Study of human salivary proline-rich proteins interaction with food tannins.

PubMed

Soares, Susana; García-Estévez, Ignacio; Ferrer-Galego, Raúl; Brás, Natércia F; Brandão, Elsa; Silva, Mafalda; Teixeira, Natércia; Fonseca, Fátima; Sousa, Sérgio F; Ferreira-da-Silva, Frederico; Mateus, Nuno; de Freitas, Victor

2018-03-15

In this work, saturation transfer difference-NMR, isothermal microcalorimetry and molecular dynamics simulations have been used to study the individual interactions between basic, glycosylated and acidic proline-rich proteins (bPRPS, gPRPs, aPRPs) and P-B peptide with some representative food tannins [procyanidin B2, procyanidin B2 3'-O-gallate (B2g) and procyanidin trimer (catechin-4-8-catechin-4-8-catechin)]. Results showed that P-B peptide was in general the salivary protein (SP) with higher affinity whereas aPRPs showed lower affinity to the studied procyanidins. Moreover, B2g was the procyanidin with higher affinity for all SP. Hydrophobic and hydrogen bonds were present in all interactions but the major driving force depended on the procyanidin-SP pair. Furthermore, proline clusters or residues in their vicinity were identified as the probable sites of proteins for interaction with procyanidins. For bPRP and aPRP a significant change to less extended conformations was observed, while P-B peptide did not display any structural rearrangement upon procyanidins binding. Copyright © 2017. Published by Elsevier Ltd.

The Tomato Hybrid Proline-Rich Protein regulates the abcission zone competence to respond to ethylene signals

USDA-ARS?s Scientific Manuscript database

The Tomato Hybrid Proline-Rich Protein (THyPRP) gene was specifically expressed in the tomato (Solanum lycopersicum) flower abscission zone (FAZ), and its stable antisense silencing under the control of an abscission zone (AZ)-specific promoter, Tomato Abscission Polygalacturonase4,significantly inh...

Proline: The Distribution, Frequency, Positioning, and Common Functional Roles of Proline and Polyproline Sequences in the Human Proteome

PubMed Central

Morgan, Alexander A.; Rubenstein, Edward

2013-01-01

Proline is an anomalous amino acid. Its nitrogen atom is covalently locked within a ring, thus it is the only proteinogenic amino acid with a constrained phi angle. Sequences of three consecutive prolines can fold into polyproline helices, structures that join alpha helices and beta pleats as architectural motifs in protein configuration. Triproline helices are participants in protein-protein signaling interactions. Longer spans of repeat prolines also occur, containing as many as 27 consecutive proline residues. Little is known about the frequency, positioning, and functional significance of these proline sequences. Therefore we have undertaken a systematic bioinformatics study of proline residues in proteins. We analyzed the distribution and frequency of 687,434 proline residues among 18,666 human proteins, identifying single residues, dimers, trimers, and longer repeats. Proline accounts for 6.3% of the 10,882,808 protein amino acids. Of all proline residues, 4.4% are in trimers or longer spans. We detected patterns that influence function based on proline location, spacing, and concentration. We propose a classification based on proline-rich, polyproline-rich, and proline-poor status. Whereas singlet proline residues are often found in proteins that display recurring architectural patterns, trimers or longer proline sequences tend be associated with the absence of repetitive structural motifs. Spans of 6 or more are associated with DNA/RNA processing, actin, and developmental processes. We also suggest a role for proline in Kruppel-type zinc finger protein control of DNA expression, and in the nucleation and translocation of actin by the formin complex. PMID:23372670

The heptad repeats region is essential for AcMNPV P10 filament formation and not the proline-rich or the C-terminus basic regions.

PubMed

Dong, Chunsheng; Deng, Fei; Li, Dan; Wang, Hualin; Hu, Zhihong

2007-09-01

Baculovirus P10 protein is a small conserved protein and is expressed as bundles of filaments in the host cell during the late phase of virus infection. So far the published results on the domain responsible for filament structural formation have been contradictory. Electron microscopy revealed that the C-terminus basic region was involved in filament structural formation in the Autographa californica multiple nucleocapsid nucleopolyhedrovirus (AcMNPV) [van Oers, M.M., Flipsen, J.T., Reusken, C.B., Sliwinsky, E.L., Vlak, J.M., 1993. Functional domains of the p10 protein of Autographa californica nuclear polyhedorsis virus. J. Gen. Virol. 74, 563-574.]. While in the Helicoverpa armigera nucleopolyhedrovirus (HearNPV), the heptad repeats region but not the C-terminus domain was proven to be responsible for filament formation [Dong, C., Li, D., Long, G., Deng, F., Wang, H., Hu, Z., 2005. Identification of functional domains required for HearNPV P10 filament formation. Virology 338, 112-120.]. In this manuscript, fluorescence confocal microscopy was applied to study AcMNPV P10 filament formation. A set of plasmids containing different P10 structural domains fused with a fluorescent protein were constructed and transfected into Sf-9 cells. The data indicated that the heptad repeats region, but not the proline-rich region or the C-terminus basic region, is essential for AcMNPV P10 filament formation. Co-transfection of P10s tagged with different fluorescent revealed that P10s with defective heptad repeats region could not interact with intact heptad repeats region or even full-length P10s to form filament structure. Within the heptad repeats region, deletion of the three amino acids spacing of AcMNPV P10 appeared to have no significant impact on the formation of filament structures, but the content of the heptad repeats region appeared to play a role in the morphology of the filaments.

Cell wall-associated ROOT HAIR SPECIFIC 10, a proline-rich receptor-like kinase, is a negative modulator of Arabidopsis root hair growth

PubMed Central

Hwang, Youra; Lee, Hyodong; Lee, Young-Sook; Cho, Hyung-Taeg

2016-01-01

Plant cell growth is restricted by the cell wall, and cell wall dynamics act as signals for the cytoplasmic and nuclear events of cell growth. Among various receptor kinases, ROOT HAIR SPECIFIC 10 (RHS10) belongs to a poorly known receptor kinase subfamily with a proline-rich extracellular domain. Here, we report that RHS10 defines the root hair length of Arabidopsis thaliana by negatively regulating hair growth. RHS10 modulates the duration of root hair growth rather than the growth rate. As poplar and rice RHS10 orthologs also showed a root hair-inhibitory function, this receptor kinase-mediated function appears to be conserved in angiosperms. RHS10 showed a strong association with the cell wall, most probably through its extracellular proline-rich domain (ECD). Deletion analysis of the ECD demonstrated that a minimal extracellular part, which includes a few proline residues, is required for RHS10-mediated root hair inhibition. RHS10 suppressed the accumulation of reactive oxygen species (ROS) in the root, which are necessary for root hair growth. A yeast two-hybrid screening identified an RNase (RNS2) as a putative downstream target of RHS10. Accordingly, RHS10 overexpression decreased and RHS10 loss increased RNA levels in the hair-growing root region. Our results suggest that RHS10 mediates cell wall-associated signals to maintain proper root hair length, at least in part by regulating RNA catabolism and ROS accumulation. PMID:26884603

A Novel Topology of Proline-rich Transmembrane Protein 2 (PRRT2)

PubMed Central

Rossi, Pia; Sterlini, Bruno; Castroflorio, Enrico; Marte, Antonella; Onofri, Franco; Valtorta, Flavia; Maragliano, Luca; Corradi, Anna; Benfenati, Fabio

2016-01-01

Proline-rich transmembrane protein 2 (PRRT2) has been identified as the single causative gene for a group of paroxysmal syndromes of infancy, including epilepsy, paroxysmal movement disorders, and migraine. On the basis of topology predictions, PRRT2 has been assigned to the recently characterized family of Dispanins, whose members share the two-transmembrane domain topology with a large N terminus and short C terminus oriented toward the outside of the cell. Because PRRT2 plays a role at the synapse, it is important to confirm the exact orientation of its N and C termini with respect to the plasma membrane to get clues regarding its possible function. Using a combination of different experimental approaches, including live immunolabeling, immunogold electron microscopy, surface biotinylation and computational modeling, we demonstrate a novel topology for this protein. PRRT2 is a type II transmembrane protein in which only the second hydrophobic segment spans the plasma membrane, whereas the first one is associated with the internal surface of the membrane and forms a helix-loop-helix structure without crossing it. Most importantly, the large proline-rich N-terminal domain is not exposed to the extracellular space but is localized intracellularly, and only the short C terminus is extracellular (Ncyt/Cexo topology). Accordingly, we show that PRRT2 interacts with the Src homology 3 domain-bearing protein Intersectin 1, an intracellular protein involved in synaptic vesicle cycling. These findings will contribute to the clarification of the role of PRRT2 at the synapse and the understanding of pathogenic mechanisms on the basis of PRRT2-related neurological disorders. PMID:26797119

Elevated immunoglobulin G antibodies to the proline-rich amino-terminal region of Epstein-Barr virus nuclear antigen-2 in sera from patients with systemic connective tissue diseases and from a subgroup of Sjögren's syndrome patients with pulmonary involvements.

PubMed

Yamazaki, M; Kitamura, R; Kusano, S; Eda, H; Sato, S; Okawa-Takatsuji, M; Aotsuka, S; Yanagi, K

2005-03-01

Associations of Epstein-Barr virus (EBV) and autoimmune diseases have been hypothesized. We have analysed IgG antibodies to EBV nuclear antigen (EBNA)-2 in sera from Japanese patients with autoimmune systemic connective tissue diseases (CTD), exemplified by systemic lupus erythematosus (SLE), primary Sjogren's syndrome (SS), rheumatoid arthritis (RA), systemic sclerosis (SSc) and secondary SS (classical CTDs complicated with SS). An enzyme-linked immunosorbent assay (ELISA) which uses glutathione-S-transferase polypeptides fused to EBV nuclear antigen (EBNA)-2 and EBNA-1 was developed. Ratios of IgG antibody reactivity to whole IgG concentrations of sera were calculated to normalize EBNA-2 and EBNA-1 antibody levels to the hypergammaglobulinaemia that occurs in CTD. The ELISA optical density OD(450) readings of IgG antibodies to both the amino-terminal aa 1-116 of EBNA-2 and carboxyl-terminal aa 451-641 of EBNA-1 were elevated significantly in patients with SLE, primary SS, RA, SSc and secondary SS when compared to EBNA-1. The OD readings were divided by serum IgG concentrations to normalize for the hypergammaglobulinaemia. The specific levels of IgG antibodies to the amino-terminal region of EBNA-2 were elevated in patients with SLE, primary SS or RA, as well as those with secondary SS complicated with SLE or RA. The EBNA-2 amino-terminal region contains a polyproline tract and a proline-rich sequence and has considerable amino acid sequence homology with many cellular proline-rich proteins. High ratios of EBNA-2 aa 1-116 to EBNA-1 aa 451-641 IgG antibody levels which probably suggest reactivation of EBV latent infection were associated significantly with pulmonary involvement in SS patients. These results are consistent with the hypothesis that the sequence similarity between the amino-terminal region of EBNA-2 and proline-rich cellular proteins is associated with pathogenesis in a subpopulation of CTD patients, possibly by the molecular mimicry-epitope shift

Isolation of a new class of cysteine-glycine-proline-rich beta-proteins (beta-keratins) and their expression in snake epidermis.

PubMed

Dalla Valle, Luisa; Nardi, Alessia; Alibardi, Lorenzo

2010-03-01

Scales of snakes contain hard proteins (beta-keratins), now referred to as keratin-associated beta-proteins. In the present study we report the isolation, sequencing, and expression of a new group of these proteins from snake epidermis, designated cysteine-glycine-proline-rich proteins. One deduced protein from expressed mRNAs contains 128 amino acids (12.5 kDa) with a theoretical pI at 7.95, containing 10.2% cysteine and 15.6% glycine. The sequences of two more snake cysteine-proline-rich proteins have been identified from genomic DNA. In situ hybridization shows that the messengers for these proteins are present in the suprabasal and early differentiating beta-cells of the renewing scale epidermis. The present study shows that snake scales, as previously seen in scales of lizards, contain cysteine-rich beta-proteins in addition to glycine-rich beta-proteins. These keratin-associated beta-proteins mix with intermediate filament keratins (alpha-keratins) to produce the resistant corneous layer of snake scales. The specific proportion of these two subfamilies of proteins in different scales can determine various degrees of hardness in scales.

Proline puckering parameters for collagen structure simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Di, E-mail: diwu@fudan.edu.cn

Collagen is made of triple helices rich in proline residues, and hence is influenced by the conformational motions of prolines. Because the backbone motions of prolines are restricted by the helical structures, the only side chain motion—proline puckering—becomes an influential factor that may affect the stability of collagen structures. In molecular simulations, a proper proline puckering population is desired so to yield valid results of the collagen properties. Here we design the proline puckering parameters in order to yield suitable proline puckering populations as demonstrated in the experimental results. We test these parameters in collagen and the proline dipeptide simulations.more » Compared with the results of the PDB and the quantum calculations, we propose the proline puckering parameters for the selected collagen model simulations.« less

Proline-Rich Peptide Mimics Effects of Enamel Matrix Derivative on Rat Oral Mucosa Incisional Wound Healing.

PubMed

Villa, Oscar; Wohlfahrt, Johan C; Mdla, Ibrahimu; Petzold, Christiane; Reseland, Janne E; Snead, Malcolm L; Lyngstadaas, Staale P

2015-12-01

Proline-rich peptides have been shown to promote periodontal regeneration. However, their effect on soft tissue wound healing has not yet been investigated. The aim of this study is to evaluate the effect of enamel matrix derivative (EMD), tyrosine-rich amelogenin peptide (TRAP), and a synthetic proline-rich peptide (P2) on acute wound healing after a full-thickness flap procedure in an incisional rat model. This experimental study has a split-mouth, randomized, placebo-controlled design. Test and control wounds were created on the palatal mucosa of 54 Sprague-Dawley rats. Wounds were histologically processed, and reepithelialization, leukocyte infiltration, and angiogenesis were assessed at days 1, 3, and 7 post-surgery. EMD and P2 significantly promoted early wound closure at day 1 (P <0.001 and P = 0.004, respectively). EMD maintained a significant acceleration of reepithelialization at day 3 (P = 0.004). Wounds treated by EMD and P2 showed increased angiogenesis during the first 3 days of healing (P = 0.03 and 0.001, respectively). Leukocyte infiltration was decreased in EMD-treated wounds at day 1 (P = 0.03), and P2 and TRAP induced a similar effect at days 3 (P = 0.002 and P <0.0001, respectively) and 7 (P = 0.005 and P <0.001). EMD and P2 promoted reepithelialization and neovascularization in full-thickness surgical wounds on rat oral mucosa.

Isolation of a new class of cysteine–glycine–proline-rich beta-proteins (beta-keratins) and their expression in snake epidermis

PubMed Central

Dalla Valle, Luisa; Nardi, Alessia; Alibardi, Lorenzo

2010-01-01

Scales of snakes contain hard proteins (beta-keratins), now referred to as keratin-associated beta-proteins. In the present study we report the isolation, sequencing, and expression of a new group of these proteins from snake epidermis, designated cysteine–glycine–proline-rich proteins. One deduced protein from expressed mRNAs contains 128 amino acids (12.5 kDa) with a theoretical pI at 7.95, containing 10.2% cysteine and 15.6% glycine. The sequences of two more snake cysteine–proline-rich proteins have been identified from genomic DNA. In situ hybridization shows that the messengers for these proteins are present in the suprabasal and early differentiating beta-cells of the renewing scale epidermis. The present study shows that snake scales, as previously seen in scales of lizards, contain cysteine-rich beta-proteins in addition to glycine-rich beta-proteins. These keratin-associated beta-proteins mix with intermediate filament keratins (alpha-keratins) to produce the resistant corneous layer of snake scales. The specific proportion of these two subfamilies of proteins in different scales can determine various degrees of hardness in scales. PMID:20070430

Structure of the dimeric exonuclease TREX1 in complex with DNA displays a proline-rich binding site for WW Domains.

PubMed

Brucet, Marina; Querol-Audí, Jordi; Serra, Maria; Ramirez-Espain, Ximena; Bertlik, Kamila; Ruiz, Lidia; Lloberas, Jorge; Macias, Maria J; Fita, Ignacio; Celada, Antonio

2007-05-11

TREX1 is the most abundant mammalian 3' --> 5' DNA exonuclease. It has been described to form part of the SET complex and is responsible for the Aicardi-Goutières syndrome in humans. Here we show that the exonuclease activity is correlated to the binding preferences toward certain DNA sequences. In particular, we have found three motifs that are selected, GAG, ACA, and CTGC. To elucidate how the discrimination occurs, we determined the crystal structures of two murine TREX1 complexes, with a nucleotide product of the exonuclease reaction, and with a single-stranded DNA substrate. Using confocal microscopy, we observed TREX1 both in nuclear and cytoplasmic subcellular compartments. Remarkably, the presence of TREX1 in the nucleus requires the loss of a C-terminal segment, which we named leucine-rich repeat 3. Furthermore, we detected the presence of a conserved proline-rich region on the surface of TREX1. This observation points to interactions with proline-binding domains. The potential interacting motif "PPPVPRPP" does not contain aromatic residues and thus resembles other sequences that select SH3 and/or Group 2 WW domains. By means of nuclear magnetic resonance titration experiments, we show that, indeed, a polyproline peptide derived from the murine TREX1 sequence interacted with the WW2 domain of the elongation transcription factor CA150. Co-immunoprecipitation studies confirmed this interaction with the full-length TREX1 protein, thereby suggesting that TREX1 participates in more functional complexes than previously thought.

Production and characterization of two major Aspergillus oryzae secreted prolyl endopeptidases able to efficiently digest proline-rich peptides of gliadin.

