Sample records for prokaryotic 5s ribonucleic

  1. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.


    MacKay, R M; Gray, M W; Doolittle, W F


    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  2. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.


    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  3. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B


    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  4. Diversity of 5S rRNA genes within individual prokaryotic genomes.


    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng


    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  5. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.


    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling


    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  6. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.


    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling


    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps.

  7. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.


    Smith, B A; Dworkin, M


    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  8. Ribonucleic Acid Polymerase in Allomyces arbuscula

    PubMed Central

    Cain, Alice K.; Nester, Eugene W.


    Three distinct species of ribonucleic acid (RNA) polymerase were resolved from Allomyces arbuscula by diethylaminoethyl-cellulose chromatography and characterized as to ionic strength and divalent cation preference. α-Amanitin specifically inhibited enzyme II; neither rifampin nor cycloheximide had any effect on the three enzymes. RNA polymerase was isolated from three stages of the diploid life cycle: the hyphal growth stage, mycelia in the process of forming sporangia, and the mitospores. The same three enzyme species could be resolved from each stage. Thus, there is no evidence from this work that RNA polymerase plays a major role in the control of development. PMID:4728272

  9. Ribonucleic acid interference induced gene knockdown

    PubMed Central

    Gottumukkala, Sruthima N. V. S.; Dwarakanath, C. D.; Sudarsan, Sabitha


    Despite major advances in periodontal regeneration over the past three decades, complete regeneration of the lost periodontium on a regular and predictable basis in humans has still remained elusive. The identification of stem cells in the periodontal ligament together with the growing concept of tissue engineering has opened new vistas in periodontal regenerative medicine. In this regard, ribonucleic acid interference (RNAi) opens a new gate way for a novel RNA based approach in periodontal management. This paper aims to summarize the current opinion on the mechanisms underlying RNAi, in vitro and in vivo existing applications in the dental research, which could lead to their future use in periodontal regeneration. PMID:24174717

  10. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.


    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  11. Evolution of prokaryote and eukaryote lines inferred from sequence evidence

    NASA Technical Reports Server (NTRS)

    Hunt, L. T.; George, D. G.; Yeh, L.-S.; Dayhoff, M. O.


    This paper describes the evolution of prokaryotes and early eukaryotes, including their symbiotic relationships, as inferred from phylogenetic trees of bacterial ferredoxin, 5S ribosomal RNA, ribulose-1,5-biphosphate carboxylase large chain, and mitochondrial cytochrome oxidase polypeptide II.

  12. Control of dihydrofolate reductase messenger ribonucleic acid production

    SciTech Connect

    Leys, E.J.; Kellems, R.E.


    The authors used methotrexate-resistant mouse cells in which dihydrofolate reductase levels are approximately 500 times normal to study the effect of growth stimulation on dihydrofolate reductase gene expression. As a result of growth stimulation, the relative rate of dihydrofolate reductase protein synthesis increased threefold, reaching a maximum between 25 and 30 h after stimulation. The relative rate of dihydrofolate reductase messenger ribonucleic acid production (i.e., the appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm) increased threefold after growth stimulation and was accompanied by a corresponding increase in the relative steady-state level of dihydrofolate reductase ribonucleic acid in the nucleus. However, the increase in the nuclear level of dihydrofolate reductase ribonucleic acid was not accompanied by a significant increase in the relative rate of transcription of the dihydrofolate reductase genes. These data indicated that the relative rate of appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm depends on the relative stability of the dihydrofolate reductase ribonucleic acid sequences in the nucleus and is not dependent on the relative rate of transcription of the dihydrofolate reductase genes.

  13. Ribonucleic acid (RNA) biosynthesis in human cancer.


    Hajjawi, Omar S


    In many respects, the most remarkable chemical substances within the genome of eukaryotic cells are remarkable proteins which are the critical structural and functional units of living cells. The specifications for everything that goes in the cell are natural digital-to-digital decoding process in an archive sequence by deoxyribonucleic acid (DNA) and an articulate construction by ribonucleic acid (RNA). The products of DNA transcription are long polymers of ribonucleotides rather than deoxyribonucleotides and are termed ribonucleic acids. Certain deoxyribonucleotide sequences, or genes, give rise to transfer RNA (tRNA) and other ribosomal RNA (rRNA) when transcribed. The ribonucleotide sequences fold extensively and rRNA is associated with specific proteins to yield the essential cell components, ribosomes. Transcription of other special sequences yields messenger RNAs (mRNAs) that contain ribonucleotide sequences that will be ultimately translated into new types of amino acid sequences of functional cellular protein molecules. This switch to a different variety of cellular molecular sequences is complex, but each sequence of the three ribonucleotides specifies the insertion of one particular amino acid into the polypeptide chain under production. Whilst mRNA is considered the vehicle by which genetic information is transmitted from the genome and allocated in the appropriate cytoplasmic sites for translation into protein via cap-dependent mechanism, the actual translation depends also on the presence of other so-called household and luxury protein molecules. Recent evidence suggests RNA species are required at initiation, because treatment of cells with antibiotics or drugs that inhibit RNA synthesis cause a decrease in protein synthesis. The rRNA is necessary as a structural constituent of the ribosomes upon which translation takes place, whereas tRNA is necessary as an adaptor in amino acid activation and elongation protein chains to ribosomes. In this article

  14. The precarious prokaryotic chromosome.


    Kuzminov, Andrei


    Evolutionary selection for optimal genome preservation, replication, and expression should yield similar chromosome organizations in any type of cells. And yet, the chromosome organization is surprisingly different between eukaryotes and prokaryotes. The nuclear versus cytoplasmic accommodation of genetic material accounts for the distinct eukaryotic and prokaryotic modes of genome evolution, but it falls short of explaining the differences in the chromosome organization. I propose that the two distinct ways to organize chromosomes are driven by the differences between the global-consecutive chromosome cycle of eukaryotes and the local-concurrent chromosome cycle of prokaryotes. Specifically, progressive chromosome segregation in prokaryotes demands a single duplicon per chromosome, while other "precarious" features of the prokaryotic chromosomes can be viewed as compensations for this severe restriction.

  15. Bioinformatics of prokaryotic RNAs.


    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F


    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes.

  16. Bioinformatics of prokaryotic RNAs

    PubMed Central

    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F


    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  17. Bioinformatics of prokaryotic RNAs.


    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F


    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  18. Inhibition of Influenza Virus Ribonucleic Acid Polymerase by Ribavirin Triphosphate

    PubMed Central

    Eriksson, Bertil; Helgstrand, Erik; Johansson, Nils Gunnar; Larsson, Alf; Misiorny, Alfons; Noren, Jan Olof; Philipson, Lennart; Stenberg, Kjell; Stening, Goran; Stridh, Stig; Öberg, Bo


    Ribavirin 5′-triphosphate (RTP), derived from the broad-spectrum antiviral compound ribavirin (Virazole), can selectively inhibit influenza virus ribonucleic acid polymerase in a cell-free assay. Ribavirin and its 5′-monophosphate have no effect on the polymerase. The inhibition is competitive with respect to adenosine 5′-triphosphate and guanosine 5′-triphosphate. RTP also inhibits ApG- and GpC-stimulated influenza virus ribonucleic acid polymerase. Since ribavirin is phosphorylated in the cell, the inhibition of influenza multiplication in the cell may also be caused by RTP. PMID:879760

  19. Saliva of Lygus lineolaris digests double stranded ribonucleic acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The prospects for development of highly specific pesticides based on double stranded ribonucleic acid have been a recent focus of scientific research. Creative applications have been proposed and demonstrated. However, not all insects are sensitive to double stranded RNA (dsRNA) gene knockdown effec...

  20. Towards the elements of successful insect Ribonucleic acid interference (RNAi)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that ...

  1. Ecology of prokaryotic viruses.


    Weinbauer, Markus G


    The finding that total viral abundance is higher than total prokaryotic abundance and that a significant fraction of the prokaryotic community is infected with phages in aquatic systems has stimulated research on the ecology of prokaryotic viruses and their role in ecosystems. This review treats the ecology of prokaryotic viruses ('phages') in marine, freshwater and soil systems from a 'virus point of view'. The abundance of viruses varies strongly in different environments and is related to bacterial abundance or activity suggesting that the majority of the viruses found in the environment are typically phages. Data on phage diversity are sparse but indicate that phages are extremely diverse in natural systems. Lytic phages are predators of prokaryotes, whereas lysogenic and chronic infections represent a parasitic interaction. Some forms of lysogeny might be described best as mutualism. The little existing ecological data on phage populations indicate a large variety of environmental niches and survival strategies. The host cell is the main resource for phages and the resource quality, i.e., the metabolic state of the host cell, is a critical factor in all steps of the phage life cycle. Virus-induced mortality of prokaryotes varies strongly on a temporal and spatial scale and shows that phages can be important predators of bacterioplankton. This mortality and the release of cell lysis products into the environment can strongly influence microbial food web processes and biogeochemical cycles. Phages can also affect host diversity, e.g., by 'killing the winner' and keeping in check competitively dominant species or populations. Moreover, they mediate gene transfer between prokaryotes, but this remains largely unknown in the environment. Genomics or proteomics are providing us now with powerful tools in phage ecology, but final testing will have to be performed in the environment. PMID:15109783

  2. Ecology of prokaryotic viruses.


    Weinbauer, Markus G


    The finding that total viral abundance is higher than total prokaryotic abundance and that a significant fraction of the prokaryotic community is infected with phages in aquatic systems has stimulated research on the ecology of prokaryotic viruses and their role in ecosystems. This review treats the ecology of prokaryotic viruses ('phages') in marine, freshwater and soil systems from a 'virus point of view'. The abundance of viruses varies strongly in different environments and is related to bacterial abundance or activity suggesting that the majority of the viruses found in the environment are typically phages. Data on phage diversity are sparse but indicate that phages are extremely diverse in natural systems. Lytic phages are predators of prokaryotes, whereas lysogenic and chronic infections represent a parasitic interaction. Some forms of lysogeny might be described best as mutualism. The little existing ecological data on phage populations indicate a large variety of environmental niches and survival strategies. The host cell is the main resource for phages and the resource quality, i.e., the metabolic state of the host cell, is a critical factor in all steps of the phage life cycle. Virus-induced mortality of prokaryotes varies strongly on a temporal and spatial scale and shows that phages can be important predators of bacterioplankton. This mortality and the release of cell lysis products into the environment can strongly influence microbial food web processes and biogeochemical cycles. Phages can also affect host diversity, e.g., by 'killing the winner' and keeping in check competitively dominant species or populations. Moreover, they mediate gene transfer between prokaryotes, but this remains largely unknown in the environment. Genomics or proteomics are providing us now with powerful tools in phage ecology, but final testing will have to be performed in the environment.

  3. Prokaryote and eukaryote evolvability.


    Poole, Anthony M; Phillips, Matthew J; Penny, David


    The concept of evolvability covers a broad spectrum of, often contradictory, ideas. At one end of the spectrum it is equivalent to the statement that evolution is possible, at the other end are untestable post hoc explanations, such as the suggestion that current evolutionary theory cannot explain the evolution of evolvability. We examine similarities and differences in eukaryote and prokaryote evolvability, and look for explanations that are compatible with a wide range of observations. Differences in genome organisation between eukaryotes and prokaryotes meets this criterion. The single origin of replication in prokaryote chromosomes (versus multiple origins in eukaryotes) accounts for many differences because the time to replicate a prokaryote genome limits its size (and the accumulation of junk DNA). Both prokaryotes and eukaryotes appear to switch from genetic stability to genetic change in response to stress. We examine a range of stress responses, and discuss how these impact on evolvability, particularly in unicellular organisms versus complex multicellular ones. Evolvability is also limited by environmental interactions (including competition) and we describe a model that places limits on potential evolvability. Examples are given of its application to predator competition and limits to lateral gene transfer. We suggest that unicellular organisms evolve largely through a process of metabolic change, resulting in biochemical diversity. Multicellular organisms evolve largely through morphological changes, not through extensive changes to cellular biochemistry. PMID:12689728

  4. Chaperoning 5S RNA assembly.


    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas


    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  5. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas


    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  6. Cell biology of prokaryotic organelles.


    Murat, Dorothee; Byrne, Meghan; Komeili, Arash


    Mounting evidence in recent years has challenged the dogma that prokaryotes are simple and undefined cells devoid of an organized subcellular architecture. In fact, proteins once thought to be the purely eukaryotic inventions, including relatives of actin and tubulin control prokaryotic cell shape, DNA segregation, and cytokinesis. Similarly, compartmentalization, commonly noted as a distinguishing feature of eukaryotic cells, is also prevalent in the prokaryotic world in the form of protein-bounded and lipid-bounded organelles. In this article we highlight some of these prokaryotic organelles and discuss the current knowledge on their ultrastructure and the molecular mechanisms of their biogenesis and maintenance.

  7. Thiol biochemistry of prokaryotes

    NASA Technical Reports Server (NTRS)

    Fahey, Robert C.


    The present studies have shown that GSH metabolism arose in the purple bacteria and cyanobacteria where it functions to protect against oxygen toxicity. Evidence was obtained indicating that GSH metabolism was incorporated into eucaryotes via the endosymbiosis giving rise to mitochrondria and chloroplasts. Aerobic bacteria lacking GSH utilize other thiols for apparently similar functions, the thiol being coenzyme A in Gram positive bacteria and chi-glutamylcysteine in the halobacteria. The thiol biochemistry of prokaryotes is thus seen to be much more highly diversified than that of eucaryotes and much remains to be learned about this subject.

  8. Do prokaryotes contain microtubules?

    NASA Technical Reports Server (NTRS)

    Bermudes, D.; Hinkle, G.; Margulis, L.


    In eukaryotic cells, microtubules are 24-nm-diameter tubular structures composed of a class of conserved proteins called tubulin. They are involved in numerous cell functions including ciliary motility, nerve cell elongation, pigment migration, centrosome formation, and chromosome movement. Although cytoplasmic tubules and fibers have been observed in bacteria, some with diameters similar to those of eukaryotes, no homologies to eukaryotic microtubules have been established. Certain groups of bacteria including azotobacters, cyanobacteria, enteric bacteria, and spirochetes have been frequently observed to possess microtubule-like structures, and others, including archaebacteria, have been shown to be sensitive to drugs that inhibit the polymerization of microtubules. Although little biochemical or molecular biological information is available, the differences observed among these prokaryotic structures suggest that their composition generally differs among themselves as well as from that of eukaryotes. We review the distribution of cytoplasmic tubules in prokaryotes, even though, in all cases, their functions remain unknown. At least some tend to occur in cells that are large, elongate, and motile, suggesting that they may be involved in cytoskeletal functions, intracellular motility, or transport activities comparable to those performed by eukaryotic microtubules. In Escherichia coli, the FtsZ protein is associated with the formation of a ring in the division zone between the newly forming offspring cells. Like tubulin, FtsZ is a GTPase and shares with tubulin a 7-amino-acid motif, making it a promising candidate in which to seek the origin of tubulins.

  9. Promoter propagation in prokaryotes

    PubMed Central

    Matus-Garcia, Mariana; Nijveen, Harm; van Passel, Mark W. J.


    Transcriptional activation or ‘rewiring’ of silent genes is an important, yet poorly understood, phenomenon in prokaryotic genomes. Anecdotal evidence coming from experimental evolution studies in bacterial systems has shown the promptness of adaptation upon appropriate selective pressure. In many cases, a partial or complete promoter is mobilized to silent genes from elsewhere in the genome. We term hereafter such recruited regulatory sequences as Putative Mobile Promoters (PMPs) and we hypothesize they have a large impact on rapid adaptation of novel or cryptic functions. Querying all publicly available prokaryotic genomes (1362) uncovered >4000 families of highly conserved PMPs (50 to 100 long with ≥80% nt identity) in 1043 genomes from 424 different genera. The genomes with the largest number of PMP families are Anabaena variabilis (28 families), Geobacter uraniireducens (27 families) and Cyanothece PCC7424 (25 families). Family size varied from 2 to 93 homologous promoters (in Desulfurivibrio alkaliphilus). Some PMPs are present in particular species, but some are conserved across distant genera. The identified PMPs represent a conservative dataset of very recent or conserved events of mobilization of non-coding DNA and thus they constitute evidence of an extensive reservoir of recyclable regulatory sequences for rapid transcriptional rewiring. PMID:22933716

  10. Do prokaryotes contain microtubules?

    PubMed Central

    Bermudes, D; Hinkle, G; Margulis, L


    In eukaryotic cells, microtubules are 24-nm-diameter tubular structures composed of a class of conserved proteins called tubulin. They are involved in numerous cell functions including ciliary motility, nerve cell elongation, pigment migration, centrosome formation, and chromosome movement. Although cytoplasmic tubules and fibers have been observed in bacteria, some with diameters similar to those of eukaryotes, no homologies to eukaryotic microtubules have been established. Certain groups of bacteria including azotobacters, cyanobacteria, enteric bacteria, and spirochetes have been frequently observed to possess microtubule-like structures, and others, including archaebacteria, have been shown to be sensitive to drugs that inhibit the polymerization of microtubules. Although little biochemical or molecular biological information is available, the differences observed among these prokaryotic structures suggest that their composition generally differs among themselves as well as from that of eukaryotes. We review the distribution of cytoplasmic tubules in prokaryotes, even though, in all cases, their functions remain unknown. At least some tend to occur in cells that are large, elongate, and motile, suggesting that they may be involved in cytoskeletal functions, intracellular motility, or transport activities comparable to those performed by eukaryotic microtubules. In Escherichia coli, the FtsZ protein is associated with the formation of a ring in the division zone between the newly forming offspring cells. Like tubulin, FtsZ is a GTPase and shares with tubulin a 7-amino-acid motif, making it a promising candidate in which to seek the origin of tubulins. Images PMID:7968920

  11. Effect of growth rate on the amounts of ribosomal and transfer ribonucleic acids in yeast.

    PubMed Central

    Waldron, C; Lacroute, F


    The steady-state growth rate of Saccharomyces cerevisiae was varied by growing the cells in different media. The total amount of ribonucleic acid (RNA) per cell was found to decrease as a nonlinear function of decreasing growh rate. The RNA from cells growing in different media was analyzed by polyacrylamide gel electrophoresis. Although the amounts of both ribosomal RNA and transfer RNA decreased with decreasing growth rate, the ratio of ribosomal to transfer RNA was not constant. As the growth rate was reduced the ribosomal RNA fraction decreased slightly, whereas the transfer RNA fraction increased slightly. Thus the levels of ribosomal and transfer RNA were regulated to similar yet different extents. The levels of the different ribosomal RNA species were more closely coordinated. At all growth rates the ribosomal RNAs (including 5S RNA) were present in equimolar amounts. The rate of protein synthesis in yeast cells also decreased with decreasing growth rate. The low rates of protein synthesis did not appear to be due to limiting numbers of ribosomes or transfer RNA molecules. PMID:1097403

  12. Rate of ribonucleic acid chain growth in Mycobacterium tuberculosis H37Rv.

    PubMed Central

    Harshey, R M; Ramakrishnan, T


    Two methods were employed to measure the rate of ribonucleic acid (RNA) chain growth in vivo in Mycobacterium tuberculosis H37Rv cultures growing in Sauton medium at 37 degrees C, with a generation time of 10 h. In the first, the bacteria were allowed to assimilate [3H]uracil or [3H]guanine into their RNA for short time periods. The RNA was then extracted and hydrolyzed with alkali, and the radioactivity in the resulting nucleotides and nucleosides was measured. The data obtained by this method allowed the calculation of the individual nucleotide step times during the growth of RNA chains, from which the average rate of RNA chain elongation was estimated to be about 4 nucleotides per s. The second method employed the antibiotic rifampin, which specifically inhibits the initiation of RNA synthesis without interfering with the elongation and completion of nascent RNA chains. Usint this method, the transcription time of the 16S, 23S, and 5S ribosomal RNA genes was estimated to be 7.6 min, which corresponds to a ribosomal RNA chain growth rate of 10 nucleotides per s. PMID:402354

  13. Desiccation tolerance of prokaryotes.

    PubMed Central

    Potts, M


    The removal of cell-bound water through air drying and the addition of water to air-dried cells are forces that have played a pivotal role in the evolution of the prokaryotes. In bacterial cells that have been subjected to air drying, the evaporation of free cytoplasmic water (Vf) can be instantaneous, and an equilibrium between cell-bound water (Vb) and the environmental water (vapor) potential (psi wv) may be achieved rapidly. In the air-dried state some bacteria survive only for seconds whereas others can tolerate desiccation for thousands, perhaps millions, of years. The desiccated (anhydrobiotic) cell is characterized by its singular lack of water--with contents as low as 0.02 g of H2O g (dry weight)-1. At these levels the monolayer coverage by water of macromolecules, including DNA and proteins, is disturbed. As a consequence the mechanisms that confer desiccation tolerance upon air-dried bacteria are markedly different from those, such as the mechanism of preferential exclusion of compatible solutes, that preserve the integrity of salt-, osmotically, and freeze-thaw-stressed cells. Desiccation tolerance reflects a complex array of interactions at the structural, physiological, and molecular levels. Many of the mechanisms remain cryptic, but it is clear that they involve interactions, such as those between proteins and co-solvents, that derive from the unique properties of the water molecule. A water replacement hypothesis accounts for how the nonreducing disaccharides trehalose and sucrose preserve the integrity of membranes and proteins. Nevertheless, we have virtually no insight into the state of the cytoplasm of an air-dried cell. There is no evidence for any obvious adaptations of proteins that can counter the effects of air drying or for the occurrence of any proteins that provide a direct and a tangible contribution to cell stability. Among the prokaryotes that can exist as anhydrobiotic cells, the cyanobacteria have a marked capacity to do so. One

  14. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.


    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  15. The chromosome cycle of prokaryotes.


    Kuzminov, Andrei


    In both eukaryotes and prokaryotes, chromosomal DNA undergoes replication, condensation-decondensation and segregation, sequentially, in some fixed order. Other conditions, like sister-chromatid cohesion (SCC), may span several chromosomal events. One set of these chromosomal transactions within a single cell cycle constitutes the 'chromosome cycle'. For many years it was generally assumed that the prokaryotic chromosome cycle follows major phases of the eukaryotic one: -replication-condensation-segregation-(cell division)-decondensation-, with SCC of unspecified length. Eventually it became evident that, in contrast to the strictly consecutive chromosome cycle of eukaryotes, all stages of the prokaryotic chromosome cycle run concurrently. Thus, prokaryotes practice 'progressive' chromosome segregation separated from replication by a brief SCC, and all three transactions move along the chromosome at the same fast rate. In other words, in addition to replication forks, there are 'segregation forks' in prokaryotic chromosomes. Moreover, the bulk of prokaryotic DNA outside the replication-segregation transition stays compacted. I consider possible origins of this concurrent replication-segregation and outline the 'nucleoid administration' system that organizes the dynamic part of the prokaryotic chromosome cycle.

  16. Evolution of small prokaryotic genomes

    PubMed Central

    Martínez-Cano, David J.; Reyes-Prieto, Mariana; Martínez-Romero, Esperanza; Partida-Martínez, Laila P.; Latorre, Amparo; Moya, Andrés; Delaye, Luis


    As revealed by genome sequencing, the biology of prokaryotes with reduced genomes is strikingly diverse. These include free-living prokaryotes with ∼800 genes as well as endosymbiotic bacteria with as few as ∼140 genes. Comparative genomics is revealing the evolutionary mechanisms that led to these small genomes. In the case of free-living prokaryotes, natural selection directly favored genome reduction, while in the case of endosymbiotic prokaryotes neutral processes played a more prominent role. However, new experimental data suggest that selective processes may be at operation as well for endosymbiotic prokaryotes at least during the first stages of genome reduction. Endosymbiotic prokaryotes have evolved diverse strategies for living with reduced gene sets inside a host-defined medium. These include utilization of host-encoded functions (some of them coded by genes acquired by gene transfer from the endosymbiont and/or other bacteria); metabolic complementation between co-symbionts; and forming consortiums with other bacteria within the host. Recent genome sequencing projects of intracellular mutualistic bacteria showed that previously believed universal evolutionary trends like reduced G+C content and conservation of genome synteny are not always present in highly reduced genomes. Finally, the simplified molecular machinery of some of these organisms with small genomes may be used to aid in the design of artificial minimal cells. Here we review recent genomic discoveries of the biology of prokaryotes endowed with small gene sets and discuss the evolutionary mechanisms that have been proposed to explain their peculiar nature. PMID:25610432

  17. Structure of the Ribonucleic Acid Bacteriophage R17

    PubMed Central

    Vasquez, Cesar; Granboulan, Nicole; Franklin, Richard M.


    Vasquez, Cesar (Institut de Recherches sur le Cancer, Villejuif, Seine, France), Nicole Granboulan, and Richard M. Franklin. Structure of the ribonucleic acid bacteriophage R17. J. Bacteriol. 92:1779–1786. 1966.—The morphology of bacteriophage R17 was studied by electron microscopy of negatively stained virions. The hexagonal shape, the presence of a maximum of 10 units at the periphery, and especially the observation of central fivefold points of symmetry with neighboring five and six coordinated units indicated icosahedral symmetry with 32 morphological units. Although the exact shape of the polyhedron could not be specified, the number of morphological units agreed with the chemically estimated number of structural units. Images PMID:5958109

  18. Isolation and Characterization of Simian Virus 40 Ribonucleic Acid

    PubMed Central

    Weinberg, R. A.; Warnaar, S. O.; Winocour, E.


    Deoxyribonucleic acid-ribonucleic acid (RNA) hybridization in formamide was used to isolate simian virus 40-specific RNA. Early in the lytic cycle, a 19S viral RNA species was observed. Late in the lytic cycle, 16S and 19S viral species were found. The 16S and 19S species of viral RNA were localized in the cytoplasm. High-molecular-weight heterogeneous RNA, containing viral sequences, was isolated from the nuclear fraction of infected cells late in the lytic cycle. This RNA may contain non-viral sequences linked to viral sequences. The formamide hybridization technique can be used to isolate intact late lytic viral RNA which is at least 99% pure. PMID:4342237

  19. Effect of Bacteriophage R17 Infection on Hostdirected Synthesis of Ribosomal Ribonucleates

    PubMed Central

    Hudson, James B.; Paranchych, William


    Studies were performed on the synthesis of ribosomal ribonucleates in cells of Escherichia coli K-12 infected by the ribonucleic acid (RNA) bacteriophage R17. Host-specific RNA was measured in the presence of phage RNA by in vitro hybridization of the purified ribonucleates with E. coli deoxyribonucleic acid. The results showed that, although the overall rate of RNA synthesis was only slightly affected by phage infection, the level of host RNA synthesis was decreased by 70 to 80%. Fractionation of the purified ribonucleates by sucrose gradient sedimentation, followed by hybridization of fractions sedimenting in the 23S and 16S regions, revealed that the level of ribosomal RNA synthesis was also decreased by 70 to 80%, and that this inhibition occurred during the first 15 to 20 min after infection. These findings are discussed in light of what is known about the inhibition of host RNA synthesis by other virus systems. PMID:4918239

  20. Ribonucleic acid interference (RNAi) Technology for control of Asian citrus psyllid - You Tube

    Technology Transfer Automated Retrieval System (TEKTRAN)

    RNAi, Ribonucleic acid interference, function and application are described to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry....

  1. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G


    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  2. Environmental distribution of prokaryotic taxa

    PubMed Central


    Background The increasing availability of gene sequences of prokaryotic species in samples extracted from all kind of locations allows addressing the study of the influence of environmental patterns in prokaryotic biodiversity. We present a comprehensive study to address the potential existence of environmental preferences of prokaryotic taxa and the commonness of the specialist and generalist strategies. We also assessed the most significant environmental factors shaping the environmental distribution of taxa. Results We used 16S rDNA sequences from 3,502 sampling experiments in natural and artificial sources. These sequences were taxonomically assigned, and the corresponding samples were also classified into a hierarchical classification of environments. We used several statistical methods to analyze the environmental distribution of taxa. Our results indicate that environmental specificity is not very common at the higher taxonomic levels (phylum to family), but emerges at lower taxonomic levels (genus and species). The most selective environmental characteristics are those of animal tissues and thermal locations. Salinity is another very important factor for constraining prokaryotic diversity. On the other hand, soil and freshwater habitats are the less restrictive environments, harboring the largest number of prokaryotic taxa. All information on taxa, samples and environments is provided at the envDB online database, Conclusions This is, as far as we know, the most comprehensive assessment of the distribution and diversity of prokaryotic taxa and their associations with different environments. Our data indicate that we are still far from characterizing prokaryotic diversity in any environment, except, perhaps, for human tissues such as the oral cavity and the vagina. PMID:20307274

  3. Interaction of neomycin with ribosomes and ribosomal ribonucleic acid.


    Dahlberg, A E; Horodyski, F; Keller, P


    Neomycin binds ribosomes and ribosomal ribonucleic acid (rRNA) in vivo and in vitro producing changes detectable by increases in gel electrophoretic mobility. These changes were observed in gels that contain ethylenediaminetetraacetic acid or no added magnesium ion. The progressive increase in gel electrophoretic mobility with increasing antibiotic concentrations suggests that neomycin is binding at multiple sites on RNA. The binding was reversible but sufficiently stable to survive dialysis and electrophoresis. It is proposed that bound neomycin stabilizes the ribosome and RNA structures, restricting the unfolding of the particles during electrophoresis and thus allowing for a more rapid migration in the gel. Gentamicin produced an effect similar to that of neomycin. Paromomycin, differing from neomycin by only one amino group, had considerably less effect on ribosome and rRNA mobilities. The binding of neomycin to rRNA improved the linearity of the plot of log molecular weight versus mobility and thus may be of benefit in providing a more accurate estimation of molecular weights of large RNAs.

  4. Ribonucleic Acid Polymerases of the Yeast Phase of Histoplasma capsulatum

    PubMed Central

    Boguslawski, George; Schlessinger, David; Medoff, Gerald; Kobayashi, George


    Ribonucleic acid (RNA) polymerases of Histoplasma capsulatum (yeast phase) were fractionated by phosphocellulose chromatography and partially characterized. Three distinct, active fractions were seen. The major RNA polymerase species was inhibited strongly by α-amanitin, whereas the other two were resistant. When either slightly purified (HSE) extract or the major active component was assayed at 37 C, the incorporation of tritiated uridine monophosphate into RNA stopped after 10 to 15 min. In contrast, the synthesis continued for at least 1 h at 23 C. The other two RNA polymerase species exhibited higher rates of incorporation when tested at 37 C, and continued to synthesize RNA even after 60 min. However, by that time the levels of incorporation at 23 C were higher than at 37 C for all three enzymes. The temperature sensitivity was not affected by changing substrate concentration or employing either native or denatured calf thymus deoxyribonucleic acid as a template. These results are compared with the data obtained with RNA polymerases from different fungi and other organisms. A possible involvement of RNA polymerase(s) in morphological differentiation of H. capsulatum is discussed. PMID:4828308

  5. Capturing prokaryotic dark matter genomes.


    Gasc, Cyrielle; Ribière, Céline; Parisot, Nicolas; Beugnot, Réjane; Defois, Clémence; Petit-Biderre, Corinne; Boucher, Delphine; Peyretaillade, Eric; Peyret, Pierre


    Prokaryotes are the most diverse and abundant cellular life forms on Earth. Most of them, identified by indirect molecular approaches, belong to microbial dark matter. The advent of metagenomic and single-cell genomic approaches has highlighted the metabolic capabilities of numerous members of this dark matter through genome reconstruction. Thus, linking functions back to the species has revolutionized our understanding of how ecosystem function is sustained by the microbial world. This review will present discoveries acquired through the illumination of prokaryotic dark matter genomes by these innovative approaches.

  6. Capturing prokaryotic dark matter genomes.


    Gasc, Cyrielle; Ribière, Céline; Parisot, Nicolas; Beugnot, Réjane; Defois, Clémence; Petit-Biderre, Corinne; Boucher, Delphine; Peyretaillade, Eric; Peyret, Pierre


    Prokaryotes are the most diverse and abundant cellular life forms on Earth. Most of them, identified by indirect molecular approaches, belong to microbial dark matter. The advent of metagenomic and single-cell genomic approaches has highlighted the metabolic capabilities of numerous members of this dark matter through genome reconstruction. Thus, linking functions back to the species has revolutionized our understanding of how ecosystem function is sustained by the microbial world. This review will present discoveries acquired through the illumination of prokaryotic dark matter genomes by these innovative approaches. PMID:26100932

  7. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.




    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  8. 5S rRNA and ribosome.


    Gongadze, G M


    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  9. Inactivation of Encephalomyocarditis Virus in Aerosols: Fate of Virus Protein and Ribonucleic Acid

    PubMed Central

    De Jong, J. C.; Harmsen, M.; Trouwborst, T.; Winkler, K. C.


    After aerosolization at relative humidities of 50% or lower, encephalomyocarditis virus is rapidly inactivated. In this process the protein coat of the virion is damaged. This appears as a loss of hemagglutination activity and loss of affinity for hemagglutination inhibiting antibodies. The ribonucleic acid of the virus retains its infectivity but it becomes susceptible to ribonuclease. It sediments in sucrose gradients when centrifuged at high speed with the same velocity as free infectious ribonucleic acid extracted with phenol from intact encephalomyocarditis virus. PMID:4358862

  10. The 5S genes of Drosophila melanogaster.


    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J


    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  11. Compartmentalization of prokaryotic DNA replication.


    Bravo, Alicia; Serrano-Heras, Gemma; Salas, Margarita


    It becomes now apparent that prokaryotic DNA replication takes place at specific intracellular locations. Early studies indicated that chromosomal DNA replication, as well as plasmid and viral DNA replication, occurs in close association with the bacterial membrane. Moreover, over the last several years, it has been shown that some replication proteins and specific DNA sequences are localized to particular subcellular regions in bacteria, supporting the existence of replication compartments. Although the mechanisms underlying compartmentalization of prokaryotic DNA replication are largely unknown, the docking of replication factors to large organizing structures may be important for the assembly of active replication complexes. In this article, we review the current state of this subject in two bacterial species, Escherichia coli and Bacillus subtilis, focusing our attention in both chromosomal and extrachromosomal DNA replication. A comparison with eukaryotic systems is also presented.

  12. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.


    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  13. Carbon cycling: the prokaryotic contribution.


    Shively, J M; English, R S; Baker, S H; Cannon, G C


    Although the debate continues, the concept of global warming as a consequence of the increased production of 'greenhouse gases' via human activities is now widely accepted. The role of microbes, especially the prokaryotes, in the formation, trapping and retention of 'greenhouse gases' has, for the most part, been overlooked. The future requires that we pay close attention to these organisms for possible solutions to adverse global changes.

  14. The Epigenomic Landscape of Prokaryotes.


    Blow, Matthew J; Clark, Tyson A; Daum, Chris G; Deutschbauer, Adam M; Fomenkov, Alexey; Fries, Roxanne; Froula, Jeff; Kang, Dongwan D; Malmstrom, Rex R; Morgan, Richard D; Posfai, Janos; Singh, Kanwar; Visel, Axel; Wetmore, Kelly; Zhao, Zhiying; Rubin, Edward M; Korlach, Jonas; Pennacchio, Len A; Roberts, Richard J


    DNA methylation acts in concert with restriction enzymes to protect the integrity of prokaryotic genomes. Studies in a limited number of organisms suggest that methylation also contributes to prokaryotic genome regulation, but the prevalence and properties of such non-restriction-associated methylation systems remain poorly understood. Here, we used single molecule, real-time sequencing to map DNA modifications including m6A, m4C, and m5C across the genomes of 230 diverse bacterial and archaeal species. We observed DNA methylation in nearly all (93%) organisms examined, and identified a total of 834 distinct reproducibly methylated motifs. This data enabled annotation of the DNA binding specificities of 620 DNA Methyltransferases (MTases), doubling known specificities for previously hard to study Type I, IIG and III MTases, and revealing their extraordinary diversity. Strikingly, 48% of organisms harbor active Type II MTases with no apparent cognate restriction enzyme. These active 'orphan' MTases are present in diverse bacterial and archaeal phyla and show motif specificities and methylation patterns consistent with functions in gene regulation and DNA replication. Our results reveal the pervasive presence of DNA methylation throughout the prokaryotic kingdoms, as well as the diversity of sequence specificities and potential functions of DNA methylation systems.

  15. [Progress in proteogenomics of prokaryotes].


    Zhang, Chengpu; Xu, Ping; Zhu, Yunping


    With the rapid development of genome sequencing technologies, a large amount of prokaryote genomes have been sequenced in recent years. To further investigate the models and functions of genomes, the algorithms for genome annotations based on the sequence and homology features have been widely implemented to newly sequenced genomes. However, gene annotations only using the genomic information are prone to errors, such as the incorrect N-terminals and pseudogenes. It is even harder to provide reasonable annotating results in the case of the poor genome sequencing results. The transcriptomics based on the technologies such as microarray and RNA-seq and the proteomics based on the MS/MS have been used widely to identify the gene products with high throughput and high sensitivity, providing the powerful tools for the verification and correction of annotated genome. Compared with transcriptomics, proteomics can generate the protein list for the expressed genes in the samples or cells without any confusion of the non-coding RNA, leading the proteogenomics an important basis for the genome annotations in prokaryotes. In this paper, we first described the traditional genome annotation algorithms and pointed out the shortcomings. Then we summarized the advantages of proteomics in the genome annotations and reviewed the progress of proteogenomics in prokaryotes. Finally we discussed the challenges and strategies in the data analyses and potential solutions for the developments of proteogenomics.

  16. Theory of prokaryotic genome evolution

    PubMed Central

    Sela, Itamar; Wolf, Yuri I.; Koonin, Eugene V.


    Bacteria and archaea typically possess small genomes that are tightly packed with protein-coding genes. The compactness of prokaryotic genomes is commonly perceived as evidence of adaptive genome streamlining caused by strong purifying selection in large microbial populations. In such populations, even the small cost incurred by nonfunctional DNA because of extra energy and time expenditure is thought to be sufficient for this extra genetic material to be eliminated by selection. However, contrary to the predictions of this model, there exists a consistent, positive correlation between the strength of selection at the protein sequence level, measured as the ratio of nonsynonymous to synonymous substitution rates, and microbial genome size. Here, by fitting the genome size distributions in multiple groups of prokaryotes to predictions of mathematical models of population evolution, we show that only models in which acquisition of additional genes is, on average, slightly beneficial yield a good fit to genomic data. These results suggest that the number of genes in prokaryotic genomes reflects the equilibrium between the benefit of additional genes that diminishes as the genome grows and deletion bias (i.e., the rate of deletion of genetic material being slightly greater than the rate of acquisition). Thus, new genes acquired by microbial genomes, on average, appear to be adaptive. The tight spacing of protein-coding genes likely results from a combination of the deletion bias and purifying selection that efficiently eliminates nonfunctional, noncoding sequences. PMID:27702904

  17. NCBI prokaryotic genome annotation pipeline.


    Tatusova, Tatiana; DiCuccio, Michael; Badretdin, Azat; Chetvernin, Vyacheslav; Nawrocki, Eric P; Zaslavsky, Leonid; Lomsadze, Alexandre; Pruitt, Kim D; Borodovsky, Mark; Ostell, James


    Recent technological advances have opened unprecedented opportunities for large-scale sequencing and analysis of populations of pathogenic species in disease outbreaks, as well as for large-scale diversity studies aimed at expanding our knowledge across the whole domain of prokaryotes. To meet the challenge of timely interpretation of structure, function and meaning of this vast genetic information, a comprehensive approach to automatic genome annotation is critically needed. In collaboration with Georgia Tech, NCBI has developed a new approach to genome annotation that combines alignment based methods with methods of predicting protein-coding and RNA genes and other functional elements directly from sequence. A new gene finding tool, GeneMarkS+, uses the combined evidence of protein and RNA placement by homology as an initial map of annotation to generate and modify ab initio gene predictions across the whole genome. Thus, the new NCBI's Prokaryotic Genome Annotation Pipeline (PGAP) relies more on sequence similarity when confident comparative data are available, while it relies more on statistical predictions in the absence of external evidence. The pipeline provides a framework for generation and analysis of annotation on the full breadth of prokaryotic taxonomy. For additional information on PGAP see and the NCBI Handbook, PMID:27342282

  18. NCBI prokaryotic genome annotation pipeline.


    Tatusova, Tatiana; DiCuccio, Michael; Badretdin, Azat; Chetvernin, Vyacheslav; Nawrocki, Eric P; Zaslavsky, Leonid; Lomsadze, Alexandre; Pruitt, Kim D; Borodovsky, Mark; Ostell, James


    Recent technological advances have opened unprecedented opportunities for large-scale sequencing and analysis of populations of pathogenic species in disease outbreaks, as well as for large-scale diversity studies aimed at expanding our knowledge across the whole domain of prokaryotes. To meet the challenge of timely interpretation of structure, function and meaning of this vast genetic information, a comprehensive approach to automatic genome annotation is critically needed. In collaboration with Georgia Tech, NCBI has developed a new approach to genome annotation that combines alignment based methods with methods of predicting protein-coding and RNA genes and other functional elements directly from sequence. A new gene finding tool, GeneMarkS+, uses the combined evidence of protein and RNA placement by homology as an initial map of annotation to generate and modify ab initio gene predictions across the whole genome. Thus, the new NCBI's Prokaryotic Genome Annotation Pipeline (PGAP) relies more on sequence similarity when confident comparative data are available, while it relies more on statistical predictions in the absence of external evidence. The pipeline provides a framework for generation and analysis of annotation on the full breadth of prokaryotic taxonomy. For additional information on PGAP see and the NCBI Handbook,

  19. ASM Conference on Prokaryotic Development

    SciTech Connect

    Kaplan, H. B.


    Support was provided by DOE for the 2nd ASM Conference on Prokaryotic Development. The final conference program and abstracts book is attached. The conference presentations are organized around topics that are central to the current research areas in prokaryotic development. The program starts with topics that involve relatively simple models systems and ends with systems that are more complex. The topics are: i) the cell cycle, ii) the cytoskeleton, iii) morphogenesis, iv) developmental transcription, v) signaling, vi) multicellularity, and vii) developmental diversity and symbiosis. The best-studied prokaryotic development model systems will be highlighted at the conference through research presentations by leaders in the field. Many of these systems are also model systems of relevance to the DOE mission including carbon sequestration (Bradyrizobium, Synechococcus), energy production (Anabaena, Rhodobacter) and bioremediation (Caulobacter, Mesorhizobium). In addition, many of the highlighted organisms have important practical applications; the actinomycetes and myxobacteria produce antimicrobials that are of commercial interest. It is certain that the cutting-edge science presented at the conference will be applicable to the large group of bacteria relevant to the DOE mission.

  20. The Epigenomic Landscape of Prokaryotes

    PubMed Central

    Blow, Matthew J.; Clark, Tyson A.; Daum, Chris G.; Deutschbauer, Adam M.; Fomenkov, Alexey; Fries, Roxanne; Froula, Jeff; Kang, Dongwan D.; Malmstrom, Rex R.; Morgan, Richard D.; Posfai, Janos; Singh, Kanwar; Visel, Axel; Wetmore, Kelly; Zhao, Zhiying; Rubin, Edward M.; Korlach, Jonas; Pennacchio, Len A.; Roberts, Richard J.


    DNA methylation acts in concert with restriction enzymes to protect the integrity of prokaryotic genomes. Studies in a limited number of organisms suggest that methylation also contributes to prokaryotic genome regulation, but the prevalence and properties of such non-restriction-associated methylation systems remain poorly understood. Here, we used single molecule, real-time sequencing to map DNA modifications including m6A, m4C, and m5C across the genomes of 230 diverse bacterial and archaeal species. We observed DNA methylation in nearly all (93%) organisms examined, and identified a total of 834 distinct reproducibly methylated motifs. This data enabled annotation of the DNA binding specificities of 620 DNA Methyltransferases (MTases), doubling known specificities for previously hard to study Type I, IIG and III MTases, and revealing their extraordinary diversity. Strikingly, 48% of organisms harbor active Type II MTases with no apparent cognate restriction enzyme. These active ‘orphan’ MTases are present in diverse bacterial and archaeal phyla and show motif specificities and methylation patterns consistent with functions in gene regulation and DNA replication. Our results reveal the pervasive presence of DNA methylation throughout the prokaryotic kingdoms, as well as the diversity of sequence specificities and potential functions of DNA methylation systems. PMID:26870957

  1. Ribonucleic acid synthesis by Escherichia coli C3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of coliphage-ZIK/1 ribonucleic acid.


    Bishop, D H


    1. A method is described for the preparation and purification of the RNA from the RNA coliphage ZIK/1. 2. Some of the physical characteristics and infective properties of coliphage-ZIK/1 RNA were examined. 3. A method is also described for examining the type and quantity of RNA synthesized after bacteriophage infection. 4. Ribosome synthesis was decreased 15min. after bacteriophage adsorption, bacteriophage RNA was synthesized from 15min. to 120min. after adsorption and intracellular bacteriophages appeared 40min. after adsorption. Cell lysis commenced 60min. after adsorption, and was half complete 20min. later and 90-95% complete 120min. after adsorption. 5. Cell division continued until 40min. after bacteriophage adsorption. 6. Bacterial ribosomes were conserved during the infective process. 7. Intracellular bacteriophage RNA has sedimentation coefficient 28s but after cell lysis it has sedimentation coefficient 10-5s.

  2. Characterization of the Subunit Structure of the Ribonucleic Acid Genome of Influenza Virus

    PubMed Central

    Lewandowski, L. J.; Content, J.; Leppla, S. H.


    Ribonucleic acid extracted from influenza virus was labeled at the 3′ termini with 3H and analyzed by polyacrylamide gel electrophoresis. Influenza virus was found to contain a minimum of seven and possibly as many as 10 polynucleotide chains, most of which appear to terminate at the 3′ end in uridine. PMID:4332140

  3. "Anticipated" nucleosome positioning pattern in prokaryotes.


    Rapoport, Alexandra E; Trifonov, Edward N


    Linguistic (word count) analysis of prokaryotic genome sequences, by Shannon N-gram extension, reveals that the dominant hidden motifs in A+T rich genomes are T(A)(T)A and G(A)(T)C with uncertain number of repeating A and T. Since prokaryotic sequences are largely protein-coding, the motifs would correspond to amphipathic alpha-helices with alternating lysine and phenylalanine as preferential polar and non-polar residues. The motifs are also known in eukaryotes, as nucleosome positioning patterns. Their existence in prokaryotes as well may serve for binding of histone-like proteins to DNA. In this case the above patterns in prokaryotes may be considered as "anticipated" nucleosome positioning patterns which, quite likely, existed in prokaryotic genomes before the evolutionary separation between eukaryotes and prokaryotes.

  4. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.


    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W


    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  5. Generalized oscillator strengths for 5s, 5s{sup '}, and 5p excitations of krypton

    SciTech Connect

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing


    The absolute generalized oscillator strengths (GOSs) for 5s, 5s{sup '}, 5p [5/2]{sub 3,2}, 5p [3/2]{sub 1,2}, and 5p [1/2]{sub 0} transitions of krypton have been determined in a large K{sup 2} region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s{sup '} transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s{sup '} transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)].

  6. The evolution of ecological tolerance in prokaryotes

    NASA Technical Reports Server (NTRS)

    Knoll, A. H.; Bauld, J.


    The ecological ranges of Archaeobacteria and Eubacteria are constrained by a requirement for liquid water and the physico-chemical stability limits of biomolecules, but within this broad envelope, prokaryotes have evolved adaptations that permit them to tolerate a remarkable spectrum of habitats. Laboratory experiments indicate that prokaryotes can adapt rapidly to novel environmental conditions, yet geological studies suggest early diversification and long-term stasis within the prokaryotic kingdoms. These apparently contradictory perspectives can be reconciled by understanding that, in general, rates and patterns of prokaryotic evolution reflect the developmental history of the Earth's surface environments. Our understanding of modern microbial ecology provides a lens through which our accumulating knowledge of physiology, molecular phylogeny and the Earth's history can be integrated and focussed on the phenomenon of prokaryotic evolution.

  7. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen


    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  8. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.


    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette


    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  9. Stygofauna enhance prokaryotic transport in groundwater ecosystems

    PubMed Central

    Smith, Renee J.; Paterson, James S.; Launer, Elise; Tobe, Shanan S.; Morello, Eliesa; Leijs, Remko; Marri, Shashikanth; Mitchell, James G.


    More than 97% of the world’s freshwater reserves are found in aquifers, making groundwater one of the most important resources on the planet. Prokaryotic communities in groundwater underpin the turnover of energy and matter while also maintaining groundwater purity. Thus, knowledge of microbial transport in the subsurface is crucial for maintaining groundwater health. Here, we describe for the first time the importance of stygofauna as vectors for prokaryotes. The “hitch-hiking” prokaryotes associated with stygofauna may be up to 5 orders of magnitude higher in abundance and transported up to 34× faster than bulk groundwater flow. We also demonstrate that prokaryotic diversity associated with stygofauna may be higher than that of the surrounding groundwater. Stygofauna are a newly recognized prokaryotic niche in groundwater ecosystems that have the potential to transport remediating, water purifying and pathogenic prokaryotes. Therefore, stygofauna may influence ecosystem dynamics and health at a microbial level, and at a larger scale could be a new source of prokaryotic diversity in groundwater ecosystems. PMID:27597322

  10. Stygofauna enhance prokaryotic transport in groundwater ecosystems.


    Smith, Renee J; Paterson, James S; Launer, Elise; Tobe, Shanan S; Morello, Eliesa; Leijs, Remko; Marri, Shashikanth; Mitchell, James G


    More than 97% of the world's freshwater reserves are found in aquifers, making groundwater one of the most important resources on the planet. Prokaryotic communities in groundwater underpin the turnover of energy and matter while also maintaining groundwater purity. Thus, knowledge of microbial transport in the subsurface is crucial for maintaining groundwater health. Here, we describe for the first time the importance of stygofauna as vectors for prokaryotes. The "hitch-hiking" prokaryotes associated with stygofauna may be up to 5 orders of magnitude higher in abundance and transported up to 34× faster than bulk groundwater flow. We also demonstrate that prokaryotic diversity associated with stygofauna may be higher than that of the surrounding groundwater. Stygofauna are a newly recognized prokaryotic niche in groundwater ecosystems that have the potential to transport remediating, water purifying and pathogenic prokaryotes. Therefore, stygofauna may influence ecosystem dynamics and health at a microbial level, and at a larger scale could be a new source of prokaryotic diversity in groundwater ecosystems. PMID:27597322

  11. {upsilon}(5S) Results from CLEO

    SciTech Connect

    Pavlunin, Victor


    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the {upsilon}(5S) resonance. We have fully reconstructed 14 candidates consistent with Bs decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that this is a background fluctuation is less than 8 x 10-10. We have established that Bs production proceeds predominantly through the creation of B{sub s}*B-bar{sub s}* pairs with {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) =0[ .11{sub -0.03}{sup +0.04}(stat) {+-} 0.02(syst)] nb. The following limits are set: {sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s})/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 and [{sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s}*) + {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s})]/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 (90% CL). In a separate analysis, by comparing production rates of D{sub s}{sup +} mesons in {upsilon}(5S) and {upsilon}(4S) decays, an estimate of the ratio of B{sub s}{sup (*)} B-bar{sub s}{sup (*)} to the total bb-bar quark pair production at the {upsilon}(5S) energy of (16 {+-} 3 {+-} 6)% is obtained.

  12. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.


    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha


    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  13. Prokaryotic carbonic anhydrases of Earth's environment.


    Kumar, R Siva Sai; Ferry, James G


    Carbonic anhydrase is a metalloenzyme catalyzing the reversible hydration of carbon dioxide to bicarbonate. Five independently evolved classes have been described for which one or more are found in nearly every cell type underscoring the general importance of this ubiquitous enzyme in Nature. The bulk of research to date has centered on the enzymes from mammals and plants with less emphasis on prokaryotes. Prokaryotic carbonic anhydrases play important roles in the ecology of Earth's biosphere including acquisition of CO2 for photosynthesis and the physiology of aerobic and anaerobic prokaryotes decomposing the photosynthate back to CO2 thereby closing the global carbon cycle. This review focuses on the physiology and biochemistry of carbonic anhydrases from prokaryotes belonging to the domains Bacteria and Archaea that play key roles in the ecology of Earth's biosphere.

  14. Phylogenomics of Prokaryotic Ribosomal Proteins

    PubMed Central

    Yutin, Natalya; Puigbò, Pere; Koonin, Eugene V.; Wolf, Yuri I.


    Archaeal and bacterial ribosomes contain more than 50 proteins, including 34 that are universally conserved in the three domains of cellular life (bacteria, archaea, and eukaryotes). Despite the high sequence conservation, annotation of ribosomal (r-) protein genes is often difficult because of their short lengths and biased sequence composition. We developed an automated computational pipeline for identification of r-protein genes and applied it to 995 completely sequenced bacterial and 87 archaeal genomes available in the RefSeq database. The pipeline employs curated seed alignments of r-proteins to run position-specific scoring matrix (PSSM)-based BLAST searches against six-frame genome translations, mitigating possible gene annotation errors. As a result of this analysis, we performed a census of prokaryotic r-protein complements, enumerated missing and paralogous r-proteins, and analyzed the distributions of ribosomal protein genes among chromosomal partitions. Phyletic patterns of bacterial and archaeal r-protein genes were mapped to phylogenetic trees reconstructed from concatenated alignments of r-proteins to reveal the history of likely multiple independent gains and losses. These alignments, available for download, can be used as search profiles to improve genome annotation of r-proteins and for further comparative genomics studies. PMID:22615861

  15. Prokaryotic and eukaryotic unicellular chronomics

    PubMed Central

    Halberg, F.; Cornélissen, G.; Faraone, P.; Poeggeler, B.; Hardeland, R.; Katinas, G.; Schwartzkopff, O.; Otsuka, K.; Bakken, E. E.


    An impeccable time series, published in 1930, consisting of hourly observations on colony advance in a fluid culture of E. coli, was analyzed by a periodogram and power spectrum in 1961. While the original senior author had emphasized specifically periodicity with no estimate of period length, he welcomed further analyses. After consulting his technician, he knew of no environmental periodicity related to human schedules other than an hourly photography. A periodogram analysis in 1961 showed a 20.75-h period. It was emphasized that “… the circadian period disclosed is not of exactly 24-h length.” Confirmations notwithstanding, a committee ruled out microbial circadian rhythms based on grounds that could have led to a different conclusion, namely first, the inability of some committee members to see (presumably by eyeballing) the rhythms in their own data, and second, what hardly follows, that there were “too many analyses” in the published papers. Our point in dealing with microbes and humans is that analyses are indispensable for quantification and for discovering a biologically novel spectrum of cyclicities, matching physical ones. The scope of circadian organization estimated in 1961 has become broader, including about 7-day, about half-yearly, about-yearly and ex-yearly and decadal periodisms, among others. Microbial circadians have become a field of their own with eyeballing, yet time-microscopy can quantify characteristics with their uncertainties and can assess broad chronomes (time structures) with features beyond circadians. As yet only suggestive differences between eukaryotes and prokaryotes further broaden the perspective and may lead to life’s sites of origin and to new temporal aspects of life’ s development as a chronomic tree by eventual rhythm dating in ontogeny and phylogeny. PMID:16275493

  16. In Vitro Synthesis of Poliovirus Ribonucleic Acid: Role of the Replicative Intermediate

    PubMed Central

    Girard, Marc


    Poliovirus ribonucleic acid (RNA) polymerase crude extracts could be stored frozen in liquid nitrogen without loss of activity or specificity. The major in vitro product of these extracts was viral single-stranded RNA. However, after short periods of incubation with radioactive nucleoside triphosphates, most of the incorporated label was found in replicative intermediate. When excess unlabeled nucleoside triphosphate was added, the label was displaced from the replicative intermediate and accumulated as viral RNA. It is concluded from this experiment that the replicative intermediate is the precursor to viral RNA. In addition, some of the label was chased into double-stranded RNA. The implications of this finding are discussed. PMID:4306193

  17. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.


