Exploiting Drug-Resistant Enzymes as Tools to Identify Thienopyrimidinone Inhibitors of Human Immunodeficiency Virus Reverse Transcriptase-Associated Ribonuclease H

PubMed Central

Masaoka, Takashi; Chung, Suhman; Caboni, Pierluigi; Rausch, Jason W.; Wilson, Jennifer A.; Taskent-Sezgin, Humeyra; Beutler, John A.; Tocco, Graziella; Le Grice, Stuart F. J.

2013-01-01

The thienopyrimidinone 5,6-dimethyl-2-(4-nitrophenyl)thieno[2,3-d]pyrimidin-4(3H)-one (DNTP) occupies the interface between the p66 ribonuclease H (RNase H) domain and p51 thumb of human immunodeficiency virus reverse transcriptase (HIV RT), thereby inducing a conformational change incompatible with catalysis. Here, we combined biochemical characterization of 39 DNTP derivatives with antiviral testing of selected compounds. In addition to wild-type HIV-1 RT, derivatives were evaluated with rationally-designed, p66/p51 heterodimers exhibiting high-level DNTP sensitivity or resistance. This strategy identified 3′,4′-dihydroxyphenyl (catechol)-substituted thienopyrimidinones with sub-micromolar in vitro activity against both wild type HIV-1 RT and drug-resistant variants. Thermal shift analysis indicates that, in contrast to active site RNase H inhibitors, these thienopyrimidinones destabilize the enzyme, in some instances reducing the Tm by 5°C. Importantly, catechol-containing thienopyrimidinones also inhibit HIV-1 replication in cells. Our data strengthens the case for allosteric inhibition of HIV RNase H activity, providing a platform for designing improved antagonists for use in combination antiviral therapy. PMID:23631411

Allosteric dynamics of SAMHD1 studied by molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Patra, K. K.; Bhattacharya, A.; Bhattacharya, S.

2016-10-01

SAMHD1 is a human cellular enzyme that blocks HIV-1 infection in myeloid cells and non-cycling CD4+T cells. The enzyme is an allosterically regulated triphosphohydrolase that modulates the level of cellular dNTP. The virus restriction is attributed to the lowering of the pool of dNTP in the cell to a point where reverse-transcription is impaired. Mutations in SAMHD1 are also implicated in Aicardi-Goutieres syndrome. A mechanistic understanding of the allosteric activation of the enzyme is still elusive. We have performed molecular dynamics simulations to examine the allosteric site dynamics of the protein and to examine the connection between the stability of the tetrameric complex and the Allosite occupancy.

Dynamics of translocation and substrate binding in individual complexes formed with active site mutants of {phi}29 DNA polymerase.

PubMed

Dahl, Joseph M; Wang, Hongyun; Lázaro, José M; Salas, Margarita; Lieberman, Kate R

2014-03-07

The Φ29 DNA polymerase (DNAP) is a processive B-family replicative DNAP. Fluctuations between the pre-translocation and post-translocation states can be quantified from ionic current traces, when individual Φ29 DNAP-DNA complexes are held atop a nanopore in an electric field. Based upon crystal structures of the Φ29 DNAP-DNA binary complex and the Φ29 DNAP-DNA-dNTP ternary complex, residues Tyr-226 and Tyr-390 in the polymerase active site were implicated in the structural basis of translocation. Here, we have examined the dynamics of translocation and substrate binding in complexes formed with the Y226F and Y390F mutants. The Y226F mutation diminished the forward and reverse rates of translocation, increased the affinity for dNTP in the post-translocation state by decreasing the dNTP dissociation rate, and increased the affinity for pyrophosphate in the pre-translocation state. The Y390F mutation significantly decreased the affinity for dNTP in the post-translocation state by decreasing the association rate ∼2-fold and increasing the dissociation rate ∼10-fold, implicating this as a mechanism by which this mutation impedes DNA synthesis. The Y390F dissociation rate increase is suppressed when complexes are examined in the presence of Mn(2+) rather than Mg(2+). The same effects of the Y226F or Y390F mutations were observed in the background of the D12A/D66A mutations, located in the exonuclease active site, ∼30 Å from the polymerase active site. Although translocation rates were unaffected in the D12A/D66A mutant, these exonuclease site mutations caused a decrease in the dNTP dissociation rate, suggesting that they perturb Φ29 DNAP interdomain architecture.

SAMHD1 knockout mice: modeling retrovirus restriction in vivo.

PubMed

Wu, Li

2013-11-20

The host dNTP hydrolase SAMHD1 acts as a viral restriction factor to inhibit the replication of several retroviruses and DNA viruses in non-cycling human immune cells. However, understanding the physiological role of mammalian SAMHD1 has been elusive due to the lack of an animal model. Two recent studies reported the generation of samhd1 knockout mouse models for investigating the restriction of HIV-1 vectors and endogenous retroviruses in vivo. Both studies suggest that SAMHD1 is important for regulating the intracellular dNTP pool and the intrinsic immunity against retroviral infection, despite different outcomes of HIV-1 vector transduction in these mouse models. Here I discuss the significance of these new findings and the future directions in studying SAMHD1-mediated retroviral restriction.

A time to be stressed? Time perspectives and cortisol dynamics among healthy adults.

PubMed

Olivera-Figueroa, Lening A; Juster, Robert-Paul; Morin-Major, Julie Katia; Marin, Marie-France; Lupien, Sonia J

2015-10-01

Perceptions of past, present, and future events may be related to stress pathophysiology. We assessed whether Time Perspective (TP) is associated with cortisol dynamics among healthy adults (N=61, Ages=18-35, M=22.9, SD=4.1) exposed to the Trier Social Stress Test (TSST). TP was measured according to two profiles: maladaptive Deviation from Balanced TP (DBTP) and adaptive Deviation from Negative TP (DNTP). Eight salivary cortisol samples were analyzed using area under the curve with respect to ground (AUCg) and to increase (AUCi). Statistic analyses involved partial correlations controlling for depressive symptoms. Results for both sexes showed that higher DBTP scores were associated with lower cortisol AUCg scores, while higher DNTP scores were associated with higher cortisol AUCg scores. These novel findings suggest that maladaptive TP profiles influence hypocortisolism, whereas adaptive TP profiles influence hypercortisolism. Thus, TP profiles may impact conditions characterized by altered cortisol concentrations. Published by Elsevier B.V.

Long Term Expression of Drosophila melanogaster Nucleoside Kinase in Thymidine Kinase 2-deficient Mice with No Lethal Effects Caused by Nucleotide Pool Imbalances*

PubMed Central

Krishnan, Shuba; Paredes, João A.; Zhou, Xiaoshan; Kuiper, Raoul V.; Hultenby, Kjell; Curbo, Sophie; Karlsson, Anna

2014-01-01

Mitochondrial DNA depletion caused by thymidine kinase 2 (TK2) deficiency can be compensated by a nucleoside kinase from Drosophila melanogaster (Dm-dNK) in mice. We show that transgene expression of Dm-dNK in Tk2 knock-out (Tk2−/−) mice extended the life span of Tk2−/− mice from 3 weeks to at least 20 months. The Dm-dNK+/−Tk2−/− mice maintained normal mitochondrial DNA levels throughout the observation time. A significant difference in total body weight due to the reduction of subcutaneous and visceral fat in the Dm-dNK+/−Tk2−/− mice was the only visible difference compared with control mice. This indicates an effect on fat metabolism mediated through residual Tk2 deficiency because Dm-dNK expression was low in both liver and fat tissues. Dm-dNK expression led to increased dNTP pools and an increase in the catabolism of purine and pyrimidine nucleotides but these alterations did not apparently affect the mice during the 20 months of observation. In conclusion, Dm-dNK expression in the cell nucleus expanded the total dNTP pools to levels required for efficient mitochondrial DNA synthesis, thereby compensated the Tk2 deficiency, during a normal life span of the mice. The Dm-dNK+/− mouse serves as a model for nucleoside gene or enzyme substitutions, nucleotide imbalances, and dNTP alterations in different tissues. PMID:25296759

Long term expression of Drosophila melanogaster nucleoside kinase in thymidine kinase 2-deficient mice with no lethal effects caused by nucleotide pool imbalances.

PubMed

Krishnan, Shuba; Paredes, João A; Zhou, Xiaoshan; Kuiper, Raoul V; Hultenby, Kjell; Curbo, Sophie; Karlsson, Anna

2014-11-21

Mitochondrial DNA depletion caused by thymidine kinase 2 (TK2) deficiency can be compensated by a nucleoside kinase from Drosophila melanogaster (Dm-dNK) in mice. We show that transgene expression of Dm-dNK in Tk2 knock-out (Tk2(-/-)) mice extended the life span of Tk2(-/-) mice from 3 weeks to at least 20 months. The Dm-dNK(+/-)Tk2(-/-) mice maintained normal mitochondrial DNA levels throughout the observation time. A significant difference in total body weight due to the reduction of subcutaneous and visceral fat in the Dm-dNK(+/-)Tk2(-/-) mice was the only visible difference compared with control mice. This indicates an effect on fat metabolism mediated through residual Tk2 deficiency because Dm-dNK expression was low in both liver and fat tissues. Dm-dNK expression led to increased dNTP pools and an increase in the catabolism of purine and pyrimidine nucleotides but these alterations did not apparently affect the mice during the 20 months of observation. In conclusion, Dm-dNK expression in the cell nucleus expanded the total dNTP pools to levels required for efficient mitochondrial DNA synthesis, thereby compensated the Tk2 deficiency, during a normal life span of the mice. The Dm-dNK(+/-) mouse serves as a model for nucleoside gene or enzyme substitutions, nucleotide imbalances, and dNTP alterations in different tissues. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Mechanism of Ribonucleotide Incorporation by Human DNA Polymerase η*

PubMed Central

Su, Yan; Egli, Martin; Guengerich, F. Peter

2016-01-01

Ribonucleotides and 2′-deoxyribonucleotides are the basic units for RNA and DNA, respectively, and the only difference is the extra 2′-OH group on the ribonucleotide sugar. Cellular rNTP concentrations are much higher than those of dNTP. When copying DNA, DNA polymerases not only select the base of the incoming dNTP to form a Watson-Crick pair with the template base but also distinguish the sugar moiety. Some DNA polymerases use a steric gate residue to prevent rNTP incorporation by creating a clash with the 2′-OH group. Y-family human DNA polymerase η (hpol η) is of interest because of its spacious active site (especially in the major groove) and tolerance of DNA lesions. Here, we show that hpol η maintains base selectivity when incorporating rNTPs opposite undamaged DNA and the DNA lesions 7,8-dihydro-8-oxo-2′-deoxyguanosine and cyclobutane pyrimidine dimer but with rates that are 103-fold lower than for inserting the corresponding dNTPs. X-ray crystal structures show that the hpol η scaffolds the incoming rNTP to pair with the template base (dG) or 7,8-dihydro-8-oxo-2′-deoxyguanosine with a significant propeller twist. As a result, the 2′-OH group avoids a clash with the steric gate, Phe-18, but the distance between primer end and Pα of the incoming rNTP increases by 1 Å, elevating the energy barrier and slowing polymerization compared with dNTP. In addition, Tyr-92 was identified as a second line of defense to maintain the position of Phe-18. This is the first crystal structure of a DNA polymerase with an incoming rNTP opposite a DNA lesion. PMID:26740629

Inhibition of herpes simplex virus type 1 by the CDK6 inhibitor PD-0332991 (palbociclib) through the control of SAMHD1.

PubMed

Badia, Roger; Angulo, Guillem; Riveira-Muñoz, Eva; Pujantell, Maria; Puig, Teresa; Ramirez, Cristina; Torres-Torronteras, Javier; Martí, Ramón; Pauls, Eduardo; Clotet, Bonaventura; Ballana, Ester; Esté, José A

2016-02-01

Sterile α motif and histidine-aspartate domain-containing protein 1 (SAMHD1) has been shown to restrict retroviruses and DNA viruses by decreasing the pool of intracellular deoxynucleotides. In turn, SAMHD1 is controlled by cyclin-dependent kinases (CDK) that regulate the cell cycle and cell proliferation. Here, we explore the effect of CDK6 inhibitors on the replication of herpes simplex virus type 1 (HSV-1) in primary monocyte-derived macrophages (MDM). MDM were treated with palbociclib, a selective CDK4/6 inhibitor, and then infected with a GFP-expressing HSV-1. Intracellular deoxynucleotide triphosphate (dNTP) content was determined using a polymerase-based method. CDK6 inhibitor palbociclib blocked SAMHD1 phosphorylation, intracellular dNTP levels and HSV-1 replication in MDM at subtoxic concentrations. Treatment of MDM with palbociclib reduced CDK2 activation, measured as the phosphorylation of the T-loop at Thr160. The antiviral activity of palbociclib was lost when SAMHD1 was degraded by viral protein X. Similarly, palbociclib did not block HSV-1 replication in SAMHD1-negative Vero cells at subtoxic concentrations, providing further evidence for a role of SAMHD1 in mediating the antiviral effect. SAMHD1-mediated HSV-1 restriction is controlled by CDK and points to a preferential role for CDK6 and CDK2 as mediators of SAMHD1 activation. Similarly, the restricting activity of SAMHD1 against DNA viruses suggests that control of dNTP availability is the major determinant of its antiviral activity. This is the first study describing the anti-HSV-1 activity of palbociclib. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Interactions between HIV-1 Reverse Transcriptase and the Downstream Template Strand in Stable Complexes with Primer-Template

PubMed Central

Rutvisuttinunt, Wiriya; Meyer, Peter R.; Scott, Walter A.

2008-01-01

Background Human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT) forms stable ternary complexes in which RT is bound tightly at fixed positions on the primer-template (P/T). We have probed downstream interactions between RT and the template strand in the complex containing the incoming dNTP (+1 dNTP•RT•P/T complex) and in the complex containing the pyrophosphate analog, foscarnet (foscarnet•RT•P/T complex). Methods and Results UV-induced cross-linking between RT and the DNA template strand was most efficient when a bromodeoxyuridine residue was placed in the +2 position (the first template position downstream from the incoming dNTP). Furthermore, formation of the +1 dNTP•RT•P/T complex on a biotin-containing template inhibited binding of streptavidin when biotin was in the +2 position on the template but not when the biotin was in the +3 position. Streptavidin pre-bound to a biotin residue in the template caused RT to stall two to three nucleotides upstream from the biotin residue. The downstream border of the complex formed by the stalled RT was mapped by digestion with exonuclease RecJF. UV-induced cross-linking of the complex formed by the pyrophosphate analog, foscarnet, with RT and P/T occurred preferentially with bromodeoxyuridine in the +1 position on the template in keeping with the location of RT one base upstream in the foscarnet•RT•P/T complex (i.e., in the pre-translocation position). Conclusions For +1 dNTP•RT•P/T and foscarnet•RT•P/T stable complexes, tight interactions were observed between RT and the first unpaired template nucleotide following the bound dNTP or the primer terminus, respectively. PMID:18974785

Antiretroviral Therapy-Induced Mitochondrial Toxicity: Potential Mechanisms Beyond Polymerase-γ Inhibition

PubMed Central

Selvaraj, Shanmugapriya; Ghebremichael, Musie; Li, Min; Foli, Yram; Langs-Barlow, Allison; Ogbuagu, Arit; Barakat, Lydia; Tubridy, Elizabeth; Edifor, Regina; Lam, Wing; Cheng, Yung-Chi; Paintsil, Elijah

2014-01-01

We hypothesized that competition between NRTI-triphosphate and endogenous deoxyribonucleoside triphosphate (dNTP) may lead to depletion of dNTP pools and mitochondrial dysfunction independent of Pol-γ inhibition. We collected peripheral blood mononuclear cells from 75 adults (25 cases: HIV-infected with mitochondrial toxicity, 25 HIV-infected positive controls, and 25 HIV-negative controls). We observed statistically significant individual and group differences in ribonucleotide (RN) and deoxyribonucleotide (dRN) pools. The median RN pool was 10062 (IQR, 7090 – 12590), 4360 (IQR, 3058 –6838), and 2968 (IQR, 2538 – 4436) pmol/106 cells for negative controls, positive controls, and cases, respectively. Cases had significantly higher absolute mtDNA copy number compared to negative controls (p<0.05). Cases had significantly higher expression of Pol-γ, nucleoside transporters, cellular kinases, and ABC compared to controls. Antiretroviral therapy perturbs ribonucleotide and deoxyribonucleotide pools. Depletion of RN and dRN pools may be associated with ART-induced mitochondrial toxicity independent of Pol-γ inhibition. PMID:24637942

Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.

PubMed

Berglund, Anna-Karin; Navarrete, Clara; Engqvist, Martin K M; Hoberg, Emily; Szilagyi, Zsolt; Taylor, Robert W; Gustafsson, Claes M; Falkenberg, Maria; Clausen, Anders R

2017-02-01

Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA) and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP) pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication.

5′CAG and 5′CTG Repeats Create Differential Impediment to the Progression of a Minimal Reconstituted T4 Replisome Depending on the Concentration of dNTPs

PubMed Central

Delagoutte, Emmanuelle; Baldacci, Giuseppe

2011-01-01

Instability of repetitive sequences originates from strand misalignment during repair or replicative DNA synthesis. To investigate the activity of reconstituted T4 replisomes across trinucleotide repeats (TNRs) during leading strand DNA synthesis, we developed a method to build replication miniforks containing a TNR unit of defined sequence and length. Each minifork consists of three strands, primer, leading strand template, and lagging strand template with a 5′ single-stranded (ss) tail. Each strand is prepared independently, and the minifork is assembled by hybridization of the three strands. Using these miniforks and a minimal reconstituted T4 replisome, we show that during leading strand DNA synthesis, the dNTP concentration dictates which strand of the structure-forming 5′CAG/5′CTG repeat creates the strongest impediment to the minimal replication complex. We discuss this result in the light of the known fluctuation of dNTP concentration during the cell cycle and cell growth and the known concentration balance among individual dNTPs. PMID:22096622

SAMHD1 controls cell cycle status, apoptosis and HIV-1 infection in monocytic THP-1 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonifati, Serena; Daly, Michele B.; St Gelais, Corine

SAMHD1 limits HIV-1 infection in non-dividing myeloid cells by decreasing intracellular dNTP pools. HIV-1 restriction by SAMHD1 in these cells likely prevents activation of antiviral immune responses and modulates viral pathogenesis, thus highlighting a critical role of SAMHD1 in HIV-1 physiopathology. Here, we explored the function of SAMHD1 in regulating cell proliferation, cell cycle progression and apoptosis in monocytic THP-1 cells. Using the CRISPR/Cas9 technology, we generated THP-1 cells with stable SAMHD1 knockout. We found that silencing of SAMHD1 in cycling cells stimulates cell proliferation, redistributes cell cycle population in the G{sub 1}/G{sub 0} phase and reduces apoptosis. These alterationsmore » correlated with increased dNTP levels and more efficient HIV-1 infection in dividing SAMHD1 knockout cells relative to control. Our results suggest that SAMHD1, through its dNTPase activity, affects cell proliferation, cell cycle distribution and apoptosis, and emphasize a key role of SAMHD1 in the interplay between cell cycle regulation and HIV-1 infection.« less

Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

PubMed

Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

2017-09-12

Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

The forkhead-like transcription factor (Fhl1p) maintains yeast replicative lifespan by regulating ribonucleotide reductase 1 (RNR1) gene transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tai, Akiko; Kamei, Yuka; Mukai, Yukio

In eukaryotes, numerous genetic factors contribute to the lifespan including metabolic enzymes, signal transducers, and transcription factors. As previously reported, the forkhead-like transcription factor (FHL1) gene was required for yeast replicative lifespan and cell proliferation. To determine how Fhl1p regulates the lifespan, we performed a DNA microarray analysis of a heterozygous diploid strain deleted for FHL1. We discovered numerous Fhl1p-target genes, which were then screened for lifespan-regulating activity. We identified the ribonucleotide reductase (RNR) 1 gene (RNR1) as a regulator of replicative lifespan. RNR1 encodes a large subunit of the RNR complex, which consists of two large (Rnr1p/Rnr3p) and twomore » small (Rnr2p/Rnr4p) subunits. Heterozygous deletion of FHL1 reduced transcription of RNR1 and RNR3, but not RNR2 and RNR4. Chromatin immunoprecipitation showed that Fhl1p binds to the promoter regions of RNR1 and RNR3. Cells harboring an RNR1 deletion or an rnr1-C428A mutation, which abolishes RNR catalytic activity, exhibited a short lifespan. In contrast, cells with a deletion of the other RNR genes had a normal lifespan. Overexpression of RNR1, but not RNR3, restored the lifespan of the heterozygous FHL1 mutant to the wild-type (WT) level. The Δfhl1/FHL1 mutant conferred a decrease in dNTP levels and an increase in hydroxyurea (HU) sensitivity. These findings reveal that Fhl1p regulates RNR1 gene transcription to maintain dNTP levels, thus modulating longevity by protection against replication stress. - Highlights: • Fhl1p regulates replicative lifespan and transcription of RNR large subunit genes. • Rnr1p uniquely acts as a lifespan regulator independent of the RNR complex. • dNTP levels modulate longevity by protection against replication stress.« less

A fuel-limited isothermal DNA machine for the sensitive detection of cellular deoxyribonucleoside triphosphates.

PubMed

Dong, Jiantong; Wu, Tongbo; Xiao, Yu; Xu, Lei; Fang, Simin; Zhao, Meiping

2016-09-29

A fuel-limited isothermal DNA machine has been built for the sensitive fluorescence detection of cellular deoxyribonucleoside triphosphates (dNTPs) at the fmol level, which greatly reduces the required sample cell number. Upon the input of the limiting target dNTP, the machine runs automatically at 37 °C without the need for higher temperature.

Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA

PubMed Central

Hoberg, Emily; Szilagyi, Zsolt; Taylor, Robert W.; Gustafsson, Claes M.; Falkenberg, Maria

2017-01-01

Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA) and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP) pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication. PMID:28207748

Antiretroviral therapy-induced mitochondrial toxicity: potential mechanisms beyond polymerase-γ inhibition.

PubMed

Selvaraj, S; Ghebremichael, M; Li, M; Foli, Y; Langs-Barlow, A; Ogbuagu, A; Barakat, L; Tubridy, E; Edifor, R; Lam, W; Cheng, Y-C; Paintsil, E

2014-07-01

We hypothesized that competition between nucleotide reverse-transcriptase inhibitor triphosphate and endogenous deoxyribonucleotide triphosphate (dNTP) may lead to depletion of dNTP pools and mitochondrial dysfunction independent of polymerase-γ (pol-γ) inhibition. We collected peripheral blood mononuclear cells from 75 adults (25 cases: HIV-infected patients with mitochondrial toxicity, 25 HIV-infected positive controls, and 25 HIV-negative controls). We observed statistically significant individual and group differences in ribonucleotide (RN) and deoxyribonucleotide (dRN) pools. The median values for the RN pools were 10,062 (interquartile range (IQR): 7,090-12,590), 4,360 (IQR: 3,058-6,838), and 2,968 (IQR: 2,538-4,436) pmol/10(6) cells for negative controls, positive controls, and cases, respectively. Cases had significantly higher absolute mitochondrial DNA copy number as compared with negative controls (P < 0.05). Moreover, cases had significantly higher expression levels of pol-γ, nucleotide transporters, cellular kinases, and adenosine triphosphate (ATP)-binding cassette (ABC) proteins as compared with controls. Antiretroviral therapy (ART) perturbs RN and dRN pools. Depletion of RN and dRN pools may be associated with ART-induced mitochondrial toxicity independent of pol-γ inhibition.

DNA Precursor Metabolism and Mitochondrial Genome Stability

DTIC Science & Technology

2003-04-01

mitochondrial DNA replication , to learn how the pool sizes are regulated, and to understand how perturbations of normal dNTP metabolism within the...mitochondria raises the possibility, however unlikely, that it is serving a function in addition to its role in DNA replication . The literature on non-DNA...is below since many authors do not follow the 200 word limit 14. SUBJECT TERMS Mitochondria, Genome stability, DNA precursors, Mitochondrial DNA

Pyrosequencing for Microbial Identification and Characterization

PubMed Central

Cummings, Patrick J.; Ahmed, Ray; Durocher, Jeffrey A.; Jessen, Adam; Vardi, Tamar; Obom, Kristina M.

2013-01-01

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns. PMID:23995536

Pyrosequencing for microbial identification and characterization.

PubMed

Cummings, Patrick J; Ahmed, Ray; Durocher, Jeffrey A; Jessen, Adam; Vardi, Tamar; Obom, Kristina M

2013-08-22

Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns.

Potent Inhibition of HIV-1 Replication in Resting CD4 T Cells by Resveratrol and Pterostilbene

PubMed Central

Chan, Chi N.; Trinité, Benjamin

2017-01-01

ABSTRACT HIV-1 infection of resting CD4 T cells plays a crucial and numerically dominant role during virus transmission at mucosal sites and during subsequent acute replication and T cell depletion. Resveratrol and pterostilbene are plant stilbenoids associated with several health-promoting benefits. Resveratrol has been shown to inhibit the replication of several viruses, including herpes simplex viruses 1 and 2, papillomaviruses, severe acute respiratory syndrome virus, and influenza virus. Alone, resveratrol does not inhibit HIV-1 infection of activated T cells, but it does synergize with nucleoside reverse transcriptase inhibitors in these cells to inhibit reverse transcription. Here, we demonstrate that resveratrol and pterostilbene completely block HIV-1 infection at a low micromolar dose in resting CD4 T cells, primarily at the reverse transcription step. The anti-HIV effect was fully reversed by exogenous deoxynucleosides and Vpx, an HIV-1 and simian immunodeficiency virus protein that increases deoxynucleoside triphosphate (dNTP) levels. These findings are consistent with the reported ability of resveratrol to inhibit ribonucleotide reductase and to lower dNTP levels in cells. This study supports the potential use of resveratrol, pterostilbene, or related compounds as adjuvants in anti-HIV preexposure prophylaxis (PrEP) formulations. PMID:28652233

Potent Inhibition of HIV-1 Replication in Resting CD4 T Cells by Resveratrol and Pterostilbene.

PubMed

Chan, Chi N; Trinité, Benjamin; Levy, David N

2017-09-01

HIV-1 infection of resting CD4 T cells plays a crucial and numerically dominant role during virus transmission at mucosal sites and during subsequent acute replication and T cell depletion. Resveratrol and pterostilbene are plant stilbenoids associated with several health-promoting benefits. Resveratrol has been shown to inhibit the replication of several viruses, including herpes simplex viruses 1 and 2, papillomaviruses, severe acute respiratory syndrome virus, and influenza virus. Alone, resveratrol does not inhibit HIV-1 infection of activated T cells, but it does synergize with nucleoside reverse transcriptase inhibitors in these cells to inhibit reverse transcription. Here, we demonstrate that resveratrol and pterostilbene completely block HIV-1 infection at a low micromolar dose in resting CD4 T cells, primarily at the reverse transcription step. The anti-HIV effect was fully reversed by exogenous deoxynucleosides and Vpx, an HIV-1 and simian immunodeficiency virus protein that increases deoxynucleoside triphosphate (dNTP) levels. These findings are consistent with the reported ability of resveratrol to inhibit ribonucleotide reductase and to lower dNTP levels in cells. This study supports the potential use of resveratrol, pterostilbene, or related compounds as adjuvants in anti-HIV preexposure prophylaxis (PrEP) formulations. Copyright © 2017 American Society for Microbiology.

Aptamer Selection Express: A Novel Method for Rapid Single-Step Selection and Sensing of Aptamers

DTIC Science & Technology

2008-12-01

sample) was as follows: 5 µL buffer, 2 µL MgCl2, 2.5 µL DMSO, 1 µL betaine , 1 µL each dNTP, 2.5 µL F primer, 2.5 µL R primer, 0.54 µL taq polymerase...and 25.1 µL H2O. Betaine and increased DMSO were added to the master mix to eliminate polymerase jumping during PCR ampli- fication.10 Using the

Singlet Oxygen-Mediated Oxidation during UVA Radiation Alters the Dynamic of Genomic DNA Replication

PubMed Central

Graindorge, Dany; Martineau, Sylvain; Machon, Christelle; Arnoux, Philippe; Guitton, Jérôme; Francesconi, Stefania; Frochot, Céline; Sage, Evelyne; Girard, Pierre-Marie

2015-01-01

UVA radiation (320–400 nm) is a major environmental agent that can exert its deleterious action on living organisms through absorption of the UVA photons by endogenous or exogenous photosensitizers. This leads to the production of reactive oxygen species (ROS), such as singlet oxygen (1O2) and hydrogen peroxide (H2O2), which in turn can modify reversibly or irreversibly biomolecules, such as lipids, proteins and nucleic acids. We have previously reported that UVA-induced ROS strongly inhibit DNA replication in a dose-dependent manner, but independently of the cell cycle checkpoints activation. Here, we report that the production of 1O2 by UVA radiation leads to a transient inhibition of replication fork velocity, a transient decrease in the dNTP pool, a quickly reversible GSH-dependent oxidation of the RRM1 subunit of ribonucleotide reductase and sustained inhibition of origin firing. The time of recovery post irradiation for each of these events can last from few minutes (reduction of oxidized RRM1) to several hours (replication fork velocity and origin firing). The quenching of 1O2 by sodium azide prevents the delay of DNA replication, the decrease in the dNTP pool and the oxidation of RRM1, while inhibition of Chk1 does not prevent the inhibition of origin firing. Although the molecular mechanism remains elusive, our data demonstrate that the dynamic of replication is altered by UVA photosensitization of vitamins via the production of singlet oxygen. PMID:26485711

Single-Stranded Nucleic Acids Bind to the Tetramer Interface of SAMHD1 and Prevent Formation of the Catalytic Homotetramer.

PubMed

Seamon, Kyle J; Bumpus, Namandjé N; Stivers, James T

2016-11-08

Sterile alpha motif and HD domain protein 1 (SAMHD1) is a unique enzyme that plays important roles in nucleic acid metabolism, viral restriction, and the pathogenesis of autoimmune diseases and cancer. Although much attention has been focused on its dNTP triphosphohydrolase activity in viral restriction and disease, SAMHD1 also binds to single-stranded RNA and DNA. Here we utilize a UV cross-linking method using 5-bromodeoxyuridine-substituted oligonucleotides coupled with high-resolution mass spectrometry to identify the binding site for single-stranded nucleic acids (ssNAs) on SAMHD1. Mapping cross-linked amino acids on the surface of existing crystal structures demonstrated that the ssNA binding site lies largely along the dimer-dimer interface, sterically blocking the formation of the homotetramer required for dNTPase activity. Surprisingly, the disordered C-terminus of SAMHD1 (residues 583-626) was also implicated in ssNA binding. An interaction between this region and ssNA was confirmed in binding studies using the purified SAMHD1 583-626 peptide. Despite a recent report that SAMHD1 possesses polyribonucleotide phosphorylase activity, we did not detect any such activity in the presence of inorganic phosphate, indicating that nucleic acid binding is unrelated to this proposed activity. These data suggest an antagonistic regulatory mechanism in which the mutually exclusive oligomeric state requirements for ssNA binding and dNTP hydrolase activity modulate these two functions of SAMHD1 within the cell.

p21 Restricts HIV-1 in Monocyte-Derived Dendritic Cells through the Reduction of Deoxynucleoside Triphosphate Biosynthesis and Regulation of SAMHD1 Antiviral Activity.

PubMed

Valle-Casuso, Jose Carlos; Allouch, Awatef; David, Annie; Lenzi, Gina M; Studdard, Lydia; Barré-Sinoussi, Françoise; Müller-Trutwin, Michaela; Kim, Baek; Pancino, Gianfranco; Sáez-Cirión, Asier

2017-12-01

HIV-1 infection of noncycling cells, such as dendritic cells (DCs), is impaired due to limited availability of deoxynucleoside triphosphates (dNTPs), which are needed for HIV-1 reverse transcription. The levels of dNTPs are tightly regulated during the cell cycle and depend on the balance between dNTP biosynthesis and degradation. SAMHD1 potently blocks HIV-1 replication in DCs, although the underlying mechanism is still unclear. SAMHD1 has been reported to be able to degrade dNTPs and viral nucleic acids, which may both hamper HIV-1 reverse transcription. The relative contribution of these activities may differ in cycling and noncycling cells. Here, we show that inhibition of HIV-1 replication in monocyte-derived DCs (MDDCs) is associated with an increased expression of p21cip1/waf, a cell cycle regulator that is involved in the differentiation and maturation of DCs. Induction of p21 in MDDCs decreases the pool of dNTPs and increases the antiviral active isoform of SAMHD1. Although both processes are complementary in inhibiting HIV-1 replication, the antiviral activity of SAMHD1 in our primary cell model appears to be, at least partially, independent of its dNTPase activity. The reduction in the pool of dNTPs in MDDCs appears rather mostly due to a p21-mediated suppression of several enzymes involved in dNTP synthesis (i.e., RNR2, TYMS, and TK-1). These results are important to better understand the interplay between HIV-1 and DCs and may inform the design of new therapeutic approaches to decrease viral dissemination and improve immune responses against HIV-1. IMPORTANCE DCs play a key role in the induction of immune responses against HIV. However, HIV has evolved ways to exploit these cells, facilitating immune evasion and virus dissemination. We have found that the expression of p21, a cyclin-dependent kinase inhibitor involved in cell cycle regulation and monocyte differentiation and maturation, potentially can contribute to the inhibition of HIV-1 replication in monocyte-derived DCs through multiple mechanisms. p21 decreased the size of the intracellular dNTP pool. In parallel, p21 prevented SAMHD1 phosphorylation and promoted SAMHD1 dNTPase-independent antiviral activity. Thus, induction of p21 resulted in conditions that allowed the effective inhibition of HIV-1 replication through complementary mechanisms. Overall, p21 appears to be a key regulator of HIV infection in myeloid cells. Copyright © 2017 American Society for Microbiology.