PubMed

Eugster, Philippe J; Salamin, Karine; Grouzmann, Eric; Monod, Michel

2015-12-01

Prolyl endopeptidases are key enzymes in the digestion of proline-rich proteins. Fungal extracts rich in prolyl endopeptidases produced by a species such as Aspergillus oryzae used in food fermentation would be of particular interest for the development of an oral enzyme therapy product in patients affected by intolerance to gluten. Two major A. oryzae secreted prolyl endopeptidases of the MEROPS S28 peptidase family, AoS28A and AoS28B, were identified when this fungus was grown at acidic pH in a medium containing soy meal protein or wheat gliadin as the sole source of nitrogen. AoS28B was produced by 12 reference A. oryzae strains used in food fermentation. AoS28A was secreted by six of these 12 strains. This protease is the orthologue of the previously characterized Aspergillus fumigatus (AfuS28) and Aspergillus niger (AN-PEP) prolyl endopeptidases which are encoded by genes with a similar intron-exon structure. Large amounts of secreted AoS28A and AoS28B were obtained by gene overexpression in A. oryzae. AoS28A and AoS28B are endoproteases able to cleave N-terminally blocked proline substrates. Both enzymes very efficiently digested the proline-rich 33-mer of gliadin, the most representative immunotoxic peptide deriving from gliadin, with some differences in terms of specificity and optimal pH. Digestion of the gliadin peptide in short peptides with both enzymes was found to occur from its N terminus.

Antimicrobial proline-rich peptides from the hemolymph of marine snail Rapana venosa.

PubMed

Dolashka, Pavlina; Moshtanska, Vesela; Borisova, Valika; Dolashki, Aleksander; Stevanovic, Stefan; Dimanov, Tzvetan; Voelter, Wolfgang

2011-07-01

Hemolymph of Rapana venosa snails is a complex mixture of biochemically and pharmacologically active components such as peptides and proteins. Antimicrobial peptides are gaining attention as antimicrobial alternatives to chemical food preservatives and commonly used antibiotics. Therefore, for the first time we have explored the isolation, identification and characterisation of 11 novel antimicrobial peptides produced by the hemolymph of molluscs. The isolated peptides from the hemolymph applying ultrafiltration and reverse-phase high-performance liquid chromatography (RP-HPLC) have molecular weights between 3000 and 9500 Da, determined by mass spectrometric analysis. The N-terminal sequences of the peptides identified by Edman degradation matched no peptides in the MASCOT search database, indicating novel proline-rich peptides. UV spectra revealed that these substances possessed the characteristics of protein peptides with acidic isoelectric points. However, no Cotton effects were observed between 190 and 280 nm by circular dichroism spectroscopy. Four of the pro-rich peptides also showed strong antimicrobial activities against tested microorganisms including Gram-positive and Gram-negative bacteria. Copyright © 2011 Elsevier Inc. All rights reserved.

GSK3β phosphorylates newly identified site in the proline-alanine-rich region of cardiac myosin-binding protein C and alters cross-bridge cycling kinetics in human: short communication.

PubMed

Kuster, Diederik W D; Sequeira, Vasco; Najafi, Aref; Boontje, Nicky M; Wijnker, Paul J M; Witjas-Paalberends, E Rosalie; Marston, Steven B; Dos Remedios, Cristobal G; Carrier, Lucie; Demmers, Jeroen A A; Redwood, Charles; Sadayappan, Sakthivel; van der Velden, Jolanda

2013-02-15

Cardiac myosin-binding protein C (cMyBP-C) regulates cross-bridge cycling kinetics and, thereby, fine-tunes the rate of cardiac muscle contraction and relaxation. Its effects on cardiac kinetics are modified by phosphorylation. Three phosphorylation sites (Ser275, Ser284, and Ser304) have been identified in vivo, all located in the cardiac-specific M-domain of cMyBP-C. However, recent work has shown that up to 4 phosphate groups are present in human cMyBP-C. To identify and characterize additional phosphorylation sites in human cMyBP-C. Cardiac MyBP-C was semipurified from human heart tissue. Tandem mass spectrometry analysis identified a novel phosphorylation site on serine 133 in the proline-alanine-rich linker sequence between the C0 and C1 domains of cMyBP-C. Unlike the known sites, Ser133 was not a target of protein kinase A. In silico kinase prediction revealed glycogen synthase kinase 3β (GSK3β) as the most likely kinase to phosphorylate Ser133. In vitro incubation of the C0C2 fragment of cMyBP-C with GSK3β showed phosphorylation on Ser133. In addition, GSK3β phosphorylated Ser304, although the degree of phosphorylation was less compared with protein kinase A-induced phosphorylation at Ser304. GSK3β treatment of single membrane-permeabilized human cardiomyocytes significantly enhanced the maximal rate of tension redevelopment. GSK3β phosphorylates cMyBP-C on a novel site, which is positioned in the proline-alanine-rich region and increases kinetics of force development, suggesting a noncanonical role for GSK3β at the sarcomere level. Phosphorylation of Ser133 in the linker domain of cMyBP-C may be a novel mechanism to regulate sarcomere kinetics.

A novel zinc-finger protein with a proline-rich domain mediates ABA-regulated seed dormancy in Arabidopsis.

PubMed

He, Yuehui; Gan, Susheng

2004-01-01

Seed dormancy is an important developmental process that prevents pre-harvest sprouting in many grains and other seeds. Abscisic acid (ABA), a plant hormone, plays a crucial role in regulating dormancy but the underlying molecular regulatory mechanisms are not fully understood. An Arabidopsis zinc-finger gene, MEDIATOR OF ABA-REGULATED DORMANCY 1 ( MARD1 ) was identified and functionally analyzed. MARD1 expression is up-regulated by ABA. A T-DNA insertion in the promoter region downstream of two ABA-responsive elements (ABREs) renders MARD1 unable to respond to ABA. The mard1 seeds are less dormant and germinate in total darkness; their germination is resistant to external ABA at the stage of radicle protrusion. These results suggest that this novel zinc-finger protein with a proline-rich N-terminus is an important downstream component of the ABA signaling pathway that mediates ABA-regulated seed dormancy in Arabidopsis.

Proline isomerization in the C-terminal region of HSP27.

PubMed

Alderson, T Reid; Benesch, Justin L P; Baldwin, Andrew J

2017-07-01

In mammals, small heat-shock proteins (sHSPs) typically assemble into interconverting, polydisperse oligomers. The dynamic exchange of sHSP oligomers is regulated, at least in part, by molecular interactions between the α-crystallin domain and the C-terminal region (CTR). Here we report solution-state nuclear magnetic resonance (NMR) spectroscopy investigations of the conformation and dynamics of the disordered and flexible CTR of human HSP27, a systemically expressed sHSP. We observed multiple NMR signals for residues in the vicinity of proline 194, and we determined that, while all observed forms are highly disordered, the extra resonances arise from cis-trans peptidyl-prolyl isomerization about the G193-P194 peptide bond. The cis-P194 state is populated to near 15% at physiological temperatures, and, although both cis- and trans-P194 forms of the CTR are flexible and dynamic, both states show a residual but differing tendency to adopt β-strand conformations. In NMR spectra of an isolated CTR peptide, we observed similar evidence for isomerization involving proline 182, found within the IPI/V motif. Collectively, these data indicate a potential role for cis-trans proline isomerization in regulating the oligomerization of sHSPs.

A Proline-Rich N-Terminal Region of the Dengue Virus NS3 Is Crucial for Infectious Particle Production.

PubMed

Gebhard, Leopoldo G; Iglesias, Néstor G; Byk, Laura A; Filomatori, Claudia V; De Maio, Federico A; Gamarnik, Andrea V

2016-06-01

Dengue virus is currently the most important insect-borne viral human pathogen. Viral nonstructural protein 3 (NS3) is a key component of the viral replication machinery that performs multiple functions during viral replication and participates in antiviral evasion. Using dengue virus infectious clones and reporter systems to dissect each step of the viral life cycle, we examined the requirements of different domains of NS3 on viral particle assembly. A thorough site-directed mutagenesis study based on solvent-accessible surface areas of NS3 revealed that, in addition to being essential for RNA replication, different domains of dengue virus NS3 are critically required for production of infectious viral particles. Unexpectedly, point mutations in the protease, interdomain linker, or helicase domain were sufficient to abolish infectious particle formation without affecting translation, polyprotein processing, or RNA replication. In particular, we identified a novel proline-rich N-terminal unstructured region of NS3 that contains several amino acid residues involved in infectious particle formation. We also showed a new role for the interdomain linker of NS3 in virion assembly. In conclusion, we present a comprehensive genetic map of novel NS3 determinants for viral particle assembly. Importantly, our results provide evidence of a central role of NS3 in the coordination of both dengue virus RNA replication and particle formation. Dengue virus is an important human pathogen, and its prominence is expanding globally; however, basic aspects of its biology are still unclear, hindering the development of effective therapeutic and prophylactic treatments. Little is known about the initial steps of dengue and other flavivirus particle assembly. This process involves a complex interplay between viral and cellular components, making it an attractive antiviral target. Unpredictably, we identified spatially separated regions of the large NS3 viral protein as determinants for

The proline-rich domain of TonB possesses an extended polyproline II-like conformation of sufficient length to span the periplasm of Gram-negative bacteria

PubMed Central

Köhler, Silvia Domingo; Weber, Annemarie; Howard, S Peter; Welte, Wolfram; Drescher, Malte

2010-01-01

TonB from Escherichia coli and its homologues are critical for the uptake of siderophores through the outer membrane of Gram-negative bacteria using chemiosmotic energy. When different models for the mechanism of TonB mediated energy transfer from the inner to the outer membrane are discussed, one of the key questions is whether TonB spans the periplasm. In this article, we use long range distance measurements by spin-label pulsed EPR (Double Electron–Electron Resonance, DEER) and CD spectroscopy to show that the proline-rich segment of TonB exists in a PPII-like conformation. The result implies that the proline-rich segment of TonB possesses a length of more than 15 nm, sufficient to span the periplasm of Gram-negative bacteria. PMID:20095050

Structural studies and SH3 domain binding properties of a human antiviral salivary proline-rich peptide.

PubMed

Righino, Benedetta; Pirolli, Davide; Radicioni, Giorgia; Marzano, Valeria; Longhi, Renato; Arcovito, Alessandro; Sanna, Maria Teresa; De Rosa, Maria Cristina; Paoluzi, Serena; Cesareni, Gianni; Messana, Irene; Castagnola, Massimo; Vitali, Alberto

2016-09-01

Human saliva contains hundreds of small proline-rich peptides originated by the proteolytic cleavage of the salivary basic Proline-Rich Proteins. Nevertheless only for few of them a specific biological activity has been assigned to date. Among them, the 1932 Da peptide (p1932) has been patented as an anti-HIV agent. In order to shed light on the possible mechanism of action of this peptide, we assessed in this study, by means of molecular dynamics calculations, circular dichroism and FTIR spectroscopic techniques, that p1932 has an intrinsic propensity to adopt a polyproline-II helix arrangement. This structural feature combined with the presence of PxxP motifs in its primary structure, represents an essential property for the exploitation of several biological activities. Next to these findings, we recently demonstrated the ability of this peptide to be internalized within cells of the oral mucosa, thus we focused onto a possible intracellular target, represented by the SH3 domains family. Its ability to interact with selected SH3 domains was finally assayed by Surface Plasmon Resonance spectroscopy. As a result, only Fyn, Hck, and c-Src SH3 domains gave positive results in terms of interaction, showing dissociation constants ranging from nanomolar to micromolar values having the best performer a KD of 148 nM. It is noteworthy that all the interacting domains belong to the Src kinases family, suggesting a role for p1932 as a modulator of the signal transduction pathways mediated by these kinases. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 714-725, 2016. © 2016 Wiley Periodicals, Inc.

Characterisation of secretory calcium-binding phosphoprotein-proline-glutamine-rich 1: a novel basal lamina component expressed at cell-tooth interfaces.

PubMed

Moffatt, Pierre; Wazen, Rima M; Dos Santos Neves, Juliana; Nanci, Antonio

2014-12-01

Functional genomic screening of the rat enamel organ (EO) has led to the identification of a number of secreted proteins expressed during the maturation stage of amelogenesis, including amelotin (AMTN) and odontogenic ameloblast-associated (ODAM). In this study, we characterise the gene, protein and pattern of expression of a related protein called secretory calcium-binding phosphoprotein-proline-glutamine-rich 1 (SCPPPQ1). The Scpppq1 gene resides within the secretory calcium-binding phosphoprotein (Scpp) cluster. SCPPPQ1 is a highly conserved, 75-residue, secreted protein rich in proline, leucine, glutamine and phenylalanine. In silico data mining has revealed no correlation to any known sequences. Northern blotting of various rat tissues suggests that the expression of Scpppq1 is restricted to tooth and associated tissues. Immunohistochemical analyses show that the protein is expressed during the late maturation stage of amelogenesis and in the junctional epithelium where it localises to an atypical basal lamina at the cell-tooth interface. This discrete localisation suggests that SCPPPQ1, together with AMTN and ODAM, participates in structuring the basal lamina and in mediating attachment of epithelia cells to mineralised tooth surfaces.

Salivary proline-rich proteins and gluten: Do structural similarities suggest a role in celiac disease?

PubMed

Tian, Na; Messana, Irene; Leffler, Daniel A; Kelly, Ciaran P; Hansen, Joshua; Cabras, Tiziana; D'Alessandro, Alfredo; Schuppan, Detlef; Castagnola, Massimo; Helmerhorst, Eva J

2015-10-01

Gluten proteins, the culprits in celiac disease (CD), show striking similarities in primary structure with human salivary proline-rich proteins (PRPs). Both are enriched in proline and glutamine residues that often occur consecutively in their sequences. We investigated potential differences in the spectrum of salivary PRPs in health and CD. Stimulated salivary secretions were collected from CD patients, patients with refractory CD, patients with gastrointestinal complaints but no CD, and healthy controls. PRP isoforms/peptides were characterized by anionic and SDS-PAGE, PCR, and LC-ESI-MS. The gene frequencies of the acidic PRP isoforms PIF, Db, Pa, PRP1, and PRP2 did not differ between groups. At the protein level, PRPs peptides showed minor group differences, but these could not differentiate the CD and/or refractory CDs groups from the controls. This extensive study established that salivary PRPs, despite similarity to gluten proteins, show no apparent correlation with CD and thus will not serve as diagnostic markers for the disease. The structural basis for the tolerance to the gluten-like PRP proteins in CD is worthy of further exploration and may lead to the development of gluten-like analogs lacking immunogenicity that could be used therapeutically. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Novel Vasoactive Proline-Rich Oligopeptide from the Skin Secretion of the Frog Brachycephalus ephippium.

PubMed

Arcanjo, Daniel Dias Rufino; Vasconcelos, Andreanne Gomes; Comerma-Steffensen, Simón Gabriel; Jesus, Joilson Ramos; Silva, Luciano Paulino; Pires Júnior, Osmindo Rodrigues; Costa-Neto, Claudio Miguel; Oliveira, Eduardo Brandt; Migliolo, Ludovico; Franco, Octávio Luiz; Restini, Carolina Baraldi Araújo; Paulo, Michele; Bendhack, Lusiane Maria; Bemquerer, Marcelo Porto; Oliveira, Aldeidia Pereira; Simonsen, Ulf; Leite, José Roberto de Souza de Almeida

2015-01-01

Proline-rich oligopeptides (PROs) are a large family which comprises the bradykinin-potentiating peptides (BPPs). They inhibit the activity of the angiotensin I-converting enzyme (ACE) and have a typical pyroglutamyl (Pyr)/proline-rich structure at the N- and C-terminus, respectively. Furthermore, PROs decrease blood pressure in animals. In the present study, the isolation and biological characterization of a novel vasoactive BPP isolated from the skin secretion of the frog Brachycephalus ephippium is described. This new PRO, termed BPP-Brachy, has the primary structure WPPPKVSP and the amidated form termed BPP-BrachyNH2 inhibits efficiently ACE in rat serum. In silico molecular modeling and docking studies suggest that BPP-BrachyNH2 is capable of forming a hydrogen bond network as well as multiple van der Waals interactions with the rat ACE, which blocks the access of the substrate to the C-domain active site. Moreover, in rat thoracic aorta BPP-BrachyNH2 induces potent endothelium-dependent vasodilatation with similar magnitude as captopril. In DAF-FM DA-loaded aortic cross sections examined by confocal microscopy, BPP-BrachyNH2 was found to increase the release of nitric oxide (NO). Moreover, BPP-BrachyNH2 was devoid of toxicity in endothelial and smooth muscle cell cultures. In conclusion, the peptide BPP-BrachyNH2 has a novel sequence being the first BPP isolated from the skin secretion of the Brachycephalidae family. This opens for exploring amphibians as a source of new biomolecules. The BPP-BrachyNH2 is devoid of cytotoxicity and elicits endothelium-dependent vasodilatation mediated by NO. These findings open for the possibility of potential application of these peptides in the treatment of endothelial dysfunction and cardiovascular diseases.