    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  18. The role of micro-ribonucleic acids in normal hematopoiesis and leukemic T-lymphogenesis.


    Slavov, S N; Gimenes Teixeira, H L; Rego, E M


    Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

  19. Factors Affecting Immunogenic Activity of Mycobacterial Ribosomal and Ribonucleic Acid Preparations

    PubMed Central

    Youmans, Anne S.; Youmans, Guy P.


    By following careful procedures, mycobacterial ribosomal fractions and ribonucleic acid (RNA) prepared by ethyl alcohol precipitation were obtained which have immunogenic activities similar to the viable attenuated H37Ra cells of Mycobacterium tuberculosis from which they were obtained. This comparison was based on the amount of ribonucleic acid (RNA) present. These preparations consisted of approximately 63% RNA and 37% protein; no deoxyribonucleic acid or polysaccharide was detected by chemical tests. A high correlation was found between the immunogenic activity of a preparation and the per cent increase in hyperchromicity at 260 nm of a ribonuclease-hydrolyzed portion. Final concentrations of sodium dodecyl sulfate higher than 0.25% when used for the preparation of the ribosomal fractions and RNA resulted in significantly lower immune responses and greater variation between experiments. This was not related to the amount of protein present. The stability of the ribosomal and RNA preparations was tested under a variety of conditions. The need for a good protective adjuvant again was shown since mouse serum readily hydrolyzed the RNA. Equal immunity was obtained after immunization by the intraperitoneal and subcutaneous routes; however, no immune response was obtained when the intravenous route was used. Preliminary results with RNA prepared with phenol showed that it was more easily degraded during preparation. This resulted in a lower immune response than was obtained with the RNA prepared with ethyl alcohol. PMID:4979447

  20. Analysis of inserts in prokaryote genomes

    NASA Astrophysics Data System (ADS)

    Cristea, Paul Dan; Tuduce, Rodica Aurora


    Nucleotide genomic signals satisfy regularities that reveal restrictions in the distribution of nucleotides and pairs of nucleotides along DNA sequences. Structurally, a chromosome appears to be more than a plain text, by satisfying symmetry constrains that evoke the rhythm and rhyme in poems. These regularities make it easy to identify exogenous inserts in the genomes of prokaryotes, because such inserts obey different regularities than the background sequence. The paper presents instances of inserts found in the genomes of Bacillus subtilis, Mycobacterium tuberculosis and other prokaryotes. Inserts of exogenous material are frequently accompanied by complementary inserts tending to restore the original constrains.

  1. Control of larval and egg development in Aedes aegypti with Ribonucleic acid interference (RNAi) against juvenile hormone acid methyl transferase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference (RNAi) is a powerful approach for elucidating gene functions in a variety of organisms, including mosquitoes and many other insects. Little has been done, however, to harness this approach in order to control adult and larval mosquitoes. Juvenile hormone (JH) plays a pi...

  2. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

    SciTech Connect

    Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.


    The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

  3. Eukaryotic versus prokaryotic marine picoplankton ecology.


    Massana, Ramon; Logares, Ramiro


    Marine microorganisms contribute markedly to global biomass and ecosystem function. They include a diverse collection of organisms differing in cell size and in evolutionary history. In particular, microbes within the picoplankton are similar in size but belong to two drastically different cellular plans, the prokaryotes and the eukaryotes. Compared with larger organisms, prokaryotes and picoeukaryotes share ecological features, such as high specific activity, large and constant abundances, and high dispersal potential. Still, there are some aspects where their different cell organization influences their ecological performance. First, prokaryotes have a huge metabolic versatility and are involved in all biogeochemical cycles, whereas picoeukaryotes are metabolically less flexible but can exploit diverse predatory life strategies due to their phagocytic capacity. Second, sexual reproduction is absent in prokaryotes but may be present in picoeukaryotes, thus determining different evolutionary diversification dynamics and making species limits clearer in picoeukaryotes. Finally, it is plausible that picoeukaryotes are less flexible to enter a reversible state of low metabolic activity, thus picoeukaryote assemblages may have fewer rare species and may be less resilient to environmental change. In summary, lumping together pico-sized microbes may be convenient for some ecological studies, but it is also important to keep in mind their differences.

  4. In vivo analysis of polyadenylation in prokaryotes.


    Mohanty, Bijoy K; Kushner, Sidney R


    Polyadenylation at the 3' ends of mRNAs, tRNAs, rRNAs, and sRNAs plays important roles in RNA metabolism in both prokaryotes and eukaryotes. However, the nature of poly(A) tails in prokaryotes is distinct compared to their eukaryotic counterparts. Specifically, depending on the organism, eukaryotic poly(A) tails average between 50 and >200 nt and can easily be isolated by several techniques involving oligo(dT)-dependent cDNA amplification. In contrast, the bulk of the poly(A) tails present on prokaryotic transcripts is relatively short (<10 nt) and is difficult to characterize using similar techniques. This chapter describes methods that can circumvent these problems. For example, we discuss how to isolate total RNA and characterize its overall polyadenylation status employing a poly(A) sizing assay. Furthermore, we describe a technique involving RNase H treatment of total RNA followed by northern analysis in order to distinguish length of poly(A) tails on various types of transcripts. Finally, we outline a useful procedure to clone the poly(A) tails of specific transcripts using 5'-3' end-ligated RNA, which is independent of oligo(dT)-dependent cDNA amplification. These approaches are particularly helpful in analyzing transcripts with either short or long poly(A) tails both in prokaryotes and eukaryotes.

  5. Microcompartments and Protein Machines in Prokaryotes

    PubMed Central

    Saier, Milton H.


    The prokaryotic cell was once thought of as a “bag of enzymes” with little or no intracellular compartmentalization. In this view, most reactions essential for life occurred as a consequence of random molecular collisions involving substrates, cofactors and cytoplasmic enzymes. Our current conception of a prokaryote is far from this view. We now consider a bacterium or an archaeon as a highly structured, non-random collection of functional membrane-embedded and proteinaceous molecular machines, each of which serves a specialized function. In this article we shall present an overview of such microcompartments including (i) the bacterial cytoskeleton and the apparati allowing DNA segregation during cells division, (ii) energy transduction apparati involving light-driven proton pumping and ion gradient-driven ATP synthesis, (iii) prokaryotic motility and taxis machines that mediate cell movements in response to gradients of chemicals and physical forces, (iv) machines of protein folding, secretion and degradation, (v) metabolasomes carrying out specific chemical reactions, (vi) 24 hour clocks allowing bacteria to coordinate their metabolic activities with the daily solar cycle and (vii) proteinaceous membrane compartmentalized structures such as sulfur granules and gas vacuoles. Membrane-bounded prokaryotic organelles were considered in a recent JMMB written symposium concerned with membraneous compartmentalization in bacteria [Saier and Bogdanov, 2013]. By contrast, in this symposium, we focus on proteinaceous microcompartments. These two symposia, taken together, provide the interested reader with an objective view of the remarkable complexity of what was once thought of as a simple non-compartmentalized cell. PMID:23920489

  6. Predatory prokaryotes: an emerging research opportunity.


    Martin, Mark O


    Predatory prokaryotes have evolved a unique strategy of obtaining energy and biosynthetic materials from their surroundings: acquiring them from other living bacterial cells. These types of microbes have been found in a diverse variety of environments, and may play an important role in modulating microbial population structure and dynamics, as has been hypothesized for marine viruses and possibly protists. Only one genus of predatory bacterium, Bdellovibrio, has been extensively described and studied, though several other examples have been reported in the literature. In this review, the four basic strategies used by currently described predatory prokaryotes will be discussed: "wolfpack" group predation, epibiotic attachment, direct cytoplasmic invasion, and periplasmic invasion. Special adaptations to each approach will be considered, and compared overall to the genetic and biochemical characteristics of symbiotic or pathogenic prokaryotes living within eukaryotic cells. Two specific examples of predatory microbes, Bdellovibrio and Ensifer, will be described in terms of predation strategy, association with host cells, and host range. The prospects for bringing to bear the tools of molecular microbial genetics to the study of predatory prokaryotes will be explored, using current research with Bdellovibrio and Ensifer as examples.

  7. Estimating prokaryotic diversity and its limits.


    Curtis, Thomas P; Sloan, William T; Scannell, Jack W


    The absolute diversity of prokaryotes is widely held to be unknown and unknowable at any scale in any environment. However, it is not necessary to count every species in a community to estimate the number of different taxa therein. It is sufficient to estimate the area under the species abundance curve for that environment. Log-normal species abundance curves are thought to characterize communities, such as bacteria, which exhibit highly dynamic and random growth. Thus, we are able to show that the diversity of prokaryotic communities may be related to the ratio of two measurable variables: the total number of individuals in the community and the abundance of the most abundant members of that community. We assume that either the least abundant species has an abundance of 1 or Preston's canonical hypothesis is valid. Consequently, we can estimate the bacterial diversity on a small scale (oceans 160 per ml; soil 6,400-38,000 per g; sewage works 70 per ml). We are also able to speculate about diversity at a larger scale, thus the entire bacterial diversity of the sea may be unlikely to exceed 2 x 10(6), while a ton of soil could contain 4 x 10(6) different taxa. These are preliminary estimates that may change as we gain a greater understanding of the nature of prokaryotic species abundance curves. Nevertheless, it is evident that local and global prokaryotic diversity can be understood through species abundance curves and purely experimental approaches to solving this conundrum will be fruitless.

  8. Multicellular life cycle of magnetotactic prokaryotes.


    Keim, Carolina N; Martins, Juliana L; Abreu, Fernanda; Rosado, Alexandre Soares; de Barros, Henrique Lins; Borojevic, Radovan; Lins, Ulysses; Farina, Marcos


    Most multicellular organisms, prokaryotes as well as animals, plants, and algae have a unicellular stage in their life cycle. Here, we describe an uncultured prokaryotic magnetotactic multicellular organism that reproduces by binary fission. It is multicellular in all the stages of its life cycle, and during most of the life cycle the cells organize into a hollow sphere formed by a functionally coordinated and polarized single-cell layer that grows by increasing the cell size. Subsequently, all the cells divide synchronously; the organism becomes elliptical, and separates into two equal spheres with a torsional movement in the equatorial plane. Unicellular bacteria similar to the cells that compose these organisms have not been found. Molecular biology analysis showed that all the organisms studied belong to a single genetic population phylogenetically related to many-celled magnetotactic prokaryotes in the delta sub-group of the proteobacteria. This appears to be the first report of a multicellular prokaryotic organism that proliferates by dividing into two equal multicellular organisms each similar to the parent one. PMID:15522508

  9. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.


    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  10. In vitro translation of cardiovirus ribonucleic acid by mammalian cell-free extracts.


    Eggen, K L; Shatkin, A J


    Cell-free extracts prepared from Ehrlich ascites and mouse L cells synthesize viral proteins in response to encephalomyocarditis virus, mouse Elberfeld virus, and mengovirus ribonucleic acid. Although HeLa cell extracts are inactive, their ribosomes are functional in the presence of heterologous supernatant fractions. Synthesis depends upon the addition of adenosine triphosphate, guanosine triphosphate, an energy-generating system, and 4 mm Mg(2+). Initiation is completed during the first 10 to 20 min of incubation, but chain elongation continues for 1 hr or more. The products are of higher molecular weight than virion structural proteins and resemble polypeptides formed in virus-infected cells during a short pulse. Tryptic peptides of virion proteins and in vitro products are similar for all three cardioviruses.

  11. Transcription In Vitro by Reovirus-Associated Ribonucleic Acid-Dependent Polymerase 1

    PubMed Central

    Banerjee, A. K.; Shatkin, A. J.


    Digestion of purified reovirus type 3 with chymotrypsin degrades 70% of the viral protein and converts the virions to subviral particles (SVP). The SVP contain 3 of the 6 viral structural proteins and all 10 double-stranded ribonucleic acid (RNA) genome segments but not adenine-rich, single-stranded RNA. An RNA polymerase which is structurally associated with SVP transcribes one strand of each genome segment by a conservative mechanism in vitro. The single-stranded products include large (1.2 × 106 daltons), medium (0.7 × 106 daltons), and small (0.4 × 106 daltons) molecules which hybridize exclusively with the corresponding genome segments. The enzyme obtained by heating virions at 60 C synthesizes similar products. Kinetic and pulse-chase studies indicate that the different-sized products are synthesized simultaneously but at rates which are in the order: small > medium > large. Images PMID:5529847

  12. Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

    SciTech Connect

    Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya


    Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitated lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.

  13. New aspects of RNA processing in prokaryotes.


    Evguenieva-Hackenberg, Elena; Klug, Gabriele


    The pivotal role of posttranscriptional gene regulation is strongly underlined by genome-wide analyses showing strikingly low correlation between mRNA and protein levels in bacterial and archaeal cells. The stability of an mRNA and its availability for translation contribute to posttranscriptional gene regulation, and are determined by the following factors: i) the cell-specific set of ribonucleases and related proteins, ii) regulatory RNAs, and iii) the sequence and structural features of the RNA molecule itself. High-resolution analyses of whole prokaryotic transcriptomes allow comprehensive mapping of processed transcripts, detection of essentially all expressed regulatory RNAs, and monitoring of the global impact of ribonucleases and other processing factors. This opens new perspectives for the understanding of the molecular mechanisms responsible for mRNA decay in prokaryotes.

  14. Prokaryotic Diacylglycerol Kinase and Undecaprenol Kinase

    PubMed Central

    Van Horn, Wade D.; Sanders, Charles R.


    Prokaryotic diacylglycerol kinase (DAGK) and undecaprenol kinase (UDPK) are the lone members of a family of multispan membrane enzymes that are very small, lack relationships to any other family of proteins—including water soluble kinases, and that exhibit an unusual structure and active site architecture. Escherichia coli DAGK plays an important role in recycling diacylglycerol produced as a byproduct of biosynthesis of molecules located in the periplasmic space. UDPK seems to play an analogous role in Gram-positive bacteria, where its importance is evident by the fact that UDPK is essential for biofilm formation by the oral pathogen Streptococcus mutans. DAGK has also long served as a model system for studies of membrane protein biocatalysis, folding, stability, and structure. This review explores our current understanding of the microbial physiology, enzymology, structural biology, and folding of the prokaryotic diacylglycerol kinase family, which is based on over 40 years of studies. PMID:22224599

  15. Prokaryotes Versus Eukaryotes: Who is Hosting Whom?

    PubMed Central

    Tellez, Guillermo


    Microorganisms represent the largest component of biodiversity in our world. For millions of years, prokaryotic microorganisms have functioned as a major selective force shaping eukaryotic evolution. Microbes that live inside and on animals outnumber the animals’ actual somatic and germ cells by an estimated 10-fold. Collectively, the intestinal microbiome represents a “forgotten organ,” functioning as an organ inside another that can execute many physiological responsibilities. The nature of primitive eukaryotes was drastically changed due to the association with symbiotic prokaryotes facilitating mutual coevolution of host and microbe. Phytophagous insects have long been used to test theories of evolutionary diversification; moreover, the diversification of a number of phytophagous insect lineages has been linked to mutualisms with microbes. From termites and honey bees to ruminants and mammals, depending on novel biochemistries provided by the prokaryotic microbiome, the association helps to metabolize several nutrients that the host cannot digest and converting these into useful end products (such as short-chain fatty acids), a process, which has huge impact on the biology and homeostasis of metazoans. More importantly, in a direct and/or indirect way, the intestinal microbiota influences the assembly of gut-associated lymphoid tissue, helps to educate immune system, affects the integrity of the intestinal mucosal barrier, modulates proliferation and differentiation of its epithelial lineages, regulates angiogenesis, and modifies the activity of enteric as well as the central nervous system. Despite these important effects, the mechanisms by which the gut microbial community influences the host’s biology remain almost entirely unknown. Our aim here is to encourage empirical inquiry into the relationship between mutualism and evolutionary diversification between prokaryotes and eukaryotes, which encourage us to postulate: who is hosting whom? PMID

  16. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.


    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  17. Increased 5S rRNA oxidation in Alzheimer's disease.


    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R


    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  18. Advantages and limitations of genomics in prokaryotic taxonomy.


    Sentausa, E; Fournier, P-E


    Taxonomic classification is an important field of microbiology, as it enables scientists to identify prokaryotes worldwide. Although the current classification system is still based on the one designed by Carolus Linnaeus, the currently available genomic content of several thousands of sequenced prokaryotic genomes represents a unique source of taxonomic information that should not be ignored. In addition, the development of faster, cheaper and improved sequencing methods has made genomics a tool that has a place in the workflow of a routine microbiology laboratory. Thus, genomics has reached a stage where it may be used in prokaryotic taxonomic classification, with criteria such as the genome index of average nucleotide identity being an alternative to DNA-DNA hybridization. However, several hurdles remain, including the lack of genomic sequences of many prokaryotic taxonomic representatives, and consensus procedures to describe new prokaryotic taxa that do not, as yet, accommodate genomic data. We herein review the advantages and disadvantages of using genomics in prokaryotic taxonomy.

  19. Advantages and limitations of genomics in prokaryotic taxonomy.


    Sentausa, E; Fournier, P-E


    Taxonomic classification is an important field of microbiology, as it enables scientists to identify prokaryotes worldwide. Although the current classification system is still based on the one designed by Carolus Linnaeus, the currently available genomic content of several thousands of sequenced prokaryotic genomes represents a unique source of taxonomic information that should not be ignored. In addition, the development of faster, cheaper and improved sequencing methods has made genomics a tool that has a place in the workflow of a routine microbiology laboratory. Thus, genomics has reached a stage where it may be used in prokaryotic taxonomic classification, with criteria such as the genome index of average nucleotide identity being an alternative to DNA-DNA hybridization. However, several hurdles remain, including the lack of genomic sequences of many prokaryotic taxonomic representatives, and consensus procedures to describe new prokaryotic taxa that do not, as yet, accommodate genomic data. We herein review the advantages and disadvantages of using genomics in prokaryotic taxonomy. PMID:23490121

  20. 5SRNAdb: an information resource for 5S ribosomal RNAs.


    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M


    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb ( is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  1. 5SRNAdb: an information resource for 5S ribosomal RNAs.


    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M


    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb ( is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  2. [Structural organization of 5S ribosomal DNA of Rosa rugosa].


    Tynkevych, Iu O; Volkov, R A


    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  3. Influence of age of aggregates and prokaryotic abundance on glucose and leucine uptake by heterotrophic marine prokaryotes.


    Azúa, Iñigo; Unanue, Marian; Ayo, Begoña; Artolozaga, Itxaso; Iriberri, Juan


    The kinetics of glucose and leucine uptake in attached and free-living prokaryotes in two types of microcosms with different nutrient qualities were compared. Microcosm type M1, derived from unaltered seawater, and microcosm type M2, from phytoplankton cultures, clearly expressed different kinetic parameters (Vmax/cell and K' m). In aggregates with low cell densities (M1 microcosm), the attached prokaryotes benefited from attachment as reflected in the higher potential uptake rates, while in aggregates with high cell densities (M2 microcosm) differences in the potential uptake rates of attached and free-living prokaryotes were not evident. The aging process and the chemical changes in aggregates of M2 microcosms were followed for 15-20 days. The results showed that as the aggregates aged and prokaryotic abundance increased, attached prokaryotes decreased their potential uptake rate and their K' m for substrate. This suggests an adaptive response by attached prokaryotes when aggregates undergo quantitative and qualitative impoverishment.

  4. Simple sequence repeats in prokaryotic genomes

    PubMed Central

    Mrázek, Jan; Guo, Xiangxue; Shah, Apurva


    Simple sequence repeats (SSRs) in DNA sequences are composed of tandem iterations of short oligonucleotides and may have functional and/or structural properties that distinguish them from general DNA sequences. They are variable in length because of slip-strand mutations and may also affect local structure of the DNA molecule or the encoded proteins. Long SSRs (LSSRs) are common in eukaryotes but rare in most prokaryotes. In pathogens, SSRs can enhance antigenic variance of the pathogen population in a strategy that counteracts the host immune response. We analyze representations of SSRs in >300 prokaryotic genomes and report significant differences among different prokaryotes as well as among different types of SSRs. LSSRs composed of short oligonucleotides (1–4 bp length, designated LSSR1–4) are often found in host-adapted pathogens with reduced genomes that are not known to readily survive in a natural environment outside the host. In contrast, LSSRs composed of longer oligonucleotides (5–11 bp length, designated LSSR5–11) are found mostly in nonpathogens and opportunistic pathogens with large genomes. Comparisons among SSRs of different lengths suggest that LSSR1–4 are likely maintained by selection. This is consistent with the established role of some LSSR1–4 in enhancing antigenic variance. By contrast, abundance of LSSR5–11 in some genomes may reflect the SSRs' general tendency to expand rather than their specific role in the organisms' physiology. Differences among genomes in terms of SSR representations and their possible interpretations are discussed. PMID:17485665

  5. In vitro evaluation of endothelial exosomes as carriers for small interfering ribonucleic acid delivery.


    Banizs, Anna B; Huang, Tao; Dryden, Kelly; Berr, Stuart S; Stone, James R; Nakamoto, Robert K; Shi, Weibin; He, Jiang


    Exosomes, one subpopulation of nanosize extracellular vesicles derived from multivesicular bodies, ranging from 30 to 150 nm in size, emerged as promising carriers for small interfering ribonucleic acid (siRNA) delivery, as they are capable of transmitting molecular messages between cells through carried small noncoding RNAs, messenger RNAs, deoxyribonucleic acids, and proteins. Endothelial cells are involved in a number of important biological processes, and are a major source of circulating exosomes. In this study, we prepared exosomes from endothelial cells and evaluated their capacity to deliver siRNA into primary endothelial cells. Exosomes were isolated and purified by sequential centrifugation and ultracentrifugation from cultured mouse aortic endothelial cells. Similar to exosome particles from other cell sources, endothelial exosomes are nanometer-size vesicles, examined by both the NanoSight instrument and transmission electron microscopy. Enzyme-linked immunosorbent assay analysis confirmed the expression of two exosome markers: CD9 and CD63. Flow cytometry and fluorescence microscopy studies demonstrated that endothelial exosomes were heterogeneously distributed within cells. In a gene-silencing study with luciferase-expressing endothelial cells, exosomes loaded with siRNA inhibited luciferase expression by more than 40%. In contrast, siRNA alone and control siRNA only suppressed luciferase expression by less than 15%. In conclusion, we demonstrated that endothelial exosomes have the capability to accommodate and deliver short foreign nucleic acids into endothelial cells.

  6. In vitro evaluation of endothelial exosomes as carriers for small interfering ribonucleic acid delivery

    PubMed Central

    Banizs, Anna B; Huang, Tao; Dryden, Kelly; Berr, Stuart S; Stone, James R; Nakamoto, Robert K; Shi, Weibin; He, Jiang


    Exosomes, one subpopulation of nanosize extracellular vesicles derived from multivesicular bodies, ranging from 30 to 150 nm in size, emerged as promising carriers for small interfering ribonucleic acid (siRNA) delivery, as they are capable of transmitting molecular messages between cells through carried small noncoding RNAs, messenger RNAs, deoxyribonucleic acids, and proteins. Endothelial cells are involved in a number of important biological processes, and are a major source of circulating exosomes. In this study, we prepared exosomes from endothelial cells and evaluated their capacity to deliver siRNA into primary endothelial cells. Exosomes were isolated and purified by sequential centrifugation and ultracentrifugation from cultured mouse aortic endothelial cells. Similar to exosome particles from other cell sources, endothelial exosomes are nanometer-size vesicles, examined by both the NanoSight instrument and transmission electron microscopy. Enzyme-linked immunosorbent assay analysis confirmed the expression of two exosome markers: CD9 and CD63. Flow cytometry and fluorescence microscopy studies demonstrated that endothelial exosomes were heterogeneously distributed within cells. In a gene-silencing study with luciferase-expressing endothelial cells, exosomes loaded with siRNA inhibited luciferase expression by more than 40%. In contrast, siRNA alone and control siRNA only suppressed luciferase expression by less than 15%. In conclusion, we demonstrated that endothelial exosomes have the capability to accommodate and deliver short foreign nucleic acids into endothelial cells. PMID:25214786

  7. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.


    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  8. Aggregates of Small Nuclear Ribonucleic Acids (snRNAs) in Alzheimer’s Disease’

    PubMed Central

    Hales, Chadwick M.; Dammer, Eric B.; Diner, Ian; Yi, Hong; Seyfried, Nicholas T.; Gearing, Marla; Glass, Jonathan D.; Montine, Thomas J.; Levey, Allan I.; Lah, James J.


    We recently discovered that protein components of the ribonucleic acid (RNA) spliceosome form cytoplasmic aggregates in Alzheimer’s disease (AD) brain, resulting in widespread changes in RNA splicing. However, the involvement of small nuclear RNAs (snRNAs), also key components of the spliceosome complex, in the pathology of AD remains unknown. Using immunohistochemical staining of post-mortem human brain and spinal cord, we identified cytoplasmic tangle-shaped aggregates of snRNA in both sporadic and familial AD cases but not in aged controls or other neurodegenerative disorders. Immunofluorescence using antibodies reactive with the 2,2,7-trimethylguanosine cap of snRNAs and transmission electron microscopy demonstrated snRNA localization with tau and paired helical filaments, the main component of neurofibrillary tangles. Quantitative real-time polymerase chain reaction (PCR) showed U1 snRNA accumulation in the insoluble fraction of AD brains whereas other U snRNAs were not enriched. In combination with our previous results, these findings demonstrate that aggregates of U1 snRNA and U1 small nuclear ribonucleoproteins represent a new pathological hallmark of AD. PMID:24571648

  9. Characterization of hybrid plasmids carrying individual ribosomal ribonucleic acid transcription units of Escherichia coli.

    PubMed Central

    Kenerley, M E; Morgan, E A; Post, L; Lindahl, L; Nomura, M


    We have screened the strains with ColE1 hybrid plasmids constructed by Clarke and Carbon (Cell 9:91-99, 1976) for the presence of ribosomal ribonucleic acid (rRNA) genes on the plasmids and identified 16 strains whose plasmids carry rRNA genes. The structures of these 16 plasmids were compared by heteroduplex analysis, and the plasmids were classified into six groups on the basis of their chromosomal origins. Homology with known transducing-phage deoxyribonucleic acids and genetic mapping have assigned locations on the Escherichia coli chromosome to three of the six groups. These are rrnB near rif at 88 min, rrnC near ilvE at 83 min, and rrnD near aroE at 71 min. A fourth group is probably rrnA at 85 min (T. Ikemura and M. Nomura, Cell, 11:779-793, 1977). We conclude that the minimum number of rRNA transcription units per haploid chromosomes is seven, that is, the six groups identified in this work plus a known operon (rrnE near metA at 89 min) that we failed to find among the hybrid plasmids. This heteroduplex analysis also suggests that there are only two kinds of rRNA operons with respect to their spacer region; three of the six rRNA operon groups studied here have one kind, whereas the remaining three have the other kind. Images PMID:336613

  10. CRISPR-Cas immunity in prokaryotes.


    Marraffini, Luciano A


    Prokaryotic organisms are threatened by a large array of viruses and have developed numerous defence strategies. Among these, only clustered, regularly interspaced short palindromic repeat (CRISPR)-Cas systems provide adaptive immunity against foreign elements. Upon viral injection, a small sequence of the viral genome, known as a spacer, is integrated into the CRISPR locus to immunize the host cell. Spacers are transcribed into small RNA guides that direct the cleavage of the viral DNA by Cas nucleases. Immunization through spacer acquisition enables a unique form of evolution whereby a population not only rapidly acquires resistance to its predators but also passes this resistance mechanism vertically to its progeny.

  11. Emerging spatial patterns in Antarctic prokaryotes.


    Chong, Chun-Wie; Pearce, David A; Convey, Peter


    Recent advances in knowledge of patterns of biogeography in terrestrial eukaryotic organisms have led to a fundamental paradigm shift in understanding of the controls and history of life on land in Antarctica, and its interactions over the long term with the glaciological and geological processes that have shaped the continent. However, while it has long been recognized that the terrestrial ecosystems of Antarctica are dominated by microbes and their processes, knowledge of microbial diversity and distributions has lagged far behind that of the macroscopic eukaryote organisms. Increasing human contact with and activity in the continent is leading to risks of biological contamination and change in a region whose isolation has protected it for millions of years at least; these risks may be particularly acute for microbial communities which have, as yet, received scant recognition and attention. Even a matter apparently as straightforward as Protected Area designation in Antarctica requires robust biodiversity data which, in most parts of the continent, remain almost completely unavailable. A range of important contributing factors mean that it is now timely to reconsider the state of knowledge of Antarctic terrestrial prokaryotes. Rapid advances in molecular biological approaches are increasingly demonstrating that bacterial diversity in Antarctica may be far greater than previously thought, and that there is overlap in the environmental controls affecting both Antarctic prokaryotic and eukaryotic communities. Bacterial dispersal mechanisms and colonization patterns remain largely unaddressed, although evidence for regional evolutionary differentiation is rapidly accruing and, with this, there is increasing appreciation of patterns in regional bacterial biogeography in this large part of the globe. In this review, we set out to describe the state of knowledge of Antarctic prokaryote diversity patterns, drawing analogy with those of eukaryote groups where appropriate

  12. Emerging spatial patterns in Antarctic prokaryotes

    PubMed Central

    Chong, Chun-Wie; Pearce, David A.; Convey, Peter


    Recent advances in knowledge of patterns of biogeography in terrestrial eukaryotic organisms have led to a fundamental paradigm shift in understanding of the controls and history of life on land in Antarctica, and its interactions over the long term with the glaciological and geological processes that have shaped the continent. However, while it has long been recognized that the terrestrial ecosystems of Antarctica are dominated by microbes and their processes, knowledge of microbial diversity and distributions has lagged far behind that of the macroscopic eukaryote organisms. Increasing human contact with and activity in the continent is leading to risks of biological contamination and change in a region whose isolation has protected it for millions of years at least; these risks may be particularly acute for microbial communities which have, as yet, received scant recognition and attention. Even a matter apparently as straightforward as Protected Area designation in Antarctica requires robust biodiversity data which, in most parts of the continent, remain almost completely unavailable. A range of important contributing factors mean that it is now timely to reconsider the state of knowledge of Antarctic terrestrial prokaryotes. Rapid advances in molecular biological approaches are increasingly demonstrating that bacterial diversity in Antarctica may be far greater than previously thought, and that there is overlap in the environmental controls affecting both Antarctic prokaryotic and eukaryotic communities. Bacterial dispersal mechanisms and colonization patterns remain largely unaddressed, although evidence for regional evolutionary differentiation is rapidly accruing and, with this, there is increasing appreciation of patterns in regional bacterial biogeography in this large part of the globe. In this review, we set out to describe the state of knowledge of Antarctic prokaryote diversity patterns, drawing analogy with those of eukaryote groups where appropriate

  13. Emerging spatial patterns in Antarctic prokaryotes.


    Chong, Chun-Wie; Pearce, David A; Convey, Peter


    Recent advances in knowledge of patterns of biogeography in terrestrial eukaryotic organisms have led to a fundamental paradigm shift in understanding of the controls and history of life on land in Antarctica, and its interactions over the long term with the glaciological and geological processes that have shaped the continent. However, while it has long been recognized that the terrestrial ecosystems of Antarctica are dominated by microbes and their processes, knowledge of microbial diversity and distributions has lagged far behind that of the macroscopic eukaryote organisms. Increasing human contact with and activity in the continent is leading to risks of biological contamination and change in a region whose isolation has protected it for millions of years at least; these risks may be particularly acute for microbial communities which have, as yet, received scant recognition and attention. Even a matter apparently as straightforward as Protected Area designation in Antarctica requires robust biodiversity data which, in most parts of the continent, remain almost completely unavailable. A range of important contributing factors mean that it is now timely to reconsider the state of knowledge of Antarctic terrestrial prokaryotes. Rapid advances in molecular biological approaches are increasingly demonstrating that bacterial diversity in Antarctica may be far greater than previously thought, and that there is overlap in the environmental controls affecting both Antarctic prokaryotic and eukaryotic communities. Bacterial dispersal mechanisms and colonization patterns remain largely unaddressed, although evidence for regional evolutionary differentiation is rapidly accruing and, with this, there is increasing appreciation of patterns in regional bacterial biogeography in this large part of the globe. In this review, we set out to describe the state of knowledge of Antarctic prokaryote diversity patterns, drawing analogy with those of eukaryote groups where appropriate

  14. Multilocus sequence analysis (MLSA) in prokaryotic taxonomy.


    Glaeser, Stefanie P; Kämpfer, Peter


    To obtain a higher resolution of the phylogenetic relationships of species within a genus or genera within a family, multilocus sequence analysis (MLSA) is currently a widely used method. In MLSA studies, partial sequences of genes coding for proteins with conserved functions ('housekeeping genes') are used to generate phylogenetic trees and subsequently deduce phylogenies. However, MLSA is not only suggested as a phylogenetic tool to support and clarify the resolution of bacterial species with a higher resolution, as in 16S rRNA gene-based studies, but has also been discussed as a replacement for DNA-DNA hybridization (DDH) in species delineation. Nevertheless, despite the fact that MLSA has become an accepted and widely used method in prokaryotic taxonomy, no common generally accepted recommendations have been devised to date for either the whole area of microbial taxonomy or for taxa-specific applications of individual MLSA schemes. The different ways MLSA is performed can vary greatly for the selection of genes, their number, and the calculation method used when comparing the sequences obtained. Here, we provide an overview of the historical development of MLSA and critically review its current application in prokaryotic taxonomy by highlighting the advantages and disadvantages of the method's numerous variations. This provides a perspective for its future use in forthcoming genome-based genotypic taxonomic analyses.

  15. A degradation signal recognition in prokaryotes

    PubMed Central

    Park, Eun Young; Song, Hyun Kyu


    The degradation of ssrA-tagged substrates in prokaryotes is conducted by a subset of ATP-dependent proteases, including ClpXP complex. More than 630 sequences of ssrA have been identified from 514 species, and are conserved in a wide range of prokaryotes. SspB protein markedly stimulates the degradation of these ssrA-tagged substrates by the ClpXP proteolytic machine. The dimeric SspB protein is composed of a compact ssrA-binding domain, which has a dimerization surface and a flexible C-terminal tail with a ClpX-binding motif at its very end. Since SspB is an adaptor protein for the ClpXP complex, designed mutagenesis, fluorescence spectroscopy, biochemistry and X-ray crystallography have been used to investigate the mechanism of delivery of ssrA-tagged proteins. In this paper the structural basis of ssrA-tag recognition by ClpX and SspB, as well as SspB-tail recognition by ZBD, is described. PMID:18421150

  16. Prokaryotic silicon utilizing microorganisms in the biosphere

    NASA Astrophysics Data System (ADS)

    Gupta, D.; Das, S.


    Although a little study has been done to determine the silicon utilizing prokaryotes, our previous experiments indicated that almost all Gram-positive bacteria are silicon utilizing; one of them, Streptococci survived exposure on the lunar surface for a long period in experiment done by others. Our initial experiments with these Gram positive microorganisms showed that there were limited growths of these microorganisms on carbon free silicate medium probably with the help of some carry over carbon and nitrogen during cultivation procedures. However, increase in growth rate after repeated subcultures could not be explained at present. The main groups of prokaryotes which were found silicon utilizing microorganisms were Mycobacterium, Bacillus, Nocardia, Streptomyces, Staphylococcus, Streptococcus, Lactobacillus, and Clostridium. In a another previous study by us when silicon level was studied in such grown up cells on carbon "free" silicate medium by electron prove microanalyser, it was found that silicon in cells grown on carbon "free" silicate medium was much higher (24.9%) than those grown on conventional carbon based medium (0.84%). However, these initial findings are encouraging for our future application of this group of organisms on extraterrestrial surfaces for artificial micro-ecosystem formation. It was found that when electropositive elements are less in extraterrestrial situation, then polymerization of silicon-oxygen profusion may occur easily, particularly in carbon and nitrogen paucity in the rocky worlds of the Universe.

  17. PEPR: pipelines for evaluating prokaryotic references.


    Olson, Nathan D; Zook, Justin M; Samarov, Daniel V; Jackson, Scott A; Salit, Marc L


    The rapid adoption of microbial whole genome sequencing in public health, clinical testing, and forensic laboratories requires the use of validated measurement processes. Well-characterized, homogeneous, and stable microbial genomic reference materials can be used to evaluate measurement processes, improving confidence in microbial whole genome sequencing results. We have developed a reproducible and transparent bioinformatics tool, PEPR, Pipelines for Evaluating Prokaryotic References, for characterizing the reference genome of prokaryotic genomic materials. PEPR evaluates the quality, purity, and homogeneity of the reference material genome, and purity of the genomic material. The quality of the genome is evaluated using high coverage paired-end sequence data; coverage, paired-end read size and direction, as well as soft-clipping rates, are used to identify mis-assemblies. The homogeneity and purity of the material relative to the reference genome are characterized by comparing base calls from replicate datasets generated using multiple sequencing technologies. Genomic purity of the material is assessed by checking for DNA contaminants. We demonstrate the tool and its output using sequencing data while developing a Staphylococcus aureus candidate genomic reference material. PEPR is open source and available at . PMID:26935931

  18. [Organization of 5S ribosomal DNA of Melitaea trivia].


    Cherevatov, O V; Volkov, R A


    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  19. Biophysical Adaptations of Prokaryotic Voltage-Gated Sodium Channels.


    Vien, T N; DeCaen, P G


    This chapter describes the adaptive features found in voltage-gated sodium channels (NaVs) of prokaryotes and eukaryotes. These two families are distinct, having diverged early in evolutionary history but maintain a surprising degree of convergence in function. While prokaryotic NaVs are required for growth and motility, eukaryotic NaVs selectively conduct fast electrical currents for short- and long-range signaling across cell membranes in mammalian organs. Current interest in prokaryotic NaVs is stoked by their resolved high-resolution structures and functional features which are reminiscent of eukaryotic NaVs. In this chapter, comparisons between eukaryotic and prokaryotic NaVs are made to highlight the shared and unique aspects of ion selectivity, voltage sensitivity, and pharmacology. Examples of prokaryotic and eukaryotic NaV convergent evolution will be discussed within the context of their structural features. PMID:27586280

  20. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    NASA Astrophysics Data System (ADS)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.


    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  1. Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.


    Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E


    During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs.

  2. Acoustic cavitation-mediated delivery of small interfering ribonucleic acids with phase-shift nanoemulsions

    PubMed Central

    Burgess, Mark T.; Porter, Tyrone M.


    Localized, targeted delivery of small interfering ribonucleic acid (siRNA) has been the foremost hurdle in the use of siRNA for the treatment of various diseases. Major advances have been achieved in the synthesis of siRNA, which has led to greater target messenger RNA (mRNA) silencing and stability in physiological conditions. Although numerous delivery strategies have shown promise, there are still limited options for targeted delivery and release of siRNA administered systemically. In this in vitro study, phase-shift nanoemulsions (PSNE) were explored as cavitation nuclei to facilitate free siRNA delivery to cancer cells via sonoporation. A cell suspension containing varying amounts of PSNE and siRNA was exposed to 5 MHz pulsed ultrasound at fixed settings (6.2 MPa peak negative pressure, 5 cycle pulses, 250 Hz pulse repetition frequency, and total exposure duration of 100 seconds). Inertial cavitation emissions were detected throughout the exposure using a passive cavitation detector. Successful siRNA delivery was achieved (i.e. > 50% cell uptake) with high viability (> 80% viability). The percentage of cells with siRNA uptake was correlated with the amount of inertial cavitation activity generated from vaporized PSNE. The siRNA remained functional after delivery, significantly reducing expression of green fluorescent protein (GFP) in a stably transfected cell line. These results show that vaporized PSNE can facilitate siRNA entry into the cytosol of a majority of sonicated cells and may provide a non-endosomal route for siRNA delivery. PMID:25979417

  3. Optical and electronic properties of polyaniline sulfonic acid-ribonucleic acid-gold nanobiocomposites.


    Routh, Parimal; Garai, Ashesh; Nandi, Arun K


    Finely fibrillar polyaniline sulfonic acid (PSA)/ribonucleic acid (RNA) hybrids are developed by wrapping PSA with RNA from a mixture of aqueous PSA (P) and RNA (R) solutions of different compositions. FTIR spectra suggest H-bonding and π-π interactions in the hybrids and dedoping of self doped PSA during hybrid formation. UV-vis spectra exhibit a blue shift of the π-band to polaron band transition of PSA from 870 to 581 nm due to dedoping. The PR hybrids show enhanced PL-properties when excited at 540 nm relative to PSA which also exhibits rectification behavior in current (I)-voltage (V) curves. Gold nanoparticles (Au NPs) grown on these PR hybrids by the reduction of Au(3+) by PSA show different morphologies with varying composition. FTIR spectra of the nanobiocomposites indicate that Au NPs are stabilized by the co-ordination of the nitrogen atoms of -N=Q=N- bonds of PSA (Q = quinonoid ring). The intensity of the Au plasmon band gradually decreases with time but the PL-intensities of the PAu/PRAu nanocomposites increase with time. The PL-intensity of the nanocomposites is higher than that of PSA and PR hybrids. The DC-conductivity of the PR hybrids increases by an order of magnitude on addition of Au NPs. I-V curves of the nanobiocomposites show negative differential resistance (NDR) in PSA rich systems with a stable NDR ratio of 7 in the PRAu21 and PRAu11 hybrids. Possible reasons from the accumulation of charges on the Au NPs and its stabilization through the π-clouds of RNA bases are discussed. The PRAu11 system also exhibits rectification properties with a rectification ratio of 14.

  4. Optical and electronic properties of polyaniline sulfonic acid-ribonucleic acid-gold nanobiocomposites.


    Routh, Parimal; Garai, Ashesh; Nandi, Arun K


    Finely fibrillar polyaniline sulfonic acid (PSA)/ribonucleic acid (RNA) hybrids are developed by wrapping PSA with RNA from a mixture of aqueous PSA (P) and RNA (R) solutions of different compositions. FTIR spectra suggest H-bonding and π-π interactions in the hybrids and dedoping of self doped PSA during hybrid formation. UV-vis spectra exhibit a blue shift of the π-band to polaron band transition of PSA from 870 to 581 nm due to dedoping. The PR hybrids show enhanced PL-properties when excited at 540 nm relative to PSA which also exhibits rectification behavior in current (I)-voltage (V) curves. Gold nanoparticles (Au NPs) grown on these PR hybrids by the reduction of Au(3+) by PSA show different morphologies with varying composition. FTIR spectra of the nanobiocomposites indicate that Au NPs are stabilized by the co-ordination of the nitrogen atoms of -N=Q=N- bonds of PSA (Q = quinonoid ring). The intensity of the Au plasmon band gradually decreases with time but the PL-intensities of the PAu/PRAu nanocomposites increase with time. The PL-intensity of the nanocomposites is higher than that of PSA and PR hybrids. The DC-conductivity of the PR hybrids increases by an order of magnitude on addition of Au NPs. I-V curves of the nanobiocomposites show negative differential resistance (NDR) in PSA rich systems with a stable NDR ratio of 7 in the PRAu21 and PRAu11 hybrids. Possible reasons from the accumulation of charges on the Au NPs and its stabilization through the π-clouds of RNA bases are discussed. The PRAu11 system also exhibits rectification properties with a rectification ratio of 14. PMID:21698302

  5. TFIIIA binds to different domains of 5S RNA and the Xenopus borealis 5S RNA gene.

    PubMed Central

    Sands, M S; Bogenhagen, D F


    We have established the conditions for the reassociation of 5S RNA and TFIIIA to form 7S particles. We tested the ability of altered 5S RNAs to bind TFIIIA, taking advantage of the slower mobility of 7S particles compared with free 5S RNA in native polyacrylamide gels. Linker substitution mutants were constructed encompassing the entire gene, including the intragenic control region. In vitro transcripts of the linker substitution mutants were tested for their ability to bind TFIIIA to form 7S ribonucleoprotein particles. Altered 5S RNAs with base changes in or around helices IV and V, which would interfere with the normal base pairing of that region, showed decreased ability to bind TFIIIA. The transcripts of some mutant genes that were efficiently transcribed (greater than 50% of wild-type efficiency) failed to bind TFIIIA in this gel assay. In contrast, the RNA synthesized from a poorly transcribed mutant, LS 86/97, in which residues 87 to 96 of the RNA were replaced in the single-stranded loop at the base of helix V, bound TFIIIA well. The data indicate that TFIIIA binds to different domains in the 5S RNA gene and 5S RNA. Images PMID:3431548

  6. Evolution of thiol protective systems in prokaryotes

    NASA Technical Reports Server (NTRS)

    Fahey, R. C.; Newton, G. L.


    Biological thiols are essential elements in most aspects of cell function but undergo rapid oxidation to disulfides in the presence of oxygen. The evolution of systems to protect against such oxygen toxicity was essential to the emergence of aerobic life. The protection system used by eukaryotes is based upon glutathione (GSH) and GSH-dependent enzymes but many bacteria lack GSH and apparently use other mechanisms. The objective of this research is to elaborate the thiol protective mechanisms employed by prokaryotes of widely divergent evolutionary origin and to understand why GSH became the central thiol employed in essentially all higher organisms. Thiol-selective fluorescent labeling and HPLC analysis has been used to determine key monothiol components.

  7. Macromolecule diffusion and confinement in prokaryotic cells.


    Mika, Jacek T; Poolman, Bert


    We review recent observations on the mobility of macromolecules and their spatial organization in live bacterial cells. We outline the major fluorescence microscopy-based methods to determine the mobility and thus the diffusion coefficients (D) of molecules, which is not trivial in small cells. The extremely high macromolecule crowding of prokaryotes is used to rationalize the reported lower diffusion coefficients as compared to eukaryotes, and we speculate on the nature of the barriers for diffusion observed for proteins (and mRNAs) in vivo. Building on in vitro experiments and modeling studies, we evaluate the size dependence of diffusion coefficients for macromolecules in vivo, in case of both water-soluble and integral membrane proteins. We comment on the possibilities of anomalous diffusion and provide examples where the macromolecule mobility may be limiting biological processes.

  8. International code of nomenclature of prokaryotes

    SciTech Connect

    Garrity, George M.; Parker, Charles T.; Tindall, Brian J.


    Here, this volume contains the edition of the International Code of Nomenclature of Prokaryotes that was presented in draft form and available for comment at the Plenary Session of the Fourteenth International Congress of Bacteriology and Applied Microbiology (BAM), Montréal, 2014, together with updated lists of conserved and rejected bacterial names and of Opinions issued by the Judicial Commission. As in the past it brings together those changes accepted, published and documented by the ICSP and the Judicial Commission since the last revision was published. Several new appendices have been added to this edition. Appendix 11 addresses the appropriate application of the Candidatus concept, Appendix 12 contains the history of the van Niel Prize, and Appendix 13 contains the summaries of Congresses.

  9. International code of nomenclature of prokaryotes


    Garrity, George M.; Parker, Charles T.; Tindall, Brian J.


    Here, this volume contains the edition of the International Code of Nomenclature of Prokaryotes that was presented in draft form and available for comment at the Plenary Session of the Fourteenth International Congress of Bacteriology and Applied Microbiology (BAM), Montréal, 2014, together with updated lists of conserved and rejected bacterial names and of Opinions issued by the Judicial Commission. As in the past it brings together those changes accepted, published and documented by the ICSP and the Judicial Commission since the last revision was published. Several new appendices have been added to this edition. Appendix 11 addresses the appropriate applicationmore » of the Candidatus concept, Appendix 12 contains the history of the van Niel Prize, and Appendix 13 contains the summaries of Congresses.« less

  10. Arsenic transport in prokaryotes and eukaryotic microbes.


    Rosen, Barry P; Tamás, Markus J


    Aquaporins (AQPs) and aquaglyceroporins facilitate transport of a broad spectrum of substrates such as water, glycerol and other small uncharged solutes. More recently, AQPs ave also been shown to facilitate diffusion of metalloids such as arsenic (As) and antimony (Sb). At neutral pH, the trivalent forms of these metalloids are structurally similar to glycerol and hence they can enter cells through AQPs. As- and Sb-containing compounds are toxic to cells, yet both metalloids are used as chemotherapeutic agents for treating acute promyelocytic leukemia and diseases caused by protozoan parasites. In this chapter, we will review the role of AQPs and other proteins in metalloid transport in prokaryotes and eukaryotic microbes.

  11. [Thermophilic prokaryotes from deep subterranean habitats].


    Slobodkin, A I; Slobodkina, G B


    The deep continental biosphere consists of geologically isolated ecosystems differing in their physicochemical, geological, and trophic parameters. Most of the deep ecosystems exist at elevated temperatures (50-120 degrees C), which favor the development of thermophilic microorganisms. In many cases, indigenous nature of subsurface microorganisms is questionable due to problems of collecting representative and non-contaminated samples. In spite of the numerous studies on the deep biosphere microbial communities, the number of cultivated thermophiles isolated from subsurface environments not associated with petroleum deposits does not exceed 30 species. More than half of the thermophilic species isolated from deep subsurface belong to the Firmicutes. Majority of the underground thermophiles are subsurface strict or facultative anaerobes, with capacity for sulfate and iron reduction are notably widespread. Most thermophilic subsurface microorganisms are organotrophs, although chemolithoautotrophic thermophiles also have been reported. This review deals with the phylogenetic diversity and physiological properties of the cultivated thermophilic prokaryotes isolated from various deep subterranean habitats.

  12. Detecting uber-operons in prokaryotic genomes.


    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying


    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database:, the first of its kind.

  13. Translational Selection Is Ubiquitous in Prokaryotes

    PubMed Central

    Supek, Fran; Škunca, Nives; Repar, Jelena; Vlahoviček, Kristian; Šmuc, Tomislav


    Codon usage bias in prokaryotic genomes is largely a consequence of background substitution patterns in DNA, but highly expressed genes may show a preference towards codons that enable more efficient and/or accurate translation. We introduce a novel approach based on supervised machine learning that detects effects of translational selection on genes, while controlling for local variation in nucleotide substitution patterns represented as sequence composition of intergenic DNA. A cornerstone of our method is a Random Forest classifier that outperformed previous distance measure-based approaches, such as the codon adaptation index, in the task of discerning the (highly expressed) ribosomal protein genes by their codon frequencies. Unlike previous reports, we show evidence that translational selection in prokaryotes is practically universal: in 460 of 461 examined microbial genomes, we find that a subset of genes shows a higher codon usage similarity to the ribosomal proteins than would be expected from the local sequence composition. These genes constitute a substantial part of the genome—between 5% and 33%, depending on genome size—while also exhibiting higher experimentally measured mRNA abundances and tending toward codons that match tRNA anticodons by canonical base pairing. Certain gene functional categories are generally enriched with, or depleted of codon-optimized genes, the trends of enrichment/depletion being conserved between Archaea and Bacteria. Prominent exceptions from these trends might indicate genes with alternative physiological roles; we speculate on specific examples related to detoxication of oxygen radicals and ammonia and to possible misannotations of asparaginyl–tRNA synthetases. Since the presence of codon optimizations on genes is a valid proxy for expression levels in fully sequenced genomes, we provide an example of an “adaptome” by highlighting gene functions with expression levels elevated specifically in thermophilic

  14. Magnetite as a prokaryotic biomarker: A review

    NASA Astrophysics Data System (ADS)

    Jimenez-Lopez, Concepcion; Romanek, Christopher S.; Bazylinski, Dennis A.


    Over the years, nanometer-sized magnetite (Fe3O4) crystals have been recovered from many modern and ancient environments including sediments and soils and even meteorites. In some cases these crystals have been used as "magnetofossils" for evidence of the past presence of specific microbes. Magnetite nanocrystals can be formed by a number of different biological and inorganic mechanisms resulting in crystals with different physical and magnetic characteristics. Prokaryotes (bacteria) biomineralize magnetite through two methods that differ mechanistically, including: biologically induced mineralization (BIM) and biologically controlled mineralization (BCM). Magnetite nanocrystals produced by BIM are known to be synthesized by the dissimilatory iron-reducing bacteria, are deposited external to the cell, and generally are physically indistinguishable from magnetite particles formed inorganically. BCM magnetites, in contrast, are synthesized by the magnetotactic bacteria and some higher organisms and are precipitated intracellularly as membrane-bounded structures called magnetosomes. These magnetites appear to have unique crystal morphologies and a narrow size range leading to their original use as magnetofossils. Because of the discovery of nanometer-sized crystals of magnetite in the Martian meteorite ALH84001, the use of these criteria for the determination of whether magnetite crystals could constitute a prokaryotic biomarker was questioned. Thus, there is currently great debate over what criteria to use in the determination of whether specific magnetite crystals are biogenic or not. In the last decade, additional criteria have been established (e.g., the Magnetite Assay for Biogenicity), and new tools and technologies have been developed to determine the origin of specific types of magnetite crystals.

  15. Human immunodeficiency virus trans-activator of transcription peptide detection via ribonucleic acid aptamer on aminated diamond biosensor

    NASA Astrophysics Data System (ADS)

    Rahim Ruslinda, A.; Wang, Xianfen; Ishii, Yoko; Ishiyama, Yuichiro; Tanabe, Kyosuke; Kawarada, Hiroshi


    The potential of ribonucleic acid (RNA) as both informational and ligand binding molecule have opened a scenario in the development of biosensors. An aminated diamond-based RNA aptasensor is presented for human immunodeficiency virus (HIV) trans-activator of transcription (Tat) peptide protein detection that not only gives a labeled or label-free detection method but also provides a reusable platform for a simple, sensitive, and selective detection of proteins. The immobilized procedure was based on the binding interaction between positively charged amine terminated diamond and the RNA aptamer probe molecules with the negatively charged surface carboxylic compound linker molecule such as terephthalic acid.

  16. Antibacterial Action of Primaquine: Effects In Vitro on Polypeptide Synthesis and In Vivo on Ribosomes and Ribosomal Ribonucleic Acid

    PubMed Central

    Olenick, John G.


    Primaquine inhibited polyphenylalanine formation directed by poly(U) in a cell-free system obtained from Bacillus megaterium only when the drug was preincubated with transfer ribonucleic acid (tRNA), poly(U), or ribosomes. Considerably less inhibition was produced when the ionic strength of the preincubation mixture of tRNA or poly(U) plus primaquine was increased; with ribosomes, the extent of inhibition was only slightly reduced. In cultures of B. megaterium, primaquine induced the breakdown of ribosomes and their RNA. PMID:813574

  17. Oligonucleotide-conjugated thiazole orange probes as "light-up" probes for messenger ribonucleic acid molecules in living cells.


    Privat, E; Melvin, T; Asseline, U; Vigny, P


    "Light-up" probes, icosa-alpha-thymidylate-thiazole orange conjugates, for the in situ time-resolved detection of messenger ribonucleic acid (mRNA) in living cells are evaluated. Upon annealing with polyA in aqueous solutions, the icosa-alpha-thymidylate-thiazole orange conjugates were shown to be up to 15 times more fluorescent. Microinjection of these probes into adherent fibroblasts resulted in high yields of hybridization and fluorescent signals. Incubation of cells in the presence of these probes resulted in facile internalization of the probe and similar painting of the messenger RNA in the nuclear and cytosolic regions.