The ribonuclease activity of SAMHD1 is required for HIV-1 restriction

PubMed Central

Ryoo, Jeongmin; Choi, Jongsu; Oh, Changhoon; Kim, Sungchul; Seo, Minji; Kim, Seokyoung; Seo, Daekwan; Kim, Jongkyu; White, Tommy E.; Brandariz-Nunez, Alberto; Diaz-Griffero, Felipe; Yun, Cheol-Heui; Hollenbaugh, Joseph A.; Kim, Baek; Baek, Daehyun

2015-01-01

The HIV-1 restriction factor SAMHD11,2 is proposed to inhibit HIV-1 replication by depleting the intracellular dNTP pool3-5. However, the phosphorylation of SAMHD1 regulates its ability to restrict HIV-1 without decreasing cellular dNTP levels6-8, which is not consistent with a role for SAMHD1 dNTPase activity in HIV-1 restriction. Here, we show that SAMHD1 possesses RNase activity and that the RNase but not the dNTPase function is essential for HIV-1 restriction. By enzymatically characterizing Aicardi-Goutières syndrome (AGS)-associated SAMHD1 mutations and mutations in the allosteric dGTP-binding site of SAMHD1, we identify SAMHD1 mutants that are RNase-positive but dNTPase-negative (SAMHD1D137N) or RNase-negative but dNTPase-positive (SAMHD1Q548A). The allosteric mutant SAMHD1D137N is able to restrict HIV-1 infection, whereas the AGS mutant SAMHD1Q548A is defective for HIV-1 restriction. SAMHD1 associates with HIV-1 RNA and degrades it during the early phases of infection. SAMHD1 silencing in macrophages and CD4+ T cells from healthy donors increases HIV-1 RNA stability, rendering the cells permissive for HIV-1 infection. Furthermore, the phosphorylation of SAMHD1 at T592 negatively regulates its RNase activity in vivo and impedes HIV-1 restriction. Our results reveal that the RNase activity of SAMHD1 is responsible for preventing HIV-1 infection by directly degrading the HIV-1 RNA. PMID:25038827

A Rapid and Inexpensive PCR-Based STR Genotyping Method for Identifying Forensic Specimens

DTIC Science & Technology

2006-06-01

this report) 20. Security Classif. (of this page) 21 . No. of Pages 22. Price Unclassified Unclassified 18 Form DOT F 1700.7 (8-72) Reproduction of...Promega PowerPlex 2.1 system (7) except that the buffer was 1x Amplitaq gold reaction buffer, 0.1% TritonX-100, and 0.2mM each dNTP in a 25µl final...electrophoresis were done using the PowerPlex 16 System (Promega Corp.; Madison, WI). rEsulTs ANd dIsCussION The goal of this study was to develop a simple DNA

Molecular Dynamics Study of the Opening Mechanism for DNA Polymerase I

PubMed Central

Miller, Bill R.; Parish, Carol A.; Wu, Eugene Y.

2014-01-01

During DNA replication, DNA polymerases follow an induced fit mechanism in order to rapidly distinguish between correct and incorrect dNTP substrates. The dynamics of this process are crucial to the overall effectiveness of catalysis. Although X-ray crystal structures of DNA polymerase I with substrate dNTPs have revealed key structural states along the catalytic pathway, solution fluorescence studies indicate that those key states are populated in the absence of substrate. Herein, we report the first atomistic simulations showing the conformational changes between the closed, open, and ajar conformations of DNA polymerase I in the binary (enzyme∶DNA) state to better understand its dynamics. We have applied long time-scale, unbiased molecular dynamics to investigate the opening process of the fingers domain in the absence of substrate for B. stearothermophilis DNA polymerase in silico. These simulations are biologically and/or physiologically relevant as they shed light on the transitions between states in this important enzyme. All closed and ajar simulations successfully transitioned into the fully open conformation, which is known to be the dominant binary enzyme-DNA conformation from solution and crystallographic studies. Furthermore, we have detailed the key stages in the opening process starting from the open and ajar crystal structures, including the observation of a previously unknown key intermediate structure. Four backbone dihedrals were identified as important during the opening process, and their movements provide insight into the recognition of dNTP substrate molecules by the polymerase binary state. In addition to revealing the opening mechanism, this study also demonstrates our ability to study biological events of DNA polymerase using current computational methods without biasing the dynamics. PMID:25474643

Kinetic analysis of bypass of abasic site by the catalytic core of yeast DNA polymerase eta.

PubMed

Yang, Juntang; Wang, Rong; Liu, Binyan; Xue, Qizhen; Zhong, Mengyu; Zeng, Hao; Zhang, Huidong

2015-09-01

Abasic sites (Apurinic/apyrimidinic (AP) sites), produced ∼ 50,000 times/cell/day, are very blocking and miscoding. To better understand miscoding mechanisms of abasic site for yeast DNA polymerase η, pre-steady-state nucleotide incorporation and LC-MS/MS sequence analysis of extension product were studied using pol η(core) (catalytic core, residues 1-513), which can completely eliminate the potential effects of the C-terminal C2H2 motif of pol η on dNTP incorporation. The extension beyond the abasic site was very inefficient. Compared with incorporation of dCTP opposite G, the incorporation efficiencies opposite abasic site were greatly reduced according to the order of dGTP > dATP > dCTP and dTTP. Pol η(core) showed no fast burst phase for any incorporation opposite G or abasic site, suggesting that the catalytic step is not faster than the dissociation of polymerase from DNA. LC-MS/MS sequence analysis of extension products showed that 53% products were dGTP misincorporation, 33% were dATP and 14% were -1 frameshift, indicating that Pol η(core) bypasses abasic site by a combined G-rule, A-rule and -1 frameshift deletions. Compared with full-length pol η, pol η(core) relatively reduced the efficiency of incorporation of dCTP opposite G, increased the efficiencies of dNTP incorporation opposite abasic site and the exclusive incorporation of dGTP opposite abasic site, but inhibited the extension beyond abasic site, and increased the priority in extension of A: abasic site relative to G: abasic site. This study provides further understanding in the mutation mechanism of abasic sites for yeast DNA polymerase η. Copyright © 2015 Elsevier B.V. All rights reserved.

How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

PubMed

Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

2014-04-02

A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

Using a Fluorescent Cytosine Analogue tC[superscript o] To Probe the Effect of the Y567 to Ala Substitution on the Preinsertion Steps of dNMP Incorporation by RB69 DNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xia, Shuangluo; Beckman, Jeff; Wang, Jimin

2012-10-10

Residues in the nascent base pair binding pocket (NBP) of bacteriophage RB69 DNA polymerase (RB69pol) are responsible for base discrimination. Replacing Tyr567 with Ala leads to greater flexibility in the NBP, increasing the probability of misincorporation. We used the fluorescent cytosine analogue, 1,3-diaza-2-oxophenoxazine (tC{sup o}), to identify preinsertion step(s) altered by NBP flexibility. When tC{sup o} is the templating base in a wild-type (wt) RB69pol ternary complex, its fluorescence is quenched only in the presence of dGTP. However, with the RB69pol Y567A mutant, the fluorescence of tC{sup o} is also quenched in the presence of dATP. We determined the crystalmore » structure of the dATP/tC{sup o}-containing ternary complex of the RB69pol Y567A mutant at 1.9 {angstrom} resolution and found that the incoming dATP formed two hydrogen bonds with an imino-tautomerized form of tC{sup o}. Stabilization of the dATP/tC{sup o} base pair involved movement of the tC{sup o} backbone sugar into the DNA minor groove and required tilting of the tC{sup o} tricyclic ring to prevent a steric clash with L561. This structure, together with the pre-steady-state kinetic parameters and dNTP binding affinity, estimated from equilibrium fluorescence titrations, suggested that the flexibility of the NBP, provided by the Y567 to Ala substitution, led to a more favorable forward isomerization step resulting in an increase in dNTP binding affinity.« less

Uncovering allostery and regulation in SAMHD1 through molecular dynamics simulations.

PubMed

Patra, Kajwal Kumar; Bhattacharya, Akash; Bhattacharya, Swati

2017-07-01

The human sterile alpha motif and HD domain-containing protein 1 (SAMHD1) is a retroviral restriction factor in myeloid cells and non-cycling CD4+ T cells, a feature imputed to its phosphohydrolase activity-the enzyme depletes the cellular dNTP levels inhibiting reverse transcription. The functionally active form of SAMHD1 is an allosterically triggered tetramer which utilizes GTP-Mg +2 -dNTP cross bridges to link and stabilize adjacent monomers. However, very little is known about how it assembles into a tetramer and how long the tetramer stays intact. In this computational study, we provide a molecular dynamics based analysis of the structural stability and allosteric site dynamics in SAMHD1. We have investigated the allosteric links which assemble and hold the tetramer together. We have also extended this analysis to a regulatory mutant of SAMHD1. Experimental studies have indicated that phosphorylation of T592 downregulates HIV-1 restriction. A similar result is also achieved by a phosphomimetic mutation T592E. While a mechanistic understanding of the process is still elusive, the loss of structural integrity of the enzyme is conjectured to be the cause of the impaired dNTPase activity of the T592E mutant. MD simulations show that the T592E mutation causes slightly elevated local motions which remain confined to the short helix (residues 591-595), which contains the phosphorylation site and do not cause long-range destabilization of the SAMHD1 tetramer within the timeframe of the simulations. Thus, the regulatory mechanism of SAMHD1 is a more subtle mechanism than has been previously suspected. Proteins 2017; 85:1266-1275. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

The mechano-chemistry of a monomeric reverse transcriptase

PubMed Central

Malik, Omri; Khamis, Hadeel; Rudnizky, Sergei

2017-01-01

Abstract Retroviral reverse transcriptase catalyses the synthesis of an integration-competent dsDNA molecule, using as a substrate the viral RNA. Using optical tweezers, we follow the Murine Leukemia Virus reverse transcriptase as it performs strand-displacement polymerization on a template under mechanical force. Our results indicate that reverse transcriptase functions as a Brownian ratchet, with dNTP binding as the rectifying reaction of the ratchet. We also found that reverse transcriptase is a relatively passive enzyme, able to polymerize on structured templates by exploiting their thermal breathing. Finally, our results indicate that the enzyme enters the recently characterized backtracking state from the pre-translocation complex. PMID:29165701

Template-independent DNA synthesis activity associated with the reverse transcriptase of the long terminal repeat retrotransposon Tf1.

PubMed

Oz-Gleenberg, Iris; Herzig, Eytan; Hizi, Amnon

2012-01-01

Reverse transcriptases (RTs) possess a non-templated addition (NTA) activity while synthesizing DNA with blunt-ended DNA primer/templates. Interestingly, the RT of the long terminal repeat retrotransposon Tf1 has an NTA activity that is substantially higher than that of HIV-1 or murine leukemia virus RTs. By performing steady state kinetics, we found that the differences between the NTA activities of Tf1 and HIV-1 RTs can be explained by the substantially lower K(M) value for the incoming dNTP of Tf1 RT (while the differences between the apparent k(cat) values of these two RTs are relatively small). Furthermore, the K(M) values, calculated for both RTs with the same dNTP, are much lower for the template-dependent synthesis (TDS) than those of NTA. However, TDS of HIV-1 RT is higher than that of Tf1 RT. The overall relative order of the apparent k(cat)/K(M) values for dATP is: HIV-1 RT (TDS) > Tf1 RT (TDS) > Tf1 RT (NTA) > HIV-1 RT (NTA). Under the employed conditions, Tf1 RT can add up to seven nucleotides to the blunt-ended substrate, while the other RTs add mostly a single nucleotide. The NTA activity of Tf1 RT is restricted to DNA primers. Furthermore, the NTA activity of Tf1 and HIV-1 RTs is suppressed by ATP, as it competes with the incoming dATP (although ATP is not incorporated by the NTA activity of the RTs). The unusually high NTA activity of Tf1 RT can explain why, after completing cDNA synthesis, the in vivo generated Tf1 cDNA has relatively long extra sequences beyond the highly conserved CA at its 3'-ends. © 2011 The Authors Journal compilation © 2011 FEBS.

Mechanistic Investigation of the Bypass of a Bulky Aromatic DNA Adduct Catalyzed by a Y-family DNA Polymerase

PubMed Central

Gadkari, Varun V.; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai

2014-01-01

3-Nitrobenzanthrone (3-NBA), a nitropolyaromatic hydrocarbon (NitroPAH) pollutant in diesel exhaust, is a potent mutagen and carcinogen. After metabolic activation, the primary metabolites of 3-NBA react with DNA to form dG and dA adducts. One of the three major adducts identified is N-(2’-deoxyguanosin-8-yl)-3-aminobenzanthrone (dGC8-N-ABA). This bulky adduct likely stalls replicative DNA polymerases but can be traversed by lesion bypass polymerases in vivo. Here, we employed running start assays to show that a site-specifically placed dGC8-N-ABA is bypassed in vitro by Sulfolobus solfataricus DNA polymerase IV (Dpo4), a model Y-family DNA polymerase. However, the nucleotide incorporation rate of Dpo4 was significantly reduced opposite both the lesion and the template position immediately downstream from the lesion site, leading to two strong pause sites. To investigate the kinetic effect of dGC8-N-ABA on polymerization, we utilized pre-steady-state kinetic methods to determine the kinetic parameters for individual nucleotide incorporations upstream, opposite, and downstream from the dGC8-N-ABA lesion. Relative to the replication of the corresponding undamaged DNA template, both nucleotide incorporation efficiency and fidelity of Dpo4 were considerably decreased during dGC8-N-ABA lesion bypass and the subsequent extension step. The lower nucleotide incorporation efficiency caused by the lesion is a result of a significantly reduced dNTP incorporation rate constant and modestly weaker dNTP binding affinity. At both pause sites, nucleotide incorporation followed biphasic kinetics with a fast and a slow phase and their rates varied with nucleotide concentration. In contrast, only the fast phase was observed with undamaged DNA. A kinetic mechanism was proposed for the bypass of dGC8-N-ABA bypass catalyzed by Dpo4. PMID:25048879

Mechanistic investigation of the bypass of a bulky aromatic DNA adduct catalyzed by a Y-family DNA polymerase.

PubMed

Gadkari, Varun V; Tokarsky, E John; Malik, Chanchal K; Basu, Ashis K; Suo, Zucai

2014-09-01

3-Nitrobenzanthrone (3-NBA), a nitropolyaromatic hydrocarbon (NitroPAH) pollutant in diesel exhaust, is a potent mutagen and carcinogen. After metabolic activation, the primary metabolites of 3-NBA react with DNA to form dG and dA adducts. One of the three major adducts identified is N-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone (dG(C8-N-ABA)). This bulky adduct likely stalls replicative DNA polymerases but can be traversed by lesion bypass polymerases in vivo. Here, we employed running start assays to show that a site-specifically placed dG(C8-N-ABA) is bypassed in vitro by Sulfolobus solfataricus DNA polymerase IV (Dpo4), a model Y-family DNA polymerase. However, the nucleotide incorporation rate of Dpo4 was significantly reduced opposite both the lesion and the template position immediately downstream from the lesion site, leading to two strong pause sites. To investigate the kinetic effect of dG(C8-N-ABA) on polymerization, we utilized pre-steady-state kinetic methods to determine the kinetic parameters for individual nucleotide incorporations upstream, opposite, and downstream from the dG(C8-N-ABA) lesion. Relative to the replication of the corresponding undamaged DNA template, both nucleotide incorporation efficiency and fidelity of Dpo4 were considerably decreased during dG(C8-N-ABA) lesion bypass and the subsequent extension step. The lower nucleotide incorporation efficiency caused by the lesion is a result of a significantly reduced dNTP incorporation rate constant and modestly weaker dNTP binding affinity. At both pause sites, nucleotide incorporation followed biphasic kinetics with a fast and a slow phase and their rates varied with nucleotide concentration. In contrast, only the fast phase was observed with undamaged DNA. A kinetic mechanism was proposed for the bypass of dG(C8-N-ABA) bypass catalyzed by Dpo4. Copyright © 2014 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Surajit; Christov, Plamen P.; Kozekova, Albena

trans-4-Hydroxynonenal (HNE) is the major peroxidation product of {omega}-6 polyunsaturated fatty acids in vivo. Michael addition of the N{sub 2}-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N{sub 2}-dGuo (1,N{sub 2}-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPsmore » to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua {yields} Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, the (6S,8R,11S)-1,N{sub 2}-dGuo lesion remained in the ring-closed conformation at the active site. The incoming dNTP, either dGTP or dATP, was positioned with Watson-Crick pairing opposite the template 5'-neighbor base, dCyt or dThy, respectively. In contrast, for the 18-mer:14-mer template-primers with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, ring opening of the adduct to the corresponding N{sub 2}-dGuo aldehyde species occurred. This allowed Watson-Crick base pairing at the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair.« less

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Gemcitabine and Nucleos(t)ide Synthesis Inhibitors Are Broad-Spectrum Antiviral Drugs that Activate Innate Immunity.

PubMed

Shin, Hye Jin; Kim, Chonsaeng; Cho, Sungchan

2018-04-20

Nucleoside analogs have been frequently identified as antiviral agents. In recent years, gemcitabine, a cytidine analog in clinical use for the treatment of many solid tumors, was also shown to have antiviral activity against a broad range of viruses. Nucleoside analogs generally interfere with cellular nucleos(t)ide synthesis pathways, resulting in the depletion or imbalance of (d)NTP pools. Intriguingly, a few recent reports have shown that some nucleoside analogs, including gemcitabine, activated innate immunity, inducing the expression of interferon-stimulated genes, through nucleos(t)ide synthesis inhibition. The precise crosstalk between these two independent processes remains to be determined. Nonetheless, we summarize the current knowledge of nucleos(t)ide synthesis inhibition-related innate immunity and propose it as a newly emerging antiviral mechanism of nucleoside analogs.

Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

DOEpatents

Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

2001-01-01

Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

Identification of Non-nucleoside Human Ribonucleotide Reductase Modulators

DOE PAGES

Ahmad, Md. Faiz; Huff, Sarah E.; Pink, John; ...

2015-10-21

Ribonucleotide reductase (RR) catalyzes the rate-limiting step of dNTP synthesis and is an established cancer target. Drugs targeting RR are mainly nucleoside in nature. In this study, we sought to identify non-nucleoside small-molecule inhibitors of RR. Using virtual screening, binding affinity, inhibition, and cell toxicity, we have discovered a class of small molecules that alter the equilibrium of inactive hexamers of RR, leading to its inhibition. Several unique chemical categories, including a phthalimide derivative, show micromolar IC 50s and K Ds while demonstrating cytotoxicity. A crystal structure of an active phthalimide binding at the targeted interface supports the noncompetitive modemore » of inhibition determined by kinetic studies. Furthermore, the phthalimide shifts the equilibrium from dimer to hexamer. Finally, together, these data identify several novel non-nucleoside inhibitors of human RR which act by stabilizing the inactive form of the enzyme.« less

A study of deoxyribonucleotide metabolism and its relation to DNA synthesis. Supercomputer simulation and model-system analysis.

PubMed

Heinmets, F; Leary, R H

1991-06-01

A model system (1) was established to analyze purine and pyrimidine metabolism. This system has been expanded to include macrosimulation of DNA synthesis and the study of its regulation by terminal deoxynucleoside triphosphates (dNTPs) via a complex set of interactions. Computer experiments reveal that our model exhibits adequate and reasonable sensitivity in terms of dNTP pool levels and rates of DNA synthesis when inputs to the system are varied. These simulation experiments reveal that in order to achieve maximum DNA synthesis (in terms of purine metabolism), a proper balance is required in guanine and adenine input into this metabolic system. Excessive inputs will become inhibitory to DNA synthesis. In addition, studies are carried out on rates of DNA synthesis when various parameters are changed quantitatively. The current system is formulated by 110 differential equations.

Cytotoxicity and Antineoplastic Activities of Alkylamines and Their Borane Derivatives

PubMed Central

Tse, Elaine Y.; Muhammad, Rosallah A.

1996-01-01

The alkylamines and their related boron derivatives demonstrated potent cytotoxicity against the growth of murine and human tissue cultured cells. These agents did not necessarily require the boron atom to possess potent cytotoxic action in certain tumor lines. Their ability to suppress tumor cell growth was based on their inhibition of DNA and protein syntheses. DNA synthesis was reduced because purine synthesis was blocked at the enzyme site of IMP dehydrogenase by the agents. In addition ribonucleotide reductase and nucleoside kinase activities were reduced by the agents which would account for the reduced d[NTP] pools. The DNA template or molecule may be a target of the drugs with regard to binding of the drug to nucleoside bases or intercalaction of the drug between DNA base pairs. Only some Of the agents caused DNA fragmentation with reduced DNA viscosity. These effects would contribute to overall cell death afforded by the agents. PMID:18472803

Novel multiplex qualitative detection using universal primer-multiplex-PCR combined with pyrosequencing.

PubMed

Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun

2017-12-15

This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.

The SAMHD1 dNTP Triphosphohydrolase Is Controlled by a Redox Switch.

PubMed

Mauney, Christopher H; Rogers, LeAnn C; Harris, Reuben S; Daniel, Larry W; Devarie-Baez, Nelmi O; Wu, Hanzhi; Furdui, Cristina M; Poole, Leslie B; Perrino, Fred W; Hollis, Thomas

2017-12-01

Proliferative signaling involves reversible posttranslational oxidation of proteins. However, relatively few molecular targets of these modifications have been identified. We investigate the role of protein oxidation in regulation of SAMHD1 catalysis. Here we report that SAMHD1 is a major target for redox regulation of nucleotide metabolism and cell cycle control. SAMHD1 is a triphosphate hydrolase, whose function involves regulation of deoxynucleotide triphosphate pools. We demonstrate that the redox state of SAMHD1 regulates its catalytic activity. We have identified three cysteine residues that constitute an intrachain disulfide bond "redox switch" that reversibly inhibits protein tetramerization and catalysis. We show that proliferative signals lead to SAMHD1 oxidation in cells and oxidized SAMHD1 is localized outside of the nucleus. Innovation and Conclusions: SAMHD1 catalytic activity is reversibly regulated by protein oxidation. These data identify a previously unknown mechanism for regulation of nucleotide metabolism by SAMHD1. Antioxid. Redox Signal. 27, 1317-1331.

A defect in the thymidine kinase 2 gene causing isolated mitochondrial myopathy without mtDNA depletion.

PubMed

Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D

2008-07-01

Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.

Fatty acid carbon is essential for dNTP synthesis in endothelial cells

PubMed Central

Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter

2015-01-01

The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893

[Control levels of Sin3 histone deacetylase for spontaneous and UV-induced mutagenesis in yeasts Saccharomyces cerevisiae].

PubMed

Lebovka, I Iu; Kozhina, T N; Fedorova, I V; Peshekhonov, V T; Evstiukhina, T A; Chernenkov, A Iu; Korolev, V G

2014-01-01

SIN3 gene product operates as a repressor for a huge amount of genes in Saccharomyces cerevisiae. Sin3 protein with a mass of about 175 kDa is a member of the RPD3 protein complex with an assessed mass of greater than 2 million Da. It was previously shownthat RPD3 gene mutations influence recombination and repair processes in S. cerevisiae yeasts. We studied the impacts of the sin3 mutation on UV-light sensitivity and UV-induced mutagenesis in budding yeast cells. The deletion ofthe SIN3 gene causes weak UV-sensitivity of mutant budding cells as compared to the wild-type strain. These results show that the sin3 mutation decreases both spontaneous and UV-induced levels of levels. This fact is hypothetically related to themalfunction of ribonucleotide reductase activity regulation, which leads to a decrease in the dNTP pool and the inaccurate error-prone damage bypass postreplication repair pathway, which in turn provokes a reduction in the incidence of mutations.

Investigating the Molecular Mechanism of TSO1 Function in Arabidopsis cell division and meristem development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhongchi Liu

2004-10-01

Unlike animals, plants are constantly exposed to environmental mutagens including ultraviolet light and reactive oxygen species. Further, plant cells are totipotent with highly plastic developmental programs. An understanding of molecular mechanisms underlying the ability of plants to monitor and repair its DNA and to eliminate damaged cells are of great importance. Previously we have identified two genes, TSO1 and TSO2, from a flowering plant Arabidopsis thaliana. Mutations in these two genes cause callus-like flowers, fasciated shoot apical meristems, and abnormal cell division, indicating that TSO1 and TSO2 may encode important cell cycle regulators. Previous funding from DOE led to themore » molecular cloning of TSO1, which was shown to encode a novel nuclear protein with two CXC domains suspected to bind DNA. This DOE grant has allowed us to characterize and isolate TSO2 that encodes the small subunit of the ribonucleotide reductase (RNR). RNR comprises two large subunits (R1) an d two small subunits (R2), catalyzes a rate-limiting step in the production of deoxyribonucleotides needed for DNA replication and repair. Previous studies in yeast and mammals indicated that defective RNR often led to cell cycle arrest, growth retardation and p53-dependent apoptosis while abnormally elevated RNR activities led to higher mutation rates. Subsequently, we identified two additional R2 genes, R2A and R2B in the Arabidopsis genome. Using reverse genetics, mutations in R2A and R2B were isolated, and double and triple mutants among the three R2 genes (TSO2, R2A and R2B) were constructed and analyzed. We showed that Arabidopsis tso2 mutants, with reduced dNTP levels, were more sensitive to UV-C. While r2a or r2b single mutants did not exhibit any phenotypes, tso2 r2b double mutants were embryonic lethal and tso2 r2a double mutants were seedling lethal indicating redundant functions among the three R2 genes. Furthermore, tso2 r2a double mutants exhibited increased DNA dam age, massive programmed cell death, and the release of transcriptional gene silencing. Our data suggests that plants can initiate programmed cell death to eliminate damaged cells despite the absence of p53 in plant genome.« less

34 CFR 472.1 - What is the National Workplace Literacy Program?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 34 Education 3 2010-07-01 2010-07-01 false What is the National Workplace Literacy Program? 472.1... VOCATIONAL AND ADULT EDUCATION, DEPARTMENT OF EDUCATION NATIONAL WORKPLACE LITERACY PROGRAM General § 472.1 What is the National Workplace Literacy Program? The National Workplace Literacy Program provides...

Toward a national fuels mapping strategy: Lessons from selected mapping programs

USGS Publications Warehouse

Loveland, Thomas R.

2001-01-01

The establishment of a robust national fuels mapping program must be based on pertinent lessons from relevant national mapping programs. Many large-area mapping programs are under way in numerous Federal agencies. Each of these programs follows unique strategies to achieve mapping goals and objectives. Implementation approaches range from highly centralized programs that use tightly integrated standards and dedicated staff, to dispersed programs that permit considerable flexibility. One model facilitates national consistency, while the other allows accommodation of locally relevant conditions and issues. An examination of the programmatic strategies of four national vegetation and land cover mapping initiatives can identify the unique approaches, accomplishments, and lessons of each that should be considered in the design of a national fuel mapping program. The first three programs are the U.S. Geological Survey Gap Analysis Program, the U.S. Geological Survey National Land Cover Characterization Program, and the U.S. Fish and Wildlife Survey National Wetlands Inventory. A fourth program, the interagency Multiresolution Land Characterization Program, offers insights in the use of partnerships to accomplish mapping goals. Collectively, the programs provide lessons, guiding principles, and other basic concepts that can be used to design a successful national fuels mapping initiative.

Nucleotides with altered hydrogen bonding capacities impede human DNA polymerase η by reducing synthesis in the presence of the major cisplatin DNA adduct.

PubMed

Nilforoushan, Arman; Furrer, Antonia; Wyss, Laura A; van Loon, Barbara; Sturla, Shana J

2015-04-15

Human DNA polymerase η (hPol η) contributes to anticancer drug resistance by catalyzing the replicative bypass of DNA adducts formed by the widely used chemotherapeutic agent cis-diamminedichloroplatinum (cisplatin). A chemical basis for overcoming bypass-associated resistance requires greater knowledge of how small molecules influence the hPol η-catalyzed bypass of DNA adducts. In this study, we demonstrated how synthetic nucleoside triphosphates act as hPol η substrates and characterized their influence on hPol η-mediated DNA synthesis over unmodified and platinated DNA. The single nucleotide incorporation efficiency of the altered nucleotides varied by more than 10-fold and the higher incorporation rates appeared to be attributable to the presence of an additional hydrogen bond between incoming dNTP and templating base. Finally, full-length DNA synthesis in the presence of increasing concentrations of synthetic nucleotides reduced the amount of DNA product independent of the template, representing the first example of hPol η inhibition in the presence of a platinated DNA template.

HPV31 Utilizes the ATR-Chk1 Pathway to Maintain Elevated RRM2 Levels and a Replication-Competent Environment in Differentiating Keratinocytes

PubMed Central

Anacker, Daniel C.; Aloor, Heather L.; Shepard, Caitlin N.; Lenzi, Gina M.; Johnson, Bryan A.; Kim, Baek; Moody, Cary A.

2016-01-01

Productive replication of human papillomaviruses (HPV) is restricted to the uppermost layers of the differentiating epithelia. How HPV ensures an adequate supply of cellular substrates for viral DNA synthesis in a differentiating environment is unclear. Here, we demonstrate that HPV31 positive cells exhibit increased dNTP pools and levels of RRM2, a component of the ribonucleotide reductase (RNR) complex, which is required for de novo synthesis of dNTPs. RRM2 depletion blocks productive replication, suggesting RRM2 provides dNTPs for viral DNA synthesis in differentiating cells. We demonstrate that HPV31 regulates RRM2 levels through expression of E7 and activation of the ATR-Chk1-E2F1 DNA damage response, which is essential to combat replication stress upon entry into S-phase, as well as for productive replication. Our findings suggest a novel way in which viral DNA synthesis is regulated through activation of ATR and Chk1 and highlight an intriguing new virus/host interaction utilized for viral replication. PMID:27764728

Two novel mutations in thymidine kinase-2 cause early onset fatal encephalomyopathy and severe mtDNA depletion.

PubMed

Lesko, Nicole; Naess, Karin; Wibom, Rolf; Solaroli, Nicola; Nennesmo, Inger; von Döbeln, Ulrika; Karlsson, Anna; Larsson, Nils-Göran

2010-03-01

Deficiency of thymidine kinase-2 (TK2) has been described in children with early onset fatal skeletal myopathy. TK2 is a mitochondrial deoxyribonucleoside kinase required for the phosphorylation of deoxycytidine and deoxythymidine and hence is vital for the maintenance of a balanced mitochondrial dNTP pool in post-mitotic tissues. We describe a patient with two novel TK2 mutations, which caused disease onset shortly after birth and death at the age of three months. One mutation (219insCG) generated an early stop codon, thus preventing the synthesis of a functional protein. The second mutation (R130W) resulted in an amino acid substitution, which caused a severe reduction (<3%) of TK2 enzyme activity. These two novel TK2 mutations cause an extremely severe phenotype with overwhelming central nervous system symptoms not commonly seen in patients with TK2-deficiency. We conclude that the severe clinical presentation in this patient was due to a virtual lack of mitochondrial TK2 activity. Copyright 2009 Elsevier B.V. All rights reserved.

SAMHD1 Inhibits LINE-1 Retrotransposition by Promoting Stress Granule Formation

PubMed Central

Xu, Fengwen; Mei, Shan; Le Duff, Yann; Yin, Lijuan; Pang, Xiaojing; Cen, Shan; Jin, Qi; Liang, Chen; Guo, Fei

2015-01-01

The SAM domain and HD domain containing protein 1 (SAMHD1) inhibits retroviruses, DNA viruses and long interspersed element 1 (LINE-1). Given that in dividing cells, SAMHD1 loses its antiviral function yet still potently restricts LINE-1, we propose that, instead of blocking viral DNA synthesis by virtue of its dNTP triphosphohydrolase activity, SAMHD1 may exploit a different mechanism to control LINE-1. Here, we report a new activity of SAMHD1 in promoting cellular stress granule assembly, which correlates with increased phosphorylation of eIF2α and diminished eIF4A/eIF4G interaction. This function of SAMHD1 enhances sequestration of LINE-1 RNP in stress granules and consequent blockade to LINE-1 retrotransposition. In support of this new mechanism of action, depletion of stress granule marker proteins G3BP1 or TIA1 abrogates stress granule formation and overcomes SAMHD1 inhibition of LINE-1. Together, these data reveal a new mechanism for SAMHD1 to control LINE-1 by activating cellular stress granule pathway. PMID:26134849

Lesion bypass by S. cerevisiae Pol ζ alone

PubMed Central

Stone, Jana E.; Kumar, Dinesh; Binz, Sara K.; Inase, Aki; Iwai, Shigenori; Chabes, Andrei; Burgers, Peter M.; Kunkel, Thomas A.

2011-01-01

DNA polymerase zeta (Pol ζ) participates in translesion synthesis (TLS) of DNA adducts that stall replication fork progression. Previous studies have led to the suggestion that the primary role of Pol ζ in TLS is to extend primers created when another DNA polymerase inserts nucleotides opposite lesions. Here we test the non-exclusive possibility that Pol ζ can sometimes perform TLS in the absence of any other polymerase. To do so, we quantified the efficiency with which S. cerevisiae Pol ζ bypasses abasic sites, cis-syn cyclobutane pyrimidine dimers and (6-4) photoproducts. In reactions containing dNTP concentrations that mimic those induced by DNA damage, a Pol ζ derivative with phenylalanine substituted for leucine 979 at the polymerase active site bypasses all three lesions at efficiencies between 27–73%. Wild-type Pol ζ also bypasses these lesions, with efficiencies that are lower and depend on the sequence context in which the lesion resides. The results are consistent with the hypothesis that, in addition to extending aberrant termini created by other DNA polymerases, Pol ζ has the potential to be the sole DNA polymerase involved in TLS. PMID:21622032

Single-stranded nucleic acids promote SAMHD1 complex formation.

PubMed

Tüngler, Victoria; Staroske, Wolfgang; Kind, Barbara; Dobrick, Manuela; Kretschmer, Stefanie; Schmidt, Franziska; Krug, Claudia; Lorenz, Mike; Chara, Osvaldo; Schwille, Petra; Lee-Kirsch, Min Ae

2013-06-01

SAM domain and HD domain-containing protein 1 (SAMHD1) is a dGTP-dependent triphosphohydrolase that degrades deoxyribonucleoside triphosphates (dNTPs) thereby limiting the intracellular dNTP pool. Mutations in SAMHD1 cause Aicardi-Goutières syndrome (AGS), an inflammatory encephalopathy that mimics congenital viral infection and that phenotypically overlaps with the autoimmune disease systemic lupus erythematosus. Both disorders are characterized by activation of the antiviral cytokine interferon-α initiated by immune recognition of self nucleic acids. Here we provide first direct evidence that SAMHD1 associates with endogenous nucleic acids in situ. Using fluorescence cross-correlation spectroscopy, we demonstrate that SAMHD1 specifically interacts with ssRNA and ssDNA and establish that nucleic acid-binding and formation of SAMHD1 complexes are mutually dependent. Interaction with nucleic acids and complex formation do not require the SAM domain, but are dependent on the HD domain and the C-terminal region of SAMHD1. We finally demonstrate that mutations associated with AGS exhibit both impaired nucleic acid-binding and complex formation implicating that interaction with nucleic acids is an integral aspect of SAMHD1 function.