A Novel Vasoactive Proline-Rich Oligopeptide from the Skin Secretion of the Frog Brachycephalus ephippium

PubMed Central

Arcanjo, Daniel Dias Rufino; Vasconcelos, Andreanne Gomes; Comerma-Steffensen, Simón Gabriel; Jesus, Joilson Ramos; Silva, Luciano Paulino; Pires, Osmindo Rodrigues; Costa-Neto, Claudio Miguel; Oliveira, Eduardo Brandt; Migliolo, Ludovico; Franco, Octávio Luiz; Restini, Carolina Baraldi Araújo; Paulo, Michele; Bendhack, Lusiane Maria; Bemquerer, Marcelo Porto; Oliveira, Aldeidia Pereira; Simonsen, Ulf; Leite, José Roberto de Souza de Almeida

2015-01-01

Proline-rich oligopeptides (PROs) are a large family which comprises the bradykinin-potentiating peptides (BPPs). They inhibit the activity of the angiotensin I-converting enzyme (ACE) and have a typical pyroglutamyl (Pyr)/proline-rich structure at the N- and C-terminus, respectively. Furthermore, PROs decrease blood pressure in animals. In the present study, the isolation and biological characterization of a novel vasoactive BPP isolated from the skin secretion of the frog Brachycephalus ephippium is described. This new PRO, termed BPP-Brachy, has the primary structure WPPPKVSP and the amidated form termed BPP-BrachyNH2 inhibits efficiently ACE in rat serum. In silico molecular modeling and docking studies suggest that BPP-BrachyNH2 is capable of forming a hydrogen bond network as well as multiple van der Waals interactions with the rat ACE, which blocks the access of the substrate to the C-domain active site. Moreover, in rat thoracic aorta BPP-BrachyNH2 induces potent endothelium-dependent vasodilatation with similar magnitude as captopril. In DAF-FM DA-loaded aortic cross sections examined by confocal microscopy, BPP-BrachyNH2 was found to increase the release of nitric oxide (NO). Moreover, BPP-BrachyNH2 was devoid of toxicity in endothelial and smooth muscle cell cultures. In conclusion, the peptide BPP-BrachyNH2 has a novel sequence being the first BPP isolated from the skin secretion of the Brachycephalidae family. This opens for exploring amphibians as a source of new biomolecules. The BPP-BrachyNH2 is devoid of cytotoxicity and elicits endothelium-dependent vasodilatation mediated by NO. These findings open for the possibility of potential application of these peptides in the treatment of endothelial dysfunction and cardiovascular diseases. PMID:26661890

Penultimate proline in neuropeptides.

PubMed

Glover, Matthew S; Bellinger, Earl P; Radivojac, Predrag; Clemmer, David E

2015-08-18

A recent ion mobility spectrometry-mass spectrometry (IMS-MS) study revealed that tryptic peptide ions containing a proline residue at the second position from the N-terminus (i.e., penultimate proline) frequently adopt multiple conformations, owing to the cis-trans isomerization of Xaa(1)-Pro(2) peptide bonds [J. Am. Soc. Mass Spectrom. 2015, 26, 444]. Here, we present a statistical analysis of a neuropeptide database that illustrates penultimate proline residues are frequently found in neuropeptides. In order to probe the effect of penultimate proline on neuropeptide conformations, IMS-MS experiments were performed on two model peptides in which penultimate proline residues were known to be important for biological activity: the N-terminal region of human neuropeptide Y (NPY1-9, Tyr(1)-Pro(2)-Ser(3)-Lys(4)-Pro(5)-Asp(6)-Asn(7)-Pro(8)-Gly(9)-NH2) and a tachykinin-related peptide (CabTRP Ia, Ala(1)-Pro(2)-Ser(3)-Gly(4)-Phe(5)-Leu(6)-Gly(7)-Met(8)-Arg(9)-NH2). From these studies, it appears that penultimate prolines allow neuropeptides to populate multiple conformations arising from the cis-trans isomerization of Xaa(1)-Pro(2) peptide bonds. Although it is commonly proposed that the role of penultimate proline residues is to protect peptides from enzymatic degradation, the present results indicate that penultimate proline residues also are an important means of increasing the conformational heterogeneity of neuropeptides.

Abscisic Acid- and Stress-Induced Highly Proline-Rich Glycoproteins Regulate Root Growth in Rice1[W][OPEN

PubMed Central

Tseng, I-Chieh; Hong, Chwan-Yang; Yu, Su-May; Ho, Tuan-Hua David

2013-01-01

In the root of rice (Oryza sativa), abscisic acid (ABA) treatment, salinity, or water deficit stress induces the expression of a family of four genes, REPETITIVE PROLINE-RICH PROTEIN (RePRP). These genes encode two subclasses of novel proline-rich glycoproteins with highly repetitive PX1PX2 motifs, RePRP1 and RePRP2. RePRP orthologs exist only in monocotyledonous plants, and their functions are virtually unknown. Rice RePRPs are heavily glycosylated with arabinose and glucose on multiple hydroxyproline residues. They are significantly different from arabinogalactan proteins that have glycan chains composed of arabinose and galactose. Transient and stable expressions of RePRP-green fluorescent protein reveal that a fraction of this protein is localized to the plasma membrane. In rice roots, ABA treatment increases RePRP expression preferentially in the elongation zone. Overexpression of RePRP in transgenic rice reduces root cell elongation in the absence of ABA, similar to the effect of ABA on wild-type roots. Conversely, simultaneous knockdown of the expression of RePRP1 and RePRP2 reduces the root sensitivity to ABA, indicating that RePRP proteins play an essential role in ABA/stress regulation of root growth and development. Moreover, rice RePRPs specifically interact with a polysaccharide, arabinogalactan, in a dosage-dependent manner. It is suggested that RePRP1 and RePRP2 are functionally redundant suppressors of root cell expansion and probably act through interactions with cell wall components near the plasma membrane. PMID:23886623

Bio-mimicking of Proline-Rich Motif Applied to Carbon Nanotube Reveals Unexpected Subtleties Underlying Nanoparticle Functionalization

NASA Astrophysics Data System (ADS)

Zhang, Yuanzhao; Jimenez-Cruz, Camilo A.; Wang, Jian; Zhou, Bo; Yang, Zaixing; Zhou, Ruhong

2014-11-01

Here, we report computational studies of the SH3 protein domain interacting with various single-walled carbon nanotubes (SWCNT) either bare or functionalized by mimicking the proline-rich motif (PRM) ligand (PPPVPPRR) and compare it to the SH3-PRM complex binding. With prolines or a single arginine attached, the SWCNT gained slightly on specificity when compared with the bare control, whereas with multi-arginine systems the specificity dropped dramatically to our surprise. Although the electrostatic interaction provided by arginines is crucial in the recognition between PRM and SH3 domain, our results suggest that attaching multiple arginines to the SWCNT has a detrimental effect on the binding affinity. Detailed analysis of the MD trajectories found two main factors that modulate the specificity of the binding: the existence of competing acidic patches at the surface of SH3 that leads to ``trapping and clamping'' by the arginines, and the rigidity of the SWCNT introducing entropic penalties in the proper binding. Further investigation revealed that the same ``clamping'' phenomenon exits in the PRM-SH3 system, which has not been reported in previous literature. The competing effects between nanoparticle and its functionalization components revealed by our model system should be of value to current and future nanomedicine designs.

Bio-mimicking of Proline-Rich Motif Applied to Carbon Nanotube Reveals Unexpected Subtleties Underlying Nanoparticle Functionalization

PubMed Central

Zhang, Yuanzhao; Jimenez-Cruz, Camilo A.; Wang, Jian; Zhou, Bo; Yang, Zaixing; Zhou, Ruhong

2014-01-01

Here, we report computational studies of the SH3 protein domain interacting with various single-walled carbon nanotubes (SWCNT) either bare or functionalized by mimicking the proline-rich motif (PRM) ligand (PPPVPPRR) and compare it to the SH3-PRM complex binding. With prolines or a single arginine attached, the SWCNT gained slightly on specificity when compared with the bare control, whereas with multi-arginine systems the specificity dropped dramatically to our surprise. Although the electrostatic interaction provided by arginines is crucial in the recognition between PRM and SH3 domain, our results suggest that attaching multiple arginines to the SWCNT has a detrimental effect on the binding affinity. Detailed analysis of the MD trajectories found two main factors that modulate the specificity of the binding: the existence of competing acidic patches at the surface of SH3 that leads to “trapping and clamping” by the arginines, and the rigidity of the SWCNT introducing entropic penalties in the proper binding. Further investigation revealed that the same “clamping” phenomenon exits in the PRM-SH3 system, which has not been reported in previous literature. The competing effects between nanoparticle and its functionalization components revealed by our model system should be of value to current and future nanomedicine designs. PMID:25427563

The role of proline substitutions within flexible regions on thermostability of luciferase.

PubMed

Yu, Haoran; Zhao, Yang; Guo, Chao; Gan, Yiru; Huang, He

2015-01-01

Improving the stability of firefly luciferase has been a critical issue for its wider industrial applications. Studies about hyperthermophile proteins show that flexibility could be an effective indicator to find out weak spots to engineering thermostability of proteins. However, the relationship among flexibility, activity and stability in most of proteins is unclear. Proline is the most rigid residue and can be introduced to rigidify flexible regions to enhance thermostability of proteins. We firstly apply three different methods, molecular dynamics (MD) simulation, B-FITTER and framework rigidity optimized dynamics algorithm (FRODA) to determine the flexible regions of Photinus pyralis luciferase: Fragment 197-207; Fragment 471-481 and Fragment 487-495. Then, introduction of proline is used to rigidify these flexible regions. Two mutants D476P and H489P within most flexible regions are finally designed. In the results, H489P mutant shows improved thermostability while maintaining its catalytic efficiency compared to that of wild type luciferase. Flexibility analysis confirms that the overall rigidity and local rigidity of H489P mutant are greatly strengthened. D476P mutant shows decreased thermosatbility and the reason for this is elucidated at the molecular level. S307P mutation is randomly chosen outside the flexible regions as a control. Thermostability analysis shows that S307P mutation has decreased kinetic stability and enhanced thermodynamic stability. Copyright © 2014 Elsevier B.V. All rights reserved.

Structural Landscape of the Proline-Rich Domain of Sos1 Nucleotide Exchange Factor

PubMed Central

McDonald, Caleb B.; Bhat, Vikas; Kurouski, Dmitry; Mikles, David C.; Deegan, Brian J.; Seldeen, Kenneth L.; Lednev, Igor K.; Farooq, Amjad

2013-01-01

Despite its key role in mediating a plethora of cellular signaling cascades pertinent to health and disease, little is known about the structural landscape of the proline-rich (PR) domain of Sos1 guanine nucleotide exchange factor. Herein, using a battery of biophysical tools, we provide evidence that the PR domain of Sos1 is structurally disordered and adopts an extended random coil-like conformation in solution. Of particular interest is the observation that while chemical denaturation of PR domain results in the formation of a significant amount of polyproline II (PPII) helices, it has little or negligible effect on its overall size as measured by its hydrodynamic radius. Our data also show that the PR domain displays a highly dynamic conformational basin in agreement with the knowledge that the intrinsically unstructured proteins rapidly interconvert between an ensemble of conformations. Collectively, our study provides new insights into the conformational equilibrium of a key signaling molecule with important consequences on its physiological function. PMID:23528987

Thermodynamic contribution of backbone conformational entropy in the binding between SH3 domain and proline-rich motif.

PubMed

Zeng, Danyun; Shen, Qingliang; Cho, Jae-Hyun

2017-02-26

Biological functions of intrinsically disordered proteins (IDPs), and proteins containing intrinsically disordered regions (IDRs) are often mediated by short linear motifs, like proline-rich motifs (PRMs). Upon binding to their target proteins, IDPs undergo a disorder-to-order transition which is accompanied by a large conformational entropy penalty. Hence, the molecular mechanisms underlying control of conformational entropy are critical for understanding the binding affinity and selectivity of IDPs-mediated protein-protein interactions (PPIs). Here, we investigated the backbone conformational entropy change accompanied by binding of the N-terminal SH3 domain (nSH3) of CrkII and PRM derived from guanine nucleotide exchange factor 1 (C3G). In particular, we focused on the estimation of conformational entropy change of disordered PRM upon binding to the nSH3 domain. Quantitative characterization of conformational dynamics of disordered peptides like PRMs is limited. Hence, we combined various methods, including NMR model-free analysis, δ2D, DynaMine, and structure-based calculation of entropy loss. This study demonstrates that the contribution of backbone conformational entropy change is significant in the PPIs mediated by IDPs/IDRs. Copyright © 2017 Elsevier Inc. All rights reserved.

The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro.

PubMed

De Avila, Miguel; Vassall, Kenrick A; Smith, Graham S T; Bamm, Vladimir V; Harauz, George

2014-12-08

The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92-R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP-Fyn-SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62-L68), and demonstrate further that residues (V83-P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn-SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex.

The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro

PubMed Central

De Avila, Miguel; Vassall, Kenrick A.; Smith, Graham S. T.; Bamm, Vladimir V.; Harauz, George

2014-01-01

The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92–R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP–Fyn–SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62–L68), and demonstrate further that residues (V83–P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn–SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex. PMID:25343306

Study of the interactions between a proline-rich protein and a flavan-3-ol by NMR: residual structures in the natively unfolded protein provides anchorage points for the ligands.

PubMed

Pascal, Christine; Paté, Franck; Cheynier, Véronique; Delsuc, Marc-André

2009-09-01

Astringency is one of the major organoleptic properties of food and beverages that are made from plants, such as tea, chocolate, beer, or red wine. This sensation is thought to be due to interactions between tannins and salivary proline-rich proteins, which are natively unfolded proteins. A human salivary proline-rich protein, namely IB-5, was produced by the recombinant method. Its interactions with a model tannin, epigallocatechin gallate (EGCG), the major flavan-3-ol in green tea, were studied here. Circular dichroism experiments showed that IB-5 presents residual structures (PPII helices) when the ionic strength is close to that in saliva. In the presence of these residual structures, IB-5 undergoes an increase in structural content upon binding to EGCG. NMR data corroborated the presence of preformed structural elements within the protein prior to binding and a partial assignment was proposed, showing partial structuration. TOCSY experiments showed that amino acids that are involved in PPII helices are more likely to interact with EGCG than those in random coil regions, as if they were anchorage points for the ligand. The signal from IB-5 in the DOSY NMR spectrum revealed an increase in polydispersity upon addition of EGCG while the mean hydrodynamic radius remained unchanged. This strongly suggests the formation of IB-5/EGCG aggregates.

Regulation of tumor cell migration by protein tyrosine phosphatase (PTP)-proline-, glutamate-, serine-, and threonine-rich sequence (PEST)

PubMed Central

Zheng, Yanhua; Lu, Zhimin

2013-01-01

Protein tyrosine phosphatase (PTP)–proline-, glutamate-, serine-, and threonine-rich sequence (PEST) is ubiquitously expressed and is a critical regulator of cell adhesion and migration. PTP-PEST activity can be regulated transcriptionally via gene deletion or mutation in several types of human cancers or via post-translational modifications, including phosphorylation, oxidation, and caspase-dependent cleavage. PTP-PEST interacts with and dephosphorylates cytoskeletal and focal adhesion-associated proteins. Dephosphorylation of PTP-PEST substrates regulates their enzymatic activities and/or their interaction with other proteins and plays an essential role in the tumor cell migration process. PMID:23237212

The puckering free-energy surface of proline

NASA Astrophysics Data System (ADS)

Wu, Di

2013-03-01

Proline has two preferred puckering states, which are often characterized by the pseudorotation phase angle and amplitude. Although proline's five endocyclic torsion angles can be utilized to calculate the phase angle and amplitude, it is not clear if there is any direct correlation between each torsion angle and the proline-puckering pathway. Here we have designed five proline puckering pathways utilizing each torsion angle χj (j = 1˜5) as the reaction coordinate. By examining the free-energy surfaces of the five puckering pathways, we find they can be categorized into two groups. The χ2 pathway (χ2 is about the Cβ—Cγ bond) is especially meaningful in describing proline puckering: it changes linearly with the puckering amplitude and symmetrically with the phase angle. Our results show that this conclusion applies to both trans and cis proline conformations. We have also analyzed the correlations of proline puckering and its backbone torsion angles ϕ and ψ. We show proline has preferred puckering states at the specific regions of ϕ, ψ angles. Interestingly, the shapes of ψ-χ2 free-energy surfaces are similar among the trans proline in water, cis proline in water and cis proline in the gas phase, but they differ substantially from that of the trans proline in the gas phase. Our calculations are conducted using molecular simulations; we also verify our results using the proline conformations selected from the Protein Data Bank. In addition, we have compared our results with those calculated by the quantum mechanical methods.

Hybrid proline-rich proteins: novel players in plant cell elongation?

PubMed Central

Dvořáková, Lenka; Srba, Miroslav; Opatrny, Zdenek; Fischer, Lukas

2012-01-01

Background and Aims Hybrid proline-rich proteins (HyPRPs) represent a large family of putative cell-wall proteins characterized by the presence of a variable N-terminal domain and a conserved C-terminal domain that is related to non-specific lipid transfer proteins. The function of HyPRPs remains unclear, but their widespread occurrence and abundant expression patterns indicate that they may be involved in a basic cellular process. Methods To elucidate the cellular function of HyPRPs, we modulated the expression of three HyPRP genes in tobacco (Nicotiana tabacum) BY-2 cell lines and in potato (Solanum tuberosum) plants. Key Results In BY-2 lines, over-expression of the three HyPRP genes with different types of N-terminal domains resulted in similar phenotypic changes, namely increased cell elongation, both in suspension culture and on solid media where the over-expression resulted in enhanced calli size. The over-expressing cells showed increased plasmolysis in a hypertonic mannitol solution and accelerated rate of protoplast release, suggesting loosening of the cell walls. In contrast to BY-2 lines, no phenotypic changes were observed in potato plants over-expressing the same or analogous HyPRP genes, presumably due to more complex compensatory mechanisms in planta. Conclusions Based on the results from BY-2 lines, we propose that HyPRPs, more specifically their C-terminal domains, represent a novel group of proteins involved in cell expansion. PMID:22028464

Structural landscape of the proline-rich domain of Sos1 nucleotide exchange factor.