  18. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR


    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  19. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR


    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  20. L5-S1 Laparoscopic Anterior Interbody Fusion

    PubMed Central

    Zeni, Tallal M.; Phillips, Frank M.; Mathur, Sameer; Zografakis, John G.; Moore, Ronald M.; Laguna, Luis E.


    Objective: We evaluated our experience with laparoscopic L5-S1 anterior lumbar interbody fusion (ALIF). Methods: This represents a retrospective analysis of consecutive patients who underwent L5-S1 laparoscopic ALIF between February 1998 and August 2003. Results: Twenty-eight patients underwent L5-S1 LAIF (15 males and 13 females). The mean age was 43 years (range, 26 to 67). Mean operative time was 225 minutes (range, 137 to 309 minutes). No conversions to an open procedure were necessary. Twenty-four (85.7%) patients underwent successful bilateral cage placement. Four patients (14.3%) in whom only a single cage could be placed underwent supplementary posterior pedicle screw placement. Mean length of stay (LOS) was 4.1 days (range, 2 to 15). Two patients underwent reoperation subacutely secondary to symptomatic lateral displacement of the cage. One patient developed radiculopathy 6 months postoperatively and required reoperation. One patient developed a small bowel obstruction secondary to adhesions to the cage requiring laparoscopic reoperation. Fusion was achieved in all patients. Visual analogue scale scores for back pain were significantly improved from 8.6±0.8 to 2.8±0.8 (P<0.0001) at 1 year. Conclusion: L5-S1 LAIF is feasible and safe with all the advantages of minimally invasive surgery. Fusion rates and pain improvement were comparable to those with an open repair. PMID:17575763

  1. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko


    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  2. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

    PubMed Central

    MacKay, R M; Salgado, D; Bonen, L; Stackebrandt, E; Doolittle, W F


    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described. PMID:7099971

  3. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A


    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  4. Comparison of Two Serologically Distinct Ribonucleic Acid Bacteriophages II. Properties of the Nucleic Acids and Coat Proteins

    PubMed Central

    Overby, L. R.; Barlow, G. H.; Doi, R. H.; Jacob, Monique; Spiegelman, S.


    Overby, L. R. (University of Illinois, Urbana), G. H. Barlow, R. H. Doi, Monique Jacob, and S. Spiegelman. Comparison of two serologically distinct ribonucleic acid bacteriophages. II. Properties of the nucleic acids and coat proteins. J. Bacteriol. 92:739–745. 1966.—The ribonucleic acid (RNA) molecules and coat proteins of two RNA coliphages, MS-2 and Qβ, have been characterized. MS-2 RNA shows an S20,w of 25.8 and a molecular weight by light scattering of 106. The corresponding parameters for Qβ-RNA were 28.9 and 0.9 × 106. A difference in base composition was reflected in the adenine-uracil ratio, which was 0.95 for MS-2 and 0.75 for Qβ. The two RNA preparations are readily separated by chromatography on columns of methylated albumin. Both gave identical bouyant densities in cesium sulfate of 1.64 g/ml. The coat protein subunits were of similar molecular weights: 15,500 (Qβ) and 14,000 (MS-2). They differed, however, in that the Qβ-protein lacked tryptophan and histidine, whereas the MS-2 protein lacked only histidine. Images PMID:5922545

  5. Tn9 and IS1 inserts in a ribosomal ribonucleic acid operon of Escherichia coli are incompletely polar.

    PubMed Central

    Brewster, J M; Morgan, E A


    Transcription is known to be coupled to translation in many or all bacterial operons which code for proteins. In these operons, nonsense codons which prevent normal translation often result in premature termination of transcription (polarity). However, efficient transcription of ribosomal ribonucleic acid operons (rrn operons) occurs, although rrn transcripts are not translated. It therefore seemed possible that insertion sequences and transposable elements which are polar in protein-coding operons might not be polar in rrn operons. Previously, it has been shown (E. A. Morgan, Cell 21:257-265, 1980) that Tn10 is incompletely polar in the rrnX operon. Here we show that the transposon Tn9 and the insertion sequence IS1 also incompletely polar in rrnX. In normal cells expression of sequences distal to the insertions can be detected by genetic methods. In ultraviolet-irradiated cells expression of distal sequences is about 80% of that observed in uninterrupted rrnX operons. These observations provide evidence that ribonucleic acid polymerase molecules beginning at rrnX promoters can read through Tn9 and IS1 and that, at least in ultraviolet-irradiated cells, read-through is very efficient. Images PMID:6171559

  6. Prokaryote diversity and taxonomy: current status and future challenges.


    Oren, Aharon


    The prokaryotes are by far the most abundant organisms inhabiting planet Earth. They are also by far the most diverse, both metabolically and phylogenetically; they encompass the Bacteria and the Archaea, two out of the three major divisions of living organisms. The current prokaryote species classification is based on a combination of genomic and phenotypic properties. The recommended cut-off value of 70% DNA-DNA similarity to delineate species signifies an extremely broad species definition for the prokaryotes compared with the higher eukaryotes. The number of validly named species of prokaryotes is currently slightly more than 6200. However, on the basis of small-subunit rDNA characterization of whole communities and other approaches, the more exact number of species present can be inferred to be at least two orders of magnitude larger. Classic culturing methods based on colony formation on agar are generally unsatisfactory for the recovery of bacteria from the environment. Many of the most abundant prokaryotes in nature have not yet been brought into culture. Some of these may thrive by means of as yet unknown modes of energy generation. Several novel methods have recently enabled the isolation of some interesting organisms of environmental significance. A better coverage of the prokaryote diversity on Earth depends on such innovative approaches, combined with appropriate funding.

  7. Solitary restriction endonucleases in prokaryotic genomes

    PubMed Central

    Ershova, Anna S.; Karyagina, Anna S.; Vasiliev, Mikhail O.; Lyashchuk, Alexander M.; Lunin, Vladimir G.; Spirin, Sergey A.; Alexeevski, Andrei V.


    Prokaryotic restriction-modification (R-M) systems defend the host cell from the invasion of a foreign DNA. They comprise two enzymatic activities: specific DNA cleavage activity and DNA methylation activity preventing cleavage. Typically, these activities are provided by two separate enzymes: a DNA methyltransferase (MTase) and a restriction endonuclease (RE). In the absence of a corresponding MTase, an RE of Type II R-M system is highly toxic for the cell. Genes of the R-M system are linked in the genome in the vast majority of annotated cases. There are only a few reported cases in which the genes of MTase and RE from one R-M system are not linked. Nevertheless, a few hundreds solitary RE genes are present in the Restriction Enzyme Database ( annotations. Using the comparative genomic approach, we analysed 272 solitary RE genes. For 57 solitary RE genes we predicted corresponding MTase genes located distantly in a genome. Of the 272 solitary RE genes, 99 are likely to be fragments of RE genes. Various explanations for the existence of the remaining 116 solitary RE genes are also discussed. PMID:22965118

  8. How prokaryotes deal with arsenic(†).


    Slyemi, Djamila; Bonnefoy, Violaine


    Arsenic is a notorious poison classified as a carcinogen, a teratogen and a clastogen that ranks number one on the Environmental Protection Agency's priority list of drinking water contaminants. It is ubiquitous and relatively abundant in the Earth's crust. Its mobilization in waters by weathering, volcanic, anthropogenic or biological activities represents a major hazard to public health, exemplified in India and Bangladesh where 50 million people are acutely at risk. Since basically the origin of life, microorganisms have been exposed to this toxic compound and have evolved a variety of resistance mechanisms, such as extracellular precipitation, chelation, intracellular sequestration, active extrusion from the cell or biochemical transformation (redox or methylation). Arsenic efflux systems are widespread and are found in nearly all organisms. Some microorganisms are also able to utilize this metalloid as a metabolic energy source through either arsenite oxidation or arsenate reduction. The energy metabolism involving redox reactions of arsenic has been suggested to have evolved during early life on Earth. This review highlights the different systems evolved by prokaryotes to cope with arsenic and how they participate in its biogeochemical cycle. PMID:23760928

  9. Eukaryotic and Prokaryotic Cytoskeletons: Structure and Mechanics

    NASA Astrophysics Data System (ADS)

    Gopinathan, Ajay


    The eukaryotic cytoskeleton is an assembly of filamentous proteins and a host of associated proteins that collectively serve functional needs ranging from spatial organization and transport to the production and transmission of forces. These systems can exhibit a wide variety of non-equilibrium, self-assembled phases depending on context and function. While much recent progress has been made in understanding the self-organization, rheology and nonlinear mechanical properties of such active systems, in this talk, we will concentrate on some emerging aspects of cytoskeletal physics that are promising. One such aspect is the influence of cytoskeletal network topology and its dynamics on both active and passive intracellular transport. Another aspect we will highlight is the interplay between chirality of filaments, their elasticity and their interactions with the membrane that can lead to novel conformational states with functional implications. Finally we will consider homologs of cytoskeletal proteins in bacteria, which are involved in templating cell growth, segregating genetic material and force production, which we will discuss with particular reference to contractile forces during cell division. These prokaryotic structures function in remarkably similar yet fascinatingly different ways from their eukaryotic counterparts and can enrich our understanding of cytoskeletal functioning as a whole.

  10. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B


    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  11. Evidence for messenger ribonucleic acid of an ammonium-inducible glutamate dehydrogenase and synthesis, covalent modification, and degradation of enzyme subunits in uninduced Chlorella sorokiniana cells.

    PubMed Central

    Turner, K J; Bascomb, N F; Lynch, J J; Molin, W T; Thurston, C F; Schmidt, R R


    The cells of Chlorella sorokiniana cultured in nitrate medium contain no detectable catalytic activity of an ammonium-inducible nicotinamide adenine dinucleotide phosphate-specific glutamate dehydrogenase (NADP-GDH). However, several lines of experimental evidence indicated that the NADP-GDH messenger ribonucleic acid was present at high levels and was being translated in uninduced cells. First, binding studies with 125I-labeled anti-NADP-GDH immunoglobulin G and total polysomes isolated from uninduced and induced cells showed that NADP-GDH subunits were being synthesized on polysomes from both types of cells. Second, when polyadenylic acid-containing ribonucleic acid was extracted from polysomes from uninduced and induced cells and placed into a messenger ribonucleic acid-dependent in vitro translation system, NADP-GDH subunits were synthesized from the ribonucleic acid from both sources. Third, when ammonia was added to uninduced cells, NADP-GDH antigen accumulated without an apparent induction lag. Fourth, by use of a specific immunoprecipitation procedure coupled to pulse-chase studies with [35S]sulfate, it was shown that the NADP-GDH subunits are rapidly synthesized, covalently modified, and then degraded in uninduced cells. PMID:7217012

  12. A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA.


    Lang, B F; Goff, L J; Gray, M W


    Except in the case of land plants, mitochondrial ribosomes apparently lack a 5 S rRNA species, even though this small RNA is a component of all prokaryotic, chloroplast and eukaryotic cytosol ribosomes. In plants, the mitochondrial 5 S rRNA is encoded by mtDNA and differs in sequence from the 5 S rRNA specified by plant nuclear and chloroplast genomes. A distinctive 5 S rRNA component has not been found in the mitochondrial ribosomes of non-plant eukaryotes and, with the notable exception of the chlorophycean alga, Prototheca wickerhamii, a 5 S rRNA gene has not been identified in those non-plant mtDNAs characterized to date. Here, we report the presence of a 5 S rRNA gene in the mtDNA of the heterotrophic flagellate Reclinomonas americana. This unicellular eukaryote is a member of the jakobid flagellates, an early-diverging group of protists that share ultrastructural characteristics with the retortamonads, primitive protists that lack mitochondria. We report sequence data from the mtDNAs of the red algae Porphyra purpurea and Gracilariopsis lemaneiformis, which we use to evaluate a recent claim that a 5 S rRNA gene exists in the mtDNA of a third rhodophyte alga, Chondrus crispus. Our results lead us to the opposite conclusion: that a 5 S rRNA gene is not encoded by red algal mtDNA. In view of the accumulating evidence favoring a monophyletic origin of the mitochondrial genome, it is likely that a 5 S rRNA gene was present in an ancestral proto-mitochondrial genome, and that contemporary mtDNA-encoded 5 S rRNA genes have all descended from this ancestral gene. Considering the highly restricted phylogenetic distribution of identified mtDNA-encoded 5 S rRNA genes, it follows that the mitochondrial 5 S rRNA gene must have been lost multiple times during evolutionary diversification of the eukaryotic lineage.

  13. Evolutionary constraints of phosphorylation in eukaryotes, prokaryotes, and mitochondria.


    Gnad, Florian; Forner, Francesca; Zielinska, Dorota F; Birney, Ewan; Gunawardena, Jeremy; Mann, Matthias


    High accuracy mass spectrometry has proven to be a powerful technology for the large scale identification of serine/threonine/tyrosine phosphorylation in the living cell. However, despite many described phosphoproteomes, there has been no comparative study of the extent of phosphorylation and its evolutionary conservation in all domains of life. Here we analyze the results of phosphoproteomics studies performed with the same technology in a diverse set of organisms. For the most ancient organisms, the prokaryotes, only a few hundred proteins have been found to be phosphorylated. Applying the same technology to eukaryotic species resulted in the detection of thousands of phosphorylation events. Evolutionary analysis shows that prokaryotic phosphoproteins are preferentially conserved in all living organisms, whereas-site specific phosphorylation is not. Eukaryotic phosphosites are generally more conserved than their non-phosphorylated counterparts (with similar structural constraints) throughout the eukaryotic domain. Yeast and Caenorhabditis elegans are two exceptions, indicating that the majority of phosphorylation events evolved after the divergence of higher eukaryotes from yeast and reflecting the unusually large number of nematode-specific kinases. Mitochondria present an interesting intermediate link between the prokaryotic and eukaryotic domains. Applying the same technology to this organelle yielded 174 phosphorylation sites mapped to 74 proteins. Thus, the mitochondrial phosphoproteome is similarly sparse as the prokaryotic phosphoproteomes. As expected from the endosymbiotic theory, phosphorylated as well as non-phosphorylated mitochondrial proteins are significantly conserved in prokaryotes. However, mitochondrial phosphorylation sites are not conserved throughout prokaryotes, consistent with the notion that serine/threonine phosphorylation in prokaryotes occurred relatively recently in evolution. Thus, the phosphoproteome reflects major events in the

  14. The copper metallome in prokaryotic cells.


    Rensing, Christopher; McDevitt, Sylvia Franke


    As a trace element copper has an important role in cellular function like many other transition metals. Its ability to undergo redox changes [Cu(I) ↔ Cu(II)] makes copper an ideal cofactor in enzymes catalyzing electron transfers. However, this redox change makes copper dangerous for a cell since it is able to be involved in Fenton-like reactions creating reactive oxygen species (ROS). Cu(I) also is a strong soft metal and can attack and destroy iron-sulfur clusters thereby releasing iron which can in turn cause oxidative stress. Therefore, copper homeostasis has to be highly balanced to ensure proper cellular function while avoiding cell damage.Throughout evolution bacteria and archaea have developed a highly regulated balance in copper metabolism. While for many prokaryotes copper uptake seems to be unspecific, others have developed highly sophisticated uptake mechanisms to ensure the availability of sufficient amounts of copper. Within the cytoplasm copper is sequestered by various proteins and molecules, including specific copper chaperones, to prevent cellular damage. Copper-containing proteins are usually located in the cytoplasmic membrane with the catalytic domain facing the periplasm, in the periplasm of Gram-negative bacteria, or they are secreted, limiting the necessity of copper to accumulate in the cytoplasm. To prevent cellular damage due to excess copper, bacteria and archaea have developed various copper detoxification strategies. In this chapter we attempt to give an overview of the mechanisms employed by bacteria and archaea to handle copper and the importance of the metal for cellular function as well as in the global nutrient cycle.

  15. 5S rDNA genome regions of Lens species.


    Fernández, M; Ruiz, M L; Linares, C; Fominaya, A; Pérez de la Vega, M


    The length variability of the nontranscribed spacer (NTS) of the 5S rDNA repeats was analyzed in species of the genus Lens by means of PCR amplification. The NTS ranged from approximately 227 to approximately 952 bp. The polymorphism detected was higher than previous NTS polymorphisms described in this genus. Three NTS length variants from Lens culinaris subsp. culinaris and 2 from Lens culinaris subsp. orientalis were sequenced. The culinaris NTS fragment lengths were 239, 371, and 838 bp, whereas the orientalis ones were 472 bp and 506 bp, respectively. As a result of sequence similarities, 2 families of sequences were distinguished, 1 including the sequences of 838 and 506 bp, and others with the sequences of 239, 371, and 472 bp. The 1st family was characterized by the presence of a repeated sequence designated A, whereas the 2nd family showed a single A sequence and other repeated sequences designated B, C, and D. The presence of an (AT)n microsatellite was also observed in the 2nd family of sequences. The fragments, which included the 239-bp and 838-bp NTS sequences, as well as the intergenic spacer (IGS) of the 18S-5.8S-26S ribosomal DNA also from L. culinaris subsp. culinaris, were used to localize the nucleolar organizer region (NOR) and the 5S rDNA loci in the chromosomes of several species of the genus Lens by means of fluorescence in situ hybridization (FISH). The selective hybridization of the 2 NTS probes allowed us to distinguish between different 5S rDNA chromosomal loci.

  16. Effect of Infection with Ribonucleic Acid Bacteriophage R23 on the Inducible Synthesis of β-Galactosidase in Escherichia coli

    PubMed Central

    Watanabe, Hiroko; Watanabe, Mamoru


    Infection by ribonucleic acid (RNA) bacteriophage R23 inhibited the synthesis of β-galactosidase in Escherichia coli. The inhibition, although not complete, was apparent shortly after infection and was maximal after the first 20 min of infection. R23 diminished the β-galactosidase-synthesizing capacity when inducer was added after phage infection, but not when infection followed inducer removal. These findings suggested that the primary effect of R23 on enzyme-forming capacity was limitation of synthesis of enzyme-specific messenger RNA. Studies with ultraviolet irradiated phage and amber mutants of R23 indicated that the inhibitory process could be separated into two phases. Early inhibition did not require the expression of the viral genome, whereas late inhibition required the expression of the viral RNA synthetase cistron. PMID:4910818

  17. Simian Virus 40 Deoxyribonucleic Acid Transcription In Vitro: Binding and Transcription Patterns with a Mammalian Ribonucleic Acid Polymerase 1

    PubMed Central

    Herzberg, Max; Winocour, Ernest


    The in vitro transcription pattern of simian virus 40 (SV40) deoxyribonucleic acid (DNA) by a mammalian ribonucleic acid (RNA) polymerase, was studied by electron microscopy and velocity sedimentation techniques. It was found that (i) the majority of supercoiled SV40 DNA molecules displayed a single binding site for the enzyme, (ii) the supercoiled structure of SV40 DNA was frequently retained during transcription, and (iii) the majority of RNA molecules synthesized from the supercoiled SV40 DNA template showed no self-complementarity and sedimented relatively homogeneously in the 15S to 16S region of a sucrose gradient (in contrast, the RNA product synthesized from the nicked-circular SV40 DNA template showed self-complementarity and sedimented heterogeneously). RNA polymerase preparations isolated from SV40-infected monkey cells were more active than those isolated from uninfected monkey cells. Images PMID:4320700

  18. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.


    Ulbrich, N; Lin, A; Wool, I G


    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  19. Determination of base ratios of six ribonucleic acid bacteriophages specific to Escherichia coli

    PubMed Central

    Bishop, D. H. L.; Bradley, D. E.


    1. A method is described for the isolation of single-stranded-RNA coliphages. Two of the six RNA coliphages investigated were new strains. 2. The base ratios of six RNA coliphages were determined by labelling the host bacterium with [32P]-phosphate, purification of the radioactive coliphages and separation of 2′,3′-ribonucleotides liberated by alkaline hydrolysis of the coliphage RNA. 3. All six of the coliphages were morphologically similar, contained single-stranded RNA, and had sedimentation coefficient 80±5s. 4. The six RNA coliphages fell into two distinct groups, both serologically and in terms of their RNA base ratios. PMID:14333571

  20. Coevolution of the Organization and Structure of Prokaryotic Genomes.


    Touchon, Marie; Rocha, Eduardo P C


    The cytoplasm of prokaryotes contains many molecular machines interacting directly with the chromosome. These vital interactions depend on the chromosome structure, as a molecule, and on the genome organization, as a unit of genetic information. Strong selection for the organization of the genetic elements implicated in these interactions drives replicon ploidy, gene distribution, operon conservation, and the formation of replication-associated traits. The genomes of prokaryotes are also very plastic with high rates of horizontal gene transfer and gene loss. The evolutionary conflicts between plasticity and organization lead to the formation of regions with high genetic diversity whose impact on chromosome structure is poorly understood. Prokaryotic genomes are remarkable documents of natural history because they carry the imprint of all of these selective and mutational forces. Their study allows a better understanding of molecular mechanisms, their impact on microbial evolution, and how they can be tinkered in synthetic biology.

  1. Energetics and genetics across the prokaryote-eukaryote divide

    PubMed Central


    Background All complex life on Earth is eukaryotic. All eukaryotic cells share a common ancestor that arose just once in four billion years of evolution. Prokaryotes show no tendency to evolve greater morphological complexity, despite their metabolic virtuosity. Here I argue that the eukaryotic cell originated in a unique prokaryotic endosymbiosis, a singular event that transformed the selection pressures acting on both host and endosymbiont. Results The reductive evolution and specialisation of endosymbionts to mitochondria resulted in an extreme genomic asymmetry, in which the residual mitochondrial genomes enabled the expansion of bioenergetic membranes over several orders of magnitude, overcoming the energetic constraints on prokaryotic genome size, and permitting the host cell genome to expand (in principle) over 200,000-fold. This energetic transformation was permissive, not prescriptive; I suggest that the actual increase in early eukaryotic genome size was driven by a heavy early bombardment of genes and introns from the endosymbiont to the host cell, producing a high mutation rate. Unlike prokaryotes, with lower mutation rates and heavy selection pressure to lose genes, early eukaryotes without genome-size limitations could mask mutations by cell fusion and genome duplication, as in allopolyploidy, giving rise to a proto-sexual cell cycle. The side effect was that a large number of shared eukaryotic basal traits accumulated in the same population, a sexual eukaryotic common ancestor, radically different to any known prokaryote. Conclusions The combination of massive bioenergetic expansion, release from genome-size constraints, and high mutation rate favoured a protosexual cell cycle and the accumulation of eukaryotic traits. These factors explain the unique origin of eukaryotes, the absence of true evolutionary intermediates, and the evolution of sex in eukaryotes but not prokaryotes. Reviewers This article was reviewed by: Eugene Koonin, William Martin

  2. Origins of prokaryotes, eukaryotes, mitochondria, and chloroplasts

    NASA Technical Reports Server (NTRS)

    Schwartz, R. M.; Dayhoff, M. O.


    A computer branching model is used to analyze cellular evolution. Attention is given to certain key amino acids and nucleotide residues (ferredoxin, 5s ribosomal RNA, and c-type cytochromes) because of their commonality over a wide variety of cell types. Each amino acid or nucleotide residue is a sequence in an inherited biological trait; and the branching method is employed to align sequences so that changes reflect substitution of one residue for another. Based on the computer analysis, the symbiotic theory of cellular evolution is considered the most probable. This theory holds that organelles, e.g., mitochondria and chloroplasts invaded larger bodies, e.g., bacteria, and combined functions to form eucaryotic cells.

  3. PECAS: prokaryotic and eukaryotic classical analysis of secretome.


    Cortazar, Ana R; Oguiza, José A; Aransay, Ana M; Lavín, José L


    Full sets of proteins that are transported to the extracellular space, called secretomes, have been studied for a variety of organisms to understand their potential role in crucial metabolic pathways and complex health conditions. However, there is a lack of tools for integrative classical analysis of secretomes that consider all the data sources available nowadays. Thus, PECAS (Prokaryotic and Eukaryotic Classical Analysis of Secretome) has been developed to provide a well-established prediction pipeline on secreted proteins for prokaryote and eukaryote species. PMID:26233761

  4. Evolution of early life inferred from protein and ribonucleic acid sequences

    NASA Technical Reports Server (NTRS)

    Dayhoff, M. O.; Schwartz, R. M.


    The chemical structures of ferredoxin, 5S ribosomal RNA, and c-type cytochrome sequences have been employed to construct a phylogenetic tree which connects all major photosynthesizing organisms: the three types of bacteria, blue-green algae, and chloroplasts. Anaerobic and aerobic bacteria, eukaryotic cytoplasmic components and mitochondria are also included in the phylogenetic tree. Anaerobic nonphotosynthesizing bacteria similar to Clostridium were the earliest organisms, arising more than 3.2 billion years ago. Bacterial photosynthesis evolved nearly 3.0 billion years ago, while oxygen-evolving photosynthesis, originating in the blue-green algal line, came into being about 2.0 billion years ago. The phylogenetic tree supports the symbiotic theory of the origin of eukaryotes.

  5. The prokaryotic FAD synthetase family: a potential drug target.


    Serrano, Ana; Ferreira, Patricia; Martínez-Júlvez, Marta; Medina, Milagros


    Disruption of cellular production of the flavin cofactors, flavin adenine mononucleotide (FMN) and flavin adenine dinucleotide(FAD) will prevent the assembly of a large number of flavoproteins and flavoenzymes involved in key metabolic processes in all types of organisms. The enzymes responsible for FMN and FAD production in prokaryotes and eukaryotes exhibit various structural characteristics to catalyze the same chemistry, a fact that converts the prokaryotic FAD synthetase (FADS) in a potential drug target for the development of inhibitors endowed with anti-pathogenic activity. The first step before searching for selective inhibitors of FADS is to understand the structural and functional mechanisms for the riboflavin kinase and FMN adenylyltransferase activities of the prokaryotic enzyme, and particularly to identify their differential functional characteristics with regard to the enzymes performing similar functions in other organisms, particularly humans. In this paper, an overview of the current knowledge of the structure-function relationships in prokaryotic FADS has been presented, as well as of the state of the art in the use of these enzymes as drug targets.

  6. Calcium binding proteins and calcium signaling in prokaryotes.


    Domínguez, Delfina C; Guragain, Manita; Patrauchan, Marianna


    With the continued increase of genomic information and computational analyses during the recent years, the number of newly discovered calcium binding proteins (CaBPs) in prokaryotic organisms has increased dramatically. These proteins contain sequences that closely resemble a variety of eukaryotic calcium (Ca(2+)) binding motifs including the canonical and pseudo EF-hand motifs, Ca(2+)-binding β-roll, Greek key motif and a novel putative Ca(2+)-binding domain, called the Big domain. Prokaryotic CaBPs have been implicated in diverse cellular activities such as division, development, motility, homeostasis, stress response, secretion, transport, signaling and host-pathogen interactions. However, the majority of these proteins are hypothetical, and only few of them have been studied functionally. The finding of many diverse CaBPs in prokaryotic genomes opens an exciting area of research to explore and define the role of Ca(2+) in organisms other than eukaryotes. This review presents the most recent developments in the field of CaBPs and novel advancements in the role of Ca(2+) in prokaryotes.

  7. Metagenome sequencing of prokaryotic microbiota collected from Byron Glacier, Alaska.


    Choudhari, Sulbha; Smith, Sean; Owens, Sarah; Gilbert, Jack A; Shain, Daniel H; Dial, Roman J; Grigoriev, Andrey


    Cold environments, such as glaciers, are large reservoirs of microbial life. The present study employed 16S rRNA gene amplicon metagenomic sequencing to survey the prokaryotic microbiota on Alaskan glacial ice, revealing a rich and diverse microbial community of some 2,500 species of bacteria and archaea.

  8. Cytokinesis in Prokaryotes and Eukaryotes: Common Principles and Different Solutions

    PubMed Central

    Nanninga, Nanne


    Cytokinesis requires duplication of cellular structures followed by bipolarization of the predivisional cell. As a common principle, this applies to prokaryotes as well as eukaryotes. With respect to eukaryotes, the discussion has focused mainly on Saccharomyces cerevisiae and on Schizosaccharomyces pombe. Escherichia coli and to a lesser extent Bacillus subtilis have been used as prokaryotic examples. To establish a bipolar cell, duplication of a eukaryotic origin of DNA replication as well as its genome is not sufficient. Duplication of the microtubule-organizing center is required as a prelude to mitosis, and it is here that the dynamic cytoskeleton with all its associated proteins comes to the fore. In prokaryotes, a cytoskeleton that pervades the cytoplasm appears to be absent. DNA replication and the concomitant DNA segregation seem to occur without help from extensive cytosolic supramacromolecular assemblies but with help from the elongating cellular envelope. Prokaryotic cytokinesis proceeds through a contracting ring, which has a roughly 100-fold-smaller circumference than its eukaryotic counterpart. Although the ring contains proteins that can be considered as predecessors of actin, tubulin, and microtubule-associated proteins, its macromolecular composition is essentially different. PMID:11381104

  9. Tumor malignancy is engaged to prokaryotic homolog toolbox.


    Fernandes, Janaina; Guedes, Patrícia G; Lage, Celso Luiz S; Rodrigues, Juliany Cola F; Lage, Claudia de Alencar S


    Cancer cells display high proliferation rates and survival provided by high glycolysis, chemoresistance and radioresistance, metabolic features that appear to be activated with malignancy, and seemed to have arisen as early in evolution as in unicellular/prokaryotic organisms. Based on these assumptions, we hypothesize that aggressive phenotypes found in malignant cells may be related to acquired unicellular behavior, launched within a tumor when viral and prokaryotic homologs are overexpressed performing likely robust functions. The ensemble of these expressed viral and prokaryotic close homologs in the proteome of a tumor tissue gives them advantage over normal cells. To assess the hypothesis validity, sequences of human proteins involved in apoptosis, energetic metabolism, cell mobility and adhesion, chemo- and radio-resistance were aligned to homologs present in other life forms, excluding all eukaryotes, using PSI-BLAST, with further corroboration from data available in the literature. The analysis revealed that selected sequences of proteins involved in apoptosis and tumor suppression (as p53 and pRB) scored non-significant (E-value>0.001) with prokaryotic homologs; on the other hand, human proteins involved in cellular chemo- and radio-resistance scored highly significant with prokaryotic and viral homologs (as catalase, E-value=zero). We inferred that such upregulated and/or functionally activated proteins in aggressive malignant cells represent a toolbox of modern human homologs evolved from a similar key set that have granted survival of ancient prokaryotes against extremely harsh environments. According to what has been discussed along this analysis, high mutation rates usually hit hotspots in important conserved protein domains, allowing uncontrolled expansion of more resistant, death-evading malignant clones. That is the case of point mutations in key viral proteins affording viruses escape to chemotherapy, and human homologs of such retroviral

  10. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes

    PubMed Central

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F.


    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners—the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)—and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic—and plant and algal—lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller’s ratchet—the origin of eukaryotic recombination, or sex—might have required surprisingly little evolutionary innovation. PMID:25733873

  11. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes.


    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F


    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners--the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)--and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic--and plant and algal--lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller's ratchet--the origin of eukaryotic recombination, or sex--might have required surprisingly little evolutionary innovation.

  12. Gene duplications in prokaryotes can be associated with environmental adaptation

    PubMed Central


    Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism

  13. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes.


    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F


    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners--the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)--and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic--and plant and algal--lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller's ratchet--the origin of eukaryotic recombination, or sex--might have required surprisingly little evolutionary innovation. PMID:25733873

  14. The Occurrence and Distribution of Poly(A) Ribonucleic Acid in Soybean

    PubMed Central

    Key, Joe L.; Silflow, Carolyn


    The occurrence and distribution of poly(A) sequences in the RNA of soybean (Glycine max var. Wayne) have been studied. Only one of the two species of AMP-rich RNA contains poly(A). D-RNA does not contain detectable poly(A) sequences. The TB-RNA is the poly(A) RNA in this system. At least a part (up to 50% or more) of the mRNA in polyribosomes contains a poly(A) sequence. The poly(A) RNA is heterodisperse in size but has a mean size of approximately 18S (2,000 nucleotides) in urea and formamide gels. The poly(A) fragment resulting from ribonuclease A and T1 digestion migrates as a broad band overlapping the 4 to 5.8S regions of the gels with a mean size of somewhat greater than 5S. No evidence was found for the occurrence of a discrete oligo(A) fragment in the poly(A) RNA; however, oligonucleotides which migrate faster than the poly(A) fraction were observed in preparations which were not bound to oligo(dT) cellulose prior to electrophoresis. This oligonucleotide region was enriched in AMP (up to about 65%) as would be expected after ribonuclease A and T1 digestion. PMID:16659304

  15. Viral Regulation of Prokaryotic Carbon Metabolism in a Hypereutrophic Freshwater Reservoir Ecosystem (Villerest, France).


    Pradeep Ram, Angia Sriram; Colombet, Jonathan; Perriere, Fanny; Thouvenot, Antoine; Sime-Ngando, Télesphore


    The current consensus concerning the viral regulation of prokaryotic carbon metabolism is less well-studied, compared to substrate availability. We explored the seasonal and vertical distribution of viruses and its relative influence on prokaryotic carbon metabolism in a hypereutrophic reservoir, Lake Villerest (France). Flow cytometry and transmission electron microscopy (TEM) analyses to determine viral abundance (VA; range = 6.1-63.5 × 10(7) ml(-1)) and viral infection rates of prokaryotes (range = 5.3-32%) respectively suggested that both the parameters varied more significantly with depths than with seasons. Prokaryotic growth efficiency (PGE, considered as a proxy of prokaryotic carbon metabolism) calculated from prokaryotic production and respiration measurements (PGE = prokaryotic production/[prokaryotic production + prokaryotic respiration] × 100) varied from 14 to 80% across seasons and depths. Viruses through selective lyses had antagonistic impacts on PGE by regulating key prokaryotic metabolic processes (i.e., production and respiration). Higher viral lysis accompanied by higher respiration rates and lower PGE in the summer (mean = 22.9 ± 10.3%) than other seasons (mean = 59.1 ± 18.6%), led to significant loss of carbon through bacterial-viral loop and shifted the reservoir system to net heterotrophy. Our data therefore suggests that the putative adverse impact of viruses on the growth efficiency of the prokaryotic community can have strong implications on nutrient flux patterns and on the overall ecosystem metabolism in anthropogenic dominated aquatic systems such as Lake Villerest. PMID:26903963

  16. Viral Regulation of Prokaryotic Carbon Metabolism in a Hypereutrophic Freshwater Reservoir Ecosystem (Villerest, France)

    PubMed Central

    Pradeep Ram, Angia Sriram; Colombet, Jonathan; Perriere, Fanny; Thouvenot, Antoine; Sime-Ngando, Télesphore


    The current consensus concerning the viral regulation of prokaryotic carbon metabolism is less well-studied, compared to substrate availability. We explored the seasonal and vertical distribution of viruses and its relative influence on prokaryotic carbon metabolism in a hypereutrophic reservoir, Lake Villerest (France). Flow cytometry and transmission electron microscopy (TEM) analyses to determine viral abundance (VA; range = 6.1–63.5 × 107 ml-1) and viral infection rates of prokaryotes (range = 5.3–32%) respectively suggested that both the parameters varied more significantly with depths than with seasons. Prokaryotic growth efficiency (PGE, considered as a proxy of prokaryotic carbon metabolism) calculated from prokaryotic production and respiration measurements (PGE = prokaryotic production/[prokaryotic production + prokaryotic respiration] × 100) varied from 14 to 80% across seasons and depths. Viruses through selective lyses had antagonistic impacts on PGE by regulating key prokaryotic metabolic processes (i.e., production and respiration). Higher viral lysis accompanied by higher respiration rates and lower PGE in the summer (mean = 22.9 ± 10.3%) than other seasons (mean = 59.1 ± 18.6%), led to significant loss of carbon through bacterial-viral loop and shifted the reservoir system to net heterotrophy. Our data therefore suggests that the putative adverse impact of viruses on the growth efficiency of the prokaryotic community can have strong implications on nutrient flux patterns and on the overall ecosystem metabolism in anthropogenic dominated aquatic systems such as Lake Villerest. PMID:26903963

  17. Ribonucleic Acid, Deoxyribonucleic Acid, and Protein Content of Cells of Different Ages of Mycobacterium tuberculosis and the Relationship to Immunogenicity

    PubMed Central

    Youmans, Anne S.; Youmans, Guy P.


    The amount of ribonucleic acid (RNA), protein, and deoxyribonucleic acid (DNA) was determined in pellicle cultures of different ages of the H37Ra strain of Mycobacterium tuberculosis, grown on a synthetic medium. We found that the highest content of RNA and protein was present in 2-week-old cultures, indicating that these cells were in the logarithmic phase of growth. DNA content was highest at 1 and 2 weeks. The amount of all three compounds then decreased about 50% during the following 6 weeks. Two-week-old cells should therefore be used for preparation of the immunogenic ribosomal fraction. The optimal concentration of zinc chloride increased RNA and protein synthesis, and also improved the appearance of the pellicle growth. Two-week-old cells, which contained the largest amount of RNA and protein, immunized mice significantly better than older cells. Since protein and DNA are not involved in the production of immunity, a correlation could be made between amount of RNA and the capacity of viable H37Ra cells to immunize mice. The immunizing capacity of these cells was not affected by ribonuclease, probably because the ribonuclease did not penetrate into the whole cells. PMID:4966539

  18. Label-free serum ribonucleic acid analysis for colorectal cancer detection by surface-enhanced Raman spectroscopy and multivariate analysis

    NASA Astrophysics Data System (ADS)

    Chen, Yanping; Chen, Gang; Feng, Shangyuan; Pan, Jianji; Zheng, Xiongwei; Su, Ying; Chen, Yan; Huang, Zufang; Lin, Xiaoqian; Lan, Fenghua; Chen, Rong; Zeng, Haishan


    Studies with circulating ribonucleic acid (RNA) not only provide new targets for cancer detection, but also open up the possibility of noninvasive gene expression profiling for cancer. In this paper, we developed a surface-enhanced Raman scattering (SERS), platform for detection and differentiation of serum RNAs of colorectal cancer. A novel three-dimensional (3-D), Ag nanofilm formed by dry MgSO4 aggregated silver nanoparticles, Ag NP, as the SERS-active substrate was presented to effectively enhance the RNA Raman signals. SERS measurements were performed on two groups of serum RNA samples. One group from patients, n=55 with pathologically diagnosed colorectal cancer and the other group from healthy controls, n=45. Tentative assignments of the Raman bands in the normalized SERS spectra demonstrated that there are differential expressions of cancer-related RNAs between the two groups. Linear discriminate analysis, based on principal component analysis, generated features can differentiate the colorectal cancer SERS spectra from normal SERS spectra with sensitivity of 89.1 percent and specificity of 95.6 percent. This exploratory study demonstrated great potential for developing serum RNA SERS analysis into a useful clinical tool for label-free, noninvasive screening and detection of colorectal cancers.

  19. Gradient enhanced-fluidity liquid hydrophilic interaction chromatography of ribonucleic acid nucleosides and nucleotides: A "green" technique.


    Beilke, Michael C; Beres, Martin J; Olesik, Susan V


    A "green" hydrophilic interaction liquid chromatography (HILIC) technique for separating the components of mixtures with a broad range of polarities is illustrated using enhanced-fluidity liquid mobile phases. Enhanced-fluidity liquid chromatography (EFLC) involves the addition of liquid CO2 to conventional liquid mobile phases. Decreased mobile phase viscosity and increased analyte diffusivity results when a liquefied gas is dissolved in common liquid mobile phases. The impact of CO2 addition to a methanol:water (MeOH:H2O) mobile phase was studied to optimize HILIC gradient conditions. For the first time a fast separation of 16 ribonucleic acid (RNA) nucleosides/nucleotides was achieved (16min) with greater than 1.3 resolution for all analyte pairs. By using a gradient, the analysis time was reduced by over 100% compared to similar separations conducted under isocratic conditions. The optimal separation using MeOH:H2O:CO2 mobile phases was compared to MeOH:H2O and acetonitrile:water (ACN:H2O) mobile phases. Based on chromatographic performance parameters (efficiency, resolution and speed of analysis) and an assessment of the environmental impact of the mobile phase mixtures, MeOH:H2O:CO2 mixtures are preferred over ACN:H2O or MeOH:H2O mobile phases for the separation of mixtures of RNA nucleosides and nucleotides.

  20. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    NASA Astrophysics Data System (ADS)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.


    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  1. Geochemical Interactions and Viral-Prokaryote Relationships in Freshwater Environments

    NASA Astrophysics Data System (ADS)

    Kyle, J. E.; Ferris, G.


    Viral and prokaryotic abundances were surveyed throughout southern Ontario aquatic habitats to determine relationships with geochemical parameters in the natural environment. Surface water samples were collected from acid mine drainage in summer of 2007 and 2008 and from circum-neutral pH environments in October to November 2008. Site determination was based on collecting samples from various aquatic habitats (acid mine drainage, lakes, rivers, tributaries, wetlands) with differing bedrock geology (limestone and shale dominated vs granitic Canadian Shield) to obtain a range of geochemical conditions. At each site, measurements of temperature, pH, and Eh were conducted. Samples collected for microbial counts and electron imaging were preserved to a final concentration of 2.5 % (v/v) glutaraldehyde. Additional sample were filtered into 60 mL nalgene bottles and amber EPA certified 40 mL glass vials to determine chemical constituents and dissolved organic carbon (DOC), respectively. Water was also collected to determine additional physiochemical parameters (dissolved total iron, ferric iron, nitrate, sulfate, phosphate, alkalinity, and turbidity). All samples were stored at 4 °C until analysis. Viral and prokaryotic abundance was determined by staining samples with SYBR Green I and examining with a epifluorescence microscope under blue excitation. Multiple regression analysis using stepwise backwards regression and general linear models revealed that viral abundance was the most influential predictor of prokaryotic abundance. Additional predictors include pH, sulfate, phosphate, and magnesium. The strength of the model was very strong with 90 % of the variability explained (R2 = 0.90, p < 0.007). This is the first report, to our knowledge, of viruses exhibiting such strong controls over prokaryotic abundance in the natural environment. All relationships are positively correlated with the exception of Mg, which is negatively correlated. Iron was also noted as a

  2. Genome-wide survey of prokaryotic serine proteases: Analysis of distribution and domain architectures of five serine protease families in prokaryotes

    PubMed Central

    Tripathi, Lokesh P; Sowdhamini, R


    Background Serine proteases are one of the most abundant groups of proteolytic enzymes found in all the kingdoms of life. While studies have established significant roles for many prokaryotic serine proteases in several physiological processes, such as those associated with metabolism, cell signalling, defense response and development, functional associations for a large number of prokaryotic serine proteases are relatively unknown. Current analysis is aimed at understanding the distribution and probable biological functions of the select serine proteases encoded in representative prokaryotic organisms. Results A total of 966 putative serine proteases, belonging to five families, were identified in the 91 prokaryotic genomes using various sensitive sequence search techniques. Phylogenetic analysis reveals several species-specific clusters of serine proteases suggesting their possible involvement in organism-specific functions. Atypical phylogenetic associations suggest an important role for lateral gene transfer events in facilitating the widespread distribution of the serine proteases in the prokaryotes. Domain organisations of the gene products were analysed, employing sensitive sequence search methods, to infer their probable biological functions. Trypsin, subtilisin and Lon protease families account for a significant proportion of the multi-domain representatives, while the D-Ala-D-Ala carboxypeptidase and the Clp protease families are mostly single-domain polypeptides in prokaryotes. Regulatory domains for protein interaction, signalling, pathogenesis, cell adhesion etc. were found tethered to the serine protease domains. Some domain combinations (such as S1-PDZ; LON-AAA-S16 etc.) were found to be widespread in the prokaryotic lineages suggesting a critical role in prokaryotes. Conclusion Domain architectures of many serine proteases and their homologues identified in prokaryotes are very different from those observed in eukaryotes, suggesting distinct roles

  3. Cytoplasmic sulfur trafficking in sulfur-oxidizing prokaryotes.


    Dahl, Christiane


    Persulfide groups are chemically versatile and participate in a wide array of biochemical pathways. Although it is well documented that persulfurated proteins supply a number of important and elaborate biosynthetic pathways with sulfane sulfur, it is far less acknowledged that the enzymatic generation of persulfidic sulfur, the successive transfer of sulfur as a persulfide between multiple proteins, and the oxidation of sulfane sulfur in protein-bound form are also essential steps during dissimilatory sulfur oxidation in bacteria and archaea. Here, the currently available information on sulfur trafficking in sulfur oxidizing prokaryotes is reviewed, and the idea is discussed that sulfur is always presented to cytoplasmic oxidizing enzymes in a protein-bound form, thus preventing the occurrence of free sulfide inside of the prokaryotic cell. Thus, sulfur trafficking emerges as a central element in sulfur-oxidizing pathways, and TusA homologous proteins appear to be central and common elements in these processes.

  4. Proteogenomic analysis and global discovery of posttranslational modifications in prokaryotes

    PubMed Central

    Yang, Ming-kun; Yang, Yao-hua; Chen, Zhuo; Zhang, Jia; Lin, Yan; Wang, Yan; Xiong, Qian; Li, Tao; Ge, Feng; Bryant, Donald A.; Zhao, Jin-dong


    We describe an integrated workflow for proteogenomic analysis and global profiling of posttranslational modifications (PTMs) in prokaryotes and use the model cyanobacterium Synechococcus sp. PCC 7002 (hereafter Synechococcus 7002) as a test case. We found more than 20 different kinds of PTMs, and a holistic view of PTM events in this organism grown under different conditions was obtained without specific enrichment strategies. Among 3,186 predicted protein-coding genes, 2,938 gene products (>92%) were identified. We also identified 118 previously unidentified proteins and corrected 38 predicted gene-coding regions in the Synechococcus 7002 genome. This systematic analysis not only provides comprehensive information on protein profiles and the diversity of PTMs in Synechococcus 7002 but also provides some insights into photosynthetic pathways in cyanobacteria. The entire proteogenomics pipeline is applicable to any sequenced prokaryotic organism, and we suggest that it should become a standard part of genome annotation projects. PMID:25512518

  5. Classification of prokaryotic genetic replicators: between selfishness and altruism

    PubMed Central

    Jalasvuori, Matti; Koonin, Eugene V.


    Prokaryotes harbor a variety of genetic replicators, including plasmids, viruses, and chromosomes, each having differing effects on the phenotype of the hosting cell. Here, we propose a classification for replicators of bacteria and archaea on the basis of their horizontal-transfer potential and the type of relationships (mutualistic, symbiotic, commensal, or parasitic) that they have with the host cell vehicle. Horizontal movement of replicators can be either active or passive, reflecting whether or not the replicator encodes the means to mediate its own transfer from one cell to another. Some replicators also have an infectious extracellular state, thus separating viruses from other mobile elements. From the perspective of the cell vehicle, the different types of replicators form a continuum from genuinely mutualistic to completely parasitic replicators. This classification provides a general framework for dissecting prokaryotic systems into evolutionarily meaningful components. PMID:25703428

  6. Detection of Prokaryotic Genes in the Amphimedon queenslandica Genome

    PubMed Central

    Conaco, Cecilia; Tsoulfas, Pantelis; Sakarya, Onur; Dolan, Amanda; Werren, John; Kosik, Kenneth S.


    Horizontal gene transfer (HGT) is common between prokaryotes and phagotrophic eukaryotes. In metazoans, the scale and significance of HGT remains largely unexplored but is usually linked to a close association with parasites and endosymbionts. Marine sponges (Porifera), which host many microorganisms in their tissues and lack an isolated germ line, are potential carriers of genes transferred from prokaryotes. In this study, we identified a number of potential horizontally transferred genes within the genome of the sponge, Amphimedon queenslandica. We further identified homologs of some of these genes in other sponges. The transferred genes, most of which possess catalytic activity for carbohydrate or protein metabolism, have assimilated host genome characteristics and are actively expressed. The diversity of functions contributed by the horizontally transferred genes is likely an important factor in the adaptation and evolution of A. queenslandica. These findings highlight the potential importance of HGT on the success of sponges in diverse ecological niches. PMID:26959231

  7. Rates of Lateral Gene Transfer in Prokaryotes: High but Why?


    Vos, Michiel; Hesselman, Matthijn C; te Beek, Tim A; van Passel, Mark W J; Eyre-Walker, Adam


    Lateral gene transfer is of fundamental importance to the evolution of prokaryote genomes and has important practical consequences, as evidenced by the rapid dissemination of antibiotic resistance and virulence determinants. Relatively little effort has so far been devoted to explicitly quantifying the rate at which accessory genes are taken up and lost, but it is possible that the combined rate of lateral gene transfer and gene loss is higher than that of point mutation. What evolutionary forces underlie the rate of lateral gene transfer are not well understood. We here use theory developed to explain the evolution of mutation rates to address this question and explore its consequences for the study of prokaryote evolution.

  8. Detection of Prokaryotic Genes in the Amphimedon queenslandica Genome.


    Conaco, Cecilia; Tsoulfas, Pantelis; Sakarya, Onur; Dolan, Amanda; Werren, John; Kosik, Kenneth S


    Horizontal gene transfer (HGT) is common between prokaryotes and phagotrophic eukaryotes. In metazoans, the scale and significance of HGT remains largely unexplored but is usually linked to a close association with parasites and endosymbionts. Marine sponges (Porifera), which host many microorganisms in their tissues and lack an isolated germ line, are potential carriers of genes transferred from prokaryotes. In this study, we identified a number of potential horizontally transferred genes within the genome of the sponge, Amphimedon queenslandica. We further identified homologs of some of these genes in other sponges. The transferred genes, most of which possess catalytic activity for carbohydrate or protein metabolism, have assimilated host genome characteristics and are actively expressed. The diversity of functions contributed by the horizontally transferred genes is likely an important factor in the adaptation and evolution of A. queenslandica. These findings highlight the potential importance of HGT on the success of sponges in diverse ecological niches. PMID:26959231

  9. Pyrophosphate-fueled Na+ and H+ transport in prokaryotes.


    Baykov, Alexander A; Malinen, Anssi M; Luoto, Heidi H; Lahti, Reijo


    In its early history, life appeared to depend on pyrophosphate rather than ATP as the source of energy. Ancient membrane pyrophosphatases that couple pyrophosphate hydrolysis to active H(+) transport across biological membranes (H(+)-pyrophosphatases) have long been known in prokaryotes, plants, and protists. Recent studies have identified two evolutionarily related and widespread prokaryotic relics that can pump Na(+) (Na(+)-pyrophosphatase) or both Na(+) and H(+) (Na(+),H(+)-pyrophosphatase). Both these transporters require Na(+) for pyrophosphate hydrolysis and are further activated by K(+). The determination of the three-dimensional structures of H(+)- and Na(+)-pyrophosphatases has been another recent breakthrough in the studies of these cation pumps. Structural and functional studies have highlighted the major determinants of the cation specificities of membrane pyrophosphatases and their potential use in constructing transgenic stress-resistant organisms.

  10. Effects of viruses and predators on prokaryotic community composition.


    Jardillier, Ludwig; Bettarel, Yvan; Richardot, Mathilde; Bardot, Corinne; Amblard, Christian; Sime-Ngando, Télesphore; Debroas, Didier


    Dialysis bags were used to examine the impact of predation and viral lysis on prokaryotic community composition (PCC) over a 5-day experiment in the oligomesotrophic Lake Pavin (France). The impact of the different predator communities (protists and metazoans) of prokaryotes was estimated by water fractionation (<5 microm: treatment filtered on 5 microm, without ciliates and metazoans; UNF: unfiltered treatment with all planktonic communities). Enrichments of natural viruses (<1.2 microm: with a natural virus concentration; <1.2 mum V and VV: with enrichment leading to a double or triple concentration of viruses, respectively) were used to indirectly assess the control of virioplankton. Viral activity was estimated from the frequency of visibly infected cells (FVIC). PCC was determined by fluorescence in situ hybridization (FISH) and terminal restriction fragment length polymorphism (T-RFLP). In this study, PCC was affected by the eukaryote communities (especially flagellates), and viruses to a lesser extent. Cyanobacteria declined significantly during the experiment and were highly correlated with the FVIC. In addition, the 503-bp terminal restriction fragment (T-RF) disappeared in treatments with virus enrichments, suggesting possible viral-associated mortality processes, whereas the 506-bp T-RF was not affected in these treatments. On one hand, these results suggest a control of the PCC: first, by viral lysis of some dominant phylotypes and second, by interspecific competition between resistant strains for the uptake of substrates released by this lysis. The increase of Archaea may suggest that these cells benefit such resources. On the other hand, the disappearance and the stable proportion of some dominant phylotypes suggested a selection pressure due to the predatory activity on prokaryotes. In conclusion, prokaryotic abundance appears to be mainly controlled by flagellate protists, which also affected PCC, whereas viruses seemed to be essentially responsible

  11. Predatory prokaryotes: predation and primary consumption evolved in bacteria

    NASA Technical Reports Server (NTRS)

    Guerrero, R.; Pedros-Alio, C.; Esteve, I.; Mas, J.; Chase, D.; Margulis, L.


    Two kinds of predatory bacteria have been observed and characterized by light and electron microscopy in samples from freshwater sulfurous lakes in northeastern Spain. The first bacterium, named Vampirococcus, is Gram-negative and ovoidal (0.6 micrometer wide). An anaerobic epibiont, it adheres to the surface of phototrophic bacteria (Chromatium spp.) by specific attachment structures and, as it grows and divides by fission, destroys its prey. An important in situ predatory role can be inferred for Vampirococcus from direct counts in natural samples. The second bacterium, named Daptobacter, is a Gram-negative, facultatively anaerobic straight rod (0.5 x 1.5 micrometers) with a single polar flagellum, which collides, penetrates, and grows inside the cytoplasm of its prey (several genera of Chromatiaceae). Considering also the well-known case of Bdellovibrio, a Gram-negative, aerobic curved rod that penetrates and divides in the periplasmic space of many chemotrophic Gram-negative bacteria, there are three types of predatory prokaryotes presently known (epibiotic, cytoplasmic, and periplasmic). Thus, we conclude that antagonistic relationships such as primary consumption, predation, and scavenging had already evolved in microbial ecosystems prior to the appearance of eukaryotes. Furthermore, because they represent methods by which prokaryotes can penetrate other prokaryotes in the absence of phagocytosis, these associations can be considered preadaptation for the origin of intracellular organelles.

  12. Prokaryotic cells: structural organisation of the cytoskeleton and organelles.


    Souza, Wanderley de


    For many years, prokaryotic cells were distinguished from eukaryotic cells based on the simplicity of their cytoplasm, in which the presence of organelles and cytoskeletal structures had not been discovered. Based on current knowledge, this review describes the complex components of the prokaryotic cell cytoskeleton, including (i) tubulin homologues composed of FtsZ, BtuA, BtuB and several associated proteins, which play a fundamental role in cell division, (ii) actin-like homologues, such as MreB and Mb1, which are involved in controlling cell width and cell length, and (iii) intermediate filament homologues, including crescentin and CfpA, which localise on the concave side of a bacterium and along its inner curvature and associate with its membrane. Some prokaryotes exhibit specialised membrane-bound organelles in the cytoplasm, such as magnetosomes and acidocalcisomes, as well as protein complexes, such as carboxysomes. This review also examines recent data on the presence of nanotubes, which are structures that are well characterised in mammalian cells that allow direct contact and communication between cells.