Development of a rapid assay to detect the jellyfish Cyanea nozakii using a loop-mediated isothermal amplification method.

PubMed

Liu, Zhongyuan; Dong, Zhijun; Liu, Dongyan

2016-07-01

Blooms of the harmful jellyfish Cyanea nozakii, which are a severe nuisance to fisheries and tourisms, frequently occur in the northern East China Sea, Yellow Sea, and Bohai Sea. To provide early warning of this species, a simple and effective molecular method for identifying C. nozakii was developed using the loop-mediated isothermal amplification method (LAMP). The LAMP assay is highly specific and uses a set of four primers that target six different regions on the mitochondrial cytochrome c oxidase subunit I (COI) gene of C. nozakii. The amplification conditions, including the dNTP and betaine concentrations, the inner primer to outer primer concentration ratio, reaction time and temperature, were optimized. The LAMP assay amplified DNA extracted from tissue samples of C. nozakii but did not amplify DNA from other common scyphozoans and hydrozoans collected in the same region. In addition, the LAMP assay was more sensitive than conventional PCR. Therefore, the established LAMP assay is a sensitive, specific, fast, and easily performed method for detection of C. nozakii at different stages in their life cycle.

Cascade signal amplification for electrochemical immunosensing by integrating biobarcode probes, surface-initiated enzymatic polymerization and silver nanoparticle deposition.

PubMed

Lin, Dajie; Mei, Chengyang; Liu, Aili; Jin, Huile; Wang, Shun; Wang, Jichang

2015-04-15

A cascade signal amplification strategy through combining surface-initiated enzymatic polymerization (SIEP) and the subsequent deposition of strepavidin functionalized silver nanoparticles (AgNPs) was proposed. The first step of constructing the electrochemical immunosensor involves covalently immobilizing capture antibody on a chitosan modified glass carbon electrode, which then catalyzes DNA addition of deoxynucleotides (dNTP) at the 3'-OH group by terminal deoxynucleotidyl transferase (TdT), leading to the formation of long single-stranded DNAs labeled with numerous biotins. Following the deposition of numerous strepavidin functionalized AgNPs on those long DNA chains, electrochemical stripping signal of silver was used to monitor the immunoreaction in KCl solution. Using α-fetoprotein as a model analyte, this amplification strategy could detect fetoprotein down to 0.046pg/mL with a wide linear range from 0.1pg/mL to 1.0ng/mL. The achieved high sensitivity and good reproducibility suggest that this cascade signal amplification strategy has great potential for detecting biological samples and possibly clinical application. Copyright © 2014 Elsevier B.V. All rights reserved.

A nucleotide binding rectification Brownian ratchet model for translocation of Y-family DNA polymerases

PubMed Central

2011-01-01

Y-family DNA polymerases are characterized by low-fidelity synthesis on undamaged DNA and ability to catalyze translesion synthesis over the damaged DNA. Their translocation along the DNA template is an important event during processive DNA synthesis. In this work we present a Brownian ratchet model for this translocation, where the directed translocation is rectified by the nucleotide binding to the polymerase. Using the model, different features of the available structures for Dpo4, Dbh and polymerase ι in binary and ternary forms can be easily explained. Other dynamic properties of the Y-family polymerases such as the fast translocation event upon dNTP binding for Dpo4 and the considerable variations of the processivity among the polymerases can also be well explained by using the model. In addition, some predicted results of the DNA synthesis rate versus the external force acting on Dpo4 and Dbh polymerases are presented. Moreover, we compare the effect of the external force on the DNA synthesis rate of the Y-family polymerase with that of the replicative DNA polymerase. PMID:21699732

49 CFR 350.109 - What are the national program elements?

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 5 2013-10-01 2013-10-01 false What are the national program elements? 350.109... COMMERCIAL MOTOR CARRIER SAFETY ASSISTANCE PROGRAM General § 350.109 What are the national program elements? The national program elements include the following five activities: (a) Driver/vehicle inspections...

49 CFR 350.109 - What are the national program elements?

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 5 2010-10-01 2010-10-01 false What are the national program elements? 350.109... COMMERCIAL MOTOR CARRIER SAFETY ASSISTANCE PROGRAM General § 350.109 What are the national program elements? The national program elements include the following five activities: (a) Driver/vehicle inspections...

49 CFR 350.109 - What are the national program elements?

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 5 2011-10-01 2011-10-01 false What are the national program elements? 350.109... COMMERCIAL MOTOR CARRIER SAFETY ASSISTANCE PROGRAM General § 350.109 What are the national program elements? The national program elements include the following five activities: (a) Driver/vehicle inspections...

49 CFR 350.109 - What are the national program elements?

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 5 2012-10-01 2012-10-01 false What are the national program elements? 350.109... COMMERCIAL MOTOR CARRIER SAFETY ASSISTANCE PROGRAM General § 350.109 What are the national program elements? The national program elements include the following five activities: (a) Driver/vehicle inspections...

49 CFR 350.109 - What are the national program elements?

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 5 2014-10-01 2014-10-01 false What are the national program elements? 350.109... COMMERCIAL MOTOR CARRIER SAFETY ASSISTANCE PROGRAM General § 350.109 What are the national program elements? The national program elements include the following five activities: (a) Driver/vehicle inspections...

34 CFR 656.1 - What is the National Resource Centers Program?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 34 Education 3 2011-07-01 2011-07-01 false What is the National Resource Centers Program? 656.1... POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION NATIONAL RESOURCE CENTERS PROGRAM FOR FOREIGN LANGUAGE AND AREA... Centers Program? Under the National Resource Centers Program for Foreign Language and Areas Studies or...

34 CFR 656.1 - What is the National Resource Centers Program?

Code of Federal Regulations, 2012 CFR

2012-07-01

... 34 Education 3 2012-07-01 2012-07-01 false What is the National Resource Centers Program? 656.1... POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION NATIONAL RESOURCE CENTERS PROGRAM FOR FOREIGN LANGUAGE AND AREA... Centers Program? Under the National Resource Centers Program for Foreign Language and Areas Studies or...

34 CFR 656.1 - What is the National Resource Centers Program?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 34 Education 3 2010-07-01 2010-07-01 false What is the National Resource Centers Program? 656.1... POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION NATIONAL RESOURCE CENTERS PROGRAM FOR FOREIGN LANGUAGE AND AREA... Centers Program? Under the National Resource Centers Program for Foreign Language and Areas Studies or...

34 CFR 656.1 - What is the National Resource Centers Program?

Code of Federal Regulations, 2014 CFR

2014-07-01

... 34 Education 3 2014-07-01 2014-07-01 false What is the National Resource Centers Program? 656.1... POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION NATIONAL RESOURCE CENTERS PROGRAM FOR FOREIGN LANGUAGE AND AREA... Centers Program? Under the National Resource Centers Program for Foreign Language and Areas Studies or...

34 CFR 656.1 - What is the National Resource Centers Program?

Code of Federal Regulations, 2013 CFR

2013-07-01

... 34 Education 3 2013-07-01 2013-07-01 false What is the National Resource Centers Program? 656.1... POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION NATIONAL RESOURCE CENTERS PROGRAM FOR FOREIGN LANGUAGE AND AREA... Centers Program? Under the National Resource Centers Program for Foreign Language and Areas Studies or...

National Intelligence: A Consumer’s Guide

DTIC Science & Technology

2009-01-01

execution of that budget. The National Intelligence Program (NIP), formerly known as the National Foreign Intelligence Program ( NFIP ), provides the...Clandestine Service NCTC: National Counterterrorism Center NDIC: National Defense Intelligence College (DIA – formerly JMIC) NFIP : National Foreign...Center (ODNI) NIE: National Intelligence Estimate NIP: National Intelligence Program (formerly NFIP ) NIPRNet: Non-Secure Internet Protocol Router

DOE Solar Energy Technologies Program FY 2005 Annual Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The DOE Solar Energy Technologies Program FY 2005 Annual Report chronicles the R&D results of the U.S. Department of Energy Solar Energy Technologies Program for Fiscal Year 2005. In particular, the report describes R&D performed by the Program?s national laboratories (National Renewable Energy Laboratory, Sandia National Laboratories, Oak Ridge National Laboratory, and Brookhaven National Laboratory) and university and industry partners.

Why it's time for a national health program in the United States.

PubMed Central

Waitzkin, H

1989-01-01

The United States lacks a coherent national health program. Current programs leave major gaps in coverage and recently have become more restrictive. Influential policies that have failed to correct crucial problems of the health-care system include competitive strategies, corporate intervention, and public-sector cutbacks with bureaucratic expansion. A national health program that combines elements of national health insurance and a national health service is a policy that would help solve current health-care problems. Previous proposals for national health insurance contained weaknesses that would need correction under a national program. Based on the experiences of other economically advanced countries, a national health program could provide universal entitlement to health care while controlling costs and improving the health-care system through structural reorganization. Current proposals for a national health program contain several basic principles dealing with the scope of services, copayments, financing, cost controls, physician and professional associations, personnel and distribution, prevention, and participation in policy making. Support for a national health program is growing rapidly. Such a program would help protect all people who live in this country from unnecessary illness, suffering, and early death. PMID:2735021

National Program for e-Learning in Taiwan

ERIC Educational Resources Information Center

Chang, Maiga; Wang, Chin-Yeh; Chen, Gwo-Dong

2009-01-01

Taiwan government has initiated a five-year program since 2002: the National Science and Technology Program for e-Learning. The national program started from 2003 and was completed at the end of year 2007, involving thirteen government agencies. This paper describes the results that the national program has accomplished at its first phase, 2003 to…

Healthcare-associated infections in Australia: time for national surveillance.

PubMed

Russo, Philip L; Cheng, Allen C; Richards, Michael; Graves, Nicholas; Hall, Lisa

2015-02-01

Healthcare-associated infection (HAI) surveillance programs are critical for infection prevention. Australia does not have a comprehensive national HAI surveillance program. The purpose of this paper is to provide an overview of established international and Australian statewide HAI surveillance programs and recommend a pathway for the development of a national HAI surveillance program in Australia. This study examined existing HAI surveillance programs through a literature review, a review of HAI surveillance program documentation, such as websites, surveillance manuals and data reports and direct contact with program representatives. Evidence from international programs demonstrates national HAI surveillance reduces the incidence of HAIs. However, the current status of HAI surveillance activity in Australian states is disparate, variation between programs is not well understood, and the quality of data currently used to compose national HAI rates is uncertain. There is a need to develop a well-structured, evidence-based national HAI program in Australia to meet the increasing demand for validated reliable national HAI data. Such a program could be leveraged off the work of existing Australian and international programs.

76 FR 52548 - National Veterinary Accreditation Program; Currently Accredited Veterinarians Performing...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-23

.... APHIS-2006-0093] RIN 0579-AC04 National Veterinary Accreditation Program; Currently Accredited... accredited in the National Veterinary Accreditation Program (NVAP) may continue to perform accredited duties..., 2011. FOR FURTHER INFORMATION CONTACT: Dr. Todd Behre, National Veterinary Accreditation Program, VS...

77 FR 63893 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-17

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: National Archives and Records... meeting to discuss National Industrial Security Program policy matters. DATES: The meeting will be held on...

78 FR 9431 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-08

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: National Archives and Records... meeting to discuss National Industrial Security Program policy matters. DATES: The meeting will be held on...

2009 National Intelligence: A Consumer’s Guide

DTIC Science & Technology

2009-04-01

Program (NIP), formerly known as the National Foreign Intelligence Program ( NFIP ), provides the resources needed to develop and maintain...Clandestine Service NCTC: National Counterterrorism Center NDIC: National Defense Intelligence College (DIA – formerly JMIC) NFIP : National Foreign...Coordination Center (ODNI) NIE: National Intelligence Estimate NIP: National Intelligence Program (formerly NFIP ) NIPRNet: Non-Secure Internet Protocol Router

75 FR 27353 - List of Programs Eligible for Inclusion in Fiscal Year 2010 Funding Agreements To Be Negotiated...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-14

...--Arkansas. 25. Joshua Tree National Park--California. 26. Lassen Volcanic National Park--California. 27.... Rainier National Park--Washington. 57. Olympic National Park--Washington. 58. San Juan Islands National... the National Park Service, a program entry was added to the list of eligible programs and three...

76 FR 36923 - Meeting of the National Toxicology Program (NTP) Board of Scientific Counselors (BSC): Notice of...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-23

... DEPARTMENT OF HEALTH AND HUMAN SERVICES Meeting of the National Toxicology Program (NTP) Board of Scientific Counselors (BSC): Notice of Cancellation AGENCY: National Toxicology Program (NTP), National... Toxicology Program. [FR Doc. 2011-15656 Filed 6-22-11; 8:45 am] BILLING CODE 4140-01-P ...

20 CFR 669.110 - What definitions apply to this program?

Code of Federal Regulations, 2010 CFR

2010-04-01

... NATIONAL FARMWORKER JOBS PROGRAM UNDER TITLE I OF THE WORKFORCE INVESTMENT ACT Purpose and Definitions... National Farmworker Jobs Program. Housing development assistance within the NFJP, is a type of related... Jobs Program (NFJP) is the nationally administered workforce investment program for farmworkers...

PEPFAR/DOD/Pharmaccess/Tanzania Peoples Defence Forces HIV/AIDS Program

DTIC Science & Technology

2009-09-01

NACP National AIDS Control Program NGO Non Governmental Organization NLTP National Leprosy and TB Program NS National Service OIS...have an ongoing DOT-TB program monitored by the Regional Medical Officer, in line with the guidelines of the National Tuberculosis and Leprosy ...and treatment, according to the guidelines of the NACP TB Unit and the National TB and Leprosy Programme (NTLP). 48 48 C Train medical officers

78 FR 29775 - Information Collection Request Sent to the Office of Management and Budget (OMB) for Approval...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-21

... Underground Railroad Network to Freedom Program AGENCY: National Park Service, Interior. ACTION: Notice... Miller, National Manager, National Underground Railroad Network to Freedom Program, National Park Service...: OMB Control Number: 1024-0232. Title: National Underground Railroad Network to Freedom Program...

77 FR 8273 - Agency Information Collection Activities: Submission for OMB Review; Comment Request, National...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-14

..., National Flood Insurance Program-Mortgage Portfolio Protection Program AGENCY: Federal Emergency Management... Title: National Flood Insurance Program-Mortgage Portfolio Protection Program. OMB Number: 1660-0086... Write Your Own (WYO) company that wishes to participate in the Mortgage Portfolio Protection Program...

Applying national survey results for strategic planning and program improvement: the National Diabetes Education Program.

PubMed

Griffey, Susan; Piccinino, Linda; Gallivan, Joanne; Lotenberg, Lynne Doner; Tuncer, Diane

2015-02-01

Since the 1970s, the federal government has spearheaded major national education programs to reduce the burden of chronic diseases in the United States. These prevention and disease management programs communicate critical information to the public, those affected by the disease, and health care providers. The National Diabetes Education Program (NDEP), the leading federal program on diabetes sponsored by the National Institutes of Health (NIH) and the Centers for Disease Control and Prevention (CDC), uses primary and secondary quantitative data and qualitative audience research to guide program planning and evaluation. Since 2006, the NDEP has filled the gaps in existing quantitative data sources by conducting its own population-based survey, the NDEP National Diabetes Survey (NNDS). The NNDS is conducted every 2–3 years and tracks changes in knowledge, attitudes and practice indicators in key target audiences. This article describes how the NDEP has used the NNDS as a key component of its evaluation framework and how it applies the survey results for strategic planning and program improvement. The NDEP's use of the NNDS illustrates how a program evaluation framework that includes periodic population-based surveys can serve as an evaluation model for similar national health education programs.

NREL Photovoltaic Program FY 1996 Annual Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

This report summarizes the in-house and subcontract research and development (R&D) activities under the National Renewable Energy Laboratory (NREL) Photovoltaics (PV) Program from October 1, 1995 through September 30, 1996 (fiscal year [FY] 1996). The NREL PV Program is part of the U.S. Department of Energy's (DOE) National Photovoltaics Program, as described in the DOE Photovoltaics Program Plan, FY 1991 - FY 1995. The mission of the DOE National Photovoltaics Program is to: "Work in partnership with U.S. industry to develop and deploy photovoltaic technology for generating economically competitive electric power, making photovoltaics an important contributor to the nation's andmore » the world's energy use and environmental improvement. The two primary goals of the national program are to (1) maintain the U.S. PV industry's world leadership in research and technology development and (2) help the U.S. industry remain a major, profitable force in the world market. The NREL PV Program provides leadership and support to the national program toward achieving its mission and goals.« less

National Program for Inspection of Non-Federal Dams. Houghton Pond Dam (MA 00444), Charles River Basin, Holliston, Massachusetts. Phase I Inspection Report.

DTIC Science & Technology

1979-07-01

RD-A154 892 NATIONAL PROGRAM FOR INSPECTION OF NON-FEDERAL DAMS i/I HOUGHTON POND DAM (MA..(U) CORPS OF ENGINEERS WALTHAM UNCLASSIFIED N NEN ENGLAND...HOUGHTON POND DAM MA 00444 PHASE I INSPECTION REPORT _ NATIONAL DAM INSPECTION PROGRAM DTIC EECTE CD JUN4 985 -LJE DEPARTMENT OF THE ARMY NEW ENGLAND...16 SUPPLEMENTARY NOTES Co ver program reads: Phase I Inspection Report, National Dam Inspection Program ; however, the official title of the program

Descriptive Study of AmeriCorps Literacy Programs: State and National. Final Report.

ERIC Educational Resources Information Center

Moss, Marc; Hiller, Jordan; Moore, Douglas

AmeriCorps is composed of three programs, State and National; National Civilian Community Corps (NCCC); and Volunteers in Service to America (VISTA). The focus of this report is on the AmeriCorps State/National program. Education-related activities have been a priority for AmeriCorps' parent organization, the National Corporation for Public…

76 FR 3913 - National Institute on Drug Abuse; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-21

... evaluation of individual intramural programs and projects conducted by the National Institute on Drug Abuse... individual investigators. Place: Intramural Research Program, National Institute on Drug Abuse, NIH, Johns... Psychologist, Clinical Pharmacology Branch, Intramural Research Program, National Institute on Drug Abuse...

77 FR 6776 - Agency Information Collection Activities: Proposed Collection; Comment Request-National School...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-09

...: Proposed Collection; Comment Request--National School Lunch Program and School Breakfast Program Access... be directed to Steven Carlson at 703-305-2017. SUPPLEMENTARY INFORMATION: Title: National School Lunch Program and School Breakfast Program Access, Participation, Eligibility, and Certification Study...

Monitoring the Earth's Dynamic Magnetic Field

USGS Publications Warehouse

Love, Jeffrey J.; Applegate, David; Townshend, John B.

2008-01-01

The mission of the U.S. Geological Survey's Geomagnetism Program is to monitor the Earth's magnetic field. Using ground-based observatories, the Program provides continuous records of magnetic field variations covering long timescales; disseminates magnetic data to various governmental, academic, and private institutions; and conducts research into the nature of geomagnetic variations for purposes of scientific understanding and hazard mitigation. The program is an integral part of the U.S. Government's National Space Weather Program (NSWP), which also includes programs in the National Aeronautics and Space Administration (NASA), the Department of Defense (DOD), the National Oceanic and Atmospheric Administration (NOAA), and the National Science Foundation (NSF). The NSWP works to provide timely, accurate, and reliable space weather warnings, observations, specifications, and forecasts, and its work is important for the U.S. economy and national security. Please visit the National Geomagnetism Program?s website, http://geomag.usgs.gov, where you can learn more about the Program and the science of geomagnetism. You can find additional related information at the Intermagnet website, http://www.intermagnet.org.

76 FR 54999 - Notice of 2011 National Organic Certification Cost-Share Program

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-06

...] Notice of 2011 National Organic Certification Cost-Share Program AGENCY: Agricultural Marketing Service... for the National Organic Certification Cost- Share Program. SUMMARY: This Notice invites all States of...) for the allocation of National Organic Certification Cost-Share Funds. Beginning in Fiscal Year 2008...

76 FR 65517 - National Institute on Drug Abuse Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-10-21

... individual intramural programs and projects conducted by the National Institute on Drug Abuse, including.... Place: Intramural Research Program, National Institute on Drug Abuse, NIH, Johns Hopkins Bayview Campus..., Intramural Research Program, National Institute on Drug Abuse, NIH, DHHS, 251 Bayview Boulevard, Baltimore...

78 FR 55265 - National Institute on Drug Abuse; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-10

... individual intramural programs and projects conducted by the National Institute on Drug Abuse, including.... Place: Intramural Research Program, National Institute on Drug Abuse, NIH, Johns Hopkins Bayview Campus..., Intramural Research Program, National Institute on Drug Abuse, NIH, DHHS, 251 Bayview Boulevard, Baltimore...

77 FR 27712 - Notice of Request for Revision and Extension of Approval of an Information Collection; National...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-11

... an Information Collection; National Veterinary Accreditation Program AGENCY: Animal and Plant Health... approval of an information collection associated with the National Veterinary Accreditation Program. DATES...: For information on the National Veterinary Accreditation Program, contact Dr. Todd Behre, Veterinary...

42 CFR 62.1 - What is the scope and purpose of the National Health Service Corps scholarship program?

Code of Federal Regulations, 2012 CFR

2012-10-01

... Health Service Corps scholarship program? 62.1 Section 62.1 Public Health PUBLIC HEALTH SERVICE... SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.1 What is the scope and purpose of the National Health Service Corps scholarship program? These regulations apply to...

42 CFR 62.1 - What is the scope and purpose of the National Health Service Corps scholarship program?

Code of Federal Regulations, 2010 CFR

2010-10-01

... Health Service Corps scholarship program? 62.1 Section 62.1 Public Health PUBLIC HEALTH SERVICE... SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.1 What is the scope and purpose of the National Health Service Corps scholarship program? These regulations apply to...

42 CFR 62.1 - What is the scope and purpose of the National Health Service Corps scholarship program?

Code of Federal Regulations, 2013 CFR

2013-10-01

... Health Service Corps scholarship program? 62.1 Section 62.1 Public Health PUBLIC HEALTH SERVICE... SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.1 What is the scope and purpose of the National Health Service Corps scholarship program? These regulations apply to...

42 CFR 62.1 - What is the scope and purpose of the National Health Service Corps scholarship program?

Code of Federal Regulations, 2011 CFR

2011-10-01

... Health Service Corps scholarship program? 62.1 Section 62.1 Public Health PUBLIC HEALTH SERVICE... SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.1 What is the scope and purpose of the National Health Service Corps scholarship program? These regulations apply to...

42 CFR 62.1 - What is the scope and purpose of the National Health Service Corps scholarship program?

Code of Federal Regulations, 2014 CFR

2014-10-01

... Health Service Corps scholarship program? 62.1 Section 62.1 Public Health PUBLIC HEALTH SERVICE... SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.1 What is the scope and purpose of the National Health Service Corps scholarship program? These regulations apply to...

Using Implementation and Program Theory to Examine Communication Strategies in National Wildlife Federation's Backyard Wildlife Habitat Program

ERIC Educational Resources Information Center

Palmer, Dain; Dann, Shari L.

2004-01-01

Our evaluative approach used implementation theory and program theory, adapted from Weiss (1998) to examine communication processes and results for a national wildlife habitat stewardship education program. Using a mail survey of 1427 participants certified in National Wildlife Federation's (NWF) Backyard Wildlife Habitat (BWH) program and a study…

75 FR 82037 - National Protection and Programs Directorate; President's National Security Telecommunications...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-29

... DEPARTMENT OF HOMELAND SECURITY [Docket No. DHS-2010-0050] National Protection and Programs Directorate; President's National Security Telecommunications Advisory Committee AGENCY: National Protection... Committee Meeting. SUMMARY: The President's National Security Telecommunications Advisory Committee (NSTAC...

34 CFR 400.2 - What programs are governed by these regulations?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 407). (b) National discretionary programs. (1) Indian Vocational Education Program (34 CFR part 401). (2) Native Hawaiian Vocational Education Program (34 CFR part 402). (3) National Tech-Prep Education...). (8) National Network for Curriculum Coordination in Vocational and Technical Education (34 CFR part...

36 CFR 230.32 - National program administration.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 36 Parks, Forests, and Public Property 2 2012-07-01 2012-07-01 false National program... AGRICULTURE STATE AND PRIVATE FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.32 National program... three geographic funding areas based on the criteria set out in the Forest Service Manual Chapter 3310...

36 CFR 230.32 - National program administration.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 36 Parks, Forests, and Public Property 2 2014-07-01 2014-07-01 false National program... AGRICULTURE STATE AND PRIVATE FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.32 National program... three geographic funding areas based on the criteria set out in the Forest Service Manual Chapter 3310...

78 FR 54663 - National Vaccine Injury Compensation Program; List of Petitions Received

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-05

... Vaccine Injury Compensation Program; List of Petitions Received AGENCY: Health Resources and Services... publishing this notice of petitions received under the National Vaccine Injury Compensation Program (the...-6400. For information on HRSA's role in the Program, contact the Director, National Vaccine Injury...

78 FR 66012 - National Vaccine Injury Compensation Program; List of Petitions Received

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-04

... Vaccine Injury Compensation Program; List of Petitions Received AGENCY: Health Resources and Services... publishing this notice of petitions received under the National Vaccine Injury Compensation Program (the...-6400. For information on HRSA's role in the Program, contact the Director, National Vaccine Injury...

78 FR 31566 - National Vaccine Injury Compensation Program; List of Petitions Received

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-24

... Vaccine Injury Compensation Program; List of Petitions Received AGENCY: Health Resources and Services... publishing this notice of petitions received under the National Vaccine Injury Compensation Program (``the..., National Vaccine Injury Compensation Program, 5600 Fishers Lane, Room 11C-26, Rockville, MD 20857; (301...

78 FR 46354 - National Vaccine Injury Compensation Program; List of Petitions Received

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-31

... Vaccine Injury Compensation Program; List of Petitions Received AGENCY: Health Resources and Services... publishing this notice of petitions received under the National Vaccine Injury Compensation Program (``the..., (202) 357-6400. For information on HRSA's role in the Program, contact the Director, National Vaccine...

78 FR 38995 - National Vaccine Injury Compensation Program, List of Petitions Received

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-28

... Vaccine Injury Compensation Program, List of Petitions Received AGENCY: Health Resources and Services... publishing this notice of petitions received under the National Vaccine Injury Compensation Program (``the..., (202) 357-6400. For information on HRSA's role in the Program, contact the Director, National Vaccine...

75 FR 59605 - National Veterinary Accreditation Program; Currently Accredited Veterinarians Performing...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-28

.... APHIS-2006-0093] RIN 0579-AC04 National Veterinary Accreditation Program; Currently Accredited... Veterinary Accreditation Program (NVAP) may continue to perform accredited duties and to elect to continue to..., National Veterinary Accreditation Program, VS, APHIS, 4700 River Road Unit 200, Riverdale, MD 20737; (301...

U.S. Department of Energy photovoltaic energy program contract summary, fiscal year 1999

DOE Office of Scientific and Technical Information (OSTI.GOV)

Surek, T.; Hansen, A.

2000-02-17

This report summarizes the in-house and subcontracted research and development (R and D) activities under the National Center for Photovoltaics (NCPV) and US Department of Energy (DOE) National Photovoltaics Program from October 1, 1998, through September 30, 1999 (FY 1999). The mission of the DOE National Photovoltaics Program is to make PV a significant part of the domestic economy as an industry and an energy resource. The two primary goals of the national program are to (1) maintain the US industry's world leadership in research and technology development and (2) help the US industry remain a major, profitable force inmore » the world market. The NCPV is part of the National PV Program and provides leadership and support to the national program toward achieving its mission and goals.« less

North American long-term soil productivity research program

Treesearch

Allan E. Tiarks; Robert F. Powers; Jerry F. Ragus; Deborah S. Page-Dumroese; Felix, Jr. Ponder; Douglas M. Stone

1997-01-01

The National Long-term Soil Productivity research program was chartered to address National Forest Management Act concerns over possible losses in soil productivity on National Forest lands. The program supports validation of soil quality monitoring standards and process-level productivity research. Summarized results are supplied to Forests as collected. National...

77 FR 34411 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-11

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION National Industrial Security Program Policy Advisory... CFR 101-6, announcement is made for the following committee meeting. To discuss National Industrial Security Program policy matters. DATES: This meeting will be held on Wednesday, July 11, 2012 from 10:00 a...

North American long-term soil productivity research program

Treesearch

Allan E. Tiarks; Robert F. Powers; Jerry F. Ragus; Deborah S. Page-Dumroese; Felix Ponder; Douglas M. Stone

1997-01-01

The National Long-term Soil Productivity research program was chartered to address National Forest Management Act concerns over possible losses n soil productivity on national forest lands. The program supports validation of soil quality monitoring standards and process-level productivity research. Summarized results are supplied to forests as collected. National...

75 FR 4578 - Extension of Agency Information Collection Activity Under OMB Review: National Explosives...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-28

... Information Collection Activity Under OMB Review: National Explosives Detection Canine Team Program (NEDCTP... under the National Explosives Detection Canine Team Program. The data is collected electronically... feedback to the Chief of the National Explosives Detection Canine Team Program and instructional staff and...

76 FR 39857 - Alaska Coastal Management Program Withdrawal From the National Coastal Management Program Under...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-07

.... SUMMARY: By operation of Alaska State law, the federally approved Alaska Coastal Management Program... partner in the National Coastal Management Program. The ACMP expired by operation of Alaska Statutes 44.66... DEPARTMENT OF COMMERCE National Oceanic Atmospheric Administration Alaska Coastal Management...

Paramedic Program Accreditation and Individual Performance on the National Paramedic Certification Examination

ERIC Educational Resources Information Center

Rodriguez, Severo A.

2016-01-01

Paramedic program accreditation and individual performance on the national paramedic certification examination were analyzed in this study. In 2008, the National Registry of Emergency Medical Technicians mandated paramedic program accreditation by January 1, 2013. Contemporary literature has not addressed the impact of program accreditation on…

National Program for Inspection of Non-Federal Dams. Monsanto Company Upper Dam (MA 00573), Connecticut River Basin, Springfield, Massachusetts. Phase I Inspection Report.

DTIC Science & Technology

1978-10-01

DAM . * MA 00573 PHASE 1 INSPECTION REPORT NATIONAL DAM INSPECTION PROGRAM 0 V DEPARTMENT OF THE ARMY_ NEW ENGLAND DIVISION, CORPS OF ENGINEERS WALTHAM...ArIhtEN T (c- the 6b4trectenrto I lck 20, It dit.,.et i am Report) !6 5IPPLEMENTARY NOTES (,o ,er program reads: Phase I Inspection Report, National Darn...Inspection Program ; hov.ever, the official title of the program is: National Program for Inspection of lon-Federal Dans:. LISP cover date for date of

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John

One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

Thymidine kinase 2 (H126N) knockin mice show the essential role of balanced deoxynucleotide pools for mitochondrial DNA maintenance.

PubMed

Akman, Hasan O; Dorado, Beatriz; López, Luis C; García-Cazorla, Angeles; Vilà, Maya R; Tanabe, Lauren M; Dauer, William T; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio

2008-08-15

Mitochondrial DNA (mtDNA) depletion syndrome (MDS), an autosomal recessive condition, is characterized by variable organ involvement with decreased mtDNA copy number and activities of respiratory chain enzymes in affected tissues. MtDNA depletion has been associated with mutations in nine autosomal genes, including thymidine kinase (TK2), which encodes a ubiquitous mitochondrial protein. To study the pathogenesis of TK2-deficiency, we generated mice harboring an H126N Tk2 mutation. Homozygous Tk2 mutant (Tk2(-/-)) mice developed rapidly progressive weakness after age 10 days and died between ages 2 and 3 weeks. Tk2(-/-) animals showed Tk2 deficiency, unbalanced dNTP pools, mtDNA depletion and defects of respiratory chain enzymes containing mtDNA-encoded subunits that were most prominent in the central nervous system. Histopathology revealed an encephalomyelopathy with prominent vacuolar changes in the anterior horn of the spinal cord. The H126N TK2 mouse is the first knock-in animal model of human MDS and demonstrates that the severity of TK2 deficiency in tissues may determine the organ-specific phenotype.

Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency

PubMed Central

Garone, Caterina; Garcia-Diaz, Beatriz; Emmanuele, Valentina; Lopez, Luis C; Tadesse, Saba; Akman, Hasan O; Tanji, Kurenai; Quinzii, Catarina M; Hirano, Michio

2014-01-01

Autosomal recessive mutations in the thymidine kinase 2 gene (TK2) cause mitochondrial DNA depletion, multiple deletions, or both due to loss of TK2 enzyme activity and ensuing unbalanced deoxynucleotide triphosphate (dNTP) pools. To bypass Tk2 deficiency, we administered deoxycytidine and deoxythymidine monophosphates (dCMP+dTMP) to the Tk2 H126N (Tk2−/−) knock-in mouse model from postnatal day 4, when mutant mice are phenotypically normal, but biochemically affected. Assessment of 13-day-old Tk2−/− mice treated with dCMP+dTMP 200 mg/kg/day each (Tk2−/−200dCMP/dTMP) demonstrated that in mutant animals, the compounds raise dTTP concentrations, increase levels of mtDNA, ameliorate defects of mitochondrial respiratory chain enzymes, and significantly prolong their lifespan (34 days with treatment versus 13 days untreated). A second trial of dCMP+dTMP each at 400 mg/kg/day showed even greater phenotypic and biochemical improvements. In conclusion, dCMP/dTMP supplementation is the first effective pharmacologic treatment for Tk2 deficiency. Subject Categories Genetics, Gene Therapy & Genetic Disease; Metabolism PMID:24968719

Deoxypyrimidine monophosphate bypass therapy for thymidine kinase 2 deficiency.