PubMed

McDonald, Caleb B; Bhat, Vikas; Kurouski, Dmitry; Mikles, David C; Deegan, Brian J; Seldeen, Kenneth L; Lednev, Igor K; Farooq, Amjad

2013-01-01

Despite its key role in mediating a plethora of cellular signaling cascades pertinent to health and disease, little is known about the structural landscape of the proline-rich (PR) domain of Sos1 guanine nucleotide exchange factor. Herein, using a battery of biophysical tools, we provide evidence that the PR domain of Sos1 is structurally disordered and adopts an extended random coil-like conformation in solution. Of particular interest is the observation that while chemical denaturation of PR domain results in the formation of a significant amount of polyproline II (PPII) helices, it has little or negligible effect on its overall size as measured by its hydrodynamic radius. Our data also show that the PR domain displays a highly dynamic conformational basin in agreement with the knowledge that the intrinsically unstructured proteins rapidly interconvert between an ensemble of conformations. Collectively, our study provides new insights into the conformational equilibrium of a key signaling molecule with important consequences on its physiological function. Copyright © 2013 Elsevier B.V. All rights reserved.

Proline Availability Regulates Proline-4-Hydroxylase Synthesis and Substrate Uptake in Proline-Hydroxylating Recombinant Escherichia coli

PubMed Central

Falcioni, Francesco; Blank, Lars M.; Frick, Oliver; Karau, Andreas; Schmid, Andreas

2013-01-01

Microbial physiology plays a crucial role in whole-cell biotransformation, especially for redox reactions that depend on carbon and energy metabolism. In this study, regio- and enantio-selective proline hydroxylation with recombinant Escherichia coli expressing proline-4-hydroxylase (P4H) was investigated with respect to its interconnectivity to microbial physiology and metabolism. P4H production was found to depend on extracellular proline availability and on codon usage. Medium supplementation with proline did not alter p4h mRNA levels, indicating that P4H production depends on the availability of charged prolyl-tRNAs. Increasing the intracellular levels of soluble P4H did not result in an increase in resting cell activities above a certain threshold (depending on growth and assay temperature). Activities up to 5-fold higher were reached with permeabilized cells, confirming that host physiology and not the intracellular level of active P4H determines the achievable whole-cell proline hydroxylation activity. Metabolic flux analysis revealed that tricarboxylic acid cycle fluxes in growing biocatalytically active cells were significantly higher than proline hydroxylation rates. Remarkably, a catalysis-induced reduction of substrate uptake was observed, which correlated with reduced transcription of putA and putP, encoding proline dehydrogenase and the major proline transporter, respectively. These results provide evidence for a strong interference of catalytic activity with the regulation of proline uptake and metabolism. In terms of whole-cell biocatalyst efficiency, proline uptake and competition of P4H with proline catabolism are considered the most critical factors. PMID:23455348

Proline derivatives in fruits of bergamot (Citrus bergamia Risso et Poit): presence of N-methyl-L-proline and 4-hydroxy-L-prolinebetaine.

PubMed

Servillo, Luigi; Giovane, Alfonso; Balestrieri, Maria Luisa; Cautela, Domenico; Castaldo, Domenico

2011-01-12

The content of proline and various compounds deriving from its metabolism (4-hydroxy-L-proline, N-methyl-L-proline, N,N-dimethylproline, and 4-hydroxy-L-prolinebetaine) was determined in fruits and seeds of Bergamot (Citrus bergamia Risso et Poit), growing in the Calabria region (South Italy). A HPLC-ESI-tandem mass spectrometry method, which allowed rapid determination of L-proline, 4-hydroxy-L-proline, N-methyl-L-proline, N,N-dimethylproline, and 4-hydroxy-L-prolinebetaine in juice and extracts of bergamot fruit with minimum sample preparation and short analysis time (about 10 min), is presented. Proline and 4-hydroxy-L-proline levels in the samples were also determined by HPLC analysis with fluorescence detection and the results compared to those obtained with HPLC-ESI-tandem mass spectrometry. For the first time, the presence of N-methyl-L-proline and 4-hydroxy-L-prolinebetaine in the fruits of a plant of the Citrus genus is reported.

Resolution of Site-Specific Conformational Heterogeneity in Proline-Rich Molecular Recognition by Src Homology 3 Domains.

PubMed

Horness, Rachel E; Basom, Edward J; Mayer, John P; Thielges, Megan C

2016-02-03

Conformational heterogeneity and dynamics are increasingly evoked in models of protein molecular recognition but are challenging to experimentally characterize. Here we combine the inherent temporal resolution of infrared (IR) spectroscopy with the spatial resolution afforded by selective incorporation of carbon-deuterium (C-D) bonds, which provide frequency-resolved absorptions within a protein IR spectrum, to characterize the molecular recognition of the Src homology 3 (SH3) domain of the yeast protein Sho1 with its cognate proline-rich (PR) sequence of Pbs2. The IR absorptions of C-D bonds introduced at residues along a peptide of the Pbs2 PR sequence report on the changes in the local environments upon binding to the SH3 domain. Interestingly, upon forming the complex the IR spectra of the peptides labeled with C-D bonds at either of the two conserved prolines of the PXXP consensus recognition sequence show more absorptions than there are C-D bonds, providing evidence for the population of multiple states. In contrast, the NMR spectra of the peptides labeled with (13)C at the same residues show only single resonances, indicating rapid interconversion on the NMR time scale. Thus, the data suggest that the SH3 domain recognizes its cognate peptide with a component of induced fit molecular recognition involving the adoption of multiples states, which have previously gone undetected due to interconversion between the populated states that is too fast to resolve using conventional methods.

The Conformation and Aggregation of Proline-Rich Surfactant-Like Peptides.

PubMed

Hamley, Ian W; Castelletto, Valeria; Dehsorkhi, Ashkan; Torras, Juan; Aleman, Carlos; Portnaya, Irina; Danino, Dganit

2018-02-15

The secondary structure of proline-rich surfactant-like peptides is examined for the first time and is found to be influenced by charged end groups in peptides P 6 K, P 6 E, and KP 6 E and an equimolar mixture of P 6 K and P 6 E. The peptides exhibit a conformational transition from unordered to polyproline II (PPII) above a critical concentration, detected from circular dichroism (CD) measurements and unexpectedly from fluorescence dye probe measurements. Isothermal titration calorimetry (ITC) measurements provided the Gibbs energies of hydration of P 6 K and P 6 E, which correspond essentially to the hydration energies of the terminal charged residues. A detailed analysis of peptide conformation for these peptides was performed using density functional theory calculations, and this was used as a basis for hybrid quantum mechanics/molecular mechanics molecular dynamics (QM/MM MD) simulations. Quantum mechanics simulations in implicit water show both peptides (and their 1:1 mixture) exhibit PPII conformations. However, hybrid QM/MM MD simulations suggest that some deviations from this conformation are present for P 6 K and P 6 E in peptide bonds close to the charged residue, whereas in the 1:1 mixture a PPII structure is observed. Finally, aggregation of the peptides was investigated using replica exchange molecular dynamics simulations. These reveal a tendency for the average aggregate size (as measured by the radius of gyration) to increase with increasing temperature, which is especially marked for P 6 K, although the fraction of the most populated clusters is larger for P 6 E.

A Novel Topology of Proline-rich Transmembrane Protein 2 (PRRT2): HINTS FOR AN INTRACELLULAR FUNCTION AT THE SYNAPSE.

PubMed

Rossi, Pia; Sterlini, Bruno; Castroflorio, Enrico; Marte, Antonella; Onofri, Franco; Valtorta, Flavia; Maragliano, Luca; Corradi, Anna; Benfenati, Fabio

2016-03-18

Proline-rich transmembrane protein 2 (PRRT2) has been identified as the single causative gene for a group of paroxysmal syndromes of infancy, including epilepsy, paroxysmal movement disorders, and migraine. On the basis of topology predictions, PRRT2 has been assigned to the recently characterized family of Dispanins, whose members share the two-transmembrane domain topology with a large N terminus and short C terminus oriented toward the outside of the cell. Because PRRT2 plays a role at the synapse, it is important to confirm the exact orientation of its N and C termini with respect to the plasma membrane to get clues regarding its possible function. Using a combination of different experimental approaches, including live immunolabeling, immunogold electron microscopy, surface biotinylation and computational modeling, we demonstrate a novel topology for this protein. PRRT2 is a type II transmembrane protein in which only the second hydrophobic segment spans the plasma membrane, whereas the first one is associated with the internal surface of the membrane and forms a helix-loop-helix structure without crossing it. Most importantly, the large proline-rich N-terminal domain is not exposed to the extracellular space but is localized intracellularly, and only the short C terminus is extracellular (N cyt/C exo topology). Accordingly, we show that PRRT2 interacts with the Src homology 3 domain-bearing protein Intersectin 1, an intracellular protein involved in synaptic vesicle cycling. These findings will contribute to the clarification of the role of PRRT2 at the synapse and the understanding of pathogenic mechanisms on the basis of PRRT2-related neurological disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Thermodynamic dissection of the binding energetics of proline-rich peptides to the Abl-SH3 domain: implications for rational ligand design.

PubMed

Palencia, Andrés; Cobos, Eva S; Mateo, Pedro L; Martínez, Jose C; Luque, Irene

2004-02-13

The inhibition of the interactions between SH3 domains and their targets is emerging as a promising therapeutic strategy. To date, rational design of potent ligands for these domains has been hindered by the lack of understanding of the origins of the binding energy. We present here a complete thermodynamic analysis of the binding energetics of the p41 proline-rich decapeptide (APSYSPPPPP) to the SH3 domain of the c-Abl oncogene. Isothermal titration calorimetry experiments have revealed a thermodynamic signature for this interaction (very favourable enthalpic contributions opposed by an unfavourable binding entropy) inconsistent with the highly hydrophobic nature of the p41 ligand and the Abl-SH3 binding site. Our structural and thermodynamic analyses have led us to the conclusion, having once ruled out any possible ionization events or conformational changes coupled to the association, that the establishment of a complex hydrogen-bond network mediated by water molecules buried at the binding interface is responsible for the observed thermodynamic behaviour. The origin of the binding energetics for proline-rich ligands to the Abl-SH3 domain is further investigated by a comparative calorimetric analysis of a set of p41-related ligands. The striking effects upon the enthalpic and entropic contributions provoked by conservative substitutions at solvent-exposed positions in the ligand confirm the complexity of the interaction. The implications of these results for rational ligand design are discussed.

PPII propensity of multiple-guest amino acids in a proline-rich environment.

PubMed

Moradi, Mahmoud; Babin, Volodymyr; Sagui, Celeste; Roland, Christopher

2011-07-07

There has been considerable debate about the intrinsic PPII propensity of amino acid residues in denatured polypeptides. Experimentally, this scale is based on the behavior of guest amino acid residues placed in the middle of proline-based hosts. We have used classical molecular dynamics simulations combined with replica-exchange methods to carry out a comprehensive analysis of the conformational equilibria of proline-based host oligopeptides with multiple guest amino acids including alanine, glutamine, valine, and asparagine. The tracked structural characteristics include the secondary structural motifs based on the Ramachandran angles and the cis/trans isomerization of the prolyl bonds. In agreement with our recent study of single amino acid guests, we did not observe an intrinsic PPII propensity in any of the guest amino acids in a multiple-guest setting. Instead, the experimental results can be explained in terms of (i) the steric restrictions imposed on the C-terminal guest amino acid that is immediately followed by a proline residue and (ii) an increase in the trans content of the prolyl bonds due to the presence of guest residues. In terms of the latter, we found that the more guests added to the system, the larger the increase in the trans content of the prolyl bonds, which results in an effective increase in the PPII content of the peptide.

Two novel mutations in the glycine-rich region of human PAX6 gene: Implications for an association of cataracts and anosmia with aniridia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martha, A.; Ferrel, R.E.; Hittner, H.M.

1994-09-01

Aniridia (iris hyplasia) is a autosomal dominant congenital disorder of the eye. Mutations in the human aniridia (PAX6) gene have now been identified in many patients from various ethnic groups. In the present study we describe new mutations in this gene. Out of four mutations found, three were novel mutations; the fourth one is identical to the previously reported mutations (C{yields}T transition at nt 240). The three novel mutations analyzed were in the glycine-rich region (two) and in the proline/serine/threonine-rich (PST) region (one). Previously no mutations were reported for the glycine-rich region in humans. One of the mutations found inmore » this region is associated with cataracts in an aniridia family. The other splice mutation found in the PST domain is associated with anosmia (lack of sensation to smell) in a sporadic aniridia case. Two of the mutations presented here, one in the glycine-rich region and the other in the PST domain, were not detected by SSCR. These mutations could be detected by using MDE gel and heteroduplex information. All mutations found in the present study are similar in that 32 of 33 PAX6 mutations result in protein truncation and haploinsufficiency.« less

A Statistical Analysis of the PPII Propensity of Amino Acid Guests in Proline-Rich Peptides

PubMed Central

Moradi, Mahmoud; Babin, Volodymyr; Sagui, Celeste; Roland, Christopher

2011-01-01

There has been considerable debate about the intrinsic PPII propensity of amino-acid residues in denatured polypeptides. Experimentally, the propensity scale is based on the behavior of guest amino-acid residues placed in the middle of polyproline hosts. We have used classical molecular dynamics simulations, with state-of-the-art force fields to carry out a comprehensive analysis of the conformational equilibria of the proline-based host oligopeptides with single guests. The tracked structural characteristics include the PPII content, the cis/trans isomerization of the prolyl bonds, the puckering of the pyrrolidine rings of the proline residues, and the secondary structural motifs. We find no evidence for an intrinsic PPII propensity in any of the guest amino acids other than proline. Instead, the PPII content as derived from experiments may be explained in terms of: 1), a local correlation between the dihedral angles of the guest amino acid and the proline residue immediately preceding it; and 2), a nonlocal correlation between the cis/trans states of the peptide bonds. In terms of the latter, we find that the presence of a guest (other than proline, tyrosine, or tryptophan) increases the trans content of most of the prolyl bonds, which results in an effective increase of the peptide PPII content. With respect to the local dihedral correlations, we find that these are well described in terms of the so-called odds-ratio statistic. Expressed in terms of free energy language, the PPII content based on the odds-ratio of the relevant residues correlate well with the experimentally measured PPII content. PMID:21320454

Exploring the Roles of Proline in Three-Dimensional Domain Swapping from Structure Analysis and Molecular Dynamics Simulations.

PubMed

Huang, Yongqi; Gao, Meng; Su, Zhengding

2018-02-01

Three-dimensional (3D) domain swapping is a mechanism to form protein oligomers. It has been proposed that several factors, including proline residues in the hinge region, may affect the occurrence of 3D domain swapping. Although introducing prolines into the hinge region has been found to promote domain swapping for some proteins, the opposite effect has also been observed in several studies. So far, how proline affects 3D domain swapping remains elusive. In this work, based on a large set of 3D domain-swapped structures, we performed a systematic analysis to explore the correlation between the presence of proline in the hinge region and the occurrence of 3D domain swapping. We further analyzed the conformations of proline and pre-proline residues to investigate the roles of proline in 3D domain swapping. We found that more than 40% of the domain-swapped structures contained proline residues in the hinge region. Unexpectedly, conformational transitions of proline residues were rarely observed upon domain swapping. Our analyses showed that hinge regions containing proline residues preferred more extended conformations, which may be beneficial for the occurrence of domain swapping by facilitating opening of the exchanged segments.

A statistical analysis of the PPII propensity of amino acid guests in proline-rich peptides.

PubMed

Moradi, Mahmoud; Babin, Volodymyr; Sagui, Celeste; Roland, Christopher

2011-02-16

There has been considerable debate about the intrinsic PPII propensity of amino-acid residues in denatured polypeptides. Experimentally, the propensity scale is based on the behavior of guest amino-acid residues placed in the middle of polyproline hosts. We have used classical molecular dynamics simulations, with state-of-the-art force fields to carry out a comprehensive analysis of the conformational equilibria of the proline-based host oligopeptides with single guests. The tracked structural characteristics include the PPII content, the cis/trans isomerization of the prolyl bonds, the puckering of the pyrrolidine rings of the proline residues, and the secondary structural motifs. We find no evidence for an intrinsic PPII propensity in any of the guest amino acids other than proline. Instead, the PPII content as derived from experiments may be explained in terms of: 1), a local correlation between the dihedral angles of the guest amino acid and the proline residue immediately preceding it; and 2), a nonlocal correlation between the cis/trans states of the peptide bonds. In terms of the latter, we find that the presence of a guest (other than proline, tyrosine, or tryptophan) increases the trans content of most of the prolyl bonds, which results in an effective increase of the peptide PPII content. With respect to the local dihedral correlations, we find that these are well described in terms of the so-called odds-ratio statistic. Expressed in terms of free energy language, the PPII content based on the odds-ratio of the relevant residues correlate well with the experimentally measured PPII content. Copyright © 2011 Biophysical Society. Published by Elsevier Inc. All rights reserved.