  13. Birth, death, and diversification of mobile promoters in prokaryotes.


    van Passel, Mark W J; Nijveen, Harm; Wahl, Lindi M


    A previous study of prokaryotic genomes identified large reservoirs of putative mobile promoters (PMPs), that is, homologous promoter sequences associated with nonhomologous coding sequences. Here we extend this data set to identify the full complement of mobile promoters in sequenced prokaryotic genomes. The expanded search identifies nearly 40,000 PMP sequences, 90% of which occur in noncoding regions of the genome. To gain further insight from this data set, we develop a birth-death-diversification model for mobile genetic elements subject to sequence diversification; applying the model to PMPs we are able to quantify the relative importance of duplication, loss, horizontal gene transfer (HGT), and diversification to the maintenance of the PMP reservoir. The model predicts low rates of HGT relative to the duplication and loss of PMP copies, rapid dynamics of PMP families, and a pool of PMPs that exist as a single copy in a genome at any given time, despite their mobility. We report evidence of these "singletons" at high frequencies in prokaryotic genomes. We also demonstrate that including selection, either for or against PMPs, was not necessary to describe the observed data.

  14. Genomic and functional adaptation in surface ocean planktonic prokaryotes.


    Yooseph, Shibu; Nealson, Kenneth H; Rusch, Douglas B; McCrow, John P; Dupont, Christopher L; Kim, Maria; Johnson, Justin; Montgomery, Robert; Ferriera, Steve; Beeson, Karen; Williamson, Shannon J; Tovchigrechko, Andrey; Allen, Andrew E; Zeigler, Lisa A; Sutton, Granger; Eisenstadt, Eric; Rogers, Yu-Hui; Friedman, Robert; Frazier, Marvin; Venter, J Craig


    The understanding of marine microbial ecology and metabolism has been hampered by the paucity of sequenced reference genomes. To this end, we report the sequencing of 137 diverse marine isolates collected from around the world. We analysed these sequences, along with previously published marine prokaryotic genomes, in the context of marine metagenomic data, to gain insights into the ecology of the surface ocean prokaryotic picoplankton (0.1-3.0 μm size range). The results suggest that the sequenced genomes define two microbial groups: one composed of only a few taxa that are nearly always abundant in picoplanktonic communities, and the other consisting of many microbial taxa that are rarely abundant. The genomic content of the second group suggests that these microbes are capable of slow growth and survival in energy-limited environments, and rapid growth in energy-rich environments. By contrast, the abundant and cosmopolitan picoplanktonic prokaryotes for which there is genomic representation have smaller genomes, are probably capable of only slow growth and seem to be relatively unable to sense or rapidly acclimate to energy-rich conditions. Their genomic features also lead us to propose that one method used to avoid predation by viruses and/or bacterivores is by means of slow growth and the maintenance of low biomass.

  15. Distributions of Virus-Like Particles and Prokaryotes within Microenvironments

    PubMed Central

    Dann, Lisa M.; Paterson, James S.; Newton, Kelly; Oliver, Rod; Mitchell, James G.


    Microbial interactions are important for ecosystem function, but occur at the microscale and so are difficult to observe. Previous studies in marine systems have shown significant shifts in microbial community abundance and composition over scales of micrometres to centimetres. This study investigates the microscale abundance distributions of virus-like particles (VLPs) and prokaryotes in the lower reaches of a river to determine the extent to which microscale microbial patchiness exists in freshwater systems. Here we report local hotspots surrounded by gradients that reach a maximum 80 and 107 fold change in abundance over 0.9 cm for prokaryotic and VLP subpopulations. Changes in prokaryotic and VLP hotspots were tightly coupled. There were no gradients at tens of centimetres across the boundary layers, which is consistent with strong mixing and turbulence-driven aggregation found in river systems. Quantification of the patchiness shows a marked asymmetry with patches 10 times greater than background common, but depletions being rare or absent in most samples. This consistent asymmetry suggests that coldspots depleted by grazing and lysis are rapidly mixed to background concentrations, while the prevalence of hotspots indicates persistence against disruption. The hotspot to coldspot relative abundance may be useful for understanding microbial river dynamics. The patchiness indicates that the mean- field approach of bulk phase sampling misses the microbially relevant community variation and may underestimate the concentrations of these important microbial groups. PMID:26785114

  16. Predatory prokaryotes: Predation and primary consumption evolved in bacteria

    PubMed Central

    Guerrero, Ricardo; Pedrós-Alió, Carlos; Esteve, Isabel; Mas, Jordi; Chase, David; Margulis, Lynn


    Two kinds of predatory bacteria have been observed and characterized by light and electron microscopy in samples from freshwater sulfurous lakes in northeastern Spain. The first bacterium, named Vampirococcus, is Gram-negative and ovoidal (0.6 μm wide). An anaerobic epibiont, it adheres to the surface of phototrophic bacteria (Chromatium spp.) by specific attachment structures and, as it grows and divides by fission, destroys its prey. An important in situ predatory role can be inferred for Vampirococcus from direct counts in natural samples. The second bacterium, named Daptobacter, is a Gram-negative, facultatively anaerobic straight rod (0.5 × 1.5 μm) with a single polar flagellum, which collides, penetrates, and grows inside the cytoplasm of its prey (several genera of Chromatiaceae). Considering also the well-known case of Bdellovibrio, a Gram-negative, aerobic curved rod that penetrates and divides in the periplasmic space of many chemotrophic Gram-negative bacteria, there are three types of predatory prokaryotes presently known (epibiotic, cytoplasmic, and periplasmic). Thus, we conclude that antagonistic relationships such as primary consumption, predation, and scavenging had already evolved in microbial ecosystems prior to the appearance of eukaryotes. Furthermore, because they represent methods by which prokaryotes can penetrate other prokaryotes in the absence of phagocytosis, these associations can be considered preadaptations for the origin of intracellular organelles. Images PMID:11542073

  17. A comprehensive repertoire of prokaryotic species identified in human beings.


    Hugon, Perrine; Dufour, Jean-Charles; Colson, Philippe; Fournier, Pierre-Edouard; Sallah, Kankoe; Raoult, Didier


    The compilation of the complete prokaryotic repertoire associated with human beings as commensals or pathogens is a major goal for the scientific and medical community. The use of bacterial culture techniques remains a crucial step to describe new prokaryotic species. The large number of officially acknowledged bacterial species described since 1980 and the recent increase in the number of recognised pathogenic species have highlighted the absence of an exhaustive compilation of species isolated in human beings. By means of a thorough investigation of several large culture databases and a search of the scientific literature, we built an online database containing all human-associated prokaryotic species described, whether or not they had been validated and have standing in nomenclature. We list 2172 species that have been isolated in human beings. They were classified in 12 different phyla, mostly in the Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes phyla. Our online database is useful for both clinicians and microbiologists and forms part of the Human Microbiome Project, which aims to characterise the whole human microbiota and help improve our understanding of the human predisposition and susceptibility to infectious agents.

  18. The Prokaryote-Eukaryote Dichotomy: Meanings and Mythology

    PubMed Central

    Sapp, Jan


    Drawing on documents both published and archival, this paper explains how the prokaryote-eukaryote dichotomy of the 1960s was constructed, the purposes it served, and what it implied in terms of classification and phylogeny. In doing so, I first show how the concept was attributed to Edouard Chatton and the context in which he introduced the terms. Following, I examine the context in which the terms were reintroduced into biology in 1962 by Roger Stanier and C. B. van Niel. I study the discourse over the subsequent decade to understand how the organizational dichotomy took on the form of a natural classification as the kingdom Monera or superkingdom Procaryotae. Stanier and van Niel admitted that, in regard to constructing a natural classification of bacteria, structural characteristics were no more useful than physiological properties. They repeatedly denied that bacterial phylogenetics was possible. I thus examine the great historical irony that the “prokaryote,” in both its organizational and phylogenetic senses, was defined (negatively) on the basis of structure. Finally, we see how phylogenetic research based on 16S rRNA led by Carl Woese and his collaborators confronted the prokaryote concept while moving microbiology to the center of evolutionary biology. PMID:15944457

  19. Distributions of Virus-Like Particles and Prokaryotes within Microenvironments.


    Dann, Lisa M; Paterson, James S; Newton, Kelly; Oliver, Rod; Mitchell, James G


    Microbial interactions are important for ecosystem function, but occur at the microscale and so are difficult to observe. Previous studies in marine systems have shown significant shifts in microbial community abundance and composition over scales of micrometres to centimetres. This study investigates the microscale abundance distributions of virus-like particles (VLPs) and prokaryotes in the lower reaches of a river to determine the extent to which microscale microbial patchiness exists in freshwater systems. Here we report local hotspots surrounded by gradients that reach a maximum 80 and 107 fold change in abundance over 0.9 cm for prokaryotic and VLP subpopulations. Changes in prokaryotic and VLP hotspots were tightly coupled. There were no gradients at tens of centimetres across the boundary layers, which is consistent with strong mixing and turbulence-driven aggregation found in river systems. Quantification of the patchiness shows a marked asymmetry with patches 10 times greater than background common, but depletions being rare or absent in most samples. This consistent asymmetry suggests that coldspots depleted by grazing and lysis are rapidly mixed to background concentrations, while the prevalence of hotspots indicates persistence against disruption. The hotspot to coldspot relative abundance may be useful for understanding microbial river dynamics. The patchiness indicates that the mean- field approach of bulk phase sampling misses the microbially relevant community variation and may underestimate the concentrations of these important microbial groups.

  20. Structural properties of prokaryotic promoter regions correlate with functional features.


    Meysman, Pieter; Collado-Vides, Julio; Morett, Enrique; Viola, Roberto; Engelen, Kristof; Laukens, Kris


    The structural properties of the DNA molecule are known to play a critical role in transcription. In this paper, the structural profiles of promoter regions were studied within the context of their diversity and their function for eleven prokaryotic species; Escherichia coli, Klebsiella pneumoniae, Salmonella Typhimurium, Pseudomonas auroginosa, Geobacter sulfurreducens Helicobacter pylori, Chlamydophila pneumoniae, Synechocystis sp., Synechoccocus elongates, Bacillus anthracis, and the archaea Sulfolobus solfataricus. The main anchor point for these promoter regions were transcription start sites identified through high-throughput experiments or collected within large curated databases. Prokaryotic promoter regions were found to be less stable and less flexible than the genomic mean across all studied species. However, direct comparison between species revealed differences in their structural profiles that can not solely be explained by the difference in genomic GC content. In addition, comparison with functional data revealed that there are patterns in the promoter structural profiles that can be linked to specific functional loci, such as sigma factor regulation or transcription factor binding. Interestingly, a novel structural element clearly visible near the transcription start site was found in genes associated with essential cellular functions and growth in several species. Our analyses reveals the great diversity in promoter structural profiles both between and within prokaryotic species. We observed relationships between structural diversity and functional features that are interesting prospects for further research to yet uncharacterized functional loci defined by DNA structural properties.

  1. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq


    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  2. Prolactin messenger ribonucleic acid levels, prolactin synthesis, and radioimmunoassayable prolactin during the estrous cycle in the Golden Syrian hamster

    SciTech Connect

    Massa, J.S. ); Blask, D.E. )


    The purpose of this study was to observe the molecular dynamics of pituitary prolactin (PRL) gene expression during the estrous cycle of the Golden Syrian hamster. PRL messenger ribonucleic acid (mRNA) levels, PRL synthesis were measured in the morning on each day of the cycle. We observed that all of these PRL indices declined or did not change from Day 2 to Day 3 of the cycle. From Day 3 to Day 4 however, PRL mRNA levels increased 33-38% and media {sup 3}H-PRL increased 32-42%, while there were no significant changes in pituitary {sup 3}H-PRL, or RIA-PRL in the media or pituitary. From Day 4 to Day 1 (estrus) there was reciprocal change in the levels of {sup 3}H-PRL in the pituitary vs. the media, with the former increasing 37-50% and the latter decreasing 25-32%. Pituitary RIA-PRL did also increased 45-64% from Day 4 to Day 1 while media RIA-PRL did not change. These data are consistent with the following hypothesis: On the morning of proestrus(Day 4) in the hamster, PRL mRNA levels are elevated compared to those on Day 3, signaling an increase in PRL synthesis. This newly synthesized PRL is shunted into a readily releasable pool on the morning of Day 4 (contributing to the afternoon surge of serum PRL), and into a preferentially stored pool by the morning of Day 1.

  3. Short hairpin ribonucleic acid constructs targeting insulin-like growth factor binding protein-3 rehabilitated dyslipidaemia in diabetic rats.


    Zhou, Z-Y; Cheng, S-P; Huang, H; Wang, J; Pan, H; Liu, C-M; Xing, C; Sun, Y-L; Liu, R-H; Zhong, G-J


    It was investigated whether short hairpin ribonucleic acid constructs targeting insulin-like growth factor binding protein-3 (IGFBP-3 shRNA) can rehabilitate dyslipidaemia in streptozotocin-induced diabetic rats. After 12 weeks of intracavernous administration of IGFBP-3 shRNA, intracavernous pressure responses to electrical stimulation of cavernous nerves were evaluated. The concentrations of serum low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, triglyceride and cavernous cyclic guanosine monophosphate were all detected by enzyme-linked immunosorbent assay. The per cent of smooth muscle in corpus cavernous tissue was also evaluated. It was found that the cavernosal pressure was significantly increased in the IGFBP-3 shRNA treatment group compared to the diabetic control group after 12 weeks of intracavernous administration of IGFBP-3 shRNA (P < 0.01). The concentrations of serum low-density lipoprotein cholesterol and triglyceride were significantly decreased in the IGFBP-3 shRNA treatment group compared to the diabetic control group, while no significant changes of serum high-density lipoprotein cholesterol concentration were found (P < 0.01). At the same time, cavernous cyclic guanosine monophosphate concentrations and the percentage of cavernosal smooth muscle were both significantly increased in the IGFBP-3 shRNA treatment group compared to the diabetic control group (P < 0.01). This study indicated that IGFBP-3 shRNA might rehabilitate erectile function via a decrease in concentrations of serum low-density lipoprotein and triglyceride, an increase in the percentage of cavernosal smooth muscle and an improvement in the nitric oxide-cyclic guanosine monophosphate signalling activities in streptozotocin-induced diabetic rats.

  4. Transfer ribonucleic acid synthesis during sporulation and spore outgrowth in Bacillus subtilis studied by two-dimensional polyacrylamide gel electrophoresis.

    PubMed Central

    Henner, D J; Steinberg, W


    The synthesis of transfer ribonucleic acid (tRNA) was examined during spore formation and spore outgrowth in Bacillus subtilis by two-dimensional polyacrylamide gel electrophoresis of in vivo 32P-labeled RNA. The two-dimensional gel system separated the B. subtilis tRNA's into 32 well-resolved spots, with the relative abundances ranging from 0.9 to 17% of the total. There were several spots (five to six) resolved which were not quantitated due to their low abundance. All of the tRNA species resolved by this gel system were synthesized at every stage examined, including vegetative growth, different stages of sporulation, and different stages of outgrowth. Quantitation of the separated tRNA's showed that in general the tRNA species were present in approximately the same relative abundances at the different developmental periods. tRNA turnover and compartmentation occurring during sporulation were examined by labeling during vegetative growth followed by the addition of excess phosphate to block further 32P incorporation. The two-dimensional gels of these samples showed the same tRNA's seen during vegetative growth, and they were in approximately the same relative abundances, indicating minimal differences in the rates of turnover of individual tRNA's. Vegetatively labeled samples, chased with excess phosphate into mature spores, also showed all of the tRNA species seen during vegetative growth, but an additional five to six minor spots were also observed. These are hypothesized to arise from the loss of 3'-terminal residues from preexisting tRNA's. Images PMID:115846

  5. Reagentless measurement of aminoglycoside antibiotics in blood serum via an electrochemical, ribonucleic acid aptamer-based biosensor.


    Rowe, Aaron A; Miller, Erin A; Plaxco, Kevin W


    Biosensors built using ribonucleic acid (RNA) aptamers show promise as tools for point-of-care medical diagnostics, but they remain vulnerable to nuclease degradation when deployed in clinical samples. To explore methods for protecting RNA-based biosensors from such degradation we have constructed and characterized an electrochemical, aptamer-based sensor for the detection of aminoglycosidic antibiotics. We find that while this sensor achieves low micromolar detection limits and subminute equilibration times when challenged in buffer, it deteriorates rapidly when immersed directly in blood serum. In order to circumvent this problem, we have developed and tested sensors employing modified versions of the same aptamer. Our first effort to this end entailed the methylation of all of the 2'-hydroxyl groups outside of the aptamer's antibiotic binding pocket. However, while devices employing this modified aptamer are as sensitive as those employing an unmodified parent, the modification fails to confer greater stability when the sensor is challenged directly in blood serum. As a second potentially naive alternative, we replaced the RNA bases in the aptamer with their more degradation-resistant deoxyribonucleic acid (DNA) equivalents. Surprisingly and unlike control DNA-stem loops employing other sequences, this DNA aptamer retains the ability to bind aminoglycosides, albeit with poorer affinity than the parent RNA aptamer. Unfortunately, however, while sensors fabricated using this DNA aptamer are stable in blood serum, its lower affinity pushes their detection limits above the therapeutically relevant range. Finally, we find that ultrafiltration through a low-molecular-weight-cutoff spin column rapidly and efficiently removes the relevant nucleases from serum samples spiked with gentamicin, allowing the convenient detection of this aminoglycoside at clinically relevant concentrations using the original RNA-based sensor.

  6. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H


    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  7. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.


    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto


    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  8. Linking host prokaryotic physiology to viral lifestyle dynamics in a temperate freshwater lake (Lake Pavin, France).


    Palesse, S; Colombet, J; Pradeep Ram, A S; Sime-Ngando, T


    In aquatic ecosystems, fluctuations in environmental conditions and prokaryotic host physiological states can strongly affect the dynamics of viral life strategies. The influence of prokaryote physiology and environmental factors on viral replication cycles (lytic and lysogeny) was investigated from April to September 2011 at three different strata (epi, meta, and hypolimnion) in the mixolimnion of deep volcanic temperate freshwater Lake Pavin (France). Overall, the euphotic region (epi and metalimnion) was more dynamic and showed significant variation in microbial standing stocks, prokaryotic physiological state, and viral life strategies compared to the aphotic hypolimnion which was stable within sampled months. The prokaryotic host physiology as inferred from the nucleic acid content of prokaryotic cells (high or low nucleic acid) was strongly regulated by the chlorophyll concentration. The predominance of the high nucleic acid (HNA) prokaryotes (cells) over low nucleic acid (LNA) prokaryotes (cells) in the spring (HNA/LNA = 1.2) and vice versa in the summer period (HNA/LNA = 0.4) suggest that the natural prokaryotic communities underwent major shifts in their physiological states during investigated time period. The increase in the percentage of inducible lysogenic prokaryotes in the summer period was associated with the switch in the dominance of LNA over HNA cells, which coincided with the periods of strong resource (nutrient) limitation. This supports the idea that lysogeny represents a maintenance strategy for viruses in unproductive or harsh nutrient/host conditions. A negative correlation of percentage of lysogenic prokaryotes with HNA cell abundance and chlorophyll suggest that lysogenic cycle is closely related to prokaryotic cells which are stressed or starved due to unavailability of resources for its growth and activity. Our results provide support to previous findings that changes in prokaryote physiology are critical for the promotion and

  9. Linking host prokaryotic physiology to viral lifestyle dynamics in a temperate freshwater lake (Lake Pavin, France).


    Palesse, S; Colombet, J; Pradeep Ram, A S; Sime-Ngando, T


    In aquatic ecosystems, fluctuations in environmental conditions and prokaryotic host physiological states can strongly affect the dynamics of viral life strategies. The influence of prokaryote physiology and environmental factors on viral replication cycles (lytic and lysogeny) was investigated from April to September 2011 at three different strata (epi, meta, and hypolimnion) in the mixolimnion of deep volcanic temperate freshwater Lake Pavin (France). Overall, the euphotic region (epi and metalimnion) was more dynamic and showed significant variation in microbial standing stocks, prokaryotic physiological state, and viral life strategies compared to the aphotic hypolimnion which was stable within sampled months. The prokaryotic host physiology as inferred from the nucleic acid content of prokaryotic cells (high or low nucleic acid) was strongly regulated by the chlorophyll concentration. The predominance of the high nucleic acid (HNA) prokaryotes (cells) over low nucleic acid (LNA) prokaryotes (cells) in the spring (HNA/LNA = 1.2) and vice versa in the summer period (HNA/LNA = 0.4) suggest that the natural prokaryotic communities underwent major shifts in their physiological states during investigated time period. The increase in the percentage of inducible lysogenic prokaryotes in the summer period was associated with the switch in the dominance of LNA over HNA cells, which coincided with the periods of strong resource (nutrient) limitation. This supports the idea that lysogeny represents a maintenance strategy for viruses in unproductive or harsh nutrient/host conditions. A negative correlation of percentage of lysogenic prokaryotes with HNA cell abundance and chlorophyll suggest that lysogenic cycle is closely related to prokaryotic cells which are stressed or starved due to unavailability of resources for its growth and activity. Our results provide support to previous findings that changes in prokaryote physiology are critical for the promotion and

  10. A computational genomics pipeline for prokaryotic sequencing projects

    PubMed Central

    Kislyuk, Andrey O.; Katz, Lee S.; Agrawal, Sonia; Hagen, Matthew S.; Conley, Andrew B.; Jayaraman, Pushkala; Nelakuditi, Viswateja; Humphrey, Jay C.; Sammons, Scott A.; Govil, Dhwani; Mair, Raydel D.; Tatti, Kathleen M.; Tondella, Maria L.; Harcourt, Brian H.; Mayer, Leonard W.; Jordan, I. King


    Motivation: New sequencing technologies have accelerated research on prokaryotic genomes and have made genome sequencing operations outside major genome sequencing centers routine. However, no off-the-shelf solution exists for the combined assembly, gene prediction, genome annotation and data presentation necessary to interpret sequencing data. The resulting requirement to invest significant resources into custom informatics support for genome sequencing projects remains a major impediment to the accessibility of high-throughput sequence data. Results: We present a self-contained, automated high-throughput open source genome sequencing and computational genomics pipeline suitable for prokaryotic sequencing projects. The pipeline has been used at the Georgia Institute of Technology and the Centers for Disease Control and Prevention for the analysis of Neisseria meningitidis and Bordetella bronchiseptica genomes. The pipeline is capable of enhanced or manually assisted reference-based assembly using multiple assemblers and modes; gene predictor combining; and functional annotation of genes and gene products. Because every component of the pipeline is executed on a local machine with no need to access resources over the Internet, the pipeline is suitable for projects of a sensitive nature. Annotation of virulence-related features makes the pipeline particularly useful for projects working with pathogenic prokaryotes. Availability and implementation: The pipeline is licensed under the open-source GNU General Public License and available at the Georgia Tech Neisseria Base ( The pipeline is implemented with a combination of Perl, Bourne Shell and MySQL and is compatible with Linux and other Unix systems. Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20519285

  11. Microdiversity of extracellular enzyme genes among sequenced prokaryotic genomes

    PubMed Central

    Zimmerman, Amy E; Martiny, Adam C; Allison, Steven D


    Understanding the relationship between prokaryotic traits and phylogeny is important for predicting and modeling ecological processes. Microbial extracellular enzymes have a pivotal role in nutrient cycling and the decomposition of organic matter, yet little is known about the phylogenetic distribution of genes encoding these enzymes. In this study, we analyzed 3058 annotated prokaryotic genomes to determine which taxa have the genetic potential to produce alkaline phosphatase, chitinase and β-N-acetyl-glucosaminidase enzymes. We then evaluated the relationship between the genetic potential for enzyme production and 16S rRNA phylogeny using the consenTRAIT algorithm, which calculated the phylogenetic depth and corresponding 16S rRNA sequence identity of clades of potential enzyme producers. Nearly half (49.2%) of the genomes analyzed were found to be capable of extracellular enzyme production, and these were non-randomly distributed across most prokaryotic phyla. On average, clades of potential enzyme-producing organisms had a maximum phylogenetic depth of 0.008004–0.009780, though individual clades varied broadly in both size and depth. These values correspond to a minimum 16S rRNA sequence identity of 98.04–98.40%. The distribution pattern we found is an indication of microdiversity, the occurrence of ecologically or physiologically distinct populations within phylogenetically related groups. Additionally, we found positive correlations among the genes encoding different extracellular enzymes. Our results suggest that the capacity to produce extracellular enzymes varies at relatively fine-scale phylogenetic resolution. This variation is consistent with other traits that require a small number of genes and provides insight into the relationship between taxonomy and traits that may be useful for predicting ecological function. PMID:23303371

  12. Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase.


    McDonald, Allison E; Amirsadeghi, Sasan; Vanlerberghe, Greg C


    The mitochondrial alternative oxidase (AOX) and the plastid terminal oxidase (PTOX) are two similar members of the membrane-bound diiron carboxylate group of proteins. AOX is a ubiquinol oxidase present in all higher plants, as well as some algae, fungi, and protists. It may serve to dampen reactive oxygen species generation by the respiratory electron transport chain. PTOX is a plastoquinol oxidase in plants and some algae. It is required in carotenoid biosynthesis and may represent the elusive oxidase in chlororespiration. Recently, prokaryotic orthologues of both AOX and PTOX proteins have appeared in sequence databases. These include PTOX orthologues present in four different cyanobacteria as well as an AOX orthologue in an alpha-proteobacterium. We used PCR, RT-PCR and northern analyses to confirm the presence and expression of the PTOX gene in Anabaena variabilis PCC 7120. An extensive phylogeny of newly found prokaryotic and eukaryotic AOX and PTOX proteins supports the idea that AOX and PTOX represent two distinct groups of proteins that diverged prior to the endosymbiotic events that gave rise to the eukaryotic organelles. Using multiple sequence alignment, we identified residues conserved in all AOX and PTOX proteins. We also provide a scheme to readily distinguish PTOX from AOX proteins based upon differences in amino acid sequence in motifs around the conserved iron-binding residues. Given the presence of PTOX in cyanobacteria, we suggest that this acronym now stand for plastoquinol terminal oxidase. Our results have implications for the photosynthetic and respiratory metabolism of these prokaryotes, as well as for the origin and evolution of eukaryotic AOX and PTOX proteins.

  13. A new view into prokaryotic cell biology from electron cryotomography.


    Oikonomou, Catherine M; Jensen, Grant J


    Electron cryotomography (ECT) enables intact cells to be visualized in 3D in an essentially native state to 'macromolecular' (∼4 nm) resolution, revealing the basic architectures of complete nanomachines and their arrangements in situ. Since its inception, ECT has advanced our understanding of many aspects of prokaryotic cell biology, from morphogenesis to subcellular compartmentalization and from metabolism to complex interspecies interactions. In this Review, we highlight how ECT has provided structural and mechanistic insights into the physiology of bacteria and archaea and discuss prospects for the future.

  14. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.


    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  15. Environmental Pressure May Change the Composition Protein Disorder in Prokaryotes.


    Vicedo, Esmeralda; Schlessinger, Avner; Rost, Burkhard


    Many prokaryotic organisms have adapted to incredibly extreme habitats. The genomes of such extremophiles differ from their non-extremophile relatives. For example, some proteins in thermophiles sustain high temperatures by being more compact than homologs in non-extremophiles. Conversely, some proteins have increased volumes to compensate for freezing effects in psychrophiles that survive in the cold. Here, we revealed that some differences in organisms surviving in extreme habitats correlate with a simple single feature, namely the fraction of proteins predicted to have long disordered regions. We predicted disorder with different methods for 46 completely sequenced organisms from diverse habitats and found a correlation between protein disorder and the extremity of the environment. More specifically, the overall percentage of proteins with long disordered regions tended to be more similar between organisms of similar habitats than between organisms of similar taxonomy. For example, predictions tended to detect substantially more proteins with long disordered regions in prokaryotic halophiles (survive high salt) than in their taxonomic neighbors. Another peculiar environment is that of high radiation survived, e.g. by Deinococcus radiodurans. The relatively high fraction of disorder predicted in this extremophile might provide a shield against mutations. Although our analysis fails to establish causation, the observed correlation between such a simplistic, coarse-grained, microscopic molecular feature (disorder content) and a macroscopic variable (habitat) remains stunning.

  16. Structural and functional relationships between prokaryotic and eukaryotic DNA polymerases.


    Bernad, A; Zaballos, A; Salas, M; Blanco, L


    The Bacillus subtilis phage luminal diameter 29 DNA polymerase, involved in protein-primed viral DNA replication, was inhibited by phosphonoacetic acid (PAA), a known inhibitor of alpha-like DNA polymerases, by decreasing the rate of elongation. Three highly conserved regions of amino acid homology, found in several viral alpha-like DNA polymerases and in the luminal diameter 29 DNA polymerase, one of them proposed to be the PAA binding site, were also found in the T4 DNA polymerase. This prokaryotic enzyme was highly sensitive to the drugs aphidicolin and the nucleotide analogues butylanilino dATP (BuAdATP) and butylphenyl dGTP (BuPdGTP), known to be specific inhibitors of eukaryotic alpha-like DNA polymerases. Two potential DNA polymerases from the linear plasmid pGKL1 from yeast and the S1 mitochondrial DNA from maize have been identified, based on the fact that they contain the three conserved regions of amino acid homology. Comparison of DNA polymerases from prokaryotic and eukaryotic origin showed extensive amino acid homology in addition to highly conserved domains. These findings reflect evolutionary relationships between hypothetically unrelated DNA polymerases.

  17. Deciphering unusual uncultured magnetotactic multicellular prokaryotes through genomics

    PubMed Central

    Abreu, Fernanda; Morillo, Viviana; Nascimento, Fabrícia F; Werneck, Clarissa; Cantão, Mauricio Egidio; Ciapina, Luciane Prioli; de Almeida, Luiz Gonzaga Paula; Lefèvre, Christopher T; Bazylinski, Dennis A; de Vasconcelos, Ana Tereza Ribeiro; Lins, Ulysses


    Candidatus Magnetoglobus multicellularis (Ca. M. multicellularis) is a member of a group of uncultured magnetotactic prokaryotes that possesses a unique multicellular morphology. To better understand this organism's physiology, we used a genomic approach through pyrosequencing. Genomic data analysis corroborates previous structural studies and reveals the proteins that are likely involved in multicellular morphogenesis of this microorganism. Interestingly, some detected protein sequences that might be involved in cell adhesion are homologues to phylogenetically unrelated filamentous multicellular bacteria proteins, suggesting their contribution in the early development of multicellular organization in Bacteria. Genes related to the behavior of Ca. M. multicellularis (chemo-, photo- and magnetotaxis) and its metabolic capabilities were analyzed. On the basis of the genomic–physiologic information, enrichment media were tested. One medium supported chemoorganoheterotrophic growth of Ca. M. multicellularis and allowed the microorganisms to maintain their multicellular morphology and cell cycle, confirming for the first time that the entire life cycle of the MMP occurs in a multicellular form. Because Ca. M. multicellularis has a unique multicellular life style, its cultivation is an important achievement for further studies regarding the multicellular evolution in prokaryotes. PMID:24196322

  18. Environmental Pressure May Change the Composition Protein Disorder in Prokaryotes

    PubMed Central

    Vicedo, Esmeralda; Schlessinger, Avner; Rost, Burkhard


    Many prokaryotic organisms have adapted to incredibly extreme habitats. The genomes of such extremophiles differ from their non-extremophile relatives. For example, some proteins in thermophiles sustain high temperatures by being more compact than homologs in non-extremophiles. Conversely, some proteins have increased volumes to compensate for freezing effects in psychrophiles that survive in the cold. Here, we revealed that some differences in organisms surviving in extreme habitats correlate with a simple single feature, namely the fraction of proteins predicted to have long disordered regions. We predicted disorder with different methods for 46 completely sequenced organisms from diverse habitats and found a correlation between protein disorder and the extremity of the environment. More specifically, the overall percentage of proteins with long disordered regions tended to be more similar between organisms of similar habitats than between organisms of similar taxonomy. For example, predictions tended to detect substantially more proteins with long disordered regions in prokaryotic halophiles (survive high salt) than in their taxonomic neighbors. Another peculiar environment is that of high radiation survived, e.g. by Deinococcus radiodurans. The relatively high fraction of disorder predicted in this extremophile might provide a shield against mutations. Although our analysis fails to establish causation, the observed correlation between such a simplistic, coarse-grained, microscopic molecular feature (disorder content) and a macroscopic variable (habitat) remains stunning. PMID:26252577

  19. Environmental Pressure May Change the Composition Protein Disorder in Prokaryotes.


    Vicedo, Esmeralda; Schlessinger, Avner; Rost, Burkhard


    Many prokaryotic organisms have adapted to incredibly extreme habitats. The genomes of such extremophiles differ from their non-extremophile relatives. For example, some proteins in thermophiles sustain high temperatures by being more compact than homologs in non-extremophiles. Conversely, some proteins have increased volumes to compensate for freezing effects in psychrophiles that survive in the cold. Here, we revealed that some differences in organisms surviving in extreme habitats correlate with a simple single feature, namely the fraction of proteins predicted to have long disordered regions. We predicted disorder with different methods for 46 completely sequenced organisms from diverse habitats and found a correlation between protein disorder and the extremity of the environment. More specifically, the overall percentage of proteins with long disordered regions tended to be more similar between organisms of similar habitats than between organisms of similar taxonomy. For example, predictions tended to detect substantially more proteins with long disordered regions in prokaryotic halophiles (survive high salt) than in their taxonomic neighbors. Another peculiar environment is that of high radiation survived, e.g. by Deinococcus radiodurans. The relatively high fraction of disorder predicted in this extremophile might provide a shield against mutations. Although our analysis fails to establish causation, the observed correlation between such a simplistic, coarse-grained, microscopic molecular feature (disorder content) and a macroscopic variable (habitat) remains stunning. PMID:26252577

  20. The Gas Vacuole - an Early Organelle of Prokaryote Motility

    NASA Astrophysics Data System (ADS)

    Staley, James T.


    Several lines of evidence suggest that the gas vesicle may have been an early organelle of prokaryote motility. First, it is found in bacteria that are thought to be representatives of primitive groups. Second, it is a simple structure, and the structure alone imparts the function of motility. Thirdly, it is widely distributed amongst prokaryotes, having been found in the purple and green sulfur photosynthetic bacteria, cyanobacteria, methanogenic bacteria, obligate and facultative anaerobic heterotrophic bacteria, as well as aerobic heterotrophic bacteria that divide by budding and binary transverse fission. Recent evidence suggests that in some bacteria the genes for gas vesicle synthesis occur on plasmids. Thus, the wide distribution of this characteristic could be due to recent evolution and rapid dispersal, though early evolution is not precluded. Though the gas vesicle structure itself appears to be highly conserved among the various groups of bacteria, it seems doubtful that the regulatory mechanism to control its synthesis could be the same for the diverse gas vacuolate bacterial groups.

  1. Sequence determinants of prokaryotic gene expression level under heat stress.


    Xiong, Heng; Yang, Yi; Hu, Xiao-Pan; He, Yi-Ming; Ma, Bin-Guang


    Prokaryotic gene expression is environment-dependent and temperature plays an important role in shaping the gene expression profile. Revealing the regulation mechanisms of gene expression pertaining to temperature has attracted tremendous efforts in recent years particularly owning to the yielding of transcriptome and proteome data by high-throughput techniques. However, most of the previous works concentrated on the characterization of the gene expression profile of individual organism and little effort has been made to disclose the commonality among organisms, especially for the gene sequence features. In this report, we collected the transcriptome and proteome data measured under heat stress condition from recently published literature and studied the sequence determinants for the expression level of heat-responsive genes on multiple layers. Our results showed that there indeed exist commonness and consistent patterns of the sequence features among organisms for the differentially expressed genes under heat stress condition. Some features are attributed to the requirement of thermostability while some are dominated by gene function. The revealed sequence determinants of bacterial gene expression level under heat stress complement the knowledge about the regulation factors of prokaryotic gene expression responding to the change of environmental conditions. Furthermore, comparisons to thermophilic adaption have been performed to reveal the similarity and dissimilarity of the sequence determinants for the response to heat stress and for the adaption to high habitat temperature, which elucidates the complex landscape of gene expression related to the same physical factor of temperature.

  2. Insights into structural variations and genome rearrangements in prokaryotic genomes.


    Periwal, Vinita; Scaria, Vinod


    Structural variations (SVs) are genomic rearrangements that affect fairly large fragments of DNA. Most of the SVs such as inversions, deletions and translocations have been largely studied in context of genetic diseases in eukaryotes. However, recent studies demonstrate that genome rearrangements can also have profound impact on prokaryotic genomes, leading to altered cell phenotype. In contrast to single-nucleotide variations, SVs provide a much deeper insight into organization of bacterial genomes at a much better resolution. SVs can confer change in gene copy number, creation of new genes, altered gene expression and many other functional consequences. High-throughput technologies have now made it possible to explore SVs at a much refined resolution in bacterial genomes. Through this review, we aim to highlight the importance of the less explored field of SVs in prokaryotic genomes and their impact. We also discuss its potential applicability in the emerging fields of synthetic biology and genome engineering where targeted SVs could serve to create sophisticated and accurate genome editing.

  3. Distribution of putative xenogeneic silencers in prokaryote genomes.


    Perez-Rueda, Ernesto; Ibarra, J Antonio


    Gene silencing is an important function as it keeps newly acquired foreign DNA repressed, thereby avoiding possible deleterious effects in the host organism. Known transcriptional regulators associated with this process are called xenogeneic silencers (XS) and belong to either the H-NS, Lsr2, MvaT or Rok families. In the work described here we looked for XS-like regulators and their distribution in prokaryotic organisms was evaluated. Our analysis showed that putative XS regulators similar to H-NS, Lsr2, MvaT or Rok are present only in bacteria (31.7%). This does not exclude the existence of alternative XS in the rest of the organisms analyzed. Additionally, of the four XS groups evaluated in this work, those from the H-NS family have diversified more than the other groups. In order to compare the distribution of these putative XS regulators we also searched for other nucleoid-associated proteins (NAPs) not included in this group such as Fis, EbfC/YbaB, HU/IHF and Alba. Results showed that NAPs from the Fis, EbfC/YbaB, HU/IHF and Alba families are widely (94%) distributed among prokaryotes. These NAPs were found in multiple combinations with or without XS-like proteins. In regard with XS regulators, results showed that only XS proteins from one family were found in those organisms containing them. This suggests specificity for this type of regulators and their corresponding genomes.

  4. Lengths of Orthologous Prokaryotic Proteins Are Affected by Evolutionary Factors

    PubMed Central

    Tatarinova, Tatiana; Dien Bard, Jennifer; Cohen, Irit


    Proteins of the same functional family (for example, kinases) may have significantly different lengths. It is an open question whether such variation in length is random or it appears as a response to some unknown evolutionary driving factors. The main purpose of this paper is to demonstrate existence of factors affecting prokaryotic gene lengths. We believe that the ranking of genomes according to lengths of their genes, followed by the calculation of coefficients of association between genome rank and genome property, is a reasonable approach in revealing such evolutionary driving factors. As we demonstrated earlier, our chosen approach, Bubble-sort, combines stability, accuracy, and computational efficiency as compared to other ranking methods. Application of Bubble Sort to the set of 1390 prokaryotic genomes confirmed that genes of Archaeal species are generally shorter than Bacterial ones. We observed that gene lengths are affected by various factors: within each domain, different phyla have preferences for short or long genes; thermophiles tend to have shorter genes than the soil-dwellers; halophiles tend to have longer genes. We also found that species with overrepresentation of cytosines and guanines in the third position of the codon (GC3 content) tend to have longer genes than species with low GC3 content. PMID:26114113

  5. Desiccation tolerance of prokaryotes: application of principles to human cells.


    Potts, Malcolm; Slaughter, Stephen M; Hunneke, Frank-U; Garst, James F; Helm, Richard F


    The loss of water from cells is a stress that was likely imposed very early in evolution. An understanding of the sensitivity or tolerance of cells to depletion of intracellular water is relevant to the study of quiescence, longevity and aging, because one consequence of air-drying is full metabolic arrest, sometimes for extended periods. When considering the adaptation of cells to physiological extremes of pH, temperature or pressure, it is generally assumed that evolution is driven toward optimum function rather than maximum stability. However, adaptation to desiccation has the singular and crucial distinction that dried cells do not grow, and the time the cell is dried may represent the greater part of the life (the time the cell remains viable) of that cell and its component macromolecules. Is a consideration of "function" relevant in the context of desiccated cells? The response of prokaryotic cells to desiccation, and the mechanisms they employ to tolerate this stress at the level of the cell, genome and proteome are considered. Fundamental principles were then implemented in the design of strategies to achieve air-dry stabilization of sensitive eukaryotic (human) cells. The responses of the transcriptomes and proteomes of prokaryotic cells and eukaryotic cells (yeast and human) to drying in air are compared and contrasted to achieve an evolutionary context. The concept of the "desiccome" is developed to question whether there is common set of structural, physiological and molecular mechanisms that constitute desiccation tolerance. PMID:21676831

  6. When integration fails: Prokaryote phylogeny and the tree of life.


    O'Malley, Maureen A


    Much is being written these days about integration, its desirability and even its necessity when complex research problems are to be addressed. Seldom, however, do we hear much about the failure of such efforts. Because integration is an ongoing activity rather than a final achievement, and because today's literature about integration consists mostly of manifesto statements rather than precise descriptions, an examination of unsuccessful integration could be illuminating to understand better how it works. This paper will examine the case of prokaryote phylogeny and its apparent failure to achieve integration within broader tree-of-life accounts of evolutionary history (often called 'universal phylogeny'). Despite the fact that integrated databases exist of molecules pertinent to the phylogenetic reconstruction of all lineages of life, and even though the same methods can be used to construct phylogenies wherever the organisms fall on the tree of life, prokaryote phylogeny remains at best only partly integrated within tree-of-life efforts. I will examine why integration does not occur, compare it with integrative practices in animal and other eukaryote phylogeny, and reflect on whether there might be different expectations of what integration should achieve. Finally, I will draw some general conclusions about integration and its function as a 'meta-heuristic' in the normative commitments guiding scientific practice.

  7. GeneTrees: a phylogenomics resource for prokaryotes.


    Tian, Yuying; Dickerman, Allan W


    The GeneTrees phylogenomics system pursues comparative genomic analyses from the perspective of gene phylogenies for individual genes. The GeneTrees project has the goal of providing detailed evolutionary models for all protein-coding gene components of the fully sequenced genomes. Currently, a database of alignments and trees for all protein sequences for 325 fully sequenced and annotated prokaryote genomes is available. The prokaryote database contains 890,000 protein sequences organized into over 100,000 alignments, each described by a phylogenetic tree. An original homology group discovery tool assembles sets of related proteins from all versus all pairwise alignments. Multiple alignments for each homology group are stored and subjected to phylogenetic tree inference. A graphical web interface provides visual exploration of the GeneTrees database. Homology groups can be queried by sequence identifiers or annotation terms. Genomes can be browsed visually on a gene map of each chromosome or plasmid. Phylogenetic trees with support values are displayed in conjunction with the associated sequence alignment. A variety of classes of information can be selected to label the tree tips to aid in visual evaluation of annotation and gene function. This web interface is available at

  8. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.


    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M


    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  9. Proposal to include the rank of phylum in the International Code of Nomenclature of Prokaryotes.


    Oren, Aharon; da Costa, Milton S; Garrity, George M; Rainey, Fred A; Rosselló-Móra, Ramon; Schink, Bernhard; Sutcliffe, Iain; Trujillo, Martha E; Whitman, William B


    The International Code of Nomenclature of Prokaryotes covers the nomenclature of prokaryotes up to the rank of class. We propose here modifying the Code to include the rank of phylum so that names of phyla that fulfil the rules of the Code will obtain standing in the nomenclature. PMID:26654112

  10. Links between viruses and prokaryotes throughout the water column along a North Atlantic latitudinal transect.


    De Corte, Daniele; Sintes, Eva; Yokokawa, Taichi; Reinthaler, Thomas; Herndl, Gerhard J


    Viruses are an abundant, diverse and dynamic component of marine ecosystems and have a key role in the biogeochemical processes of the ocean by controlling prokaryotic and phytoplankton abundance and diversity. However, most of the studies on virus-prokaryote interactions in marine environments have been performed in nearshore waters. To assess potential variations in the relation between viruses and prokaryotes in different oceanographic provinces, we determined viral and prokaryotic abundance and production throughout the water column along a latitudinal transect in the North Atlantic. Depth-related trends in prokaryotic and viral abundance (both decreasing by one order of magnitude from epi- to abyssopelagic waters), and prokaryotic production (decreasing by three orders of magnitude) were observed along the latitudinal transect. The virus-to-prokaryote ratio (VPR) increased from ~19 in epipelagic to ~53 in the bathy- and abyssopelagic waters. Although the lytic viral production decreased significantly with depth, the lysogenic viral production did not vary with depth. In bathypelagic waters, pronounced differences in prokaryotic and viral abundance were found among different oceanic provinces with lower leucine incorporation rates and higher VPRs in the North Atlantic Gyre province than in the provinces further north and south. The percentage of lysogeny increased from subpolar regions toward the more oligotrophic lower latitudes. Based on the observed trends over this latitudinal transect, we conclude that the viral-host interactions significantly change among different oceanic provinces in response to changes in the biotic and abiotic variables. PMID:22258100

  11. Proposal to include the rank of phylum in the International Code of Nomenclature of Prokaryotes.


    Oren, Aharon; da Costa, Milton S; Garrity, George M; Rainey, Fred A; Rosselló-Móra, Ramon; Schink, Bernhard; Sutcliffe, Iain; Trujillo, Martha E; Whitman, William B


    The International Code of Nomenclature of Prokaryotes covers the nomenclature of prokaryotes up to the rank of class. We propose here modifying the Code to include the rank of phylum so that names of phyla that fulfil the rules of the Code will obtain standing in the nomenclature.

  12. A proposed genus boundary for the prokaryotes based on genomic insights.


    Qin, Qi-Long; Xie, Bin-Bin; Zhang, Xi-Ying; Chen, Xiu-Lan; Zhou, Bai-Cheng; Zhou, Jizhong; Oren, Aharon; Zhang, Yu-Zhong


    Genomic information has already been applied to prokaryotic species definition and classification. However, the contribution of the genome sequence to prokaryotic genus delimitation has been less studied. To gain insights into genus definition for the prokaryotes, we attempted to reveal the genus-level genomic differences in the current prokaryotic classification system and to delineate the boundary of a genus on the basis of genomic information. The average nucleotide sequence identity between two genomes can be used for prokaryotic species delineation, but it is not suitable for genus demarcation. We used the percentage of conserved proteins (POCP) between two strains to estimate their evolutionary and phenotypic distance. A comprehensive genomic survey indicated that the POCP can serve as a robust genomic index for establishing the genus boundary for prokaryotic groups. Basically, two species belonging to the same genus would share at least half of their proteins. In a specific lineage, the genus and family/order ranks showed slight or no overlap in terms of POCP values. A prokaryotic genus can be defined as a group of species with all pairwise POCP values higher than 50%. Integration of whole-genome data into the current taxonomy system can provide comprehensive information for prokaryotic genus definition and delimitation.

  13. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.


    Belkhiri, A; Intengan, H; Klassen, G R


    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  14. Coupling of soil prokaryotic diversity and plant diversity across latitudinal forest ecosystems

    PubMed Central

    Wang, Jun-Tao; Zheng, Yuan-Ming; Hu, Hang-Wei; Li, Jing; Zhang, Li-Mei; Chen, Bao-Dong; Chen, Wei-Ping; He, Ji-Zheng


    The belowground soil prokaryotic community plays a cardinal role in sustaining the stability and functions of forest ecosystems. Yet, the nature of how soil prokaryotic diversity co-varies with aboveground plant diversity along a latitudinal gradient remains elusive. By establishing three hundred 400-m2 quadrats from tropical rainforest to boreal forest in a large-scale parallel study on both belowground soil prokaryote and aboveground tree and herb communities, we found that soil prokaryotic diversity couples with the diversity of herbs rather than trees. The diversity of prokaryotes and herbs responds similarly to environmental factors along the latitudinal gradient. These findings revealed that herbs provide a good predictor of belowground biodiversity in forest ecosystems, and provide new perspective on the aboveground and belowground interactions in forest ecosystems. PMID:26781165

  15. Coupling of soil prokaryotic diversity and plant diversity across latitudinal forest ecosystems

    NASA Astrophysics Data System (ADS)

    Wang, Jun-Tao; Zheng, Yuan-Ming; Hu, Hang-Wei; Li, Jing; Zhang, Li-Mei; Chen, Bao-Dong; Chen, Wei-Ping; He, Ji-Zheng


    The belowground soil prokaryotic community plays a cardinal role in sustaining the stability and functions of forest ecosystems. Yet, the nature of how soil prokaryotic diversity co-varies with aboveground plant diversity along a latitudinal gradient remains elusive. By establishing three hundred 400-m2 quadrats from tropical rainforest to boreal forest in a large-scale parallel study on both belowground soil prokaryote and aboveground tree and herb communities, we found that soil prokaryotic diversity couples with the diversity of herbs rather than trees. The diversity of prokaryotes and herbs responds similarly to environmental factors along the latitudinal gradient. These findings revealed that herbs provide a good predictor of belowground biodiversity in forest ecosystems, and provide new perspective on the aboveground and belowground interactions in forest ecosystems.

  16. Ribonucleic acid purification.


    Martins, R; Queiroz, J A; Sousa, F


    Research on RNA has led to many important biological discoveries and improvement of therapeutic technologies. From basic to applied research, many procedures employ pure and intact RNA molecules; however their isolation and purification are critical steps because of the easy degradability of RNA, which can impair chemical stability and biological functionality. The current techniques to isolate and purify RNA molecules still have several limitations and the requirement for new methods able to improve RNA quality to meet regulatory demands is growing. In fact, as basic research improves the understanding of biological roles of RNAs, the biopharmaceutical industry starts to focus on them as a biotherapeutic tools. Chromatographic bioseparation is a high selective unit operation and is the major option in the purification of biological compounds, requiring high purity degree. In addition, its application in biopharmaceutical manufacturing is well established. This paper discusses the importance and the progress of RNA isolation and purification, considering RNA applicability both in research and clinical fields. In particular and in view of the high specificity, affinity chromatography has been recently applied to RNA purification processes. Accordingly, recent chromatographic investigations based on biorecognition phenomena occurring between RNA and amino acids are focused. Histidine and arginine have been used as amino acid ligands, and their ability to isolate different RNA species demonstrated a multipurpose applicability in molecular biology analysis and RNA therapeutics preparation, highlighting the potential contribution of these methods to overcome the challenges of RNA purification. PMID:24951289

  17. Fossils of Prokaryotic Microorganisms in the Orgueil Meteorite

    NASA Technical Reports Server (NTRS)

    Hoover, Richard B.


    The Orgueil CII meteorite, which fell in southern France on the evening of May 14, 1864, has been one of the most extensively studied of all known carbonaceous meteorites. Field Emission Scanning Electron Microscopy (FESEM) studies of freshly fractured interior surfaces of the Orgueil meteorite have resulted in the detection of the fossilized remains of a large and diverse population of filamentous prokaryotic microorganisms. The taphonomy and the diverse modes of the preservation of these remains ,are diverse. Some of the remains exhibit carbonization of a hollow sheath and in other cases the remains are permineralized with water-soluble evaporite minerals, such as magnesium sulfate or ammonium salts. After the sample is fractured and the interior surfaces are exposed to the atmospheric moisture, some of these friable remains have been observed to exhibit significant alterations in appearance with time. Images are presented to document the changes that have been observed in some forms within the past two years. Images and EDS spectral data will also be presented to document the studies carried out on abiotic forms to search for possible nonbiological interpretations of the indigenous filamentous microstructures that have been found in the Orgueil meteorite. Images and EDS data will be presented showing the size, size range, morphology and chemical compositions of abiotic microstructures found in native crystalline and fibrous Epsomites from Poison Lake, Washington, USA and Catalayud, Zaragoza, Aragon, Spain. Many of these embedded forms are consistent in size and microstructure with cyanobacteria morphotypes. Some of the forms are exhibit known characteristics differentiation of cells, and reproductive structures of filamentous trichomic prokaryotes (bacteria and cyanobacteria) and the degraded remains of microfibrils associated with sheaths of cyanobacteria. In this paper, recently obtained comparative images and EDS data will be presented for the mineralized

  18. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.


    Hori, H; Osawa, S; Iwabuchi, M


    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  19. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR


    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  20. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR


    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  1. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian


    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  2. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.


    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W


    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  3. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR


    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  4. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.


    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  5. Identifications of 5{{s}_{1/2}}-5{{p}_{3/2}} and 5{{s}^{2}}-5s5p EUV transitions of promethium-like Pt, Ir, Os and Re

    NASA Astrophysics Data System (ADS)

    Bekker, H.; Versolato, O. O.; Windberger, A.; Oreshkina, N. S.; Schupp, R.; Baumann, T. M.; Harman, Z.; Keitel, C. H.; Schmidt, P. O.; Ullrich, J.; Crespo López-Urrutia, J. R.


    We investigated Pm-, Nd-, and Pr-like spectra in the extreme ultra-violet region around 20 nm of Pt, Ir, Os, and Re (Z = 78-75) produced in the Heidelberg electron beam ion trap. Identification of the transitions was supported by several theoretical calculations, including collisional radiative modeling of the observed spectra. Special attention is given to the identifications of the alkaline-like 5{{s}1/2}-5{{p}3/2} resonance lines in promethium-like highly charged ions. Previous identifications of these lines have been tentative at best due to disagreements with theory and doubts about the experimental charge state identifications. Our experimental results for the 5{{s}1/2}-5{{p}3/2} wavelengths are accurate at the 0.005%-level. Understanding the level-structure of ions near the 4f-5s level crossing is of particular importance for future searches of a possible fine-structure constant variation, and new optical clocks.

  6. There must be a prokaryote somewhere: microbiology's search for itself

    NASA Technical Reports Server (NTRS)

    Woese, C. R.


    While early microbiologists showed considerable interest in the problem of the natural (evolutionary) relationships among prokaryotes, by the middle of this century that problem had largely been discarded as being unsolvable. In other words, the science of microbiology developed without an evolutionary framework, the lack of which kept it a weak discipline, defined largely by external forces. Modern technology has allowed microbiology finally to develop the needed evolutionary framework, and with this comes a sense of coherence, a sense of identity. Not only is this development radically changing microbiology itself, but also it will change microbiology's relationship to the other biological disciplines. Microbiology of the future will become the primary biological science, the base upon which our future understanding of the living world rests, and the font from which new understanding of it flows.

  7. Dynamic optimization identifies optimal programmes for pathway regulation in prokaryotes.


    Bartl, Martin; Kötzing, Martin; Schuster, Stefan; Li, Pu; Kaleta, Christoph


    To survive in fluctuating environmental conditions, microorganisms must be able to quickly react to environmental challenges by upregulating the expression of genes encoding metabolic pathways. Here we show that protein abundance and protein synthesis capacity are key factors that determine the optimal strategy for the activation of a metabolic pathway. If protein abundance relative to protein synthesis capacity increases, the strategies shift from the simultaneous activation of all enzymes to the sequential activation of groups of enzymes and finally to a sequential activation of individual enzymes along the pathway. In the case of pathways with large differences in protein abundance, even more complex pathway activation strategies with a delayed activation of low abundance enzymes and an accelerated activation of high abundance enzymes are optimal. We confirm the existence of these pathway activation strategies as well as their dependence on our proposed constraints for a large number of metabolic pathways in several hundred prokaryotes.

