tz =±3/2→±1/2 analogous Gamow-Teller (GT) transitions and analogous M1 transitions within the A=41 isobar quartet are compared in detail. The Tz =+3/2→+1/2 GT transitions from the Jπ = 3/2+ ground state of 41K leading to excited Jπ = 1/2+ , 3/2+ , and 5/2+ states in 41Ca were measured using the ( 3He ,t) charge-exchange reaction. With a high energy resolution of 35 keV , many fragmented states were observed, and the GT strength distribution was determined up to 10 MeV excitation energy ( Ex ) . The main part of the strength was concentrated in the Ex =4 6 MeV region. A shell-model calculation could reproduce the concentration, but not so well details of the strength distribution. The obtained distribution was further compared with two results of 41Ti β decay studying the analogous Tz =-3/2→-1/2 GT strengths. They reported contradicting distributions. One-to-one correspondences of analogous transitions and analog states were assigned up to Ex =6 MeV in the comparison with one of these 41Ti β -decay results. Combining the spectroscopic information of the analog states in 41Ca and 41Sc , the most probable Jπ values were deduced for each pair of analog states. It was found that 5/2+ states carry the main part of the observed GT strength, while much less GT strength was carried by 1/2+ and 3/2+ states. The gross features of the GT strength distributions for each J were similar for the isospin analogous Tz =±3/2→±1/2 transitions, but the details were somewhat different. From the difference of the distributions, isospin-asymmetry matrix elements of ≈8 keV were deduced. The Coulomb displacement energy, which is sensitive to the configuration of states, showed a sudden increase of about 50 keV at the excitation energy of 3.8 MeV . The strengths of several M1 transitions to the IAS in 41Ca were compared with the strengths of analogous GT transitions. It was found that ratios of the M1 and GT transition strengths were similar, suggesting that the contributions of the ℓτ term in M1 transitions are small.

  11. Theory of rotational transition in atom-diatom chemical reaction

    NASA Astrophysics Data System (ADS)

    Nakamura, Masato; Nakamura, Hiroki

    1989-05-01

    Rotational transition in atom-diatom chemical reaction is theoretically studied. A new approximate theory (which we call IOS-DW approximation) is proposed on the basis of the physical idea that rotational transition in reaction is induced by the following two different mechanisms: rotationally inelastic half collision in both initial and final arrangement channels, and coordinate transformation in the reaction zone. This theory gives a fairy compact expression for the state-to-state transition probability. Introducing the additional physically reasonable assumption that reaction (particle rearrangement) takes place in a spatially localized region, we have reduced this expression into a simpler analytical form which can explicitly give overall rotational state distribution in reaction. Numerical application was made to the H+H2 reaction and demonstrated its effectiveness for the simplicity. A further simplified most naive approximation, i.e., independent events approximation was also proposed and demonstrated to work well in the test calculation of H+H2. The overall rotational state distribution is expressed simply by a product sum of the transition probabilities for the three consecutive processes in reaction: inelastic transition in the initial half collision, transition due to particle rearrangement, and inelastic transition in the final half collision.

  12. Characterization and N-terminal sequencing of a calcium binding protein from the calcareous concretion organic matrix of the terrestrial crustacean Orchestia cavimana.

    PubMed

    Luquet, G; Testenière, O; Graf, F

    1996-04-16

    We extracted proteins from the organic matrix of calcareous concretions, which represents the calcium storage form in a terrestrial crustacean. Electrophoretic analyses of water-soluble organic-matrix proteinaceous components revealed 11 polypeptides, 6 of which are probably glycosylated. Among the unglycosylated proteins, we characterized a 23 kDa polypeptide, with an isoelectric point of 5.5, which is able to bind calcium. Its N-terminal sequence is rich in acidic amino acids (essentially aspartic acid). All these characteristics suggest its involvement in the calcium precipitation process within the successive layers of the organic matrix.

  13. Empirical models of transitions between coral reef states: effects of region, protection, and environmental change.

    PubMed

    Lowe, Phillip K; Bruno, John F; Selig, Elizabeth R; Spencer, Matthew

    2011-01-01

    There has been substantial recent change in coral reef communities. To date, most analyses have focussed on static patterns or changes in single variables such as coral cover. However, little is known about how community-level changes occur at large spatial scales. Here, we develop Markov models of annual changes in coral and macroalgal cover in the Caribbean and Great Barrier Reef (GBR) regions. We analyzed reef surveys from the Caribbean and GBR (1996-2006). We defined a set of reef states distinguished by coral and macroalgal cover, and obtained Bayesian estimates of the annual probabilities of transitions between these states. The Caribbean and GBR had different transition probabilities, and therefore different rates of change in reef condition. This could be due to differences in species composition, management or the nature and extent of disturbances between these regions. We then estimated equilibrium probability distributions for reef states, and coral and macroalgal cover under constant environmental conditions. In both regions, the current distributions are close to equilibrium. In the Caribbean, coral cover is much lower and macroalgal cover is higher at equilibrium than in the GBR. We found no evidence for differences in transition probabilities between the first and second halves of our survey period, or between Caribbean reefs inside and outside marine protected areas. However, our power to detect such differences may have been low. We also examined the effects of altering transition probabilities on the community state equilibrium, along a continuum from unfavourable (e.g., increased sea surface temperature) to favourable (e.g., improved management) conditions. Both regions showed similar qualitative responses, but different patterns of uncertainty. In the Caribbean, uncertainty was greatest about effects of favourable changes, while in the GBR, we are most uncertain about effects of unfavourable changes. Our approach could be extended to provide risk analysis for management decisions.

  14. Spectroscopic parameters, vibrational levels, transition dipole moments and transition probabilities of the 9 low-lying states of the NCl+ cation

    NASA Astrophysics Data System (ADS)

    Yin, Yuan; Shi, Deheng; Sun, Jinfeng; Zhu, Zunlue

    2018-03-01

    This work calculates the potential energy curves of 9 Λ-S and 28 Ω states of the NCl+ cation. The technique employed is the complete active space self-consistent field method, which is followed by the internally contracted multireference configuration interaction approach with the Davidson correction. The Λ-S states are X2Π, 12Σ+, 14Π, 14Σ+, 14Σ-, 24Π, 14Δ, 16Σ+, and 16Π, which are yielded from the first two dissociation channels of NCl+ cation. The Ω states are generated from these Λ-S states. The 14Π, 14Δ, 16Σ+, and 16Π states are inverted with the spin-orbit coupling effect included. The 14Σ+, 16Σ+, and 16Π states are very weakly bound, whose well depths are only several-hundred cm- 1. One avoided crossing of PECs occurs between the 12Σ+ and 22Σ+ states. To improve the quality of potential energy curves, core-valence correlation and scalar relativistic corrections are included. The potential energies are extrapolated to the complete basis set limit. The spectroscopic parameters and vibrational levels are calculated. The transition dipole moments are computed. The Franck-Condon factors, Einstein coefficients, and radiative lifetimes of many transitions are determined. The spectroscopic approaches are proposed for observing these states according to the transition probabilities. The spin-orbit coupling effect on the spectroscopic and vibrational properties is evaluated. The spectroscopic parameters, vibrational levels, transition dipole moments, as well as transition probabilities reported in this paper could be considered to be very reliable.

  15. Simple expression for the quantum Fisher information matrix

    NASA Astrophysics Data System (ADS)

    Šafránek, Dominik

    2018-04-01

    Quantum Fisher information matrix (QFIM) is a cornerstone of modern quantum metrology and quantum information geometry. Apart from optimal estimation, it finds applications in description of quantum speed limits, quantum criticality, quantum phase transitions, coherence, entanglement, and irreversibility. We derive a surprisingly simple formula for this quantity, which, unlike previously known general expression, does not require diagonalization of the density matrix, and is provably at least as efficient. With a minor modification, this formula can be used to compute QFIM for any finite-dimensional density matrix. Because of its simplicity, it could also shed more light on the quantum information geometry in general.