PubMed

Garone, Caterina; Garcia-Diaz, Beatriz; Emmanuele, Valentina; Lopez, Luis C; Tadesse, Saba; Akman, Hasan O; Tanji, Kurenai; Quinzii, Catarina M; Hirano, Michio

2014-08-01

Autosomal recessive mutations in the thymidine kinase 2 gene (TK2) cause mitochondrial DNA depletion, multiple deletions, or both due to loss of TK2 enzyme activity and ensuing unbalanced deoxynucleotide triphosphate (dNTP) pools. To bypass Tk2 deficiency, we administered deoxycytidine and deoxythymidine monophosphates (dCMP+dTMP) to the Tk2 H126N (Tk2(-/-)) knock-in mouse model from postnatal day 4, when mutant mice are phenotypically normal, but biochemically affected. Assessment of 13-day-old Tk2(-/-) mice treated with dCMP+dTMP 200 mg/kg/day each (Tk2(-/-200dCMP/) (dTMP)) demonstrated that in mutant animals, the compounds raise dTTP concentrations, increase levels of mtDNA, ameliorate defects of mitochondrial respiratory chain enzymes, and significantly prolong their lifespan (34 days with treatment versus 13 days untreated). A second trial of dCMP+dTMP each at 400 mg/kg/day showed even greater phenotypic and biochemical improvements. In conclusion, dCMP/dTMP supplementation is the first effective pharmacologic treatment for Tk2 deficiency. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

Deoxyribonucleoside kinases in mitochondrial DNA depletion.

PubMed

Saada-Reisch, Ann

2004-10-01

Mitochondrial DNA (mtDNA) depletion syndromes (MDS) are a heterogeneous group of mitochondrial disorders, manifested by a decreased mtDNA copy number and respiratory chain dysfunction. Primary MDS are inherited autosomally and may affect a single organ or multiple tissues. Mutated mitochondrial deoxyribonucleoside kinases; deoxyguanosine kinase (dGK) and thymidine kinase 2 (TK2), were associated with the hepatocerebral and myopathic forms of MDS respectively. dGK and TK2 are key enzymes in the mitochondrial nucleotide salvage pathway, providing the mitochondria with deoxyribonucleotides (dNP) essential for mtDNA synthesis. Although the mitochondrial dNP pool is physically separated from the cytosolic one, dNP's may still be imported through specific transport. Non-replicating tissues, where cytosolic dNP supply is down regulated, are thus particularly vulnerable to dGK and TK2 deficiency. The overlapping substrate specificity of deoxycytidine kinase (dCK) may explain the relative sparing of muscle in dGK deficiency, while low basal TK2 activity render this tissue susceptible to TK2 deficiency. The precise pathophysiological mechanisms of mtDNA depletion due to dGK and TK2 deficiencies remain to be determined, though recent findings confirm that it is attributed to imbalanced dNTP pools.

Thymidine kinase 2 (H126N) knockin mice show the essential role of balanced deoxynucleotide pools for mitochondrial DNA maintenance

PubMed Central

Akman, Hasan O.; Dorado, Beatriz; López, Luis C.; García-Cazorla, Ángeles; Vilà, Maya R.; Tanabe, Lauren M.; Dauer, William T.; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio

2008-01-01

Mitochondrial DNA (mtDNA) depletion syndrome (MDS), an autosomal recessive condition, is characterized by variable organ involvement with decreased mtDNA copy number and activities of respiratory chain enzymes in affected tissues. MtDNA depletion has been associated with mutations in nine autosomal genes, including thymidine kinase (TK2), which encodes a ubiquitous mitochondrial protein. To study the pathogenesis of TK2-deficiency, we generated mice harboring an H126N Tk2 mutation. Homozygous Tk2 mutant (Tk2−/−) mice developed rapidly progressive weakness after age 10 days and died between ages 2 and 3 weeks. Tk2−/− animals showed Tk2 deficiency, unbalanced dNTP pools, mtDNA depletion and defects of respiratory chain enzymes containing mtDNA-encoded subunits that were most prominent in the central nervous system. Histopathology revealed an encephalomyelopathy with prominent vacuolar changes in the anterior horn of the spinal cord. The H126N TK2 mouse is the first knock-in animal model of human MDS and demonstrates that the severity of TK2 deficiency in tissues may determine the organ-specific phenotype. PMID:18467430

Simultaneous detection of wheat dwarf virus, northern cereal mosaic virus, barley yellow striate mosaic virus and rice black-streaked dwarf virus in wheat by multiplex RT-PCR.

PubMed

Zhang, Peipei; Liu, Yan; Liu, Wenwen; Massart, Sebastien; Wang, Xifeng

2017-11-01

Wheat dwarf virus (WDV), barley yellow striate mosaic virus (BYSMV), rice black-streaked dwarf virus (RBSDV) and northern cereal mosaic virus (NCMV) are four viruses infecting wheat and causing similar symptoms. In this paper, a multiplex reverse transcription polymerase chain reaction (m-RT-PCR) method has been developed for the simultaneous detection and discrimination of these viruses. The protocol uses specific primer set for each virus and produces four distinct fragments (273, 565, 783 and 1296bp), detecting the presence of RBSDV, BYSMV, WDV and NCMV, respectively. Annealing temperature, concentrations of dNTP, Taq polymerase and Mg 2+ were optimized for the m-RT-PCR. The detection limit of the assay was up to 10 -2 dilution. The amplification specificity of these primers was tested against a range of field samples from different regions of China, where RBSDV, BYSMV, WDV have been detected. This study fulfills the need for a rapid and specific wheat virus detection that also has the potential for investigating the epidemiology of these new viral diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

Polyphosphate is a key factor for cell survival after DNA damage in eukaryotic cells.

PubMed

Bru, Samuel; Samper-Martín, Bàrbara; Quandt, Eva; Hernández-Ortega, Sara; Martínez-Laínez, Joan M; Garí, Eloi; Rafel, Marta; Torres-Torronteras, Javier; Martí, Ramón; Ribeiro, Mariana P C; Jiménez, Javier; Clotet, Josep

2017-09-01

Cells require extra amounts of dNTPs to repair DNA after damage. Polyphosphate (polyP) is an evolutionary conserved linear polymer of up to several hundred inorganic phosphate (Pi) residues that is involved in many functions, including Pi storage. In the present article, we report on findings demonstrating that polyP functions as a source of Pi when required to sustain the dNTP increment essential for DNA repair after damage. We show that mutant yeast cells without polyP produce less dNTPs upon DNA damage and that their survival is compromised. In contrast, when polyP levels are ectopically increased, yeast cells become more resistant to DNA damage. More importantly, we show that when polyP is reduced in HEK293 mammalian cell line cells and in human dermal primary fibroblasts (HDFa), these cells become more sensitive to DNA damage, suggesting that the protective role of polyP against DNA damage is evolutionary conserved. In conclusion, we present polyP as a molecule involved in resistance to DNA damage and suggest that polyP may be a putative target for new approaches in cancer treatment or prevention. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparative genomic analysis reveals a critical role of de novo nucleotide biosynthesis for Saccharomyces cerevisiae virulence.

PubMed

Pérez-Torrado, Roberto; Llopis, Silvia; Perrone, Benedetta; Gómez-Pastor, Rocío; Hube, Bernhard; Querol, Amparo

2015-01-01

In recent years, the number of human infection cases produced by the food related species Saccharomyces cerevisiae has increased. Whereas many strains of this species are considered safe, other 'opportunistic' strains show a high degree of potential virulence attributes and can cause infections in immunocompromised patients. Here we studied the genetic characteristics of selected opportunistic strains isolated from dietary supplements and also from patients by array comparative genomic hybridization. Our results show increased copy numbers of IMD genes in opportunistic strains, which are implicated in the de novo biosynthesis of the purine nucleotides pathway. The importance of this pathway for virulence of S. cerevisiae was confirmed by infections in immunodeficient murine models using a GUA1 mutant, a key gene of this pathway. We show that exogenous guanine, an end product of this pathway in its triphosphorylated form, increases the survival of yeast strains in ex vivo blood infections. Finally, we show the importance of the DNA damage response that activates dNTP biosynthesis in yeast cells during ex vivo blood infections. We conclude that opportunistic yeasts may use an enhanced de novo biosynthesis of the purine nucleotides pathway to increase survival and favor infections in the host.

Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†

PubMed Central

Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai

2010-01-01

Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555

Metabolic Recruitment and Directed Evolution of Nucleoside Triphosphate Uptake in Escherichia coli.

PubMed

Pezo, Valérie; Hassan, Camille; Louis, Dominique; Sargueil, Bruno; Herdewijn, Piet; Marlière, Philippe

2018-05-18

We report the design and elaboration of a selection protocol for importing a canonical substrate of DNA polymerase, thymidine triphosphate (dTTP) in Escherichia coli. Bacterial strains whose growth depend on dTTP uptake, through the action of an algal plastid transporter expressed from a synthetic gene inserted in the chromosome, were constructed and shown to withstand the simultaneous loss of thymidylate synthase and thymidine kinase. Such thyA tdk dual deletant strains provide an experimental model of tight nutritional containment for preventing dissemination of microbial GMOs. Our strains transported the four canonical dNTPs, in the following order of preference: dCTP > dATP ≥ dGTP > dTTP. Prolonged cultivation under limitation of exogenous dTTP led to the enhancement of dNTP transport by adaptive evolution. We investigated the uptake of dCTP analogues with altered sugar or nucleobase moieties, which were found to cause a loss of cell viability and an increase of mutant frequency, respectively. E. coli strains equipped with nucleoside triphosphate transporters should be instrumental for evolving organisms whose DNA genome is morphed chemically by fully substituting its canonical nucleotide components.

Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

PubMed

Makarova, A V; Kulbachinskiy, A V

2012-06-01

Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

Civilian Health and Medical Program of the Uniformed Services (CHAMPUS)/TRICARE: Refills of Maintenance Medications Through Military Treatment Facility Pharmacies or National Mail Order Pharmacy Program. Final rule.

PubMed

2016-11-02

This final rule implements section 702 (c) of the Carl Levin and Howard P. "Buck" McKeon National Defense Authorization Act for Fiscal Year 2015 which states that beginning October 1, 2015, the pharmacy benefits program shall require eligible covered beneficiaries generally to refill non-generic prescription maintenance medications through military treatment facility pharmacies or the national mail-order pharmacy program. An interim final rule is in effect. Section 702(c) of the National Defense Authorization Act for Fiscal Year 2015 also terminates the TRICARE For Life Pilot Program on September 30, 2015. The TRICARE For Life Pilot Program described in section 716(f) of the National Defense Authorization Act for Fiscal Year 2013, was a pilot program which began in March 2014 requiring TRICARE For Life beneficiaries to refill non-generic prescription maintenance medications through military treatment facility pharmacies or the national mail-order pharmacy program. TRICARE for Life beneficiaries are those enrolled in the Medicare wraparound coverage option of the TRICARE program. This rule includes procedures to assist beneficiaries in transferring covered prescriptions to the mail order pharmacy program.

The National Security Education Program and Its Service Requirement: An Exploratory Study of What Areas of Government and for What Duration National Security Education Program Recipients Have Worked

ERIC Educational Resources Information Center

Comp, David J.

2013-01-01

The National Security Education Program, established under the National Security Education Act of 1991, has had a post-funding service requirement in the Federal Government for undergraduate scholarship and graduate fellowship recipients since its inception. The service requirement, along with the concern that the National Security Education…

Transcending jurisdictions: developing partnerships for health in Manitoba First Nation communities.

PubMed

Eni, Rachel; Phillips-Beck, Wanda

2011-09-01

The article describes national, regional and community-level activities that contributed to the Manitoba First Nation partnership in maternal and child health programming. The activities reveal a potential for health change that is possible through working together across jurisdictional boundaries. Although we are only in the early phases of program implementation, the Manitoba First Nation Strengthening Families Maternal Child Health Program already suggests considerable successes and measurable outcomes. The article encourages development of further partnerships in the promotion of First Nation health and wellness programming.

48 CFR 52.211-14 - Notice of Priority Rating for National Defense, Emergency Preparedness, and Energy Program Use.

Code of Federal Regulations, 2010 CFR

2010-10-01

... for National Defense, Emergency Preparedness, and Energy Program Use. 52.211-14 Section 52.211-14... for National Defense, Emergency Preparedness, and Energy Program Use. As prescribed in 11.604(a), insert the following provision: Notice of Priority Rating for National Defense, Emergency Preparedness...

75 FR 66766 - National Toxicology Program (NTP); Office of Liaison, Policy and Review; Meeting of the NTP Board...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-29

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Toxicology Program (NTP); Office of Liaison, Policy and Review; Meeting of the NTP Board of Scientific Counselors: Amended Notice AGENCY: National....gov ). Dated: October 21, 2010. John R. Bucher, Associate Director, National Toxicology Program. [FR...

78 FR 25879 - National Organic Program (NOP); Sunset Review (2013)

Federal Register 2010, 2011, 2012, 2013, 2014

2013-05-03

... CFR Part 205 [Document Number AMS-NOP-11-0003; NOP-10-13PR] RIN 0581-AD13 National Organic Program... (Secretary) by the National Organic Standards Board (NOSB) following their November 2011 and May 2012..., National Organic Program, USDA-AMS-NOP, 1400 Independence Ave. SW., Room 2646-So., Ag Stop 0268, Washington...

76 FR 18166 - Technology Innovation Program Advisory Board

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-01

... DEPARTMENT OF COMMERCE National Institute of Standards and Technology Technology Innovation Program Advisory Board AGENCY: National Institute of Standards and Technology, Department of Commerce. ACTION: Notice of public meeting. SUMMARY: The Technology Innovation Program Advisory Board, National...

75 FR 62369 - Technology Innovation Program Advisory Board

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-08

... DEPARTMENT OF COMMERCE National Institute of Standards and Technology Technology Innovation Program Advisory Board AGENCY: National Institute of Standards and Technology, Department of Commerce. ACTION: Notice of public meeting. SUMMARY: The Technology Innovation Program Advisory Board, National...

75 FR 22553 - Technology Innovation Program Advisory Board

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-29

... DEPARTMENT OF COMMERCE National Institute of Standards and Technology Technology Innovation Program Advisory Board AGENCY: National Institute of Standards and Technology, Department of Commerce. ACTION: Notice of public meeting. SUMMARY: The Technology Innovation Program Advisory Board, National...

76 FR 29253 - Part F Special Projects of National Significance Program Cooperative Agreement Under the Ryan...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-20

... Special Projects of National Significance Program Cooperative Agreement Under the Ryan White HIV/AIDS...-Competitive Supplemental Award of the Ryan White HIV/AIDS Program Part F Funds for the Special Projects of National Significance (SPNS) Program's Enhancing Linkages to HIV Care and Treatment in Jail Settings...

National Water Program FY 2015 Performance, Trends and Best Practices Report

EPA Pesticide Factsheets

This Report includes final FY 2015 performance data for all U.S. Environmental Protection Agency (EPA) National Water Program measures included in EPA's 2014-2018 Strategic Plan and the FY 2015 National Water Program Guidance Addendum.

45 CFR 1152.3 - What programs and activities of the Endowment are subject to these regulations?

Code of Federal Regulations, 2011 CFR

2011-10-01

... (Continued) NATIONAL FOUNDATION ON THE ARTS AND THE HUMANITIES NATIONAL ENDOWMENT FOR THE ARTS INTERGOVERNMENTAL REVIEW OF NATIONAL ENDOWMENT FOR THE ARTS PROGRAMS AND ACTIVITIES § 1152.3 What programs and...

76 FR 27002 - Information Collection; National Recreation Program Administration

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-10

... Administration AGENCY: Forest Service, USDA. ACTION: Notice; request for comment. SUMMARY: In accordance with the... organizations on the new information collection, National Recreation Program Administration. DATES: Comments... holidays. SUPPLEMENTARY INFORMATION: Title: National Recreation Program Administration. OMB Number: 0596...

45 CFR 1152.3 - What programs and activities of the Endowment are subject to these regulations?

Code of Federal Regulations, 2010 CFR

2010-10-01

... (Continued) NATIONAL FOUNDATION ON THE ARTS AND THE HUMANITIES NATIONAL ENDOWMENT FOR THE ARTS INTERGOVERNMENTAL REVIEW OF NATIONAL ENDOWMENT FOR THE ARTS PROGRAMS AND ACTIVITIES § 1152.3 What programs and...

National Water Program Performance FY 2017 Trends, and Best Practices Report

EPA Pesticide Factsheets

This report includes FY 2017 performance data for all U.S. Environmental Protection Agency (EPA) National Water Program measures included in EPA's 2014-2018 Strategic Plan and the FY 2016-2017 National Water Program Guidance.

40 CFR 195.1 - Purpose and applicability.

Code of Federal Regulations, 2010 CFR

2010-07-01

... PROGRAMS RADON PROFICIENCY PROGRAMS General Provisions § 195.1 Purpose and applicability. (a) Purpose. The... following programs: The National Radon Measurement Proficiency (RMP) Program, the individual proficiency component of the RMP Program, and the National Radon Contractor Proficiency (RCP) Program. (b) Applicability...

40 CFR 195.1 - Purpose and applicability.

Code of Federal Regulations, 2011 CFR

2011-07-01

... PROGRAMS RADON PROFICIENCY PROGRAMS General Provisions § 195.1 Purpose and applicability. (a) Purpose. The... following programs: The National Radon Measurement Proficiency (RMP) Program, the individual proficiency component of the RMP Program, and the National Radon Contractor Proficiency (RCP) Program. (b) Applicability...

National Program for Solar Heating and Cooling of Buildings. Project Data Summaries. Vol. II: Demonstration Support.

ERIC Educational Resources Information Center

Energy Research and Development Administration, Washington, DC. Div. of Solar Energy.

Brief abstracts of projects funded by the Energy Research and Development Administration (ERDA) and conducted under the National Program for Solar Heating and Cooling of Buildings are presented in three volumes. This, the second volume, identifies the major efforts currently underway in support of the national program. The National Aeronautics and…

50 CFR 86.11 - What does the national BIG Program do?

Code of Federal Regulations, 2010 CFR

2010-10-01

... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false What does the national BIG Program do? 86.11 Section 86.11 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE... GRANT (BIG) PROGRAM General Information About the Grant Program § 86.11 What does the national BIG...

45 CFR 2515.10 - What are the service-learning programs of the Corporation for National and Community Service?

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false What are the service-learning programs of the... Public Welfare (Continued) CORPORATION FOR NATIONAL AND COMMUNITY SERVICE SERVICE-LEARNING PROGRAM PURPOSES § 2515.10 What are the service-learning programs of the Corporation for National and Community...

45 CFR 2515.10 - What are the service-learning programs of the Corporation for National and Community Service?

Code of Federal Regulations, 2011 CFR

2011-10-01

... 45 Public Welfare 4 2011-10-01 2011-10-01 false What are the service-learning programs of the... Public Welfare (Continued) CORPORATION FOR NATIONAL AND COMMUNITY SERVICE SERVICE-LEARNING PROGRAM PURPOSES § 2515.10 What are the service-learning programs of the Corporation for National and Community...

77 FR 73657 - Public Buildings Service; Submission for OMB Review; Art-in-Architecture Program National Artist...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-11

... Buildings Service; Submission for OMB Review; Art-in- Architecture Program National Artist Registry (GSA... Architecture Program National Artist Registry (GSA Form 7437). A notice was published in the Federal Register at 77 FR 58141, on September 19, 2012. No comments were received. The Art-in-Architecture Program is...

National Program for Inspection of Non-Federal Dams. Merino Pond Dam (MA 00110), Thames River Basin, Dudley, Massachusetts. Phase I Inspection Report.

DTIC Science & Technology

1979-09-01

of slm~ lu THAMES RIVER BASIN 00 DUDLEY, MASSACHUSETTS 0 0 in MERINO POND DAM MA 00110 0 PHASE I INSPECTION REPORT 0 NATIONAL DAM INSPECTION PROGRAM ...NATIONAL PROGRAM FOR INSPECTION OF NON-FEDERAL , e, .* f. ,,,-Ue I,. h TNw@ e 6, CONTACT OR IAUNT ONUWSaEPe* U.S. AMY CORPS OF ENGINEERS NEW ENGLAND...SAaUmN el ame 6 am vel NSON* Odlmwmn ba 00-0 o6. oll.I,,NIA*v mOTE& Cover program reads: Phase I Inspection Report, National Dam Inspection Program

NCPV FY 1998 Annual Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

McConnell, R. D.; Hansen, A.

1999-07-19

This report summarizes the in-house and subcontracted research and development (R and D) activities under the National Center for Photovoltaics (NCPV) from October 1, 1997 through September 30, 1998 (FY 1998). The NCPV is part of the U.S. Department of Energy's (DOE's) National Photovoltaics Program, as described in the DOE National Photovoltaics Program Plan for 1996-2000. The mission of the DOE National Photovoltaics Program is to make PV a significant part of the domestic economy--as an industry and as an energy resource. The two primary goals of the national program are to (1) maintain the U.S. industry's world leadership inmore » research and technology development and (2) help the U.S. industry remain a major, profitable force in the world market. The NCPV provides leadership and support to the national program toward achieving its mission and goals.« less

77 FR 63341 - Agency Information Collection Activities; Proposed Collection; Comments Requested: National...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-16

... DEPARTMENT OF JUSTICE Office of Justice Programs [OMB Number 1121-0321] Agency Information Collection Activities; Proposed Collection; Comments Requested: National Institute of Justice Compliance Testing Program ACTION: 30-Day Notice. The Department of Justice, Office of Justice Programs, National...

32 CFR 322.1 - Purpose and applicability.

Code of Federal Regulations, 2012 CFR

2012-07-01

... National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.1 Purpose and... of Defense Privacy Program (32 CFR part 310) within the National Security Agency/Central Security...

32 CFR 322.1 - Purpose and applicability.

Code of Federal Regulations, 2014 CFR

2014-07-01

... National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.1 Purpose and... of Defense Privacy Program (32 CFR part 310) within the National Security Agency/Central Security...

32 CFR 322.1 - Purpose and applicability.

Code of Federal Regulations, 2011 CFR

2011-07-01

... National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.1 Purpose and... of Defense Privacy Program (32 CFR part 310) within the National Security Agency/Central Security...

32 CFR 322.1 - Purpose and applicability.

Code of Federal Regulations, 2010 CFR

2010-07-01

... National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.1 Purpose and... of Defense Privacy Program (32 CFR part 310) within the National Security Agency/Central Security...

32 CFR 322.1 - Purpose and applicability.

Code of Federal Regulations, 2013 CFR

2013-07-01

... National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.1 Purpose and... of Defense Privacy Program (32 CFR part 310) within the National Security Agency/Central Security...

75 FR 52768 - National Protection and Programs Directorate; Agency Information Collection Activities: Office of...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-27

... DEPARTMENT OF HOMELAND SECURITY [Docket No. DHS-2010-0071] National Protection and Programs Directorate; Agency Information Collection Activities: Office of Infrastructure Protection; Chemical Security.... SUMMARY: The Department of Homeland Security, National Protection and Programs Directorate, Office of...

Military Airlift: DOD Plans to Participate in Multi-National Program to Exchange Air Services with European Nations

DTIC Science & Technology

2013-10-30

Air Transport, Air-to-Air Refueling and Other Exchange of Services ( ATARES ) program.1 ATARES is a European program through which member nations use a... ATARES is managed by the Movement Coordination Centre Europe (MCCE), a multi-national organization established in July 2007 to coordinate and optimize...of ATARES but is seeking to join the program. DOD is a member of MCCE and pays a fee for this membership; there is no additional fee to become a

[The German program for disease management guidelines. Results and perspectives].

PubMed

Ollenschläger, Günter; Kopp, Ina

2007-05-15

The Program for National Disease Management Guidelines (German DM-CPG Program) is a joint initiative of the German Medical Association (umbrella organization of the German Chambers of Physicians), the Association of the Scientific Medical Societies (AWMF), and of the National Association of Statutory Health Insurance Physicians (NASHIP). The program aims at developing, implementing and continuously updating best-practice recommendations for countrywide and regional disease management programs in Germany. Since 2003 twelve national guidelines (topics: asthma, chronic obstructive pulmonary disease, HI (Chronic heart failure), CVD (Chronic coronary heart disease) back pain, depression, several aspects of diabetes) have been produced by use of a standardized procedure in accordance with internationally consented methodologies. For countrywide dissemination and implementation the program uses a wide range of specialist journals, continuous medical education and quality management programs. So far, 36 out of 150 national scientific medical associations, four allied health profession organizations, and twelve national consumer organizations have been participating in the DM-CPG Program. Studies to evaluate the program's effects on health-care providers' behavior and patients' outcomes are under way.

Administrator, National Security Education Program

DTIC Science & Technology

1993-01-19

1. Administer, direct, and manage the resources for the lit program. 2. Establish and direct an international education center, as approved by the...approve the hiring of, and evaluate the performance of personnel who staff the international education center. 4. Ensure appropriate internal management...Administrator, National Security Education Program * References: (a) DoD Directive 1025.2 , "National Security * Education Program," January 13, 1993

75 FR 9607 - National Protection and Programs Directorate; Guidance Document Request and Evaluation

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-03

... techniques or other forms of information technology, e.g., permitting electronic submissions of responses... DEPARTMENT OF HOMELAND SECURITY [Docket No. DHS-2010-0010] National Protection and Programs Directorate; Guidance Document Request and Evaluation AGENCY: National Protection and Programs Directorate...

77 FR 54615 - Strategic Management Program; Fiscal Year 2013-2016 Strategic Plan

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-05

... Manager, Strategic Management Program; National Transportation Safety Board, 490 L'Enfant Plaza SW., MD-1... NATIONAL TRANSPORTATION SAFETY BOARD Strategic Management Program; Fiscal Year 2013-2016 Strategic Plan AGENCY: National Transportation Safety Board. ACTION: Notice: Request for comments. SUMMARY: This...

75 FR 14454 - National Protection and Programs Directorate; National Infrastructure Advisory Council

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-25

..., National Infrastructure Advisory Council. [FR Doc. 2010-6633 Filed 3-24-10; 8:45 am] BILLING CODE 9110-9P-P ... Directorate; National Infrastructure Advisory Council AGENCY: National Protection and Programs Directorate... Infrastructure Advisory Council (NIAC) will meet on Tuesday, April 13, 2010, at the National Press Club's...

Postdeployment military mental health training: cross-national evaluations.

PubMed

Foran, Heather M; Garber, Bryan G; Zamorski, Mark A; Wray, Mariane; Mulligan, Kathleen; Greenberg, Neil; Castro, Carl Andrew; Adler, Amy B

2013-05-01

Deployments increase risk for adjustment problems in service members. To mitigate this increased risk, mental health training programs have been developed and implemented in several nations. As part of a coordinated effort, three nations adapted a U.S. mental health training program that had been validated by a series of group randomized trials demonstrating improvement in postdeployment adjustment. Implementation of evidence-based programs in a new context is challenging: How much of the original program needs to remain intact in order to retain its utility? User satisfaction rates can provide essential data to assess how well a program is accepted. This article summarizes service member ratings of postdeployment mental health training and compares ratings from service members across four nations. The participating nations (Canada, New Zealand, United Kingdom, and the United States) administered mental health training to active duty military personnel in their respective nations. Following the training, military personnel completed an evaluation of the training. Overall, across the four nations, more than 70% of military personnel agreed or strongly agreed that they were satisfied with the mental health training. Although some differences in evaluations were observed across nations, components of training that were most important to overall satisfaction with the training were strikingly similar across nations. Fundamentally, it appears feasible that despite cultural and organizational differences, a mental health training program developed in one nation can be successfully adapted for use in other nations. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Trans-National Scale-Up of Services in Global Health

PubMed Central

Shahin, Ilan; Sohal, Raman; Ginther, John; Hayden, Leigh; MacDonald, John A.; Mossman, Kathryn; Parikh, Himanshu; McGahan, Anita; Mitchell, Will; Bhattacharyya, Onil

2014-01-01

Background Scaling up innovative healthcare programs offers a means to improve access, quality, and health equity across multiple health areas. Despite large numbers of promising projects, little is known about successful efforts to scale up. This study examines trans-national scale, whereby a program operates in two or more countries. Trans-national scale is a distinct measure that reflects opportunities to replicate healthcare programs in multiple countries, thereby providing services to broader populations. Methods Based on the Center for Health Market Innovations (CHMI) database of nearly 1200 health programs, the study contrasts 116 programs that have achieved trans-national scale with 1,068 single-country programs. Data was collected on the programs' health focus, service activity, legal status, and funding sources, as well as the programs' locations (rural v. urban emphasis), and founding year; differences are reported with statistical significance. Findings This analysis examines 116 programs that have achieved trans-national scale (TNS) across multiple disease areas and activity types. Compared to 1,068 single-country programs, we find that trans-nationally scaled programs are more donor-reliant; more likely to focus on targeted health needs such as HIV/AIDS, TB, malaria, or family planning rather than provide more comprehensive general care; and more likely to engage in activities that support healthcare services rather than provide direct clinical care. Conclusion This work, based on a large data set of health programs, reports on trans-national scale with comparison to single-country programs. The work is a step towards understanding when programs are able to replicate their services as they attempt to expand health services for the poor across countries and health areas. A subset of these programs should be the subject of case studies to understand factors that affect the scaling process, particularly seeking to identify mechanisms that lead to improved health outcomes. PMID:25375328

Profiles of Participants in the National School Lunch Program: Data from Two National Surveys. Economic Information Bulletin Number 17

ERIC Educational Resources Information Center

Newman, Constance; Ralston, Katherine

2006-01-01

The National School Lunch Program (NSLP) serves more than 29 million children each day, but there is little information on the characteristics of those children. This study reports new estimates of NSLP participant characteristics using two national surveys: the 2001 Panel of the Survey of Income and Program Participation (SIPP) and the 1999-2002…

76 FR 8378 - National Park Service Alaska Region's Subsistence Resource Commission (SRC) Program

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-14

... DEPARTMENT OF THE INTERIOR National Park Service [NPS-AKR-DENA] [9924-PYS] National Park Service Alaska Region's Subsistence Resource Commission (SRC) Program AGENCY: National Park Service, Interior. ACTION: Notice of public meeting for the National Park Service Alaska Region's Subsistence Resource...

Wiisokotaatiwin: development and evaluation of a community-based palliative care program in Naotkamegwanning First Nation.

PubMed

Nadin, Shevaun; Crow, Maxine; Prince, Holly; Kelley, Mary Lou

2018-04-01

Approximately 474 000 Indigenous people live in 617 First Nations communities across Canada; 125 of those communities are located in Ontario, primarily in rural and remote areas. Common rural health challenges, including for palliative care, involve quality and access. The need for culturally relevant palliative care programs in First Nations communities is urgent because the population is aging with a high burden of chronic and terminal disease. Because local palliative care is lacking, most First Nations people now leave their culture, family and community to receive care in distant hospitals or long-term care homes. Due to jurisdictional issues, a policy gap exists where neither federal nor provincial governments takes responsibility for funding palliative care in First Nations communities. Further, no Canadian program models existed for how different levels of government can collaborate to fund and deliver palliative care in First Nations communities. This article describes an innovative, community-based palliative care program (Wiisokotaatiwin) developed in rural Naotkamegwanning, and presents the results of a process evaluation of its pilot implementation. The evaluation aimed to (i) document the program's pilot implementation, (ii) assess progress toward intended program outcomes and (iii) assess the perceived value of the program. The Wiisokotaatiwin Program was developed and implemented over 5 years using participatory action research (http://www.eolfn.lakeheadu.ca). A mixed-method evaluation approach was adopted. Descriptive data were extracted from program documents (eg client registration forms). Client tracking forms documented service provision data for a 4-month sample period. Quantitative and qualitative data were collected through client and family member questionnaires (n=7) and healthcare provider questionnaires (n=22). A focus group was conducted with the program leadership team responsible for program development. Quantitative data were summarized using descriptive statistics. An inductive approach was used to identify themes in the qualitative data related to the evaluation questions. The findings demonstrated the program was implemented as intended, and that there was a need for the program, with six clients on the 10-month pilot. The findings also indicated achievement of program-level outcomes and progress toward system-level outcomes. Clients/families and healthcare providers were satisfied with the program and perceived it to be meeting its objectives. The program model was also perceived to be transferrable to other First Nations communities. The results demonstrate how a rural First Nations community can build capacity and develop a palliative care program tailored to their unique culture and context that builds upon and is integrated into existing services. The Wiisokotaatiwin Program allowed community members to receive their palliative care at home, improved client experience and enhanced service integration. This article provides a First Nations specific model for a palliative care program that overcomes jurisdictional issues at the local level, and a methodology for developing and evaluating community-based palliative care programs in rural First Nations communities. The article demonstrates how local, federal and provincial healthcare providers and organizations collaborated to build capacity, fund and deliver community-based palliative care. The described process of developing the program has applicability in other First Nations (Indigenous) communities and for healthcare decisionmakers.

Reforming the community research program: from Community Clinical Oncology Program to the National Cancer Institute Community Oncology Research Program.

PubMed

Zon, Robin T

2014-01-01

Community research has been an integral and influential component of the National Research Program since the late 1970s. Institutionalization of community research in the Community Clinical Oncology Program (CCOP) has resulted in successful collaborations, meaningful accrual, achievement of quality standards, and translation of research into clinical practice. Although the national clinical trial system is undergoing modernization and improvement, the success of the CCOP and minority-based CCOP in cancer treatment, prevention, and control research is being extended to include cancer care delivery research in the newly created National Cancer Institute (NCI) Community Oncology Research Program. This article briefly presents a historic perspective of community involvement in federally sponsored clinical trials and introduces the continued involvement in the newly created NCI program.