  8. Prokaryotic Production of Virus-Like Particle Vaccine of Betanodavirus.


    Xie, Junfeng; Huang, Runqing; Lai, Yuxiong


    Betanodaviruses are the causative agents of viral nervous necrosis (VNN), a serious disease of cultured marine fish worldwide. To control this disease, vaccines of subunit capsid proteins (recombinant proteins or peptides), inactivated viruses, and virus-like particles (VLPs) were developed. VLP, which is highly similar to the wild-type virus in virion structure and contains no viral genome, was proved as one of the good and safe vaccines that can activate humoral immune response in the long term and induce cellular and innate immunities in the early stage post-immunization. The VLP vaccines can be expressed in vitro either by Baculovirus-based or yeast-based eukaryotic system or by bacterial expression system. In this chapter, the prokaryotic expression and the subsequent purification of VLP of betanodavirus orange-spotted grouper nervous necrosis virus (OGNNV) are presented. PMID:27076301

  9. Single-Molecule Observation of Prokaryotic DNA Replication

    PubMed Central

    Tanner, Nathan A.; van Oijen, Antoine M.


    Recent advances in optical imaging and molecular manipulation techniques have made it possible to observe the activity of individual enzymes and study the dynamic properties of processes that are challenging to elucidate using ensemble-averaging techniques. The use of single-molecule approaches has proven to be particularly successful in the study of the dynamic interactions between the components at the replication fork. In this section, we describe the methods necessary for in vitro single-molecule studies of prokaryotic replication systems. Through these experiments, accurate information can be obtained on the rates and processivities of DNA unwinding and polymerization. The ability to monitor in real time the progress of a single replication fork allows for the detection of short-lived, intermediate states that would be difficult to visualize in bulk-phase assays. PMID:19563119

  10. Pi sensing and signalling: from prokaryotic to eukaryotic cells.


    Qi, Wanjun; Baldwin, Stephen A; Muench, Stephen P; Baker, Alison


    Phosphorus is one of the most important macronutrients and is indispensable for all organisms as a critical structural component as well as participating in intracellular signalling and energy metabolism. Sensing and signalling of phosphate (Pi) has been extensively studied and is well understood in single-cellular organisms like bacteria (Escherichia coli) and Saccharomyces cerevisiae In comparison, the mechanism of Pi regulation in plants is less well understood despite recent advances in this area. In most soils the available Pi limits crop yield, therefore a clearer understanding of the molecular basis underlying Pi sensing and signalling is of great importance for the development of plants with improved Pi use efficiency. This mini-review compares some of the main Pi regulation pathways in prokaryotic and eukaryotic cells and identifies similarities and differences among different organisms, as well as providing some insight into future research.

  11. Bacterial swarming: an example of prokaryotic differentiation and multicellular behaviour.


    Allison, C; Hughes, C


    Bacterial swarming involves the differentiation of vegetative cells into hyperflagellated swarm cells which undergo cycles of rapid and coordinated population migration across solid surfaces. Species capable of this simple form of developmental behaviour lie on the boundary between unicellular and multicellular organisms and provide processes for study which are not only of intrinsic interest but which are analogous to components of more complex eukaryotic systems. This review attempts to place current knowledge of bacterial swarming within the framework provided by more extensively studied forms of prokaryotic multicellular behaviour. It discusses the potential of swarming as a readily accessible model of differentiation and multicellular behaviour and describes evidence indicating that swarming differentiation plays an important role in bacterial virulence.

  12. There must be a prokaryote somewhere: microbiology's search for itself.

    PubMed Central

    Woese, C R


    While early microbiologists showed considerable interest in the problem of the natural (evolutionary) relationships among prokaryotes, by the middle of this century that problem had largely been discarded as being unsolvable. In other words, the science of microbiology developed without an evolutionary framework, the lack of which kept it a weak discipline, defined largely by external forces. Modern technology has allowed microbiology finally to develop the needed evolutionary framework, and with this comes a sense of coherence, a sense of identity. Not only is this development radically changing microbiology itself, but also it will change microbiology's relationship to the other biological disciplines. Microbiology of the future will become the primary biological science, the base upon which our future understanding of the living world rests, and the font from which new understanding of it flows. PMID:8177167

  13. Pi sensing and signalling: from prokaryotic to eukaryotic cells.


    Qi, Wanjun; Baldwin, Stephen A; Muench, Stephen P; Baker, Alison


    Phosphorus is one of the most important macronutrients and is indispensable for all organisms as a critical structural component as well as participating in intracellular signalling and energy metabolism. Sensing and signalling of phosphate (Pi) has been extensively studied and is well understood in single-cellular organisms like bacteria (Escherichia coli) and Saccharomyces cerevisiae In comparison, the mechanism of Pi regulation in plants is less well understood despite recent advances in this area. In most soils the available Pi limits crop yield, therefore a clearer understanding of the molecular basis underlying Pi sensing and signalling is of great importance for the development of plants with improved Pi use efficiency. This mini-review compares some of the main Pi regulation pathways in prokaryotic and eukaryotic cells and identifies similarities and differences among different organisms, as well as providing some insight into future research. PMID:27284040

  14. Disulfide bond formation in prokaryotes: history, diversity and design.


    Hatahet, Feras; Boyd, Dana; Beckwith, Jon


    The formation of structural disulfide bonds is essential for the function and stability of a great number of proteins, particularly those that are secreted. There exists a variety of dedicated cellular catalysts and pathways from archaea to humans that ensure the formation of native disulfide bonds. In this review we describe the initial discoveries of these pathways and report progress in recent years in our understanding of the diversity of these pathways in prokaryotes, including those newly discovered in some archaea. We will also discuss the various successful efforts to achieve laboratory-based evolution and design of synthetic disulfide bond formation machineries in the bacterium Escherichia coli. These latter studies have also led to new more general insights into the redox environment of the cytoplasm and bacterial cell envelope. This article is part of a Special Issue entitled: Thiol-Based Redox Processes.

  15. Prokaryotic peptides that block leukocyte adherence to selectins

    PubMed Central


    Pertussis toxin binds target cells through the carbohydrate recognition properties of two subunits, S2 and S3, which share amino acid sequence similarity with the lectin domains of the eukaryotic selectin family. Selectins appear on inflamed endothelial cells and promote rolling of leukocytes by reversibly binding carbohydrates. S2, S3, and synthetic peptides representing their carbohydrate recognition domains competitively inhibited adherence of neutrophils to selectin-coated surfaces and to endothelial cells in vitro. These proteins and peptides also rapidly upregulated the function of the leukocyte integrin CD11b/CD18. These findings implicate mimicry of eukaryotic selectins by prokaryotic adhesive ligands and link the mechanisms underlying leukocyte trafficking to microbial pathogenesis. PMID:7688793

  16. Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.


    Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi


    One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction.

  17. Prokaryotic arsenate reductase enhances arsenate resistance in Mammalian cells.


    Wu, Dan; Tao, Xuanyu; Wu, Gaofeng; Li, Xiangkai; Liu, Pu


    Arsenic is a well-known heavy metal toxicant in the environment. Bioremediation of heavy metals has been proposed as a low-cost and eco-friendly method. This article described some of recent patents on transgenic plants with enhanced heavy metal resistance. Further, to test whether genetic modification of mammalian cells could render higher arsenic resistance, a prokaryotic arsenic reductase gene arsC was transfected into human liver cancer cell HepG2. In the stably transfected cells, the expression level of arsC gene was determined by quantitative real-time PCR. Results showed that arsC was expressed in HepG2 cells and the expression was upregulated by 3 folds upon arsenate induction. To further test whether arsC has function in HepG2 cells, the viability of HepG2-pCI-ArsC cells exposed to arsenite or arsenate was compared to that of HepG2-pCI cells without arsC gene. The results indicated that arsC increased the viability of HepG2 cells by 25% in arsenate, but not in arsenite. And the test of reducing ability of stably transfected cells revealed that the concentration of accumulated trivalent arsenic increased by 25% in HepG2-pCI-ArsC cells. To determine the intracellular localization of ArsC, a fusion vector with fluorescent marker pEGFP-N1-ArsC was constructed and transfected into.HepG2. Laser confocal microscopy showed that EGFP-ArsC fusion protein was distributed throughout the cells. Taken together, these results demonstrated that prokaryotic arsenic resistant gene arsC integrated successfully into HepG2 genome and enhanced arsenate resistance of HepG2, which brought new insights of arsenic detoxification in mammalian cells.

  18. Biological diversity of prokaryotic type IV secretion systems.


    Alvarez-Martinez, Cristina E; Christie, Peter J


    Type IV secretion systems (T4SS) translocate DNA and protein substrates across prokaryotic cell envelopes generally by a mechanism requiring direct contact with a target cell. Three types of T4SS have been described: (i) conjugation systems, operationally defined as machines that translocate DNA substrates intercellularly by a contact-dependent process; (ii) effector translocator systems, functioning to deliver proteins or other macromolecules to eukaryotic target cells; and (iii) DNA release/uptake systems, which translocate DNA to or from the extracellular milieu. Studies of a few paradigmatic systems, notably the conjugation systems of plasmids F, R388, RP4, and pKM101 and the Agrobacterium tumefaciens VirB/VirD4 system, have supplied important insights into the structure, function, and mechanism of action of type IV secretion machines. Information on these systems is updated, with emphasis on recent exciting structural advances. An underappreciated feature of T4SS, most notably of the conjugation subfamily, is that they are widely distributed among many species of gram-negative and -positive bacteria, wall-less bacteria, and the Archaea. Conjugation-mediated lateral gene transfer has shaped the genomes of most if not all prokaryotes over evolutionary time and also contributed in the short term to the dissemination of antibiotic resistance and other virulence traits among medically important pathogens. How have these machines adapted to function across envelopes of distantly related microorganisms? A survey of T4SS functioning in phylogenetically diverse species highlights the biological complexity of these translocation systems and identifies common mechanistic themes as well as novel adaptations for specialized purposes relating to the modulation of the donor-target cell interaction. PMID:19946141

  19. Function of prokaryotic and eukaryotic ABC proteins in lipid transport.


    Pohl, Antje; Devaux, Philippe F; Herrmann, Andreas


    ATP binding cassette (ABC) proteins of both eukaryotic and prokaryotic origins are implicated in the transport of lipids. In humans, members of the ABC protein families A, B, C, D and G are mutated in a number of lipid transport and metabolism disorders, such as Tangier disease, Stargardt syndrome, progressive familial intrahepatic cholestasis, pseudoxanthoma elasticum, adrenoleukodystrophy or sitosterolemia. Studies employing transfection, overexpression, reconstitution, deletion and inhibition indicate the transbilayer transport of endogenous lipids and their analogs by some of these proteins, modulating lipid transbilayer asymmetry. Other proteins appear to be involved in the exposure of specific lipids on the exoplasmic leaflet, allowing their uptake by acceptors and further transport to specific sites. Additionally, lipid transport by ABC proteins is currently being studied in non-human eukaryotes, e.g. in sea urchin, trypanosomatides, arabidopsis and yeast, as well as in prokaryotes such as Escherichia coli and Lactococcus lactis. Here, we review current information about the (putative) role of both pro- and eukaryotic ABC proteins in the various phenomena associated with lipid transport. Besides providing a better understanding of phenomena like lipid metabolism, circulation, multidrug resistance, hormonal processes, fertilization, vision and signalling, studies on pro- and eukaryotic ABC proteins might eventually enable us to put a name on some of the proteins mediating transbilayer lipid transport in various membranes of cells and organelles. It must be emphasized, however, that there are still many uncertainties concerning the functions and mechanisms of ABC proteins interacting with lipids. In particular, further purification and reconstitution experiments with an unambiguous role of ATP hydrolysis are needed to demonstrate a clear involvement of ABC proteins in lipid transbilayer asymmetry. PMID:15749056

  20. Homopolymeric tracts represent a general regulatory mechanism in prokaryotes

    PubMed Central


    Background While, traditionally, regulation of gene expression can be grouped into transcriptional, translational, and post-translational mechanisms, some mechanisms of rapid genetic variation can also contribute to regulation of gene expression, e.g., phase variation. Results We show here that prokaryotes evolved to include homopolymeric tracts (HTs) within coding genes as a system that allows for efficient gene inactivation. Analyses of 81 bacterial and 18 archaeal genomes showed that poly(A) and poly(T) HTs are overrepresented in these genomes and preferentially located at the 5' end of coding genes. Location of HTs at the 5' end is not driven by a preferential placement of aminoacids encoded by the AAA and TTT codons at the N-terminal of proteins. The inlA gene of the pathogen L. monocytogenes was used as a model to further study the role of HTs in reversible gene inactivation. In a number of L. monocytogenes strains, inlA harbors a 5' poly(A) HT, which regularly shows frameshift mutation leading to expression of a truncated 8 aa InlA protein. Translational fusions of the inlA 5' end allowed us to estimate that the frequency of variation in this HT is about 1,000 fold higher than the estimated average point mutation frequency. Conclusions As frameshift mutations in HTs can occur at high frequencies and enable efficient gene inactivation, hypermutable HTs appear to represent a universal system for regulation of gene expression in prokaryotes. Combined with other studies indicating that HTs also enable rapid diversification of both coding and regulatory genetic sequences in eukaryotes, our data suggest that hypermutable HTs represent a general and rapid evolutionary mechanism facilitating adaptation and gene regulation across diverse organisms. PMID:20144225

  1. Viral and grazer regulation of prokaryotic growth efficiency in temperate freshwater pelagic environments.


    Pradeep Ram, A S; Colombet, Jonathan; Perriere, Fanny; Thouvenot, Antoine; Sime-Ngando, Telesphore


    In aquatic systems, limited data exists on the impact of mortality forces such as viral lysis and flagellate grazing when seeking to explain factors regulating prokaryotic metabolism. We explored the relative influence of top-down factors (viral lysis and heterotrophic nanoflagellate grazing) on prokaryotic mortality and their subsequent impact on their community metabolism in the euphotic zone of 21 temperate freshwater lakes located in the French Massif Central. Prokaryotic growth efficiency (PGE, index of prokaryotic community metabolism) determined from prokaryotic production and respiration measurements varied from 5 to 74% across the lakes. Viral and potential grazer-induced mortality of prokaryotes had contrasting impact on PGE. Potential flagellate grazing was found to enhance PGE whereas viral lysis had antagonistic impacts on PGE. The average PGE value in the grazing and viral lysis dominated lake water samples was 35.4% (±15.2%) and 17.2% (±8.1%), respectively. Selective viral lysis or flagellate grazing on prokaryotes together with the nature of contrasted substrates released through mortality processes can perhaps explain for the observed variation and differences in PGE among the studied lakes. The influences of such specific top-down processes on PGE can have strong implications on the carbon and nutrient fluxes in freshwater pelagic environments.

  2. Evolution of prokaryotic respiratory molybdoenzymes and the frequency of their genomic co-occurrence.


    Harel, Arye; Häggblom, Max M; Falkowski, Paul G; Yee, Nathan


    Molybdoenzymes are an ancient protein family found in phylogenetically and ecologically diverse prokaryotes. Under anaerobic conditions, respiratory molybdoenzymes catalyze redox reactions that transfer electrons to a variety of substrates that act as terminal electron acceptors for energy generation. Here, we used probe sequences to conduct an extensive genomic survey and phylogenetic inference for NarG, DmsA, TorA and nine other respiratory molybdoenzyme subfamilies. Our analysis demonstrates their abundance in 60% of prokaryotic phyla. In contrast to many other autonomic genetic units in prokaryotes, the major route of evolution of their predominant subfamilies is vertical gene transfer, gene duplication and divergence. Our results show the robustness of genomic co-occurrence of respiratory molybdoenzymes genes, found in the majority of studied species, for most of the enzyme subfamilies. Genomes which encode for multiple respiratory molybdoenzymes are also enriched in genes regulating replication, recombination and mobility of genetic elements. Respiratory molybdoenzymes were found in prokaryotes associated with diverse environments occupying terrestrial, aquatic, food and host-related habitats, emphasizing their essential role in adaptation of prokaryotes to changing environments. Interestingly, host-associated prokaryotes such as human pathogens more frequently carry multiple respiratory molybdoenzyme genes compared with non-host-associated prokaryotes, highlighting the importance of metabolic flexibility in host-microbiome environments.

  3. Evolution of prokaryotic respiratory molybdoenzymes and the frequency of their genomic co-occurrence.


    Harel, Arye; Häggblom, Max M; Falkowski, Paul G; Yee, Nathan


    Molybdoenzymes are an ancient protein family found in phylogenetically and ecologically diverse prokaryotes. Under anaerobic conditions, respiratory molybdoenzymes catalyze redox reactions that transfer electrons to a variety of substrates that act as terminal electron acceptors for energy generation. Here, we used probe sequences to conduct an extensive genomic survey and phylogenetic inference for NarG, DmsA, TorA and nine other respiratory molybdoenzyme subfamilies. Our analysis demonstrates their abundance in 60% of prokaryotic phyla. In contrast to many other autonomic genetic units in prokaryotes, the major route of evolution of their predominant subfamilies is vertical gene transfer, gene duplication and divergence. Our results show the robustness of genomic co-occurrence of respiratory molybdoenzymes genes, found in the majority of studied species, for most of the enzyme subfamilies. Genomes which encode for multiple respiratory molybdoenzymes are also enriched in genes regulating replication, recombination and mobility of genetic elements. Respiratory molybdoenzymes were found in prokaryotes associated with diverse environments occupying terrestrial, aquatic, food and host-related habitats, emphasizing their essential role in adaptation of prokaryotes to changing environments. Interestingly, host-associated prokaryotes such as human pathogens more frequently carry multiple respiratory molybdoenzyme genes compared with non-host-associated prokaryotes, highlighting the importance of metabolic flexibility in host-microbiome environments. PMID:27612494

  4. Regulation of Synthesis of the Branched-Chain Amino Acids and Cognate Aminoacyl-Transfer Ribonucleic Acid Synthetases of Escherichia coli: a Common Regulatory Element

    PubMed Central

    Jackson, Julius; Williams, L. S.; Umbarger, H. E.


    Regulation of isoleucine, valine, and leucine biosynthesis and isoleucyl-, valyl-, and leucyl-transfer ribonucleic acid (tRNA) synthetase formation was examined in two mutant strains of Escherichia coli. One mutant was selected for growth resistance to the isoleucine analogue, ketomycin, and the other was selected for growth resistance to both trifluoroleucine and valine. Control of the synthesis of the branched-chain amino acids by repression was altered in both of these mutants. They also exhibited altered control of formation of isoleucyl-tRNA synthetase (EC 6.1.15, isoleucine:sRNA ligase, AMP), valyl-tRNA synthetase (EC, valine:sRNA ligase, AMP), and leucyl-tRNA synthetase (EC, leucine:sRNA ligase, AMP). These results suggest the existence of a common element for the control of these two classes of enzymes in Escherichia coli. PMID:4612020

  5. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A


    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  6. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio


    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  7. Primary structure of the 5 S subunit of transcarboxylase as deduced from the genomic DNA sequence.


    Thornton, C G; Kumar, G K; Shenoy, B C; Haase, F C; Phillips, N F; Park, V M; Magner, W J; Hejlik, D P; Wood, H G; Samols, D


    Transcarboxylase from Propionibacterium shermanii is a complex biotin-containing enzyme composed of 30 polypeptides of three different types. It is composed of six dimeric outer subunits associated with a central cylindrical hexameric subunit through 12 biotinyl subunits; three outer subunits on each face of the central hexamer. Each outer dimer is termed a 5 S subunit which associates with two biotinyl subunits. The enzyme catalyzes a two-step reaction in which methylmalonyl-CoA and pyruvate form propionyl-CoA and oxalacetate, the 5 S subunit specifically catalyzing one of these reactions. We report here the cloning, sequencing and expression of the monomer of the 5 S subunit. The gene was identified by matching amino acid sequences derived from isolated authentic 5 S peptides with the deduced sequence of an open reading frame present on a cloned P. shermanii genomic fragment known to contain the gene encoding the 1.3 S biotinyl subunit. The cloned 5 S gene encodes a protein of 519 amino acids, M(r) 57,793. The deduced sequence shows regions of extensive homology with that of pyruvate carboxylase and oxalacetate decarboxylase, two enzymes which catalyze the same or reverse reaction. A fragment was subcloned into pUC19 in an orientation such that the 5 S open reading frame could be expressed from the lac promoter of the vector. Crude extracts prepared from these cells contained an immunoreactive band on Western blots which co-migrated with authentic 5 S and were fully active in catalyzing the 5 S partial reaction. We conclude that we have cloned, sequenced and expressed the monomer of the 5 S subunit and that the expressed product is catalytically active. PMID:8365490

  8. Angular distribution of Xe 5s. -->. epsilonp photoelectrons: Disagreement between experiment and theory

    SciTech Connect

    Fahlman, A.; Carlson, T.A.; Krause, M.O.


    The angular asymmetry parameter ..beta.. for the Xe 5s..-->..epsilonp photoelectrons has been studied with use of synchrotron radiation ( = 28--65 eV). The present results show that the relativistic random-phase approximation theory does not satisfactorily describe the Xe 5s photoionization process close to the Cooper minimum and thus require a renewed theoretical approach. The 5s partial photoionization cross section was obtained over the same photon region and the results agree with experimental values found in the literature.

  9. Abridged 5S rDNA units in sea beet (Beta vulgaris subsp. maritima).


    Turner, Daniel J; Brown, Terence A


    Amplification by polymerase chain reaction of the 5S rDNA repeat units of Beta vulgaris subsp. maritima resulted in a 350-bp product corresponding to the full-length 5S unit, but also revealed 4 abridged unit classes, each with a deletion that removed most of the spacer and 12-76 bp of the coding sequence. Each abridged type lacks at least 1 of the conserved elements involved in transcription of the 5S gene, and so appear to be nonfunctional. Network analysis revealed that the abridged units are evolving in the same manner as the full-length versions.

  10. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y


    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  11. Pressure broadening and line shifting of atomic strontium 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} and 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} absorption transitions induced by noble-gas collisions

    SciTech Connect

    Holtgrave, Jeremy C.; Wolf, Paul J.


    The broadening and shifting of spectral lines induced by collisions with the five noble gases in both the intercombination 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} system and the triplet 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} manifold of Sr are studied using tunable dye laser absorption spectroscopy. Cross sections for impact broadening and line shifting are determined from an examination of the spectral line profiles. These results are utilized in an analysis to compute difference potentials modeled by the Lennard-Jones (6-12) potential and the coefficients C{sub 6} and C{sub 12} derived from this analysis are reported.

  12. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.


    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  13. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.


    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  14. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  15. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].


    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem


    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  16. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].


    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem


    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  17. Interaction of Xenopus TFIIIC with the TFIIIA.5 S RNA gene complex.


    Keller, H J; Romaniuk, P J; Gottesfeld, J M


    The general transcription factor TFIIIC is necessary for transcription initiation by RNA polymerase III. TFIIIC binds predominantly to the B-Block promoter element, which is present in tRNA genes, several viral RNA genes and repetitive DNA elements, and to the TFIIIA.DNA complex on 5 S RNA genes. Here we report a characterization of Xenopus laevis TFIIIC and its interaction with the TFIIIA.5 S RNA gene complex. A polypeptide with apparent molecular mass of 85 kDa was specifically cross-linked to a B-Block oligonucleotide by UV light. This polypeptide was present in the partially purified TFIIIC fraction and in a complex with a B-Block double-stranded oligonucleotide isolated by nondenaturing gel electrophoresis. TFIIIC.TFIIIA.DNA gel mobility shift complexes were obtained using B-Block DNA affinity-purified TFIIIC and buffer conditions employing low Mg2+ (1 mM) and high dithiothreitol (7 mM) concentrations. Three TFIIIC.TFIIIA.5 S RNA gene complexes were observed by gel mobility shift analysis. One of these complexes was resistant to dissociation by the addition of competing DNA, but the formation of all three complexes was prevented by the inclusion of excess specific competitor DNA in the initial binding reactions. The apparent affinity of TFIIIC for the TFIIIA.5 S DNA complex was 5-fold higher for the somatic-type 5 S RNA gene than for the oocyte-type 5 S RNA gene. Mutations near the 5' boundary of the TFIIIA binding site alter the DNase I footprint of the TFIIIA.DNA complex and reduce the affinity of TFIIIA-mutant 5 S gene complexes for TFIIIC. Differences in TFIIIC affinity for the two classes of 5 S RNA genes may play a role in the developmental regulation of these gene families. PMID:1517247

  18. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).


    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M


    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  19. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR


    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  20. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR


    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  1. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR


    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  2. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.


    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J


    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  3. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü


    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  4. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.


    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  5. Identification and Detection of Prokaryotic Symbionts in the Ciliate Metopus from Anaerobic Granular Sludge

    PubMed Central

    Hirakata, Yuga; Oshiki, Mamoru; Kuroda, Kyohei; Hatamoto, Masashi; Kubota, Kengo; Yamaguchi, Takashi; Harada, Hideki; Araki, Nobuo


    The aim of the present study was to investigate the prokaryotic community structure of the anaerobic ciliate, Metopus sp. using rRNA sequencing, fluorescence in situ hybridization (FISH), and transmission electron microscopy (TEM). Metopus sp. was physically separated from anaerobic granular sludge in a domestic wastewater treatment plant and anoxically cultivated for 7 d. 16S rRNA gene sequences from the prokaryotes Methanoregula boonei and Clostridium aminobutyricum were abundantly detected in Metopus ciliates. The FISH analysis using the oligonucleotide probes Mg1200b and Cla568 demonstrated that these prokaryotes were localized within Metopus cells. These results identify M. boonei- and C. aminobutyricum-like prokaryotes as novel endosymbionts of Metopus ciliates. PMID:26639580


    EPA Science Inventory

    Within potable water distribution systems, opportunistic pathogens such as Legionella species infect protozoa, gaining protection from disinfectant residuals. Analyzing the prokaryotic and eukaryotic populations in distribution system water provides a basis for understanding the...

  7. Macroevolutionary trends of atomic composition and related functional group proportion in eukaryotic and prokaryotic proteins.


    Zhang, Yu-Juan; Yang, Chun-Lin; Hao, You-Jin; Li, Ying; Chen, Bin; Wen, Jian-Fan


    To fully explore the trends of atomic composition during the macroevolution from prokaryote to eukaryote, five atoms (oxygen, sulfur, nitrogen, carbon, hydrogen) and related functional groups in prokaryotic and eukaryotic proteins were surveyed and compared. Genome-wide analysis showed that eukaryotic proteins have more oxygen, sulfur and nitrogen atoms than prokaryotes do. Clusters of Orthologous Groups (COG) analysis revealed that oxygen, sulfur, carbon and hydrogen frequencies are higher in eukaryotic proteins than in their prokaryotic orthologs. Furthermore, functional group analysis demonstrated that eukaryotic proteins tend to have higher proportions of sulfhydryl, hydroxyl and acylamino, but lower of sulfide and carboxyl. Taken together, an apparent trend of increase was observed for oxygen and sulfur atoms in the macroevolution; the variation of oxygen and sulfur compositions and their related functional groups in macroevolution made eukaryotic proteins carry more useful functional groups. These results will be helpful for better understanding the functional significances of atomic composition evolution.


    EPA Science Inventory

    Within potable water distribution systems, opportunistic pathogens such as Legionella species infect protozoa, gaining protection from disinfectant residuals. Analyzing the prokaryotic and eukaryotic populations in distribution system water provides a basis for understanding the...

  9. Connectivity between surface and deep waters determines prokaryotic diversity in the North Atlantic Deep Water

    PubMed Central

    Frank, Alexander H.; Garcia, Juan A. L.; Herndl, Gerhard J.


    Summary To decipher the influence of depth stratification and surface provincialism on the dark ocean prokaryotic community composition, we sampled the major deep‐water masses in the eastern North Atlantic covering three biogeographic provinces. Their diversity was evaluated using ordination and canonical analysis of 454 pyrotag sequences. Variance partitioning suggested that 16% of the variation in the bacterial community composition was based on depth stratification while 9% of the variation was due to geographic location. General linear mixed effect models showed that the community of the subsurface waters was connected to the dark ocean prokaryotic communities in different biogeographic provinces. Cluster analysis indicated that some prokaryotic taxa are specific to distinct regions in bathypelagic water masses. Taken together, our data suggest that the dark ocean prokaryotic community composition of the eastern North Atlantic is primed by the formation and the horizontal transport of water masses. PMID:26914787

  10. Identification and Detection of Prokaryotic Symbionts in the Ciliate Metopus from Anaerobic Granular Sludge.


    Hirakata, Yuga; Oshiki, Mamoru; Kuroda, Kyohei; Hatamoto, Masashi; Kubota, Kengo; Yamaguchi, Takashi; Harada, Hideki; Araki, Nobuo


    The aim of the present study was to investigate the prokaryotic community structure of the anaerobic ciliate, Metopus sp. using rRNA sequencing, fluorescence in situ hybridization (FISH), and transmission electron microscopy (TEM). Metopus sp. was physically separated from anaerobic granular sludge in a domestic wastewater treatment plant and anoxically cultivated for 7 d. 16S rRNA gene sequences from the prokaryotes Methanoregula boonei and Clostridium aminobutyricum were abundantly detected in Metopus ciliates. The FISH analysis using the oligonucleotide probes Mg1200b and Cla568 demonstrated that these prokaryotes were localized within Metopus cells. These results identify M. boonei- and C. aminobutyricum-like prokaryotes as novel endosymbionts of Metopus ciliates.

  11. Ribosomal oxygenases are structurally conserved from prokaryotes to humans.


    Chowdhury, Rasheduzzaman; Sekirnik, Rok; Brissett, Nigel C; Krojer, Tobias; Ho, Chia-Hua; Ng, Stanley S; Clifton, Ian J; Ge, Wei; Kershaw, Nadia J; Fox, Gavin C; Muniz, Joao R C; Vollmar, Melanie; Phillips, Claire; Pilka, Ewa S; Kavanagh, Kathryn L; von Delft, Frank; Oppermann, Udo; McDonough, Michael A; Doherty, Aidan J; Schofield, Christopher J


    2-Oxoglutarate (2OG)-dependent oxygenases have important roles in the regulation of gene expression via demethylation of N-methylated chromatin components and in the hydroxylation of transcription factors and splicing factor proteins. Recently, 2OG-dependent oxygenases that catalyse hydroxylation of transfer RNA and ribosomal proteins have been shown to be important in translation relating to cellular growth, TH17-cell differentiation and translational accuracy. The finding that ribosomal oxygenases (ROXs) occur in organisms ranging from prokaryotes to humans raises questions as to their structural and evolutionary relationships. In Escherichia coli, YcfD catalyses arginine hydroxylation in the ribosomal protein L16; in humans, MYC-induced nuclear antigen (MINA53; also known as MINA) and nucleolar protein 66 (NO66) catalyse histidine hydroxylation in the ribosomal proteins RPL27A and RPL8, respectively. The functional assignments of ROXs open therapeutic possibilities via either ROX inhibition or targeting of differentially modified ribosomes. Despite differences in the residue and protein selectivities of prokaryotic and eukaryotic ROXs, comparison of the crystal structures of E. coli YcfD and Rhodothermus marinus YcfD with those of human MINA53 and NO66 reveals highly conserved folds and novel dimerization modes defining a new structural subfamily of 2OG-dependent oxygenases. ROX structures with and without their substrates support their functional assignments as hydroxylases but not demethylases, and reveal how the subfamily has evolved to catalyse the hydroxylation of different residue side chains of ribosomal proteins. Comparison of ROX crystal structures with those of other JmjC-domain-containing hydroxylases, including the hypoxia-inducible factor asparaginyl hydroxylase FIH and histone N(ε)-methyl lysine demethylases, identifies branch points in 2OG-dependent oxygenase evolution and distinguishes between JmjC-containing hydroxylases and demethylases

  12. GTAG- and CGTC-tagged palindromic DNA repeats in prokaryotes

    PubMed Central


    Background REPs (Repetitive Extragenic Palindromes) are small (20–40 bp) palindromic repeats found in high copies in some prokaryotic genomes, hypothesized to play a role in DNA supercoiling, transcription termination, mRNA stabilization. Results We have monitored a large number of REP elements in prokaryotic genomes, and found that most can be sorted into two large DNA super-families, as they feature at one end unpaired motifs fitting either the GTAG or the CGTC consensus. Tagged REPs have been identified in >80 species in 8 different phyla. GTAG and CGTC repeats reside predominantly in microorganisms of the gamma and alpha division of Proteobacteria, respectively. However, the identification of members of both super- families in deeper branching phyla such Cyanobacteria and Planctomycetes supports the notion that REPs are old components of the bacterial chromosome. On the basis of sequence content and overall structure, GTAG and CGTC repeats have been assigned to 24 and 4 families, respectively. Of these, some are species-specific, others reside in multiple species, and several organisms contain different REP types. In many families, most units are close to each other in opposite orientation, and may potentially fold into larger secondary structures. In different REP-rich genomes the repeats are predominantly located between unidirectionally and convergently transcribed ORFs. REPs are predominantly located downstream from coding regions, and many are plausibly transcribed and function as RNA elements. REPs located inside genes have been identified in several species. Many lie within replication and global genome repair genes. It has been hypothesized that GTAG REPs are miniature transposons mobilized by specific transposases known as RAYTs (REP associated tyrosine transposases). RAYT genes are flanked either by GTAG repeats or by long terminal inverted repeats (TIRs) unrelated to GTAG repeats. Moderately abundant families of TIRs have been identified in

  13. Microscopic identification of prokaryotes in modern and ancient halite, Saline Valley and Death Valley, California.


    Schubert, Brian A; Lowenstein, Tim K; Timofeeff, Michael N


    Primary fluid inclusions in halite crystallized in Saline Valley, California, in 1980, 2004-2005, and 2007, contain rod- and coccoid-shaped microparticles the same size and morphology as archaea and bacteria living in modern brines. Primary fluid inclusions from a well-dated (0-100,000 years), 90 m long salt core from Badwater Basin, Death Valley, California, also contain microparticles, here interpreted as halophilic and halotolerant prokaryotes. Prokaryotes are distinguished from crystals on the basis of morphology, optical properties (birefringence), and uniformity of size. Electron micrographs of microparticles from filtered modern brine (Saline Valley), dissolved modern halite crystals (Saline Valley), and dissolved ancient halite crystals (Death Valley) support in situ microscopic observations that prokaryotes are present in fluid inclusions in ancient halite. In the Death Valley salt core, prokaryotes in fluid inclusions occur almost exclusively in halite precipitated in perennial saline lakes 10,000 to 35,000 years ago. This suggests that trapping and preservation of prokaryotes in fluid inclusions is influenced by the surface environment in which the halite originally precipitated. In all cases, prokaryotes in fluid inclusions in halite from the Death Valley salt core are miniaturized (<1 microm diameter cocci, <2.5 microm long, very rare rod shapes), which supports interpretations that the prokaryotes are indigenous to the halite and starvation survival may be the normal response of some prokaryotes to entrapment in fluid inclusions for millennia. These results reinforce the view that fluid inclusions in halite and possibly other evaporites are important repositories of microbial life and should be carefully examined in the search for ancient microorganisms on Earth, Mars, and elsewhere in the Solar System.

  14. Modeling the winter-to-summer transition of prokaryotic and viral abundance in the Arctic Ocean.


    Winter, Christian; Payet, Jérôme P; Suttle, Curtis A


    One of the challenges in oceanography is to understand the influence of environmental factors on the abundances of prokaryotes and viruses. Generally, conventional statistical methods resolve trends well, but more complex relationships are difficult to explore. In such cases, Artificial Neural Networks (ANNs) offer an alternative way for data analysis. Here, we developed ANN-based models of prokaryotic and viral abundances in the Arctic Ocean. The models were used to identify the best predictors for prokaryotic and viral abundances including cytometrically-distinguishable populations of prokaryotes (high and low nucleic acid cells) and viruses (high- and low-fluorescent viruses) among salinity, temperature, depth, day length, and the concentration of Chlorophyll-a. The best performing ANNs to model the abundances of high and low nucleic acid cells used temperature and Chl-a as input parameters, while the abundances of high- and low-fluorescent viruses used depth, Chl-a, and day length as input parameters. Decreasing viral abundance with increasing depth and decreasing system productivity was captured well by the ANNs. Despite identifying the same predictors for the two populations of prokaryotes and viruses, respectively, the structure of the best performing ANNs differed between high and low nucleic acid cells and between high- and low-fluorescent viruses. Also, the two prokaryotic and viral groups responded differently to changes in the predictor parameters; hence, the cytometric distinction between these populations is ecologically relevant. The models imply that temperature is the main factor explaining most of the variation in the abundances of high nucleic acid cells and total prokaryotes and that the mechanisms governing the reaction to changes in the environment are distinctly different among the prokaryotic and viral populations.

  15. Viral infections stimulate the metabolism and shape prokaryotic assemblages in submarine mud volcanoes.


    Corinaldesi, Cinzia; Dell'Anno, Antonio; Danovaro, Roberto


    Mud volcanoes are geological structures in the oceans that have key roles in the functioning of the global ecosystem. Information on the dynamics of benthic viruses and their interactions with prokaryotes in mud volcano ecosystems is still completely lacking. We investigated the impact of viral infection on the mortality and assemblage structure of benthic prokaryotes of five mud volcanoes in the Mediterranean Sea. Mud volcano sediments promote high rates of viral production (1.65-7.89 × 10(9) viruses g(-1) d(-1)), viral-induced prokaryotic mortality (VIPM) (33% cells killed per day) and heterotrophic prokaryotic production (3.0-8.3 μgC g(-1) d(-1)) when compared with sediments outside the mud volcano area. The viral shunt (that is, the microbial biomass converted into dissolved organic matter as a result of viral infection, and thus diverted away from higher trophic levels) provides 49 mgC m(-2) d(-1), thus fuelling the metabolism of uninfected prokaryotes and contributing to the total C budget. Bacteria are the dominant components of prokaryotic assemblages in surface sediments of mud volcanoes, whereas archaea dominate the subsurface sediment layers. Multivariate multiple regression analyses show that prokaryotic assemblage composition is not only dependant on the geochemical features and processes of mud volcano ecosystems but also on synergistic interactions between bottom-up (that is, trophic resources) and top-down (that is, VIPM) controlling factors. Overall, these findings highlight the significant role of the viral shunt in sustaining the metabolism of prokaryotes and shaping their assemblage structure in mud volcano sediments, and they provide new clues for our understanding of the functioning of cold-seep ecosystems.

  16. Viral infections stimulate the metabolism and shape prokaryotic assemblages in submarine mud volcanoes

    PubMed Central

    Corinaldesi, Cinzia; Dell'Anno, Antonio; Danovaro, Roberto


    Mud volcanoes are geological structures in the oceans that have key roles in the functioning of the global ecosystem. Information on the dynamics of benthic viruses and their interactions with prokaryotes in mud volcano ecosystems is still completely lacking. We investigated the impact of viral infection on the mortality and assemblage structure of benthic prokaryotes of five mud volcanoes in the Mediterranean Sea. Mud volcano sediments promote high rates of viral production (1.65–7.89 × 109 viruses g−1 d−1), viral-induced prokaryotic mortality (VIPM) (33% cells killed per day) and heterotrophic prokaryotic production (3.0–8.3 μgC g−1 d−1) when compared with sediments outside the mud volcano area. The viral shunt (that is, the microbial biomass converted into dissolved organic matter as a result of viral infection, and thus diverted away from higher trophic levels) provides 49 mgC m−2 d−1, thus fuelling the metabolism of uninfected prokaryotes and contributing to the total C budget. Bacteria are the dominant components of prokaryotic assemblages in surface sediments of mud volcanoes, whereas archaea dominate the subsurface sediment layers. Multivariate multiple regression analyses show that prokaryotic assemblage composition is not only dependant on the geochemical features and processes of mud volcano ecosystems but also on synergistic interactions between bottom-up (that is, trophic resources) and top-down (that is, VIPM) controlling factors. Overall, these findings highlight the significant role of the viral shunt in sustaining the metabolism of prokaryotes and shaping their assemblage structure in mud volcano sediments, and they provide new clues for our understanding of the functioning of cold-seep ecosystems. PMID:22170423

  17. Viral infections stimulate the metabolism and shape prokaryotic assemblages in submarine mud volcanoes.


    Corinaldesi, Cinzia; Dell'Anno, Antonio; Danovaro, Roberto


    Mud volcanoes are geological structures in the oceans that have key roles in the functioning of the global ecosystem. Information on the dynamics of benthic viruses and their interactions with prokaryotes in mud volcano ecosystems is still completely lacking. We investigated the impact of viral infection on the mortality and assemblage structure of benthic prokaryotes of five mud volcanoes in the Mediterranean Sea. Mud volcano sediments promote high rates of viral production (1.65-7.89 × 10(9) viruses g(-1) d(-1)), viral-induced prokaryotic mortality (VIPM) (33% cells killed per day) and heterotrophic prokaryotic production (3.0-8.3 μgC g(-1) d(-1)) when compared with sediments outside the mud volcano area. The viral shunt (that is, the microbial biomass converted into dissolved organic matter as a result of viral infection, and thus diverted away from higher trophic levels) provides 49 mgC m(-2) d(-1), thus fuelling the metabolism of uninfected prokaryotes and contributing to the total C budget. Bacteria are the dominant components of prokaryotic assemblages in surface sediments of mud volcanoes, whereas archaea dominate the subsurface sediment layers. Multivariate multiple regression analyses show that prokaryotic assemblage composition is not only dependant on the geochemical features and processes of mud volcano ecosystems but also on synergistic interactions between bottom-up (that is, trophic resources) and top-down (that is, VIPM) controlling factors. Overall, these findings highlight the significant role of the viral shunt in sustaining the metabolism of prokaryotes and shaping their assemblage structure in mud volcano sediments, and they provide new clues for our understanding of the functioning of cold-seep ecosystems. PMID:22170423

  18. Microscopic Identification of Prokaryotes in Modern and Ancient Halite, Saline Valley and Death Valley, California

    NASA Astrophysics Data System (ADS)

    Schubert, Brian A.; Lowenstein, Tim K.; Timofeeff, Michael N.


    Primary fluid inclusions in halite crystallized in Saline Valley, California, in 1980, 2004-2005, and 2007, contain rod- and coccoid-shaped microparticles the same size and morphology as archaea and bacteria living in modern brines. Primary fluid inclusions from a well-dated (0-100,000 years), 90 m long salt core from Badwater Basin, Death Valley, California, also contain microparticles, here interpreted as halophilic and halotolerant prokaryotes. Prokaryotes are distinguished from crystals on the basis of morphology, optical properties (birefringence), and uniformity of size. Electron micrographs of microparticles from filtered modern brine (Saline Valley), dissolved modern halite crystals (Saline Valley), and dissolved ancient halite crystals (Death Valley) support in situ microscopic observations that prokaryotes are present in fluid inclusions in ancient halite. In the Death Valley salt core, prokaryotes in fluid inclusions occur almost exclusively in halite precipitated in perennial saline lakes 10,000 to 35,000 years ago. This suggests that trapping and preservation of prokaryotes in fluid inclusions is influenced by the surface environment in which the halite originally precipitated. In all cases, prokaryotes in fluid inclusions in halite from the Death Valley salt core are miniaturized (<1 μm diameter cocci, <2.5 μm long, very rare rod shapes), which supports interpretations that the prokaryotes are indigenous to the halite and starvation survival may be the normal response of some prokaryotes to entrapment in fluid inclusions for millennia. These results reinforce the view that fluid inclusions in halite and possibly other evaporites are important repositories of microbial life and should be carefully examined in the search for ancient microorganisms on Earth, Mars, and elsewhere in the Solar System.

  19. Microscopic identification of prokaryotes in modern and ancient halite, Saline Valley and Death Valley, California.


    Schubert, Brian A; Lowenstein, Tim K; Timofeeff, Michael N


    Primary fluid inclusions in halite crystallized in Saline Valley, California, in 1980, 2004-2005, and 2007, contain rod- and coccoid-shaped microparticles the same size and morphology as archaea and bacteria living in modern brines. Primary fluid inclusions from a well-dated (0-100,000 years), 90 m long salt core from Badwater Basin, Death Valley, California, also contain microparticles, here interpreted as halophilic and halotolerant prokaryotes. Prokaryotes are distinguished from crystals on the basis of morphology, optical properties (birefringence), and uniformity of size. Electron micrographs of microparticles from filtered modern brine (Saline Valley), dissolved modern halite crystals (Saline Valley), and dissolved ancient halite crystals (Death Valley) support in situ microscopic observations that prokaryotes are present in fluid inclusions in ancient halite. In the Death Valley salt core, prokaryotes in fluid inclusions occur almost exclusively in halite precipitated in perennial saline lakes 10,000 to 35,000 years ago. This suggests that trapping and preservation of prokaryotes in fluid inclusions is influenced by the surface environment in which the halite originally precipitated. In all cases, prokaryotes in fluid inclusions in halite from the Death Valley salt core are miniaturized (<1 microm diameter cocci, <2.5 microm long, very rare rod shapes), which supports interpretations that the prokaryotes are indigenous to the halite and starvation survival may be the normal response of some prokaryotes to entrapment in fluid inclusions for millennia. These results reinforce the view that fluid inclusions in halite and possibly other evaporites are important repositories of microbial life and should be carefully examined in the search for ancient microorganisms on Earth, Mars, and elsewhere in the Solar System. PMID:19566426

  20. Discovery of conserved motifs in promoters of orthologous genes in prokaryotes.


    Janky, Rekin's; van Helden, Jacques


    We present a method to predict cis-acting elements for a given gene by detecting over-represented motifs in promoters of a set of ortholo gous genes in prokaryotes (single-gene, multiple-genomes approach). The method has been used successfully to detect regulatory elements at various taxonomical levels in prokaryotes. A web interface is available at the Regulatory Sequence Analysis Tools site (

  1. Prokaryotic responses to hydrostatic pressure in the ocean--a review.


    Tamburini, Christian; Boutrif, Mehdi; Garel, Marc; Colwell, Rita R; Deming, Jody W


    Effects of hydrostatic pressure on pure cultures of prokaryotes have been studied extensively but impacts at the community level in the ocean are less well defined. Here we consider hydrostatic pressure effects on natural communities containing both unadapted (piezosensitive) prokaryotes originating from surface water and adapted (including piezophilic) prokaryotes from the deep sea. Results from experiments mimicking pressure changes experienced by particle-associated prokaryotes during their descent through the water column show that rates of degradation of organic matter (OM) by surface-originating microorganisms decrease with sinking. Analysis of a much larger data set shows that, under stratified conditions, deep-sea communities adapt to in situ conditions of high pressure, low temperature and low OM. Measurements made using decompressed samples and atmospheric pressure thus underestimate in situ activity. Exceptions leading to overestimates can be attributed to deep mixing events, large influxes of surface particles, or provision of excessive OM during experimentation. The sediment-water interface, where sinking particles accumulate, will be populated by a mixture of piezosensitive, piezotolerant and piezophilic prokaryotes, with piezophilic activity prevailing deeper within sediment. A schematic representation of how pressure shapes prokaryotic communities in the ocean is provided, allowing a reasonably accurate interpretation of the available activity measurements.

  2. Comparative mechanisms of protein transduction mediated by cell-penetrating peptides in prokaryotes.


    Liu, Betty Revon; Huang, Yue-Wern; Aronstam, Robert S; Lee, Han-Jung


    Bacterial and archaeal cell envelopes are complex multilayered barriers that serve to protect these microorganisms from their extremely harsh and often hostile environments. Import of exogenous proteins and nanoparticles into cells is important for biotechnological applications in prokaryotes. In this report, we demonstrate that cell-penetrating peptides (CPPs), both bacteria-expressed nona-arginine peptide (R9) and synthetic R9 (SR9), are able to deliver noncovalently associated proteins or quantum dots into four representative species of prokaryotes: cyanobacteria (Synechocystis sp. PCC 6803), bacteria (Escherichia coli DH5α and Arthrobacter ilicis D-50), and archaea (Thermus aquaticus). Although energy-dependent endocytosis is generally accepted as a hallmark that distinguishes eukaryotes from prokaryotes, cellular uptake of uncomplexed green fluorescent protein (GFP) by cyanobacteria was mediated by classical endocytosis. Mechanistic studies revealed that macropinocytosis plays a critical and major role in CPP-mediated protein transduction in all four prokaryotes. Membrane damage was not observed when cyanobacterial cells were treated with R9/GFP complexes, nor was cytotoxicity detected when bacteria or archaea were treated with SR9/QD complexes in the presence of macropinocytic inhibitors. These results indicate that the uptake of protein is not due to a compromise of membrane integrity in cyanobacteria, and that CPP can be an effective and safe carrier for membrane trafficking in prokaryotic cells. Our investigation provides important new insights into the transport of exogenous proteins and nanoparticles across the complex membrane systems of prokaryotes.

  3. The hidden side of the prokaryotic cell: rediscovering the microbial world.


    Guerrero, Ricardo; Berlanga, Mercedes


    How many different forms of life exist and how they are evolutionarily related is one of the most challenging problems in biology. In 1962, Roger Y. Stanier and Cornelis B. van Niel proposed "the concept of a bacterium" and thus allowed (micro)biologists to divide living organisms into two primary groups: prokaryotes and eukaryotes. Initially, prokaryotes were believed to be devoid of any internal organization or other characteristics typical of eukaryotes, due to their minute size and deceptively simple appearance. However, the last few decades have demonstrated that the structure and function of the prokaryotic cell are much more intricate than initially thought. We will discuss here two characteristics of prokaryotic cells that were not known to Stanier and van Niel but which now allow us to understand the basis of many characteristics that are fully developed in eukaryotic cells: First, it has recently become clear that bacteria contain all of the cytoskeletal elements present in eukaryotic cells, demonstrating that the cytoskeleton was not a eukaryotic invention; on the contrary, it evolved early in evolution. Essential processes of the prokaryotic cell, such as the maintenance of cell shape, DNA segregation, and cell division, rely on the cytoskeleton. Second, the accumulation of intracellular storage polymers, such as polyhydroxyalkanoates (a property studied in detail by Stanier and colleagues), provides a clear evolutionary advantage to bacteria. These compounds act as a "time-binding" mechanism, one of several prokaryotic strategies to increases survival in the Earth's everchanging environments.

  4. Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.


    Asplund-Samuelsson, Johannes; Bergman, Birgitta; Larsson, John


    Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18%) were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota). Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

  5. Prokaryote diversity and viral production in deep-sea sediments and seamounts

    NASA Astrophysics Data System (ADS)

    Danovaro, Roberto; Corinaldesi, Cinzia; Luna, Gian Marco; Magagnini, Mirko; Manini, Elena; Pusceddu, Antonio


    Despite the fact that marine prokaryotes and viruses have been increasingly investigated over the last decade, knowledge on prokaryote diversity and viral production in bathyal sediments is limited. We investigated microbial variables in the deep-sea sediments around two seamounts at 3000-m depth in the Tyrrhenian Sea and sediments located at the same depth, but not affected by the presence of the seamounts. We hypothesized that seamounts altered significantly prokaryotes-viruses interactions in surrounding deep-sea sediments. Sediments surrounding seamounts were characterised by prokaryotic abundances significantly higher than those observed in non-seamount sediments. Benthic viral production was about double in sediments close to seamounts than in non-seamount sediments, where virus turnover was up to 3 times lower. Total Bacteria, as assessed by CARD-FISH, dominated prokaryotic community structure, whereas Archaea accounted on average for approximately 10%. The fraction of Crenarchaeota was always higher than Euryarchaeota. Bacterial diversity, estimated using ARISA, was high, with up to 127 different microbial operational taxonomic units (OTUs) in a single sample. Archaeal richness (determined using T-RFLP of the 16S rRNA gene) ranged from 12 to 20 OTUs, while Archaeal evenness was comprised between 0.529±0.018 and 0.623±0.08. Results represent a pointer for future investigations dealing with the interactions between viruses and prokaryotes in deep-sea sediments.

  6. Prokaryotic Community Diversity Along an Increasing Salt Gradient in a Soda Ash Concentration Pond.


    Simachew, Addis; Lanzén, Anders; Gessesse, Amare; Øvreås, Lise


    The effect of salinity on prokaryotic community diversity in Abijata-Shalla Soda Ash Concentration Pond system was investigated by using high-throughput 16S rRNA gene 454 pyrosequencing. Surface water and brine samples from five sites spanning a salinity range of 3.4 % (Lake Abijata) to 32 % (SP230F, crystallizer pond) were analyzed. Overall, 33 prokaryotic phyla were detected, and the dominant prokaryotic phyla accounted for more than 95 % of the reads consisting of Planctomycetes, Bacteroidetes, candidate division TM7, Deinococcus-Thermus, Firmicutes, Actinobacteria, Proteobacteria, and Euryarchaeota. Diversity indices indicated that operational taxonomic unit (OTU) richness decreases drastically with increasing salinity in the pond system. A total of 471 OTUs were found at 3.4 % salinity whereas 49 OTUs were detected in pond SP211 (25 % salinity), and only 19 OTUs in the crystallization pond at 32 % salinity (SP230F). Along the salinity gradient, archaeal community gradually replaced bacterial community. Thus, archaeal community accounted for 0.4 % in Lake Abijata while 99.0 % in pond SP230F. This study demonstrates that salinity appears to be the key environmental parameter in structuring the prokaryotic communities of haloalkaline environments. Further, it confirmed that the prokaryotic diversity in Lake Abijata is high and it harbors taxa with low or no phylogenetic similarities to existing prokaryotic taxa and thus represents novel microorganisms.

  7. A novel prokaryotic promoter identified in the genome of some monopartite begomoviruses.


    Wang, Wei-Chen; Hsu, Yau-Heiu; Lin, Na-Sheng; Wu, Chia-Ying; Lai, Yi-Chin; Hu, Chung-Chi


    Geminiviruses are known to exhibit both prokaryotic and eukaryotic features in their genomes, with the ability to express their genes and even replicate in bacterial cells. We have demonstrated previously the existence of unit-length single-stranded circular DNAs of Ageratum yellow vein virus (AYVV, a species in the genus Begomovirus, family Geminiviridae) in Escherichia coli cells, which prompted our search for unknown prokaryotic functions in the begomovirus genomes. By using a promoter trapping strategy, we identified a novel prokaryotic promoter, designated AV3 promoter, in nts 762-831 of the AYVV genome. Activity assays revealed that the AV3 promoter is strong, unidirectional, and constitutive, with an endogenous downstream ribosome binding site and a translatable short open reading frame of eight amino acids. Sequence analyses suggested that the AV3 promoter might be a remnant of prokaryotic ancestors that could be related to certain promoters of bacteria from marine or freshwater environments. The discovery of the prokaryotic AV3 promoter provided further evidence for the prokaryotic origin in the evolutionary history of geminiviruses.

  8. Vertical distribution of the prokaryotic cell size in the Mediterranean Sea

    NASA Astrophysics Data System (ADS)

    La Ferla, R.; Maimone, G.; Azzaro, M.; Conversano, F.; Brunet, C.; Cabral, A. S.; Paranhos, R.


    Distributions of prokaryotic cell size and morphology were studied in different areas of the Mediterranean Sea by using image analysis on samples collected from surface down to bathypelagic layers (max depth 4,900 m) in the Southern Tyrrhenian, Southern Adriatic and Eastern Mediterranean Seas. Distribution of cell size of prokaryotes in marine ecosystem is very often not considered, which makes our study first in the context of prokaryotic ecology. In the deep Mediterranean layers, an usually-not-considered form of carbon sequestration through prokaryotic cells has been highlighted, which is consistent with an increase in cell size with the depth of the water column. A wide range in prokaryotic cell volumes was observed (between 0.045 and 0.566 μm3). Increase in cell size with depth was opposed to cell abundance distribution. Our results from microscopic observations were confirmed by the increasing HNA/LNA ratio (HNA, cells with high nucleic acid content; LNA, cells with low nucleic acid content) along the water column. Implications of our results on the increasing cell size with depth are in the fact that the quantitative estimation of prokaryotic biomass changes along the water column and the amount of carbon sequestered in the deep biota is enhanced.