  16. Identifying critical life stage transitions for biological control of long-lived perennial Vincetoxicum species

    USDA-ARS?s Scientific Manuscript database

    Demographic matrix modeling of invasive plant populations can be a powerful tool to identify key life stage transitions for targeted disruption in order to cause population decline. This approach can provide quantitative estimates of reductions in select vital rates needed to reduce population growt...

  17. Approximating Multivariate Normal Orthant Probabilities. ONR Technical Report. [Biometric Lab Report No. 90-1.

    ERIC Educational Resources Information Center

    Gibbons, Robert D.; And Others

    The probability integral of the multivariate normal distribution (ND) has received considerable attention since W. F. Sheppard's (1900) and K. Pearson's (1901) seminal work on the bivariate ND. This paper evaluates the formula that represents the "n x n" correlation matrix of the "chi(sub i)" and the standardized multivariate…

  18. TEM study of {beta} Prime precipitate interaction mechanisms with dislocations and {beta} Prime interfaces with the aluminium matrix in Al-Mg-Si alloys

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Teichmann, Katharina; Marioara, Calin D.; Andersen, Sigmund J.

    The interaction mechanisms between dislocations and semi-coherent, needle-shaped {beta} Prime precipitates in Al-Mg-Si alloys have been studied by High Resolution Transmission Electron Microscopy (HRTEM). Dislocation loops appearing as broad contrast rings around the precipitate cross-sections were identified in the Al matrix. A size dependency of the interaction mechanism was observed; the precipitates were sheared when the longest dimension of their cross-section was shorter than approximately 15 nm, and looped otherwise. A more narrow ring located between the Al matrix and bulk {beta} Prime indicates the presence of a transition interface layer. Together with the bulk {beta} Prime structure, this wasmore » further investigated by High Angle Annular Dark Field Scanning TEM (HAADF-STEM). In the bulk {beta} Prime a higher intensity could be correlated with a third of the Si-columns, as predicted from the published structure. The transition layer incorporates Si columns in the same arrangement as in bulk {beta} Prime , although it is structurally distinct from it. The Z-contrast information and arrangement of these Si-columns demonstrate that they are an extension of the Si-network known to structurally connect all the precipitate phases in the Al-Mg-Si(-Cu) system. The width of the interface layer was estimated to about 1 nm. - Highlights: Black-Right-Pointing-Pointer {beta} Prime is found to be looped at sizes larger than 15 nm (cross section diameter). Black-Right-Pointing-Pointer {beta} Prime is found to be sheared at sizes smaller than 15 nm (cross section diameter). Black-Right-Pointing-Pointer The recently determined crystal structure of {beta} Prime is confirmed by HAADF-STEM. Black-Right-Pointing-Pointer Between {beta} Prime and the Al-matrix a transition layer of about 1 nm is existent. Black-Right-Pointing-Pointer The {beta} Prime /matrix layer is structurally distinct from bulk {beta} Prime and the aluminium matrix.« less

  19. Spicule matrix protein LSM34 is essential for biomineralization of the sea urchin spicule.

    PubMed

    Peled-Kamar, Mira; Hamilton, Patricia; Wilt, Fred H

    2002-01-01

    Biomineralized skeletal structures are composite materials containing mineral and matrix protein(s). The cell biological mechanisms that underlie the formation, secretion, and organization of the biomineralized materials are not well understood. Although the matrix proteins influence physical properties of the structures, little is known of the role of these matrix proteins in the actual formation of the biomineralized structure. We present here results using an antisense oligonucleotide directed against a spicule matrix protein, LSM34, present in spicules of embryos of Lytechinus pictus. After injection of anti-LSM34 into the blastocoel of a sea urchin embryo, LSM34 protein in the primary mesenchyme cells decreases and biomineralization ceases, demonstrating that LSM34 function is essential for the formation of the calcareous endoskeletal spicule of the embryo. Since LSM34 is found primarily in a specialized extracellular matrix surrounding the spicule, it is probable that this matrix is important for the biomineralization process.

  20. Atmospheric Chemiluminescence: COCHISE (COld CHemical Infrared Simulation Experiment) and Related Experiments.

    DTIC Science & Technology

    1982-10-13

    35. 𔄁. Wiese, W.L., Smith, M.W., and Miles , B.M. (1969) Atomic Transition Probabilities, Vol. II, NSRDS-NBS 22. 8. Green, B.D., private communication...sidearms simultane- ously changes the flow velocity (that is, the residence time) and the ratio of charge to number density E/N in the discharge plasma , as...Levels, Vol. I, NSRDS-NBS 35. 7. Wiese, W. L., Smith, M. W., and Miles , B. M. (1969’, Atomic Transition Probabilities, Vol. II, NSRDS-NBS 22. 8. Green, B

  1. Linear canonical transformations of coherent and squeezed states in the Wigner phase space. II - Quantitative analysis

    NASA Technical Reports Server (NTRS)

    Han, D.; Kim, Y. S.; Noz, Marilyn E.

    1989-01-01

    It is possible to calculate expectation values and transition probabilities from the Wigner phase-space distribution function. Based on the canonical transformation properties of the Wigner function, an algorithm is developed for calculating these quantities in quantum optics for coherent and squeezed states. It is shown that the expectation value of a dynamical variable can be written in terms of its vacuum expectation value of the canonically transformed variable. Parallel-axis theorems are established for the photon number and its variant. It is also shown that the transition probability between two squeezed states can be reduced to that of the transition from one squeezed state to vacuum.

  2. Precise Calculation of a Bond Percolation Transition and Survival Rates of Nodes in a Complex Network

    PubMed Central

    Kawamoto, Hirokazu; Takayasu, Hideki; Jensen, Henrik Jeldtoft; Takayasu, Misako

    2015-01-01

    Through precise numerical analysis, we reveal a new type of universal loopless percolation transition in randomly removed complex networks. As an example of a real-world network, we apply our analysis to a business relation network consisting of approximately 3,000,000 links among 300,000 firms and observe the transition with critical exponents close to the mean-field values taking into account the finite size effect. We focus on the largest cluster at the critical point, and introduce survival probability as a new measure characterizing the robustness of each node. We also discuss the relation between survival probability and k-shell decomposition. PMID:25885791

  3. Using hidden Markov models to align multiple sequences.

    PubMed

    Mount, David W

    2009-07-01

    A hidden Markov model (HMM) is a probabilistic model of a multiple sequence alignment (msa) of proteins. In the model, each column of symbols in the alignment is represented by a frequency distribution of the symbols (called a "state"), and insertions and deletions are represented by other states. One moves through the model along a particular path from state to state in a Markov chain (i.e., random choice of next move), trying to match a given sequence. The next matching symbol is chosen from each state, recording its probability (frequency) and also the probability of going to that state from a previous one (the transition probability). State and transition probabilities are multiplied to obtain a probability of the given sequence. The hidden nature of the HMM is due to the lack of information about the value of a specific state, which is instead represented by a probability distribution over all possible values. This article discusses the advantages and disadvantages of HMMs in msa and presents algorithms for calculating an HMM and the conditions for producing the best HMM.

  4. Transition sum rules in the shell model

    NASA Astrophysics Data System (ADS)

    Lu, Yi; Johnson, Calvin W.

    2018-03-01

    An important characterization of electromagnetic and weak transitions in atomic nuclei are sum rules. We focus on the non-energy-weighted sum rule (NEWSR), or total strength, and the energy-weighted sum rule (EWSR); the ratio of the EWSR to the NEWSR is the centroid or average energy of transition strengths from an nuclear initial state to all allowed final states. These sum rules can be expressed as expectation values of operators, which in the case of the EWSR is a double commutator. While most prior applications of the double commutator have been to special cases, we derive general formulas for matrix elements of both operators in a shell model framework (occupation space), given the input matrix elements for the nuclear Hamiltonian and for the transition operator. With these new formulas, we easily evaluate centroids of transition strength functions, with no need to calculate daughter states. We apply this simple tool to a number of nuclides and demonstrate the sum rules follow smooth secular behavior as a function of initial energy, as well as compare the electric dipole (E 1 ) sum rule against the famous Thomas-Reiche-Kuhn version. We also find surprising systematic behaviors for ground-state electric quadrupole (E 2 ) centroids in the s d shell.