Laboratory directed research and development program FY 1999

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hansen, Todd; Levy, Karin

2000-03-08

The Ernest Orlando Lawrence Berkeley National Laboratory (Berkeley Lab or LBNL) is a multi-program national research facility operated by the University of California for the Department of Energy (DOE). As an integral element of DOE's National Laboratory System, Berkeley Lab supports DOE's missions in fundamental science, energy resources, and environmental quality. Berkeley Lab programs advance four distinct goals for DOE and the nation: (1) To perform leading multidisciplinary research in the computing sciences, physical sciences, energy sciences, biosciences, and general sciences in a manner that ensures employee and public safety and protection of the environment. (2) To develop and operatemore » unique national experimental facilities for qualified investigators. (3) To educate and train future generations of scientists and engineers to promote national science and education goals. (4) To transfer knowledge and technological innovations and to foster productive relationships among Berkeley Lab's research programs, universities, and industry in order to promote national economic competitiveness. This is the annual report on Laboratory Directed Research and Development (LDRD) program for FY99.« less

77 FR 26509 - Request for Information on Proposed New Program: National Network for Manufacturing Innovation...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-04

...): Refining standards, materials, and equipment for additive manufacturing to enable low- cost, low-volume...-01] Request for Information on Proposed New Program: National Network for Manufacturing Innovation...: Request for information. SUMMARY: The NIST-hosted Advanced Manufacturing National Program Office (AMNPO...

42 CFR 68c.9 - What loans qualify for repayment?

Code of Federal Regulations, 2011 CFR

2011-10-01

... Program, Public Health and National Health Service Corps Scholarship Training Program, National Health..., INTERNSHIPS, TRAINING NATIONAL INSTITUTE OF CHILD HEALTH AND HUMAN DEVELOPMENT CONTRACEPTION AND INFERTILITY RESEARCH LOAN REPAYMENT PROGRAM § 68c.9 What loans qualify for repayment? (a) The CIR-LRP will repay...

42 CFR 68c.9 - What loans qualify for repayment?

Code of Federal Regulations, 2012 CFR

2012-10-01

... Program, Public Health and National Health Service Corps Scholarship Training Program, National Health..., INTERNSHIPS, TRAINING NATIONAL INSTITUTE OF CHILD HEALTH AND HUMAN DEVELOPMENT CONTRACEPTION AND INFERTILITY RESEARCH LOAN REPAYMENT PROGRAM § 68c.9 What loans qualify for repayment? (a) The CIR-LRP will repay...

42 CFR 68a.5 - Who is ineligible to participate?

Code of Federal Regulations, 2010 CFR

2010-10-01

..., INTERNSHIPS, TRAINING NATIONAL INSTITUTES OF HEALTH (NIH) CLINICAL RESEARCH LOAN REPAYMENT PROGRAM FOR...: Physicians Shortage Area Scholarship Program, National Research Service Award Program, Public Health Service...) Professions Scholarship Program, Indian Health Service Scholarship Program, and the NIH AIDS Research Loan...

Integration of strategic inventory and monitoring programs for the forest lands, wood lands, range lands and agricultural lands of the United States

Treesearch

Raymond L. Czaplewski

1999-01-01

The United States Department of Agriculture uses the Forest Inventory and Analysis (FIA) program to monitor the nation's forests and wood lands, and the National Resources Inventory (NRI) program to monitor the nation's agricultural and range lands. Although their measurement methods and sampling frames are very different, both programs are developing annual...

15 CFR 922.25 - Designation determination and findings.

Code of Federal Regulations, 2010 CFR

2010-01-01

... RESOURCE MANAGEMENT NATIONAL MARINE SANCTUARY PROGRAM REGULATIONS Designation of National Marine Sanctuaries § 922.25 Designation determination and findings. (a) In designating a National Marine Sanctuary... Program's fiscal capability to manage the area as a National Marine Sanctuary. ...

32 CFR 2004.20 - National Industrial Security Program Operating Manual (NISPOM) [201(a)].

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 6 2010-07-01 2010-07-01 false National Industrial Security Program Operating Manual (NISPOM) [201(a)]. 2004.20 Section 2004.20 National Defense Other Regulations Relating to National... that surface from industry, Executive Branch departments and agencies, or the NISPPAC. When consensus...

The First Nation Forestry Program in Ontario

Treesearch

Rick Greet

2001-01-01

"In partnership with First Nations" has been described as the motto of the First Nation Forestry Program (FNFP). Working in cooperation with the federal and provincial governments, forest industry companies, and other partners, the FNFP provides an opportunity for First Nations and First Nation businesses and organizations to promote forest-based economic...

75 FR 79025 - Notice Pursuant to the National Cooperative Research and Production Act of 1993-National...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-17

... DEPARTMENT OF JUSTICE Antitrust Division Notice Pursuant to the National Cooperative Research and Production Act of 1993--National Shipbuilding Research Program Notice is hereby given that, on November 29....C. 4301 et seq. (``the Act''), National Shipbuilding Research Program (``NSRP'') has filed written...

75 FR 65511 - Notice Pursuant to the National Cooperative Research and Production Act of 1993-National...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-25

... DEPARTMENT OF JUSTICE Antitrust Division Notice Pursuant to the National Cooperative Research and Production Act of 1993--National Shipbuilding Research Program Notice is hereby given that, on September 20....C. 4301 et seq. (``the Act''), National Shipbuilding Research Program (``NSRP'') has filed written...

76 FR 57066 - National Heart, Lung, and Blood Institute; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-15

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Heart, Lung, and..., discussion, and evaluation of individual intramural programs and projects conducted by the National Heart... Assistance Program Nos. 93.233, National Center for Sleep Disorders Research; 93.837, Heart and Vascular...

77 FR 58402 - National Heart, Lung, and Blood Institute; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-20

... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Heart, Lung, and..., discussion, and evaluation of individual intramural programs and projects conducted by the National Heart... Assistance Program Nos. 93.233, National Center for Sleep Disorders Research; 93.837, Heart and Vascular...

The Impact of a National Faculty Development Program Embedded Within an Academic Professional Organization.

PubMed

Baldwin, Constance D; Gusic, Maryellen E; Chandran, Latha

2017-08-01

A sizeable literature describes the effectiveness of institution-based faculty development programs in nurturing faculty educators as scholars, but national programs are less common and seldom evaluated. To fill this role, the Educational Scholars Program (ESP) was created within the Academic Pediatric Association (APA) in 2006. It is a national, three-year, cohort-based certification program focused on fostering educational scholarship. This article describes the development and outcomes of an innovative program embedded within the framework of a national professional organization, and offers a model for potential adaptation by similar organizations to enhance their support of educators.After 10 years, 171 scholars have enrolled in the ESP, and 50 faculty have participated. Scholars are assigned a faculty advisor and participate in three full-day sessions at a national meeting; online, interactive learning modules; and a mentored, scholarly project. The program receives support from the APA in four organizational frames: structural, human resource, political, and symbolic. The self-perceived scholarly proficiency of the scholars in Cohort 1 increased significantly over time, and their productivity and collaborations increased during and after the program. Scholars wrote enthusiastically about their experience in yearly and postprogram evaluations. In interviews, eight past APA presidents explained that the ESP strengthened the APA's mission, created new leaders, and provided a new model for other APA programs. Outcomes of the ESP suggest that a longitudinal faculty development program embedded within a national professional organization can create a social enterprise not only within the organization but also within the broader national community of educator-scholars.

75 FR 51919 - National Organic Program; Amendment to the National List of Allowed and Prohibited Substances...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-24

...-10-0051; NOP-10-04IR] RIN 0581-AD04 National Organic Program; Amendment to the National List of... recommendation submitted to the Secretary of Agriculture (Secretary) by the National Organic Standards Board... the annotation of one substance on the National List, methionine, to extend its use in organic poultry...

78 FR 58548 - Request for Information: The National Toxicology Program Requests Information on Use, Human...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-24

... validate new and better testing methods. Other activities of the program focus on strengthening the science... National Toxicology Program (NTP) at the National Institute of Environmental Health Sciences (NIEHS... FURTHER INFORMATION CONTACT: Dr. Inok Surh, Research Fellow, Toxicology Branch, Division of the NTP, NIH...

8 CFR 245a.30 - Description of program.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Description of program. 245a.30 Section 245a.30 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS ADJUSTMENT OF... IMMIGRATION AND NATIONALITY ACT LIFE Act Amendments Family Unity Provisions § 245a.30 Description of program...

8 CFR 245a.30 - Description of program.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Description of program. 245a.30 Section 245a.30 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS ADJUSTMENT OF... IMMIGRATION AND NATIONALITY ACT LIFE Act Amendments Family Unity Provisions § 245a.30 Description of program...

8 CFR 245a.30 - Description of program.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Description of program. 245a.30 Section 245a.30 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS ADJUSTMENT OF... IMMIGRATION AND NATIONALITY ACT LIFE Act Amendments Family Unity Provisions § 245a.30 Description of program...

78 FR 78325 - National Research, Promotion, and Consumer Information Programs; Request for Extension and...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-26

...: Title: National Research, Promotion, and Consumer Information Programs. OMB Number: 0581-0093..., filing of petitions and applications and agency #0;statements of organization and functions are examples... Service [Doc.No. AMS-LPS-13-0088] National Research, Promotion, and Consumer Information Programs; Request...

78 FR 77204 - Proposed Information Collection (VA National Veterans Sports Programs and Special Event Surveys...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-20

... National Veterans Sports Programs and Special Event Surveys Data Collection) Activity: Comment Request... needed to evaluate the National Veterans Sports Programs and Special Event Surveys Data Collection is... treatments are being offered, and tangible, quantitative results are being measured and tracked for continual...

77 FR 72365 - National Institute on Drug Abuse; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-05

... U.S.C. App.), notice is hereby given of a meeting of the National Advisory Council on Drug Abuse... administrative, legislative and program developments in the drug abuse field. Place: National Institutes of... of Federal Domestic Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs...

76 FR 51381 - National Institute on Drug Abuse; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-18

... U.S.C. App.), notice is hereby given of a meeting of the National Advisory Council on Drug Abuse... administrative, legislative and program developments in the drug abuse field. Place: National Institutes of.... (Catalogue of Federal Domestic Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs...

76 FR 8965 - National Vaccine Injury Compensation Program: Revisions to the Vaccine Injury Table

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-16

... DEPARTMENT OF HEALTH AND HUMAN SERVICES 42 CFR Part 100 RIN 0907-AA National Vaccine Injury Compensation Program: Revisions to the Vaccine Injury Table AGENCY: Health Resources and Services... ``National Vaccine Injury Compensation Program: Revisions to the Vaccine Injury Table.'' Date and Time: The...

Literacy Program. National Issues Forums Special Report.

ERIC Educational Resources Information Center

National Issues Forums, Dayton, OH.

In the spring of 1988, 33 representatives from 20 institutions or organizations sponsoring National Issues Forum (NIF) literacy programs attended a national conference in Washington, D.C. Throughout the conference, representatives from the organizations sponsoring NIF literacy programs made statements on the importance of NIF as a tool for…

Program of Research for Forests and Associated Rangelands

Treesearch

Nelson S. Loftus; Joseph G. Massey; [Compilers

1978-01-01

This research plan for the Southern Region is a companion publication to the National Program of Research for Forests and Associated Rangelands. While the national program reflects both regional and national priorities, this plan provides details on forestry research matters concerning the South. For the reader's convenience, background information on development...

75 FR 57658 - National Veterinary Accreditation Program; Correcting Amendment

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-22

... [Docket No. APHIS-2006-0093] RIN 0579-AC04 National Veterinary Accreditation Program; Correcting Amendment..., Docket No. APHIS-2006-0093), and effective on February 1, 2010, we amended the National Veterinary... Veterinary Accreditation Program, VS, APHIS, 4700 River Road Unit 200, Riverdale, MD 20737; (301) 851-3401...

77 FR 58141 - Public Buildings Service; Information Collection; Art-in-Architecture Program National Artist...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-19

... Buildings Service; Information Collection; Art-in- Architecture Program National Artist Registry (GSA Form... regarding Art-in Architecture Program National Artist Registry (GSA Form 7437). The Art-in-Architecture...-Architecture & Fine Arts Division (PCAC), 1800 F Street NW., Room 3305, Washington, DC 20405, at telephone(202...

Status of US Maglev Program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rote, D.M.

1993-11-01

Factors that have led to a reawakening of national interest in maglev technology in the United States are discussed. The development of the National Maglev program, its findings, and the four maglev design concepts resulting from the System Concept Definition study are reviewed. Technical requirements for the SCD contractors and for the Prototype Development Program are compared. Some legislative background information is given, with a review of the most important maglev legislation. Plans for the National Maglev Prototype Development Program are discussed, and activities related to maglev at Argonne National Laboratory are summarized.

A summary of the U.S. Geological Survey National Water-Quality Assessment program

USGS Publications Warehouse

Hirsch, R.M.; Alley, W.M.; Wilber, W.G.

1988-01-01

Beginning in 1986, the Congress appropriated funds for the U.S. Geological Survey to test and refine concepts for a National Water Quality Assessment Program. At present, the program is in a pilot phase with field studies occurring in seven areas around the Nation. In 1990, a committee of the National Academy of Sciences will complete an evaluation of the design and potential utility of the program. A decision about moving to full-scale implementation will be made upon completion of this evaluation. The program is intended to address a wide range of national water quality issues that include chemical contamination, acidification, eutrophication, salinity, sedimentation, and sanitary quality. The goals of the program are to: (1) provide nationally consistent descriptions of current water quality conditions for a large part of the Nation 's water resources; (2) define long-term trends (or lack of trends) in water quality; and (3) identify and describe the relations of both current conditions and trends in water quality to natural and human factors. This information will be provided to water managers, policy makers, and the public to provide an improved scientific basis for evaluating the effectiveness of water quality management programs and for predicting the likely effects of contemplated changes in land- and water-management practices. (USGS)

50 CFR 253.18 - Program operating guidelines.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Program operating guidelines. 253.18 Section 253.18 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC... Guarantee Program § 253.18 Program operating guidelines. The Division may issue Program operating guidelines...

Evaluation of 6 remote First Nations community-based buprenorphine programs in northwestern Ontario: Retrospective study.

PubMed

Mamakwa, Solomon; Kahan, Meldon; Kanate, Dinah; Kirlew, Mike; Folk, David; Cirone, Sharon; Rea, Sara; Parsons, Pierre; Edwards, Craig; Gordon, Janet; Main, Fiona; Kelly, Len

2017-02-01

To evaluate established opioid addiction treatment programs that use traditional healing in combination with buprenorphine-naloxone maintenance treatment in 6 First Nations communities in the Sioux Lookout region of northwestern Ontario. Retrospective cohort study. Six First Nations communities in northwestern Ontario. A total of 526 First Nations participants in opioid-dependence treatment programs. Buprenorphine-naloxone substitution therapy and First Nations healing programming. Retention rates and urine drug screening (UDS) results. Treatment retention rates at 6, 12, and 18 months were 84%, 78%, and 72%, respectively. We estimate that the rate at 24 months will also be more than 70%. The UDS programming varied and was implemented in only 1 community. Initially urine testing was voluntary and it then became mandatory. Screening with either method found the proportion of urine samples with negative results for illicit opioids ranged between 84% and 95%. The program's treatment retention rates and negative UDS results were higher than those reported for most methadone and buprenorphine-naloxone programs, despite a patient population where severe posttraumatic stress disorder is endemic, and despite the programs' lack of resources and addiction expertise. Community-based programs like these overcome the initial challenge of cultural competence. First Nations communities in other provinces should establish their own buprenorphinenaloxone programs, using local primary care physicians as prescribers. Sustainable core funding is needed for programming, long-term aftercare, and trauma recovery for such initiatives. Copyright© the College of Family Physicians of Canada.

40 CFR 35.9000 - Applicability.

Code of Federal Regulations, 2010 CFR

2010-07-01

... ASSISTANCE Financial Assistance for the National Estuary Program § 35.9000 Applicability. This subpart..., organizations, and individuals for pollution abatement and control programs under the National Estuary Program...

40 CFR 35.9000 - Applicability.

Code of Federal Regulations, 2011 CFR

2011-07-01

... ASSISTANCE Financial Assistance for the National Estuary Program § 35.9000 Applicability. This subpart..., organizations, and individuals for pollution abatement and control programs under the National Estuary Program...

40 CFR 35.9000 - Applicability.

Code of Federal Regulations, 2014 CFR

2014-07-01

... ASSISTANCE Financial Assistance for the National Estuary Program § 35.9000 Applicability. This subpart..., organizations, and individuals for pollution abatement and control programs under the National Estuary Program...

40 CFR 35.9000 - Applicability.

Code of Federal Regulations, 2012 CFR

2012-07-01

... ASSISTANCE Financial Assistance for the National Estuary Program § 35.9000 Applicability. This subpart..., organizations, and individuals for pollution abatement and control programs under the National Estuary Program...

40 CFR 35.9000 - Applicability.

Code of Federal Regulations, 2013 CFR

2013-07-01

... ASSISTANCE Financial Assistance for the National Estuary Program § 35.9000 Applicability. This subpart..., organizations, and individuals for pollution abatement and control programs under the National Estuary Program...

Student Assistance General Provisions; Federal Pell Grant Program; Academic Competitiveness Grant Program; and National Science and Mathematics Access to Retain Talent Grant Program. Final Rule. Federal Register, Part IV, Department of Education, 34 CFR Parts 668, 690, and 691

ERIC Educational Resources Information Center

National Archives and Records Administration, 2006

2006-01-01

The Secretary is adopting as final, with changes, interim final regulations in: 34 CFR part 691 for the Academic Competitiveness Grant (ACG) and National Science and Mathematics Access to Retain Talent Grant (National SMART Grant) programs; 34 CFR part 668 (Student Assistance General Provisions); and 34 CFR part 690 (Federal Pell Grant Program).…

National Civil Applications Program: strategic plan vision for 2005

USGS Publications Warehouse

,

2004-01-01

The National Mapping Division (NMD) has developed this comprehensive strategic plan to chart the course of the National Civil Applications Program (NCAP) over the next 5 years. To meet the challenges of the future, the NCAP is changing its program emphases, methods of responding to customer needs, and business practices. The NCAP Strategic Plan identifies the new direction for the program through a series of strategic thrusts and goals for managers to use in formulating plans, establishing program emphases, and determining resource needs and allocations.

Evaluation of hospitals participating in the American College of Surgeons National Surgical Quality Improvement Program.

PubMed

Sheils, Catherine R; Dahlke, Allison R; Kreutzer, Lindsey; Bilimoria, Karl Y; Yang, Anthony D

2016-11-01

The American College of Surgeons National Surgical Quality Improvement Program is well recognized in surgical quality measurement and is used widely in research. Recent calls to make it a platform for national public reporting and pay-for-performance initiatives highlight the importance of understanding which types of hospitals elect to participate in the program. Our objective was to compare characteristics of hospitals participating in the American College of Surgeons National Surgical Quality Improvement Program to characteristics of nonparticipating US hospitals. The 2013 American Hospital Association and Centers for Medicare & Medicaid Services Healthcare Cost Report Information System datasets were used to compare characteristics and operating margins of hospitals participating in the American College of Surgeons National Surgical Quality Improvement Program to those of nonparticipating hospitals. Of 3,872 general medical and surgical hospitals performing inpatient surgery in the United States, 475 (12.3%) participated in the American College of Surgeons National Surgical Quality Improvement Program. Participating hospitals performed 29.0% of all operations in the United States. Compared with nonparticipating hospitals, American College of Surgeons National Surgical Quality Improvement Program hospitals had a higher mean annual inpatient surgical case volume (6,426 vs 1,874; P < .001) and a larger mean number of hospital beds (420 vs 167; P < .001); participating hospitals were more often teaching hospitals (35.2% vs 4.1%; P < .001), had more quality-related accreditations (P < .001), and had higher mean operating margins (P < .05). States with the highest proportions of hospitals participating in the American College of Surgeons National Surgical Quality Improvement Program had established surgical quality improvement collaboratives. The American College of Surgeons National Surgical Quality Improvement Program hospitals are large teaching hospitals with more quality-related accreditations and financial resources. These findings should be considered when reviewing research studies using the American College of Surgeons National Surgical Quality Improvement Program data, and the findings reinforce that efforts are needed to facilitate participation in surgical quality improvement by all hospital types. Copyright © 2016 Elsevier Inc. All rights reserved.

40 CFR 195.30 - Failure to remit fee.

Code of Federal Regulations, 2010 CFR

2010-07-01

... PROGRAMS RADON PROFICIENCY PROGRAMS Fees § 195.30 Failure to remit fee. EPA will not process an application or continue a participant's listing in the National Radon Measurement Proficiency program, individual proficiency component of the RMP program, or the National Radon Contractor Proficiency program until the...

32 CFR 33.25 - Program income.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 1 2010-07-01 2010-07-01 false Program income. 33.25 Section 33.25 National... Post-Award Requirements Financial Administration § 33.25 Program income. (a) General. Grantees are encouraged to earn income to defray program costs. Program income includes income from fees for services...

40 CFR 195.30 - Failure to remit fee.

Code of Federal Regulations, 2011 CFR

2011-07-01

... PROGRAMS RADON PROFICIENCY PROGRAMS Fees § 195.30 Failure to remit fee. EPA will not process an application or continue a participant's listing in the National Radon Measurement Proficiency program, individual proficiency component of the RMP program, or the National Radon Contractor Proficiency program until the...

Pediatric Resident-as-Teacher Curricula: A National Survey of Existing Programs and Future Needs.

PubMed

Fromme, H Barrett; Whicker, Shari A; Paik, Steve; Konopasek, Lyuba; Koestler, Jennifer L; Wood, Beverly; Greenberg, Larrie

2011-06-01

We conducted a national survey of US pediatric program directors to explore the current status, content, and teaching methods of Resident-as-Teacher (RAT) curricula. The purposes of the survey were to (1) determine the level and method of evaluation of such curricula, and (2) assess the need for a national curricular resource in this area. A survey was sent to US pediatric program directors that asked questions regarding demographics, support, design, development, content, and evaluation of RAT curricula, as well as existing needs and desires for RAT curricular resources. Sixty-two percent of pediatric program directors completed our survey. Eighty-seven percent have a formal RAT curriculum, but more than 50% allocate 10 hours or less to it during residency. The primary teaching modalities are lectures and workshops. Content areas include feedback, in-patient teaching, communication skills, case-based teaching, role modeling, evaluation, leadership skills, 1-minute preceptors, teaching/learning styles, professionalism, and small-group teaching. Sixty-three percent of programs report evaluating their curricula, but only 27% perceive their program to be very/extremely effective. Nearly all respondents expressed interest in a national RAT curriculum, preferring web-based modules for dissemination. Despite an Accreditation Council for Graduate Medical Education requirement for a RAT curriculum, some pediatrics programs still lack one, and some consider their program only moderately effective. A wealth of curricular material exists across programs, which could be shared nationally. Establishing a national RAT curriculum would offer programs resources to meet educational mandates and the ability to tailor programs to best fit their own program needs.

49 CFR 33.3 - Program eligibility.

Code of Federal Regulations, 2013 CFR

2013-10-01

..., military or critical infrastructure assistance to any foreign nation, homeland security, stockpiling, space... § 33.3 Program eligibility. Certain programs to promote the national defense are eligible for...

49 CFR 33.3 - Program eligibility.

Code of Federal Regulations, 2012 CFR

2012-10-01

..., military or critical infrastructure assistance to any foreign nation, homeland security, stockpiling, space... § 33.3 Program eligibility. Certain programs to promote the national defense are eligible for...

42 CFR 68a.9 - What loans qualify for repayment?

Code of Federal Regulations, 2010 CFR

2010-10-01

..., INTERNSHIPS, TRAINING NATIONAL INSTITUTES OF HEALTH (NIH) CLINICAL RESEARCH LOAN REPAYMENT PROGRAM FOR... following programs: Physicians Shortage Area Scholarship Program (Federal or State), National Research...

75 FR 54590 - Notice of 2010 National Organic Certification Cost-Share Program

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-08

...] Notice of 2010 National Organic Certification Cost-Share Program AGENCY: Agricultural Marketing Service... Certification Cost-Share Funds. The AMS has allocated $22.0 million for this organic certification cost-share... National Organic Certification Cost- Share Program is authorized under 7 U.S.C. 6523, as amended by section...

24 CFR 570.605 - National Flood Insurance Program.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false National Flood Insurance Program... Requirements § 570.605 National Flood Insurance Program. Notwithstanding the date of HUD approval of the... accordance with 24 CFR part 91), section 202(a) of the Flood Disaster Protection Act of 1973 (42 U.S.C. 4106...

76 FR 53844 - National Dairy Promotion and Research Program; Invitation To Submit Comments on Proposed...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-30

... Stabilization Act of 1983 authorizes a national program for dairy product promotion, research and nutrition...-0007; DA-11-02] National Dairy Promotion and Research Program; Invitation To Submit Comments on.... SUMMARY: This document invites comments on a proposed amendment to the Dairy Promotion and Research Order...

77 FR 25024 - Certification of Compliance With Meal Requirements for the National School Lunch Program Under...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-27

... SNDA was conducted. Larger proportions of elementary schools met the standards for total fat and... Certification of Compliance With Meal Requirements for the National School Lunch Program Under the Healthy.... SUMMARY: This interim rule amends National School Lunch Program regulations to conform to requirements...

Evaluating a National Science and Technology Program Using the Human Capital and Relational Asset Perspectives

ERIC Educational Resources Information Center

Hung, Chia-Liang; Chou, Jerome Chih-Lung; Roan, Hung-Wei

2010-01-01

The purpose of this research is to evaluate the performance of the National Science and Technology Program (NSTP) by targeting the Taiwan National Telecommunication Program (NTP) initiated in 1998. The Taiwan telecommunications industry has prospered, currently occupying key positions in global markets even though NTP seldom contributes positively…

Institutionalization and Sustainability of the National Science Foundation's Advanced Technological Education Program.

ERIC Educational Resources Information Center

Bailey, Thomas R.; Matsuzuka, Yukari; Jacobs, James; Morest, Vanessa Smith; Hughes, Katherine L.

This document reports on a study conducted by the National Science Foundation (NSF) that examines the Advanced Technological Education (ATE) program. ATE aims to promote systemic reform of the nation's science, technology, engineering, and mathematics (STEM) education. The study analyzed the influence of the ATE program on the nature of STEM…

Techniques: Integrating the National Issues Forums into ABE Programs.

ERIC Educational Resources Information Center

Colhapp, Barbara Jones

1989-01-01

This article discusses the National Issues Forum (NIF), a national, nonpartisan program designed to encourage citizen discussion of important public issues. The programs try to recreate the town meeting concept of reaching consensus on public issues. Short workbooks are available on two reading levels for issues such as the superpowers, crime,…

15 CFR 700.55 - Assistance programs with Canada and other nations.

Code of Federal Regulations, 2010 CFR

2010-01-01

... the United Kingdom in support of approved programs. (b) Canada. (1) The joint U.S.-Canadian military arrangements for the defense of North America and the integrated nature of their defense industries as set... Assistance programs with Canada and other nations. (a) To promote military assistance to foreign nations...

15 CFR 700.55 - Assistance programs with Canada and other nations.

Code of Federal Regulations, 2013 CFR

2013-01-01

... the United Kingdom in support of approved programs. (b) Canada. (1) The joint U.S.-Canadian military arrangements for the defense of North America and the integrated nature of their defense industries as set... Assistance programs with Canada and other nations. (a) To promote military assistance to foreign nations...

15 CFR 700.55 - Assistance programs with Canada and other nations.

Code of Federal Regulations, 2012 CFR

2012-01-01

... the United Kingdom in support of approved programs. (b) Canada. (1) The joint U.S.-Canadian military arrangements for the defense of North America and the integrated nature of their defense industries as set... Assistance programs with Canada and other nations. (a) To promote military assistance to foreign nations...

15 CFR 700.55 - Assistance programs with Canada and other nations.

Code of Federal Regulations, 2011 CFR

2011-01-01

... the United Kingdom in support of approved programs. (b) Canada. (1) The joint U.S.-Canadian military arrangements for the defense of North America and the integrated nature of their defense industries as set... Assistance programs with Canada and other nations. (a) To promote military assistance to foreign nations...

15 CFR 700.55 - Assistance programs with Canada and other nations.

Code of Federal Regulations, 2014 CFR

2014-01-01

... the United Kingdom in support of approved programs. (b) Canada. (1) The joint U.S.-Canadian military arrangements for the defense of North America and the integrated nature of their defense industries as set... Assistance programs with Canada and other nations. (a) To promote military assistance to foreign nations...

76 FR 23914 - National Organic Program; Periodic Residue Testing

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-29

... Service 7 CFR Part 205 [Document Number AMS-NOP-10-0102; NOP-10-10] RIN 0581-AD10 National Organic Program... proposed rule would clarify a provision of the Organic Foods Production Act of 1990 and the regulations...) National Organic Program (NOP) regulations to make clear that accredited certifying agents must conduct...

National School Lunch Program

ERIC Educational Resources Information Center

US Department of Agriculture, 2009

2009-01-01

The National School Lunch Program is a federally assisted meal program operating in over 101,000 public and non-profit private schools and residential child care institutions. It provides nutritionally balanced, low-cost or free lunches to more than 30.5 million children each school day in 2008. In 1998, Congress expanded the National School Lunch…

75 FR 10507 - Information Security Oversight Office; National Industrial Security Program Policy Advisory...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-08

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office; National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: National Archives and Records... individuals planning to attend must be submitted to the Information Security Oversight Office (ISOO) no later...

78 FR 64024 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2013-10-25

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office [NARA-2014-001] National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: National Archives and... submitted to the Information Security Oversight Office (ISOO) no later than Friday, November 8, 2013. ISOO...

78 FR 4421 - National Institute on Drug Abuse; Notice of Closed Meetings

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-22

...: National Institutes of Health, Neuroscience Center, 6001 Executive Boulevard, Rockville, MD 20852... contract proposals. Place: National Institutes of Health, Neuroscience Center, 6001 Executive Boulevard... Federal Domestic Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs, National...

Bibliography of Regional Aquifer-System Analysis Program of the US Geological Survey, 1978-96

USGS Publications Warehouse

Sun, Ren Jen; Weeks, John B.; Grubb, Hayes F.

1997-01-01

The Regional Aquifer-System Analysis (RASA) Program of the U.S. Geological Survey was initiated in 1978 and was completed in 1995. The purpose of this program was to define the regional geohydrology and establish a framework of background information on geology, hydrology, and geochemistry of the Nation's important aquifer systems. This information is critically needed to develop an understanding of the Nation's major ground-water flow systems and to support better management of ground-water resources. Twenty-five of the Nation's major aquifer systems were studied under this program. Starting in 1988, the program devoted part of its resources to compilation of a National Ground Water Atlas that presets a comprehensive summary of the Nation's major ground-water resources. The atlas, which is designed in a graphical format supported by descriptive text, serves as a basic reference for the location, geography, geology, and hydrologic characteristics of the major aquifers in the Nation. This bibliography lists 1,105 reports that result from various studies of the program. The list of reports for each study follows a brief description of that study.

Laboratory Directed Research and Development Program FY 2006

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hansen

2007-03-08

The Ernest Orlando Lawrence Berkeley National Laboratory (Berkeley Lab or LBNL) is a multi-program national research facility operated by the University of California for the Department of Energy (DOE). As an integral element of DOE's National Laboratory System, Berkeley Lab supports DOE's missions in fundamental science, energy resources, and environmental quality. Berkeley Lab programs advance four distinct goals for DOE and the nation: (1) To perform leading multidisciplinary research in the computing sciences, physical sciences, energy sciences, biosciences, and general sciences in a manner that ensures employee and public safety and protection of the environment. (2) To develop and operatemore » unique national experimental facilities for qualified investigators. (3) To educate and train future generations of scientists and engineers to promote national science and education goals. (4) To transfer knowledge and technological innovations and to foster productive relationships among Berkeley Lab's research programs, universities, and industry in order to promote national economic competitiveness.« less

7 CFR 3406.4 - Purpose of the program.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Purpose of the program. 3406.4 Section 3406.4... Program Description § 3406.4 Purpose of the program. (a) The Department of Agriculture and the Nation depend upon sound programs in the food and agricultural sciences at the Nation's colleges and...

76 FR 29747 - State Program Requirements; Proposal To Approve Maine's Base National Pollutant Discharge...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-23

...'s Base National Pollutant Discharge Elimination System (NPDES) Permitting Program AGENCY... of Maine's Base NPDES Permitting Program in these territories as part of the administrative record to... Maine's base program as EPA approved it in 2001. Thus, the state's program would not include regulation...

Controllable Fabrication of GeSi Nanowires in Diameter of About 10 nm Using the Top-Down Approach

NASA Astrophysics Data System (ADS)

Zeng, Cheng; Li, Yi; Xia, Jin-Song

2017-11-01

Not Available Supported by the State Key Program of the National Natural Science Foundation of China under Grant No 61335002, the National High Technology Research and Development Program of China under Grant No 2015AA016904, the National Natural Science Foundation of China under Grant No 11574102, and the National Basic Research Program of China under Grant Nos 2013CB933303 and 2013CB632104.

NATIONAL ENVIRONMENTAL LABORATORY ACCREDITATION PROGRAM (NELAP) SUPPORT

EPA Science Inventory

The nation has long suffered from the inefficiencies and inconsistencies of the current multiple environmental laboratory accreditation programs. In the 1970's, EPA set minimum standards for a drinking water certification program. The drinking water program was adopted by the s...

National Water-Quality Assessment Program - Red River of the North

USGS Publications Warehouse

Stoner, J.D.

1991-01-01

In 1991, the U.S. Geological Survey (USGS) began to implement a full-scale National Water-Quality Assessment (NAWQA) program. The long-term goals of the NAWQA program are to describe the status and trends in the quality of a large, representative part of the Nation's surface- and ground-water resources, and to provide a sound scientific understanding of the primary natural and human factors affecting the quality of these resources. The program will produce a wealth of water-quality information that will be useful to policy makers and managers at the national, State, and local levels.

78 FR 38077 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-25

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office [NARA-13-0030] National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: National Archives and... submitted to the Information Security Oversight Office (ISOO) no later than Friday, July 12, 2013. ISOO will...

10 CFR 605.18 - National security.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false National security. 605.18 Section 605.18 Energy DEPARTMENT... PROGRAM § 605.18 National security. Activities under ER's Financial Assistance Program shall not involve classified information (i.e., Restricted Data, formerly Restricted Data, National Security Information...

10 CFR 605.18 - National security.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 4 2014-01-01 2014-01-01 false National security. 605.18 Section 605.18 Energy DEPARTMENT... PROGRAM § 605.18 National security. Activities under ER's Financial Assistance Program shall not involve classified information (i.e., Restricted Data, formerly Restricted Data, National Security Information...