PRELP (proline/arginine-rich end leucine-rich repeat protein) promotes osteoblastic differentiation of preosteoblastic MC3T3-E1 cells by regulating the β-catenin pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haiying; Cui, Yazhou; Luan, Jing

Proline/arginine-rich end leucine-rich repeat protein (PRELP) is a collagen-binding proteoglycan highly expressed in the developing bones. Recent studies indicated that PRELP could inhibit osteoclastogenesis as a NF-κB inhibitor. However, its role during osteoblast differentiation is still unclear. In this study, we confirmed that the expression of PRELP increased with the osteogenesis induction of preosteoblastic MC3T3-E1 cells. Down-regulation of PRELP expression by shRNA reduced ALP activity, mineralization and expression of osteogenic marker gene Runx2. Our microarray analysis data suggested that β-catenin may act as a hub gene in the PRELP-mediated gene network. We validated furtherly that PRELP knockdown could inhibit themore » level of connexin43, a key regulator of osteoblast differentiation by affecting β-catenin protein expression, and its nuclear translocation in MC3T3-E1 preosteoblasts. Therefore, this study established a new role of PRELP in modulating β-catenin/connexin43 pathway and osteoblast differentiation.« less

Genome-Wide Analyses and Functional Classification of Proline Repeat-Rich Proteins: Potential Role of eIF5A in Eukaryotic Evolution

PubMed Central

Mandal, Ajeet; Mandal, Swati; Park, Myung Hee

2014-01-01

The eukaryotic translation factor, eIF5A has been recently reported as a sequence-specific elongation factor that facilitates peptide bond formation at consecutive prolines in Saccharomyces cerevisiae, as its ortholog elongation factor P (EF-P) does in bacteria. We have searched the genome databases of 35 representative organisms from six kingdoms of life for PPP (Pro-Pro-Pro) and/or PPG (Pro-Pro-Gly)-encoding genes whose expression is expected to depend on eIF5A. We have made detailed analyses of proteome data of 5 selected species, Escherichia coli, Saccharomyces cerevisiae, Drosophila melanogaster, Mus musculus and Homo sapiens. The PPP and PPG motifs are low in the prokaryotic proteomes. However, their frequencies markedly increase with the biological complexity of eukaryotic organisms, and are higher in newly derived proteins than in those orthologous proteins commonly shared in all species. Ontology classifications of S. cerevisiae and human genes encoding the highest level of polyprolines reveal their strong association with several specific biological processes, including actin/cytoskeletal associated functions, RNA splicing/turnover, DNA binding/transcription and cell signaling. Previously reported phenotypic defects in actin polarity and mRNA decay of eIF5A mutant strains are consistent with the proposed role for eIF5A in the translation of the polyproline-containing proteins. Of all the amino acid tandem repeats (≥3 amino acids), only the proline repeat frequency correlates with functional complexity of the five organisms examined. Taken together, these findings suggest the importance of proline repeat-rich proteins and a potential role for eIF5A and its hypusine modification pathway in the course of eukaryotic evolution. PMID:25364902

Interspecific differences in tannin intakes of forest-dwelling rodents in the wild revealed by a new method using fecal proline content.

PubMed

Shimada, Takuya; Nishii, Eriko; Saitoh, Takashi

2011-12-01

Mammalian herbivores adopt various countermeasures against dietary tannins, which are among the most widespread plant secondary metabolites. The large Japanese wood mouse Apodemus speciosus produces proline-rich salivary tannin-binding proteins in response to tannins. Proline-rich proteins (PRPs) react with tannins to form stable complexes that are excreted in the feces. Here, we developed a new method for estimating the tannin intake of free-living small rodents, by measuring fecal proline content, and applied the method to a field investigation. A feeding experiment with artificial diets containing various levels of tannic acid revealed that fecal proline content was clearly related to dietary tannin content in three species (A. speciosus, Apodemus argenteus, and Myodes rufocanus). We then used fecal proline content to estimate the tannin intakes of these three forest-dwelling species in a forest in Hokkaido. In the autumn, estimated tannin intakes increased significantly in the Apodemus species, but not in M. rufocanus. We speculated that an increase in tannin intake during autumn may result from consumption of tannin-rich acorns. This hypothesis was consistent with population fluctuation patterns of the three species, which were well-synchronized with acorn abundance for the Apodemus species but not for M. rufocanus.

Proline oxidase silencing induces proline-dependent pro-survival pathways in MCF-7 cells

PubMed Central

Zareba, Ilona; Celinska-Janowicz, Katarzyna; Surazynski, Arkadiusz; Miltyk, Wojciech; Palka, Jerzy

2018-01-01

Proline degradation by proline dehydrogenase/proline oxidase (PRODH/POX) contributes to apoptosis or autophagy. The identification of specific pathway of apoptosis/survival regulation is the aim of this study. We generated knocked-down PRODH/POX MCF-7 breast cancer cells (MCF-7shPRODH/POX). PRODH/POX silencing did not affect cell viability. However, it contributed to decrease in DNA and collagen biosynthesis, increase in prolidase activity and intracellular proline concentration as well as increase in the expression of iNOS, NF-κB, mTOR, HIF-1α, COX-2, AMPK, Atg7 and Beclin-1 in MCF-7shPRODH/POX cells. In these cells, glycyl-proline (GlyPro, substrate for prolidase) further inhibited DNA and collagen biosynthesis, maintained high prolidase activity, intracellular concentration of proline and up-regulated HIF-1α, AMPK, Atg7 and Beclin-1, compared to GlyPro-treated MCF-7 cells. In MCF-7 cells, GlyPro increased collagen biosynthesis, concentration of proline and expression of caspase-3, cleaved caspases -3 and -9, iNOS, NF-κB, COX-2 and AMPKβ. PRODH/POX knock-down contributed to pro-survival autophagy pathways in MCF-7 cells and GlyPro-derived proline augmented this process. However, GlyPro induced apoptosis in PRODH/POX-expressing MCF-7 cells as detected by up-regulation of active caspases -3 and -9. The data suggest that PRODH/POX silencing induces autophagy in MCF-7 cells and GlyPro-derived proline supports this process. PMID:29568391

Pinpointing proline substitution to be responsible for the loss of amyloidogenesis in IAPP.

PubMed

Chakraborty, Sandipan; Mukherjee, Barnali; Basu, Soumalee

2013-10-01

Human islet amyloid polypeptide (hIAPP) is highly amyloidogenic, whereas its homologs in rodents are non-amyloidogenic. This observed non-amyloidogenecity of rodent IAPP has been attributed to substitutions by proline in a region of IAPP that forms the core of the fibril. By employing molecular dynamics simulation, we have analyzed effects of position-specific proline substitution on amyloidogenesis of the core region of the hIAPP fibril (22-28). We depict that substitution to proline at the 25th position is primarily responsible for the loss of amyloidogenecity of the peptide. In addition, 25th and 26th double mutation to proline and valine has been observed to show significant fibril destabilizing ability. On the contrary, substitution at 28th position to proline has the least ability to destabilize the amyloid fibril. Results obtained from this study are particularly important to design variants of the existing antihyperglycemic drug with minimalistic mutation approach for use in patients with diabetes. © 2013 John Wiley & Sons A/S.

Role of interfacial water molecules in proline-rich ligand recognition by the Src homology 3 domain of Abl.

PubMed

Palencia, Andres; Camara-Artigas, Ana; Pisabarro, M Teresa; Martinez, Jose C; Luque, Irene

2010-01-22

The interaction of Abl-Src homology 3 domain (SH3) with the high affinity peptide p41 is the most notable example of the inconsistency existing between the currently accepted description of SH3 complexes and their binding thermodynamic signature. We had previously hypothesized that the presence of interfacial water molecules is partially responsible for this thermodynamic behavior. We present here a thermodynamic, structural, and molecular dynamics simulation study of the interaction of p41 with Abl-SH3 and a set of mutants designed to alter the water-mediated interaction network. Our results provide a detailed description of the dynamic properties of the interfacial water molecules and a molecular interpretation of the thermodynamic effects elicited by the mutations in terms of the modulation of the water-mediated hydrogen bond network. In the light of these results, a new dual binding mechanism is proposed that provides a better description of proline-rich ligand recognition by Abl-SH3 and that has important implications for rational design.

Study of base pair mutations in proline-rich homeodomain (PRH)-DNA complexes using molecular dynamics.

PubMed

Jalili, Seifollah; Karami, Leila; Schofield, Jeremy

2013-06-01

Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.

Mycorrhizal-Mediated Lower Proline Accumulation in Poncirus trifoliata under Water Deficit Derives from the Integration of Inhibition of Proline Synthesis with Increase of Proline Degradation

PubMed Central

Zou, Ying-Ning; Wu, Qiang-Sheng; Huang, Yong-Ming; Ni, Qiu-Dan; He, Xin-Hua

2013-01-01

Proline accumulation was often correlated with drought tolerance of plants infected by arbuscular mycorrhizal fungi (AMF), whereas lower proline in some AM plants including citrus was also found under drought stress and the relevant mechanisms have not been fully elaborated. In this study proline accumulation and activity of key enzymes relative to proline biosynthesis (▵1-pyrroline-5-carboxylate synthetase, P5CS; ornithine-δ-aminotransferase, OAT) and degradation (proline dehydrogenase, ProDH) were determined in trifoliate orange (Poncirus trifoliata, a widely used citrus rootstock) inoculated with or without Funneliformis mosseae and under well-watered (WW) or water deficit (WD). AMF colonization significantly increased plant height, stem diameter, leaf number, root volume, biomass production of both leaves and roots and leaf relative water content, irrespectively of water status. Water deficit induced more tissue proline accumulation, in company with an increase of P5CS activity, but a decrease of OAT and ProDH activity, no matter whether under AM or no-AM. Compared with no-AM treatment, AM treatment resulted in lower proline concentration and content in leaf, root, and total plant under both WW and WD. The AMF colonization significantly decreased the activity of both P5CS and OAT in leaf, root, and total plant under WW and WD, except for an insignificant difference of root OAT under WD. The AMF inoculation also generally increased tissue ProDH activity under WW and WD. Plant proline content significantly positively correlated with plant P5CS activity, negatively with plant ProDH activity, but not with plant OAT activity. These results suggest that AM plants may suffer less from WD, thereby inducing lower proline accumulation, which derives from the integration of an inhibition of proline synthesis with an enhancement of proline degradation. PMID:24260421

Force-dependent isomerization kinetics of a highly conserved proline switch modulates the mechanosensing region of filamin

PubMed Central

Rognoni, Lorenz; Möst, Tobias; Žoldák, Gabriel; Rief, Matthias

2014-01-01

Proline switches, controlled by cis–trans isomerization, have emerged as a particularly effective regulatory mechanism in a wide range of biological processes. In this study, we use single-molecule mechanical measurements to develop a full kinetic and energetic description of a highly conserved proline switch in the force-sensing domain 20 of human filamin and how prolyl isomerization modulates the force-sensing mechanism. Proline isomerization toggles domain 20 between two conformations. A stable cis conformation with slow unfolding, favoring the autoinhibited closed conformation of filamin’s force-sensing domain pair 20–21, and a less stable, uninhibited conformation promoted by the trans form. The data provide detailed insight into the folding mechanisms that underpin the functionality of this binary switch and elucidate its remarkable efficiency in modulating force-sensing, thus combining two previously unconnected regulatory mechanisms, proline switches and mechanosensing. PMID:24706888

Disturbance alters local-regional richness relationships in appalachian forests

USGS Publications Warehouse

Belote, R.T.; Sanders, N.J.; Jones, R.H.

2009-01-01

Whether biological diversity within communities is limited by local interactions or regional species pools remains an important question in ecology. In this paper, we investigate how an experimentally applied tree-harvesting disturbance gradient influenced local-regional richness relationships. Plant species richness was measured at three spatial scales (2 ha = regional; 576 m2 and 1 m2 = local) on three occasions (one year pre-disturbance, one year post-disturbance, and 10 years post-disturbance) across five disturbance treatments (uncut control through clearcut) replicated throughout the southern Appalachian Mountains, USA. We investigated whether species richness in 576-m2 plots and 1-m2 subplots depended on species richness in 2-ha experimental units and whether this relationship changed through time before and after canopy disturbance. We found that, before disturbance, the relationship between local and regional richness was weak or nonexistent. One year after disturbance local richness was a positive function of regional richness, because local sites were colonized from the regional species pool. Ten years after disturbance, the positive relationship persisted, but the slope had decreased by half. These results suggest that disturbance can set the stage for strong influences of regional species pools on local community assembly in temperate forests. However, as time since disturbance increases, local controls on community assembly decouple the relationships between regional and local diversity. ?? 2009 by the Ecological Society of America.

Influence of proline position upon the ion channel activity of alamethicin.

PubMed Central

Kaduk, C; Duclohier, H; Dathe, M; Wenschuh, H; Beyermann, M; Molle, G; Bienert, M

1997-01-01

Alamethicin, a 20-residue peptaibol, induces voltage-dependent ion channels in lipid bilayers according to the barrel-stave model. To study relationships between the proline-14-induced kink region and the channel-forming behavior of the peptide, a set of alamethicin analogs with proline incorporated at positions 11, 12, 13, 14, 15, 16, and 17, respectively, as well as an analog with alanine instead of proline at position 14 were synthesized. Macroscopic conductance experiments show that the voltage dependence of the peptides is conserved although slightly influenced, but the apparent mean number of monomers forming the channels is significantly reduced when proline is not located at position 14. This is confirmed in single-channel experiments. The analogs with proline next to position 14 (i.e., 13, 15, 16) show stable conductance levels, but of reduced number, which follows the order Alam-P14 > Alam-P15 > Alam-P16 > Alam-P13. This reduction in the number of levels is connected with changes in the lifetime of the channels. Analogs with proline at position 11, 12, or 17 produce erratic, extremely short-lived current events that could not be resolved. The changes in functional properties are related to structural properties as probed by circular dichroism. The results indicate that proline at position 14 results in optimal channel activity, whereas channels formed by the analogs bearing proline at different positions are considerably less stable. PMID:9129817

Role of Interfacial Water Molecules in Proline-rich Ligand Recognition by the Src Homology 3 Domain of Abl*

PubMed Central

Palencia, Andres; Camara-Artigas, Ana; Pisabarro, M. Teresa; Martinez, Jose C.; Luque, Irene

2010-01-01

The interaction of Abl-Src homology 3 domain (SH3) with the high affinity peptide p41 is the most notable example of the inconsistency existing between the currently accepted description of SH3 complexes and their binding thermodynamic signature. We had previously hypothesized that the presence of interfacial water molecules is partially responsible for this thermodynamic behavior. We present here a thermodynamic, structural, and molecular dynamics simulation study of the interaction of p41 with Abl-SH3 and a set of mutants designed to alter the water-mediated interaction network. Our results provide a detailed description of the dynamic properties of the interfacial water molecules and a molecular interpretation of the thermodynamic effects elicited by the mutations in terms of the modulation of the water-mediated hydrogen bond network. In the light of these results, a new dual binding mechanism is proposed that provides a better description of proline-rich ligand recognition by Abl-SH3 and that has important implications for rational design. PMID:19906645

Contribution of proline to the pre-structuring tendency of transient helical secondary structure elements in intrinsically disordered proteins.

PubMed

Lee, Chewook; Kalmar, Lajos; Xue, Bin; Tompa, Peter; Daughdrill, Gary W; Uversky, Vladimir N; Han, Kyou-Hoon

2014-03-01

IDPs function without relying on three-dimensional structures. No clear rationale for such a behavior is available yet. PreSMos are transient secondary structures observed in the target-free IDPs and serve as the target-binding "active" motifs in IDPs. Prolines are frequently found in the flanking regions of PreSMos. Contribution of prolines to the conformational stability of the helical PreSMos in IDPs is investigated. MD simulations are performed for several IDP segments containing a helical PreSMo and the flanking prolines. To measure the influence of flanking-prolines on the structural content of a helical PreSMo calculations were done for wild type as well as for mutant segments with Pro→Asp, His, Lys, or Ala. The change in the helicity due to removal of a proline was measured both for the PreSMo region and for the flanking regions. The α-helical content in ~70% of the helical PreSMos at the early stage of simulation decreases due to replacement of an N-terminal flanking proline by other residues whereas the helix content in nearly all PreSMos increases when the same replacements occur at the C-terminal flanking region. The helix destabilizing/terminating role of the C-terminal flanking prolines is more pronounced than the helix promoting effect of the N-terminal flanking prolines. This work represents a novel example demonstrating that a proline is encoded in an IDP with a defined purpose. The helical PreSMos presage their target-bound conformations. As they most likely mediate IDP-target binding via conformational selection their helical content can be an important feature for IDP function. Copyright © 2013 Elsevier B.V. All rights reserved.

Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition

DOE PAGES

Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.; ...

2016-01-24

Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less

Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.

Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less

Salivary proline-rich protein may reduce tannin-iron chelation: a systematic narrative review.

PubMed

Delimont, Nicole M; Rosenkranz, Sara K; Haub, Mark D; Lindshield, Brian L

2017-01-01

Tannins are often cited for antinutritional effects, including chelation of non-heme iron. Despite this, studies exploring non-heme iron bioavailability inhibition with long-term consumption have reported mixed results. Salivary proline-rich proteins (PRPs) may mediate tannin-antinutritional effects on non-heme iron bioavailability. To review evidence regarding biochemical binding mechanisms and affinity states between PRPs and tannins, as well as effects of PRPs on non-heme iron bioavailability with tannin consumption in vivo. Narrative systematic review and meta-analysis. Common themes in biochemical modeling and affinity studies were collated for summary and synthesis; data were extracted from in vivo experiments for meta-analysis. Thirty-two studies were included in analysis. Common themes that positively influenced tannin-PRP binding included specificity of tannin-PRP binding, PRP and tannin stereochemistry. Hydrolyzable tannins have different affinities than condensed tannins when binding to PRPs. In vivo, hepatic iron stores and non-heme iron absorption are not significantly affected by tannin consumption ( d  = -0.64-1.84; -2.7-0.13 respectively), and PRP expression may increase non-heme iron bioavailability with tannin consumption. In vitro modeling suggests that tannins favor PRP binding over iron chelation throughout digestion. Hydrolyzable tannins are not representative of tannin impact on non-heme iron bioavailability in food tannins because of their unique structural properties and PRP affinities. With tannin consumption, PRP production is increased, and may be an initial line of defense against tannin-non-heme iron chelation in vivo . More research is needed to compare competitive binding of tannin-PRP to tannin-non-heme iron complexes, and elucidate PRPs' role in adaption to non-heme iron bioavailability in vivo.