  5. Integrating K-means Clustering with Kernel Density Estimation for the Development of a Conditional Weather Generation Downscaling Model

    NASA Astrophysics Data System (ADS)

    Chen, Y.; Ho, C.; Chang, L.

    2011-12-01

    In previous decades, the climate change caused by global warming increases the occurrence frequency of extreme hydrological events. Water supply shortages caused by extreme events create great challenges for water resource management. To evaluate future climate variations, general circulation models (GCMs) are the most wildly known tools which shows possible weather conditions under pre-defined CO2 emission scenarios announced by IPCC. Because the study area of GCMs is the entire earth, the grid sizes of GCMs are much larger than the basin scale. To overcome the gap, a statistic downscaling technique can transform the regional scale weather factors into basin scale precipitations. The statistic downscaling technique can be divided into three categories include transfer function, weather generator and weather type. The first two categories describe the relationships between the weather factors and precipitations respectively based on deterministic algorithms, such as linear or nonlinear regression and ANN, and stochastic approaches, such as Markov chain theory and statistical distributions. In the weather type, the method has ability to cluster weather factors, which are high dimensional and continuous variables, into weather types, which are limited number of discrete states. In this study, the proposed downscaling model integrates the weather type, using the K-means clustering algorithm, and the weather generator, using the kernel density estimation. The study area is Shihmen basin in northern of Taiwan. In this study, the research process contains two steps, a calibration step and a synthesis step. Three sub-steps were used in the calibration step. First, weather factors, such as pressures, humidities and wind speeds, obtained from NCEP and the precipitations observed from rainfall stations were collected for downscaling. Second, the K-means clustering grouped the weather factors into four weather types. Third, the Markov chain transition matrixes and the conditional probability density function (PDF) of precipitations approximated by the kernel density estimation are calculated respectively for each weather types. In the synthesis step, 100 patterns of synthesis data are generated. First, the weather type of the n-th day are determined by the results of K-means clustering. The associated transition matrix and PDF of the weather type were also determined for the usage of the next sub-step in the synthesis process. Second, the precipitation condition, dry or wet, can be synthesized basing on the transition matrix. If the synthesized condition is dry, the quantity of precipitation is zero; otherwise, the quantity should be further determined in the third sub-step. Third, the quantity of the synthesized precipitation is assigned as the random variable of the PDF defined above. The synthesis efficiency compares the gap of the monthly mean curves and monthly standard deviation curves between the historical precipitation data and the 100 patterns of synthesis data.

  6. Analysis of TPA Pulsed-Laser-Induced Single-Event Latchup Sensitive-Area

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Peng; Sternberg, Andrew L.; Kozub, John A.

    Two-photon absorption (TPA) testing is employed to analyze the laser-induced latchup sensitive-volume (SV) of a specially designed test structure. This method takes into account the existence of an onset region in which the probability of triggering latchup transitions from zero to one as the laser pulse energy increases. This variability is attributed to pulse-to-pulse variability, uncertainty in measurement of the pulse energy, and variation in local carrier density and temperature. For each spatial position, the latchup probability associated with a given energy is calculated from multiple pulses. The latchup probability data are well-described by a Weibull distribution. The results showmore » that the area between p-n-p-n cell structures is more sensitive than the p+ and n+ source areas, and locations far from the well contacts are more sensitive than those near the contact region. The transition from low probability of latchup to high probability is more abrupt near the source contacts than it is for the surrounding areas.« less

  7. Analysis of TPA Pulsed-Laser-Induced Single-Event Latchup Sensitive-Area

    DOE PAGES

    Wang, Peng; Sternberg, Andrew L.; Kozub, John A.; ...

    2017-12-07

    Two-photon absorption (TPA) testing is employed to analyze the laser-induced latchup sensitive-volume (SV) of a specially designed test structure. This method takes into account the existence of an onset region in which the probability of triggering latchup transitions from zero to one as the laser pulse energy increases. This variability is attributed to pulse-to-pulse variability, uncertainty in measurement of the pulse energy, and variation in local carrier density and temperature. For each spatial position, the latchup probability associated with a given energy is calculated from multiple pulses. The latchup probability data are well-described by a Weibull distribution. The results showmore » that the area between p-n-p-n cell structures is more sensitive than the p+ and n+ source areas, and locations far from the well contacts are more sensitive than those near the contact region. The transition from low probability of latchup to high probability is more abrupt near the source contacts than it is for the surrounding areas.« less

  8. Effective collision strengths for the electron impact excitation of Mg

    NASA Astrophysics Data System (ADS)

    Hudson, C. E.; Ramsbottom, C. A.; Norrington, P. H.; Scott, M. P.

    2008-05-01

    Electron impact excitation collision strengths for fine structure transitions of Mg,have been determined by a Breit-Pauli R-matrix calculation. The target states are represented by configuration interaction wavefunctions and consist of the 19 lowest LS states, having configurations 2s^22p^4, 2s2p^5, 2p^6, 2s^22p^33s and 2s^22p^33p. These target states give rise to 37 fine structure levels and 666 possible transitions. The effective collision strengths are calculated by averaging the electron collision strengths over a Maxwellian distribution of electron velocities. Effective collision strengths for transitions between the fine structure levels are given for electron temperatures in the range 10Te(K) = 3.0 - 7.0. Results are compared with the previous R-matrix calculation of Butler & Zeippen (AASS, 1994) and the recent Distorted Wave evaluations of Bhatia, Landi & Eissner (ADNDT, 2006).

  9. Topology-driven phase transitions in the classical monomer-dimer-loop model.

    PubMed

    Li, Sazi; Li, Wei; Chen, Ziyu

    2015-06-01

    In this work, we investigate the classical loop models doped with monomers and dimers on a square lattice, whose partition function can be expressed as a tensor network (TN). In the thermodynamic limit, we use the boundary matrix product state technique to contract the partition function TN, and determine the thermodynamic properties with high accuracy. In this monomer-dimer-loop model, we find a second-order phase transition between a trivial monomer-condensation and a loop-condensation (LC) phase, which cannot be distinguished by any local order parameter, while nevertheless the two phases have distinct topological properties. In the LC phase, we find two degenerate dominating eigenvalues in the transfer-matrix spectrum, as well as a nonvanishing (nonlocal) string order parameter, both of which identify the topological ergodicity breaking in the LC phase and can serve as the order parameter for detecting the phase transitions.

  10. Dynamic Jahn-Teller effect: Calculation of fine structure spectrum, isotope shift and Zeeman behavior at deep center Ni2+ in CdS

    NASA Astrophysics Data System (ADS)

    Schoepp, Juergen

    The internal transition of the deep center Ni2+ in II to IV semiconductor cadmium sulfide is examined with reference to crystal field theory. An algorithm was developed for calculation, in a basis fitted to trigonal symmetry, of fine structure operator matrix which is made of the sum of operators from spin trajectory coupling, trigonal field and electron phonon coupling. The dependence of energy level on the mass was calculated in order to examine the isotropy effect at Ni2+ transition. The mass dependence of phonon energy was estimated in an atomic cluster by using a valence force model from Keating for elastic energy. The Zeeman behavior of Ni2+ transition was examined for magnetic fields; the Zeeman operator was added to the fine structure operator and the resulting matrix was diagonalized. It is noticed that calculations are quantitatively and qualitatively in agreement with experiments.