  9. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.


    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  10. Genomic Mining of Prokaryotic Repressors for Orthogonal Logic Gates

    PubMed Central

    Stanton, Brynne C.; Nielsen, Alec A.K.; Tamsir, Alvin; Clancy, Kevin; Peterson, Todd; Voigt, Christopher A.


    Genetic circuits perform computational operations based on interactions between freely diffusing molecules within a cell. When transcription factors are combined to build a circuit, unintended interactions can disrupt its function. Here, we apply “part mining” to build a library of 73 TetR-family repressors gleaned from prokaryotic genomes. The operators of a subset were determined using an in vitro method and this information was used to build synthetic promoters. The promoters and repressors were screened for cross-reactions. Of these, 16 were identified that both strongly repress their cognate promoter (5- to 207-fold) and do not interact with other promoters. Each repressor:promoter pair was converted to a NOT gate and characterized. Used as a set of 16 NOR gates, there are >1054 circuits that could be built by changing the pattern of input and output promoters. This represents a large set of compatible gates that can be used to construct user-defined circuits. PMID:24316737

  11. Biogeography of sulfate-reducing prokaryotes in river floodplains.


    Miletto, Marzia; Loy, Alexander; Antheunisse, A Martijn; Loeb, Roos; Bodelier, Paul L E; Laanbroek, Hendrikus J


    In this study, a large-scale field survey was conducted to describe the biogeography of sulfate-reducing prokaryotes (SRPs) in river floodplains. Fingerprints obtained with three methods, i.e. 16S rRNA gene-based oligonucleotide microarray, dsrB-based denaturing gradient gel electrophoresis (DGGE) and polar lipid-derived fatty acid (PLFA) analyses, were used as a proxy to describe the SRPs community diversity. Each set of profiles was subjected to a combined multivariate/correlation analysis in order to compare SRP community profiles and to highlight the environmental variables influencing the SRPs distribution along environmental gradients. Floodplain soils harbored distinct SRP communities displaying biogeographic patterns. Nearly all profiles from the tidal sites consistently separated from the nontidal sites, independently from the screening method and the multivariate statistics used. The distribution of the microarray/DGGE/PLFA-based fingerprints in the principal component plots could be correlated to eight soil variables, i.e. soil organic matter, total nitrogen, total phosphorous and total potassium, and extractable ammonium, nitrate, phosphate and sulfate, as well as seven pore water variables, i.e. phosphate, sulfate, sulfide, chloride, sodium, potassium and magnesium ions. Indication of a salinity- and plant nutrient-dependent distribution of SRPs related to Desulfosarcina, Desulfomonile and Desulfobacter was suggested by microarray, DGGE and PLFA analyses.

  12. The Sec translocon mediated protein transport in prokaryotes and eukaryotes.


    Denks, Kärt; Vogt, Andreas; Sachelaru, Ilie; Petriman, Narcis-Adrian; Kudva, Renuka; Koch, Hans-Georg


    Protein transport via the Sec translocon represents an evolutionary conserved mechanism for delivering cytosolically-synthesized proteins to extra-cytosolic compartments. The Sec translocon has a three-subunit core, termed Sec61 in Eukaryotes and SecYEG in Bacteria. It is located in the endoplasmic reticulum of Eukaryotes and in the cytoplasmic membrane of Bacteria where it constitutes a channel that can be activated by multiple partner proteins. These partner proteins determine the mechanism of polypeptide movement across the channel. During SRP-dependent co-translational targeting, the ribosome threads the nascent protein directly into the Sec channel. This pathway is in Bacteria mainly dedicated for membrane proteins but in Eukaryotes also employed by secretory proteins. The alternative pathway, leading to post-translational translocation across the Sec translocon engages an ATP-dependent pushing mechanism by the motor protein SecA in Bacteria and a ratcheting mechanism by the lumenal chaperone BiP in Eukaryotes. Protein transport and biogenesis is also assisted by additional proteins at the lateral gate of SecY/Sec61α and in the lumen of the endoplasmic reticulum or in the periplasm of bacterial cells. The modular assembly enables the Sec complex to transport a vast array of substrates. In this review we summarize recent biochemical and structural information on the prokaryotic and eukaryotic Sec translocons and we describe the remarkably complex interaction network of the Sec complexes.

  13. TET peptidases: A family of tetrahedral complexes conserved in prokaryotes.


    Appolaire, Alexandre; Colombo, Matteo; Basbous, Hind; Gabel, Frank; Girard, E; Franzetti, Bruno


    The TET peptidases are large polypeptide destruction machines present among prokaryotes. They form 12-subunits hollow tetrahedral particles, and belong to the family of M42 metallo-peptidases. Structural characterization of various archaeal and bacterial complexes has revealed a unique mechanism of internal compartmentalization and peptide trafficking that distinguishes them from the other oligomeric peptidases. Different versions of the TET complex often co-exist in the cytosol of microorganisms. In depth enzymatic studies have revealed that they are non-processive cobalt-activated aminopeptidases and display contrasting substrate specificities based on the properties of the catalytic chambers. Recent studies have shed light on the assembly mechanism of homo and hetero-dodecameric TET complexes and shown that the activity of TET aminopeptidase towards polypeptides is coupled with its assembly process. These findings suggested a functional regulation based on oligomerization control in vivo. This review describes a current knowledge on M42 TET peptidases biochemistry and discuss their possible physiological roles. This article is a part of the Special Issue entitled: «A potpourri of proteases and inhibitors: from molecular toolboxes to signalling scissors».

  14. Comparative analysis of essential genes in prokaryotic genomic islands.


    Zhang, Xi; Peng, Chong; Zhang, Ge; Gao, Feng


    Essential genes are thought to encode proteins that carry out the basic functions to sustain a cellular life, and genomic islands (GIs) usually contain clusters of horizontally transferred genes. It has been assumed that essential genes are not likely to be located in GIs, but systematical analysis of essential genes in GIs has not been explored before. Here, we have analyzed the essential genes in 28 prokaryotes by statistical method and reached a conclusion that essential genes in GIs are significantly fewer than those outside GIs. The function of 362 essential genes found in GIs has been explored further by BLAST against the Virulence Factor Database (VFDB) and the phage/prophage sequence database of PHAge Search Tool (PHAST). Consequently, 64 and 60 eligible essential genes are found to share the sequence similarity with the virulence factors and phage/prophages-related genes, respectively. Meanwhile, we find several toxin-related proteins and repressors encoded by these essential genes in GIs. The comparative analysis of essential genes in genomic islands will not only shed new light on the development of the prediction algorithm of essential genes, but also give a clue to detect the functionality of essential genes in genomic islands.

  15. Current Developments in Prokaryotic Single Cell Whole Genome Amplification

    SciTech Connect

    Goudeau, Danielle; Nath, Nandita; Ciobanu, Doina; Cheng, Jan-Fang; Malmstrom, Rex


    Our approach to prokaryotic single-cell Whole Genome Amplification at the JGI continues to evolve. To increase both the quality and number of single-cell genomes produced, we explore all aspects of the process from cell sorting to sequencing. For example, we now utilize specialized reagents, acoustic liquid handling, and reduced reaction volumes eliminate non-target DNA contamination in WGA reactions. More specifically, we use a cleaner commercial WGA kit from Qiagen that employs a UV decontamination procedure initially developed at the JGI, and we use the Labcyte Echo for tip-less liquid transfer to set up 2uL reactions. Acoustic liquid handling also dramatically reduces reagent costs. In addition, we are exploring new cell lysis methods including treatment with Proteinase K, lysozyme, and other detergents, in order to complement standard alkaline lysis and allow for more efficient disruption of a wider range of cells. Incomplete lysis represents a major hurdle for WGA on some environmental samples, especially rhizosphere, peatland, and other soils. Finding effective lysis strategies that are also compatible with WGA is challenging, and we are currently assessing the impact of various strategies on genome recovery.

  16. Evolution of animal Piwi-interacting RNAs and prokaryotic CRISPRs

    PubMed Central

    Kumar, M. Senthil; Chen, Kevin C.


    Piwi-interacting RNAs (piRNAs) and CRISPR RNAs (crRNAs) are two recently discovered classes of small noncoding RNA that are found in animals and prokaryotes, respectively. Both of these novel RNA species function as components of adaptive immune systems that protect their hosts from foreign nucleic acids—piRNAs repress transposable elements in animal germlines, whereas crRNAs protect their bacterial hosts from phage and plasmids. The piRNA and CRISPR systems are nonhomologous but rather have independently evolved into logically similar defense mechanisms based on the specificity of targeting via nucleic acid base complementarity. Here we review what is known about the piRNA and CRISPR systems with a focus on comparing their evolutionary properties. In particular, we highlight the importance of several factors on the pattern of piRNA and CRISPR evolution, including the population genetic environment, the role of alternate defense systems and the mechanisms of acquisition of new piRNAs and CRISPRs. PMID:22539610

  17. Genotoxicity induced by saponified coconut oil surfactant in prokaryote systems.


    Petta, Tirzah Braz; de Medeiros, Sílvia Regina Batistuzzo; do Egito, Eryvaldo Sócrates Tabosa; Agnez-Lima, Lucymara Fassarella


    Surfactants are amphiphilic substances with special properties and chemical structures that allow a reduction in interfacial tension, which permits an increase in molecule solubilization. The critical micelle concentration (CMC) is an important characteristic of surfactants that determines their aggregate state, which is generally related to its functional mechanism. In this work the genotoxic potential of saponified coconut oil (SCO), a surfactant obtained from Cocos nucifera, was analyzed using prokaryote systems. DNA strand breaks were not observed after treatment of a plasmid with SCO. Negative results were also obtained in the SOS Chromotest using Escherichia coli strains PQ35 and PQ37. A moderate toxicity of SCO was observed after treatment of strain CC104 with a concentration above its CMC, in which micelles were found. Nevertheless, this treatment was not cytotoxic to a CC104mutMmutY strain. Furthermore, in this DNA repair-deficient strain treatment with a SCO dose below its CMC, in which only monomers were found, demonstrated the possibility of an antioxidant effect, since a reduction in spontaneous mutagenesis frequency was observed. Finally, in an Ames test without metabolic activation mutagenicity induction was observed in strains TA100 and TA104 with treatment doses below the CMC. The cytotoxic, antioxidant and mutagenic effects of SCO can be influenced by the aggregational state.

  18. Do Phages influence Species Richness of Prokaryotic Communities?

    NASA Astrophysics Data System (ADS)

    Winter, C.; Smit, A.; Herndl, G. J.; Weinbauer, M. G.


    The aim of the study was to follow the potential influence of phage infection on the species richness of their pelagic prokaryotic hosts. Experiments were conducted during cruises in the tropical Atlantic and the southern North Sea. Concentrates of bacteria and viruses were obtained by ultrafiltration. An aliquot of the bacterial concentrate was inoculated in virus-free seawater and varying amounts of viral concentrate were added. Batch cultures with microwave-inactivated viruses and without virus amendment served as controls. Species richness of the domains Bacteria and Archaea was determined by terminal restriction fragment length polymorphism (T-RFLP) analysis of PCR amplified 16S rDNA fragments collected every 24 hrs for up to four days. The time courses of viral abundance in the cultures amended with viral concentrates were comparable to each other. However, the observed oscillations in bacterial and viral numbers appeared to increase in magnitude with increasing initial viral abundance. Differences between the microbial communities of the various treatments increased with increasing initial viral abundance for Bacteria and Archaea, regardless of the initial bacterial abundance. The results show that bacteriophages are affecting the species richness of pelagic Bacteria and Archaea under non-steady state conditions.

  19. Metabolic Design and Control for Production in Prokaryotes

    SciTech Connect

    Chhabra, Swapnil R.; Keasling, J.D.


    Prokaryotic life on earth is manifested by its diversity and omnipresence. These microbes serve as natural sources of a large variety of compounds with the potential to serve the ever growing, medicinal, chemical and transportation needs of the human population. However, commercially viable production of these compounds can be realized only through significant improvement of the native production capacity of natural isolates. The most favorable way to achieve this goal is through the genetic manipulation of metabolic pathways that direct the production of these molecules. While random mutagenesis and screening have dominated the industrial production of such compounds in the past our increased understanding of microbial physiology over the last five decades has shifted this trend towards rational approaches for metabolic design. Major drivers of this trend include recombinant DNA technology, high throughput characterization of macromolecular cellular components, quantitative modeling for metabolic engine ring, targeted combinatorial engineering and synthetic biology. In this chapter we track the evolution of microbial engineering technologies from the black box era of random mutagenesis to the science and engineering-driven era of metabolic design.

  20. Novel species and expanded distribution of ellipsoidal multicellular magnetotactic prokaryotes.


    Chen, Yi-ran; Zhang, Wen-yan; Zhou, Ke; Pan, Hong-miao; Du, Hai-jian; Xu, Cong; Xu, Jian-hong; Pradel, Nathalie; Santini, Claire-Lise; Li, Jin-hua; Huang, Hui; Pan, Yong-xin; Xiao, Tian; Wu, Long-fei


    Multicellular magnetotactic prokaryotes (MMPs) are a peculiar group of magnetotactic bacteria, each comprising approximately 10-100 cells of the same phylotype. Two morphotypes of MMP have been identified, including several species of globally distributed spherical mulberry-like MMPs (s-MMPs), and two species of ellipsoidal pineapple-like MMPs (e-MMPs) from China (Qingdao and Rongcheng cities). We recently collected e-MMPs from Mediterranean Sea sediments (Six-Fours-les-Plages) and Drummond Island, in the South China Sea. Phylogenetic analysis revealed that the MMPs from Six-Fours-les-Plages and the previously reported e-MMP Candidatus Magnetananas rongchenensis have 98.5% sequence identity and are the same species, while the MMPs from Drummond Island appear to be a novel species, having > 7.1% sequence divergence from the most closely related e-MMP, Candidatus Magnetananas tsingtaoensis. Identification of the novel species expands the distribution of e-MMPs to Tropical Zone. Comparison of nine physical and chemical parameters revealed that sand grain size and the content of inorganic nitrogen (nitrate, ammonium and nitrite) in the sediments from Rongcheng City and Six-Fours-les-Plages were similar, and lower than found for sediments from the other two sampling sites. The results of the study reveal broad diversity and wide distribution of e-MMPs. PMID:26711721

  1. Direct Regulation of Prokaryotic Kir Channel by Cholesterol*

    PubMed Central

    Singh, Dev K.; Rosenhouse-Dantsker, Avia; Nichols, Colin G.; Enkvetchakul, Decha; Levitan, Irena


    Our earlier studies have shown that channel activity of Kir2 subfamily of inward rectifiers is strongly suppressed by the elevation of cellular cholesterol. The goal of this study is to determine whether cholesterol suppresses Kir channels directly. To achieve this goal, purified prokaryotic Kir (KirBac1.1) channels were incorporated into liposomes of defined lipid composition, and channel activity was assayed by 86Rb+ uptake. Our results show that 86Rb+ flux through KirBac1.1 is strongly inhibited by cholesterol. Incorporation of 5% (mass cholesterol/phospholipid) cholesterol into the liposome suppresses 86Rb+ flux by >50%, and activity is completely inhibited at 12–15%. However, epicholesterol, a stereoisomer of cholesterol with similar physical properties, has significantly less effect on KirBac-mediated 86Rb+ uptake than cholesterol. Furthermore, analysis of multiple sterols suggests that cholesterol-induced inhibition of KirBac1.1 channels is mediated by specific interactions rather than by changes in the physical properties of the lipid bilayer. In contrast to the inhibition of KirBac1.1 activity, cholesterol had no effect on the activity of reconstituted KscA channels (at up to 250 μg/mg of phospholipid). Taken together, these observations demonstrate that cholesterol suppresses Kir channels in a pure protein-lipid environment and suggest that the interaction is direct and specific. PMID:19740741

  2. Engineering prokaryotic channels for control of mammalian tissue excitability

    PubMed Central

    Nguyen, Hung X.; Kirkton, Robert D.; Bursac, Nenad


    The ability to directly enhance electrical excitability of human cells is hampered by the lack of methods to efficiently overexpress large mammalian voltage-gated sodium channels (VGSC). Here we describe the use of small prokaryotic sodium channels (BacNav) to create de novo excitable human tissues and augment impaired action potential conduction in vitro. Lentiviral co-expression of specific BacNav orthologues, an inward-rectifying potassium channel, and connexin-43 in primary human fibroblasts from the heart, skin or brain yields actively conducting cells with customizable electrophysiological phenotypes. Engineered fibroblasts (‘E-Fibs') retain stable functional properties following extensive subculture or differentiation into myofibroblasts and rescue conduction slowing in an in vitro model of cardiac interstitial fibrosis. Co-expression of engineered BacNav with endogenous mammalian VGSCs enhances action potential conduction and prevents conduction failure during depolarization by elevated extracellular K+, decoupling or ischaemia. These studies establish the utility of engineered BacNav channels for induction, control and recovery of mammalian tissue excitability. PMID:27752065

  3. ICDS database: interrupted CoDing sequences in prokaryotic genomes.


    Perrodou, Emmanuel; Deshayes, Caroline; Muller, Jean; Schaeffer, Christine; Van Dorsselaer, Alain; Ripp, Raymond; Poch, Olivier; Reyrat, Jean-Marc; Lecompte, Odile


    Unrecognized frameshifts, in-frame stop codons and sequencing errors lead to Interrupted CoDing Sequence (ICDS) that can seriously affect all subsequent steps of functional characterization, from in silico analysis to high-throughput proteomic projects. Here, we describe the Interrupted CoDing Sequence database containing ICDS detected by a similarity-based approach in 80 complete prokaryotic genomes. ICDS can be retrieved by species browsing or similarity searches via a web interface ( The definition of each interrupted gene is provided as well as the ICDS genomic localization with the surrounding sequence. Furthermore, to facilitate the experimental characterization of ICDS, we propose optimized primers for re-sequencing purposes. The database will be regularly updated with additional data from ongoing sequenced genomes. Our strategy has been validated by three independent tests: (i) ICDS prediction on a benchmark of artificially created frameshifts, (ii) comparison of predicted ICDS and results obtained from the comparison of the two genomic sequences of Bacillus licheniformis strain ATCC 14580 and (iii) re-sequencing of 25 predicted ICDS of the recently sequenced genome of Mycobacterium smegmatis. This allows us to estimate the specificity and sensitivity (95 and 82%, respectively) of our program and the efficiency of primer determination.

  4. Prokaryotic and eukaryotic RNA polymerases have homologous core subunits.

    PubMed Central

    Sweetser, D; Nonet, M; Young, R A


    Eukaryotic RNA polymerases are complex aggregates whose component subunits are functionally ill-defined. The gene that encodes the 140,000-dalton subunit of Saccharomyces cerevisiae RNA polymerase II was isolated and studied in detail to obtain clues to the protein's function. This gene, RPB2, exists in a single copy in the haploid genome. Disruption of the gene is lethal to the yeast cell. RPB2 encodes a protein of 138,750 daltons, which contains sequences implicated in binding purine nucleotides and zinc ions and exhibits striking sequence homology with the beta subunit of Escherichia coli RNA polymerase. These observations suggest that the yeast and the E. coli subunit have similar roles in RNA synthesis, as the beta subunit contains binding sites for nucleotide substrates and a portion of the catalytic site for RNA synthesis. The subunit homologies reported here, and those observed previously with the largest RNA polymerase subunit, indicate that components of the prokaryotic RNA polymerase "core" enzyme have counterparts in eukaryotic RNA polymerases. PMID:3547406

  5. Tracing the path of a prokaryotic paracrine signal.


    Mullineaux, Conrad W; Nürnberg, Dennis J


    Filamentous heterocyst-forming cyanobacteria are a beautiful example of prokaryotic multicellularity. The filaments can achieve simultaneous nitrogen fixation and oxygenic photosynthesis by cooperation between two cell types: the photosynthetic vegetative cells and the nitrogen-fixing heterocysts. The multicellular features exhibited by the system include differentiation of different cell types, metabolic interdependence and even pattern formation, as the spacing of heterocysts along the filament is non-random. Recent years have seen exciting progress both in understanding the control of heterocyst differentiation, and also in understanding the function of 'septal junctions': an array of pore-like structures at the cell junctions that allow intercellular communication by facilitating the diffusion of small molecules from cell to cell. A new report by Rivers et al. (2014) makes the connection between pattern formation and intercellular communication by showing that a mutation that partially disables the septal junctions leads to a decrease in the range of a signal dependent on the HetN protein that is one of the factors controlling heterocyst spacing. This suggests that the signal travels from cell to cell by diffusion through the septal junctions, opening the door to quantitative understanding of the mechanism that controls heterocyst spacing in filamentous cyanobacteria. PMID:25362990

  6. Single-molecule observation of prokaryotic DNA replication.


    Geertsema, Hylkje J; Duderstadt, Karl E; van Oijen, Antoine M


    Replication of DNA requires the coordinated activity of a number of proteins within a multiprotein complex, the replisome. Recent advances in single-molecule techniques have enabled the observation of dynamic behavior of individual replisome components and of the replisome as a whole, aspects that previously often have been obscured by ensemble averaging in more classical solution-phase biochemical experiments. To improve robustness and reproducibility of single-molecule assays of replication and allow objective analysis and comparison of results obtained from such assays, common practices should be established. Here, we describe the technical details of two assays to study replisome activity. In one, the kinetics of replication are observed as length changes in DNA molecules mechanically stretched by a laminar flow applied to attached beads. In the other, fluorescence imaging is used to determine both the kinetics and stoichiometry of individual replisome components. These in vitro single-molecule methods allow for elucidation of the dynamic behavior of individual replication proteins of prokaryotic replication systems.

  7. Correlation between structure and temperature in prokaryotic metabolic networks

    PubMed Central

    Takemoto, Kazuhiro; Nacher, Jose C; Akutsu, Tatsuya


    Background In recent years, an extensive characterization of network structures has been made in an effort to elucidate design principles of metabolic networks, providing valuable insights into the functional organization and the evolutionary history of organisms. However, previous analyses have not discussed the effects of environmental factors (i.e., exogenous forces) in shaping network structures. In this work, we investigate the effect of temperature, which is one of the environmental factors that may have contributed to shaping structures of metabolic networks. Results For this, we investigate the correlations between several structural properties characterized by graph metrics like the edge density, the degree exponent, the clustering coefficient, and the subgraph concentration in the metabolic networks of 113 prokaryotes and optimal growth temperature. As a result, we find that these structural properties are correlated with the optimal growth temperature. With increasing temperature, the edge density, the clustering coefficient and the subgraph concentration decrease and the degree exponent becomes large. Conclusion This result implies that the metabolic networks transit with temperature as follows. The density of chemical reactions becomes low, the connectivity of the networks becomes homogeneous such as random networks and both the network modularity, based on the graph-theoretic clustering coefficient, and the frequency of recurring subgraphs decay. In short, metabolic networks undergo a change from heterogeneous and high-modular structures to homogeneous and low-modular structures, such as random networks, with temperature. This finding may suggest that the temperature plays an important role in the design principles of metabolic networks. PMID:17711568

  8. Engineering input/output nodes in prokaryotic regulatory circuits.


    de Las Heras, Aitor; Carreño, Carlos A; Martínez-García, Esteban; de Lorenzo, Víctor


    A large number of prokaryotic regulatory elements have been interfaced artificially with biological circuits that execute specific expression programs. Engineering such circuits involves the association of input/output components that perform discrete signal-transfer steps in an autonomous fashion while connected to the rest of the network with a defined topology. Each of these nodes includes a signal-recognition component for the detection of the relevant physicochemical or biological stimulus, a molecular device able to translate the signal-sensing event into a defined output and a genetic module capable of understanding such an output as an input for the next component of the circuit. The final outcome of the process can be recorded by means of a reporter product. This review addresses three such aspects of forward engineering of signal-responding genetic parts. We first recap natural and non-natural regulatory assets for designing gene expression in response to predetermined signals - chemical or otherwise. These include transcriptional regulators developed by in vitro evolution (or designed from scratch), and synthetic riboswitches derived from in vitro selection of aptamers. Then we examine recent progress on reporter genes, whose expression allows the quantification and parametrization of signal-responding circuits in their entirety. Finally, we critically examine recent work on other reporters that confer bacteria with gross organoleptic properties (e.g. distinct odour) and the interfacing of signal-sensing devices with determinants of community behaviour.

  9. Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.


    Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K


    Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.

  10. Engineering input/output nodes in prokaryotic regulatory circuits.


    de Las Heras, Aitor; Carreño, Carlos A; Martínez-García, Esteban; de Lorenzo, Víctor


    A large number of prokaryotic regulatory elements have been interfaced artificially with biological circuits that execute specific expression programs. Engineering such circuits involves the association of input/output components that perform discrete signal-transfer steps in an autonomous fashion while connected to the rest of the network with a defined topology. Each of these nodes includes a signal-recognition component for the detection of the relevant physicochemical or biological stimulus, a molecular device able to translate the signal-sensing event into a defined output and a genetic module capable of understanding such an output as an input for the next component of the circuit. The final outcome of the process can be recorded by means of a reporter product. This review addresses three such aspects of forward engineering of signal-responding genetic parts. We first recap natural and non-natural regulatory assets for designing gene expression in response to predetermined signals - chemical or otherwise. These include transcriptional regulators developed by in vitro evolution (or designed from scratch), and synthetic riboswitches derived from in vitro selection of aptamers. Then we examine recent progress on reporter genes, whose expression allows the quantification and parametrization of signal-responding circuits in their entirety. Finally, we critically examine recent work on other reporters that confer bacteria with gross organoleptic properties (e.g. distinct odour) and the interfacing of signal-sensing devices with determinants of community behaviour. PMID:20618867

  11. Prokaryotic diversity in a Tunisian hypersaline lake, Chott El Jerid.


    Abdallah, Manel Ben; Karray, Fatma; Mhiri, Najla; Mei, Nan; Quéméneur, Marianne; Cayol, Jean-Luc; Erauso, Gaël; Tholozan, Jean-Luc; Alazard, Didier; Sayadi, Sami


    Prokaryotic diversity was investigated in a Tunisian salt lake, Chott El Jerid, by quantitative real-time PCR, denaturing gradient gel electrophoresis (DGGE) fingerprinting methods targeting the 16S rRNA gene and culture-dependent methods. Two different samples S1-10 and S2-10 were taken from under the salt crust of Chott El Jerid in the dry season. DGGE analysis revealed that bacterial sequences were related to Firmicutes, Proteobacteria, unclassified bacteria, and Deinococcus-Thermus phyla. Anaerobic fermentative and sulfate-reducing bacteria were also detected in this ecosystem. Within the domain archaea, all sequences were affiliated to Euryarchaeota phylum. Quantitative real-time PCR showed that 16S rRNA gene copy numbers of bacteria was 5 × 10(6) DNA copies g(-1) whereas archaea varied between 5 × 10(5) and 10(6) DNA copies g(-1) in these samples. Eight anaerobic halophilic fermentative bacterial strains were isolated and affiliated with the species Halanaerobium alcaliphilum, Halanaerobium saccharolyticum, and Sporohalobacter salinus. These data showed an abundant and diverse microbial community detected in the hypersaline thalassohaline environment of Chott El Jerid. PMID:26724953

  12. Mechanisms and Evolution of Control Logic in Prokaryotic Transcriptional Regulation

    PubMed Central

    van Hijum, Sacha A. F. T.; Medema, Marnix H.; Kuipers, Oscar P.


    Summary: A major part of organismal complexity and versatility of prokaryotes resides in their ability to fine-tune gene expression to adequately respond to internal and external stimuli. Evolution has been very innovative in creating intricate mechanisms by which different regulatory signals operate and interact at promoters to drive gene expression. The regulation of target gene expression by transcription factors (TFs) is governed by control logic brought about by the interaction of regulators with TF binding sites (TFBSs) in cis-regulatory regions. A factor that in large part determines the strength of the response of a target to a given TF is motif stringency, the extent to which the TFBS fits the optimal TFBS sequence for a given TF. Advances in high-throughput technologies and computational genomics allow reconstruction of transcriptional regulatory networks in silico. To optimize the prediction of transcriptional regulatory networks, i.e., to separate direct regulation from indirect regulation, a thorough understanding of the control logic underlying the regulation of gene expression is required. This review summarizes the state of the art of the elements that determine the functionality of TFBSs by focusing on the molecular biological mechanisms and evolutionary origins of cis-regulatory regions. PMID:19721087

  13. Novel species and expanded distribution of ellipsoidal multicellular magnetotactic prokaryotes.


    Chen, Yi-ran; Zhang, Wen-yan; Zhou, Ke; Pan, Hong-miao; Du, Hai-jian; Xu, Cong; Xu, Jian-hong; Pradel, Nathalie; Santini, Claire-Lise; Li, Jin-hua; Huang, Hui; Pan, Yong-xin; Xiao, Tian; Wu, Long-fei


    Multicellular magnetotactic prokaryotes (MMPs) are a peculiar group of magnetotactic bacteria, each comprising approximately 10-100 cells of the same phylotype. Two morphotypes of MMP have been identified, including several species of globally distributed spherical mulberry-like MMPs (s-MMPs), and two species of ellipsoidal pineapple-like MMPs (e-MMPs) from China (Qingdao and Rongcheng cities). We recently collected e-MMPs from Mediterranean Sea sediments (Six-Fours-les-Plages) and Drummond Island, in the South China Sea. Phylogenetic analysis revealed that the MMPs from Six-Fours-les-Plages and the previously reported e-MMP Candidatus Magnetananas rongchenensis have 98.5% sequence identity and are the same species, while the MMPs from Drummond Island appear to be a novel species, having > 7.1% sequence divergence from the most closely related e-MMP, Candidatus Magnetananas tsingtaoensis. Identification of the novel species expands the distribution of e-MMPs to Tropical Zone. Comparison of nine physical and chemical parameters revealed that sand grain size and the content of inorganic nitrogen (nitrate, ammonium and nitrite) in the sediments from Rongcheng City and Six-Fours-les-Plages were similar, and lower than found for sediments from the other two sampling sites. The results of the study reveal broad diversity and wide distribution of e-MMPs.

  14. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.


    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  15. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.


    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti


    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  16. A critical role for noncoding 5S rRNA in regulating Mdmx stability.


    Li, Muyang; Gu, Wei


    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  17. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.


    Drouin, Guy; Tsang, Corey


    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  18. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.


    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  19. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.


    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti


    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  20. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.


    Stark, B C; Chooi, W Y


    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  1. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.


    Walker, W F


    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  2. ATGC: a database of orthologous genes from closely related prokaryotic genomes and a research platform for microevolution of prokaryotes

    SciTech Connect

    Novichkov, Pavel S.; Ratnere, Igor; Wolf, Yuri I.; Koonin, Eugene V.; Dubchak, Inna


    The database of Alignable Tight Genomic Clusters (ATGCs) consists of closely related genomes of archaea and bacteria, and is a resource for research into prokaryotic microevolution. Construction of a data set with appropriate characteristics is a major hurdle for this type of studies. With the current rate of genome sequencing, it is difficult to follow the progress of the field and to determine which of the available genome sets meet the requirements of a given research project, in particular, with respect to the minimum and maximum levels of similarity between the included genomes. Additionally, extraction of specific content, such as genomic alignments or families of orthologs, from a selected set of genomes is a complicated and time-consuming process. The database addresses these problems by providing an intuitive and efficient web interface to browse precomputed ATGCs, select appropriate ones and access ATGC-derived data such as multiple alignments of orthologous proteins, matrices of pairwise intergenomic distances based on genome-wide analysis of synonymous and nonsynonymous substitution rates and others. The ATGC database will be regularly updated following new releases of the NCBI RefSeq. The database is hosted by the Genomics Division at Lawrence Berkeley National laboratory and is publicly available at

  3. ATGC: a database of orthologous genes from closely related prokaryotic genomes and a research platform for microevolution of prokaryotes.


    Novichkov, Pavel S; Ratnere, Igor; Wolf, Yuri I; Koonin, Eugene V; Dubchak, Inna


    The database of Alignable Tight Genomic Clusters (ATGCs) consists of closely related genomes of archaea and bacteria, and is a resource for research into prokaryotic microevolution. Construction of a data set with appropriate characteristics is a major hurdle for this type of studies. With the current rate of genome sequencing, it is difficult to follow the progress of the field and to determine which of the available genome sets meet the requirements of a given research project, in particular, with respect to the minimum and maximum levels of similarity between the included genomes. Additionally, extraction of specific content, such as genomic alignments or families of orthologs, from a selected set of genomes is a complicated and time-consuming process. The database addresses these problems by providing an intuitive and efficient web interface to browse precomputed ATGCs, select appropriate ones and access ATGC-derived data such as multiple alignments of orthologous proteins, matrices of pairwise intergenomic distances based on genome-wide analysis of synonymous and nonsynonymous substitution rates and others. The ATGC database will be regularly updated following new releases of the NCBI RefSeq. The database is hosted by the Genomics Division at Lawrence Berkeley National laboratory and is publicly available at

  4. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.


    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J


    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics.

  5. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.


    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J


    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  6. Metabolic profiles of prokaryotic and eukaryotic communities in deep-sea sponge Neamphius huxleyi [corrected]. indicated by metagenomics.


    Li, Zhi-Yong; Wang, Yue-Zhu; He, Li-Ming; Zheng, Hua-Jun


    The whole metabolism of a sponge holobiont and the respective contributions of prokaryotic and eukaryotic symbionts and their associations with the sponge host remain largely unclear. Meanwhile, compared with shallow water sponges, deep-sea sponges are rarely understood. Here we report the metagenomic exploration of deep-sea sponge Neamphius huxleyi [corrected] . at the whole community level. Metagenomic data showed phylogenetically diverse prokaryotes and eukaryotes in Neamphius huxleyi [corrected]. MEGAN and gene enrichment analyses indicated different metabolic potentials of prokaryotic symbionts from eukaryotic symbionts, especially in nitrogen and carbon metabolisms, and their molecular interactions with the sponge host. These results supported the hypothesis that prokaryotic and eukaryotic symbionts have different ecological roles and relationships with sponge host. Moreover, vigorous denitrification, and CO2 fixation by chemoautotrophic prokaryotes were suggested for this deep-sea sponge. The study provided novel insights into the respective potentials of prokaryotic and eukaryotic symbionts and their associations with deep-sea sponge Neamphius huxleyi [corrected].

  7. Metabolic profiles of prokaryotic and eukaryotic communities in deep-sea sponge Lamellomorpha sp. indicated by metagenomics

    NASA Astrophysics Data System (ADS)

    Li, Zhi-Yong; Wang, Yue-Zhu; He, Li-Ming; Zheng, Hua-Jun


    The whole metabolism of a sponge holobiont and the respective contributions of prokaryotic and eukaryotic symbionts and their associations with the sponge host remain largely unclear. Meanwhile, compared with shallow water sponges, deep-sea sponges are rarely understood. Here we report the metagenomic exploration of deep-sea sponge Lamellomorpha sp. at the whole community level. Metagenomic data showed phylogenetically diverse prokaryotes and eukaryotes in Lamellomorpha sp.. MEGAN and gene enrichment analyses indicated different metabolic potentials of prokaryotic symbionts from eukaryotic symbionts, especially in nitrogen and carbon metabolisms, and their molecular interactions with the sponge host. These results supported the hypothesis that prokaryotic and eukaryotic symbionts have different ecological roles and relationships with sponge host. Moreover, vigorous denitrification, and CO2 fixation by chemoautotrophic prokaryotes were suggested for this deep-sea sponge. The study provided novel insights into the respective potentials of prokaryotic and eukaryotic symbionts and their associations with deep-sea sponge Lamellomorpha sp..

  8. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.


    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  9. Strong nondipole effect created by multielectron correlation in 5s photoionization of xenon

    SciTech Connect

    Ricz, S.; Koever, A.; Varga, D.; Ricsoka, T.; Sankari, R.; Jurvansuu, M.; Nikkinen, J.; Aksela, H.; Aksela, S.


    The angular distribution of the Xe 5s photoelectrons was measured in the 90-225 eV photon energy range using linearly polarized synchrotron radiation. The experimentally determined angular distribution parameters were compared with theoretical values obtained from calculations based on the random-phase approximation and the time-dependent density-functional theory. Experiment shows that the dipole ({beta}) and nondipole ({gamma}) parameters vary strongly as a function of the photon energy, in accordance with calculations that account for the interchannel coupling. Nondipole effects observed clearly in experiment confirm the role of multielectron correlation in describing the 5s photoionization of Xe far from the ionization threshold.

  10. The radiative lifetime of the 5S(0)2 metastable level of O(2+)

    NASA Technical Reports Server (NTRS)

    Johnson, B. C.; Smith, P. L.; Knight, R. D.


    The radiative lifetime of the 5S(0)2 metastable level of O(2+) was measured as 1.22 + or - 0.08 ms at the 90 percent confidence level by observing the time dependence of the spontaneous emission from metastable ions created and stored in a cylindrical radio-frequency ion trap. The intersystem line emission 2s(2)2p(2) 3P - 2s2p(3) 5S(0) was observed at 1660.8 and 1666.2 A. Discrepancies between measured and calculated values indicate that certain calculated transition probabilities for intersystem lines may be less reliable than previously believed.

  11. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T


    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  12. Variable viral and grazer control of prokaryotic growth efficiency in temperate freshwater lakes (French Massif Central).


    Ram, A S Pradeep; Palesse, S; Colombet, J; Sabart, M; Perriere, F; Sime-Ngando, T


    The effects of viral lysis and heterotrophic nanoflagellate grazing (top down forces) on prokaryotic mortality and their subsequent impact on their metabolism were estimated in the upper euphotic and deeper aphotic depth of 11 freshwater lakes located in the French Massif Central. The standing stocks of viruses (VA) and heterotrophic nanoflagellate (HNF) varied significantly (p < 0.05) with sampled depth. VA was substantially (twofold on an average) and significantly higher (p < 0.03) at the aphotic compared to euphotic depth, whereas the reverse was true (p < 0.02) for HNF. Among the prokaryote subgroup, high nucleic acid content prokaryotes explained for significant variability in the total VA and served as principle host target for viral proliferation. Like standing stocks, flagellate grazing and viral infection rates also followed similar patterns. In the investigated lakes, the mechanism for regulating prokaryotic production varied with sampled depth from grazing control in the euphotic to control due to viral lysis in the aphotic. We also tested the hypothesis of top down control on prokaryotic growth efficiency (PGE, which we used as an index of prokaryotic physiological and energetic status at the community level) at both depths. Overall, among the studied lakes, PGE varied widely (4-51 %) with significantly (p < 0.05) lower values in the aphotic (mean = 18 ± 4 %) than euphotic depth (mean = 32 ± 9 %). Contrasting observations on the top down control of PGE between sampled depths were observed. The presence of grazers was found to stimulate PGE at the euphotic, whereas viruses through their lytic infection had a strong negative impact on PGE at the aphotic depth. Such observed differences in PGE and the mechanism controlling prokaryotic production with depth could eventually have strong implication on carbon and nutrient flux patterns in the studied lakes.

  13. Domain-based identification and analysis of glutamate receptor ion channels and their relatives in prokaryotes.


    Ger, Mao-Feng; Rendon, Gloria; Tilson, Jeffrey L; Jakobsson, Eric


    Voltage-gated and ligand-gated ion channels are used in eukaryotic organisms for the purpose of electrochemical signaling. There are prokaryotic homologues to major eukaryotic channels of these sorts, including voltage-gated sodium, potassium, and calcium channels, Ach-receptor and glutamate-receptor channels. The prokaryotic homologues have been less well characterized functionally than their eukaryotic counterparts. In this study we identify likely prokaryotic functional counterparts of eukaryotic glutamate receptor channels by comprehensive analysis of the prokaryotic sequences in the context of known functional domains present in the eukaryotic members of this family. In particular, we searched the nonredundant protein database for all proteins containing the following motif: the two sections of the extracellular glutamate binding domain flanking two transmembrane helices. We discovered 100 prokaryotic sequences containing this motif, with a wide variety of functional annotations. Two groups within this family have the same topology as eukaryotic glutamate receptor channels. Group 1 has a potassium-like selectivity filter. Group 2 is most closely related to eukaryotic glutamate receptor channels. We present analysis of the functional domain architecture for the group of 100, a putative phylogenetic tree, comparison of the protein phylogeny with the corresponding species phylogeny, consideration of the distribution of these proteins among classes of prokaryotes, and orthologous relationships between prokaryotic and human glutamate receptor channels. We introduce a construct called the Evolutionary Domain Network, which represents a putative pathway of domain rearrangements underlying the domain composition of present channels. We believe that scientists interested in ion channels in general, and ligand-gated ion channels in particular, will be interested in this work. The work should also be of interest to bioinformatics researchers who are interested in the use

  14. Biosynthesis and Desaturation of Prokaryotic Galactolipids in Leaves and Isolated Chloroplasts from Spinach 1

    PubMed Central

    Heemskerk, Johan W. M.; Schmidt, Hermann; Hammer, Ute; Heinz, Ernst


    Mono- and digalactosyldiacylglycerol (MGDG and DGDG) were isolated from the leaves of sixteen 16:3 plants. In all of these plant species, the sn-2 position of MGDG was more enriched in C16 fatty acids than sn-2 of DGDG. The molar ratios of prokaryotic MGDG to prokaryotic DGDG ranged from 4 to 10. This suggests that 16:3 plants synthesize more prokaryotic MGDG than prokaryotic DGDG. In the 16:3 plant Spinacia oleracea L. (spinach), the formation of prokaryotic galactolipids was studied both in vivo and in vitro. In intact spinach leaves as well as in chloroplasts isolated from these leaves, radioactivity from [1-14C]acetate accumulated 10 times faster in MGDG than in DGDG. After 2 hours of incorporation, most labeled galactolipids from leaves and all labeled galactolipids from isolated chloroplasts were in the prokaryotic configuration. Both in vivo and in vitro, the desaturation of labeled palmitate and oleate to trienoic fatty acids was higher in MGDG than in DGDG. In leaves, palmitate at the sn-2 position was desaturated in MGDG but not in DGDG. In isolated chloroplasts, palmitate at sn-2 similarly was desaturated only in MGDG, but palmitate and oleate at the sn-1 position were desaturated in MGDG as well as in DGDG. Apparently, palmitate desaturase reacts with sn-1 palmitate in either galactolipid, but does not react with the sn-2 fatty acid of DGDG. These results demonstrate that isolated spinach chloroplasts can synthesize and desaturate prokaryotic MGDG and DGDG. The finally accumulating molecular species, MGDG(18:3/16:3) and DGDG(18:3/16:0), are made by the chloroplasts in proportions similar to those found in leaves. PMID:16668143

  15. Toward a standard in structural genome annotation for prokaryotes


    Tripp, H. James; Sutton, Granger; White, Owen; Wortman, Jennifer; Pati, Amrita; Mikhailova, Natalia; Ovchinnikova, Galina; Payne, Samuel H.; Kyrpides, Nikos C.; Ivanova, Natalia


    In an effort to identify the best practice for finding genes in prokaryotic genomes and propose it as a standard for automated annotation pipelines, we collected 1,004,576 peptides from various publicly available resources, and these were used as a basis to evaluate various gene-calling methods. The peptides came from 45 bacterial replicons with an average GC content from 31 % to 74 %, biased toward higher GC content genomes. Automated, manual, and semi-manual methods were used to tally errors in three widely used gene calling methods, as evidenced by peptides mapped outside the boundaries of called genes. We found thatmore » the consensus set of identical genes predicted by the three methods constitutes only about 70 % of the genes predicted by each individual method (with start and stop required to coincide). Peptide data was useful for evaluating some of the differences between gene callers, but not reliable enough to make the results conclusive, due to limitations inherent in any proteogenomic study. A single, unambiguous, unanimous best practice did not emerge from this analysis, since the available proteomics data were not adequate to provide an objective measurement of differences in the accuracy between these methods. However, as a result of this study, software, reference data, and procedures have been better matched among participants, representing a step toward a much-needed standard. In the absence of sufficient amount of experimental data to achieve a universal standard, our recommendation is that any of these methods can be used by the community, as long as a single method is employed across all datasets to be compared.« less

  16. Prochlorococcus, a Marine Photosynthetic Prokaryote of Global Significance

    PubMed Central

    Partensky, F.; Hess, W. R.; Vaulot, D.


    The minute photosynthetic prokaryote Prochlorococcus, which was discovered about 10 years ago, has proven exceptional from several standpoints. Its tiny size (0.5 to 0.7 μm in diameter) makes it the smallest known photosynthetic organism. Its ubiquity within the 40°S to 40°N latitudinal band of oceans and its occurrence at high density from the surface down to depths of 200 m make it presumably the most abundant photosynthetic organism on Earth. Prochlorococcus typically divides once a day in the subsurface layer of oligotrophic areas, where it dominates the photosynthetic biomass. It also possesses a remarkable pigment complement which includes divinyl derivatives of chlorophyll a (Chl a) and Chl b, the so-called Chl a2 and Chl b2, and, in some strains, small amounts of a new type of phycoerythrin. Phylogenetically, Prochlorococcus has also proven fascinating. Recent studies suggest that it evolved from an ancestral cyanobacterium by reducing its cell and genome sizes and by recruiting a protein originally synthesized under conditions of iron depletion to build a reduced antenna system as a replacement for large phycobilisomes. Environmental constraints clearly played a predominant role in Prochlorococcus evolution. Its tiny size is an advantage for its adaptation to nutrient-deprived environments. Furthermore, genetically distinct ecotypes, with different antenna systems and ecophysiological characteristics, are present at depth and in surface waters. This vertical species variation has allowed Prochlorococcus to adapt to the natural light gradient occurring in the upper layer of oceans. The present review critically assesses the basic knowledge acquired about Prochlorococcus both in the ocean and in the laboratory. PMID:10066832

  17. Stabilization of a prokaryotic LAT transporter by random mutagenesis.


    Rodríguez-Banqueri, Arturo; Errasti-Murugarren, Ekaitz; Bartoccioni, Paola; Kowalczyk, Lukasz; Perálvarez-Marín, Alex; Palacín, Manuel; Vázquez-Ibar, José Luis


    The knowledge of three-dimensional structures at atomic resolution of membrane transport proteins has improved considerably our understanding of their physiological roles and pathological implications. However, most structural biology techniques require an optimal candidate within a protein family for structural determination with (a) reasonable production in heterologous hosts and (b) good stability in detergent micelles. SteT, the Bacillus subtilis L-serine/L-threonine exchanger is the best-known prokaryotic paradigm of the mammalian L-amino acid transporter (LAT) family. Unfortunately, SteT's lousy stability after extracting from the membrane prevents its structural characterization. Here, we have used an approach based on random mutagenesis to engineer stability in SteT. Using a split GFP complementation assay as reporter of protein expression and membrane insertion, we created a library of 70 SteT mutants each containing random replacements of one or two residues situated in the transmembrane domains. Analysis of expression and monodispersity in detergent of this library permitted the identification of evolved versions of SteT with a significant increase in both expression yield and stability in detergent with respect to wild type. In addition, these experiments revealed a correlation between the yield of expression and the stability in detergent micelles. Finally, and based on protein delipidation and relipidation assays together with transport experiments, possible mechanisms of SteT stabilization are discussed. Besides optimizing a member of the LAT family for structural determination, our work proposes a new approach that can be used to optimize any membrane protein of interest. PMID:26976827

  18. Toward a standard in structural genome annotation for prokaryotes

    SciTech Connect

    Tripp, H. James; Sutton, Granger; White, Owen; Wortman, Jennifer; Pati, Amrita; Mikhailova, Natalia; Ovchinnikova, Galina; Payne, Samuel H.; Kyrpides, Nikos C.; Ivanova, Natalia


    In an effort to identify the best practice for finding genes in prokaryotic genomes and propose it as a standard for automated annotation pipelines, we collected 1,004,576 peptides from various publicly available resources, and these were used as a basis to evaluate various gene-calling methods. The peptides came from 45 bacterial replicons with an average GC content from 31 % to 74 %, biased toward higher GC content genomes. Automated, manual, and semi-manual methods were used to tally errors in three widely used gene calling methods, as evidenced by peptides mapped outside the boundaries of called genes. We found that the consensus set of identical genes predicted by the three methods constitutes only about 70 % of the genes predicted by each individual method (with start and stop required to coincide). Peptide data was useful for evaluating some of the differences between gene callers, but not reliable enough to make the results conclusive, due to limitations inherent in any proteogenomic study. A single, unambiguous, unanimous best practice did not emerge from this analysis, since the available proteomics data were not adequate to provide an objective measurement of differences in the accuracy between these methods. However, as a result of this study, software, reference data, and procedures have been better matched among participants, representing a step toward a much-needed standard. In the absence of sufficient amount of experimental data to achieve a universal standard, our recommendation is that any of these methods can be used by the community, as long as a single method is employed across all datasets to be compared.

  19. Systematic Transfer of Prokaryotic Sensors and Circuits to Mammalian Cells

    PubMed Central


    Prokaryotic regulatory proteins respond to diverse signals and represent a rich resource for building synthetic sensors and circuits. The TetR family contains >105 members that use a simple mechanism to respond to stimuli and bind distinct DNA operators. We present a platform that enables the transfer of these regulators to mammalian cells, which is demonstrated using human embryonic kidney (HEK293) and Chinese hamster ovary (CHO) cells. The repressors are modified to include nuclear localization signals (NLS) and responsive promoters are built by incorporating multiple operators. Activators are also constructed by modifying the protein to include a VP16 domain. Together, this approach yields 15 new regulators that demonstrate 19- to 551-fold induction and retain both the low levels of crosstalk in DNA binding specificity observed between the parent regulators in Escherichia coli, as well as their dynamic range of activity. By taking advantage of the DAPG small molecule sensing mediated by the PhlF repressor, we introduce a new inducible system with 50-fold induction and a threshold of 0.9 μM DAPG, which is comparable to the classic Dox-induced TetR system. A set of NOT gates is constructed from the new repressors and their response function quantified. Finally, the Dox- and DAPG- inducible systems and two new activators are used to build a synthetic enhancer (fuzzy AND gate), requiring the coordination of 5 transcription factors organized into two layers. This work introduces a generic approach for the development of mammalian genetic sensors and circuits to populate a toolbox that can be applied to diverse applications from biomanufacturing to living therapeutics. PMID:25360681

  20. Systematic transfer of prokaryotic sensors and circuits to mammalian cells.


    Stanton, Brynne C; Siciliano, Velia; Ghodasara, Amar; Wroblewska, Liliana; Clancy, Kevin; Trefzer, Axel C; Chesnut, Jonathan D; Weiss, Ron; Voigt, Christopher A


    Prokaryotic regulatory proteins respond to diverse signals and represent a rich resource for building synthetic sensors and circuits. The TetR family contains >10(5) members that use a simple mechanism to respond to stimuli and bind distinct DNA operators. We present a platform that enables the transfer of these regulators to mammalian cells, which is demonstrated using human embryonic kidney (HEK293) and Chinese hamster ovary (CHO) cells. The repressors are modified to include nuclear localization signals (NLS) and responsive promoters are built by incorporating multiple operators. Activators are also constructed by modifying the protein to include a VP16 domain. Together, this approach yields 15 new regulators that demonstrate 19- to 551-fold induction and retain both the low levels of crosstalk in DNA binding specificity observed between the parent regulators in Escherichia coli, as well as their dynamic range of activity. By taking advantage of the DAPG small molecule sensing mediated by the PhlF repressor, we introduce a new inducible system with 50-fold induction and a threshold of 0.9 μM DAPG, which is comparable to the classic Dox-induced TetR system. A set of NOT gates is constructed from the new repressors and their response function quantified. Finally, the Dox- and DAPG- inducible systems and two new activators are used to build a synthetic enhancer (fuzzy AND gate), requiring the coordination of 5 transcription factors organized into two layers. This work introduces a generic approach for the development of mammalian genetic sensors and circuits to populate a toolbox that can be applied to diverse applications from biomanufacturing to living therapeutics.

  1. CINPER: an interactive web system for pathway prediction for prokaryotes.


    Mao, Xizeng; Chen, Xin; Zhang, Yu; Pangle, Spencer; Xu, Ying


    We present a web-based network-construction system, CINPER (CSBL INteractive Pathway BuildER), to assist a user to build a user-specified gene network for a prokaryotic organism in an intuitive manner. CINPER builds a network model based on different types of information provided by the user and stored in the system. CINPER's prediction process has four steps: (i) collection of template networks based on (partially) known pathways of related organism(s) from the SEED or BioCyc database and the published literature; (ii) construction of an initial network model based on the template networks using the P-Map program; (iii) expansion of the initial model, based on the association information derived from operons, protein-protein interactions, co-expression modules and phylogenetic profiles; and (iv) computational validation of the predicted models based on gene expression data. To facilitate easy applications, CINPER provides an interactive visualization environment for a user to enter, search and edit relevant data and for the system to display (partial) results and prompt for additional data. Evaluation of CINPER on 17 well-studied pathways in the MetaCyc database shows that the program achieves an average recall rate of 76% and an average precision rate of 90% on the initial models; and a higher average recall rate at 87% and an average precision rate at 28% on the final models. The reduced precision rate in the final models versus the initial models reflects the reality that the final models have large numbers of novel genes that have no experimental evidences and hence are not yet collected in the MetaCyc database. To demonstrate the usefulness of this server, we have predicted an iron homeostasis gene network of Synechocystis sp. PCC6803 using the server. The predicted models along with the server can be accessed at

  2. The action of α-amanitin in vivo on the synthesis and maturation of mouse liver ribonucleic acids

    PubMed Central

    Hadjiolov, Asen A.; Dabeva, Mariana D.; Mackedonski, Vladimir V.


    α-Amanitin acts in vitro and in vivo as a selective inhibitor of nucleoplasmic RNA polymerases. Treatment of mice with low doses of α-amanitin causes the following changes in the synthesis, maturation and nucleocytoplasmic transfer of liver RNA species. 1. The synthesis of the nuclear precursor of mRNA is strongly inhibited and all electrophoretic components are randomly affected. The labelling of cytoplasmic mRNA is blocked. These effects may be correlated with the rapid and lasting inhibition of nucleoplasmic RNA polymerase. 2. The synthesis and maturation of the nuclear precursor of rRNA is inhibited within 30min. (a) The initial effect is a strong (about 80%) inhibition of the early steps of 45S precursor rRNA maturation. (b) The synthesis of 45S precursor rRNA is also inhibited and the effect increases from about 30% at 30min to more than 70% at 150min. (c) The labelling of nuclear and cytoplasmic 28S and 18S rRNA is almost completely blocked. The labelling of nuclear 5S rRNA is inhibited by about 50%, but that of cytoplasmic 5S rRNA is blocked. (d) The action of α-amanitin on the synthesis of precursor rRNA cannot be correlated with the slight gradual decrease of nucleolar RNA polymerase activity (only 10–20% inhibition at 150min). (e) The inhibition of precursor rRNA maturation and synthesis precedes the ultrastructural lesions of the nucleolus detected by standard electron microscopy. 3. The synthesis of nuclear 4.6S precursor of tRNA is not affected by α-amanitin. However, the labelling of nuclear and cytoplasmic tRNA is decreased by about 50%, which indicates an inhibition of precursor tRNA maturation. The results of this study suggest that the synthesis and maturation of the precursor of rRNA and the maturation of the precursor of tRNA are under the control of nucleoplasmic gene products. The regulator molecules may be either RNA or proteins with exceedingly fast turnover. ImagesPLATE 1(a)PLATE 1(b) PMID:4473981


    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  4. Nucleotide sequences of 5S rRNAs from four jellyfishes.


    Hori, H; Ohama, T; Kumazaki, T; Osawa, S


    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.