Role of proline under changing environments

PubMed Central

Hayat, Shamsul; Hayat, Qaiser; Alyemeni, Mohammed Nasser; Wani, Arif Shafi; Pichtel, John; Ahmad, Aqil

2012-01-01

When exposed to stressful conditions, plants accumulate an array of metabolites, particularly amino acids. Amino acids have traditionally been considered as precursors to and constituents of proteins, and play an important role in plant metabolism and development. A large body of data suggests a positive correlation between proline accumulation and plant stress. Proline, an amino acid, plays a highly beneficial role in plants exposed to various stress conditions. Besides acting as an excellent osmolyte, proline plays three major roles during stress, i.e., as a metal chelator, an antioxidative defense molecule and a signaling molecule. Review of the literature indicates that a stressful environment results in an overproduction of proline in plants which in turn imparts stress tolerance by maintaining cell turgor or osmotic balance; stabilizing membranes thereby preventing electrolyte leakage; and bringing concentrations of reactive oxygen species (ROS) within normal ranges, thus preventing oxidative burst in plants. Reports indicate enhanced stress tolerance when proline is supplied exogenously at low concentrations. However, some reports indicate toxic effects of proline when supplied exogenously at higher concentrations. In this article, we review and discuss the effects of exogenous proline on plants exposed to various abiotic stresses. Numerous examples of successful application of exogenous proline to improve stress tolerance are presented. The roles played by exogenous proline under varying environments have been critically examined and reviewed. PMID:22951402

A conserved proline residue in the leucine zipper region of AtbZIP34 and AtbZIP61 in Arabidopsis thaliana interferes with the formation of homodimer.

PubMed

Shen, Huaishun; Cao, Kaiming; Wang, Xiping

2007-10-19

Two putative Arabidopsis E group bZIP transcript factors, AtbZIP34 and AtbZIP61, are nuclear-localized and their transcriptional activation domain is in their N-terminal region. By searching GenBank, we found other eight plant homologues of AtbZIP34 and AtbZIP61. All of them have a proline residue in the third heptad of zipper region. Yeast two-hybrid assay and EMSA showed that AtbZIP34 and AtbZIP61 could not form homodimer while their mutant forms, AtbZIP34m and AtbZIP61m, which the proline residue was replaced by an alanine residue in the zipper region, could form homodimer and bind G-box element. These results suggest that the conserved proline residue interferes with the homodimer formation. However, both AtbZIP34 and AtbZIP61 could form heterodimers with members of I group and S group transcription factors in which some members involved in vascular development. So we speculate that AtbZIP34 and AtbZIP61 may participate in plant development via interacting with other group bZIP transcription factors.

PROLINE OXIDASES IN HANSENULA SUBPELLICULOSA

PubMed Central

Ling, Chung-Mei; Hedrick, L. R.

1964-01-01

Ling, Chung-Mei (Illinois Institute of Technology, Chicago), and L. R. Hedrick. Proline oxidases in Hansenula subpelliculosa. J. Bacteriol. 87:1462–1470. 1964—Cells of Hansenula subpelliculosa can use l-proline as a carbon and a nitrogen source after a 6- to 8-hr induction period. However, they cannot use l-glutamate as both nitrogen and carbon sources unless the induction period is of several days' duration. Two l-proline oxidases were demonstrated in the mitochondrial preparation of this yeast. One forms the product Δ′-pyrroline-2-carboxylic acid (P2C), which is in equilibrium with α-keto-δ-amino-valeric acid; the other forms the product Δ′-pyrroline-5-carboxylic acid (P5C), which is in equilibrium with glutamic-γ-semialdehyde. The first-mentioned enzyme is induced when l-proline is the carbon source; the second appears to be constitutive, and is probably associated with the use of l-proline as a nitrogen source. The P2C-forming enzyme is specific for the l isomer of proline, and is inactive against l-hydroxyproline. The enzyme activity is at its peak when the mitochondria are prepared from logarithmically grown cells, and is rapidly reduced after cells reach the stationary phase of growth. Kinetic studies with varying concentrations of substrate indicate a Michaelis-Menten constant of 2.45 × 10−2m. Paper chromatographic studies, chemical tests with H2O2, sensitivity to freezing, and spectral measurements indicate that proline oxidase from H. subpelliculosa mitochondria forms a product from l-proline which is like, if not identical to, P2C formed by the action of sheep kidney d-proline oxidase upon dl-proline. The soluble portion of the cell extract contains NAD+ enzymes which use either P2C (α-keto-δ-amino-valeric acid) or P5C (glutamic-γ-semialdehyde) as substrates. No glutamic dehydrogenase activity could be detected when l-glutamic acid and the nicotinamide adenine dinucleotide (NAD+) cofactor were added to the supernatant solution with the

Gene Mining for Proline Based Signaling Proteins in Cell Wall of Arabidopsis thaliana

PubMed Central

Ihsan, Muhammad Z.; Ahmad, Samina J. N.; Shah, Zahid Hussain; Rehman, Hafiz M.; Aslam, Zubair; Ahuja, Ishita; Bones, Atle M.; Ahmad, Jam N.

2017-01-01

The cell wall (CW) as a first line of defense against biotic and abiotic stresses is of primary importance in plant biology. The proteins associated with cell walls play a significant role in determining a plant's sustainability to adverse environmental conditions. In this work, the genes encoding cell wall proteins (CWPs) in Arabidopsis were identified and functionally classified using geneMANIA and GENEVESTIGATOR with published microarrays data. This yielded 1605 genes, out of which 58 genes encoded proline-rich proteins (PRPs) and glycine-rich proteins (GRPs). Here, we have focused on the cellular compartmentalization, biological processes, and molecular functioning of proline-rich CWPs along with their expression at different plant developmental stages. The mined genes were categorized into five classes on the basis of the type of PRPs encoded in the cell wall of Arabidopsis thaliana. We review the domain structure and function of each class of protein, many with respect to the developmental stages of the plant. We have then used networks, hierarchical clustering and correlations to analyze co-expression, co-localization, genetic, and physical interactions and shared protein domains of these PRPs. This has given us further insight into these functionally important CWPs and identified a number of potentially new cell-wall related proteins in A. thaliana. PMID:28289422

Proline-rich proteins moderate the inhibitory effect of tea on iron absorption in rats.

PubMed

Kim, Hee-Seon; Miller, Dennis D

2005-03-01

Tea inhibits iron absorption in studies in which tea is given with radiolabeled iron to humans as a single dose. Our objective was to test the hypothesis that proline-rich proteins (PRPs) may act as a defense against this effect by forming complexes with tannins, thereby preventing them from inhibiting iron absorption. Two studies were conducted. In study 1, rats were given test solutions containing (59)FeCl(3) in water, tea, or tea + gelatin (T/G). In study 2, the rats were divided into 3 groups and assigned to one of 3 nutritionally complete diets: control, tea (5 g tea tannin/kg diet), or T/G (5 g tea tannin + 60 g gelatin/kg diet). Rats were fed the respective diets for 5 d and then given a single (59)Fe-labeled meal of the diet. Iron absorption was measured by whole-body retention of the (59)Fe over a 2-wk period. Iron absorption in study 1 was lower in the tea group (24 +/- 9.6%, P < 0.05) than in the T/G (42 +/- 19.4%) or water groups (50 +/- 7.5%). In study 2, iron absorption did not differ among the groups. Rats fed the tea diet had dramatic hypertrophy of the parotid salivary glands. Adding gelatin as a proxy for salivary PRPs to the tea eliminated the inhibitory effect of tea on iron absorption. The results suggest that PRPs, whether from salivary glands or diet, can protect against the inhibition of iron absorption by tea.

Salt stress encourages proline accumulation by regulating proline biosynthesis and degradation in Jerusalem artichoke plantlets.

PubMed

Huang, Zengrong; Zhao, Long; Chen, Dandan; Liang, Mingxiang; Liu, Zhaopu; Shao, Hongbo; Long, Xiaohua

2013-01-01

Proline accumulation is an important mechanism for osmotic regulation under salt stress. In this study, we evaluated proline accumulation profiles in roots, stems and leaves of Jerusalem artichoke (Helianthus tuberosus L.) plantlets under NaCl stress. We also examined HtP5CS, HtOAT and HtPDH enzyme activities and gene expression patterns of putative HtP5CS1, HtP5CS2, HtOAT, HtPDH1, and HtPDH2 genes. The objective of our study was to characterize the proline regulation mechanisms of Jerusalem artichoke, a moderately salt tolerant species, under NaCl stress. Jerusalem artichoke plantlets were observed to accumulate proline in roots, stems and leaves during salt stress. HtP5CS enzyme activities were increased under NaCl stress, while HtOAT and HtPDH activities generally repressed. Transcript levels of HtP5CS2 increased while transcript levels of HtOAT, HtPDH1 and HtPDH2 generally decreased in response to NaCl stress. Our results supports that for Jerusalem artichoke, proline synthesis under salt stress is mainly through the Glu pathway, and HtP5CS2 is predominant in this process while HtOAT plays a less important role. Both HtPDH genes may function in proline degradation.

Parameterization of the proline analogue Aze (azetidine-2-carboxylic acid) for molecular dynamics simulations and evaluation of its effect on homo-pentapeptide conformations.

PubMed

Bessonov, Kyrylo; Vassall, Kenrick A; Harauz, George

2013-02-01

We have parameterized and evaluated the proline homologue Aze (azetidine-2-carboxylic acid) for the gromos56a3 force-field for use in molecular dynamics simulations using GROMACS. Using bi-phasic cyclohexane/water simulation systems and homo-pentapeptides, we measured the Aze solute interaction potential energies, ability to hydrogen bond with water, and overall compaction, for comparison to Pro, Gly, and Lys. Compared to Pro, Aze has a slightly higher H-bonding potential, and stronger electrostatic but weaker non-electrostatic interactions with water. The 20-ns simulations revealed the preferential positioning of Aze and Pro at the interface of the water and cyclohexane layers, with Aze spending more time in the aqueous layer. We also demonstrated through simulations of the homo-pentapeptides that Aze has a greater propensity than Pro to undergo trans→cis peptide bond isomerization, which results in a severe 180° bend in the polypeptide chain. The results provide evidence for the hypothesis that the misincorporation of Aze within proline-rich regions of proteins could disrupt the formation of poly-proline type II structures and compromise events such as recognition and binding by SH3-domains. Copyright © 2012 Elsevier Inc. All rights reserved.

Possible Release of an ArgGlyArgProGln Pentapeptide with Innate Immunity Properties from Acidic Proline-Rich Proteins by Proteolytic Activity in Commensal Streptococcus and Actinomyces Species

PubMed Central

Li, Tong; Bratt, Per; Jonsson, Andreas P.; Ryberg, Mats; Johansson, Ingegerd; Griffiths, William J.; Bergman, Tomas; Strömberg, Nicklas

2000-01-01

This study suggests degradation of salivary acidic proline-rich proteins (PRPs) into potential innate-immunity-like peptides by oral Streptococcus and Actinomyces species. PRP degradation paralleled cleavage of Pro-containing substrates. PRP degradation by S. gordonii strain SK12 instantly released a Pyr1-Pro104Pro105 and a Gly111-Pro149Gln150 peptide together with a presumed Arg106Gly107Arg108Pro109Gln110 pentapeptide. The synthetic Arg106Gly107Arg108Pro109Gln110 peptide desorbed bound bacteria and counteracted sucrose-induced decrease of dental plaque pH in vitro. PMID:10948176

Improved Atomistic Monte Carlo Simulations Demonstrate that Poly-L-Proline Adopts Heterogeneous Ensembles of Conformations of Semi-Rigid Segments Interrupted by Kinks

PubMed Central

Radhakrishnan, Aditya; Vitalis, Andreas; Mao, Albert H.; Steffen, Adam T.; Pappu, Rohit V.

2012-01-01

Poly-L-proline (PLP) polymers are useful mimics of biologically relevant proline-rich sequences. Biophysical and computational studies of PLP polymers in aqueous solutions are challenging because of the diversity of length scales and the slow time scales for conformational conversions. We describe an atomistic simulation approach that combines an improved ABSINTH implicit solvation model, with conformational sampling based on standard and novel Metropolis Monte Carlo moves. Refinements to forcefield parameters were guided by published experimental data for proline-rich systems. We assessed the validity of our simulation results through quantitative comparisons to experimental data that were not used in refining the forcefield parameters. Our analysis shows that PLP polymers form heterogeneous ensembles of conformations characterized by semi-rigid, rod-like segments interrupted by kinks, which result from a combination of internal cis peptide bonds, flexible backbone ψ-angles, and the coupling between ring puckering and backbone degrees of freedom. PMID:22329658

Proline oxidase controls proline, glutamate, and glutamine cellular concentrations in a U87 glioblastoma cell line.

PubMed

Cappelletti, Pamela; Tallarita, Elena; Rabattoni, Valentina; Campomenosi, Paola; Sacchi, Silvia; Pollegioni, Loredano

2018-01-01

L-Proline is a multifunctional amino acid that plays an essential role in primary metabolism and physiological functions. Proline is oxidized to glutamate in the mitochondria and the FAD-containing enzyme proline oxidase (PO) catalyzes the first step in L-proline degradation pathway. Alterations in proline metabolism have been described in various human diseases, such as hyperprolinemia type I, velo-cardio-facial syndrome/Di George syndrome, schizophrenia and cancer. In particular, the mutation giving rise to the substitution Leu441Pro was identified in patients suffering of schizophrenia and hyperprolinemia type I. Here, we report on the expression of wild-type and L441P variants of human PO in a U87 glioblastoma human cell line in an attempt to assess their effect on glutamate metabolism. The subcellular localization of the flavoenzyme is not altered in the L441P variant, for which specific activity is halved compared to the wild-type PO. While this decrease in activity is significantly less than that previously proposed, an effect of the substitution on the enzyme stability is also apparent in our studies. At 24 hours of growth from transient transfection, the intracellular level of proline, glutamate, and glutamine is decreased in cells expressing the PO variants as compared to control U87 cells, reaching a similar figure at 72 h. On the other hand, the extracellular levels of the three selected amino acids show a similar time course for all clones. Furthermore, PO overexpression does not modify to a significant extent the expression of GLAST and GLT-1 glutamate transporters. Altogether, these results demonstrate that the proline pathway links cellular proline levels with those of glutamate and glutamine. On this side, PO might play a regulatory role in glutamatergic neurotransmission by affecting the cellular concentration of glutamate.

Evidence that COMT genotype and proline interact on negative-symptom outcomes in schizophrenia and bipolar disorder.

PubMed

Clelland, C L; Drouet, V; Rilett, K C; Smeed, J A; Nadrich, R H; Rajparia, A; Read, L L; Clelland, J D

2016-09-13

Elevated peripheral proline is associated with psychiatric disorders, and there is evidence that proline is a neuromodulator. The proline dehydrogenase (PRODH) gene, which encodes the enzyme that catalyzes proline catabolism, maps to human chromosome 22q11.2, a region conferring risk of schizophrenia. In the Prodh-null mouse, an interaction between elevated peripheral proline and another 22q11.2 gene, catechol-O-methyltransferase (COMT), on neurotransmission and behavior has been reported. We explored the relationship between fasting plasma proline levels and COMT Val(158)Met genotype on symptoms (positive, negative and total) in schizophrenia patients. In an exploratory study we also examined symptom change in patients with bipolar disorder. There was a significant interaction between peripheral proline and COMT on negative symptoms in schizophrenia (P<0.0001, n=95). In COMT Val/Val patients, high proline was associated with low Scale for the Assessment of Negative Symptom (SANS) scores. In contrast, high proline was associated with high SANS scores in patients carrying a Met allele. The relationship between proline and COMT also appears to modify negative symptoms across psychiatric illness. In bipolar disorder, a significant interaction was also observed on negative-symptom change (P=0.007, n=43). Negative symptoms are intractable and largely unaddressed by current medications. These data indicate a significant interaction between peripheral proline and COMT genotype, influencing negative symptoms in schizophrenia and bipolar disorder. That high proline has converse effects on symptoms by COMT genotype, may have implications for therapeutic decisions.

Proline: Mother Nature’s cryoprotectant applied to protein crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.

The amino acid l-proline is shown to be a good cryoprotectant for protein crystals. Four examples are provided; the range of proline used for cryoprotection is 2.0–3.0 M. l-Proline is one of Mother Nature’s cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that l-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included themore » commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6–8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration needed for cryoprotection of these crystals is in the range 2.0–3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that l-proline is an effective cryoprotectant for protein crystallography.« less

Proline: Mother Nature;s cryoprotectant applied to protein crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.

L-Proline is one of Mother Nature's cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that L-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included the commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6-8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration neededmore » for cryoprotection of these crystals is in the range 2.0-3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that L-proline is an effective cryoprotectant for protein crystallography.« less

Proline: Mother Nature’s cryoprotectant applied to protein crystallography

PubMed Central

Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.; Singh, Harkewal; Srivastava, Dhiraj; Tanner, John J.