  11. Critical behavior of the extended Hubbard model with bond dimerization

    NASA Astrophysics Data System (ADS)

    Ejima, Satoshi; Lange, Florian; Essler, Fabian H. L.; Fehske, Holger

    2018-05-01

    Exploiting the matrix-product-state based density-matrix renormalization group (DMRG) technique we study the one-dimensional extended (U-V) Hubbard model with explicit bond dimerization in the half-filled band sector. In particular we investigate the nature of the quantum phase transition, taking place with growing ratio V / U between the symmetry-protected-topological and charge-density-wave insulating states. The (weak-coupling) critical line of continuous Ising transitions with central charge c = 1 / 2 terminates at a tricritical point belonging to the universality class of the dilute Ising model with c = 7 / 10 . We demonstrate that our DMRG data perfectly match with (tricritical) Ising exponents, e.g., for the order parameter β = 1 / 8 (1/24) and correlation length ν = 1 (5/9). Beyond the tricritical Ising point, in the strong-coupling regime, the quantum phase transition becomes first order.

  12. Robust location and spread measures for nonparametric probability density function estimation.

    PubMed

    López-Rubio, Ezequiel

    2009-10-01

    Robustness against outliers is a desirable property of any unsupervised learning scheme. In particular, probability density estimators benefit from incorporating this feature. A possible strategy to achieve this goal is to substitute the sample mean and the sample covariance matrix by more robust location and spread estimators. Here we use the L1-median to develop a nonparametric probability density function (PDF) estimator. We prove its most relevant properties, and we show its performance in density estimation and classification applications.

  13. Environmentally Adaptive UXO Detection and Classification Systems

    DTIC Science & Technology

    2016-04-01

    probability of false alarm ( Pfa ), as well as Receiver Op- erating Characteristic (ROC) curve and confusion matrix characteristics. The results of these...techniques at a false alarm probability of Pfa = 1× 10−3. X̃ = g(X). In this case, the problem remains invariant to the group of transformations G = { g : g(X...and observed target responses as well as the probability of detection versus SNR for both detection techniques at Pfa = 1× 10−3. with N = 128 and M = 50

  14. Effect of salts on the properties of aqueous sugar systems, in relation to biomaterial stabilization. 1. Water sorption behavior and ice crystallization/melting.

    PubMed

    Mazzobre, M F; Longinotti, M P; Corti, H R; Buera, M P

    2001-11-01

    Trehalose and sucrose, two sugars that are involved in the protection of living organisms under extreme conditions, and their mixtures with salts were employed to prepare supercooled or freeze-dried glassy systems. The objective of the present work was to explore the effects of different salts on water sorption, glass transition temperature (T(g)), and formation and melting of ice in aqueous sugar systems. In the sugar-salt mixtures, water adsorption was higher than expected on the basis of the water uptake by each pure component. In systems with a reduced mass fraction of water (w less-than-or-equal 0.4), salts delayed water crystallization, probably due to ion-water interactions. In systems where > 0.6, water crystallization could be explained by the known colligative properties of the solutes. The glass transition temperature of the maximally concentrated matrix (T(g)') was decreased by the presence of salts. However, the actual T(g) values of the systems were not modified. Thus, the effect of salts on sorption behavior and formation of ice may reflect dynamic water-salt-sugar interactions which take place at a molecular level and are related to the charge/mass ratio of the cation present without affecting supramolecular or macroscopic properties. Copyright 2001 Elsevier Science (USA).

  15. FastSKAT: Sequence kernel association tests for very large sets of markers.

    PubMed

    Lumley, Thomas; Brody, Jennifer; Peloso, Gina; Morrison, Alanna; Rice, Kenneth

    2018-06-22

    The sequence kernel association test (SKAT) is widely used to test for associations between a phenotype and a set of genetic variants that are usually rare. Evaluating tail probabilities or quantiles of the null distribution for SKAT requires computing the eigenvalues of a matrix related to the genotype covariance between markers. Extracting the full set of eigenvalues of this matrix (an n×n matrix, for n subjects) has computational complexity proportional to n 3 . As SKAT is often used when n>104, this step becomes a major bottleneck in its use in practice. We therefore propose fastSKAT, a new computationally inexpensive but accurate approximations to the tail probabilities, in which the k largest eigenvalues of a weighted genotype covariance matrix or the largest singular values of a weighted genotype matrix are extracted, and a single term based on the Satterthwaite approximation is used for the remaining eigenvalues. While the method is not particularly sensitive to the choice of k, we also describe how to choose its value, and show how fastSKAT can automatically alert users to the rare cases where the choice may affect results. As well as providing faster implementation of SKAT, the new method also enables entirely new applications of SKAT that were not possible before; we give examples grouping variants by topologically associating domains, and comparing chromosome-wide association by class of histone marker. © 2018 WILEY PERIODICALS, INC.

  16. Negative refraction using Raman transitions and chirality

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sikes, D. E.; Yavuz, D. D.

    2011-11-15

    We present a scheme that achieves negative refraction with low absorption in far-off resonant atomic systems. The scheme utilizes Raman resonances and does not require the simultaneous presence of an electric-dipole transition and a magnetic-dipole transition near the same wavelength. We show that two interfering Raman tran-sitions coupled to a magnetic-dipole transition can achieve a negative index of refraction with low absorption through magnetoelectric cross-coupling. We confirm the validity of the analytical results with exact numerical simulations of the density matrix. We also discuss possible experimental implementations of the scheme in rare-earth metal atomic systems.

  17. Spatial Probability Distribution of Strata's Lithofacies and its Impacts on Land Subsidence in Huairou Emergency Water Resources Region of Beijing

    NASA Astrophysics Data System (ADS)

    Li, Y.; Gong, H.; Zhu, L.; Guo, L.; Gao, M.; Zhou, C.

    2016-12-01

    Continuous over-exploitation of groundwater causes dramatic drawdown, and leads to regional land subsidence in the Huairou Emergency Water Resources region, which is located in the up-middle part of the Chaobai river basin of Beijing. Owing to the spatial heterogeneity of strata's lithofacies of the alluvial fan, ground deformation has no significant positive correlation with groundwater drawdown, and one of the challenges ahead is to quantify the spatial distribution of strata's lithofacies. The transition probability geostatistics approach provides potential for characterizing the distribution of heterogeneous lithofacies in the subsurface. Combined the thickness of clay layer extracted from the simulation, with deformation field acquired from PS-InSAR technology, the influence of strata's lithofacies on land subsidence can be analyzed quantitatively. The strata's lithofacies derived from borehole data were generalized into four categories and their probability distribution in the observe space was mined by using the transition probability geostatistics, of which clay was the predominant compressible material. Geologically plausible realizations of lithofacies distribution were produced, accounting for complex heterogeneity in alluvial plain. At a particular probability level of more than 40 percent, the volume of clay defined was 55 percent of the total volume of strata's lithofacies. This level, equaling nearly the volume of compressible clay derived from the geostatistics, was thus chosen to represent the boundary between compressible and uncompressible material. The method incorporates statistical geological information, such as distribution proportions, average lengths and juxtaposition tendencies of geological types, mainly derived from borehole data and expert knowledge, into the Markov chain model of transition probability. Some similarities of patterns were indicated between the spatial distribution of deformation field and clay layer. In the area with roughly similar water table decline, locations in the subsurface having a higher probability for the existence of compressible material occur more than that in the location with a lower probability. Such estimate of spatial probability distribution is useful to analyze the uncertainty of land subsidence.

  18. Dolomitic marbles from the ultrahigh-pressure metamorphic Kimi complex in Rhodope, N.E. Greece

    NASA Astrophysics Data System (ADS)

    Mposkos, E.; Baziotis, I.; Proyer, A.; Hoinkes, G.