10 CFR 605.18 - National security.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 4 2013-01-01 2013-01-01 false National security. 605.18 Section 605.18 Energy DEPARTMENT... PROGRAM § 605.18 National security. Activities under ER's Financial Assistance Program shall not involve classified information (i.e., Restricted Data, formerly Restricted Data, National Security Information...

76 FR 24893 - National Institute on Drug Abuse; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-03

... applications. Place: National Institutes of Health, Neuroscience Center, 6001 Executive Boulevard, Conference... developments in the drug abuse field. Place: National Institutes of Health, Neuroscience Center, 6001 Executive... Federal Domestic Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs, National...

76 FR 17367 - National Voluntary Laboratory Accreditation Program; Operating Procedures

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-29

... DEPARTMENT OF COMMERCE National Institute of Standards and Technology 15 CFR Part 285 [Docket No: 110125063-1062-02] RIN 0693-AB61 National Voluntary Laboratory Accreditation Program; Operating Procedures AGENCY: National Institute of Standards and Technology (NIST), Commerce. ACTION: Notice of proposed...

THE ENVIRONMENTAL MONITORING AND ASSESSMENT PROGRAM: NATIONAL COASTAL ASSESSMENT - LESSONS LEARNED

EPA Science Inventory

The purpose of the Environmental Monitoring and Assessment Program's National Coastal Assessment is to estimate the current status, extent, changes, and trends in ecological indicators of the condition of the nation's coastal resources on a state, regional and national basis. Bas...

40 CFR 35.9070 - National program assistance agreements.

Code of Federal Regulations, 2013 CFR

2013-07-01

... FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Financial Assistance for the National Estuary Program § 35... award of NEP funds for work that has broad applicability to estuaries of national significance. These...

40 CFR 35.9070 - National program assistance agreements.

Code of Federal Regulations, 2014 CFR

2014-07-01

... FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Financial Assistance for the National Estuary Program § 35... award of NEP funds for work that has broad applicability to estuaries of national significance. These...

40 CFR 35.9070 - National program assistance agreements.

Code of Federal Regulations, 2010 CFR

2010-07-01

... FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Financial Assistance for the National Estuary Program § 35... award of NEP funds for work that has broad applicability to estuaries of national significance. These...

40 CFR 35.9070 - National program assistance agreements.

Code of Federal Regulations, 2012 CFR

2012-07-01

... FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Financial Assistance for the National Estuary Program § 35... award of NEP funds for work that has broad applicability to estuaries of national significance. These...

40 CFR 35.9070 - National program assistance agreements.

Code of Federal Regulations, 2011 CFR

2011-07-01

... FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Financial Assistance for the National Estuary Program § 35... award of NEP funds for work that has broad applicability to estuaries of national significance. These...

Truth in Reporting: How Data Capture Methods Obfuscate Actual Surgical Site Infection Rates within a Health Care Network System.

PubMed

Bordeianou, Liliana; Cauley, Christy E; Antonelli, Donna; Bird, Sarah; Rattner, David; Hutter, Matthew; Mahmood, Sadiqa; Schnipper, Deborah; Rubin, Marc; Bleday, Ronald; Kenney, Pardon; Berger, David

2017-01-01

Two systems measure surgical site infection rates following colorectal surgeries: the American College of Surgeons National Surgical Quality Improvement Program and the Centers for Disease Control and Prevention National Healthcare Safety Network. The Centers for Medicare & Medicaid Services pay-for-performance initiatives use National Healthcare Safety Network data for hospital comparisons. This study aimed to compare database concordance. This is a multi-institution cohort study of systemwide Colorectal Surgery Collaborative. The National Surgical Quality Improvement Program requires rigorous, standardized data capture techniques; National Healthcare Safety Network allows 5 data capture techniques. Standardized surgical site infection rates were compared between databases. The Cohen κ-coefficient was calculated. This study was conducted at Boston-area hospitals. National Healthcare Safety Network or National Surgical Quality Improvement Program patients undergoing colorectal surgery were included. Standardized surgical site infection rates were the primary outcomes of interest. Thirty-day surgical site infection rates of 3547 (National Surgical Quality Improvement Program) vs 5179 (National Healthcare Safety Network) colorectal procedures (2012-2014). Discrepancies appeared: National Surgical Quality Improvement Program database of hospital 1 (N = 1480 patients) routinely found surgical site infection rates of approximately 10%, routinely deemed rate "exemplary" or "as expected" (100%). National Healthcare Safety Network data from the same hospital and time period (N = 1881) revealed a similar overall surgical site infection rate (10%), but standardized rates were deemed "worse than national average" 80% of the time. Overall, hospitals using less rigorous capture methods had improved surgical site infection rates for National Healthcare Safety Network compared with standardized National Surgical Quality Improvement Program reports. The correlation coefficient between standardized infection rates was 0.03 (p = 0.88). During 25 site-time period observations, National Surgical Quality Improvement Program and National Healthcare Safety Network data matched for 52% of observations (13/25). κ = 0.10 (95% CI, -0.1366 to 0.3402; p = 0.403), indicating poor agreement. This study investigated hospitals located in the Northeastern United States only. Variation in Centers for Medicare & Medicaid Services-mandated National Healthcare Safety Network infection surveillance methodology leads to unreliable results, which is apparent when these results are compared with standardized data. High-quality data would improve care quality and compare outcomes among institutions.

Vision for the Future of the US National Strong-Motion Program

USGS Publications Warehouse

,

1997-01-01

This document provides the requested vision for the future of the National Strong-Motion Program operated by the US Geological Survey. Options for operation of the program are presented in a companion document. Each of the three major charges of the EHRP, program council pertaining to the vision document is addressed here. The 'Vision Summary' through a series of answers to specific questions is intended to provide a complete synopsis of the committees response to program council charges. The Vision for the Future of the NSMP is presented as section III of the Summary. Analysis and detailed discussion supporting the answers in the summary are presented as sections organized according to the charges of the program council. The mission for the program is adopted from that developed at the national workshop entitled 'Research Needs for Strong Motion Data to Support Earthquake Engineering' sponsored by the National Science Foundation.

75 FR 77521 - National Organic Program; Amendments to the National List of Allowed and Prohibited Substances...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-13

...-08-06FR] RIN 0581-AC91 National Organic Program; Amendments to the National List of Allowed and... (Secretary) by the National Organic Standards Board (NOSB) from November 30, 2007, and May 22, 2008. This... restrictive annotations, for use in organic crop production, and adds gellan gum, fortified cooking wine...

Area-specific recreation use estimation using the national visitor use monitoring program data.

Treesearch

Eric M. White; Stanley J. Zarnoch; Donald B.K. English

2007-01-01

Estimates of national forest recreation use are available at the national, regional, and forest levels via the USDA Forest Service National Visitor Use Monitoring (NVUM) program. In some resource planning and management applications, analysts desire recreation use estimates for subforest areas within an individual national forest or for subforest areas that combine...

75 FR 1555 - National Organic Program; Proposed Amendments to the National List of Allowed and Prohibited...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-12

... use in organic crops soil amendment purposes due to the quick degradation of sulfurous acid, provided...-09-0081; TM-09-04] RIN 0581-AC93 National Organic Program; Proposed Amendments to the National List... the Secretary of Agriculture (Secretary) by the National Organic Standards Board (NOSB) on November 19...

IARC - Illinois Accelerator Research Center | Pilot Program

Science.gov Websites

Toggle navigation Pilot Program Agenda Directions Registration Illinois Accelerator Research Center National Laboratory present Accelerator Stewardship Test Facility Pilot Program Use accelerator technology , energy and environment. With this pilot program, the DOE Office of Science National Laboratories are

Program History

Cancer.gov

Learn how the National Cancer Institute transitioned the former Cooperative Groups Program to the National Clinical Trials Network (NCTN) program. The NCTN gives funds and other support to cancer research organizations to conduct cancer clinical trials.

Compensating Victims of Violent Crime: Potential Costs and Coverage of a National Program.

ERIC Educational Resources Information Center

Garofalo, James; Sutton, L. Paul

Data generated from an ongoing national crime victimization survey and details about the circumstances and consequences of personal crimes form the basis for estimating the cost of a national program to compensate victims of violent crime. Victim compensation programs represent an attempt to rectify the neglect of the victim. Uncertainty about the…

Exploring the Real Thing: A Guide to Educational Programs at National Park Sites in Massachusetts.

ERIC Educational Resources Information Center

Emerson, Rae; Hoermann, Elizabeth; Stearns, Liza

As the steward of the nation's premier historic, natural, and recreational resources, the National Park Service manages 15 unique areas within the Commonwealth of Massachusetts. Each of these sites offers hands-on programs specifically geared to meet the needs of teachers and students. The programs support the Massachusetts Curriculum Frameworks…

National Home Start Evaluation. Interim Report V: Case Studies.

ERIC Educational Resources Information Center

Jerome, Chris H.; And Others

One of a series of documents on the evaluation of the National Home Start (NHS) program this third year interim report of case studies describes program efforts and successes with 16 Home Start families throughout the nation. A federally funded demonstration program, NHS is aimed at providing home-based services (such as health, education,…

The Power to Grow: Success Stories from the National Library Power Program.

ERIC Educational Resources Information Center

Sadowski, Michael

1994-01-01

Describes the National Library Program supported by the DeWitt Wallace-Reader's Digest Fund. The program's national goals and guidelines and results of eight projects are presented. Brief descriptions of five new projects and nine planning sites are given. Continuation plans and the possibility of funding beyond the three-year project period are…

Strategies toward the Inclusion of Environmental Education in Educator Preparation Programs: Results from a National Survey

ERIC Educational Resources Information Center

Crim, Courtney; Moseley, Christine; Desjean-Perrotta, Blanche

2017-01-01

A national study was conducted to investigate the inclusion of environmental education (EE) into educator preparation programs across the United States. Responses from teacher educators in institutions of higher education indicated that the infusion of EE into educator preparation programs is limited and varies greatly across the nation. Findings…

24 CFR 570.901 - Review for compliance with the primary and national objectives and other program requirements.

Code of Federal Regulations, 2010 CFR

2010-04-01

... primary and national objectives and other program requirements. 570.901 Section 570.901 Housing and Urban... primary and national objectives and other program requirements. HUD will review each entitlement, Insular...)(3) that, consistent with the primary objective of the Act, not less than 70 percent of the aggregate...

The evolution of optics education at the U.S. National Optical Astronomy Observatory

NASA Astrophysics Data System (ADS)

Pompea, Stephen M.; Walker, Constance E.; Sparks, Robert T.

2014-07-01

The last decade of optics education at the U.S. National Optical Astronomy Observatory will be described in terms of program planning, assessment of community needs, identification of networks and strategic partners, the establishment of specific program goals and objectives, and program metrics and evaluation. A number of NOAO's optics education programs for formal and informal audiences will be described, including our Hands-On Optics program, illumination engineering/dark skies energy education programs, afterschool programs, adaptive optics education program, student outreach, and Galileoscope program. Particular emphasis will be placed on techniques for funding and sustaining high-quality programs. The use of educational gap analysis to identify the key needs of the formal and informal educational systems will be emphasized as a technique that has helped us to maximize our educational program effectiveness locally, regionally, nationally, and in Chile.

32 CFR 148.2 - Classified programs.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 32 National Defense 1 2011-07-01 2011-07-01 false Classified programs. 148.2 Section 148.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN NATIONAL POLICY AND IMPLEMENTATION OF RECIPROCITY OF FACILITIES National Policy on Reciprocity of Use and...

32 CFR 148.2 - Classified programs.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 1 2010-07-01 2010-07-01 false Classified programs. 148.2 Section 148.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN NATIONAL POLICY AND IMPLEMENTATION OF RECIPROCITY OF FACILITIES National Policy on Reciprocity of Use and...

32 CFR 148.2 - Classified programs.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 32 National Defense 1 2014-07-01 2014-07-01 false Classified programs. 148.2 Section 148.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN NATIONAL POLICY AND IMPLEMENTATION OF RECIPROCITY OF FACILITIES National Policy on Reciprocity of Use and...

32 CFR 148.2 - Classified programs.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 32 National Defense 1 2013-07-01 2013-07-01 false Classified programs. 148.2 Section 148.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN NATIONAL POLICY AND IMPLEMENTATION OF RECIPROCITY OF FACILITIES National Policy on Reciprocity of Use and...

32 CFR 148.2 - Classified programs.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 32 National Defense 1 2012-07-01 2012-07-01 false Classified programs. 148.2 Section 148.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN NATIONAL POLICY AND IMPLEMENTATION OF RECIPROCITY OF FACILITIES National Policy on Reciprocity of Use and...

32 CFR 322.3 - Policy.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 32 National Defense 2 2012-07-01 2012-07-01 false Policy. 322.3 Section 322.3 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.3 Policy. (a) The National Security...

32 CFR 322.3 - Policy.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 32 National Defense 2 2011-07-01 2011-07-01 false Policy. 322.3 Section 322.3 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.3 Policy. (a) The National Security...

32 CFR 322.3 - Policy.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 32 National Defense 2 2014-07-01 2014-07-01 false Policy. 322.3 Section 322.3 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.3 Policy. (a) The National Security...

32 CFR 322.3 - Policy.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 2 2010-07-01 2010-07-01 false Policy. 322.3 Section 322.3 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.3 Policy. (a) The National Security...

32 CFR 322.3 - Policy.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 32 National Defense 2 2013-07-01 2013-07-01 false Policy. 322.3 Section 322.3 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL SECURITY AGENCY/CENTRAL SECURITY SERVICES PRIVACY ACT PROGRAM § 322.3 Policy. (a) The National Security...

75 FR 81284 - National Protection and Programs Directorate; National Infrastructure Advisory Council Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-27

... Homeland Security with advice on the security of the critical infrastructure sectors and their information systems. The NIAC will meet to address issues relevant to the protection of critical infrastructure as... Directorate; National Infrastructure Advisory Council Meeting AGENCY: National Protection and Programs...

Toward a National Job Training Program.

ERIC Educational Resources Information Center

Grede, John F.

Contending that the nation's community colleges should improve the training of future workers by building a national job training program based on successful components already in existence, this paper reviews seven monographs published by the National Council for Occupational Education (NCOE) since 1985 which identify, highlight, or address…

76 FR 6136 - Solicitation for Nominations for the National Vaccine Advisory Committee

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-03

... DEPARTMENT OF HEALTH AND HUMAN SERVICES Solicitation for Nominations for the National Vaccine... of advisory committees. SUMMARY: The National Vaccine Program Office (NVPO), a program office within... candidates to be considered for appointment as public members to the National Vaccine Advisory Committee...

76 FR 2700 - National Protection and Programs Directorate; National Emergency Communications Plan (NECP) Goal...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-14

... Programs Directorate (NPPD)/Office of Cybersecurity and Communications (CS&C)/Office of Emergency Communications (OEC) will submit the following Information Collection Request to the Office of Management and... Directorate; National Emergency Communications Plan (NECP) Goal 2 Performance Report AGENCY: National...

Coyote Community College Case Study.

ERIC Educational Resources Information Center

National Inst. of Standards and Technology, Gaithersburg, MD.

The Malcolm Baldrige National Quality Award (MBNQA) was created in 1987 to foster the success of the Baldrige National Quality Program. The award program, sponsored by the United States Department of Education, is a public-private partnership dedicated to improving national competitiveness. The National Institute of Standards and Technology…

Factor Analysis of the HEW National Strategy for Youth Development Model's Community Program Impact Scales.

ERIC Educational Resources Information Center

Truckenmiller, James L.

The former HEW (Health, Education, and Welfare) National Strategy for Youth Development Model proposed a community-based program to promote positive youth development and to prevent delinquency through a sequence of youth needs assessments, needs-targeted programs, and program impact evaluation. HEW Community Program Impact Scales data obtained…

42 CFR 62.5 - How is application made for a scholarship program award?

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false How is application made for a scholarship program... FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.5 How is application made for a scholarship program...

42 CFR 62.5 - How is application made for a scholarship program award?

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 1 2012-10-01 2012-10-01 false How is application made for a scholarship program... FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.5 How is application made for a scholarship program...

42 CFR 62.5 - How is application made for a scholarship program award?

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 1 2011-10-01 2011-10-01 false How is application made for a scholarship program... FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.5 How is application made for a scholarship program...

42 CFR 62.5 - How is application made for a scholarship program award?

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 1 2014-10-01 2014-10-01 false How is application made for a scholarship program... FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.5 How is application made for a scholarship program...

42 CFR 62.5 - How is application made for a scholarship program award?

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 1 2013-10-01 2013-10-01 false How is application made for a scholarship program... FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.5 How is application made for a scholarship program...

32 CFR 34.14 - Program income.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 1 2010-07-01 2010-07-01 false Program income. 34.14 Section 34.14 National... Financial and Program Management § 34.14 Program income. (a) DoD Components shall apply the standards in this section to the disposition of program income from projects financed in whole or in part with...

Modeling Student Participation in School Nutrition Programs.

ERIC Educational Resources Information Center

Barnes, Roberta Ott

This report describes the analyses of student participation in two school nutrition programs, the School Breakfast Program (SBP) and the National School Lunch Program (NSLP). Data were collected from students and their families during the 1983-84 school year as part of the National Evaluation of the School Nutrition Programs (NESNP). Each program…

Academic Competitiveness and SMART Grant Programs: First-Year Lessons Learned

ERIC Educational Resources Information Center

Choy, Susan P.; Berkner, Lutz; Lee, John; Topper, Amelia

2009-01-01

The "Higher Education Reconciliation Act of 2005" created two new grant programs for undergraduates: the Academic Competitiveness Grant (ACG) program and National Science and Mathematics Access to Retain Talent (National SMART) Grant program. The ACG program is intended to encourage students to take challenging courses in high school and thus…

Programs for the Deaf-Blind.

ERIC Educational Resources Information Center

American Annals of the Deaf, 1991

1991-01-01

This directory lists contact information for programs for the deaf-blind in the United States in 3 categories: (1) programs for deaf-blind children and youth (29 programs listed); (2) Helen Keller National Center for Deaf-Blind Youth and Adults (1 national and 10 regional offices); and (3) programs for training teachers of the deaf-blind (4…

U.S. Solar-Terrestrial Research Program

NASA Astrophysics Data System (ADS)

Intriligator, Devrie S.

The Committee on Solar-Terrestrial Research (CSTR) of the National Research Council of the National Academy of Sciences is charged with looking after the health of solar-terrestrial research in the United States. In 1984 the National Academy Press published the CSTR report “National Solar-Terrestrial Research Program.” This program implements the recommendations of the earlier National Research Council study “Solar-Terrestrial Research for the 1980's” (1981). The earlier study, which took over 18 months to complete and involved the participation of more than 150 scientists, specifically identified the principal scientific and management recommendations required for a balanced solar-terrestrial program. The present study was undertaken by CSTR in the fall of 1983 in response to a request from several concerned federal agencies and the Board on Atmospheric Sciences and Climate. Together, the two studies constitute a set that prescribes a broad-gaged solar-terrestrial program.

Effects of NIGMS Training Programs on Graduate Education in the Biomedical Sciences. An Evaluative Study of the Training Programs of the National Institute of General Medical Sciences 1958-1967.

ERIC Educational Resources Information Center

National Inst. of General Medical Sciences (NIH), Bethesda, MD.

This report was prepared by the National Research Council, at the request of the National Institutes of Health, in an attempt to evaluate the Graduate Research Training Grant Program and Fellowship Program in bioscience. One of the purposes of the study was to collect objective data that would provide answers to such questions as: What have been…

75 FR 29366 - ``Homeless Veterans' Reintegration Program (HVRP) National Technical Assistance Center...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-25

... ``Homeless Veterans' Reintegration Program (HVRP) National Technical Assistance Center Cooperative Agreement...). Section 2021 authorizes programs to expedite the reintegration of homeless Veterans into the labor force... Technical Assistance Center (NTAC) for the Homeless Veterans' Reintegration Program (HVRP) to include the...

42 CFR 68.10 - What loans are ineligible for repayment?

Code of Federal Regulations, 2013 CFR

2013-10-01

..., INTERNSHIPS, TRAINING NATIONAL INSTITUTES OF HEALTH (NIH) LOAN REPAYMENT PROGRAMS (LRPs) § 68.10 What loans... Health Service Corps Scholarship Program, (6) National Institutes of Health Undergraduate Scholarship... following programs, or similar programs, which provide loans, scholarships, loan repayments, or other awards...

42 CFR 68.10 - What loans are ineligible for repayment?

Code of Federal Regulations, 2014 CFR

2014-10-01

..., INTERNSHIPS, TRAINING NATIONAL INSTITUTES OF HEALTH (NIH) LOAN REPAYMENT PROGRAMS (LRPs) § 68.10 What loans... Health Service Corps Scholarship Program, (6) National Institutes of Health Undergraduate Scholarship... following programs, or similar programs, which provide loans, scholarships, loan repayments, or other awards...

34 CFR 1200.149 - Program accessibility: Discrimination prohibited.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 34 Education 4 2011-07-01 2011-07-01 false Program accessibility: Discrimination prohibited. 1200...) NATIONAL COUNCIL ON DISABILITY ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE NATIONAL COUNCIL ON DISABILITY § 1200.149 Program accessibility: Discrimination...

75 FR 40848 - Agency Information Collection Activities: Submission for OMB Review; Comment Request, OMB No...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-14

...; National Flood Insurance Program--Mortgage Portfolio Protection Program (MPPP) AGENCY: Federal Emergency... . SUPPLEMENTARY INFORMATION: Collection of Information Title: National Flood Insurance Program--Mortgage Portfolio... Portfolio Protection Program Agreement and complete the acknowledgement either agreeing to participate in...

National Water-Quality Assessment program: The Trinity River Basin

USGS Publications Warehouse

Land, Larry F.

1991-01-01

In 1991, the U.S. Geological Survey (USGS) began to implement a full-scale National Water-Quality Assessment (NAWQA) program. The long-term goals of the NAWQA program are to describe the status and trends in the quality of a large, representative part of the Nation's surface- and ground-water resources and to provide a sound, scientific understanding of the primary natural and human factors affecting the quality of these resources. In meeting these goals, the program will produce a wealth of water-quality information that will be useful to policy makers and managers at the national, State, and local levels. A major design feature of the NAWQA program will enable water-quality information at different areal scales to be integrated. A major component of the program is study-unit investigations, which comprise the principal building blocks of the program on which national-level assessment activities will be based. The 60 study-unit investigations that make up the program are hydrologic systems that include parts of most major river basins and aquifer systems. These study units cover areas of 1,200 to more than 65,000 square miles and incorporate about 60 to 70 percent of the Nation's water use and population served by public water supply. In 1991, the Trinity River basin study was among the first 20 NAWQA study units selected for study under the full-scale implementation plan.

75 FR 25844 - Federal Advisory Committee; National Security Education Board Members Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-10

... Education Program; 1101 Wilson Blvd., Suite 1210; Rosslyn, VA 22219. FOR FURTHER INFORMATION CONTACT: Dr. Kevin Gormley, Program Officer, National Security Education Program, 1101 Wilson Boulevard, Suite 1210...

Evaluation of 6 remote First Nations community-based buprenorphine programs in northwestern Ontario

PubMed Central

Mamakwa, Solomon; Kahan, Meldon; Kanate, Dinah; Kirlew, Mike; Folk, David; Cirone, Sharon; Rea, Sara; Parsons, Pierre; Edwards, Craig; Gordon, Janet; Main, Fiona; Kelly, Len

2017-01-01

Abstract Objective To evaluate established opioid addiction treatment programs that use traditional healing in combination with buprenorphine-naloxone maintenance treatment in 6 First Nations communities in the Sioux Lookout region of northwestern Ontario. Design Retrospective cohort study. Setting Six First Nations communities in northwestern Ontario. Participants A total of 526 First Nations participants in opioid-dependence treatment programs. Intervention Buprenorphine-naloxone substitution therapy and First Nations healing programming. Main outcome measures Retention rates and urine drug screening (UDS) results. Results Treatment retention rates at 6, 12, and 18 months were 84%, 78%, and 72%, respectively. We estimate that the rate at 24 months will also be more than 70%. The UDS programming varied and was implemented in only 1 community. Initially urine testing was voluntary and it then became mandatory. Screening with either method found the proportion of urine samples with negative results for illicit opioids ranged between 84% and 95%. Conclusion The program’s treatment retention rates and negative UDS results were higher than those reported for most methadone and buprenorphine-naloxone programs, despite a patient population where severe posttraumatic stress disorder is endemic, and despite the programs’ lack of resources and addiction expertise. Community-based programs like these overcome the initial challenge of cultural competence. First Nations communities in other provinces should establish their own buprenorphinenaloxone programs, using local primary care physicians as prescribers. Sustainable core funding is needed for programming, long-term aftercare, and trauma recovery for such initiatives. PMID:28209683

Mutagenic cost of ribonucleotides in bacterial DNA

PubMed Central

Schroeder, Jeremy W.; Randall, Justin R.; Hirst, William G.; O’Donnell, Michael E.; Simmons, Lyle A.

2017-01-01

Replicative DNA polymerases misincorporate ribonucleoside triphosphates (rNTPs) into DNA approximately once every 2,000 base pairs synthesized. Ribonucleotide excision repair (RER) removes ribonucleoside monophosphates (rNMPs) from genomic DNA, replacing the error with the appropriate deoxyribonucleoside triphosphate (dNTP). Ribonucleotides represent a major threat to genome integrity with the potential to cause strand breaks. Furthermore, it has been shown in the bacterium Bacillus subtilis that loss of RER increases spontaneous mutagenesis. Despite the high rNTP error rate and the effect on genome integrity, the mechanism underlying mutagenesis in RER-deficient bacterial cells remains unknown. We performed mutation accumulation lines and genome-wide mutational profiling of B. subtilis lacking RNase HII, the enzyme that incises at single rNMP residues initiating RER. We show that loss of RER in B. subtilis causes strand- and sequence-context–dependent GC → AT transitions. Using purified proteins, we show that the replicative polymerase DnaE is mutagenic within the sequence context identified in RER-deficient cells. We also found that DnaE does not perform strand displacement synthesis. Given the use of nucleotide excision repair (NER) as a backup pathway for RER in RNase HII-deficient cells and the known mutagenic profile of DnaE, we propose that misincorporated ribonucleotides are removed by NER followed by error-prone resynthesis with DnaE. PMID:29078353

Detection of cystic fibrosis mutations in a GeneChip{trademark} assay format

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyada, C.G.; Cronin, M.T.; Kim, S.M.

1994-09-01

We are developing assays for the detection of cystic fibrosis mutations based on DNA hybridization. A DNA sample is amplified by PCR, labeled by incorporating a fluorescein-tagged dNTP, enzymatically treated to produce smaller fragments and hybridized to a series of short (13-16 bases) oligonucleotides synthesized on a glass surface via photolithography. The hybrids are detected by eqifluorescence and mutations are identified by the specific pattern of hybridization. In a GeneChip assay, the chip surface is composed of a series of subarrays, each being specific for a particular mutation. Each subarray is further subdivided into a series of probes (40 total),more » half based on the mutant sequence and the remainder based on the wild-type sequence. For each of the subarrays, there is a redundancy in the number of probes that should hybridize to either a wild-type or a mutant target. The multiple probe strategy provides sequence information for a short five base region overlapping the mutation site. In addition, homozygous wild-type and mutant as well as heterozygous samples are each identified by a specific pattern of hybridization. The small size of each probe feature (250 x 250 {mu}m{sup 2}) permits the inclusion of additional probes required to generate sequence information by hybridization.« less

An Analysis of Enzyme Kinetics Data for Mitochondrial DNA Strand Termination by Nucleoside Reverse Transcription Inhibitors

PubMed Central

Wendelsdorf, Katherine V.; Song, Zhuo; Cao, Yang; Samuels, David C.

2009-01-01

Nucleoside analogs used in antiretroviral treatment have been associated with mitochondrial toxicity. The polymerase-γ hypothesis states that this toxicity stems from the analogs' inhibition of the mitochondrial DNA polymerase (polymerase-γ) leading to mitochondrial DNA (mtDNA) depletion. We have constructed a computational model of the interaction of polymerase-γ with activated nucleoside and nucleotide analog drugs, based on experimentally measured reaction rates and base excision rates, together with the mtDNA genome size, the human mtDNA sequence, and mitochondrial dNTP concentrations. The model predicts an approximately 1000-fold difference in the activated drug concentration required for a 50% probability of mtDNA strand termination between the activated di-deoxy analogs d4T, ddC, and ddI (activated to ddA) and the activated forms of the analogs 3TC, TDF, AZT, FTC, and ABC. These predictions are supported by experimental and clinical data showing significantly greater mtDNA depletion in cell culture and patient samples caused by the di-deoxy analog drugs. For zidovudine (AZT) we calculated a very low mtDNA replication termination probability, in contrast to its reported mitochondrial toxicity in vitro and clinically. Therefore AZT mitochondrial toxicity is likely due to a mechanism that does not involve strand termination of mtDNA replication. PMID:19132079

Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

DOE PAGES

Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; ...

2015-03-31

One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5'-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5'-triphosphate (dATP). Here in this article, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg 2+ appeared during the process of phosphodiester bond formation and was located between the reactingmore » α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3'-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion.« less

Ribonucleotide reductase activity is regulated by proliferating cell nuclear antigen (PCNA)

PubMed Central

Salguero, Israel; Guarino, Estrella; Shepherd, Marianne; Deegan, Tom; Havens, Courtney G.; MacNeill, Stuart A.; Walter, Johannes C.; Kearsey, Stephen E.

2014-01-01

Summary Synthesis of dNTPs is required for both DNA replication and DNA repair and is catalyzed by ribonucleotide reductases (RNR), which convert ribonucleotides to their deoxy forms [1, 2]. Maintaining the correct levels of dNTPs for DNA synthesis is important for minimising the mutation rate [3-7], and this is achieved by tight regulation of ribonucleotide reductase [2, 8, 9]. In fission yeast, ribonucleotide reductase is regulated in part by a small protein inhibitor, Spd1, which is degraded in S phase and after DNA damage to allow up-regulation of dNTP supply [10-12]. Spd1 degradation is mediated by the activity of the CRL4Cdt2 ubiquitin ligase complex [5, 13, 14]. This has been reported to be dependent on modulation of Cdt2 levels which are cell cycle regulated, peaking in S phase, and which also increase after DNA damage in a checkpoint-dependent manner [7, 13]. We show here that Cdt2 levels fluctuations are not sufficient to regulate Spd1 proteolysis and that the key step in this event is the interaction of Spd1 with the polymerase processivity factor PCNA, complexed onto DNA. This mechanism thus provides a direct link between DNA synthesis and ribonucleotide reductase regulation. PMID:22464192

Viewing Human DNA Polymerase β Faithfully and Unfaithfully Bypass an Oxidative Lesion by Time-Dependent Crystallography

PubMed Central

Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; Suo, Zucai

2015-01-01

One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5′-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5′-triphosphate (dATP). Here, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg2+ appeared during the process of phosphodiester bond formation and was located between the reacting α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3′-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion. PMID:25825995

Characterization of a cultured human T-cell line with genetically altered ribonucleotide reductase activity. Model for immunodeficiency.

PubMed

Waddell, D; Ullman, B

1983-04-10

From human CCRF-CEM T-cells growing in continuous culture, we have selected, isolated, and characterized a clonal cell line, APHID-D2, with altered ribonucleotide reductase activity. In comparative growth rate experiments, the APHID-D2 cell line is less sensitive than the parental cell line to growth inhibition by deoxyadenosine in the presence of 10 microM erythro-9-(2-hydroxy-3-nonyl)adenine, an inhibitor of adenosine deaminase. The APHID-D2 cell line has elevated levels of all four dNTPs. The resistance of the APHID-D2 cell line to growth inhibition by deoxyadenosine and the abnormal dNTP levels can be explained by the fact that the APHID-D2 ribonucleotide reductase, unlike the parental ribonucleotide reductase, is not normally sensitive to inhibition by dATP. These results suggest that the allosteric site of ribonucleotide reductase which binds both dATP and ATP is altered in the APHID-D2 line. The isolation of a mutant clone of human T-cells which contains a ribonucleotide reductase that has lost its normal sensitivity to dATP and which is resistant to deoxyadenosine-mediated growth inhibition suggests that a primary pathogenic target of accumulated dATP in lymphocytes from patients with adenosine deaminase deficiency may be the cellular ribonucleotide reductase.

Effect of 2',3'-dideoxythymidine-5'-triphosphate on HeLa cell in vitro DNA synthesis: evidence that DNA polymerase alpha is the only polymerase required for cellular DNA replication.

PubMed Central

Waqar, M A; Evans, M J; Huberman, J A

1978-01-01

We have studied the effects of the nucleotide analogue, 2',3'-dideoxythymidine-5'-triphosphate (ddTTP) on replicative DNA synthesis in HeLa cell lysates. As previously demonstrated (1), such lysates carry out extensive DNA synthesis in vitro, at rates and in a fashion similar to in vivo DNA replication. We report here that all aspects of DNA synthesis in such lysates (total dNTP incorporation, elongation of continuous nascent strands, and the initiation, elongation, and joining of Okazaki pieces) are only slightly inhibited by concentrations of ddTTP as high as 100-500 micrometer when the dTTP concentration is maintained at 10 micrometer. This finding is consistent with the report by Edenberg, Anderson, and DePamphilis (2) that all aspects of replicative in vitro simian virus 40 DNA synthesis are also resistant to ddTTP. We also find, in agreement with Edenberg, Anderson, and DePamphilis (2), that DNA synthesis catalyzed by DNA polymerases beta or gamma is easily inhibited by ddTTP, while synthesis catalyzed by DNA polymerase alpha is very resistant. These observations suggest that DNA polymerase alpha may be the only DNA polymerase required for all aspects of cellular DNA synthesis. PMID:673840

Text only version of the National Estuary Program Story Map

EPA Pesticide Factsheets

Since 1987, the EPA National Estuary Program (NEP) has made a unique and lasting contribution to protecting and restoring our nation's estuaries, delivering environmental and public health benefits to the American people.

77 FR 3007 - Notice Pursuant to the National Cooperative Research and Production Act of 1993-National...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-20

... Production Act of 1993--National Shipbuilding Research Program Notice is hereby given that, on December 20....C. 4301 et seq. (``the Act''), National Shipbuilding Research Program (``NSRP'') has filed written..., the following members have changed their names: Northrop Grumman Shipbuilding, Inc.--Gulf Coast...