2012-01-01

l-Proline is one of Mother Nature’s cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that l-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included the commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6–8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration needed for cryoprotection of these crystals is in the range 2.0–3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that l-proline is an effective cryoprotectant for protein crystallography. PMID:22868767

Pigeonpea Hybrid-Proline-Rich Protein (CcHyPRP) Confers Biotic and Abiotic Stress Tolerance in Transgenic Rice

PubMed Central

Mellacheruvu, Sunitha; Tamirisa, Srinath; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2016-01-01

In this study, we report the overexpression of Cajanus cajan hybrid-proline-rich protein encoding gene (CcHyPRP) in rice which resulted in increased tolerance to both abiotic and biotic stresses. Compared to the control plants, the transgenic rice lines, expressing CcHyPRP, exhibited high-level tolerance against major abiotic stresses, viz., drought, salinity, and heat, as evidenced by increased biomass, chlorophyll content, survival rate, root, and shoot growth. Further, transgenic rice lines showed increased panicle size and grain number compared to the control plants under different stress conditions. The CcHyPRP transgenics, as compared to the control, revealed enhanced activities of catalase and superoxide dismutase (SOD) enzymes and reduced malondialdehyde (MDA) levels. Expression pattern of CcHyPRP::GFP fusion-protein confirmed its predominant localization in cell walls. Moreover, the CcHyPRP transgenics, as compared to the control, exhibited increased resistance to the fungal pathogen Magnaporthe grisea which causes blast disease in rice. Higher levels of bZIP and endochitinase transcripts as well as endochitinase activity were observed in transgenic rice compared to the control plants. The overall results demonstrate the intrinsic role of CcHyPRP in conferring multiple stress tolerance at the whole-plant level. The multipotent CcHyPRP seems promising as a prime candidate gene to fortify crop plants for enhanced tolerance/resistance to different stress factors. PMID:26834756

The Sodium/Proline Transporter PutP of Helicobacter pylori

PubMed Central

Rivera-Ordaz, Araceli; Bracher, Susanne; Sarrach, Sannia; Li, Zheng; Shi, Lei; Quick, Matthias; Hilger, Daniel; Haas, Rainer; Jung, Heinrich

2013-01-01

Helicobacter pylori is cause of chronic gastritis, duodenal ulcer and gastric carcinoma in humans. L-proline is a preferred energy source of the microaerophilic bacterium. Previous analyses revealed that HpputP and HpputA, the genes that are predicted to play a central role in proline metabolism as they encode for the proline transporter and proline dehydrogenase, respectively, are essential for stomach colonization. Here, the molecular basis of proline transport in H. pylori by HpPutP was investigated experimentally for the first time. Measuring radiolabeled substrate transport in H. pylori and E. coli heterologously expressing HpputP as well as in proteoliposomes reconstituted with HpPutP, we demonstrate that the observed proline transport in H. pylori is mediated by HpPutP. HpPutP is specific and exhibits a high affinity for L-proline. Notably, L-proline transport is exclusively dependent on Na+ as coupling ion, i.e., Na+/L-proline symport, reminiscent to the properties of PutP of E. coli even though H. pylori lives in a more acidic environment. Homology model-based structural comparisons and substitution analyses identified amino acids crucial for function. HpPutP-catalyzed proline uptake was efficiently inhibited by the known proline analogs 3,4-dehydro-D,L-proline and L-azetidine-2-carboxylic acid. PMID:24358297

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

Sinorhizobium meliloti Chemoreceptor McpU Mediates Chemotaxis toward Host Plant Exudates through Direct Proline Sensing

PubMed Central

Webb, Benjamin A.; Hildreth, Sherry; Helm, Richard F.

2014-01-01

Bacterial chemotaxis is an important attribute that aids in establishing symbiosis between rhizobia and their legume hosts. Plant roots and seeds exude a spectrum of molecules into the soil to attract their bacterial symbionts. The alfalfa symbiont Sinorhizobium meliloti possesses eight chemoreceptors to sense its environment and mediate chemotaxis toward its host. The methyl accepting chemotaxis protein McpU is one of the more abundant S. meliloti chemoreceptors and an important sensor for the potent attractant proline. We established a dominant role of McpU in sensing molecules exuded by alfalfa seeds. Mass spectrometry analysis determined that a single germinating seed exudes 3.72 nmol of proline, producing a millimolar concentration near the seed surface which can be detected by the chemosensory system of S. meliloti. Complementation analysis of the mcpU deletion strain verified McpU as the key proline sensor. A structure-based homology search identified tandem Cache (calcium channels and chemotaxis receptors) domains in the periplasmic region of McpU. Conserved residues Asp-155 and Asp-182 of the N-terminal Cache domain were determined to be important for proline sensing by evaluating mutant strains in capillary and swim plate assays. Differential scanning fluorimetry revealed interaction of the isolated periplasmic region of McpU (McpU40-284) with proline and the importance of Asp-182 in this interaction. Using isothermal titration calorimetry, we determined that proline binds with a Kd (dissociation constant) of 104 μM to McpU40-284, while binding was abolished when Asp-182 was substituted by Glu. Our results show that McpU is mediating chemotaxis toward host plants by direct proline sensing. PMID:24657863

Cooperative Formation of Icosahedral Proline Clusters from Dimers

NASA Astrophysics Data System (ADS)

Jacobs, Alexander D.; Jovan Jose, K. V.; Horness, Rachel; Raghavachari, Krishnan; Thielges, Megan C.; Clemmer, David E.

2018-01-01

Ion mobility spectrometry-mass spectrometry and Fourier transform infrared spectroscopy (FTIR) techniques were combined with quantum chemical calculations to examine the origin of icosahedral clusters of the amino acid proline. When enantiopure proline solutions are electrosprayed (using nanospray) from 100 mM ammonium acetate, only three peaks are observed in the mass spectrum across a concentration range of five orders of magnitude: a monomer [Pro+H]+ species, favored from 0.001 to 0.01 mM proline concentrations; a dimer [2Pro+H]+ species, the most abundant species for proline concentrations above 0.01 mM; and, the dimer and dodecamer [12Pro+2H]2+ for 1.0 mM and more concentrated proline solutions. Electrospraying racemic D/ L-proline solutions from 100 mM ammonium acetate leads to a monomer at low proline concentrations (0.001 to 0.1 mM), and a dimer at higher concentrations (>0.09 mM), as well as a very small population of 8 to 15 Pro clusters that comprise <0.1% of the total ion signals even at the highest proline concentration. Solution FTIR studies show unique features that increase in intensity in the enantiopure proline solutions, consistent with clustering, presumably from the icosahedral geometry in bulk solution. When normalized for the total proline, these results are indicative of a cooperative formation of the enantiopure 12Pro species from 2Pro. [Figure not available: see fulltext.

Regional and local species richness in an insular environment: Serpentine plants in California

USGS Publications Warehouse

Harrison, S.; Safford, H.D.; Grace, J.B.; Viers, J.H.; Davies, K.F.

2006-01-01

We asked how the richness of the specialized (endemic) flora of serpentine rock outcrops in California varies at both the regional and local scales. Our study had two goals: first, to test whether endemic richness is affected by spatial habitat structure (e.g., regional serpentine area, local serpentine outcrop area, regional and local measures of outcrop isolation), and second, to conduct this test in the context of a broader assessment of environmental influences (e.g., climate, soils, vegetation, disturbance) and historical influences (e.g., geologic age, geographic province) on local and regional species richness. We measured endemic and total richness and environmental variables in 109 serpentine sites (1000-m2 paired plots) in 78 serpentine-containing regions of the state. We used structural equation modeling (SEM) to simultaneously relate regional richness to regionalscale predictors, and local richness to both local-scale and regional-scale predictors. Our model for serpentine endemics explained 66% of the variation in local endemic richness based on local environment (vegetation, soils, rock cover) and on regional endemic richness. It explained 73% of the variation in regional endemic richness based on regional environment (climate and productivity), historical factors (geologic age and geographic province), and spatial structure (regional total area of serpentine, the only significant spatial variable in our analysis). We did not find a strong influence of spatial structure on species richness. However, we were able to distinguish local vs. regional influences on species richness to a novel extent, despite the existence of correlations between local and regional conditions. ?? 2006 by the Ecological Society of America.

Experimental and Molecular Modeling Evaluation of the Physicochemical Properties of Proline-Based Deep Eutectic Solvents.

PubMed

van den Bruinhorst, Adriaan; Spyriouni, Theodora; Hill, Jörg-Rüdiger; Kroon, Maaike C

2018-01-11

The liquid range and applicability of deep eutectic solvents (DESs) are determined by their physicochemical properties. In this work, the physicochemical properties of glycolic acid:proline and malic acid:proline were evaluated experimentally and with MD simulations at five different ratios. Both DESs exhibited esterification upon preparation, which affected the viscosity in particular. In order to minimize oligomer formation and water release, three different experimental preparation methods were explored, but none could prevent esterification. The experimental and calculated densities of the DESs were found to be in good agreement. The measured and modeled glass transition temperature showed similar trends with composition, as did the experimental viscosity and the calculated diffusivities. The MD simulations provided additional insight at the atomistic level, showing that at acid-rich compositions, the acid-acid hydrogen bonding (HB) interactions prevail. Malic acid-based DESs show stronger acid-acid HB interactions than glycolic acid-based ones, possibly explaining its extreme viscosity. Upon the addition of proline, the interspecies interactions become predominant, confirming the formation of the widely assumed HB network between the DESs constituents in the liquid phase.

The Effects of Threonine Phosphorylation on the Stability and Dynamics of the Central Molecular Switch Region of 18.5-kDa Myelin Basic Protein

PubMed Central

De Avila, Miguel; Polverini, Eugenia; Harauz, George

2013-01-01

The classic isoforms of myelin basic protein (MBP) are essential for the formation and maintenance of myelin in the central nervous system of higher vertebrates. The protein is involved in all facets of the development, compaction, and stabilization of the multilamellar myelin sheath, and also interacts with cytoskeletal and signaling proteins. The predominant 18.5-kDa isoform of MBP is an intrinsically-disordered protein that is a candidate auto-antigen in the human demyelinating disease multiple sclerosis. A highly-conserved central segment within classic MBP consists of a proline-rich region (murine 18.5-kDa sequence –T92-P93-R94-T95-P96-P97-P98-S99–) containing a putative SH3-ligand, adjacent to a region that forms an amphipathic α-helix (P82-I90) upon interaction with membranes, or under membrane-mimetic conditions. The T92 and T95 residues within the proline-rich region can be post-translationally modified through phosphorylation by mitogen-activated protein (MAP) kinases. Here, we have investigated the structure of the α-helical and proline-rich regions in dilute aqueous buffer, and have evaluated the effects of phosphorylation at T92 and T95 on the stability and dynamics of the α-helical region, by utilizing four 36-residue peptides (S72–S107) with differing phosphorylation status. Nuclear magnetic resonance spectroscopy reveals that both the α-helical as well as the proline-rich regions are disordered in aqueous buffer, whereas they are both structured in a lipid environment (cf., Ahmed et al., Biochemistry 51, 7475-9487, 2012). Thermodynamic analysis of trifluoroethanol-titration curves monitored by circular dichroism spectroscopy reveals that phosphorylation, especially at residue T92, impedes formation of the amphipathic α-helix. This conclusion is supported by molecular dynamics simulations, which further illustrate that phosphorylation reduces the folding reversibility of the α-helix upon temperature perturbation and affect the global

The effects of threonine phosphorylation on the stability and dynamics of the central molecular switch region of 18.5-kDa myelin basic protein.

PubMed

Vassall, Kenrick A; Bessonov, Kyrylo; De Avila, Miguel; Polverini, Eugenia; Harauz, George

2013-01-01

The classic isoforms of myelin basic protein (MBP) are essential for the formation and maintenance of myelin in the central nervous system of higher vertebrates. The protein is involved in all facets of the development, compaction, and stabilization of the multilamellar myelin sheath, and also interacts with cytoskeletal and signaling proteins. The predominant 18.5-kDa isoform of MBP is an intrinsically-disordered protein that is a candidate auto-antigen in the human demyelinating disease multiple sclerosis. A highly-conserved central segment within classic MBP consists of a proline-rich region (murine 18.5-kDa sequence -T92-P93-R94-T95-P96-P97-P98-S99-) containing a putative SH3-ligand, adjacent to a region that forms an amphipathic α-helix (P82-I90) upon interaction with membranes, or under membrane-mimetic conditions. The T92 and T95 residues within the proline-rich region can be post-translationally modified through phosphorylation by mitogen-activated protein (MAP) kinases. Here, we have investigated the structure of the α-helical and proline-rich regions in dilute aqueous buffer, and have evaluated the effects of phosphorylation at T92 and T95 on the stability and dynamics of the α-helical region, by utilizing four 36-residue peptides (S72-S107) with differing phosphorylation status. Nuclear magnetic resonance spectroscopy reveals that both the α-helical as well as the proline-rich regions are disordered in aqueous buffer, whereas they are both structured in a lipid environment (cf., Ahmed et al., Biochemistry 51, 7475-9487, 2012). Thermodynamic analysis of trifluoroethanol-titration curves monitored by circular dichroism spectroscopy reveals that phosphorylation, especially at residue T92, impedes formation of the amphipathic α-helix. This conclusion is supported by molecular dynamics simulations, which further illustrate that phosphorylation reduces the folding reversibility of the α-helix upon temperature perturbation and affect the global structure

Positional preference of proline in alpha-helices.

PubMed Central

Kim, M. K.; Kang, Y. K.

1999-01-01

Conformational free energy calculations have been carried out for proline-containing alanine-based pentadecapeptides with the sequence Ac-(Ala)n-Pro-(Ala)m-NHMe, where n + m = 14, to figure out the positional preference of proline in alpha-helices. The relative free energy of each peptide was calculated by subtracting the free energy of the extended conformation from that of the alpha-helical one, which is used here as a measure of preference. The highest propensity is found for the peptide with proline at the N-terminus (i.e., Ncap + 1 position), and the next propensities are found at Ncap, N' (Ncap - 1), and C' (Ccap + 1) positions. These computed results are reasonably consistent with the positional propensities estimated from X-ray structures of proteins. The breaking in hydrogen bonds around proline is found to play a role in destabilizing alpha-helical conformations, which, however, provides the favored hydration of the corresponding N-H and C=O groups. The highest preference of proline at the beginning of alpha-helix appears to be due to the favored electrostatic and nonbonded energies between two residues preceding proline and the intrinsic stability of alpha-helical conformation of the proline residue itself as well as no disturbance in hydrogen bonds of alpha-helix by proline. The average free energy change for the substitution of Ala by Pro in a alpha-helix is computed to be 4.6 kcal/mol, which is in good agreement with the experimental value of approximately 4 kcal/mol estimated for an oligopeptide dimer and proteins of barnase and T4 lysozyme. PMID:10422838

Study of intermolecular contacts in the proline-rich homeodomain (PRH)-DNA complex using molecular dynamics simulations.

PubMed

Jalili, Seifollah; Karami, Leila

2012-03-01

The proline-rich homeodomain (PRH)-DNA complex consists of a protein with 60 residues and a 13-base-pair DNA. The PRH protein is a transcription factor that plays a key role in the regulation of gene expression. PRH is a significant member of the Q50 class of homeodomain proteins. The homeodomain section of PRH is essential for binding to DNA and mediates sequence-specific DNA binding. Three 20-ns molecular dynamics (MD) simulations (free protein, free DNA and protein-DNA complex) in explicit solvent water were performed to elucidate the intermolecular contacts in the PRH-DNA complex and the role of dynamics of water molecules forming water-mediated contacts. The simulation provides a detailed explanation of the trajectory of hydration water molecules. The simulations show that some water molecules in the protein-DNA interface exchange with bulk waters. The simulation identifies that most of the contacts consisted of direct interactions between the protein and DNA including specific and non-specific contacts, but several water-mediated polar contacts were also observed. The specific interaction between Gln50 and C18 and water-mediated hydrogen bond between Gln50 and T7 were found to be present during almost the entire time of the simulation. These results show good consistency with experimental and previous computational studies. Structural properties such as root-mean-square deviations (RMSD), root-mean-square fluctuations (RMSF) and secondary structure were also analyzed as a function of time. Analyses of the trajectories showed that the dynamic fluctuations of both the protein and the DNA were lowered by the complex formation.

Structural Characterization of Proline-rich Tyrosine Kinase 2 (PYK2) Reveals a Unique (DFG-out) Conformation and Enables Inhibitor Design

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Seungil; Mistry, Anil; Chang, Jeanne S.

Proline-rich tyrosine kinase 2 (PYK2) is a cytoplasmic, non-receptor tyrosine kinase implicated in multiple signaling pathways. It is a negative regulator of osteogenesis and considered a viable drug target for osteoporosis treatment. The high-resolution structures of the human PYK2 kinase domain with different inhibitor complexes establish the conventional bilobal kinase architecture and show the conformational variability of the DFG loop. The basis for the lack of selectivity for the classical kinase inhibitor, PF-431396, within the FAK family is explained by our structural analyses. Importantly, the novel DFG-out conformation with two diarylurea inhibitors (BIRB796, PF-4618433) reveals a distinct subclass of non-receptormore » tyrosine kinases identifiable by the gatekeeper Met-502 and the unique hinge loop conformation of Leu-504. This is the first example of a leucine residue in the hinge loop that blocks the ATP binding site in the DFG-out conformation. Our structural, biophysical, and pharmacological studies suggest that the unique features of the DFG motif, including Leu-504 hinge-loop variability, can be exploited for the development of selective protein kinase inhibitors.« less

Effects of proline cis-trans isomerization on TB domain secondary structure.

PubMed Central

Yuan, X.; Werner, J. M.; Knott, V.; Handford, P. A.; Campbell, I. D.; Downing, K.