    2006-09-01

    Dolomitic marbles from the Organi and Pandrosos areas of the ultrahigh-pressure (UHP) metamorphic Kimi complex in East Rhodope, N.E. Greece have the mineral assemblage: Cal + Dol + Ol + Phl ± Di ± Hbl ± Spl ± Ti Chu + retrograde Srp and Chl. Several generations of calcite and dolomite with variable composition and texture represent different stages of the P T evolution: The first stage is represented by matrix dolomite (X_MgCO_3 = 0.48) and relic domains of homogenous composition in matrix calcite (X_MgCO_3 = 0.11 0.13); the second stage is evident from precipitation of lath-shaped and vermicular dolomite in matrix calcite. The third stage is represented by veinlets of almost pure CaCO3 and domainal replacement of prior calcite by nearly pure CaCO3 + Ca-rich dolomite (X_MgCO_3 = 0.34 0.43). Matrix dolomite adjacent to CaCO3 veinlets also becomes Ca-rich (X_MgCO_3 = 0.42). In fact, Ca-rich dolomites with X_MgCO_3 in the range of 0.40 0.34 are reported for the first time from metamorphic marbles. Coexisting Ca-rich dolomite and Mg-poor calcite cannot be explained by the calcite-dolomite miscibility gap. This assemblage rather suggests that Mg-poor calcite was aragonite originally, which formed together with Ca-rich dolomite according to the reaction Mg Cal → Arg + Dol (1) at ultrahigh pressures and temperatures above at least 850 °C, when dolomite becomes disordered and incorporates more Ca than coexisting aragonite does in terms of Mg. The simplest explanation of these observations probably is to suggest two metamorphic events: The first one represented by relic matrix carbonates at relatively low to moderate pressures and temperatures of ca. 750 °C, and the second one limited by the minimum temperatures for dolomite disorder (ca. 850 °C) and in the aragonite + dolomite stability field, i.e. at a minimum pressure of 3 GPa and, if the presence of diamond-bearing metapelites nearby is considered, at conditions of at least 850 °C and 4.3 GPa in the diamond stability field. As there is hardly any back-reaction of Ca-rich dolomite + Mg-poor calcite to Mg-rich calcite, peak temperatures remained below the reaction (1) and the exhumation path probably crossed the aragonite-calcite transition at much lower than peak temperature. Cooling and decompression must have both occurred extremely fast in order for the µm-sized Ca-rich dolomite textures to be preserved. An alternative explanation of the formation of “UHP”-textures and compositions is by a fluid influx that not only caused serpentinisation and chloritisation of silicates but also Mg-leaching from carbonates, particularly from Mg-rich calcite and its fine grained dolomite-precipitates, thus transforming them into Mg-poor calcite + Ca-rich dolomite.

  19. A multistate dynamic site occupancy model for spatially aggregated sessile communities

    USGS Publications Warehouse

    Fukaya, Keiichi; Royle, J. Andrew; Okuda, Takehiro; Nakaoka, Masahiro; Noda, Takashi

    2017-01-01

    Estimation of transition probabilities of sessile communities seems easy in principle but may still be difficult in practice because resampling error (i.e. a failure to resample exactly the same location at fixed points) may cause significant estimation bias. Previous studies have developed novel analytical methods to correct for this estimation bias. However, they did not consider the local structure of community composition induced by the aggregated distribution of organisms that is typically observed in sessile assemblages and is very likely to affect observations.We developed a multistate dynamic site occupancy model to estimate transition probabilities that accounts for resampling errors associated with local community structure. The model applies a nonparametric multivariate kernel smoothing methodology to the latent occupancy component to estimate the local state composition near each observation point, which is assumed to determine the probability distribution of data conditional on the occurrence of resampling error.By using computer simulations, we confirmed that an observation process that depends on local community structure may bias inferences about transition probabilities. By applying the proposed model to a real data set of intertidal sessile communities, we also showed that estimates of transition probabilities and of the properties of community dynamics may differ considerably when spatial dependence is taken into account.Results suggest the importance of accounting for resampling error and local community structure for developing management plans that are based on Markovian models. Our approach provides a solution to this problem that is applicable to broad sessile communities. It can even accommodate an anisotropic spatial correlation of species composition, and may also serve as a basis for inferring complex nonlinear ecological dynamics.

  20. Characterization of Nanostructured Polymer Films

    DTIC Science & Technology

    2014-12-23

    discovered that polymer films with exceptional thermal and kinetic stability could be formed by Matrix Assisted Pulsed Laser Evaporation ( MAPLE ) onto...thermal properties of amorphous polymer nanoglobules fabricated via Matrix-Assisted Pulsed Laser Deposition ( MAPLE ). We discovered that stability in... MAPLE , Glass Transition Temperature 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Richter, W. A.; Mkhize, S.; Brown, B. Alex

    The new Hamiltonians USDA and USDB for the sd shell are used to calculate M1 and E2 moments and transition matrix elements, Gamow-Teller {beta}-decay matrix elements, and spectroscopic factors for sd-shell nuclei from A=17 to A=39. The results are compared with those obtained with the older USD Hamiltonian and with experiment to explore the interaction sensitivity of these observables.

  2. Elastic K-means using posterior probability

    PubMed Central

    Zheng, Aihua; Jiang, Bo; Li, Yan; Zhang, Xuehan; Ding, Chris

    2017-01-01

    The widely used K-means clustering is a hard clustering algorithm. Here we propose a Elastic K-means clustering model (EKM) using posterior probability with soft capability where each data point can belong to multiple clusters fractionally and show the benefit of proposed Elastic K-means. Furthermore, in many applications, besides vector attributes information, pairwise relations (graph information) are also available. Thus we integrate EKM with Normalized Cut graph clustering into a single clustering formulation. Finally, we provide several useful matrix inequalities which are useful for matrix formulations of learning models. Based on these results, we prove the correctness and the convergence of EKM algorithms. Experimental results on six benchmark datasets demonstrate the effectiveness of proposed EKM and its integrated model. PMID:29240756

  3. Sleep Stage Transition Dynamics Reveal Specific Stage 2 Vulnerability in Insomnia.

    PubMed

    Wei, Yishul; Colombo, Michele A; Ramautar, Jennifer R; Blanken, Tessa F; van der Werf, Ysbrand D; Spiegelhalder, Kai; Feige, Bernd; Riemann, Dieter; Van Someren, Eus J W

    2017-09-01

    Objective sleep impairments in insomnia disorder (ID) are insufficiently understood. The present study evaluated whether whole-night sleep stage dynamics derived from polysomnography (PSG) differ between people with ID and matched controls and whether sleep stage dynamic features discriminate them better than conventional sleep parameters. Eighty-eight participants aged 21-70 years, including 46 with ID and 42 age- and sex-matched controls without sleep complaints, were recruited through www.sleepregistry.nl and completed two nights of laboratory PSG. Data of 100 people with ID and 100 age- and sex-matched controls from a previously reported study were used to validate the generalizability of findings. The second night was used to obtain, in addition to conventional sleep parameters, probabilities of transitions between stages and bout duration distributions of each stage. Group differences were evaluated with nonparametric tests. People with ID showed higher empirical probabilities to transition from stage N2 to the lighter sleep stage N1 or wakefulness and a faster decaying stage N2 bout survival function. The increased transition probability from stage N2 to stage N1 discriminated people with ID better than any of their deviations in conventional sleep parameters, including less total sleep time, less sleep efficiency, more stage N1, and more wake after sleep onset. Moreover, adding this transition probability significantly improved the discriminating power of a multiple logistic regression model based on conventional sleep parameters. Quantification of sleep stage dynamics revealed a particular vulnerability of stage N2 in insomnia. The feature characterizes insomnia better than-and independently of-any conventional sleep parameter. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

  4. Self-perceived health among Eastern European immigrants over 50 living in Western Europe.

    PubMed

    Lanari, D; Bussini, O; Minelli, L

    2015-01-01

    This paper examines whether Eastern European immigrants aged 50 and over living in Northern and Western Europe face a health disadvantage in terms of self-perceived health, with respect to the native-born. We also examined health changes over time (2004-2006-2010) through the probabilities of transition among self-perceived health states, and how they vary according to nativity status and age group. Data were obtained from the Survey of Health, Ageing and Retirement in Europe (SHARE). Logistic regressions and probabilities of transition were used. Results emphasise the health disadvantage of Eastern European immigrants living in Germany, France and  Sweden with respect to the native-born, even after controlling for socio-economic status. Probabilities of transition also evidenced that people born in Eastern Europe were more likely to experience worsening health and less likely to recover from sickness. This paper suggests that health inequalities do not affect immigrant groups in equal measure and confirm the poorer and more steeply deteriorating health status of Eastern European immigrants.