    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  6. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz


    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  7. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian


    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  8. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.


    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N


    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molecular weights (by sedimentation equilibrium) of 18700 and 18000, respectively. No ATPase or GTPase activity could be detected in the 5-S RNA . protein complex. The amino acid composition and electrophoretic mobility on polyacrylamide gels indicated both proteins were much more acidic than the equivalent from Escherichia coli or Bacillus stearothermophilus. Partial amino acid sequence data suggest HL13 is homologous to EL18 and HL19 to EL5.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S-5S (LEFT TO RIGHT), AND FLOORBEAM/STRINGER SYSTEM. VIEW LOOKING NORTH. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  10. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.


    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz


    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator.

  11. Molecular organization of the 5S rDNA gene type II in elasmobranchs.


    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian


    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  12. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.


    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry


    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  13. Relativistic effects on interchannel coupling in atomic photoionization: The photoelectron angular distribution of Xe 5s

    SciTech Connect

    Hemmers, O.; Manson, S. T.; Sant'Anna, M. M.; Focke, P.; Wang, H.; Sellin, I. A.; Lindle, D. W.


    Measurements of the photoelectron angular-distribution asymmetry parameter {beta} for Xe 5s photoionization have been performed in the 80--200 eV photon-energy region. The results show a substantial deviation from the nonrelativistic value of {beta}=2 and provide a clear signature of significant relativistic effects in interchannel coupling.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM GIRDER SPAN TO 'SUSPENDED' TRUSS SPAN AT U0. VIEW LOOKING WEST. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  15. An efficient synthetic approach to 6,5'-(S)- and 6,5'-(R)-cyclouridine.


    Theile, Christopher S; McLaughlin, Larry W


    Here we present new routes for the efficient syntheses of 6,5'-(S)- and 6,5'-(R)-cyclouridine. The syntheses utilize readily accessible uridine as a starting material. This route to the R diastereomer is significantly more efficient than previous synthetic efforts, allowing us to obtain large amounts of pure material for future biological testing.

  16. Nucleotide sequences of 5S rRNAs from four jellyfishes.


    Hori, H; Ohama, T; Kumazaki, T; Osawa, S


    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  17. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk


    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  18. Biosynthesis of resorcylic acid lactone (5S)-5-hydroxylasiodiplodin in Lasiodiplodia theobromae.


    Kashima, Takasumi; Takahashi, Kosaku; Matsuura, Hideyuki; Nabeta, Kensuke


    An administration study of (2)H-labeled precursors showed that the 9-hydroxydecanoyl unit, the acyl intermediate of lasiodiplodin (1), was also the intermediate of (5S)-5-hydroxylasiodiplodin (2) in Lasiodiplodia theobromae. The incorporation of [O-methyl-(2)H(3)]-lasiodiplodin (6) into 2 indicated that hydroxylation at C-5 occurred after cyclization. PMID:19897901

  19. Photodissociation dynamics of superexcited O2: Dissociation channels O(5S) vs. O(3S)

    NASA Astrophysics Data System (ADS)

    Zhou, Yiyong; Meng, Qingnan; Mo, Yuxiang


    The photodissociation dynamics of O2, O2 + hυ → O(3P) + O(2p3(4S)3s, 3S/5S), has been studied by combining the XUV laser pump / UV laser probe and velocity map imaging methods in the photon energy range 14.64-15.20 eV. The fragment yield spectra of O(3S) and O(5S) and their velocity map images have been recorded using the state-selective (1+1) REMPI method to detect the fragments. The fragment yield spectra show resolved fine structure that arises from the predissociated Rydberg states I, I' and I″ (3ΠΩ = 0,1,2). The branching ratios between the two decay channels have been measured by one-photon ionization of the fragments O(3S) and O(5S) simultaneously. It is surprising to find that the dissociation cross sections for the production of O(5S) are larger than, or comparable to, those of O(3S) for the I and I' states, while the cross sections for the production of O(5S) are smaller than those of O(3S) for the I″ state. All fragments O(5S) arise from perpendicular transitions, which provides direct experimental evidence about the symmetry assignments of the states I, I' and I″ excited in this energy region. Although most of the fragments O(3S) arise from perpendicular transitions, some of them are from parallel transitions. Based on the calculated ab initio potential energy curves, we propose that the neutral dissociation into O(3P) + O(3S) occurs mainly via the interaction of the Rydberg states I, I', and I″ with the vibrational continuum of the diabatic 83Πu state (1π _u^{ - 1} (a^4 {Π}_u {)3}sσ _g ,^3 Π_u), while the neutral dissociation into O(3P) + O(5S) occurs mainly via the interaction of Rydberg states I, I', and I″ with the diabatic 73Πu (1π _g^{ - 1} (X^2 {Π}_g {)3}p{σ }_u ,^3 Π_u).

  20. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.


    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M


    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  1. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.


    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  2. Encapsulation of ribonucleic acid in human red blood cells for use as a reticulocyte quality control material for flow cytometric analysis.


    Ebrahim, A; Ryan, W L


    The osmotic lysis procedure was employed to encapsulate ribonucleic acid (RNA) in human red blood cells in order to prepare a reticulocyte reference control. The procedure required the hypotonic dialysis of erythrocytes in the presence of RNA and cytosolic components of red blood cells followed by a short hypertonic dialysis to restore isotonicity and reseal the pores formed on the cell membrane during the hypotonic swelling. The procedure was monitored by a dedicated flow cytometer for reticulocyte counting and required 120 min. Approximately 20% of the erythrocytes undergoing the reversible osmotic lysis were encapsulated with various amounts of RNA. The morphology of the RNA-loaded erythrocytes were similar to those of normal erythrocytes and reticulocytes, however, their mean cell volume (MCV) was slightly smaller than normal cells. RNA-loaded erythrocytes prepared by this method were stable for several months as a reference control for identification and enumeration of reticulocytes using flow cytometric as well as manual analysis methods and resulted in a high correlation coefficient between these counting techniques. PMID:8891445

  3. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA)

    PubMed Central

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S.; Harlow, Mark L.


    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5′ ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  4. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).


    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L


    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.

  5. Bone marrow mononuclear cells from patients with Paget's disease contain measles virus nucleocapsid messenger ribonucleic acid that has mutations in a specific region of the sequence.


    Reddy, S V; Singer, F R; Roodman, G D


    Ultrastructural, immunocytochemical, and in situ hybridization studies have suggested that paramyxoviruses, such as measles virus (MV), are present in Pagetic osteoclasts and may contribute to the abnormality in osteoclast function. However, little additional information is known about potential viruses present in Pagetic osteoclasts. As there are increased numbers of osteoclast precursors among the marrow mononuclear cells of Paget's patients, we used the reverse transcriptase-polymerase chain reaction to amplify the nucleocapsid sequence of MV from freshly isolated bone marrow-derived mononuclear cells to examine the potential role of these viruses in cells in the osteoclast lineage. We detected MV nucleocapsid transcripts in 5 of 6 individual Paget's patients' marrow samples. MV transcripts were not detected in marrow samples from 10 normal subjects. Sequence analysis of the PCR products revealed that 1 patient had the same sequence as the Edmonston strain of MV. The remaining 4 patients had point mutations clustered between position 1360-1371 base pairs. Two of the patients exhibited identical mutations at this region. In total, 3 different point mutations were identified that resulted in amino acid substitutions. These data show that 1) unlike those from normal subjects, marrow mononuclear cells from Paget's patients express MV nucleocapsid messenger ribonucleic acid; and 2) mutations of a specific region of the MV nucleocapsid gene were present in 4 of 5 patients and suggest a persistent MV infection in Pagetic osteoclast precursors. These data further suggest that osteoclasts are infected by fusion with infected precursors.

  6. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).


    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L


    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  7. Metabolic activity and functional diversity changes in sediment prokaryotic communities organically enriched with mussel biodeposits.


    Pollet, Thomas; Cloutier, Olivier; Nozais, Christian; McKindsey, Christopher W; Archambault, Philippe


    This experimental microcosm study reports the influence of organic enrichments by mussel biodeposits on the metabolic activity and functional diversity of benthic prokaryotic communities. The different biodeposit enrichment regimes created, which mimicked the quantity of faeces and pseudo-faeces potentially deposited below mussel farms, show a clear stimulatory effect of this organic enrichment on prokaryotic metabolic activity. This effect was detected once a certain level of biodeposition was attained with a tipping point estimated between 3.25 and 10 g day-1 m-2. Prokaryotic communities recovered their initial metabolic activity by 11 days after the cessation of biodeposit additions. However, their functional diversity remained greater than prior to the disturbance suggesting that mussel biodeposit enrichment may disturb the functioning and perhaps the role of prokaryotic communities in benthic ecosystems. This manipulative approach provided new information on the influence of mussel biodeposition on benthic prokaryotic communities and dose-response relationships and may support the development of carrying capacity models for bivalve culture.

  8. Effects of Predation by Protists on Prokaryotic Community Function, Structure, and Diversity in Anaerobic Granular Sludge

    PubMed Central

    Hirakata, Yuga; Oshiki, Mamoru; Kuroda, Kyohei; Hatamoto, Masashi; Kubota, Kengo; Yamaguchi, Takashi; Harada, Hideki; Araki, Nobuo


    Predation by protists is top-down pressure that regulates prokaryotic abundance, community function, structure, and diversity in natural and artificial ecosystems. Although the effects of predation by protists have been studied in aerobic ecosystems, they are poorly understood in anoxic environments. We herein studied the influence of predation by Metopus and Caenomorpha ciliates—ciliates frequently found in anoxic ecosystems—on prokaryotic community function, structure, and diversity. Metopus and Caenomorpha ciliates were cocultivated with prokaryotic assemblages (i.e., anaerobic granular sludge) in an up-flow anaerobic sludge blanket (UASB) reactor for 171 d. Predation by these ciliates increased the methanogenic activities of granular sludge, which constituted 155% of those found in a UASB reactor without the ciliates (i.e., control reactor). Sequencing of 16S rRNA gene amplicons using Illumina MiSeq revealed that the prokaryotic community in the UASB reactor with the ciliates was more diverse than that in the control reactor; 2,885–3,190 and 2,387–2,426 operational taxonomic units (>97% sequence similarities), respectively. The effects of predation by protists in anaerobic engineered systems have mostly been overlooked, and our results show that the influence of predation by protists needs to be examined and considered in the future for a better understanding of prokaryotic community structure and function. PMID:27431197

  9. Metabolic Activity and Functional Diversity Changes in Sediment Prokaryotic Communities Organically Enriched with Mussel Biodeposits

    PubMed Central

    Pollet, Thomas; Cloutier, Olivier; Nozais, Christian; McKindsey, Christopher W.; Archambault, Philippe


    This experimental microcosm study reports the influence of organic enrichments by mussel biodeposits on the metabolic activity and functional diversity of benthic prokaryotic communities. The different biodeposit enrichment regimes created, which mimicked the quantity of faeces and pseudo-faeces potentially deposited below mussel farms, show a clear stimulatory effect of this organic enrichment on prokaryotic metabolic activity. This effect was detected once a certain level of biodeposition was attained with a tipping point estimated between 3.25 and 10 g day-1 m-2. Prokaryotic communities recovered their initial metabolic activity by 11 days after the cessation of biodeposit additions. However, their functional diversity remained greater than prior to the disturbance suggesting that mussel biodeposit enrichment may disturb the functioning and perhaps the role of prokaryotic communities in benthic ecosystems. This manipulative approach provided new information on the influence of mussel biodeposition on benthic prokaryotic communities and dose-response relationships and may support the development of carrying capacity models for bivalve culture. PMID:25923715

  10. Effects of Predation by Protists on Prokaryotic Community Function, Structure, and Diversity in Anaerobic Granular Sludge.


    Hirakata, Yuga; Oshiki, Mamoru; Kuroda, Kyohei; Hatamoto, Masashi; Kubota, Kengo; Yamaguchi, Takashi; Harada, Hideki; Araki, Nobuo


    Predation by protists is top-down pressure that regulates prokaryotic abundance, community function, structure, and diversity in natural and artificial ecosystems. Although the effects of predation by protists have been studied in aerobic ecosystems, they are poorly understood in anoxic environments. We herein studied the influence of predation by Metopus and Caenomorpha ciliates-ciliates frequently found in anoxic ecosystems-on prokaryotic community function, structure, and diversity. Metopus and Caenomorpha ciliates were cocultivated with prokaryotic assemblages (i.e., anaerobic granular sludge) in an up-flow anaerobic sludge blanket (UASB) reactor for 171 d. Predation by these ciliates increased the methanogenic activities of granular sludge, which constituted 155% of those found in a UASB reactor without the ciliates (i.e., control reactor). Sequencing of 16S rRNA gene amplicons using Illumina MiSeq revealed that the prokaryotic community in the UASB reactor with the ciliates was more diverse than that in the control reactor; 2,885-3,190 and 2,387-2,426 operational taxonomic units (>97% sequence similarities), respectively. The effects of predation by protists in anaerobic engineered systems have mostly been overlooked, and our results show that the influence of predation by protists needs to be examined and considered in the future for a better understanding of prokaryotic community structure and function.

  11. [Analysis of Prokaryotic Community Structure in River Waters of the Ningbo Sanjiang Mouth].


    Hu, An-yi; Li, Jiang-wei; Yang, Xiao-yong; Wang, Hong-jie; Yu, Chang-ping


    The prokaryotic community structure in river waters of the Ningbo Sanjiang Mouth was analyzed for the first time using 16S rRNA gene based-Illumina Miseq high-throughput sequencing. A total of 215 504 high-quality sequences were obtained, and the results of alpha-diversity analysis revealed that Yongjiang River Watershed (YRW) harbored high diversity and richness of prokaryotic communities. Taxonomic assignment analysis indicated that β-Proteobacterium, Actinobacteria and Bacteroidetes dominated in the river water of YRW, and accounted for 78. 88% of the total prokaryotic communities. Hydrological condition may play an important role in influencing the composition and structure of YRW prokaryotic community. In addition, several kinds of sewer- and fecal-pollution indicator bacterial groups were observed in this area with the highest abundance of pollution indicator bacteria occurring in the water sample of Yuyao River, implying that the Yuyao River might have a high potential risk of sewer- and fecal-pollution. Moreover, a total of 76 species and 18 subspecies of potential pathogenic bacteria, which accounted for 2. 19% and 0. 40% of total sequences respectively, were identified using BLASTN analysis with a local pathogenic bacteria database. Overall, this study provided an important basic data for shedding light on the structure and ecological function of YRW prokaryotic community.

  12. Molecular aspects of gene transfer and foreign DNA acquisition in prokaryotes with regard to safety issues.


    Brigulla, Matthias; Wackernagel, Wilfried


    Horizontal gene transfer (HGT) is part of prokaryotic life style and a major factor in evolution. In principle, any combinations of genetic information can be explored via HGT for effects on prokaryotic fitness. HGT mechanisms including transformation, conjugation, transduction, and variations of these plus the role of mobile genetic elements are summarized with emphasis on their potential to translocate foreign DNA. Complementarily, we discuss how foreign DNA can be integrated in recipient cells through homologous recombination (HR), illegitimate recombination (IR), and combinations of both, site-specific recombination, and the reconstitution of plasmids. Integration of foreign DNA by IR is very low, and combinations of IR with HR provide intermediate levels compared to the high frequency of homologous integration. A survey of studies on potential HGT from various transgenic plants indicates very rare transfer of foreign DNA. At the same time, in prokaryotic habitats, genes introduced into transgenic plants are abundant, and natural HGT frequencies are relatively high providing a greater chance for direct transfer instead of via transgenic plants. It is concluded that potential HGT from transgenic plants to prokaryotes is not expected to influence prokaryotic evolution and to have negative effects on human or animal health and the environment.

  13. What are archaebacteria: life's third domain or monoderm prokaryotes related to gram-positive bacteria? A new proposal for the classification of prokaryotic organisms.


    Gupta, R S


    The evolutionary relationship within prokaryotes is examined based on signature sequences (defined as conserved inserts or deletions shared by specific taxa) and phylogenies derived from different proteins. Archaebacteria are indicated as being monophyletic by a number of proteins related to the information transfer processes. In contrast, for several other highly conserved proteins, common signature sequences are present in archaebacteria and Gram-positive bacteria, whereas Gram-negative bacteria are indicated as being distinct. For these proteins, archaebacteria do not form a phylogenetically distinct clade but show polyphyletic branching within Gram-positive bacteria. A closer relationship of archaebacteria to Gram-positive bacteria in comparison with Gram-negative bacteria is generally seen for the majority of the available gene/ protein sequences. To account for these results and the fact that both archaebacteria and Gram-positive bacteria are prokaryotes surrounded by a single cell membrane, I propose that the primary division within prokaryotes is between monoderm prokaryotes (surrounded by a single membrane) and diderm prokaryotes (i.e. all true Gram-negative bacteria containing both an inner cytoplasmic membrane and an outer membrane). This proposal is consistent with both cell morphology and signature sequences in different proteins. The monophyletic nature of archaebacteria for some genes, and their polyphyletic branching within Gram-positive bacteria as suggested by others, is critically examined, and several explanations, including derivation of archaebacteria from Gram-positive bacteria in response to antibiotic selection pressure, are proposed. Signature sequences in proteins also indicate that the low-G+C Gram-positive bacteria are phylogenetically distinct from the high-G+C Gram-positive group and that the diderm prokaryotes (i.e. Gram-negative bacteria) appear to have evolved from the latter group. Protein phylogenies and signature sequences also

  14. Examination of Prokaryotic Multipartite Genome Evolution through Experimental Genome Reduction

    PubMed Central

    diCenzo, George C.; MacLean, Allyson M.; Milunovic, Branislava; Golding, G. Brian; Finan, Turlough M.


    Many bacteria carry two or more chromosome-like replicons. This occurs in pathogens such as Vibrio cholerea and Brucella abortis as well as in many N2-fixing plant symbionts including all isolates of the alfalfa root-nodule bacteria Sinorhizobium meliloti. Understanding the evolution and role of this multipartite genome organization will provide significant insight into these important organisms; yet this knowledge remains incomplete, in part, because technical challenges of large-scale genome manipulations have limited experimental analyses. The distinct evolutionary histories and characteristics of the three replicons that constitute the S. meliloti genome (the chromosome (3.65 Mb), pSymA megaplasmid (1.35 Mb), and pSymB chromid (1.68 Mb)) makes this a good model to examine this topic. We transferred essential genes from pSymB into the chromosome, and constructed strains that lack pSymB as well as both pSymA and pSymB. This is the largest reduction (45.4%, 3.04 megabases, 2866 genes) of a prokaryotic genome to date and the first removal of an essential chromid. Strikingly, strains lacking pSymA and pSymB (ΔpSymAB) lost the ability to utilize 55 of 74 carbon sources and various sources of nitrogen, phosphorous and sulfur, yet the ΔpSymAB strain grew well in minimal salts media and in sterile soil. This suggests that the core chromosome is sufficient for growth in a bulk soil environment and that the pSymA and pSymB replicons carry genes with more specialized functions such as growth in the rhizosphere and interaction with the plant. These experimental data support a generalized evolutionary model, in which non-chromosomal replicons primarily carry genes with more specialized functions. These large secondary replicons increase the organism's niche range, which offsets their metabolic burden on the cell (e.g. pSymA). Subsequent co-evolution with the chromosome then leads to the formation of a chromid through the acquisition of functions core to all niches (e.g. p

  15. Latitudinal distribution of prokaryotic picoplankton populations in the Atlantic Ocean.


    Schattenhofer, Martha; Fuchs, Bernhard M; Amann, Rudolf; Zubkov, Mikhail V; Tarran, Glen A; Pernthaler, Jakob


    Members of the prokaryotic picoplankton are the main drivers of the biogeochemical cycles over large areas of the world's oceans. In order to ascertain changes in picoplankton composition in the euphotic and twilight zones at an ocean basin scale we determined the distribution of 11 marine bacterial and archaeal phyla in three different water layers along a transect across the Atlantic Ocean from South Africa (32.9 degrees S) to the UK (46.4 degrees N) during boreal spring. Depth profiles down to 500 m at 65 stations were analysed by catalysed reporter deposition fluorescence in situ hybridization (CARD-FISH) and automated epifluorescence microscopy. There was no obvious overall difference in microbial community composition between the surface water layer and the deep chlorophyll maximum (DCM) layer. There were, however, significant differences between the two photic water layers and the mesopelagic zone. SAR11 (35 +/- 9%) and Prochlorococcus (12 +/- 8%) together dominated the surface waters, whereas SAR11 and Crenarchaeota of the marine group I formed equal proportions of the picoplankton community below the DCM (both approximately 15%). However, due to their small cell sizes Crenarchaeota contributed distinctly less to total microbial biomass than SAR11 in this mesopelagic water layer. Bacteria from the uncultured Chloroflexi-related clade SAR202 occurred preferentially below the DCM (4-6%). Distinct latitudinal distribution patterns were found both in the photic zone and in the mesopelagic waters: in the photic zone, SAR11 was more abundant in the Northern Atlantic Ocean (up to 45%) than in the Southern Atlantic gyre (approximately 25%), the biomass of Prochlorococcus peaked in the tropical Atlantic Ocean, and Bacteroidetes and Gammaproteobacteria bloomed in the nutrient-rich northern temperate waters and in the Benguela upwelling. In mesopelagic waters, higher proportions of SAR202 were present in both central gyre regions, whereas Crenarchaeota were clearly

  16. Faster growth of the major prokaryotic versus eukaryotic CO2 fixers in the oligotrophic ocean.


    Zubkov, Mikhail V


    Because maintenance of non-scalable cellular components--membranes and chromosomes--requires an increasing fraction of energy as cell size decreases, miniaturization comes at a considerable energetic cost for a phytoplanktonic cell. Consequently, if eukaryotes can use their superior energetic resources to acquire nutrients with more or even similar efficiency compared with prokaryotes, larger unicellular eukaryotes should be able to achieve higher growth rates than smaller cyanobacteria. Here, to test this hypothesis, we directly compare the intrinsic growth rates of phototrophic prokaryotes and eukaryotes from the equatorial to temperate South Atlantic using an original flow cytometric (14)CO2-tracer approach. At the ocean basin scale, cyanobacteria double their biomass twice as frequently as the picoeukaryotes indicating that the prokaryotes are faster growing CO2 fixers, better adapted to phototrophic living in the oligotrophic open ocean-the most extensive biome on Earth.

  17. Laccases of prokaryotic origin: enzymes at the interface of protein science and protein technology.


    Martins, Lígia O; Durão, Paulo; Brissos, Vânia; Lindley, Peter F


    The ubiquitous members of the multicopper oxidase family of enzymes oxidize a range of aromatic substrates such as polyphenols, methoxy-substituted phenols, amines and inorganic compounds, concomitantly with the reduction of molecular dioxygen to water. This family of enzymes can be broadly divided into two functional classes: metalloxidases and laccases. Several prokaryotic metalloxidases have been described in the last decade showing a robust activity towards metals, such as Cu(I), Fe(II) or Mn(II) and have been implicated in the metal metabolism of the corresponding microorganisms. Many laccases, with a superior efficiency for oxidation of organic compounds when compared with metals, have also been identified and characterized from prokaryotes, playing roles that more closely conform to those of intermediary metabolism. This review aims to present an update of current knowledge on prokaryotic multicopper oxidases, with a special emphasis on laccases, anticipating their enormous potential for industrial and environmental applications.

  18. Repairing DNA double-strand breaks by the prokaryotic non-homologous end-joining pathway.


    Brissett, Nigel C; Doherty, Aidan J


    The NHEJ (non-homologous end-joining) pathway is one of the major mechanisms for repairing DSBs (double-strand breaks) that occur in genomic DNA. In common with eukaryotic organisms, many prokaryotes possess a conserved NHEJ apparatus that is essential for the repair of DSBs arising in the stationary phase of the cell cycle. Although the bacterial NHEJ complex is much more minimal than its eukaryotic counterpart, both pathways share a number of common mechanistic features. The relative simplicity of the prokaryotic NHEJ complex makes it a tractable model system for investigating the cellular and molecular mechanisms of DSB repair. The present review describes recent advances in our understanding of prokaryotic end-joining, focusing primarily on biochemical, structural and cellular aspects of the mycobacterial NHEJ repair pathway.

  19. Silver-doped calcium phosphate nanoparticles: synthesis, characterization, and toxic effects toward mammalian and prokaryotic cells.


    Peetsch, Alexander; Greulich, Christina; Braun, Dieter; Stroetges, Christian; Rehage, Heinz; Siebers, Bettina; Köller, Manfred; Epple, Matthias


    Spherical silver-doped calcium phosphate nanoparticles were synthesized in a co-precipitation route from calcium nitrate/silver nitrate and ammonium phosphate in a continuous process and colloidally stabilized by carboxymethyl cellulose. Nanoparticles with 0.39 wt% silver content and a diameter of about 50-60 nm were obtained. The toxic effects toward mammalian and prokaryotic cells were determined by viability tests and determination of the minimal inhibitory and minimal bactericidal concentrations (MIC and MBC). Three mammalian cells lines, i.e. human mesenchymal stem cells (hMSC) and blood peripheral mononuclear cells (PBMC, monocytes and T-lymphocytes), and two prokaryotic strains, i.e. Escherichia coli (E. coli) and Staphylococcus aureus (S. aureus) were used. Silver-doped calcium phosphate nanoparticles and silver acetate showed similar effect toward mammalian and prokaryotic cells with toxic silver concentrations in the range of 1-3 μg mL(-1).

  20. Assessment of diversity indices for the characterization of the soil prokaryotic community by metagenomic analysis

    NASA Astrophysics Data System (ADS)

    Chernov, T. I.; Tkhakakhova, A. K.; Kutovaya, O. V.


    The diversity indices used in ecology for assessing the metagenomes of soil prokaryotic communities at different phylogenetic levels were compared. The following indices were considered: the number of detected taxa and the Shannon, Menhinick, Margalef, Simpson, Chao1, and ACE indices. The diversity analysis of the prokaryotic communities in the upper horizons of a typical chernozem (Haplic Chernozem (Pachic)), a dark chestnut soil (Haplic Kastanozem (Chromic)), and an extremely arid desert soil (Endosalic Calcisol (Yermic)) was based on the analysis of 16S rRNA genes. The Menhinick, Margalef, Chao1, and ACE indices gave similar results for the classification of the communities according to their diversity levels; the Simpson index gave good results only for the high-level taxa (phyla); the best results were obtained with the Shannon index. In general, all the indices used showed a decrease in the diversity of the soil prokaryotes in the following sequence: chernozem > dark chestnut soil > extremely arid desert soil.

  1. 'Candidatus Magnetoglobus multicellularis', a multicellular, magnetotactic prokaryote from a hypersaline environment.


    Abreu, Fernanda; Martins, Juliana Lopes; Silveira, Thaís Souza; Keim, Carolina Neumann; de Barros, Henrique G P Lins; Filho, Frederico J Gueiros; Lins, Ulysses


    Phylogenetic analysis and phenotypic characterization were used to assign a multicellular magnetotactic prokaryote the name 'Candidatus Magnetoglobus multicellularis'. 'Candidatus Magnetoglobus multicellularis' lives in a large hypersaline coastal lagoon from Brazil and has properties that are unique among prokaryotes. It consists of a compact assembly or aggregate of flagellated bacterial cells, highly organized in a sphere, that swim in either helical or straight trajectories. The life cycle of 'Candidatus Magnetoglobus multicellularis' is completely multicellular, in which one aggregate grows by enlarging the size of its cells and approximately doubling the volume of the whole organism. Cells then divide synchronously, maintaining the spherical arrangement; finally the cells separate into two identical aggregates. Phylogenetic 16S rRNA gene sequence analysis showed that 'Candidatus Magnetoglobus multicellularis' is related to the dissimilatory sulfate-reducing bacteria within the Deltaproteobacteria and to other previously described, but not yet well characterized, multicellular magnetotactic prokaryotes.

  2. The Evolution of Epigenetics: From Prokaryotes to Humans and Its Biological Consequences

    PubMed Central

    Willbanks, Amber; Leary, Meghan; Greenshields, Molly; Tyminski, Camila; Heerboth, Sarah; Lapinska, Karolina; Haskins, Kathryn; Sarkar, Sibaji


    The evolution process includes genetic alterations that started with prokaryotes and now continues in humans. A distinct difference between prokaryotic chromosomes and eukaryotic chromosomes involves histones. As evolution progressed, genetic alterations accumulated and a mechanism for gene selection developed. It was as if nature was experimenting to optimally utilize the gene pool without changing individual gene sequences. This mechanism is called epigenetics, as it is above the genome. Curiously, the mechanism of epigenetic regulation in prokaryotes is strikingly different from that in eukaryotes, mainly higher eukaryotes, like mammals. In fact, epigenetics plays a significant role in the conserved process of embryogenesis and human development. Malfunction of epigenetic regulation results in many types of undesirable effects, including cardiovascular disease, metabolic disorders, autoimmune diseases, and cancer. This review provides a comparative analysis and new insights into these aspects. PMID:27512339

  3. The Evolution of Epigenetics: From Prokaryotes to Humans and Its Biological Consequences.


    Willbanks, Amber; Leary, Meghan; Greenshields, Molly; Tyminski, Camila; Heerboth, Sarah; Lapinska, Karolina; Haskins, Kathryn; Sarkar, Sibaji


    The evolution process includes genetic alterations that started with prokaryotes and now continues in humans. A distinct difference between prokaryotic chromosomes and eukaryotic chromosomes involves histones. As evolution progressed, genetic alterations accumulated and a mechanism for gene selection developed. It was as if nature was experimenting to optimally utilize the gene pool without changing individual gene sequences. This mechanism is called epigenetics, as it is above the genome. Curiously, the mechanism of epigenetic regulation in prokaryotes is strikingly different from that in eukaryotes, mainly higher eukaryotes, like mammals. In fact, epigenetics plays a significant role in the conserved process of embryogenesis and human development. Malfunction of epigenetic regulation results in many types of undesirable effects, including cardiovascular disease, metabolic disorders, autoimmune diseases, and cancer. This review provides a comparative analysis and new insights into these aspects. PMID:27512339

  4. Faster growth of the major prokaryotic versus eukaryotic CO2 fixers in the oligotrophic ocean

    PubMed Central

    Zubkov, Mikhail V.


    Because maintenance of non-scalable cellular components—membranes and chromosomes—requires an increasing fraction of energy as cell size decreases, miniaturization comes at a considerable energetic cost for a phytoplanktonic cell. Consequently, if eukaryotes can use their superior energetic resources to acquire nutrients with more or even similar efficiency compared with prokaryotes, larger unicellular eukaryotes should be able to achieve higher growth rates than smaller cyanobacteria. Here, to test this hypothesis, we directly compare the intrinsic growth rates of phototrophic prokaryotes and eukaryotes from the equatorial to temperate South Atlantic using an original flow cytometric 14CO2-tracer approach. At the ocean basin scale, cyanobacteria double their biomass twice as frequently as the picoeukaryotes indicating that the prokaryotes are faster growing CO2 fixers, better adapted to phototrophic living in the oligotrophic open ocean—the most extensive biome on Earth. PMID:24777140

  5. The repertoire of ICE in prokaryotes underscores the unity, diversity, and ubiquity of conjugation.


    Guglielmini, Julien; Quintais, Leonor; Garcillán-Barcia, Maria Pilar; de la Cruz, Fernando; Rocha, Eduardo P C


    Horizontal gene transfer shapes the genomes of prokaryotes by allowing rapid acquisition of novel adaptive functions. Conjugation allows the broadest range and the highest gene transfer input per transfer event. While conjugative plasmids have been studied for decades, the number and diversity of integrative conjugative elements (ICE) in prokaryotes remained unknown. We defined a large set of protein profiles of the conjugation machinery to scan over 1,000 genomes of prokaryotes. We found 682 putative conjugative systems among all major phylogenetic clades and showed that ICEs are the most abundant conjugative elements in prokaryotes. Nearly half of the genomes contain a type IV secretion system (T4SS), with larger genomes encoding more conjugative systems. Surprisingly, almost half of the chromosomal T4SS lack co-localized relaxases and, consequently, might be devoted to protein transport instead of conjugation. This class of elements is preponderant among small genomes, is less commonly associated with integrases, and is rarer in plasmids. ICEs and conjugative plasmids in proteobacteria have different preferences for each type of T4SS, but all types exist in both chromosomes and plasmids. Mobilizable elements outnumber self-conjugative elements in both ICEs and plasmids, which suggests an extensive use of T4SS in trans. Our evolutionary analysis indicates that switch of plasmids to and from ICEs were frequent and that extant elements began to differentiate only relatively recently. According to the present results, ICEs are the most abundant conjugative elements in practically all prokaryotic clades and might be far more frequently domesticated into non-conjugative protein transport systems than previously thought. While conjugative plasmids and ICEs have different means of genomic stabilization, their mechanisms of mobility by conjugation show strikingly conserved patterns, arguing for a unitary view of conjugation in shaping the genomes of prokaryotes by

  6. Evolution and diversity of the Ras superfamily of small GTPases in prokaryotes.


    Wuichet, Kristin; Søgaard-Andersen, Lotte


    The Ras superfamily of small GTPases are single domain nucleotide-dependent molecular switches that act as highly tuned regulators of complex signal transduction pathways. Originally identified in eukaryotes for their roles in fundamental cellular processes including proliferation, motility, polarity, nuclear transport, and vesicle transport, recent studies have revealed that single domain GTPases also control complex functions such as cell polarity, motility, predation, development and antibiotic resistance in bacteria. Here, we used a computational genomics approach to understand the abundance, diversity, and evolution of small GTPases in prokaryotes. We collected 520 small GTPase sequences present in 17% of 1,611 prokaryotic genomes analyzed that cover diverse lineages. We identified two discrete families of small GTPases in prokaryotes that show evidence of three distinct catalytic mechanisms. The MglA family includes MglA homologs, which are typically associated with the MglB GTPase activating protein, whereas members of the Rup (Ras superfamily GTPase of unknown function in prokaryotes) family are not predicted to interact with MglB homologs. System classification and genome context analyses support the involvement of small GTPases in diverse prokaryotic signal transduction pathways including two component systems, laying the foundation for future experimental characterization of these proteins. Phylogenetic analysis of prokaryotic and eukaryotic GTPases supports that the last universal common ancestor contained ancestral MglA and Rup family members. We propose that the MglA family was lost from the ancestral eukaryote and that the Ras superfamily members in extant eukaryotes are the result of vertical and horizontal gene transfer events of ancestral Rup GTPases.

  7. Prokaryotic Caspase Homologs: Phylogenetic Patterns and Functional Characteristics Reveal Considerable Diversity

    PubMed Central

    Asplund-Samuelsson, Johannes; Bergman, Birgitta; Larsson, John


    Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18%) were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota). Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes. PMID:23185476

  8. The Repertoire of ICE in Prokaryotes Underscores the Unity, Diversity, and Ubiquity of Conjugation

    PubMed Central

    Guglielmini, Julien; Quintais, Leonor; Garcillán-Barcia, Maria Pilar; de la Cruz, Fernando; Rocha, Eduardo P. C.


    Horizontal gene transfer shapes the genomes of prokaryotes by allowing rapid acquisition of novel adaptive functions. Conjugation allows the broadest range and the highest gene transfer input per transfer event. While conjugative plasmids have been studied for decades, the number and diversity of integrative conjugative elements (ICE) in prokaryotes remained unknown. We defined a large set of protein profiles of the conjugation machinery to scan over 1,000 genomes of prokaryotes. We found 682 putative conjugative systems among all major phylogenetic clades and showed that ICEs are the most abundant conjugative elements in prokaryotes. Nearly half of the genomes contain a type IV secretion system (T4SS), with larger genomes encoding more conjugative systems. Surprisingly, almost half of the chromosomal T4SS lack co-localized relaxases and, consequently, might be devoted to protein transport instead of conjugation. This class of elements is preponderant among small genomes, is less commonly associated with integrases, and is rarer in plasmids. ICEs and conjugative plasmids in proteobacteria have different preferences for each type of T4SS, but all types exist in both chromosomes and plasmids. Mobilizable elements outnumber self-conjugative elements in both ICEs and plasmids, which suggests an extensive use of T4SS in trans. Our evolutionary analysis indicates that switch of plasmids to and from ICEs were frequent and that extant elements began to differentiate only relatively recently. According to the present results, ICEs are the most abundant conjugative elements in practically all prokaryotic clades and might be far more frequently domesticated into non-conjugative protein transport systems than previously thought. While conjugative plasmids and ICEs have different means of genomic stabilization, their mechanisms of mobility by conjugation show strikingly conserved patterns, arguing for a unitary view of conjugation in shaping the genomes of prokaryotes by

  9. Genomics of Bacterial and Archaeal Viruses: Dynamics within the Prokaryotic Virosphere

    PubMed Central

    Krupovic, Mart; Prangishvili, David; Hendrix, Roger W.; Bamford, Dennis H.


    Summary: Prokaryotes, bacteria and archaea, are the most abundant cellular organisms among those sharing the planet Earth with human beings (among others). However, numerous ecological studies have revealed that it is actually prokaryotic viruses that predominate on our planet and outnumber their hosts by at least an order of magnitude. An understanding of how this viral domain is organized and what are the mechanisms governing its evolution is therefore of great interest and importance. The vast majority of characterized prokaryotic viruses belong to the order Caudovirales, double-stranded DNA (dsDNA) bacteriophages with tails. Consequently, these viruses have been studied (and reviewed) extensively from both genomic and functional perspectives. However, albeit numerous, tailed phages represent only a minor fraction of the prokaryotic virus diversity. Therefore, the knowledge which has been generated for this viral system does not offer a comprehensive view of the prokaryotic virosphere. In this review, we discuss all families of bacterial and archaeal viruses that contain more than one characterized member and for which evolutionary conclusions can be attempted by use of comparative genomic analysis. We focus on the molecular mechanisms of their genome evolution as well as on the relationships between different viral groups and plasmids. It becomes clear that evolutionary mechanisms shaping the genomes of prokaryotic viruses vary between different families and depend on the type of the nucleic acid, characteristics of the virion structure, as well as the mode of the life cycle. We also point out that horizontal gene transfer is not equally prevalent in different virus families and is not uniformly unrestricted for diverse viral functions. PMID:22126996

  10. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.


    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  11. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.


    Liu, X; Smerdon, M J


    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  12. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.


    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  13. How does gene expression level contribute to thermophilic adaptation of prokaryotes? An exploration based on predictors.


    Wang, Ji; Ma, Bin-Guang; Zhang, Hong-Yu; Chen, Ling-Ling; Zhang, Shi-Cui


    By analyzing the predicted gene expression levels of 33 prokaryotes with living temperature span from <10 degrees C to >100 degrees C, a universal positive correlation was found between the percentage of predicted highly expressed genes and the organisms' optimal growth temperature. A physical interpretation of the correlation revealed that highly expressed genes are statistically more thermostable than lowly expressed genes. These findings show the possibility of the significant contribution of gene expression level to the prokaryotic thermal adaptation and provide evidence for the translational selection pressure on the thermostability of natural proteins during evolution.

  14. Notes on the use of Greek word roots in genus and species names of prokaryotes.


    Oren, Aharon; Vandamme, Peter; Schink, Bernhard


    This paper provides a survey of the ways in which Greek words and word roots have been used in the nomenclature of prokaryotes and explores the extent to which the different uses agree with the wording of the International Code of Nomenclature of Prokaryotes. We here give recommendations on how to use Greek words and word roots in new genus names and specific epithets so that the resulting names are in agreement both with the rules of Greek grammar and with Principle 3 of the Code.

  15. An unusual symbiont from the gut of surgeonfishes may be the largest known prokaryote.

    PubMed Central

    Clements, K D; Bullivant, S


    Symbionts first reported from the gut of a Red Sea surgeonfish, Acanthurus nigrofuscus (family Acanthuridae), were subsequently described as Epulopiscium fishelsoni. The taxonomic position of this very large (up to 576 microns in length) microorganism has previously been designated in the literature as either uncertain or eukaryotic. We suggest that similar symbionts from Great Barrier Reef surgeonfish may be prokaryotes, which together with E. fishelsoni from the Red Sea may represent the largest known forms of this cell type. Features identifying the symbionts as prokaryotes include the presence of bacterial-type flagella and a bacterial nucleoid and the absence of a nucleus or any other membrane-bound organelle. Images PMID:1885516

  16. Prokaryotic evolution and the tree of life are two different things

    PubMed Central

    Bapteste, Eric; O'Malley, Maureen A; Beiko, Robert G; Ereshefsky, Marc; Gogarten, J Peter; Franklin-Hall, Laura; Lapointe, François-Joseph; Dupré, John; Dagan, Tal; Boucher, Yan; Martin, William


    Background The concept of a tree of life is prevalent in the evolutionary literature. It stems from attempting to obtain a grand unified natural system that reflects a recurrent process of species and lineage splittings for all forms of life. Traditionally, the discipline of systematics operates in a similar hierarchy of bifurcating (sometimes multifurcating) categories. The assumption of a universal tree of life hinges upon the process of evolution being tree-like throughout all forms of life and all of biological time. In multicellular eukaryotes, the molecular mechanisms and species-level population genetics of variation do indeed mainly cause a tree-like structure over time. In prokaryotes, they do not. Prokaryotic evolution and the tree of life are two different things, and we need to treat them as such, rather than extrapolating from macroscopic life to prokaryotes. In the following we will consider this circumstance from philosophical, scientific, and epistemological perspectives, surmising that phylogeny opted for a single model as a holdover from the Modern Synthesis of evolution. Results It was far easier to envision and defend the concept of a universal tree of life before we had data from genomes. But the belief that prokaryotes are related by such a tree has now become stronger than the data to support it. The monistic concept of a single universal tree of life appears, in the face of genome data, increasingly obsolete. This traditional model to describe evolution is no longer the most scientifically productive position to hold, because of the plurality of evolutionary patterns and mechanisms involved. Forcing a single bifurcating scheme onto prokaryotic evolution disregards the non-tree-like nature of natural variation among prokaryotes and accounts for only a minority of observations from genomes. Conclusion Prokaryotic evolution and the tree of life are two different things. Hence we will briefly set out alternative models to the tree of life to

  17. Prokaryotic origins for the mitochondrial alternative oxidase and plastid terminal oxidase nuclear genes.


    Finnegan, Patrick M; Umbach, Ann L; Wilce, Jackie A


    The mitochondrial alternative oxidase is a diiron carboxylate quinol oxidase (Dox) found in plants and some fungi and protists, but not animals. The plastid terminal oxidase is distantly related to alternative oxidase and is most likely also a Dox protein. Database searches revealed that the alpha-proteobacterium Novosphingobium aromaticivorans and the cyanobacteria Nostoc sp. PCC7120, Synechococcus sp. WH8102 and Prochlorococcus marinus subsp. pastoris CCMP1378 each possess a Dox homolog. Each prokaryotic protein conforms to the current structural models of the Dox active site and phylogenetic analyses suggest that the eukaryotic Dox genes arose from an ancestral prokaryotic gene.

  18. Predation on prokaryotes in the water column and its ecological implications.


    Pernthaler, Jakob


    The oxic realms of freshwater and marine environments are zones of high prokaryotic mortality. Lysis by viruses and predation by ciliated and flagellated protists result in the consumption of microbial biomass at approximately the same rate as it is produced. Protist predation can favour or suppress particular bacterial species, and the successful microbial groups in the water column are those that survive this selective grazing pressure. In turn, aquatic bacteria have developed various antipredator strategies that range from simply 'outrunning' protists to the production of highly effective cytotoxins. This ancient predator-prey system can be regarded as an evolutionary precursor of many other interactions between prokaryotic and eukaryotic organisms.

  19. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.


    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa


    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained.

  20. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.


    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa


    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained. PMID:21429462

  1. Climatic controls on drainage basin topography - a synopsis of the western Andean flanks between 15.5 S and 41.5 S lat

    NASA Astrophysics Data System (ADS)

    Rehak, K.; Strecker, M. R.; Echtler, H. P.; Bookhagen, B.


    Topography in tectonically active mountain ranges is determined by the interplay between tectonics and climate. Due to the complexity of natural systems it is difficult to evaluate tectonic versus climatic contributions to the long- term landscape evolution. Previous studies suggest that rainfall and its variability strongly influence the morphology of river profiles and mountain ranges. However, it is still controversially discussed how drainage basins reflect tectonic and climatic processes. The Andean Cordillera provides a unique natural setting for studying the relationship between climate, tectonics, and topography. The Andes host various climatic zones with pronounced differences in rainfall regimes. In the central to southern western Andes, climate ranges from hyperarid in the Atacama Desert, 22 to 23°S lat, with a mean annual rainfall of ~ 5 mm/yr to year-round humid conditions south of Valdivia, ~ 40°S lat, with more than 2500 mm/yr. This zonation is controlled by hemisphere-scale atmospheric circulation patterns. With the exception of a northward shift of the Southern Hemisphere Westerlies during glacials the overall precipitation pattern has remained stable on the west coast of South America. The shelf width is reasonably constant along the margin. Uplift rate and lithology vary non-systematically and do not correlate with climatic parameters. Here, we present an analysis of 120 drainage basins along the watershed of the western Andean flank between 15.5 S and 41.5 S lat, using SRTMV3-90m data and a high-resolution rainfall dataset (TRMM 5x5 km). The basins comprise drainage areas of 1 to ~ 30 x 103 km2 and were split into subsets according to position and size. For each basin, we extracted 21 geometry, relief, and climate parameters in order to unravel the determinants of drainage-basin morphology. Our data shows that river-profile concavity and slope, hypsometric integral, basin maximum and mean elevation decrease with increasing rainfall and

  2. Mengovirus Replication in Novikoff Rat Hepatoma and Mouse L Cells: Effects on Synthesis of Host-Cell Macromolecules and Virus-specific Synthesis of Ribonucleic Acid

    PubMed Central

    Plagemann, Peter G. W.


    Novikoff cells (strain N1S1-67) and L-67 cells, a nutritional mutant of the common strain of mouse L cells which grows in the same medium as N1S1-67 cells, were infected with mengovirus under identical experimental conditions. The synthesis of host-cell ribonucleic acid (RNA) by either type of cell was not affected quantitatively or qualitatively until about 2 hr after infection, when viral RNA synthesis rapidly displaced the synthesis of cellular RNA. The rate of synthesis of protein by both types of cells continued at the same rate as in uninfected cells until about 3 hr after infection, and a disintegration of polyribosomes occurred only towards the end of the replicative cycle, between 5 and 6 hr. The time courses and extent of synthesis of single-stranded and double-stranded viral RNA and of the production of virus were very similar in both types of cells, in spite of the fact that the normal rate of RNA synthesis and the growth rate of uninfected N1S1-67 cells are about three times greater than those of L-67 cells. In both cells, the commencement of viral RNA synthesis coincided with the induction of viral RNA polymerase, as measured in cell-free extracts. Viral RNA polymerase activity disappeared from infected L-67 cells during the period of production of mature virus, but there was a secondary increase in activity in both types of cells coincidental with virus-induced disintegration of the host cells. Infected L-67 cells, however, disintegrated and released progeny virus much more slowly than N1S1-67 cells. The two strains of cells also differed in that replication of the same strain of mengovirus was markedly inhibited by treating N1S1-67 cells with actinomycin D prior to infection; the same treatment did not affect replication in L-67 cells. PMID:4176992

  3. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2


    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.


    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  4. Seasonal composition and activity of sulfate-reducing prokaryotic communities in seagrass bed sediments

    EPA Science Inventory

    Sulfate-reducing prokaryotes (SRP) play a key role in the carbon and nutrient cycles of coastal marine, vegetated ecosystems, but the interactions of SRP communities with aquatic plants remain little studied. The abundance, activity, and community composition of SRP was studied i...

  5. Exploring cultivable Bacteria from the prokaryotic community associated with the carnivorous sponge Asbestopluma hypogea.


    Dupont, Samuel; Carre-Mlouka, Alyssa; Domart-Coulon, Isabelle; Vacelet, Jean; Bourguet-Kondracki, Marie-Lise


    Combining culture-dependent and independent approaches, we investigated for the first time the cultivable fraction of the prokaryotic community associated with the carnivorous sponge Asbestopluma hypogea. The heterotrophic prokaryotes isolated from this tiny sponge were compared between specimens freshly collected from cave and maintained in aquarium. Overall, 67 isolates obtained in pure culture were phylogenetically affiliated to the bacterial phyla Proteobacteria, Bacteroidetes, Actinobacteria, and Firmicutes. This cultivable diversity was lower than the prokaryotic diversity obtained by previous pyrosequencing study and comparable to that of another Mediterranean demosponge, the filter-feeding Phorbas tenacior. Furthermore, using fluorescence in situ hybridization, we visualized bacterial and archaeal cells, confirming the presence of both prokaryotes in A. hypogea tissue. Approximately 16% of the bacterial isolates tested positive for chitinolytic activity, suggesting potential microbial involvement in the digestion processes of crustacean prey by this carnivorous sponge. Additionally, 6% and 16% of bacterial isolates revealed antimicrobial and antioxidant activities, respectively. One Streptomyces sp. S1CA strain was identified as a promising candidate for the production of antimicrobial and antioxidant secondary metabolites as well as chitinolytic enzymes. Implications in the context of the sponge biology and prey-feeding strategy are discussed.

  6. Horizontal Transfer, Not Duplication, Drives the Expansion of Protein Families in Prokaryotes

    PubMed Central

    Treangen, Todd J.; Rocha, Eduardo P. C.


    Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus), average-sized genomes (Bacillus, Enterobacteriaceae), and large genomes (Pseudomonas, Bradyrhizobiaceae) to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes—xenologs—persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes—paralogs—are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein–protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families. PMID:21298028

  7. The (un)coupling between viruses and prokaryotes in the Gulf of Trieste

    NASA Astrophysics Data System (ADS)

    Karuza, Ana; Umani, Serena Fonda; Del Negro, Paola


    Viruses and prokaryotes represent the smallest and the most abundant biological entities in marine environments. The interest for viruses and their interactions with marine organisms is continuously rising but the studies are generally limited to short-time investigations. This study conducted in the Gulf of Trieste on monthly resolution investigates for the very first time relationships between viruses and prokaryotes (both heterotrophs-HP and autotrophs-AP) over ten years (2000-2010). From our results emerged that no clear relationship between the abundances of viruses and prokaryotes is observed unless for rather restricted time intervals. Some of the sporadic peaks of viral abundances can be attributable to infections occurred during the autumn phytoplankton blooms, thus probably contributing to the end of the bloom. We infer that the general uncoupling between viruses and prokaryotes in the Gulf of Trieste is due to the variety of factors that regulate viral infection, proliferation and persistence such as the diversity of viral life cycles that are determined by environmental factors, the abundance and the physiological status of their hosts.

  8. Symbiotic prokaryotic communities from different populations of the giant barrel sponge, Xestospongia muta

    PubMed Central

    Fiore, Cara L; Jarett, Jessica K; Lesser, Michael P


    The prokaryotic community composition of the ecologically dominant sponge, Xestospongia muta, and the variability of this community across in different populations of sponges from the Caribbean and Bahamas were quantified using 454 pyrosequencing of the 16S rRNA gene. The symbiotic prokaryotic communities of X. muta were significantly different than the surrounding bacterioplankton communities while an analysis of similarity (ANOSIM) of the sponge prokaryotic symbionts from three geographically distant sites showed that both symbiont and bacterioplankton populations were significantly different between locations. Comparisons of individual sponges based on the UniFrac P-test also revealed significant differences in community composition between individual sponges. The sponges harbored a variety of phylum level operational taxonomic units (OTUs) common to many sponges, including Cyanobacteria, Poribacteria, Acidobacteria, Chloroflexi, and Gemmatimonadetes, but four additional symbiotic phyla, previously not reported for this sponge, were observed. Additionally, a diverse archaeal community was also recovered from X. muta including sequences representing the phyla Euryarchaeota and Thaumarchaeota. These results have important ecological implications for the understanding of host–microbe associations, and provide a foundation for future studies addressing the functional roles these symbiotic prokaryotes have in the biology of the host sponge and the nutrient biogeochemistry of coral reefs. PMID:24124112

  9. OperomeDB: A Database of Condition-Specific Transcription Units in Prokaryotic Genomes.


    Chetal, Kashish; Janga, Sarath Chandra


    Background. In prokaryotic organisms, a substantial fraction of adjacent genes are organized into operons-codirectionally organized genes in prokaryotic genomes with the presence of a common promoter and terminator. Although several available operon databases provide information with varying levels of reliability, very few resources provide experimentally supported results. Therefore, we believe that the biological community could benefit from having a new operon prediction database with operons predicted using next-generation RNA-seq datasets. Description. We present operomeDB, a database which provides an ensemble of all the predicted operons for bacterial genomes using available RNA-sequencing datasets across a wide range of experimental conditions. Although several studies have recently confirmed that prokaryotic operon structure is dynamic with significant alterations across environmental and experimental conditions, there are no comprehensive databases for studying such variations across prokaryotic transcriptomes. Currently our database contains nine bacterial organisms and 168 transcriptomes for which we predicted operons. User interface is simple and easy to use, in terms of visualization, downloading, and querying of data. In addition, because of its ability to load custom datasets, users can also compare their datasets with publicly available transcriptomic data of an organism. Conclusion. OperomeDB as a database should not only aid experimental groups working on transcriptome analysis of specific organisms but also enable studies related to computational and comparative operomics.

  10. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.


    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan


    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  11. Physical mapping of 5S rDNA in two species of Knifefishes: Gymnotus pantanal and Gymnotus paraguensis (Gymnotiformes).


    da Silva, M; Matoso, D A; Vicari, M R; de Almeida, M C; Margarido, V P; Artoni, R F


    Physical mapping of 5S rDNA in 2 species of knifefishes, Gymnotuspantanal and G. paraguensis (Gymnotiformes), was performed using fluorescence in situ hybridization with a 5S rDNA probe. The 5S rDNA PCR product from the genomes of both species was also sequenced and aligned to determine non-transcribed spacer sequences (NTS). Both species under study had different patterns of 5S rDNA gene cluster distribution. While in the karyotype of G. pantanal two 5S rDNA-bearing pairs were observed, the karyotype of G. paraguensis possessed as many as 19 such pairs. Such multiplication of 5S rDNA gene clusters might be caused by the involvement of transposable elements because the NTS of G. paraguensis was 400 bp long with high identity (90%) with a mobile transposable element called Tc1-like transposon, described from the cyprinid fish Labeo rohita.

  12. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.


    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C


    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: . PMID:27364428

  13. Quantification of Viral and Prokaryotic Production Rates in Benthic Ecosystems: A Methods Comparison

    PubMed Central

    Rastelli, Eugenio; Dell’Anno, Antonio; Corinaldesi, Cinzia; Middelboe, Mathias; Noble, Rachel T.; Danovaro, Roberto


    Viruses profoundly influence benthic marine ecosystems by infecting and subsequently killing their prokaryotic hosts, thereby impacting the cycling of carbon and nutrients. Previously conducted studies, based on different methodologies, have provided widely differing estimates of the relevance of viruses on benthic prokaryotes. There has been no attempt so far to compare these independent approaches, including contextual comparisons among different approaches for sample manipulation (i.e., dilution or not of the sediments during incubations), between methods based on epifluorescence microscopy (EFM) or radiotracers, and between the use of different radiotracers. Therefore, it has been difficult to identify the most suitable methodologies and protocols to be used as standard approaches for the quantification of viral infections of prokaryotes. Here, we compared for the first time different methods for determining viral and prokaryotic production rates in marine sediments collected at two benthic sites, differing in depth and environmental conditions. We used a highly replicated experimental design, testing the potential biases associated to the incubation of sediments as diluted or undiluted. In parallel, we also compared EFM counts with the 3H-thymidine incubations for the determination of viral production rates, and the use of 3H-thymidine versus 3H-leucine radiotracers for the determination of prokaryotic production. We show here that, independent from sediment dilution, EFM-based values of viral production ranged from 1.4 to 4.6 × 107 viruses g-1 h-1, and were similar but overall less variable compared to those obtained by the 3H-thymidine method (0.3 to 9.0 × 107 viruses g-1h-1). In addition, the prokaryotic production rates were not affected by sediment dilution, and the use of different radiotracers provided very consistent estimates (10.3–35.1 and 9.3–34.6 ngC g-1h-1 using the 3H-thymidine or 3H-leucine method, respectively). These results indicated

  14. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.