76 FR 22715 - National Institute on Drug Abuse; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-22

... personal privacy. Name of Committee: National Institute on Drug Abuse Special Emphasis Panel; NIDA Blending..., Training and Special Projects Review Branch, Office of Extramural Affairs, National Institute on Drug Abuse... Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs, National Institutes of Health...

77 FR 27075 - National Institute on Drug Abuse Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-08

... personal privacy. Name of Committee: National Institute on Drug Abuse Special Emphasis Panel; Regulatory..., Office of Extramural Affairs, National Institute on Drug Abuse, NIH, DHHS, Room 4227, MSC 9550, 6001... Domestic Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs, National Institutes...

78 FR 73866 - National Institute on Drug Abuse; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-09

... personal privacy. Name of Committee: National Institute on Drug Abuse Special Emphasis Panel; NIDA Center... Review Officer, Office of Extramural Affairs, National Institute on Drug Abuse, NIH, DHHS, Room 4227, MSC... Federal Domestic Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs, National...

75 FR 14175 - National Institute on Drug Abuse; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-24

... unwarranted invasion of personal privacy. Name of Committee: National Institute on Drug Abuse Special Emphasis... Specialist, Office of Extramural Affairs, National Institute on Drug Abuse, NIH, DHHS, Room 220, MSC 8401... Federal Domestic Assistance Program Nos. 93.279, Drug Abuse and Addiction Research Programs, National...

76 FR 31968 - National Institute on Drug Abuse; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-02

... personal privacy. Name of Committee: National Institute on Drug Abuse Special Emphasis Panel; Technical... Specialist, Office of Extramural Affairs, National Institute on Drug Abuse, NIH, DHHS, Room 4227, MSC 9550... Federal Domestic Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs, National...

77 FR 22581 - National Institute on Drug Abuse; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-16

... personal privacy. Name of Committee: National Institute on Drug Abuse Special Emphasis Panel Multi-site... Branch, Office of Extramural Affairs, National Institute on Drug Abuse, NIH, DHHS, 6001 Executive Blvd... Domestic Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs, National Institutes...

78 FR 63994 - National Institute on Drug Abuse; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-10-25

... personal privacy. Name of Committee: National Institute on Drug Abuse Special Emphasis Panel; Substance Use...., Scientific Review Officer, Office of Extramural Affairs, National Institute on Drug Abuse, NIH, DHHS, 6001... Federal Domestic Assistance Program Nos.: 93.279, Drug Abuse and Addiction Research Programs, National...

75 FR 8649 - Evaluation of State Coastal Management Programs and National Estuarine Research Reserves

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-25

... Ocean and Coastal Resource Management (OCRM) announces a rescheduled site visit and time for a public... Management Programs and National Estuarine Research Reserves AGENCY: National Oceanic and Atmospheric Administration (NOAA), Office of Ocean and Coastal Resource Management, National Ocean Service, Commerce. ACTION...

2014 Teacher Prep Review: A Review of the Nation's Teacher Preparation Programs

ERIC Educational Resources Information Center

Greenberg, Julie; Walsh, Kate; McKee, Arthur

2014-01-01

"Teacher Prep Review 2014" is the second edition of the National Council on Teacher Quality's (NCTQ's) annual assessment of the nation's 2,400 teacher prep programs. The "Review" uncovers early evidence that teacher prep programs are beginning to make changes. It arrives at a time of heightened, unprecedented…

State survey of silviculture nonpoint source programs: a comparison of the 2000 northeastern and national results

Treesearch

Pamela J. Edwards; Gordon W. Stuart

2002-01-01

The National Association of State Foresters conducts surveys of silviculture nonpoint source (NPS) pollution control programs to measure progress and identify needs. The 2000 survey results are summarized here for the nation and for the 20-state northeastern region. Current emphasis of NPS pollution programs is on education, training, and monitoring. Educational...

Looking into the Hearts of Native Peoples: Nation Building as an Institutional Orientation for Graduate Education

ERIC Educational Resources Information Center

Brayboy, Bryan McKinley Jones; Castagno, Angelina E.; Solyom, Jessica A.

2014-01-01

In this article, we suggest that graduate programs in predominantly white institutions can and should be sites of self-education and tribal nation building. In arguing this, we examine how a particular graduate program and the participants of that program engaged tribal nation building, and then we suggest that graduate education writ large must…

Shaky Methods, Shaky Motives: A Critique of the National Council of Teacher Quality's Review of Teacher Preparation Programs

ERIC Educational Resources Information Center

Fuller, Edward J.

2014-01-01

The National Council on Teacher Quality's (NCTQ) recent review of university-based teacher preparation programs concluded the vast majority of such programs were inadequately preparing the nation's teachers. The study, however, has a number of serious flaws that include narrow focus on inputs, lack of a strong research base, missing standards,…

Challenges and Future Opportunities in Our Nation's Space Program

NASA Technical Reports Server (NTRS)

Clements, Greg

2011-01-01

For the first time in decades, there is a significant amount of change in our nation's space program. Along with change, there are opportunities, and NASA has begun a set of planning to be prepared for the future, emphasizing innovation and technology development, increased emphasis on collaboration, commercially-provided access to space, and the need for reinvention. This discussion will briefly give an overview of NASA, showcase some of the diverse activities that are part of our nation' fs space program, identify some of the new changes envisioned to NASA's mission, and how our space program can continue to inspire the nation during changing times.

23 CFR 1205.3 - Identification of National Priority Program Areas.

Code of Federal Regulations, 2011 CFR

2011-04-01

... countermeasures have been identified. Programs developed in such areas are eligible for Federal funding, pursuant... which effective countermeasures have been identified. The program developed in this area is eligible for... national concern, and for which effective countermeasures have been identified. Programs developed in such...

77 FR 28887 - Office of the Director, National Institutes of Health, Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-16

... Assistance Program Nos. 93.14, Intramural Research Training Award; 93.22, Clinical Research Loan Repayment... Research Loan Repayment Program; 93.187, Undergraduate Scholarship Program for Individuals from.../Outreach Program Specialist, Office of Communications and Public Liaison, Office of the Director, National...

Science Education Programs That work. A Collection of Proven Exemplary Educational Programs and Practices in the National Diffusion Network.

ERIC Educational Resources Information Center

Lewis, Mary G., Comp.

This catalog contains descriptions of the science education programs in the National Diffusion Network (NDN). These programs are available to school systems or other educational institutions for implementation in their classrooms. Some programs may be able to offer consultant services and limited assistance with the training and materials…

Science Education Programs That Work. A Collection of Proven Exemplary Educational Programs and Practices in the National Diffusion Network.

ERIC Educational Resources Information Center

Office of Educational Research and Improvement (ED), Washington, DC. National Diffusion Network.

The National Diffusion Network (NDN) is a federally funded system that makes exemplary educational programs available for use by schools, colleges, and other institutions. This publication contains information describing the science education programs currently in the NDN, along with procedural information on how to access these programs. The…

Early Childhood Program Participation, Results from the National Household Education Surveys Program of 2016. First Look. NCES 2017-101

ERIC Educational Resources Information Center

Corcoran, Lisa; Steinley, Katrina

2017-01-01

This report presents findings from the Early Childhood Program Participation Survey of the National Household Education Surveys Program of 2016 (NHES:2016). The Early Childhood Program Participation Survey collected data on children's participation in relative care, nonrelative care, and center-based care arrangements. It also collected…

Advancing Research in the National Science Foundation's Advanced Technological Education Program

ERIC Educational Resources Information Center

Wingate, Lori A.

2017-01-01

Advanced Technological Education is distinct from typical National Science Foundation programs in that it is essentially a training--not research--program, and most grantees are located at technical and two-year colleges. This article presents empirical data on the status of research in the program, discusses the program's role in supporting NSF's…

42 CFR 62.3 - Who is eligible to apply for a scholarship program award?

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 1 2013-10-01 2013-10-01 false Who is eligible to apply for a scholarship program... FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.3 Who is eligible to apply for a scholarship program...

42 CFR 62.3 - Who is eligible to apply for a scholarship program award?

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 1 2012-10-01 2012-10-01 false Who is eligible to apply for a scholarship program... FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.3 Who is eligible to apply for a scholarship program...

42 CFR 62.3 - Who is eligible to apply for a scholarship program award?

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 1 2014-10-01 2014-10-01 false Who is eligible to apply for a scholarship program... FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.3 Who is eligible to apply for a scholarship program...

42 CFR 62.3 - Who is eligible to apply for a scholarship program award?

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 1 2011-10-01 2011-10-01 false Who is eligible to apply for a scholarship program... FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.3 Who is eligible to apply for a scholarship program...

Specialized Study Options U.S.A. A Guide to Short-Term Programs for Foreign Nationals.

ERIC Educational Resources Information Center

Connotillo, Barbara Cahn, Ed.; Johnson, Christine, Ed.

Short-term programs, from technical courses for beginners to executive development programs for professionals, are described that are accessible to or specially designed for foreign nationals. The 875 academic, vocational, and professional programs represent 17 major and 46 minor fields of study. For each program, information is provided on:…

75 FR 6627 - Broadband Technology Opportunities Program

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-10

... DEPARTMENT OF COMMERCE National Telecommunications and Information Administration [Docket No. 0907141137-0079-07] RIN 0660-ZA28 Broadband Technology Opportunities Program AGENCY: National... policy and application procedures for the Broadband Technology Opportunities Program (BTOP) established...

Introduction to the U.S. Geological Survey National Water-Quality Assessment (NAWQA) of ground-water quality trends and comparison to other national programs

USGS Publications Warehouse

Rosen, Michael R.; Lapham, W.W.

2008-01-01

Assessment of temporal trends in national ground-water quality networks are rarely published in scientific journals. This is partly due to the fact that long-term data from these types of networks are uncommon and because many national monitoring networks are not driven by hypotheses that can be easily incorporated into scientific research. The U.S. Geological Survey (USGS) National Water-Quality Assessment Program (NAWQA) since 1991 has to date (2006) concentrated on occurrence of contaminants because sufficient data for trend analysis is only just becoming available. This paper introduces the first set of trend assessments from NAWQA and provides an assessment of the success of the program. On a national scale, nitrate concentrations in ground water have generally increased from 1988 to 2004, but trends in pesticide concentrations are less apparent. Regionally, the studies showed high nitrate concentrations and frequent pesticide detections are linked to agricultural use of fertilizers and pesticides. Most of these areas showed increases in nitrate concentration within the last decade, and these increases are associated with oxic-geochemical conditions and well-drained soils. The current NAWQA plan for collecting data to define trends needs to be constantly reevaluated to determine if the approach fulfills the expected outcome. To assist this evaluation, a comparison of NAWQA to other national ground-water quality programs was undertaken. The design and spatial extent of each national program depend on many factors, including current and long-term budgets, purpose of the program, size of the country, and diversity of aquifer types. Comparison of NAWQA to nine other national programs shows a great diversity in program designs, but indicates that different approaches can achieve similar and equally important goals. Copyright ?? 2008 by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America. All rights reserved.

Visiting Scholars Program | Frederick National Laboratory for Cancer Research

Cancer.gov

The Visiting Scholars Program (VSP) provides a unique opportunity for scientists to collaborate with the Frederick National Laboratory for Cancer Research (FNLCR), the only federal national laboratory in the United States devoted exclusively to b

National Dam Safety Program. Lake Muskoday Dam (Inventory Number N.Y. 341) Delaware River Basin, Sullivan County, New York. Phase I Inspection Report,

DTIC Science & Technology

1981-09-14

DACW-51-81-C-0006 . PERFORMING ORGANIZATION NAME AND ADDRESS 10. PROGRAM ELEMENT PROJECT. TASK AREA & WORK UNIT NUMBERS ~ Flaherty-Giauara Associates...olie It neceary and Idontily b block number) Dam Safety National Dam Safety Program Visual Inspection Lake Muskoday Dam Hydrology, Structural Stability...DELAWARE RIVER BASIN LAKE MUSKODAY DAM SULLIVAN COUNTY, NEW YORK INVENTORY No.NY341 PHASE I INSPECTION REPORT NATIONAL DAM SAFETY PROGRAM J T C NEW YORK

The National Shipbuilding Research Program. 1989 Ship Production Symposium. Paper No. 3: Producibility in Ship Design

DTIC Science & Technology

1989-09-01

INNOVATION MARINE INDUSTRY STANDARDS WELDING INDUSTRIAL ENGINEERING EDUCATION AND TRAINING THE NATIONAL SHIPBUILDING RESEARCH PROGRAM September 1989 NSRP 0310...SEP 1989 2. REPORT TYPE 3. DATES COVERED 00-00-1989 to 00-00-1989 4. TITLE AND SUBTITLE The National Shipbuilding Research Program . 1989 Ship...Production Symposium, Paper No. 3: Producibility in Ship Design 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d

The 3D Elevation Program: summary of program direction

USGS Publications Warehouse

Snyder, Gregory I.

2012-01-01

The 3D Elevation Program (3DEP) initiative responds to a growing need for high-quality topographic data and a wide range of other three-dimensional representations of the Nation's natural and constructed features. The National Enhanced Elevation Assessment (NEEA), which was completed in 2011, clearly documented this need within government and industry sectors. The results of the NEEA indicated that enhanced elevation data have the potential to generate $13 billion in new benefits annually. The benefits apply to food risk management, agriculture, water supply, homeland security, renewable energy, aviation safety, and other areas. The 3DEP initiative was recommended by the National Digital Elevation Program and its 12 Federal member agencies and was endorsed by the National States Geographic Information Council (NSGIC) and the National Geospatial Advisory Committee (NGAC).

National Research Council Research Associateships Program with Methane Hydrates Fellowships Program/National Energy Technology Laboratory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basques, Eric O.

2014-03-20

This report summarizes work carried out over the period from July 5, 2005-January 31, 2014. The work was carried out by the National Research Council Research Associateships Program of the National Academies, under the US Department of Energy's National Energy Technology Laboratory (NETL) program. This Technical Report consists of a description of activity from 2005 through 2014, broken out within yearly timeframes, for NRC/NETL Associateships researchers at NETL laboratories which includes individual tenure reports from Associates over this time period. The report also includes individual tenure reports from associates over this time period. The report also includes descriptions of programmore » promotion efforts, a breakdown of the review competitions, awards offered, and Associate's activities during their tenure.« less

The Upper Colorado River; National Water-Quality Assessment Program; surface-water-monitoring network

USGS Publications Warehouse

Spahr, Norman E.; Driver, Nancy E.; Stephens, Verlin C.

1996-01-01

The U.S. Geological Survey began full implementation of the National Water-Quality Assessment (NAWQA) program in 1991. The long-term goals of the NAWQA program are to (1) describe current water-quality conditions for a large part of the Nation's freshwater streams, rivers, and aquifers; (2) describe how water quality is changing over time; and (3) improve understanding of the primary natural and human factors that affect water-quality conditions (Leahy and others, 1990). To meet these goals, 60 study units representing the Nation's most important river basins and aquifers are being investigated. The program design balances the unique assessment requirements of individual study units with a nationally consistent design structure that incorporates a multiscale, interdisciplinary approach for assessment of surface and ground water.

50 CFR 222.404 - Observer program sampling.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 50 Wildlife and Fisheries 9 2011-10-01 2011-10-01 false Observer program sampling. 222.404 Section 222.404 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC... Requirement § 222.404 Observer program sampling. (a) During the program design, NMFS would be guided by the...

50 CFR 222.404 - Observer program sampling.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Observer program sampling. 222.404 Section 222.404 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC... Requirement § 222.404 Observer program sampling. (a) During the program design, NMFS would be guided by the...

32 CFR 505.13 - Computer Matching Agreement Program.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 3 2010-07-01 2010-07-01 true Computer Matching Agreement Program. 505.13 Section 505.13 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY AID OF CIVIL AUTHORITIES AND PUBLIC RELATIONS ARMY PRIVACY ACT PROGRAM § 505.13 Computer Matching Agreement Program. (a...

32 CFR 2.2 - Statutory relief for participating programs.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 32 National Defense 1 2012-07-01 2012-07-01 false Statutory relief for participating programs. 2.2 Section 2.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE ACQUISITION PILOT PROGRAM POLICY § 2.2 Statutory relief for participating programs. (a) Within the limitations prescribed...

32 CFR 2.2 - Statutory relief for participating programs.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 1 2010-07-01 2010-07-01 false Statutory relief for participating programs. 2.2 Section 2.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE ACQUISITION PILOT PROGRAM POLICY § 2.2 Statutory relief for participating programs. (a) Within the limitations prescribed...

32 CFR 2.2 - Statutory relief for participating programs.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 32 National Defense 1 2011-07-01 2011-07-01 false Statutory relief for participating programs. 2.2 Section 2.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE ACQUISITION PILOT PROGRAM POLICY § 2.2 Statutory relief for participating programs. (a) Within the limitations prescribed...

32 CFR 2.2 - Statutory relief for participating programs.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 32 National Defense 1 2014-07-01 2014-07-01 false Statutory relief for participating programs. 2.2 Section 2.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE ACQUISITION PILOT PROGRAM POLICY § 2.2 Statutory relief for participating programs. (a) Within the limitations prescribed...

32 CFR 2.2 - Statutory relief for participating programs.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 32 National Defense 1 2013-07-01 2013-07-01 false Statutory relief for participating programs. 2.2 Section 2.2 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE ACQUISITION PILOT PROGRAM POLICY § 2.2 Statutory relief for participating programs. (a) Within the limitations prescribed...

42 CFR 62.6 - How will individuals be selected to participate in the scholarship program?

Code of Federal Regulations, 2012 CFR

2012-10-01

... the scholarship program? 62.6 Section 62.6 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.6 How will individuals...

42 CFR 62.6 - How will individuals be selected to participate in the scholarship program?

Code of Federal Regulations, 2011 CFR

2011-10-01

... the scholarship program? 62.6 Section 62.6 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.6 How will individuals...

42 CFR 62.6 - How will individuals be selected to participate in the scholarship program?

Code of Federal Regulations, 2013 CFR

2013-10-01

... the scholarship program? 62.6 Section 62.6 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.6 How will individuals...

42 CFR 62.6 - How will individuals be selected to participate in the scholarship program?

Code of Federal Regulations, 2014 CFR

2014-10-01

... the scholarship program? 62.6 Section 62.6 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.6 How will individuals...

78 FR 46799 - Supplemental Nutrition Assistance Program: Privacy Protections of Information From Applicant...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-02

... Supplemental Nutrition Assistance Program: Privacy Protections of Information From Applicant Households AGENCY... National School Lunch Program established under the Richard B. Russell National School Lunch Act or the School Breakfast Program established under the Child Nutrition Act of 1966, in order to directly certify...

An Exploration of Program Director Leadership Practices in Nationally Accredited Paramedic Education Programs

ERIC Educational Resources Information Center

Kokx, Gordon A.

2016-01-01

The number of paramedic education programs participating in the national accreditation process has nearly tripled in the past several years. Although accreditation standards describe program director roles and responsibilities, nothing has been formally studied regarding their leadership practices. The purpose of this study was to explore…

32 CFR 728.24 - Navy and Marine Corps Officer Candidate Programs.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 32 National Defense 5 2012-07-01 2012-07-01 false Navy and Marine Corps Officer Candidate Programs... Reserve Components, Reserve Officers' Training Corps, Navy and Marine Corps Officer Candidate Programs, and National Guard Personnel § 728.24 Navy and Marine Corps Officer Candidate Programs. Members of the...

32 CFR 728.24 - Navy and Marine Corps Officer Candidate Programs.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 32 National Defense 5 2013-07-01 2013-07-01 false Navy and Marine Corps Officer Candidate Programs... Reserve Components, Reserve Officers' Training Corps, Navy and Marine Corps Officer Candidate Programs, and National Guard Personnel § 728.24 Navy and Marine Corps Officer Candidate Programs. Members of the...

Dewitt Wallace-Reader's Digest Fund National Library Power Program.

ERIC Educational Resources Information Center

School Library Media Annual (SLMA), 1993

1993-01-01

Describes the National Library Power Program, a collaborative effort sponsored by the Dewitt Wallace-Reader's Digest Fund in cooperation with local education funds and public school districts that was designed to create public elementary and middle school library programs that are central to the education program of the school. (LRW)

78 FR 79701 - National Vaccine Injury Compensation Program; List of Petitions Received

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-31

... Vaccine Injury Compensation Program; List of Petitions Received AGENCY: Health Resources and Services... publishing this notice of petitions received under the National Vaccine Injury Compensation Program (the... Vaccine Injury Compensation Program, 5600 Fishers Lane, Room 11C-26, Rockville, MD 20857; (301) 443-6593...

78 FR 72680 - National Vaccine Injury Compensation Program; List of Petitions Received

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-03

... Vaccine Injury Compensation Program; List of Petitions Received AGENCY: Health Resources and Services... publishing this notice of petitions received under the National Vaccine Injury Compensation Program (the... Vaccine Injury Compensation Program, 5600 Fishers Lane, Room 11C-26, Rockville, MD 20857; (301) 443-6593...

76 FR 37371 - Agency Information Collection: Comment Request for National Gap Analysis Program Evaluation

Federal Register 2010, 2011, 2012, 2013, 2014

2011-06-27

... Gap Analysis Program (GAP). The information collected will provide information for the Program's... DEPARTMENT OF THE INTERIOR U.S. Geological Survey [USGS--GX10RB0000SDP00] Agency Information Collection: Comment Request for National Gap Analysis Program Evaluation AGENCY: United States Geological...

28 CFR 905.3 - Participation in the NFF Program.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Participation in the NFF Program. 905.3 Section 905.3 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL NATIONAL FINGERPRINT FILE (NFF) PROGRAM QUALIFICATION REQUIREMENTS § 905.3 Participation in the NFF Program. Each NFF...

28 CFR 905.3 - Participation in the NFF Program.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Participation in the NFF Program. 905.3 Section 905.3 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL NATIONAL FINGERPRINT FILE (NFF) PROGRAM QUALIFICATION REQUIREMENTS § 905.3 Participation in the NFF Program. Each NFF...

28 CFR 905.3 - Participation in the NFF Program.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Participation in the NFF Program. 905.3 Section 905.3 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL NATIONAL FINGERPRINT FILE (NFF) PROGRAM QUALIFICATION REQUIREMENTS § 905.3 Participation in the NFF Program. Each NFF...

28 CFR 905.3 - Participation in the NFF Program.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Participation in the NFF Program. 905.3 Section 905.3 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL NATIONAL FINGERPRINT FILE (NFF) PROGRAM QUALIFICATION REQUIREMENTS § 905.3 Participation in the NFF Program. Each NFF...

28 CFR 905.3 - Participation in the NFF Program.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Participation in the NFF Program. 905.3 Section 905.3 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL NATIONAL FINGERPRINT FILE (NFF) PROGRAM QUALIFICATION REQUIREMENTS § 905.3 Participation in the NFF Program. Each NFF...

77 FR 57074 - Indirect Cost Rates for the Damage Assessment, Remediation, and Restoration Program for Fiscal...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-17

... Damage Assessment, Remediation, and Restoration Program for Fiscal Year 2011 AGENCY: National Oceanic and..., Remediation, and Restoration Program for Fiscal Year 2011. SUMMARY: The National Oceanic and Atmospheric Administration's (NOAA's) Damage Assessment, Remediation, and Restoration Program (DARRP) is announcing new...

ARS NP212 Climate change, soils and emissions program update

USDA-ARS?s Scientific Manuscript database

The Agricultural Research Service National Program 212 (Climate Change, Soils, and Emissions) has a significant component focused on air quality studies. Presented here for the Agricultural Air Quality Task Force is an update on the status of ARS programs with focus on air quality. National Program ...

Reauthorization of the National Sea Grant College Program, 1983. Hearing Before the Subcommittee on Education, Arts and Humanities of the Committee on Labor and Human Resources. United States Senate, Ninety-Eighth Congress, First Session on S. 655 to Authorize Appropriations to Carry Out the National Sea Grant Program for Fiscal Years 1984, 1985, and 1986, and for Other Purposes.

ERIC Educational Resources Information Center

Congress of the U.S., Washington, DC. Senate Subcommittee on Labor and Human Resources.

The National Sea Grant College Program was established in 1966 to create a network of colleges and universities with rigorous programs in marine education and research. Provided in these hearings are testimony and written statements related to authorizing appropriations for the program for fiscal years 1984, 1985, and 1986. Major program…

National Nuclear Forensics Expertise Development Program

NASA Astrophysics Data System (ADS)

Kentis, Samantha E.; Ulicny, William D.

2009-08-01

Over the course of the 2009 Federal Fiscal Year the United States (U.S.) Department of Homeland Security (DHS), in partnership with the Departments of Defense (DoD) and Energy (DOE), is continuing existing programs and introducing new programs designed to maintain a highly qualified, enduring workforce capable of performing the technical nuclear forensics mission. These student and university programs are designed to recruit the best and brightest students, develop university faculty and research capabilities, and engage the national laboratories in fields of study with application in nuclear forensics. This comprehensive effort constitutes the National Nuclear Forensics Expertise Development Program.

Sandia National Laboratories California Waste Management Program Annual Report February 2008.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brynildson, Mark E.

The annual program report provides detailed information about all aspects of the Sandia National Laboratories, California (SNL/CA) Waste Management Program. It functions as supporting documentation to the SNL/CA Environmental Management System Program Manual. This annual program report describes the activities undertaken during the past year, and activities planned in future years to implement the Waste Management (WM) Program, one of six programs that supports environmental management at SNL/CA.

Estimation of Agricultural Pesticide Use in Drainage Basins Using Land Cover Maps and County Pesticide Data. National Water-Quality Assessment Program

DTIC Science & Technology

2005-01-01

National Water-Quality Assessment Program NCFAP National Center for Food and Agricultural Policy NLCD 92 National Land Cover Data 1992 NLCDe 92 enhanced...cropland acreage and state agricultural pesticide use in the early to mid-1990s reported by the National Center for Food and Agricultural Policy (NCFAP...Department of Agriculture’s National Agricultural Statistics Service (NASS). [17]. The National Center for Food and Agricultural Policy (NCFAP) is a

Proceedings of the Annual National Agricultural Education Research Meeting (12th, Atlanta, Georgia, December 6, 1985).

ERIC Educational Resources Information Center

American Vocational Association, Arlington, VA. Agricultural Education Div.

These proceedings include the following papers: "An Assessment of the National FFA Public Service Announcement Program" (Sutphin, Dillon, and Rush); "Educational Objectives and Administrative Criteria for the National FFA Contest Program" (Smith and Kahler); "A National Profile of Agricultural Teacher Educators and State Supervisors of Vocational…

75 FR 35089 - Notice Pursuant to the National Cooperative Research and Production Act of 1993-National...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-21

... Production Act of 1993--National Shipbuilding Research Program Notice is hereby given that, on May 19, 2010... seq. (``the Act''), National Shipbuilding Research Program (``NSRP'') has filed written notifications... Shipbuilding & Repair Co., Inc., Mobile, AL, and Manitowoc Marine Group, Manitowoc, WI, have withdrawn as...

THE ENVIRONMENTAL MONITORING AND ASSESSMENT PROGRAM: THE NATIONAL COASTAL ASSESSMENT ERF 2001, ST. PETE BEACH, NOV 4-8, 2001

EPA Science Inventory

The purpose of the Environmental Monitoring and Assessment Program's National Coastal Assessment (NCA) is to estimate the current status, extent, changes, and trends in ecological indicators of the condition of the nation's coastal resources on a state, regional and national basi...

National visitor use monitoring implementation in Alaska.

Treesearch

Eric M. White; Joshua B. Wilson

2008-01-01

The USDA Forest Service implemented the National Visitor Use Monitoring (NVUM) program across the entire National Forest System (NFS) in calendar year 2000. The primary objective of the NVUM program is to develop reliable estimates of recreation use on NFS lands via a nationally consistent, statistically valid sampling approach. Secondary objectives of NVUM are to...

75 FR 41796 - National School Lunch, Special Milk, and School Breakfast Programs, National Average Payments...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-19

..., afterschool snacks and breakfasts served to children participating in the National School Lunch and School... Factors and to the maximum Federal reimbursement rates for lunches and afterschool snacks served to... afterschool snacks served under the National School Lunch Program are rounded down to the nearest whole cent...

National Ridesharing Demonstration Program : Regional Rideshare Promotion in North Carolina

DOT National Transportation Integrated Search

1985-09-01

This case study reports on a multi-jurisdictional ridesharing program centered in the Piedmont Crescent area of North Carolina, funded under the National Ridesharing Demonstration Program. The Crescent encompasses three metropolitan areas: the Triang...

The NCSS Public Issues Program.

ERIC Educational Resources Information Center

McFarland, Mary

1989-01-01

Describes programs sponsored by the National Council for the Social Studies (NCSS) to promote civic participation. The programs are National Issues Forums (NIF) in the Classroom; Jefferson Meetings; Great Decisions; Public Issues Series; and C-SPAN in the Classroom. (SLM)

78 FR 47274 - National School Lunch, Special Milk, and School Breakfast Programs, National Average Payments...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-05

... following correction: On page 45181, the Table titled ``AFTERSCHOOL SNACKS SERVED IN AFTERSCHOOL CARE PROGRAMS'' is corrected to read as set forth below: Afterschool Snacks Served in Afterschool Care Programs...

75 FR 10464 - Broadband Technology Opportunities Program

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-08

... DEPARTMENT OF COMMERCE National Telecommunications and Information Administration [Docket Number 0907141137-0119-08] RIN 0660-ZA28 Broadband Technology Opportunities Program AGENCY: National... Infrastructure (CCI) projects under the Broadband Technology Opportunities Program (BTOP) is extended until 5:00...

75 FR 14131 - Broadband Technology Opportunities Program

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-24

... DEPARTMENT OF COMMERCE National Telecommunications and Information Administration [Docket Number: 0907141137-0154-09] RIN 0660-ZA28 Broadband Technology Opportunities Program AGENCY: National... under the Broadband Technology Opportunities Program (BTOP) is extended until 10 p.m. Eastern Daylight...

EPA'S NATIONAL COASTAL ASSESSMENT PROGRAM

EPA Science Inventory

The National Coastal Assessment (NCA) is an environmental monitoring program initiated by the US Environmental Protection Agency's Office of Research and Development in 2000. The goal is to monitor selected ecological indicators in the nation's estuarine waters and to produce an...

NATIONAL STATUS AND TRENDS PROGRAM

EPA Science Inventory

Since 1984, the National Status and Trends (NS&T) Program has monitored, on a national scale, spatial and temporal trends of chemical contamination and biological responses to that contamination. Temporal trends are being monitored through the Mussel Watch project that analyzes m...

45 CFR 606.70 - Complaint procedures.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE NATIONAL SCIENCE FOUNDATION... Office of Equal Opportunity Programs, National Science Foundation, 4201 Wilson Boulevard, Arlington, VA...

45 CFR 606.70 - Complaint procedures.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE NATIONAL SCIENCE FOUNDATION... Office of Equal Opportunity Programs, National Science Foundation, 4201 Wilson Boulevard, Arlington, VA...

45 CFR 606.70 - Complaint procedures.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE NATIONAL SCIENCE FOUNDATION... Office of Equal Opportunity Programs, National Science Foundation, 4201 Wilson Boulevard, Arlington, VA...

45 CFR 606.70 - Complaint procedures.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE NATIONAL SCIENCE FOUNDATION... Office of Equal Opportunity Programs, National Science Foundation, 4201 Wilson Boulevard, Arlington, VA...

45 CFR 606.70 - Complaint procedures.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE NATIONAL SCIENCE FOUNDATION... Office of Equal Opportunity Programs, National Science Foundation, 4201 Wilson Boulevard, Arlington, VA...

75 FR 2879 - Identification of Foreign Countries Whose Nationals Are Eligible To Participate in the H-2A and H...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-19

... Countries Whose Nationals Are Eligible To Participate in the H-2A and H-2B Visa Programs AGENCY: Office of... the H-2A and H-2B programs for the coming year. DATES: Effective Date: This notice is effective... Visa Program,'' and ``Identification of Foreign Countries Whose Nationals Are Eligible to Participate...

The National School Lunch Program: Background, Trends, and Issues. Economic Research Report Number 61

ERIC Educational Resources Information Center

Ralston, Katherine; Newman, Constance; Clauson, Annette; Guthrie, Joanne; Buzby, Jean

2008-01-01

The National School Lunch Program (NSLP) is the Nation's second largest food and nutrition assistance program. In 2006, it operated in over 101,000 public and nonprofit private schools and provided over 28 million low-cost or free lunches to children on a typical school day at a Federal cost of $8 billion for the year. This report provides…

Resources for Teaching: Programed Instruction Community Problems Nursing Rounds. Report of a Conference for Nursing Instructors (Louisville, Kentucky, October 16-17, 1967).

ERIC Educational Resources Information Center

National League for Nursing, New York, NY. Nursing Advisory Service.

Representatives of 15 nursing programs participated in the conference conducted by the Nursing Advisory Service of the National League for Nursing and the National Tuberculosis and Respiratory Disease Association, with the Assistance of the Department of Baccalaureate and Higher Degree Programs of the National League for Nursing and cosponsored by…

The Model U.N. Program: Teaching Unreality. A United Nations Assessment Project Study. The Heritage Foundation Backgrounder No. 282.

ERIC Educational Resources Information Center

Gulick, Thomas G.; Merkle, Melanie L.

An evaluation of the instructional materials used by high school and college students who participated in the Model United Nations Program showed that the program is uncritical of the United Nations (U.N.) and biased against the United States and the West in general. These materials are strongly promoted by many prominent educational professional…

Effective Schools Programs: Their Extent and Characteristics. Briefing Report to the Chairman, Committee on Education and Labor, House of Representatives.

ERIC Educational Resources Information Center

General Accounting Office, Washington, DC. Div. of Human Resources.