  5. Time-course variation of statistics embedded in music: Corpus study on implicit learning and knowledge.

    PubMed

    Daikoku, Tatsuya

    2018-01-01

    Learning and knowledge of transitional probability in sequences like music, called statistical learning and knowledge, are considered implicit processes that occur without intention to learn and awareness of what one knows. This implicit statistical knowledge can be alternatively expressed via abstract medium such as musical melody, which suggests this knowledge is reflected in melodies written by a composer. This study investigates how statistics in music vary over a composer's lifetime. Transitional probabilities of highest-pitch sequences in Ludwig van Beethoven's Piano Sonata were calculated based on different hierarchical Markov models. Each interval pattern was ordered based on the sonata opus number. The transitional probabilities of sequential patterns that are musical universal in music gradually decreased, suggesting that time-course variations of statistics in music reflect time-course variations of a composer's statistical knowledge. This study sheds new light on novel methodologies that may be able to evaluate the time-course variation of composer's implicit knowledge using musical scores.

  6. Infinite capacity multi-server queue with second optional service channel

    NASA Astrophysics Data System (ADS)

    Ke, Jau-Chuan; Wu, Chia-Huang; Pearn, Wen Lea

    2013-02-01

    This paper deals with an infinite-capacity multi-server queueing system with a second optional service (SOS) channel. The inter-arrival times of arriving customers, the service times of the first essential service (FES) and the SOS channel are all exponentially distributed. A customer may leave the system after the FES channel with probability (1-θ), or at the completion of the FES may immediately require a SOS with probability θ (0 <= θ <= 1). The formulae for computing the rate matrix and stationary probabilities are derived by means of a matrix analytical approach. A cost model is developed to determine the optimal values of the number of servers and the two service rates, simultaneously, at the minimal total expected cost per unit time. Quasi-Newton method are employed to deal with the optimization problem. Under optimal operating conditions, numerical results are provided in which several system performance measures are calculated based on assumed numerical values of the system parameters.

  7. Matrix quality and disturbance frequency drive evolution of species behavior at habitat boundaries.

    PubMed

    Martin, Amanda E; Fahrig, Lenore

    2015-12-01

    Previous theoretical studies suggest that a species' landscape should influence the evolution of its dispersal characteristics, because landscape structure affects the costs and benefits of dispersal. However, these studies have not considered the evolution of boundary crossing, that is, the tendency of animals to cross from habitat to nonhabitat ("matrix"). It is important to understand this dispersal behavior, because of its effects on the probability of population persistence. Boundary-crossing behavior drives the rate of interaction with matrix, and thus, it influences the rate of movement among populations and the risk of dispersal mortality. We used an individual-based, spatially explicit model to simulate the evolution of boundary crossing in response to landscape structure. Our simulations predict higher evolved probabilities of boundary crossing in landscapes with more habitat, less fragmented habitat, higher-quality matrix, and more frequent disturbances (i.e., fewer generations between local population extinction events). Unexpectedly, our simulations also suggest that matrix quality and disturbance frequency have much stronger effects on the evolution of boundary crossing than either habitat amount or habitat fragmentation. Our results suggest that boundary-crossing responses are most affected by the costs of dispersal through matrix and the benefits of escaping local extinction events. Evolution of optimal behavior at habitat boundaries in response to the landscape may have implications for species in human-altered landscapes, because this behavior may become suboptimal if the landscape changes faster than the species' evolutionary response to that change. Understanding how matrix quality and habitat disturbance drive evolution of behavior at boundaries, and how this in turn influences the extinction risk of species in human-altered landscapes should help us identify species of conservation concern and target them for management.

  8. Simulation of the A-X and B-X transition emission spectra of the InBr molecule for diagnostics in low-pressure plasmas

    NASA Astrophysics Data System (ADS)

    Briefi, S.; Fantz, U.

    2011-04-01

    Inductively coupled low-pressure discharges containing InBr have been investigated spectroscopically. In order to obtain plasma parameters such as the vibrational and rotational temperature of the InBr molecule, the emission spectra of the A\\,^3\\!\\Pi_{0^+}\\rightarrow X\\,^1\\!\\Sigma_{0}^+ and the B\\,^3\\! \\Pi_{1}\\rightarrow X\\,^1\\!\\Sigma_{0}^+ transitions have been simulated. The program is based on the molecular constants and takes into account vibrational states up to v = 24. The required Franck-Condon factors and vibrationally resolved transition probabilities have been computed solving the Schrödinger equation using the Born-Oppenheimer approximation. The ground state density of the InBr molecule in the plasma has been determined from absorption spectra using effective transition probabilities for the A-X and B-X transition according to the vibrational population. The obtained densities agree well with densities derived from an Arrhenius type vapour pressure equation.

  9. The fast algorithm of spark in compressive sensing

    NASA Astrophysics Data System (ADS)

    Xie, Meihua; Yan, Fengxia

    2017-01-01

    Compressed Sensing (CS) is an advanced theory on signal sampling and reconstruction. In CS theory, the reconstruction condition of signal is an important theory problem, and spark is a good index to study this problem. But the computation of spark is NP hard. In this paper, we study the problem of computing spark. For some special matrixes, for example, the Gaussian random matrix and 0-1 random matrix, we obtain some conclusions. Furthermore, for Gaussian random matrix with fewer rows than columns, we prove that its spark equals to the number of its rows plus one with probability 1. For general matrix, two methods are given to compute its spark. One is the method of directly searching and the other is the method of dual-tree searching. By simulating 24 Gaussian random matrixes and 18 0-1 random matrixes, we tested the computation time of these two methods. Numerical results showed that the dual-tree searching method had higher efficiency than directly searching, especially for those matrixes which has as much as rows and columns.

  10. Optimizing exoplanet transit searches

    NASA Astrophysics Data System (ADS)

    Herrero, E.; Ribas, I.; Jordi, C.

    2013-05-01

    Exoplanet searches using the transit technique are nowadays providing a great number of findings. Most exoplanet transit detection programs that are currently underway are focused on large catalogs of stars with no pre-selection. This necessarily makes such surveys quite inefficient, because huge amounts of data are processed for a relatively low transiting planet yield. In this work we investigate a method to increase the efficiency of a targeted exoplanet search with the transit technique by preselecting a subset of candidates from large catalogs of stars. Assuming spin-orbit alignment, this can be done by considering stars that have higher probability to be oriented nearly equator-on (inclination close to 90°). We use activity-rotation velocity relations for low-mass stars to study the dependence of the position in the activity - v sin(i) diagram on the stellar axis inclination. We compose a catalog of G-, K-, M-type main sequence simulated stars using isochrones, an isotropic inclination distribution and empirical relations to obtain their rotation periods and activity indexes. Then the activity-vsini diagram is filled and statistics are applied to trace the areas containing the higher ratio of stars with inclinations above 80°. A similar statistics is applied to stars from real catalogs with log(R'_{HK}) and v sin(i) data to find their probability of being equator-on. We present the method used to generate the simulated star catalog and the subsequent statistics to find the highly inclined stars from real catalogs using the activity-v sin(i) diagram. Several catalogs from the literature are analysed and a subsample of stars with the highest probability of being equator-on is presented. Assuming spin-orbit alignment, the efficiency of an exoplanet transit search in the resulting subsample of probably highly inclined stars is estimated to be two to three times higher than with a global search with no pre-selection.