    Beauparlant, Marc A; Drouin, Guy


    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  15. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies.


    Qin, Qinbo; He, Weiguo; Liu, Shaojun; Wang, Jing; Xiao, Jun; Liu, Yun


    In this article, sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) were conducted in red crucian carp (RCC), blunt snout bream (BSB), and their polyploid offspring. Three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) of RCC were characterized by distinct NTS types (designated NTS-I, II, and III for the 83, 220, and 357 bp monomers, respectively). In BSB, only one monomeric 5S rDNA was observed (designated class IV: 188 bp), which was characterized by one NTS type (designated NTS-IV: 68 bp). In the polyploid offspring, the tetraploid (4nRB) hybrids partially inherited 5S rDNA classes from their female parent (RCC); however, they also possessed a unique 5S rDNA sequence (designated class I-L: 203 bp) with a novel NTS sequence (designated NTS-I-L: 83 bp). The characteristic paternal 5S rDNA sequences (class IV) were not observed. The 5S rDNA of triploid (3nRB) hybrids was completely inherited from the parental species, and generally preserved the parental 5S rDNA structural organization. These results first revealed the influence of polyploidy on the organization and evolution of the multigene family of 5S rDNA of fish, and are also useful in clarifying aspects of vertebrate genome evolution.

  16. Electron-correlation-induced interchange of lifetime broadenings of 5s{sup -1} multiplet states in atomic Cs

    SciTech Connect

    Partanen, L.; Holappa, M.; Aksela, H.; Aksela, S.; Schulz, J.


    The lifetime broadenings of the most intense 5s photolines of Cs were studied. The aim of this study was to understand the origin of the remarkable differences in the lifetime widths of different 5s{sup -1} multiplet states. The 5s photoelectron spectra of the 6s{yields}6p{sub 1/2,3/2} laser-excited states are presented in the binding energy region of 30-34 eV showing the main 5s photolines of the ground state and laser-excited states as well as the 5s5p{sup 6}6p shakeup satellites. The lifetime widths of the states were determined. The Hartree-Fock calculations were carried out to predict the 5s photoelectron spectrum. The lifetime broadenings of the 5s photolines were found to be due to the transition rates of the subsequent Coster-Kronig transitions to the 5s{sup 2}5p{sup 5} states. It was found that a straightforward single-configuration explanation cannot be given for the lifetime differences. Instead, electron correlation plays an essential role and the lifetime broadenings were found to be predicted well only when configuration interaction between the 5s{sup -1} and 5p{sup -2}5d configurations is taking into account.

  17. Impact of Lowland Rainforest Transformation on Diversity and Composition of Soil Prokaryotic Communities in Sumatra (Indonesia).


    Schneider, Dominik; Engelhaupt, Martin; Allen, Kara; Kurniawan, Syahrul; Krashevska, Valentyna; Heinemann, Melanie; Nacke, Heiko; Wijayanti, Marini; Meryandini, Anja; Corre, Marife D; Scheu, Stefan; Daniel, Rolf


    Prokaryotes are the most abundant and diverse group of microorganisms in soil and mediate virtually all biogeochemical cycles in terrestrial ecosystems. Thereby, they influence aboveground plant productivity and diversity. In this study, the impact of rainforest transformation to intensively managed cash crop systems on soil prokaryotic communities was investigated. The studied managed land use systems comprised rubber agroforests (jungle rubber), rubber plantations and oil palm plantations within two Indonesian landscapes Bukit Duabelas and Harapan. Soil prokaryotic community composition and diversity were assessed by pyrotag sequencing of bacterial and archaeal 16S rRNA genes. The curated dataset contained 16,413 bacterial and 1679 archaeal operational taxonomic units at species level (97% genetic identity). Analysis revealed changes in indigenous taxon-specific patterns of soil prokaryotic communities accompanying lowland rainforest transformation to jungle rubber, and intensively managed rubber and oil palm plantations. Distinct clustering of the rainforest soil communities indicated that these are different from the communities in the studied managed land use systems. The predominant bacterial taxa in all investigated soils were Acidobacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria. Overall, the bacterial community shifted from proteobacterial groups in rainforest soils to Acidobacteria in managed soils. The archaeal soil communities were mainly represented by Thaumarchaeota and Euryarchaeota. Members of the Terrestrial Group and South African Gold Mine Group 1 (Thaumarchaeota) dominated in the rainforest and members of Thermoplasmata in the managed land use systems. The alpha and beta diversity of the soil prokaryotic communities was higher in managed land use systems than in rainforest. In the case of bacteria, this was related to soil characteristics such as pH value, exchangeable Ca and Fe content, C to N ratio

  18. Impact of Lowland Rainforest Transformation on Diversity and Composition of Soil Prokaryotic Communities in Sumatra (Indonesia).


    Schneider, Dominik; Engelhaupt, Martin; Allen, Kara; Kurniawan, Syahrul; Krashevska, Valentyna; Heinemann, Melanie; Nacke, Heiko; Wijayanti, Marini; Meryandini, Anja; Corre, Marife D; Scheu, Stefan; Daniel, Rolf


    Prokaryotes are the most abundant and diverse group of microorganisms in soil and mediate virtually all biogeochemical cycles in terrestrial ecosystems. Thereby, they influence aboveground plant productivity and diversity. In this study, the impact of rainforest transformation to intensively managed cash crop systems on soil prokaryotic communities was investigated. The studied managed land use systems comprised rubber agroforests (jungle rubber), rubber plantations and oil palm plantations within two Indonesian landscapes Bukit Duabelas and Harapan. Soil prokaryotic community composition and diversity were assessed by pyrotag sequencing of bacterial and archaeal 16S rRNA genes. The curated dataset contained 16,413 bacterial and 1679 archaeal operational taxonomic units at species level (97% genetic identity). Analysis revealed changes in indigenous taxon-specific patterns of soil prokaryotic communities accompanying lowland rainforest transformation to jungle rubber, and intensively managed rubber and oil palm plantations. Distinct clustering of the rainforest soil communities indicated that these are different from the communities in the studied managed land use systems. The predominant bacterial taxa in all investigated soils were Acidobacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria. Overall, the bacterial community shifted from proteobacterial groups in rainforest soils to Acidobacteria in managed soils. The archaeal soil communities were mainly represented by Thaumarchaeota and Euryarchaeota. Members of the Terrestrial Group and South African Gold Mine Group 1 (Thaumarchaeota) dominated in the rainforest and members of Thermoplasmata in the managed land use systems. The alpha and beta diversity of the soil prokaryotic communities was higher in managed land use systems than in rainforest. In the case of bacteria, this was related to soil characteristics such as pH value, exchangeable Ca and Fe content, C to N ratio

  19. Impact of Lowland Rainforest Transformation on Diversity and Composition of Soil Prokaryotic Communities in Sumatra (Indonesia)

    PubMed Central

    Schneider, Dominik; Engelhaupt, Martin; Allen, Kara; Kurniawan, Syahrul; Krashevska, Valentyna; Heinemann, Melanie; Nacke, Heiko; Wijayanti, Marini; Meryandini, Anja; Corre, Marife D.; Scheu, Stefan; Daniel, Rolf


    Prokaryotes are the most abundant and diverse group of microorganisms in soil and mediate virtually all biogeochemical cycles in terrestrial ecosystems. Thereby, they influence aboveground plant productivity and diversity. In this study, the impact of rainforest transformation to intensively managed cash crop systems on soil prokaryotic communities was investigated. The studied managed land use systems comprised rubber agroforests (jungle rubber), rubber plantations and oil palm plantations within two Indonesian landscapes Bukit Duabelas and Harapan. Soil prokaryotic community composition and diversity were assessed by pyrotag sequencing of bacterial and archaeal 16S rRNA genes. The curated dataset contained 16,413 bacterial and 1679 archaeal operational taxonomic units at species level (97% genetic identity). Analysis revealed changes in indigenous taxon-specific patterns of soil prokaryotic communities accompanying lowland rainforest transformation to jungle rubber, and intensively managed rubber and oil palm plantations. Distinct clustering of the rainforest soil communities indicated that these are different from the communities in the studied managed land use systems. The predominant bacterial taxa in all investigated soils were Acidobacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria. Overall, the bacterial community shifted from proteobacterial groups in rainforest soils to Acidobacteria in managed soils. The archaeal soil communities were mainly represented by Thaumarchaeota and Euryarchaeota. Members of the Terrestrial Group and South African Gold Mine Group 1 (Thaumarchaeota) dominated in the rainforest and members of Thermoplasmata in the managed land use systems. The alpha and beta diversity of the soil prokaryotic communities was higher in managed land use systems than in rainforest. In the case of bacteria, this was related to soil characteristics such as pH value, exchangeable Ca and Fe content, C to N ratio

  20. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi


    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  1. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi


    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  2. Bottomonium physics at Υ(4S, 5S, 6S) energies with the Belle detector

    NASA Astrophysics Data System (ADS)

    Tamponi, Umberto


    The description of quarkonia as pure quark anti-quark bound states has been recently challenged by the observation of charged states in both the charmonium and bottomonium region and large violations of the heavy quark spin symmetry in hadronic transitions. All these effects can be ascribable to non-negligible contributions from the light quark degrees of freedom in the description of both charmonia and bottomonia. We will report the most recent experimental measurements performed by the Belle collaboration in the Y(4S), Y(5S) and Y(6S) regions, including the measurement of the ratio σ[e+e- → bb̅]/σ[e+e- → μ+ μ- ], the search for neutral states near the B0B̅0 threshold, the first observation of the transition ϒ(4S) → ηhb (lP) and the study of the η transitions at the ϒ(5S) energy. The contribution to the study of the structure of these states coming from the measurement of hadronic transitions will be discussed.

  3. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro


    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  4. Structural Preservation Percutaneous Endoscopic Lumbar Interlaminar Discectomy for L5-S1 Herniated Nucleus Pulposus

    PubMed Central

    Jang, Jee-Soo; Jang, Il-Tae


    Objective. Structures such as ligamentum flavum, annulus, and lamina play an important role in the segmental function. We proposed the surgical technique for achieving the sufficient preservation of segmental structures, in spite of sufficient removal of pathologic disc in the L5-S1 using the ligamentum flavum splitting and sealing technique. Methods. We retrospectively analyzed 80 cases that underwent percutaneous endoscopic lumbar discectomy for L5-S1 herniated nucleus pulposus, using the ligamentum flavum splitting and sealing technique between January 2011 and June 2013. Outcomes were assessed using VAS (leg, back), MacNab's criteria, and the immediate postoperative MRI for all patients. Structural preservation was classified as complete, sufficient, and incomplete. Results. The surgical results are as follows: 65 cases were complete, 15 cases were sufficient, and 0 cases were incomplete. The VAS was decreased at the last follow-up (leg: from 7.91 ± 0.73 to 1.15 ± 0.62; back: from 5.15 ± 0.71 to 1.19 ± 0.75). A favorable outcome (excellent or good outcome by MacNab's criteria) was achieved in 77 patients (96.25%). During the follow-up period, 2 cases (2.5%) of recurrence have occurred. Conclusion. According to the result, we could obtain the favorable clinical and radiological outcomes while simultaneously removing pathologic discs using the ligamentum flavum splitting and annular fissure sealing technique. PMID:27803927

  5. Viral Impact on Prokaryotic and Microalgal Activities in the Microphytobenthic Biofilm of an Intertidal Mudflat (French Atlantic Coast)

    PubMed Central

    Montanié, Hélène; De Crignis, Margot G.; Lavaud, Johann


    This is the first report on viriobenthos activity within the microbial biofilm located at the top-surface of the intertidal mudflat during emersion in Marennes-Oléron Bay (France). By combining in situ and ex situ approaches, the viral production (VP) was linked to the dynamics of prokaryotes and microphytobenthos (MPB). VP averaged 2–4 × 108 viruses ml−1 h−1. VP correlated positively with the Virus to Prokaryote Ratio, and both were correlated negatively with the water content. The virus-induced mortality of prokaryotes was lower in winter than in summer (6.8 vs. 39.7% of the production) and the C-shunting may supply 2–12% of their Carbon Demand, respectively. VP accounted for 79% of loss in Prokaryotes but the response was delayed compared to the increase in VP suggesting a simultaneous release of viruses of MPB origin. This hypothesis is supported by capsid-sizing of virions by transmission electronic microscopy and bioassays. Harvesting and ex situ maintenance of top-surface sediments was carried out to monitor the dynamics of viruses, prokaryotes and MPB after inoculation with benthic or planktonic viruses. Benthic viruses modified the prokaryotic and MPB dynamics and decreased the photosynthesis efficiency in contrast to planktonic viruses that impacted MPB but not the prokaryotes. PMID:26617575

  6. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.


    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B


    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  7. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.


    Campo, Daniel; García-Vázquez, Eva


    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  8. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    SciTech Connect

    Johnson, W. R.; Cheng, K. T.


    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter {gamma}{sub 5s} exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of {gamma}{sub 5s} is also found near the second minimum of the 5s cross section at 150 eV, where {gamma}{sub 5s} reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter {zeta}{sub 5p}={gamma}{sub 5p}+3{delta}{sub 5p}, which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in {gamma}{sub 5s} and {zeta}{sub 5p} arise from correlation enhanced by shape resonances in the 4p{yields}f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled.

  9. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.


    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard


    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  10. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    NASA Astrophysics Data System (ADS)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard


    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  11. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.


    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas


    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  12. The FERRUM project: Experimental transition probabilities from highly excited even 5s levels in Cr ii

    NASA Astrophysics Data System (ADS)

    Engström, L.; Lundberg, H.; Nilsson, H.; Hartman, H.; Bäckström, E.


    We report lifetime measurements of the five levels in the 3d4(a5D)5s e6D term in Cr ii at an energy around 83 000 cm-1, and log(gf) values for 38 transitions from the investigated levels. The lifetimes are obtained using time-resolved, laser-induced fluorescence on ions from a laser-produced plasma. Since the levels have the same parity as the low-lying states directly populated in the plasma, we used a two-photon excitation scheme. This process is greatly facilitated by the presence of the 3d4(a5D)4p z6F levels at roughly half the energy difference. The f-values are obtained by combining the experimental lifetimes with branching fractions derived using relative intensities from a hollow cathode lamp recorded with a Fourier transform spectrometer.

  13. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.


    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J


    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  14. Direct lateral interbody fusion (DLIF) at the lumbosacral junction L5-S1.


    Shirzadi, Ali; Birch, Kurtis; Drazin, Doniel; Liu, John C; Acosta, Frank


    The direct lateral interbody fusion (DLIF), a minimally invasive lateral approach for placement of an interbody fusion device, does not require nerve root retraction or any contact with the great vessels and can lead to short operative times with little blood loss. Due to anatomical restrictions, this procedure has not been used at the lumbosacral (L5-S1) junction. Lumbosacral transitional vertebrae (LSTV), a structural anomaly of the lumbosacral spine associated with low back pain, can result in a level being wrongly identified pre-operatively due to misnumbering of the vertebral levels. To our knowledge, use of the DLIF graft in this patient is the first report of an interbody fusion graft being placed at the disc space between the LSTV and S1 via the transpsoas route. We present a review of the literature regarding the LSTV variation as well as the lateral placement of interbody fusion grafts at the lumbosacral junction.

  15. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E


    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  16. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.


    Baum, B R; Edwards, T; Johnson, D A


    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  17. Measurement of {Upsilon}(5S) decays to B{sup 0} and B{sup +} mesons

    SciTech Connect

    Drutskoy, A.; Kinoshita, K.; Schwartz, A. J.; Adachi, I.; Haba, J.; Itoh, R.; Iwasaki, Y.; Katayama, N.; Kichimi, H.; Krokovny, P.; Nakao, M.; Nishida, S.; Sakai, Y.; Sumisawa, K.; Trabelsi, K.; Tsuboyama, T.; Uno, S.; Wicht, J.; Aihara, H.; Aulchenko, V.


    Decays of the {Upsilon}(5S) resonance to channels with B{sup +} and B{sup 0} mesons are studied using a 23.6 fb{sup -1} data sample collected with the Belle detector at the KEKB asymmetric-energy e{sup +}e{sup -} collider. Fully reconstructed B{sup +{yields}}J/{psi}K{sup +}, B{sup 0{yields}}J/{psi}K*{sup 0}, B{sup +{yields}}D{sup 0{pi}+}, and B{sup 0{yields}}D{sup -{pi}+} decays are used to obtain the charged and neutral B production rates per bb event, f(B{sup +})=(72.1{sub -3.8}{sup +3.9{+-}}5.0)% and f(B{sup 0})=(77.0{sub -5.6}{sup +5.8{+-}}6.1)%. Assuming equal rates to B{sup +} and B{sup 0} mesons in all channels produced at the {Upsilon}(5S) energy, we measure the fractions for transitions to two-body and three-body channels with B meson pairs, f(BB)=(5.5{sub -0.9}{sup +1.0{+-}}0.4)%, f(BB*+B*B)=(13.7{+-}1.3{+-}1.1)%, f(B*B*)=(37.5{sub -1.9}{sup +2.1{+-}}3.0)%, f(BB{pi})=(0.0{+-}1.2{+-}0.3)%, f(BB*{pi}+B*B{pi})=(7.3{sub -2.1}{sup +2.3{+-}}0.8)%, and f(B*B*{pi})=(1.0{sub -1.3}{sup +1.4{+-}}0.4)%. The latter three fractions are obtained assuming isospin conservation.

  18. Measuring B{sub s} width difference at the {Upsilon}(5s) using quantum entanglement

    SciTech Connect

    Atwood, David; Soni, Amarjit


    About 90% of B{sub s}B{sub s} pairs produced at the {Upsilon}(5s) resonance are initially B{sub s}{sup *}B{sub s}{sup *} pairs which decay radiatively to B{sub s}B{sub s}. This implies that the B{sub s}B{sub s} pair will then be in an eigenstate of charge conjugation (i.e. C=-1) and therefore in an entangled state. This allows for a determination of {Delta}{Gamma}{sub s}/{Gamma}{sub s} and the CP phase using a number of possible correlations between the decays of the two B{sub s} mesons. In particular, we consider the time integrated correlation, the time ordering asymmetry, and the time ordering-charge asymmetry, which in addition to time ordering distinguishes B{sub s} from B{sub s}, for various combinations of final states. With the statistics of about O(10{sup 7}-10{sup 8}) {Upsilon}(5s) events available at B factories, we find that the time ordering asymmetry between suitably defined hadronic and flavor specific (tagging) decays offers a promising method for determining the width difference. The corresponding time ordering-charge asymmetry can also bound the mixing phase. Similar observables involving exclusive decays are also considered. At the super B factories with O(50) times greater luminosity time ordering and time ordering-charge asymmetries between inclusive and exclusive modes may also provide additional bounds on the phases in those decays.

  19. Observation of B{sub s} Production at the {upsilon}(5S) Resonance

    SciTech Connect

    Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Bornheim, A.; Pappas, S.P.; Weinstein, A.; Asner, D.M.; Edwards, K.W.; Briere, R.A.; Chen, G.P.; Chen, J.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M.E.; Rosner, J.L.; Adam, N.E.; Alexander, J.P.; Berkelman, K.


    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the B{sub s} meson in e{sup +}e{sup -} annihilation at the {upsilon}(5S) resonance. We find 14 candidates consistent with B{sub s} decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that we have observed a background fluctuation is less than 8x10{sup -10}. We have established that at the energy of the {upsilon}(5S) resonance B{sub s} production proceeds predominantly through the creation of B{sub s}*B{sub s}* pairs. We find {sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)=[0.11{sub -0.03}{sup +0.04}(stat){+-}0.02(syst)] nb, and set the following limits: {sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s})/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)<0.16 and [{sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s}*)+{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s})]/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*= B{sub s}*)<0.16 (90% C.L.). The mass of the B{sub s}* meson is measured to be M{sub B{sub s}}{sub *}=[5.414{+-}0.001(stat){+-}0.003(syst)] GeV/c{sup 2}.

  20. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy.


    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun


    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure-sample entropy (SampEn)-and a more recently proposed complexity measure-distribution entropy (DistEn)-were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol.

  1. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun


    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  2. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao


    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  3. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.


    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina


    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  4. Survival of Prokaryotic- and Eukaryotic Symbiotic Rock Inhabiting Organisms in Short- and Long-Term Space Missions

    NASA Astrophysics Data System (ADS)

    de La Torre, R.; Horneck, G.; Rabbow, E.; Rettberg, P.; Sancho, L. G.; Sanchez Iñigo, F. J.; Onofri, S.; Frias, M.; Mateo-Marti, E.; de Vera, J. P.; Cockell, C.; Olsson, K.; Demets, R.


    Three experiments allowed for the first time the demonstration and intercomparision of the high survival capacity of eukaryotic and prokaryotic symbiotic organisms in space: on a short mission (LICHENS and LITHOPANSPERMIA) and on a long mission (LIFE, EXPOSE-E).

  5. Alternative oxidase and plastoquinol terminal oxidase in marine prokaryotes of the Sargasso Sea.


    McDonald, Allison E; Vanlerberghe, Greg C


    Alternative oxidase (AOX) represents a non-energy conserving branch in mitochondrial electron transport while plastoquinol terminal oxidase (PTOX) represents a potential branch in photosynthetic electron transport. Using a metagenomics dataset, we have uncovered numerous and diverse AOX and PTOX genes from the Sargasso Sea. Sequence similarity, synteny and phylogenetic analyses indicate that the large majority of these genes are from prokaryotes. AOX appears to be widely distributed among marine Eubacteria while PTOX is widespread among strains of cyanobacteria closely related to the high-light adapted Prochlorococcus marinus MED4, as well as Synechococcus. The wide distribution of AOX and PTOX in marine prokaryotes may have important implications for productivity in the world's oceans.

  6. [Diversity and viability of prokaryotes in primitive soils of the larsemann oasis (East Antarctica)].


    Kudinova, A G; Lysak, L V; Lapygina, E V; Soina, V S; Mergelov, N S


    The diversity and viability of prokaryotic communities in the primitive organomineral soils of East Antarctica have been studied; it has been shown that the total number of bacteria is smaller than and the viability of bacteria is similar to that in soils of the temperate zone. The prokaryotic communities are characterized by the occurrence of a major part of cells in filterable forms, which is higher than the analogous parameter for the temperate soils. The method of fluorescence in situ hybridization (FISH) revealed that the distribution of the main taxons is similar to that in the temperate soils: the portion of the domain Archaea is smaller than that of the domain Bacteria; the total content of Gram-negative bacteria (the phyla Proteobacteria, Acidobacteria, and Planctomycetes) is higher than that of Gram-positive bacteria (Actinobacteria). Within the phylum Proteobacteria, a significant variation of three proteobacterial classes has been noted along the profiles of the soils studied.

  7. In-cell NMR of intrinsically disordered proteins in prokaryotic cells.


    Ito, Yutaka; Mikawa, Tsutomu; Smith, Brian O


    In-cell NMR, i.e., the acquisition of heteronuclear multidimensional NMR of biomacromolecules inside living cells, is, to our knowledge, the only method for investigating the three-dimensional structure and dynamics of proteins at atomic detail in the intracellular environment. Since the inception of the method, intrinsically disordered proteins have been regarded as particular targets for in-cell NMR, due to their expected sensitivity to the molecular crowding in the intracellular environment. While both prokaryotic and eukaryotic cells can be used as host cells for in-cell NMR, prokaryotic in-cell NMR, particularly employing commonly used protein overexpression systems in Escherichia coli cells, is the most accessible approach. In this chapter we describe general procedures for obtaining in-cell NMR spectra in E. coli cells.

  8. Once in a lifetime: strategies for preventing re-replication in prokaryotic and eukaryotic cells.


    Nielsen, Olaf; Løbner-Olesen, Anders


    DNA replication is an extremely accurate process and cells have evolved intricate control mechanisms to ensure that each region of their genome is replicated only once during S phase. Here, we compare what is known about the processes that prevent re-replication in prokaryotic and eukaryotic cells by using the model organisms Escherichia coli and Schizosaccharomyces pombe as examples. Although the underlying molecular details are different, the logic behind the control mechanisms is similar. For example, after initiation, crucial molecules required for the loading of replicative helicases in both prokaryotes and eukaryotes are inactivated until the next cell cycle. Furthermore, in both systems the beta-clamp of the replicative polymerase associates with enzymatic activities that contribute to the inactivation of the helicase loaders. Finally, recent studies suggest that the control mechanism that prevents re-replication in both systems also increases the synthesis of DNA building blocks.

  9. Gene identification in prokaryotic genomes, phages, metagenomes, and EST sequences with GeneMarkS suite.


    Borodovsky, Mark; Lomsadze, Alex


    This unit describes how to use several gene-finding programs from the GeneMark line developed for finding protein-coding ORFs in genomic DNA of prokaryotic species, in genomic DNA of eukaryotic species with intronless genes, in genomes of viruses and phages, and in prokaryotic metagenomic sequences, as well as in EST sequences with spliced-out introns. These bioinformatics tools were demonstrated to have state-of-the-art accuracy, and have been frequently used for gene annotation in novel nucleotide sequences. An additional advantage of these sequence-analysis tools is that the problem of algorithm parameterization is solved automatically, with parameters estimated by iterative self-training (unsupervised training). PMID:24510847

  10. Protist Community Grazing on Prokaryotic Prey in Deep Ocean Water Masses.


    Rocke, Emma; Pachiadaki, Maria G; Cobban, Alec; Kujawinski, Elizabeth B; Edgcomb, Virginia P


    Oceanic protist grazing at mesopelagic and bathypelagic depths, and their subsequent effects on trophic links between eukaryotes and prokaryotes, are not well constrained. Recent studies show evidence of higher than expected grazing activity by protists down to mesopelagic depths. This study provides the first exploration of protist grazing in the bathypelagic North Atlantic Deep Water (NADW). Grazing was measured throughout the water column at three stations in the South Atlantic using fluorescently-labeled prey analogues. Grazing in the deep Antarctic Intermediate water (AAIW) and NADW at all three stations removed 3.79% ± 1.72% to 31.14% ± 8.24% of the standing prokaryote stock. These results imply that protist grazing may be a significant source of labile organic carbon at certain meso- and bathypelagic depths.

  11. On the Origin of CRISPR-Cas Technology: From Prokaryotes to Mammals.


    Mojica, Francisco J M; Montoliu, Lluis


    Clustered regularly-interspaced short palindromic repeat (CRISPR) sequences cooperate with CRISPR-associated (Cas) proteins to form the basis of CRISPR-Cas adaptive immune systems in prokaryotes. For more than 20 years, these systems were of interest only to specialists, mainly molecular microbiologists, who tried to understand the properties of this unique defense mechanism. In 2012, the potential of CRISPR-Cas systems was uncovered and these were presented as genome-editing tools with an outstanding capacity to trigger targeted genetic modifications that can be applied to virtually any organism. Shortly thereafter, in early 2013, these tools were shown to efficiently drive specific modification of mammalian genomes. This review attempts to summarize, in a comprehensive manner, the key events and milestones that brought CRISPR-Cas technology from prokaryotes to mammals.

  12. Composition strand asymmetries in prokaryotic genomes: mutational bias and biased gene orientation.


    Lopez, P; Philippe, H


    Most prokaryotic genomes display strand compositional asymmetries, but the reasons for these biases remain unclear. When the distribution of gene orientation is biased, as it often is, this may induce a bias in composition, as codon frequencies are not identical. We show here that this effect can be estimated and removed, and that the residual base skews are the highest at third base codon positions and lower at first and second positions. This strongly suggests that compositional asymmetries result from 1) a replication-related mutational bias that is filtered through selective pressure and/or from 2) an uneven distribution of gene orientation. In most cases, the mutational bias alters the codon usage and amino acid frequencies of the leading and the lagging strand. However, these features are not ubiquitous amongst prokaryotes, and the biological reasons for them remain to be found.

  13. Survival and Evolution of CRISPR–Cas System in Prokaryotes and Its Applications

    PubMed Central

    Shabbir, Muhammad Abu Bakr; Hao, Haihong; Shabbir, Muhammad Zubair; Hussain, Hafiz Iftikhar; Iqbal, Zahid; Ahmed, Saeed; Sattar, Adeel; Iqbal, Mujahid; Li, Jun; Yuan, Zonghui


    Prokaryotes have developed numerous innate immune mechanisms in order to fend off bacteriophage or plasmid attack. One of these immune systems is clustered regularly interspaced short palindromic repeats (CRISPR). CRISPR-associated proteins play a key role in survival of prokaryotes against invaders, as these systems cleave DNA of foreign genetic elements. Beyond providing immunity, these systems have significant impact in altering the bacterial physiology in term of its virulence and pathogenicity, as well as evolution. Also, due to their diverse nature of functionality, cas9 endoribonuclease can be easily reprogrammed with the help of guide RNAs, showing unprecedented potential and significance for gene editing in treating genetic diseases. Here, we also discuss the use of NgAgo–gDNA system in genome editing of human cells. PMID:27725818

  14. "Depupylation" of Prokaryotic Ubiquitin-like Protein from Mycobacterial Proteasome Substrates

    SciTech Connect

    Burns, K.E.; Li, H.; Cerda-Maira, F. A.; Wang, T.; Bishai, W. R.; Darwin, K. H.


    Ubiquitin (Ub) provides the recognition and specificity required to deliver proteins to the eukaryotic proteasome for destruction. Prokaryotic ubiquitin-like protein (Pup) is functionally analogous to Ub in Mycobacterium tuberculosis (Mtb), as it dooms proteins to the Mtb proteasome. Studies suggest that Pup and Ub do not share similar mechanisms of activation and conjugation to target proteins. Dop (deamidase of Pup; Mtb Rv2112c/MT2172) deamidates the C-terminal glutamine of Pup to glutamate, preparing it for ligation to target proteins by proteasome accessory factor A (PafA). While studies have shed light on the conjugation of Pup to proteins, it was not known if Pup could be removed from substrates in a manner analogous to the deconjugation of Ub from eukaryotic proteins. Here, we show that Mycobacteria have a depupylase activity provided by Dop. The discovery of a depupylase strengthens the parallels between the Pup- and Ub-tagging systems of prokaryotes and eukaryotes, respectively.

  15. The prokaryotic zinc-finger: structure, function and comparison with the eukaryotic counterpart.


    Malgieri, Gaetano; Palmieri, Maddalena; Russo, Luigi; Fattorusso, Roberto; Pedone, Paolo V; Isernia, Carla


    Classical zinc finger (ZF) domains were thought to be confined to the eukaryotic kingdom until the transcriptional regulator Ros protein was identified in Agrobacterium tumefaciens. The Ros Cys2 His2 ZF binds DNA in a peculiar mode and folds in a domain significantly larger than its eukaryotic counterpart consisting of 58 amino acids (the 9-66 region) arranged in a βββαα topology, and stabilized by a conserved, extensive, 15-residue hydrophobic core. The prokaryotic ZF domain, then, shows some intriguing new features that make it interestingly different from its eukaryotic counterpart. This review will focus on the prokaryotic ZFs, summarizing and discussing differences and analogies with the eukaryotic domains and providing important insights into their structure/function relationships.

  16. Protist Community Grazing on Prokaryotic Prey in Deep Ocean Water Masses

    PubMed Central

    Cobban, Alec; Kujawinski, Elizabeth B.; Edgcomb, Virginia P.


    Oceanic protist grazing at mesopelagic and bathypelagic depths, and their subsequent effects on trophic links between eukaryotes and prokaryotes, are not well constrained. Recent studies show evidence of higher than expected grazing activity by protists down to mesopelagic depths. This study provides the first exploration of protist grazing in the bathypelagic North Atlantic Deep Water (NADW). Grazing was measured throughout the water column at three stations in the South Atlantic using fluorescently-labeled prey analogues. Grazing in the deep Antarctic Intermediate water (AAIW) and NADW at all three stations removed 3.79% ± 1.72% to 31.14% ± 8.24% of the standing prokaryote stock. These results imply that protist grazing may be a significant source of labile organic carbon at certain meso- and bathypelagic depths. PMID:25894547

  17. Comparative analyses of fundamental differences in membrane transport capabilities in prokaryotes and eukaryotes.


    Ren, Qinghu; Paulsen, Ian T


    Whole-genome transporter analyses have been conducted on 141 organisms whose complete genome sequences are available. For each organism, the complete set of membrane transport systems was identified with predicted functions, and classified into protein families based on the transporter classification system. Organisms with larger genome sizes generally possessed a relatively greater number of transport systems. In prokaryotes and unicellular eukaryotes, the significant factor in the increase in transporter content with genome size was a greater diversity of transporter types. In contrast, in multicellular eukaryotes, greater number of paralogs in specific transporter families was the more important factor in the increase in transporter content with genome size. Both eukaryotic and prokaryotic intracellular pathogens and endosymbionts exhibited markedly limited transport capabilities. Hierarchical clustering of phylogenetic profiles of transporter families, derived from the presence or absence of a certain transporter family, showed that clustering patterns of organisms were correlated to both their evolutionary history and their overall physiology and lifestyles. PMID:16118665

  18. Exceptionally widespread nanomachines composed of type IV pilins: the prokaryotic Swiss Army knives.


    Berry, Jamie-Lee; Pelicic, Vladimir


    Prokaryotes have engineered sophisticated surface nanomachines that have allowed them to colonize Earth and thrive even in extreme environments. Filamentous machineries composed of type IV pilins, which are associated with an amazing array of properties ranging from motility to electric conductance, are arguably the most widespread since distinctive proteins dedicated to their biogenesis are found in most known species of prokaryotes. Several decades of investigations, starting with type IV pili and then a variety of related systems both in bacteria and archaea, have outlined common molecular and structural bases for these nanomachines. Using type IV pili as a paradigm, we will highlight in this review common aspects and key biological differences of this group of filamentous structures.

  19. Exceptionally widespread nanomachines composed of type IV pilins: the prokaryotic Swiss Army knives

    PubMed Central

    Berry, Jamie-Lee; Pelicic, Vladimir


    Prokaryotes have engineered sophisticated surface nanomachines that have allowed them to colonize Earth and thrive even in extreme environments. Filamentous machineries composed of type IV pilins, which are associated with an amazing array of properties ranging from motility to electric conductance, are arguably the most widespread since distinctive proteins dedicated to their biogenesis are found in most known species of prokaryotes. Several decades of investigations, starting with type IV pili and then a variety of related systems both in bacteria and archaea, have outlined common molecular and structural bases for these nanomachines. Using type IV pili as a paradigm, we will highlight in this review common aspects and key biological differences of this group of filamentous structures. PMID:25793961

  20. Symbioses of flagellates and prokaryotes in the gut of lower termites.


    Ohkuma, Moriya


    The microbial community in the gut of phylogenetically lower termites, comprising both flagellated protists and prokaryotes, has fascinated many scientists because of the symbiotic relationships that are responsible for the efficient degradation of lignocellulose. However, the complex nature of this microbial community and the formidable unculturability of most members have hampered detailed microbial studies. Comprehensive phylogenetic descriptions of the community members in the past decade still provide little information about their functions because the community contains diverse novel microbial species. Recent advances in molecular approaches have shed new light on species-specific spatial distributions, particularly the cellular associations of flagellated protists and prokaryotes, their functional interactions and coevolutionary relationships. These advances have gradually unveiled how this symbiotic complex functions to efficiently utilize lignocellulose.

  1. Protist Community Grazing on Prokaryotic Prey in Deep Ocean Water Masses.


    Rocke, Emma; Pachiadaki, Maria G; Cobban, Alec; Kujawinski, Elizabeth B; Edgcomb, Virginia P


    Oceanic protist grazing at mesopelagic and bathypelagic depths, and their subsequent effects on trophic links between eukaryotes and prokaryotes, are not well constrained. Recent studies show evidence of higher than expected grazing activity by protists down to mesopelagic depths. This study provides the first exploration of protist grazing in the bathypelagic North Atlantic Deep Water (NADW). Grazing was measured throughout the water column at three stations in the South Atlantic using fluorescently-labeled prey analogues. Grazing in the deep Antarctic Intermediate water (AAIW) and NADW at all three stations removed 3.79% ± 1.72% to 31.14% ± 8.24% of the standing prokaryote stock. These results imply that protist grazing may be a significant source of labile organic carbon at certain meso- and bathypelagic depths. PMID:25894547

  2. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.


    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette


    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  3. GenePRIMP: A GENE PRediction IMprovement Pipeline for Prokaryotic genomes

    SciTech Connect

    Pati, Amrita; Ivanova, Natalia N.; Mikhailova, Natalia; Ovchinnikova, Galina; Hooper, Sean D.; Lykidis, Athanasios; Kyrpides, Nikos C.


    We present 'gene prediction improvement pipeline' (GenePRIMP;, a computational process that performs evidence-based evaluation of gene models in prokaryotic genomes and reports anomalies including inconsistent start sites, missed genes and split genes. We found that manual curation of gene models using the anomaly reports generated by GenePRIMP improved their quality, and demonstrate the applicability of GenePRIMP in improving finishing quality and comparing different genome-sequencing and annotation technologies.

  4. Protein structure, electron transfer and evolution of prokaryotic photosynthetic reaction centers

    NASA Technical Reports Server (NTRS)

    Blankenship, R. E.


    Photosynthetic reaction centers from a variety of organisms have been isolated and characterized. The groups of prokaryotic photosynthetic organisms include the purple bacteria, the filamentous green bacteria, the green sulfur bacteria and the heliobacteria as anoxygenic representatives as well as the cyanobacteria and prochlorophytes as oxygenic representatives. This review focuses on structural and functional comparisons of the various groups of photosynthetic reaction centers and considers possible evolutionary scenarios to explain the diversity of existing photosynthetic organisms.

  5. Biodiversity of Prokaryotic Communities Associated with the Ectoderm of Ectopleura crocea (Cnidaria, Hydrozoa)

    PubMed Central

    Di Camillo, Cristina Gioia; Luna, Gian Marco; Bo, Marzia; Giordano, Giuseppe; Corinaldesi, Cinzia; Bavestrello, Giorgio


    The surface of many marine organisms is colonized by complex communities of microbes, yet our understanding of the diversity and role of host-associated microbes is still limited. We investigated the association between Ectopleura crocea (a colonial hydroid distributed worldwide in temperate waters) and prokaryotic assemblages colonizing the hydranth surface. We used, for the first time on a marine hydroid, a combination of electron and epifluorescence microscopy and 16S rDNA tag pyrosequencing to investigate the associated prokaryotic diversity. Dense assemblages of prokaryotes were associated with the hydrant surface. Two microbial morphotypes were observed: one horseshoe-shaped and one fusiform, worm-like. These prokaryotes were observed on the hydrozoan epidermis, but not in the portions covered by the perisarcal exoskeleton, and their abundance was higher in March while decreased in late spring. Molecular analyses showed that assemblages were dominated by Bacteria rather than Archaea. Bacterial assemblages were highly diversified, with up to 113 genera and 570 Operational Taxonomic Units (OTUs), many of which were rare and contributed to <0.4%. The two most abundant OTUs, likely corresponding to the two morphotypes present on the epidermis, were distantly related to Comamonadaceae (genus Delftia) and to Flavobacteriaceae (genus Polaribacter). Epibiontic bacteria were found on E. crocea from different geographic areas but not in other hydroid species in the same areas, suggesting that the host-microbe association is species-specific. This is the first detailed report of bacteria living on the hydrozoan epidermis, and indeed the first study reporting bacteria associated with the epithelium of E. crocea. Our results provide a starting point for future studies aiming at clarifying the role of this peculiar hydrozoan-bacterial association. PMID:22768172

  6. High-density sampling differential display of prokaryotic mRNAs with RAP-PCR.


    Walters, Dana M; Rouvière, Pierre E


    A high-throughput approach to prokaryotic differential display has been developed. A large number of reverse transcription polymerase chain reactions (RT-PCR) are performed on total RNA isolated from induced and control bacterial cultures. Each RT-PCR reaction uses a single oligonucleotide primer and constitutes an independent sampling of the mRNA population. The large number of reactions performed allows the repeated sampling of the targeted polycistronic mRNA, which is clearly identified among possible false positives.

  7. SIS: a program to generate draft genome sequence scaffolds for prokaryotes

    PubMed Central


    Background Decreasing costs of DNA sequencing have made prokaryotic draft genome sequences increasingly common. A contig scaffold is an ordering of contigs in the correct orientation. A scaffold can help genome comparisons and guide gap closure efforts. One popular technique for obtaining contig scaffolds is to map contigs onto a reference genome. However, rearrangements that may exist between the query and reference genomes may result in incorrect scaffolds, if these rearrangements are not taken into account. Large-scale inversions are common rearrangement events in prokaryotic genomes. Even in draft genomes it is possible to detect the presence of inversions given sufficient sequencing coverage and a sufficiently close reference genome. Results We present a linear-time algorithm that can generate a set of contig scaffolds for a draft genome sequence represented in contigs given a reference genome. The algorithm is aimed at prokaryotic genomes and relies on the presence of matching sequence patterns between the query and reference genomes that can be interpreted as the result of large-scale inversions; we call these patterns inversion signatures. Our algorithm is capable of correctly generating a scaffold if at least one member of every inversion signature pair is present in contigs and no inversion signatures have been overwritten in evolution. The algorithm is also capable of generating scaffolds in the presence of any kind of inversion, even though in this general case there is no guarantee that all scaffolds in the scaffold set will be correct. We compare the performance of sis, the program that implements the algorithm, to seven other scaffold-generating programs. The results of our tests show that sis has overall better performance. Conclusions sis is a new easy-to-use tool to generate contig scaffolds, available both as stand-alone and as a web server. The good performance of sis in our tests adds evidence that large-scale inversions are widespread in

  8. Towards understanding the molecular recognition process in prokaryotic zinc-finger domain.


    Russo, Luigi; Palmieri, Maddalena; Caso, Jolanda Valentina; D'Abrosca, Gianluca; Diana, Donatella; Malgieri, Gaetano; Baglivo, Ilaria; Isernia, Carla; Pedone, Paolo V; Fattorusso, Roberto


    Eukaryotic Cys2His2 zinc finger domain is one of the most common and important structural motifs involved in protein-DNA interaction. The recognition motif is characterized by the tetrahedral coordination of a zinc ion by conserved cysteine and histidine residues. We have characterized the prokaryotic Cys2His2 zinc finger motif, included in the DNA binding region (Ros87) of Ros protein from Agrobacterium tumefaciens, demonstrating that, although possessing a similar zinc coordination sphere, this domain presents significant differences from its eukaryotic counterpart. Furthermore, basic residues flanking the zinc binding region on either side have been demonstrated, by Electrophoretic Mobility Shift Assay (EMSA) experiments, to be essential for Ros DNA binding. In spite of this wealth of knowledge, the structural details of the mechanism through which the prokaryotic zinc fingers recognize their target genes are still unclear. Here, to gain insights into the molecular DNA recognition process of prokaryotic zinc finger domains we applied a strategy in which we performed molecular docking studies using a combination of Nuclear Magnetic Resonance (NMR) and Molecular Dynamics (MD) simulations data. The results demonstrate that the MD ensemble provides a reasonable picture of Ros87 backbone dynamics in solution. The Ros87-DNA model indicates that the interaction involves the first two residue of the first α-helix, and several residues located in the basic regions flanking the zinc finger domain. Interestingly, the prokaryotic zinc finger domain, mainly with the C-terminal tail that is wrapped around the DNA, binds a more extended recognition site than the eukaryotic counterpart. Our analysis demonstrates that the introduction of the protein flexibility in docking studies can improve, in terms of accuracy, the quality of the obtained models and could be particularly useful for protein showing high conformational heterogeneity as well as for computational drug design

  9. Holotranscobalamins in B12 and non B12 requiring prokaryotes and eukaryotes.


    Baker, H; de Angelis, B; Khalil, M; Frank, O; Baker, E R


    Transcobalamins, vitamin B12 binding proteins, deliver B12 to cell surface receptors which then permit B12 to cross cell membranes for metabolic use. There is little documentation concerning B12 binding proteins in bacteria and protists. We found that prokaryotes and eukaryotes requiring B12, as well as those protists synthesizing B12, also produce several transcobalamins for functionally transporting B12 similar to humans.

  10. The prokaryotic enhancer binding protein NTRC has an ATPase activity which is phosphorylation and DNA dependent.

    PubMed Central

    Austin, S; Dixon, R


    The prokaryotic activator protein NTRC binds to enhancer-like elements and activates transcription in response to nitrogen limitation by catalysing open complex formation by sigma 54 RNA polymerase holoenzyme. Formation of open complexes requires the phosphorylated form of NTRC and the reaction is ATP dependent. We find that NTRC has an ATPase activity which is activated by phosphorylation and is strongly stimulated by the presence of DNA containing specific NTRC binding sites. Images PMID:1534752

  11. FtsZ and the division of prokaryotic cells and organelles.


    Margolin, William


    Binary fission of many prokaryotes as well as some eukaryotic organelles depends on the FtsZ protein, which self-assembles into a membrane-associated ring structure early in the division process. FtsZ is homologous to tubulin, the building block of the microtubule cytoskeleton in eukaryotes. Recent advances in genomics and cell-imaging techniques have paved the way for the remarkable progress in our understanding of fission in bacteria and organelles. PMID:16227976

  12. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying


    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  13. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.


    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A


    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  14. Diversity and Distribution of Prokaryotes within a Shallow-Water Pockmark Field.


    Giovannelli, Donato; d'Errico, Giuseppe; Fiorentino, Federica; Fattorini, Daniele; Regoli, Francesco; Angeletti, Lorenzo; Bakran-Petricioli, Tatjana; Vetriani, Costantino; Yücel, Mustafa; Taviani, Marco; Manini, Elena


    Pockmarks are crater-like depression on the seafloor associated with hydrocarbon ascent through muddy sediments in continental shelves around the world. In this study, we examine the diversity and distribution of benthic microbial communities at shallow-water pockmarks adjacent to the Middle Adriatic Ridge. We integrate microbial diversity data with characterization of local hydrocarbons concentrations and sediment geochemistry. Our results suggest these pockmarks are enriched in sedimentary hydrocarbons, and host a microbial community dominated by Bacteria, even in deeper sediment layers. Pockmark sediments showed higher prokaryotic abundance and biomass than surrounding sediments, potentially due to the increased availability of organic matter and higher concentrations of hydrocarbons linked to pockmark activity. Prokaryotic diversity analyses showed that the microbial communities of these shallow-water pockmarks are unique, and comprised phylotypes associated with the cycling of sulfur and nitrate compounds, as well as numerous know hydrocarbon degraders. Altogether, this study suggests that shallow-water pockmark habitats enhance the diversity of the benthic prokaryotic biosphere by providing specialized environmental niches. PMID:27379070

  15. Differential viability response of prokaryotes and eukaryotes to high strength pulsed magnetic stimuli.


    Boda, Sunil Kumar; Ravikumar, K; Saini, Deepak K; Basu, Bikramjit


    The present study examines the efficacy of a high strength pulsed magnetic field (PMF) towards bacterial inactivation in vitro, without compromising eukaryotic cell viability. The differential response of prokaryotes [Staphylococcus aureus (MRSA), Staphylococcus epidermidis, and Escherichia coli], and eukaryotes [C2C12 mouse myoblasts and human mesenchymal stem cells, hMSCs] upon exposure to varying PMF stimuli (1-4 T, 30 pulses, 40 ms pulse duration) is investigated. Among the prokaryotes, ~60% and ~70% reduction was recorded in the survival of staphylococcal species and E. coli, respectively at 4 T PMF as evaluated by colony forming unit (CFU) analysis and flow cytometry. A 2-5 fold increase in intracellular ROS (reactive oxygen species) levels suggests oxidative stress as the key mediator in PMF induced bacterial death/injury. The 4 T PMF treated staphylococci also exhibited longer doubling times. Both TEM and fluorescence microscopy revealed compromised membranes of PMF exposed bacteria. Under similar PMF exposure conditions, no immediate cytotoxicity was recorded in C2C12 mouse myoblasts and hMSCs, which can be attributed to the robust resistance towards oxidative stress. The ion interference of iron containing bacterial proteins is invoked to analytically explain the PMF induced ROS accumulation in prokaryotes. Overall, this study establishes the potential of PMF as a bactericidal method without affecting eukaryotic viability. This non-invasive stimulation protocol coupled with antimicrobial agents can be integrated as a potential methodology for the localized treatment of prosthetic infections.

  16. Single prokaryotic cell isolation and total transcript amplification protocol for transcriptomic analysis.


    Kang, Yun; McMillan, Ian; Norris, Michael H; Hoang, Tung T


    Until recently, transcriptome analyses of single cells have been confined to eukaryotes. The information obtained from single-cell transcripts can provide detailed insight into spatiotemporal gene expression, and it could be even more valuable if expanded to prokaryotic cells. Transcriptome analysis of single prokaryotic cells is a recently developed and powerful tool. Here we describe a procedure that allows amplification of the total transcript of a single prokaryotic cell for in-depth analysis. This is performed by using a laser-capture microdissection instrument for single-cell isolation, followed by reverse transcription via Moloney murine leukemia virus, degradation of chromosomal DNA with McrBC and DpnI restriction enzymes, single-stranded cDNA (ss-cDNA) ligation using T4 polynucleotide kinase and CircLigase, and polymerization of ss-cDNA to double-stranded cDNA (ds-cDNA) by Φ29 polymerase. This procedure takes ∼5 d, and sufficient amounts of ds-cDNA can be obtained from single-cell RNA template for further microarray analysis.

  17. De Novo Identification of Regulatory Regions in Intergenic Spaces of Prokaryotic Genomes

    SciTech Connect

    Chain, P; Garcia, E; Mcloughlin, K; Ovcharenko, I


    This project was begun to implement, test, and experimentally validate the results of a novel algorithm for genome-wide identification of candidate transcription-factor binding sites in prokaryotes. Most techniques used to identify regulatory regions rely on conservation between different genomes or have a predetermined sequence motif(s) to perform a genome-wide search. Therefore, such techniques cannot be used with new genome sequences, where information regarding such motifs has not yet been discovered. This project aimed to apply a de novo search algorithm to identify candidate binding-site motifs in intergenic regions of prokaryotic organisms, initially testing the available genomes of the Yersinia genus. We retrofitted existing nucleotide pattern-matching algorithms, analyzed the candidate sites identified by these algorithms as well as their target genes to screen for meaningful patterns. Using properly annotated prokaryotic genomes, this project aimed to develop a set of procedures to identify candidate intergenic sites important for gene regulation. We planned to demonstrate this in Yersinia pestis, a model biodefense, Category A Select Agent pathogen, and then follow up with experimental evidence that these regions are indeed involved in regulation. The ability to quickly characterize transcription-factor binding sites will help lead to a better understanding of how known virulence pathways are modulated in biodefense-related organisms, and will help our understanding and exploration of regulons--gene regulatory networks--and novel pathways for metabolic processes in environmental microbes.

  18. A Novel Method for Accurate Operon Predictions in All SequencedProkaryotes

    SciTech Connect

    Price, Morgan N.; Huang, Katherine H.; Alm, Eric J.; Arkin, Adam P.


    We combine comparative genomic measures and the distance separating adjacent genes to predict operons in 124 completely sequenced prokaryotic genomes. Our method automatically tailors itself to each genome using sequence information alone, and thus can be applied to any prokaryote. For Escherichia coli K12 and Bacillus subtilis, our method is 85 and 83% accurate, respectively, which is similar to the accuracy of methods that use the same features but are trained on experimentally characterized transcripts. In Halobacterium NRC-1 and in Helicobacterpylori, our method correctly infers that genes in operons are separated by shorter distances than they are in E.coli, and its predictions using distance alone are more accurate than distance-only predictions trained on a database of E.coli transcripts. We use microarray data from sixphylogenetically diverse prokaryotes to show that combining intergenic distance with comparative genomic measures further improves accuracy and that our method is broadly effective. Finally, we survey operon structure across 124 genomes, and find several surprises: H.pylori has many operons, contrary to previous reports; Bacillus anthracis has an unusual number of pseudogenes within conserved operons; and Synechocystis PCC6803 has many operons even though it has unusually wide spacings between conserved adjacent genes.

  19. Cellular Viscosity in Prokaryotes and Thermal Stability of Low Molecular Weight Biomolecules.


    Cuecas, Alba; Cruces, Jorge; Galisteo-López, Juan F; Peng, Xiaojun; Gonzalez, Juan M


    Some low molecular weight biomolecules, i.e., NAD(P)H, are unstable at high temperatures. The use of these biomolecules by thermophilic microorganisms has been scarcely analyzed. Herein, NADH stability has been studied at different temperatures and viscosities. NADH decay increased at increasing temperatures. At increasing viscosities, NADH decay rates decreased. Thus, maintaining relatively high cellular viscosity in cells could result in increased stability of low molecular weight biomolecules (i.e., NADH) at high temperatures, unlike what was previously deduced from studies in diluted water solutions. Cellular viscosity was determined using a fluorescent molecular rotor in various prokaryotes covering the range from 10 to 100°C. Some mesophiles showed the capability of changing cellular viscosity depending on growth temperature. Thermophiles and extreme thermophiles presented a relatively high cellular viscosity, suggesting this strategy as a reasonable mechanism to thrive under these high temperatures. Results substantiate the capability of thermophiles and extreme thermophiles (growth range 50-80°C) to stabilize and use generally considered unstable, universal low molecular weight biomolecules. In addition, this study represents a first report, to our knowledge, on cellular viscosity measurements in prokaryotes and it shows the dependency of prokaryotic cellular viscosity on species and growth temperature.

  20. Cellular Viscosity in Prokaryotes and Thermal Stability of Low Molecular Weight Biomolecules.


    Cuecas, Alba; Cruces, Jorge; Galisteo-López, Juan F; Peng, Xiaojun; Gonzalez, Juan M


    Some low molecular weight biomolecules, i.e., NAD(P)H, are unstable at high temperatures. The use of these biomolecules by thermophilic microorganisms has been scarcely analyzed. Herein, NADH stability has been studied at different temperatures and viscosities. NADH decay increased at increasing temperatures. At increasing viscosities, NADH decay rates decreased. Thus, maintaining relatively high cellular viscosity in cells could result in increased stability of low molecular weight biomolecules (i.e., NADH) at high temperatures, unlike what was previously deduced from studies in diluted water solutions. Cellular viscosity was determined using a fluorescent molecular rotor in various prokaryotes covering the range from 10 to 100°C. Some mesophiles showed the capability of changing cellular viscosity depending on growth temperature. Thermophiles and extreme thermophiles presented a relatively high cellular viscosity, suggesting this strategy as a reasonable mechanism to thrive under these high temperatures. Results substantiate the capability of thermophiles and extreme thermophiles (growth range 50-80°C) to stabilize and use generally considered unstable, universal low molecular weight biomolecules. In addition, this study represents a first report, to our knowledge, on cellular viscosity measurements in prokaryotes and it shows the dependency of prokaryotic cellular viscosity on species and growth temperature. PMID:27558730