A national study of effective schools programs provides information on the extent and characteristics of these programs in the nation's school districts and schools. A questionnaire was mailed to a random sample of 1,685 school district superintendents. Findings are representative of the approximately 16,000 local school districts in the nation.…

An Evaluation of Bias in the 2007 National Household Education Surveys Program: Results from a Special Data Collection Effort. NCES 2009-029

ERIC Educational Resources Information Center

Van de Kerckhove, Wendy; Montaquila, Jill M.; Carver, Priscilla R.; Brick, J. Michael

2009-01-01

The National Household Education Surveys Program (NHES) is a random digit dialing (RDD) survey program developed by the National Center for Education Statistics (NCES) in the Institute of Education Sciences, U.S. Department of Education. The surveys are designed to help NCES collect data directly from households about important education topics.…

Theoretical study of micro-optical structure fabrication based on sample rotation and two-laser-beam interference

NASA Astrophysics Data System (ADS)

Chen, Yizhen; Wang, Xiangxian; Wang, Ru; Yang, Hua; Qi, Yunping

2017-05-01

Not Available Project supported by the National Natural Science Foundation of China (Grant No. 61505074), the National Basic Research Program of China (Grant No. 2013CBA01703), the HongLiu Young Teachers Training Program Funded Projects of Lanzhou University of Technology, China (Grant No. Q201509), and the National Undergraduate Innovation Training Program of China (Grant No. 201610731030).

National Space Weather Program Advances on Several Fronts

NASA Astrophysics Data System (ADS)

Gunzelman, Mark; Babcock, Michael

2008-10-01

The National Space Weather Program (NSWP; http://www.nswp.gov) is a U.S. federal government interagency initiative through the Office of the Federal Coordinator for Meteorology that was created to speed the improvement of space weather services for the nation. The Committee for Space Weather (CSW) under the NSWP has continued to advance the program on a number of fronts over the past 12 months.

Updated operational protocols for the U.S. Geological Survey Precipitation Chemistry Quality Assurance Project in support of the National Atmospheric Deposition Program

USGS Publications Warehouse

Wetherbee, Gregory A.; Martin, RoseAnn

2017-02-06

The U.S. Geological Survey Branch of Quality Systems operates the Precipitation Chemistry Quality Assurance Project (PCQA) for the National Atmospheric Deposition Program/National Trends Network (NADP/NTN) and National Atmospheric Deposition Program/Mercury Deposition Network (NADP/MDN). Since 1978, various programs have been implemented by the PCQA to estimate data variability and bias contributed by changing protocols, equipment, and sample submission schemes within NADP networks. These programs independently measure the field and laboratory components which contribute to the overall variability of NADP wet-deposition chemistry and precipitation depth measurements. The PCQA evaluates the quality of analyte-specific chemical analyses from the two, currently (2016) contracted NADP laboratories, Central Analytical Laboratory and Mercury Analytical Laboratory, by comparing laboratory performance among participating national and international laboratories. Sample contamination and stability are evaluated for NTN and MDN by using externally field-processed blank samples provided by the Branch of Quality Systems. A colocated sampler program evaluates the overall variability of NTN measurements and bias between dissimilar precipitation gages and sample collectors.This report documents historical PCQA operations and general procedures for each of the external quality-assurance programs from 2007 to 2016.

Integrating National Space Visions

NASA Technical Reports Server (NTRS)

Sherwood, Brent

2006-01-01

This paper examines value proposition assumptions for various models nations may use to justify, shape, and guide their space programs. Nations organize major societal investments like space programs to actualize national visions represented by leaders as investments in the public good. The paper defines nine 'vision drivers' that circumscribe the motivations evidently underpinning national space programs. It then describes 19 fundamental space activity objectives (eight extant and eleven prospective) that nations already do or could in the future use to actualize the visions they select. Finally the paper presents four contrasting models of engagement among nations, and compares these models to assess realistic pounds on the pace of human progress in space over the coming decades. The conclusion is that orthogonal engagement, albeit unlikely because it is unprecedented, would yield the most robust and rapid global progress.

Science Education Programs That Work. A Collection of Proven Exemplary Educational Programs and Practices in the National Diffusion Network.

ERIC Educational Resources Information Center

Sivertsen, Mary Lewis, Comp.

These programs are available to school systems or other educational institutions for implementation in the classroom. Some programs may be able to offer consultant services and limited assistance with the training and materials associated with installing one of these programs in schools. Information about the National Diffusion Network (NDN) is…

Science Education Programs That Work. A Collection of Proven Exemplary Educational Programs and Practices in the National Diffusion Network.

ERIC Educational Resources Information Center

Lewis, Mary G., Comp.

This catalog contains descriptions of the science education programs and materials in the National Diffusion Network (NDN). These programs and materials are available to school systems or other educational institutions for implementation in their classrooms. Some programs may be able to offer consultant services and limited assistance with the…

U.S. Department of Energy Photovoltaic Energy Program Contract Summary: Fiscal Year 2000

DOE Office of Scientific and Technical Information (OSTI.GOV)

Surek, T.

2001-02-21

This report summarizes the in-house and subcontracted research and development (R and D) activities under the National Center for Photovoltaics (NCPV) and U.S. Department of Energy (DOE) National Photovoltaics Program from October 1, 1999, through September 30, 2000 (FY 2000). The mission of the DOE National Photovoltaics Program is to make PV a significant part of the domestic economy-as an industry and an energy resource. The two primary goals of the national program are to (1) maintain the U.S. industry's world leadership in research and technology development and (2) help the U.S. industry remain a major, profitable force in themore » world market. The NCPV is part of the National PV Program and provides leadership and support to the national program toward achieving its mission and goals. This Contract Summary for fiscal year (FY) 2000 documents some 179 research projects supported by the PV Program, performed by 107 organizations in 32 states, including 69 projects performed by universities and 60 projects performed by our industry partners. Of the total FY 2000 PV Program budget of $65.9 million, the industry and university research efforts received $36.9 million, or nearly 56%. And, of this amount, more than 93% was for contractors selected on a competitive basis. Much of the funding to industry was matched by industry cost-sharing. Each individual effort described in this summary represents another step toward improving PV manufacturing, performance, cost, and applications, and another step toward accomplishing the DOE PV Program's overall mission.« less

77 FR 8219 - Coastal Zone Management Program: Illinois

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-14

... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Coastal Zone Management Program: Illinois AGENCY: Office of Ocean and Coastal Resource Management (OCRM), National Oceanic and... of Decision (ROD) for Federal Approval of the Illinois Coastal Management Program (ICMP). SUMMARY...

National child safety seat distribution program evaluation

DOT National Transportation Integrated Search

1999-03-01

The National Child Safety Seat Distribution Program (NCSS) was a multi-year, multi-phase program intended to distribute $8 million in child safety seats to low-income and special needs children in all fifty states. Non-profit organizations that recei...

76 FR 70970 - Technology Innovation Program Advisory Board

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-16

... DEPARTMENT OF COMMERCE National Institute of Standards and Technology Technology Innovation Program Advisory Board AGENCY: National Institute of Standards and Technology, Department of Commerce. ACTION: Notice of public meeting. SUMMARY: The Technology Innovation Program (TIP) Advisory Board will...

Lawrence Livermore National Laboratories Perspective on Code Development and High Performance Computing Resources in Support of the National HED/ICF Effort

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clouse, C. J.; Edwards, M. J.; McCoy, M. G.

2015-07-07

Through its Advanced Scientific Computing (ASC) and Inertial Confinement Fusion (ICF) code development efforts, Lawrence Livermore National Laboratory (LLNL) provides a world leading numerical simulation capability for the National HED/ICF program in support of the Stockpile Stewardship Program (SSP). In addition the ASC effort provides high performance computing platform capabilities upon which these codes are run. LLNL remains committed to, and will work with, the national HED/ICF program community to help insure numerical simulation needs are met and to make those capabilities available, consistent with programmatic priorities and available resources.

45 CFR 1152.6 - What procedures apply to the selection of programs and activities under these regulations?

Code of Federal Regulations, 2011 CFR

2011-10-01

... Public Welfare (Continued) NATIONAL FOUNDATION ON THE ARTS AND THE HUMANITIES NATIONAL ENDOWMENT FOR THE ARTS INTERGOVERNMENTAL REVIEW OF NATIONAL ENDOWMENT FOR THE ARTS PROGRAMS AND ACTIVITIES § 1152.6 What...

14 CFR 1203.900 - Establishment.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION INFORMATION SECURITY PROGRAM NASA Information Security Program Committee § 1203.900 Establishment. Pursuant to Executive Order 12958, “National Security Information,” and the National Aeronautics and Space Act of 1958, as amended, there is established...

76 FR 76023 - National Impaired Driving Prevention Month, 2011

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-06

... enforcement measures and effective substance abuse prevention programs. During National Impaired Driving... legislation, and support successful, evidence-based prevention programs. These ongoing initiatives are... National Impaired Driving Prevention Month, 2011 By the President of the United States of America A...

75 FR 65526 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-25

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: Information Security Oversight Office... planning to attend must be submitted to the Information Security Oversight Office (ISOO) no later than...

76 FR 6636 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-07

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: Information Security Oversight Office... planning to attend must be submitted to the Information Security Oversight Office (ISOO) no later than...

77 FR 12623 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2012-03-01

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office National... Information Security Oversight Office no later than Friday, March 16, 2012. The Information Security Oversight... FURTHER INFORMATION CONTACT: David O. Best, Senior Program Analyst, The Information Security Oversight...

76 FR 67484 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-01

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: Information Security Oversight Office... must be submitted to the Information Security Oversight Office (ISOO) no later than Friday, November 11...

76 FR 28099 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-13

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: Information Security Oversight Office... telephone number of individuals planning to attend must be submitted to the Information Security Oversight...

75 FR 39582 - National Industrial Security Program Policy Advisory Committee (NISPPAC)

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-09

... NATIONAL ARCHIVES AND RECORDS ADMINISTRATION Information Security Oversight Office National Industrial Security Program Policy Advisory Committee (NISPPAC) AGENCY: Information Security Oversight Office... telephone number of individuals planning to attend must be submitted to the Information Security Oversight...

14 CFR 1203.900 - Establishment.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION INFORMATION SECURITY PROGRAM NASA Information Security Program Committee § 1203.900 Establishment. Pursuant to Executive Order 12958, “National Security Information,” and the National Aeronautics and Space Act of 1958, as amended, there is established...

29 CFR 1960.41 - National committee duties.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) BASIC PROGRAM ELEMENTS FOR FEDERAL EMPLOYEE OCCUPATIONAL SAFETY AND HEALTH PROGRAMS AND RELATED MATTERS Occupational Safety and Health Committees § 1960.41 National committee duties. National committees...

29 CFR 1960.41 - National committee duties.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) BASIC PROGRAM ELEMENTS FOR FEDERAL EMPLOYEE OCCUPATIONAL SAFETY AND HEALTH PROGRAMS AND RELATED MATTERS Occupational Safety and Health Committees § 1960.41 National committee duties. National committees...

29 CFR 1960.41 - National committee duties.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) BASIC PROGRAM ELEMENTS FOR FEDERAL EMPLOYEE OCCUPATIONAL SAFETY AND HEALTH PROGRAMS AND RELATED MATTERS Occupational Safety and Health Committees § 1960.41 National committee duties. National committees...

FAA National Aviation Safety Inspection Program. Annual Report FY90

DOT National Transportation Integrated Search

1991-06-01

This report was undertaken to document, analyze, and place : into national perspective the findings from the 1990 National : Aviation Safety Inspection Program (NASIP). This report is the : fifth in a series of annual reports covering the results of ...

75 FR 2878 - National Cancer Institute; Notice of Closed Meetings

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-19

..., Resources and Training Review Branch, Division of Extramural Activities, National Cancer Institute, 6116... Officer, Research Programs Review Branch, Division of Extramural Activities, National Cancer Institute... Ahmad, PhD, Scientific Review Officer, Research Programs Review Branch, Division of Extramural...

45 CFR 1152.6 - What procedures apply to the selection of programs and activities under these regulations?

Code of Federal Regulations, 2010 CFR

2010-10-01

... Public Welfare (Continued) NATIONAL FOUNDATION ON THE ARTS AND THE HUMANITIES NATIONAL ENDOWMENT FOR THE ARTS INTERGOVERNMENTAL REVIEW OF NATIONAL ENDOWMENT FOR THE ARTS PROGRAMS AND ACTIVITIES § 1152.6 What...

National Water-Quality Assessment Program: The Sacramento River Basin

USGS Publications Warehouse

Domagalski, Joseph L.; Brown, Larry R.

1994-01-01

In 1991, the U.S. Geological Survey (USGS) began to implement a full-scale National Water-Quality Assessment (NAWQA) program. The long-term goals of the NAWQA program are to describe the status of and trends in the quality of a large, representative part of the Nation's surface- and ground-water resources and to identify the major natural and human factors that affect the quality of those resources. In addressing these goals, the program will provide a wealth of water- quality information that will be useful to policy makers and managers at the national, State, and local levels. A major asset of the NAWQA program is that it will allow for the integration of water-quality information collected at several scales. A major component of the program is the study-unit investigation-the foundation of national- level assessment. The 60 study units of the NAWQA program are hydrologic systems that include parts of most major river basins and aquifer systems of the conterminous United States. These study units cover areas of 1,000 to more than 60,000 square miles and represent 60 to 70 percent of the Nation's water use and population served by public water supplies. Investigations of the first 20 study units began in 1991. In 1994, the Sacramento River Basin was among the second set of 20 NAWQA study units selected for investigation.

National Water-Quality Assessment Program--Southern High Plains, Texas and New Mexico

USGS Publications Warehouse

Woodward, Dennis G.; Diniz, Cecilia G.

1994-01-01

BACKGROUND In 1991, the U.S. Geological Survey (USGS) began a National Water-Quality Assessment (NAWQA) program. The long-term goals of the NAWQA program are to describe the status of, and trends in, the quality of a large, representative part of the Nation's surface- and ground-water resources and to identify the major natural and human factors that affect the quality of these resources. In addressing these goals, the program will produce a wealth of water-quality information that will be useful to policy makers and managers at the National, State, and local levels. The NAWQA program emphasis is on regional water-quality problems. The program will not diminish the need for smaller studies and monitoring designed and currently being conducted by Federal, State, and local agencies to meet their individual needs. The NAWQA program, however, will provide a large-scale framework for conducting many of these activities and an understanding about National and regional water-quality conditions that cannot be acquired from individual, small-scale programs and studies. Studies of 60 hydrologic systems that include parts of most major river basins and aquifer systems (study-unit investigations) are the building blocks of the National assessment. The 60 study units range in size from 1,000 mi 2 (square miles) to more than 60,000 mi 2 and represent 60 to 70 percent of the Nation's water use and population served by public water supplies. Twenty study-unit investigations were started in 1991, 20 additional are starting in 1994, and 20 more are planned to start in 1997. The Southern High Plains study unit was selected as one of 20 study units to begin assessment activities in 1994. This study will be run from the New Mexico District office of the USGS in Albuquerque, New Mexico.

42 CFR 62.7 - What will an individual be awarded for participating in the scholarship program?

Code of Federal Regulations, 2011 CFR

2011-10-01

... participating in the scholarship program? 62.7 Section 62.7 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.7 What will an...

42 CFR 62.8 - What does an individual have to do in return for the scholarship program award?

Code of Federal Regulations, 2012 CFR

2012-10-01

... the scholarship program award? 62.8 Section 62.8 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.8 What does an...

42 CFR 62.8 - What does an individual have to do in return for the scholarship program award?

Code of Federal Regulations, 2011 CFR

2011-10-01

... the scholarship program award? 62.8 Section 62.8 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.8 What does an...

42 CFR 62.8 - What does an individual have to do in return for the scholarship program award?

Code of Federal Regulations, 2014 CFR

2014-10-01

... the scholarship program award? 62.8 Section 62.8 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.8 What does an...

42 CFR 62.11 - When can a scholarship program payment obligation be discharged in bankruptcy?

Code of Federal Regulations, 2013 CFR

2013-10-01

... 42 Public Health 1 2013-10-01 2013-10-01 false When can a scholarship program payment obligation... HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.11 When can a...

42 CFR 62.7 - What will an individual be awarded for participating in the scholarship program?

Code of Federal Regulations, 2013 CFR

2013-10-01

... participating in the scholarship program? 62.7 Section 62.7 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.7 What will an...

42 CFR 62.7 - What will an individual be awarded for participating in the scholarship program?

Code of Federal Regulations, 2010 CFR

2010-10-01

... participating in the scholarship program? 62.7 Section 62.7 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.7 What will an...

42 CFR 62.11 - When can a scholarship program payment obligation be discharged in bankruptcy?

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false When can a scholarship program payment obligation... HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.11 When can a...

42 CFR 62.11 - When can a scholarship program payment obligation be discharged in bankruptcy?

Code of Federal Regulations, 2012 CFR

2012-10-01

... 42 Public Health 1 2012-10-01 2012-10-01 false When can a scholarship program payment obligation... HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.11 When can a...

42 CFR 62.11 - When can a scholarship program payment obligation be discharged in bankruptcy?

Code of Federal Regulations, 2014 CFR

2014-10-01

... 42 Public Health 1 2014-10-01 2014-10-01 false When can a scholarship program payment obligation... HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.11 When can a...

42 CFR 62.7 - What will an individual be awarded for participating in the scholarship program?

Code of Federal Regulations, 2012 CFR

2012-10-01

... participating in the scholarship program? 62.7 Section 62.7 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.7 What will an...

42 CFR 62.8 - What does an individual have to do in return for the scholarship program award?

Code of Federal Regulations, 2013 CFR

2013-10-01

... the scholarship program award? 62.8 Section 62.8 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.8 What does an...

42 CFR 62.11 - When can a scholarship program payment obligation be discharged in bankruptcy?

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 1 2011-10-01 2011-10-01 false When can a scholarship program payment obligation... HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.11 When can a...

42 CFR 62.7 - What will an individual be awarded for participating in the scholarship program?

Code of Federal Regulations, 2014 CFR

2014-10-01

... participating in the scholarship program? 62.7 Section 62.7 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES FELLOWSHIPS, INTERNSHIPS, TRAINING NATIONAL HEALTH SERVICE CORPS SCHOLARSHIP AND LOAN REPAYMENT PROGRAMS National Health Service Corps Scholarship Program § 62.7 What will an...

Demographic Changes in School Psychology Training Programs between 1997 and 2005

ERIC Educational Resources Information Center

Cannon, Sharon

2009-01-01

The purpose of this study seeks to add to the body of knowledge regarding school psychology training programs by analyzing the data of the 2005 National Association of School Psychologists (NASP) Graduate Training in School Psychology Database, a national survey of psychology training programs. Program directors of all known existing school…

Proceedings from the Communication Across the Curriculum Strand. NCA 2001 Summer Conference: Engaging 21st Century Communication Students.

ERIC Educational Resources Information Center

Dannels, Deanna; Jackson, Nancy; Robertson, Terry; Sheckles, Ted; Tomlinson, Stephanie

This Proceedings from the Communication across the Curriculum (CXC) strand of the National Communication Association's 2001 Summer Conference first highlights and describes five of the most common types of programs across the nation: Speaking Intensive Programs, Combined Speaking and Writing Programs, Discipline-Specific Programs, Faculty…

Building a National Security Program at a Small School: Identifying Opportunities and Overcoming Challenges

ERIC Educational Resources Information Center

Grossman, Michael; Schortgen, Francis

2016-01-01

This article offers insights into the overall program development process and--institutional obstacles and constraints notwithstanding--successful introduction of a new national security program at a small liberal arts university at a time of growing institutional prioritization of science, technology, engineering, and mathematics (STEM) programs.…

National Endowment for the Humanities: Twenty-Second Annual Report--1987.

ERIC Educational Resources Information Center

1987

Reflecting the efforts of the National Endowment for the Humanities (NEH) to support the humanities in all their aspects, this report lists federal funds obligated for grants made in the 1987 fiscal year through the Endowment's five divisions (Education Programs, Fellowships and Seminars, General Programs, Research Programs, and State Programs)…

Programs for Deaf-Blind Children and Adults.

ERIC Educational Resources Information Center

American Annals of the Deaf, 1993

1993-01-01

The 1992-93 directory of programs for children and adults with deaf-blindness lists (1) 27 state or multistate programs; (2) the national headquarters and the 10 regional offices of the Helen Keller National Center for Deaf Blind Youth and Adults; and (3) seven programs for training teachers of deaf blind students. (DB)

Induction Programs for the Support and Development of Beginning Teachers of Science. National Science Teachers Association Position Statement

ERIC Educational Resources Information Center

National Science Teachers Association (NJ1), 2007

2007-01-01

The National Science Teachers Association (NSTA) recommends that schools and teacher preparation programs provide new teachers of science with comprehensive induction programs. Research suggests these programs should address specifics for teachers of science, involve trained mentors, provide adequate time to support continual learning of new…

34 CFR 648.1 - What is the Graduate Assistance in Areas of National Need program?

Code of Federal Regulations, 2012 CFR

2012-07-01

... 34 Education 3 2012-07-01 2012-07-01 false What is the Graduate Assistance in Areas of National... (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION GRADUATE ASSISTANCE IN AREAS OF NATIONAL NEED General § 648.1 What is the Graduate Assistance in Areas of National Need program? The...

34 CFR 648.1 - What is the Graduate Assistance in Areas of National Need program?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 34 Education 3 2011-07-01 2011-07-01 false What is the Graduate Assistance in Areas of National... (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION GRADUATE ASSISTANCE IN AREAS OF NATIONAL NEED General § 648.1 What is the Graduate Assistance in Areas of National Need program? The...

34 CFR 648.1 - What is the Graduate Assistance in Areas of National Need program?

Code of Federal Regulations, 2014 CFR

2014-07-01

... 34 Education 3 2014-07-01 2014-07-01 false What is the Graduate Assistance in Areas of National... (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION GRADUATE ASSISTANCE IN AREAS OF NATIONAL NEED General § 648.1 What is the Graduate Assistance in Areas of National Need program? The...

34 CFR 648.1 - What is the Graduate Assistance in Areas of National Need program?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 34 Education 3 2010-07-01 2010-07-01 false What is the Graduate Assistance in Areas of National... (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION GRADUATE ASSISTANCE IN AREAS OF NATIONAL NEED General § 648.1 What is the Graduate Assistance in Areas of National Need program? The...

34 CFR 648.1 - What is the Graduate Assistance in Areas of National Need program?

Code of Federal Regulations, 2013 CFR

2013-07-01

... 34 Education 3 2013-07-01 2013-07-01 false What is the Graduate Assistance in Areas of National... (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION GRADUATE ASSISTANCE IN AREAS OF NATIONAL NEED General § 648.1 What is the Graduate Assistance in Areas of National Need program? The...

National best management practices monitoring summary report, program phase-in period fiscal years 2013-2014

Treesearch

Joan Carlson; Pam Edwards; Todd Ellsworth; Michael Eberle

2015-01-01

The National BMP Program provides National Core BMPs, standardized monitoring protocols to evaluate implementation and effectiveness of the National Core BMPs, and a data management system to store and analyze the resulting monitoring data. BMP evaluations are completed by interdisciplinary teams of resource specialists and include assessments of whether BMP...

Nontimber forest products management on national forests in the United States.

Treesearch

Rebecca J. McLain; Eric T. Jones

2005-01-01

This study provides an overview of nontimber forest products (NTFP) programs on national forests in the United States. We conducted an email survey in 2003 to obtain data on NTFP management activities on national forests across the country. Program characteristics examined in the study included important NTFPs managed on national forests, presence of NTFP coordinators...

40 CFR 52.2348 - National Highway Systems Designation Act Motor Vehicle Inspection and Maintenance (I/M) Programs.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 5 2014-07-01 2014-07-01 false National Highway Systems Designation... IMPLEMENTATION PLANS (CONTINUED) Utah § 52.2348 National Highway Systems Designation Act Motor Vehicle Inspection... the National Highway Systems Designation Act of 1995. If Utah County fails to start its program by...

40 CFR 52.2348 - National Highway Systems Designation Act Motor Vehicle Inspection and Maintenance (I/M) Programs.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 5 2013-07-01 2013-07-01 false National Highway Systems Designation... IMPLEMENTATION PLANS (CONTINUED) Utah § 52.2348 National Highway Systems Designation Act Motor Vehicle Inspection... the National Highway Systems Designation Act of 1995. If Utah County fails to start its program by...

40 CFR 52.2348 - National Highway Systems Designation Act Motor Vehicle Inspection and Maintenance (I/M) Programs.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 5 2012-07-01 2012-07-01 false National Highway Systems Designation... IMPLEMENTATION PLANS (CONTINUED) Utah § 52.2348 National Highway Systems Designation Act Motor Vehicle Inspection... the National Highway Systems Designation Act of 1995. If Utah County fails to start its program by...

76 FR 21404 - National Park Service Alaska Region's Subsistence Resource Commission (SRC) Program

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-15

... Resource Commission (SRC) program. SUMMARY: The Gates of the Arctic National Park SRC will meet to develop... to do so. Gates of the Arctic National Park SRC Meeting Date and Location: The Gates of the Arctic... weather or local circumstances. For Further Information on the Gates of the Arctic National Park SRC...

78 FR 51206 - Notice of October 15-16, 2013, Meeting of the National Park System Advisory Board

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-20

....YM0000] Notice of October 15-16, 2013, Meeting of the National Park System Advisory Board AGENCY... Federal Regulations, that the National Park System Advisory Board will meet October 15-16, 2013, in... Landmarks Program and the National Natural Landmarks Program. The Board also may consider recommendations in...

Creating a "culture of research" in a community hospital: Strategies and tools from the National Cancer Institute Community Cancer Centers Program.

PubMed

Dimond, Eileen P; St Germain, Diane; Nacpil, Lianne M; Zaren, Howard A; Swanson, Sandra M; Minnick, Christopher; Carrigan, Angela; Denicoff, Andrea M; Igo, Kathleen E; Acoba, Jared D; Gonzalez, Maria M; McCaskill-Stevens, Worta

2015-06-01

The value of community-based cancer research has long been recognized. In addition to the National Cancer Institute's Community Clinical and Minority-Based Oncology Programs established in 1983, and 1991 respectively, the National Cancer Institute established the National Cancer Institute Community Cancer Centers Program in 2007 with an aim of enhancing access to high-quality cancer care and clinical research in the community setting where most cancer patients receive their treatment. This article discusses strategies utilized by the National Cancer Institute Community Cancer Centers Program to build research capacity and create a more entrenched culture of research at the community hospitals participating in the program over a 7-year period. To facilitate development of a research culture at the community hospitals, the National Cancer Institute Community Cancer Centers Program required leadership or chief executive officer engagement; utilized a collaborative learning structure where best practices, successes, and challenges could be shared; promoted site-to-site mentoring to foster faster learning within and between sites; required research program assessments that spanned clinical trial portfolio, accrual barriers, and outreach; increased identification and use of metrics; and, finally, encouraged research team engagement across hospital departments (navigation, multidisciplinary care, pathology, and disparities) to replace the traditionally siloed approach to clinical trials. The health-care environment is rapidly changing while complexity in research increases. Successful research efforts are impacted by numerous factors (e.g. institutional review board reviews, physician interest, and trial availability). The National Cancer Institute Community Cancer Centers Program sites, as program participants, had access to the required resources and support to develop and implement the strategies described. Metrics are an important component yet often challenging to identify and collect. The model requires a strong emphasis on outreach that challenges hospitals to improve and expand their reach, particularly into underrepresented populations and catchment areas. These efforts build on trust and a referral pipeline within the community which take time and significant commitment to establish. The National Cancer Institute Community Cancer Centers Program experience provides a relevant model to broadly address creating a culture of research in community hospitals that are increasingly networked via systems and consortiums. The strategies used align well with the National Cancer Institute-American Society of Clinical Oncology Accrual Symposium recommendations for patient-/community-, physician-/provider-, and site-/organizational-level approaches to clinical trials; they helped sites achieve organizational culture shifts that enhanced their cancer research programs. The National Cancer Institute Community Cancer Centers Program hospitals reported that the strategies were challenging to implement yet proved valuable as they provided useful metrics for programmatic assessment, planning, reporting, and growth. While focused on oncology trials, these concepts may be useful within other disease-focused research as well. © The Author(s) 2015.

National Park Service vegetation inventory program: Mississippi National River and Recreation Area, Minnesota

USGS Publications Warehouse

Hop, Kevin D.; Drake, Jim; Strassman, Andrew C.; Hoy, Erin E.; Jakusz, Joseph; Menard, Shannon; Dieck, Jennifer

2015-01-01

The Mississippi National River and Recreation Area (MISS) vegetation mapping project is an initiative of the National Park Service (NPS) Vegetation Inventory Program (VIP) to classify and map vegetation types of MISS. (Note: “MISS” is also referred to as “park” throughout this report.) The goals of the project are to adequately describe and map vegetation types of the park and to provide the NPS Natural Resource Inventory and Monitoring (I&M) Program, resource managers, and biological researchers with useful baseline vegetation information.The MISS vegetation mapping project was officially started in spring 2012, with a scoping meeting wherein partners discussed project objectives, goals, and methods. Major collaborators at this meeting included staff from the NPS MISS, the NPS Great Lakes Network (GLKN), NatureServe, and the USGS Upper Midwest Environmental Sciences Center. The Minnesota Department of Natural Resources (DNR) was also in attendance. Common to all NPS VIP projects, the three main components of the MISS vegetation mapping project are as follows: (1) vegetation classification, (2) vegetation mapping, and (3) map accuracy assessment (AA). In this report, each of these fundamental components is discussed in detail.With the completion of the MISS vegetation mapping project, all nine park units within the NPS GLKN have received vegetation classification and mapping products from the NPS and USGS vegetation programs. Voyageurs National Park and Isle Royale National Park were completed during 1996–2001 (as program pilot projects) and another six park units were completed during 2004–11, including the Apostle Islands National Lakeshore, Grand Portage National Monument, Indiana Dunes National Lakeshore, Pictured Rocks National Lakeshore, Saint Croix National Scenic Riverway, and Sleeping Bear Dunes National Lakeshore.

78 FR 4154 - Identification of Foreign Countries Whose Nationals Are Eligible To Participate in the H-2A and H...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-18

... Whose Nationals Are Eligible To Participate in the H-2A and H-2B Nonimmigrant Worker Programs AGENCY... participate in the H-2A and H-2B programs for the coming year. The list published today includes one new..., ``Identification of Foreign Countries Whose Nationals Are Eligible to Participate in the H-2A Visa Program,'' and...

Evaluating Why and How the Teen Outreach Program Works: Years 3-5 of the Teen Outreach National Replication (1986/87-1988/89).

ERIC Educational Resources Information Center

Allen, Joseph P.; Philliber, Susan

An evaluative study was done of the Teen Outreach Program, a national, multi-site effort to reduce teenage pregnancy, school failure, and dropout. The study sought to identify the critical "active ingredients" of the program responsible for its success. The study was based on analyses of data collected at 114 different sites nationally,…

32 CFR 329.5 - Responsibilities.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) PRIVACY PROGRAM NATIONAL GUARD BUREAU PRIVACY PROGRAM § 329.5 Responsibilities. (a) Chief of the National Guard Bureau...), approves and establishes overall policy, direction, and guidance for the NGB privacy program and...

7 CFR 761.205 - Computing the formula allocation.

Code of Federal Regulations, 2010 CFR

2010-01-01

..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS GENERAL PROGRAM ADMINISTRATION Allocation of Farm Loan Programs... held in the National Office reserve and distributed by base and administrative allocation, multiplied... allocation−national reserve−base allocation−administrative allocation) × State Factor (b) To calculate the...

5 CFR 1312.12 - Security Program Review Committee.

Code of Federal Regulations, 2011 CFR

2011-01-01

... CLASSIFICATION, DOWNGRADING, DECLASSIFICATION AND SAFEGUARDING OF NATIONAL SECURITY INFORMATION Classification and Declassification of National Security Information § 1312.12 Security Program Review Committee. The... 5 Administrative Personnel 3 2011-01-01 2011-01-01 false Security Program Review Committee. 1312...

5 CFR 1312.12 - Security Program Review Committee.

Code of Federal Regulations, 2010 CFR

2010-01-01

... CLASSIFICATION, DOWNGRADING, DECLASSIFICATION AND SAFEGUARDING OF NATIONAL SECURITY INFORMATION Classification and Declassification of National Security Information § 1312.12 Security Program Review Committee. The... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Security Program Review Committee. 1312...

42 CFR 68a.9 - What loans qualify for repayment?

Code of Federal Regulations, 2012 CFR

2012-10-01

..., INTERNSHIPS, TRAINING NATIONAL INSTITUTES OF HEALTH (NIH) CLINICAL RESEARCH LOAN REPAYMENT PROGRAM FOR... Service Award Program, Public Health and National Health Service Corps Scholarship Training Program... and commercial educational loans obtained by participants for the following: (1) Undergraduate...

42 CFR 68a.9 - What loans qualify for repayment?

Code of Federal Regulations, 2011 CFR

2011-10-01

..., INTERNSHIPS, TRAINING NATIONAL INSTITUTES OF HEALTH (NIH) CLINICAL RESEARCH LOAN REPAYMENT PROGRAM FOR... Service Award Program, Public Health and National Health Service Corps Scholarship Training Program... and commercial educational loans obtained by participants for the following: (1) Undergraduate...

44 CFR 78.1 - Purpose.

Code of Federal Regulations, 2013 CFR

2013-10-01

... INSURANCE AND HAZARD MITIGATION National Flood Insurance Program FLOOD MITIGATION ASSISTANCE § 78.1 Purpose... of the Flood Mitigation Assistance (FMA) program, authorized by Sections 1366 and 1367 of the... eliminate claims under the National Flood Insurance Program (NFIP) through mitigation activities. The...

44 CFR 78.1 - Purpose.

Code of Federal Regulations, 2014 CFR

2014-10-01

... INSURANCE AND HAZARD MITIGATION National Flood Insurance Program FLOOD MITIGATION ASSISTANCE § 78.1 Purpose... of the Flood Mitigation Assistance (FMA) program, authorized by Sections 1366 and 1367 of the... eliminate claims under the National Flood Insurance Program (NFIP) through mitigation activities. The...

44 CFR 78.1 - Purpose.

Code of Federal Regulations, 2012 CFR

2012-10-01

... INSURANCE AND HAZARD MITIGATION National Flood Insurance Program FLOOD MITIGATION ASSISTANCE § 78.1 Purpose... of the Flood Mitigation Assistance (FMA) program, authorized by Sections 1366 and 1367 of the... eliminate claims under the National Flood Insurance Program (NFIP) through mitigation activities. The...