  11. Transition Probabilities of Emissions and Rotationless Radiative Lifetimes of Vibrational Levels for the PO Radical

    NASA Astrophysics Data System (ADS)

    Yin, Yuan; Shi, Deheng; Sun, Jinfeng; Zhu, Zunlue

    2018-06-01

    This work investigates the transition dipole moments (TDMs) and transition probabilities of electric dipole emissions between the X2Π, B2Σ+, B‧2Π, D‧2Π, C2Σ‑, C‧2Δ, F2Σ+, and P2Π states of the PO radical. The TDMs of 23 pairs of states are calculated by the internally contracted multireference configuration method with the aug-cc-pV6Z basis set. The vibrational band origins, Franck–Condon factors, and Einstein coefficients of all the spontaneous emissions are evaluated. The rotationless radiative lifetimes of the vibrational levels are approximately 10‑7–10‑8 s for the B2Σ+, C2Σ‑, C‧2Δ, P2Π, and F2Σ+ states; 10‑4–10‑5 s for the B‧2Π state; and 10‑1–10‑2 s for the D‧2Π state. The Einstein coefficients of many emissions are large for the B2Σ+–X2Π, B‧2Π–X2Π, C‧2Δ–X2Π, C2Σ‑–X2Π, F2Σ+–X2Π, P2Π–X2Π, P2Π–B‧2Π, and P2Π–D‧2Π systems. Almost all the spontaneous emissions arising from the D‧2Π state are very weak. The vibrational band origins of these emissions extend from the UV into the far-infrared spectra. The radiative lifetimes and vibrational band origins are compared with available experimental and theoretical values. According to the radiative lifetimes and transition probabilities obtained in this paper, some guidelines for detecting these states spectroscopically are proposed. The TDMs and transition probabilities reported here are considered to be reliable and can be used as guidelines for detecting similar transitions, especially those in interstellar space.

  12. Superallowed nuclear beta decay: Precision measurements for basic physics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hardy, J. C.

    2012-11-20

    For 60 years, superallowed 0{sup +}{yields}0{sup +} nuclear beta decay has been used to probe the weak interaction, currently verifying the conservation of the vector current (CVC) to high precision ({+-}0.01%) and anchoring the most demanding available test of the unitarity of the Cabibbo-Kobayashi-Maskawa (CKM) matrix ({+-}0.06%), a fundamental pillar of the electroweak standard model. Each superallowed transition is characterized by its ft-value, a result obtained from three measured quantities: the total decay energy of the transition, its branching ratio, and the half-life of the parent state. Today's data set is composed of some 150 independent measurements of 13 separatemore » superallowed transitions covering a wide range of parent nuclei from {sup 10}C to {sup 74}Rb. Excellent consistency among the average results for all 13 transitions - a prediction of CVC - also confirms the validity of the small transition-dependent theoretical corrections that have been applied to account for isospin symmetry breaking. With CVC consistency established, the value of the vector coupling constant, G{sub V}, has been extracted from the data and used to determine the top left element of the CKM matrix, V{sub ud}. With this result the top-row unitarity test of the CKM matrix yields the value 0.99995(61), a result that sets a tight limit on possible new physics beyond the standard model. To have any impact on these fundamental weak-interaction tests, any measurement must be made with a precision of 0.1% or better - a substantial experimental challenge well beyond the requirements of most nuclear physics measurements. I overview the current state of the field and outline some of the requirements that need to be met by experimentalists if they aim to make measurements with this high level of precision.« less

  13. Neutrino mixing, oscillations and decoherence in astrophysics and cosmology

    NASA Astrophysics Data System (ADS)

    Ho, Chiu Man

    2007-08-01

    This thesis focuses on a finite-temperature field-theoretical treatment of neutrino oscillations in hot and dense media. By implementing the methods of real-time non-equilibrium field theory, we study the dynamics of neutrino mixing, oscillations, decoherence and relaxation in astrophysical and cosmological environments. We first study neutrino oscillations in the early universe in the temperature regime prior to the epoch of Big Bang Nucleosynthesis (BBN). The dispersion relations and mixing angles in the medium are found to be helicity-dependent, and a resonance like the Mikheyev-Smirnov- Wolfenstein (MSW) effect is realized. The oscillation time scales are found to be longer near a resonance and shorter for off-resonance high-energy neutrinos. We then investigate the space-time propagation of neutrino wave-packets just before BBN. A phenomenon of " frozen coherence " is found to occur if the longitudinal dispersion catches up with the progressive separation between the mass eigenstates, before the coherence time limit has been reached. However, the transverse dispersion occurs at a much shorter scale than all other possible time scales in the medium, resulting in a large suppression in the transition probabilities from electron-neutrino to muon-neutrino. We also explore the possibility of charged lepton mixing as a consequence of neutrino mixing in the early Universe. We find that charged leptons, like electrons and muons, can mix and oscillate resonantly if there is a large lepton asymmetry in the neutrino sector. We study sterile neutrino production in the early Universe via active-sterile oscillations. We provide a quantum field theoretical reassessment of the quantum Zeno suppression on the active-to-sterile transition probability and its time average. We determine the complete conditions for quantum Zeno suppression. Finally, we examine the interplay between neutrino mixing, oscillations and equilibration in a thermal medium, and the corresponding non-equilibrium dynamics. The equilibrium density matrix is found to be nearly diagonal in the basis of eigenstates of an effective Hamiltonian that includes self-energy corrections in the medium.

  14. Springtime ENSO Flavors and Their Impacts on US Regional Tornado Outbreaks

    NASA Astrophysics Data System (ADS)

    Lee, S. K.; Wittenberg, A. T.; Enfield, D. B.; Weaver, S. J.; Wang, C.; Atlas, R. M.

    2015-12-01

    A new method is presented to objectively characterize and explore the differences in the space-time evolution of equatorial Pacific SSTAs observed during El Nino events. An application of this method to the 21 El Nino events during 1949-2013 captured two leading orthogonal modes, which explain more than 60% of the inter-event variance. The first mode distinguishes a strong and persistent El Nino from a weak and early-terminating El Niño. A similar analysis applied to the 22 La Nina events during 1949-2013 also revealed two leading orthogonal modes, with its first mode distinguishing a resurgent La Nina from a transitioning La Nina. This study shows that the four main phases of springtime El Nino-Southern Oscillation (ENSO) evolution (persistent versus early-terminating El Nino, and resurgent versus transitioning La Nina) are linked to distinctive spatial patterns of the probability of U.S. regional tornado outbreaks. In particular, the outbreak probability increases significantly up to 27% over the Ohio Valley, Upper Midwest and Southeast when a La Nina persists into the spring and is followed by another La Nina (i.e., resurgent La Nina). The probability also increases significantly up to 38%, but mainly in the South, when a two-year La Nina transitions to an El Nino (i.e., transitioning La Nna). These changes in outbreak probability are shown to be largely consistent with remotely forced regional changes in the large-scale tropospheric circulation, low-level vertical wind shear, moisture transports and extratropical storm activity.

  15. On the definition of a Monte Carlo model for binary crystal growth.

    PubMed

    Los, J H; van Enckevort, W J P; Meekes, H; Vlieg, E

    2007-02-01

    We show that consistency of the transition probabilities in a lattice Monte Carlo (MC) model for binary crystal growth with the thermodynamic properties of a system does not guarantee the MC simulations near equilibrium to be in agreement with the thermodynamic equilibrium phase diagram for that system. The deviations remain small for systems with small bond energies, but they can increase significantly for systems with large melting entropy, typical for molecular systems. These deviations are attributed to the surface kinetics, which is responsible for a metastable zone below the liquidus line where no growth occurs, even in the absence of a 2D nucleation barrier. Here we propose an extension of the MC model that introduces a freedom of choice in the transition probabilities while staying within the thermodynamic constraints. This freedom can be used to eliminate the discrepancy between the MC simulations and the thermodynamic equilibrium phase diagram. Agreement is achieved for that choice of the transition probabilities yielding the fastest decrease of the free energy (i.e., largest growth rate) of the system at a temperature slightly below the equilibrium temperature. An analytical model is developed, which reproduces quite well the MC results, enabling a straightforward determination of the optimal set of transition probabilities. Application of both the MC and analytical model to conditions well away from equilibrium, giving rise to kinetic phase diagrams, shows that the effect of kinetics on segregation is even stronger than that predicted by previous models.

  16. Re-Thinking Support: The Hidden School-to-Work Challenges for Individuals with Special Needs

    ERIC Educational Resources Information Center

    Nag, Sonali

    2011-01-01

    This paper examines the hidden challenges experienced by individuals with special needs during the transition years between school and work. An assessment framework is proposed that covers domains of difficulties, developmental tasks during the transition years, the matrix of support within the home-community-institutions ecosystems, and the…

  17. Study of dipion transitions among Υ(3S), Υ(2S), and Υ(1S) states

    NASA Astrophysics Data System (ADS)

    Cronin-Hennessy, D.; Gao, K. Y.; Hietala, J.; Kubota, Y.; Klein, T.; Lang, B. W.; Poling, R.; Scott, A. W.; Smith, A.; Zweber, P.; Dobbs, S.; Metreveli, Z.; Seth, K. K.; Tomaradze, A.; Ernst, J.; Ecklund, K. M.; Severini, H.; Love, W.; Savinov, V.; Lopez, A.; Mehrabyan, S.; Mendez, H.; Ramirez, J.; Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Hu, D.; Moziak, B.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Artuso, M.; Blusk, S.; Khalil, S.; Li, J.; Menaa, N.; Mountain, R.; Nisar, S.; Randrianarivony, K.; Sia, R.; Skwarnicki, T.; Stone, S.; Wang, J. C.; Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Pappas, S. P.; Weinstein, A. J.; Asner, D. M.; Edwards, K. W.; Naik, P.; Briere, R. A.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M. E.; Rosner, J. L.; Adam, N. E.; Alexander, J. P.; Cassel, D. G.; Duboscq, J. E.; Ehrlich, R.; Fields, L.; Galik, R. S.; Gibbons, L.; Gray, R.; Gray, S. W.; Hartill, D. L.; Heltsley, B. K.; Hertz, D.; Jones, C. D.; Kandaswamy, J.; Kreinick, D. L.; Kuznetsov, V. E.; Mahlke-Krüger, H.; Mohapatra, D.; Onyisi, P. U. E.; Patterson, J. R.; Peterson, D.; Pivarski, J.; Riley, D.; Ryd, A.; Sadoff, A. J.; Schwarthoff, H.; Shi, X.; Stroiney, S.; Sun, W. M.; Wilksen, T.; Athar, S. B.; Patel, R.; Yelton, J.; Rubin, P.; Cawlfield, C.; Eisenstein, B. I.; Karliner, I.; Kim, D.; Lowrey, N.; Selen, M.; White, E. J.; Wiss, J.; Mitchell, R. E.; Shepherd, M. R.; Besson, D.; Pedlar, T. K.

    2007-10-01

    We present measurements of decay matrix elements for hadronic transitions of the form Υ(nS)→Υ(mS)ππ, where (n,m)=(3,1),(2,1),(3,2). We reconstruct charged and neutral pion modes with the final state Upsilon decaying to either μ+μ- or e+e-. Dalitz plot distributions for the 12 decay modes are fit individually as well as jointly assuming isospin symmetry, thereby measuring the matrix elements of the decay amplitude. We observe and account for the anomaly previously noted in the dipion invariant mass distribution for the Υ(3S)→Υ(1S)ππ transition and obtain good descriptions of the dynamics of the decay using the most general decay amplitude allowed by partial conservation of the axial-vector current considerations. The fits further indicate that the Υ(2S)→Υ(1S)ππ and Υ(3S)→Υ(2S)ππ transitions also show the presence of terms in the decay amplitude that were previously ignored, although at a relatively suppressed level.

  18. ab initio calculation of the rate of vibrational relaxation and thermal dissociation of hydrogen by helium at high temperatures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dove, J.E.; Raynor, S.

    The master equation for the thermal dissociation of para-H/sub 2/ infinitely dilute in He, was solved for temperatures of 1000 to 10,000/sup 0/K. Transition probabilities, used in the master equation, were obtained, in the case of energy transfer transitions, from distorted wave and quasi-classical trajectory calculations and, for dissociative processes, from trajectory calculations alone. An ab initio potential was used. From the solution, values of the dissociation rate constant, vibrational relaxation times, and incubation times for dissociation and vibrational relaxation were calculated. The sensitivity of the calculated results to variations in the transition probabilities was examined. Vibrational relaxation is mostmore » sensitive to simultaneous transitions in vibration and rotation (VRT processes); pure rotational (RT) transitions also have a substantial effect. Dissociation is most strongly affected by RT processes, but changes in VRT and groups of dissociative transitions also have a significant effect. However complete suppression of all dissociative transitions except those from levels immediately next to the continuum lowers the dissociation rates only by a factor of about 2. The location of the dissociation ''bottleneck'' is discussed. 5 figures, 3 tables.« less

  19. HIV-1 disease progression during highly active antiretroviral therapy: an application using population-level data in British Columbia: 1996-2011.

    PubMed

    Nosyk, Bohdan; Min, Jeong; Lima, Viviane D; Yip, Benita; Hogg, Robert S; Montaner, Julio S G

    2013-08-15

    Accurately estimating rates of disease progression is of central importance in developing mathematical models used to project outcomes and guide resource allocation decisions. Our objective was to specify a multivariate regression model to estimate changes in disease progression among individuals on highly active antiretroviral treatment in British Columbia, Canada, 1996-2011. We used population-level data on disease progression and antiretroviral treatment utilization from the BC HIV Drug Treatment Program. Disease progression was captured using longitudinal CD4 and plasma viral load testing data, linked with data on antiretroviral treatment. The study outcome was categorized into (CD4 count ≥ 500, 500-350, 350-200, <200 cells/mm, and mortality). A 5-state continuous-time Markov model was used to estimate covariate-specific probabilities of CD4 progression, focusing on temporal changes during the study period. A total of 210,083 CD4 measurements among 7421 individuals with HIV/AIDS were included in the study. Results of the multivariate model suggested that current highly active antiretroviral treatment at baseline, lower baseline CD4 (<200 cells/mm), and extended durations of elevated plasma viral load were each associated with accelerated progression. Immunological improvement was accelerated significantly from 2004 onward, with 23% and 46% increases in the probability of CD4 improvement from the fourth CD4 stratum (CD4 < 200) in 2004-2008 and 2008-2011, respectively. Our results demonstrate the impact of innovations in antiretroviral treatment and treatment delivery at the population level. These results can be used to estimate a transition probability matrix flexible to changes in the observed mix of clients in different clinical stages and treatment regimens over time.

  20. Ground state atoms confined in a real Rydberg and complex Rydberg-Scarf II potential

    NASA Astrophysics Data System (ADS)

    Mansoori Kermani, Maryam

    2017-12-01

    In this work, a system of two ground state atoms confined in a one-dimensional real Rydberg potential was modeled. The atom-atom interaction was considered as a nonlocal separable potential (NLSP) of rank one. This potential was assumed because it leads to an analytical solution of the Lippmann-Schwinger equation. The NLSPs are useful in the few body problems that the many-body potential at each point is replaced by a projective two-body nonlocal potential operator. Analytical expressions for the confined particle resolvent were calculated as a key function in this study. The contributions of the bound and virtual states in the complex energy plane were obtained via the derived transition matrix. Since the low energy quantum scattering problems scattering length is an important quantity, the behavior of this parameter was described versus the reduced energy considering various values of potential parameters. In a one-dimensional model, the total cross section in units of the area is not a meaningful property; however, the reflectance coefficient has a similar role. Therefore the reflectance probability and its behavior were investigated. Then a new confined potential via combining the complex absorbing Scarf II potential with the real Rydberg potential, called the Rydberg-Scarf II potential, was introduced to construct a non-Hermitian Hamiltonian. In order to investigate the effect of the complex potential, the scattering length and reflectance coefficient were calculated. It was concluded that in addition to the competition between the repulsive and attractive parts of both potentials, the imaginary part of the complex potential has an important effect on the properties of the system. The complex potential also reduces the reflectance probability via increasing the absorption probability. For all numerical computations, the parameters of a system including argon gas confined in graphite were considered.

Top