1998-01-01

The transforming growth factor beta (TGF-beta) binding protein-like (TB) domain is found principally in proteins localized to extracellular matrix fibrils, including human fibrillin-1, the defective protein in the Marfan syndrome. Analysis of the nuclear magnetic resonance (NMR) data for the sixth TB module from human fibrillin-1 has revealed the existence of two stable conformers that differ in the isomerization states of two proline residues. Unusually, the two isoforms do not readily interconvert and are stable on the time scale of milliseconds. We have computed independent structures of the major and minor conformers of TB6 to assess how the domain fold adjusts to incorporate alternatively cis- or trans-prolines. Based on previous observations, it has been suggested that multiple conformers can only be accommodated in flexible regions of protein structure. In contrast, P22, which exists in trans in the major form and cis in the minor form of TB6, is in a rigid region of the domain, which is confirmed by backbone dynamics measurements. Overall, the structures of the major and minor conformers are similar. However, the secondary structure topologies of the two forms differ as a direct consequence of the changes in proline conformation. PMID:9792099

Synthesis, spectral characterization and biological studies of some organotin(IV) complexes of L-proline, trans-hydroxy- L-proline and L-glutamine

NASA Astrophysics Data System (ADS)

Nath, Mala; Jairath, Ruchi; Eng, George; Song, Xueqing; Kumar, Ashok

2005-12-01

New organotin(IV) complexes of the general formula R 3Sn(L) (where R = Me, n-Bu and HL = L-proline; R = Me, Ph and HL = trans-hydroxy- L-proline and L-glutamine) and R 2Sn(L) 2 (where R = n-Bu, Ph and HL = L-proline; R = Ph, HL = trans-hydroxy- L-proline) have been synthesized by the reaction of R nSnCl 4- n (where n = 2 or 3) with sodium salt of the amino acid (HL). n-Bu 2Sn(Pro) 2 was synthesized by the reaction of n-Bu 2SnO with L-proline under azeotropic removal of water. The bonding and coordination behavior in these complexes have been discussed on the basis of IR and 119Sn Mössbauer spectroscopic studies in the solid-state. Their coordination behavior in solution has been discussed with the help of multinuclear ( 1H, 13C and 119Sn) NMR spectral studies. The 119Sn Mössbauer and IR studies indicate that L-proline and trans-hydroxy- L-proline show similar coordination behavior towards organotin(IV) compounds. Pentacoordinate trigonal-bipyramidal and hexacoordinate octahedral structures, respectively, have been proposed for the tri- and diorganotin(IV) complexes of L-proline and trans-hydroxy- L-proline, in which the carboxylate group acts as bidentate group. L-Glutamine shows different coordination behavior towards organotin(IV) compounds, it acts as monoanionic bidentate ligand coordinating through carboxylate and amino group. The triorganotin(IV) complexes of L-glutamine have been proposed to have trigonal-bipyramidal environment around tin. The newly synthesized complexes have been tested for their antiinflammatory and cardiovascular activities. Their LD 50 values are >1000 mg kg -1.

A rapid, ideal, and eco-friendlier protocol for quantifying proline.

PubMed

Shabnam, Nisha; Tripathi, Indu; Sharmila, P; Pardha-Saradhi, P

2016-11-01

Proline, a stress marker, is routinely quantified by a protocol that essentially uses hazardous toluene. Negative impacts of toluene on human health prompted us to develop a reliable alternate protocol for proline quantification. Absorbance of the proline-ninhydrin condensation product formed by reaction of proline with ninhydrin at 100 °C in the reaction mixture was significantly higher than that recorded after its transfer to toluene, revealing that toluene lowers sensitivity of this assay. λ max of the proline-ninhydrin complex in the reaction mixture and toluene were 508 and 513 nm, respectively. Ninhydrin in glacial acetic acid yielded higher quantity of the proline-ninhydrin condensation product compared to ninhydrin in mixture of glacial acetic acid and H 3 PO 4 , indicating negative impact of H 3 PO 4 on proline quantification. Further, maximum yield of the proline-ninhydrin complex with ninhydrin in glacial acetic acid and ninhydrin in mixture of glacial acetic acid and H 3 PO 4 was achieved within 30 and 60 min, respectively. This revealed that H 3 PO 4 has negative impact on the reaction rate and quantity of the proline-ninhydrin complex formed. In brief, our proline quantification protocol involves reaction of a 1-ml proline sample with 2 ml of 1.25 % ninhydrin in glacial acetic acid at 100 °C for 30 min, followed by recording absorbance of the proline-ninhydrin condensation product in the reaction mixture itself at 508 nm. Amongst proline quantification protocols known till date, our protocol is the most simple, rapid, reliable, cost-effective, and eco-friendlier.

Specific serine-proline phosphorylation and glycogen synthase kinase 3β-directed subcellular targeting of stathmin 3/Sclip in neurons.

PubMed

Devaux, Sara; Poulain, Fabienne E; Devignot, Véronique; Lachkar, Sylvie; Irinopoulou, Theano; Sobel, André

2012-06-22

During nervous system development, neuronal growth, migration, and functional morphogenesis rely on the appropriate control of the subcellular cytoskeleton including microtubule dynamics. Stathmin family proteins play major roles during the various stages of neuronal differentiation, including axonal growth and branching, or dendritic development. We have shown previously that stathmins 2 (SCG10) and 3 (SCLIP) fulfill distinct, independent and complementary regulatory roles in axonal morphogenesis. Although the two proteins have been proposed to display the four conserved phosphorylation sites originally identified in stathmin 1, we show here that they possess distinct phosphorylation sites within their specific proline-rich domains (PRDs) that are differentially regulated by phosphorylation by proline-directed kinases involved in the control of neuronal differentiation. ERK2 or CDK5 phosphorylate the two proteins but with different site specificities. We also show for the first time that, unlike stathmin 2, stathmin 3 is a substrate for glycogen synthase kinase (GSK) 3β both in vitro and in vivo. Interestingly, stathmin 3 phosphorylated at its GSK-3β target site displays a specific subcellular localization at neuritic tips and within the actin-rich peripheral zone of the growth cone of differentiating hippocampal neurons in culture. Finally, pharmacological inhibition of GSK-3β induces a redistribution of stathmin 3, but not stathmin 2, from the periphery toward the Golgi region of neurons. Stathmin proteins can thus be either regulated locally or locally targeted by specific phosphorylation, each phosphoprotein of the stathmin family fulfilling distinct and specific roles in the control of neuronal differentiation.

On the Split Personality of Penultimate Proline

PubMed Central

Glover, Matthew S.; Shi, Liuqing; Fuller, Daniel R.; Arnold, Randy J.; Radivojac, Predrag; Clemmer, David E.

2014-01-01

The influence of the position of the amino acid proline in polypeptide sequences is examined by a combination of ion mobility spectrometry-mass spectrometry (IMS-MS), amino acid substitutions, and molecular modeling. The results suggest that when proline exists as the second residue from the N-terminus (i.e., penultimate proline), two families of conformers are formed. We demonstrate the existence of these families by a study of a series of truncated and mutated peptides derived from the 11-residue peptide Ser1-Pro2-Glu3-Leu4-Pro5-Ser6-Pro7-Gln8-Ala9-Glu10-Lys11. We find that every peptide from this sequence with a penultimate proline residue has multiple conformations. Substitution of Ala for Pro residues indicates that multiple conformers arise from the cis- trans isomerization of Xaa1–Pro2 peptide bonds as Xaa–Ala peptide bonds are unlikely to adopt the cis isomer, and examination of spectra from a library of 58 peptides indicates that ~80% of sequences show this effect. A simple mechanism suggesting that the barrier between the cis-and trans-proline forms is lowered because of low steric impedance is proposed. This observation may have interesting biological implications as well, and we note that a number of biologically active peptides have penultimate proline residues. PMID:25503299

Inhibition of PKR Activation by the Proline-Rich RNA Binding Domain of the Herpes Simplex Virus Type 1 Us11 Protein

PubMed Central

Poppers, Jeremy; Mulvey, Matthew; Khoo, David; Mohr, Ian

2000-01-01

Upon activation by double-stranded RNA in virus-infected cells, the cellular PKR kinase phosphorylates the translation initiation factor eukaryotic initiation factor 2 (eIF2) and thereby inhibits protein synthesis. The γ34.5 and Us11 gene products encoded by herpes simplex virus type 1 (HSV-1) are dedicated to preventing the accumulation of phosphorylated eIF2. While the γ34.5 gene specifies a regulatory subunit for protein phosphatase 1α, the Us11 gene encodes an RNA binding protein that also prevents PKR activation. γ34.5 mutants fail to grow on a variety of human cells as phosphorylated eIF2 accumulates and protein synthesis ceases prior to the completion of the viral life cycle. We demonstrate that expression of a 68-amino-acid fragment of Us11 containing a novel proline-rich basic RNA binding domain allows for sustained protein synthesis and enhanced growth of γ34.5 mutants. Furthermore, this fragment is sufficient to inhibit activation of the cellular PKR kinase in a cell-free system, suggesting that the intrinsic activities of this small fragment, notably RNA binding and ribosome association, may be required to prevent PKR activation. PMID:11070019

Inhibition of PKR activation by the proline-rich RNA binding domain of the herpes simplex virus type 1 Us11 protein.

PubMed

Poppers, J; Mulvey, M; Khoo, D; Mohr, I

2000-12-01

Upon activation by double-stranded RNA in virus-infected cells, the cellular PKR kinase phosphorylates the translation initiation factor eukaryotic initiation factor 2 (eIF2) and thereby inhibits protein synthesis. The gamma 34.5 and Us11 gene products encoded by herpes simplex virus type 1 (HSV-1) are dedicated to preventing the accumulation of phosphorylated eIF2. While the gamma 34.5 gene specifies a regulatory subunit for protein phosphatase 1 alpha, the Us11 gene encodes an RNA binding protein that also prevents PKR activation. gamma 34.5 mutants fail to grow on a variety of human cells as phosphorylated eIF2 accumulates and protein synthesis ceases prior to the completion of the viral life cycle. We demonstrate that expression of a 68-amino-acid fragment of Us11 containing a novel proline-rich basic RNA binding domain allows for sustained protein synthesis and enhanced growth of gamma 34.5 mutants. Furthermore, this fragment is sufficient to inhibit activation of the cellular PKR kinase in a cell-free system, suggesting that the intrinsic activities of this small fragment, notably RNA binding and ribosome association, may be required to prevent PKR activation.

β-Sheet Containment by Flanking Prolines: Molecular Dynamic Simulations of the Inhibition of β-Sheet Elongation by Proline Residues in Human Prion Protein

PubMed Central

Shamsir, Mohd S.; Dalby, Andrew R.

2007-01-01

Previous molecular dynamic simulations have reported elongation of the existing β-sheet in prion proteins. Detailed examination has shown that these elongations do not extend beyond the proline residues flanking these β-sheets. In addition, proline has also been suggested to possess a possible structural role in preserving protein interaction sites by preventing invasion of neighboring secondary structures. In this work, we have studied the possible structural role of the flanking proline residues by simulating mutant structures with alternate substitution of the proline residues with valine. Simulations showed a directional inhibition of elongation, with the elongation progressing in the direction of valine including evident inhibition of elongation by existing proline residues. This suggests that the flanking proline residues in prion proteins may have a containment role and would confine the β-sheet within a specific length. PMID:17172295

Chirally directed formation of nanometer-scale proline clusters.

PubMed

Myung, Sunnie; Fioroni, Marco; Julian, Ryan R; Koeniger, Stormy L; Baik, Mu-Hyun; Clemmer, David E

2006-08-23

Ion mobility measurements, combined with molecular mechanics simulations, are used to study enantiopure and racemic proline clusters formed by electrospray ionization. Broad distributions of cluster sizes and charge states are observed, ranging from clusters containing only a few proline units to clusters that contain more than 100 proline units (i.e., protonated clusters of the form [xPro + nH](n+) with x = 1 to >100 and n = 1-7). As the sizes of clusters increase, there is direct evidence for nanometer scale, chirally induced organization into specific structures. For n = 4 and 5, enantiopure clusters of approximately 50 to 100 prolines assemble into structures that are more elongated than the most compact structure that is observed from the racemic proline clusters. A molecular analogue, cis-4-hydroxy-proline, displays significantly different behavior, indicating that in addition to the rigidity of the side chain ring, intermolecular interactions are important in the formation of chirally directed clusters. This is the first case in which assemblies of chirally selective elongated structures are observed in this size range of amino acid clusters. Relationships between enantiopurity, cluster shape, and overall energetics are discussed.

Chirality transfer effects in proline-substituted coumarin compounds.

PubMed

Park, Eun-Kyung; Park, Bongjeong; Choi, Jun-Ho; Choi, Kihang; Cho, Minhaeng

2009-08-13

Conformations of proline-substituted chromophores are determined by using circular dichroism (CD) spectroscopy and quantum chemistry calculation method. Coumarin is chosen for the optical chromophore and proline amino acid is attached to its C7 position. The coumarin-proline conjugate considered contains both fluorophore and peptide linker where any polypeptides or biomolecules can be additionally connected to the free carboxyl group of the proline. Thus, the coumarin-proline is a potentially useful composite chirality-probe system for studies of protein dynamics in solution. However, detailed conformation of coumarin ring with respect to the proline ring has to be determined first. We found that there are two possible conformers, which differ from each other by the relative orientation of the coumarin ring. Comparing the measured CD spectra with the calculated ones, we directly show that only one of the two conformers is dominant in polar solvents except for water. The present study suggests that the local structure around an optical chromophore, when it is introduced to polypeptides or other biomolecules, can be studied by examining the electronic optical activity of the probe chromophore, as long as the chirality transfer from the attached amino acid to the chromophore is significantly large.

Proline-Dependent Regulation of Clostridium difficile Stickland Metabolism

PubMed Central

Bouillaut, Laurent; Self, William T.

2013-01-01

Clostridium difficile, a proteolytic Gram-positive anaerobe, has emerged as a significant nosocomial pathogen. Stickland fermentation reactions are thought to be important for growth of C. difficile and appear to influence toxin production. In Stickland reactions, pairs of amino acids donate and accept electrons, generating ATP and reducing power in the process. Reduction of the electron acceptors proline and glycine requires the d-proline reductase (PR) and the glycine reductase (GR) enzyme complexes, respectively. Addition of proline in the medium increases the level of PR protein but decreases the level of GR. We report the identification of PrdR, a protein that activates transcription of the PR-encoding genes in the presence of proline and negatively regulates the GR-encoding genes. The results suggest that PrdR is a central metabolism regulator that controls preferential utilization of proline and glycine to produce energy via the Stickland reactions. PMID:23222730

Coarse-grained modeling of proline rich protein 1 (PRP-1) in bulk solution and adsorbed to a negatively charged surface.

PubMed

Skepö, Marie; Linse, Per; Arnebrant, Thomas

2006-06-22

Structural properties of the acidic proline rich protein PRP-1 of salivary origin in bulk solution and adsorbed onto a negatively charged surface have been studied by Monte Carlo simulations. A simple model system with focus on electrostatic interactions and short-ranged attractions among the uncharged amino acids has been used. In addition to PRP-1, some mutants were considered to assess the role of the interactions in the systems. Contrary to polyelectrolytes, the protein has a compact structure in salt-free bulk solutions, whereas at high salt concentration the protein becomes more extended. The protein adsorbs to a negatively charged surface, although its net charge is negative. The adsorbed protein displays an extended structure, which becomes more compact upon addition of salt. Hence, the conformational response upon salt addition in the adsorbed state is the opposite as compared to that in bulk solution. The conformational behavior of PRP-1 in bulk solution and at charged surfaces as well as its propensity to adsorb to surfaces with the same net charge are rationalized by the block polyampholytic character of the protein. The presence of a triad of positively charged amino acids in the C-terminal was found to be important for the adsorption of the protein.

Tissue distribution in mice of BPP 10c, a potent proline-rich anti-hypertensive peptide of Bothrops jararaca.

PubMed

Silva, Carlos A; Portaro, Fernanda C V; Fernandes, Beatriz L; Ianzer, Danielle A; Guerreiro, Juliano R; Gomes, Claudiana L; Konno, Katsuhiro; Serrano, Solange M T; Nascimento, Nanci; Camargo, Antonio C M

2008-03-15

The snake venom proline-rich peptide BPP 10c is an active somatic angiotensin-converting enzyme (sACE) inhibitors. Recently we demonstrated that the anti-hypertensive effect of BPP 10c is not related to the inhibition of sACE alone, thus suggesting that this enzyme is not its only target for blood pressure reduction. In the present work, a biodistribution study in Swiss mice of [(125)I]-BPP 10c in the absence or in the presence of a saturating concentration of captopril, a selective active-site inhibitor of sACE, demonstrated that: (1) [(125)I]-BPP 10c was present in several organs and the renal absorption was significantly high; (2) [(125)I]-BPP 10c showed a clear preference for the kidney, maintaining a high concentration in this organ in the presence of captopril for at least 3h; (3) The residual amount of [(125)I]-BPP 10c in the kidney of animals simultaneously treated with captopril suggest that the peptide can interact with other targets different from sACE in this organ. We also showed that Cy3-labeled BPP 10c was internalized by human embryonic kidney cells (HEK-293T). Taken together, these results suggest that sACE inhibition by captopril affects the tissue distribution of [(125)I]-BPP 10c and that the anti-hypertensive effects of BPP 10c are not only dependent on sACE inhibition.

PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen

PubMed Central

Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.

2004-01-01

A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853

Role of proline and GABA in sexual reproduction of angiosperms

PubMed Central

Biancucci, Marco; Mattioli, Roberto; Forlani, Giuseppe; Funck, Dietmar; Costantino, Paolo; Trovato, Maurizio

2015-01-01

Two glutamate derivatives, proline and γ-aminobutyric acid (GABA), appear to play pivotal roles in different aspects of sexual reproduction in angiosperms, although their precise function in plant reproduction and the molecular basis of their action are not yet fully understood. Proline and GABA have long been regarded as pivotal amino acids in pollen vitality and fertility. Proline may constitute up to 70% of the free amino acid pool in pollen grains and it has been recently shown that Arabidopsis mutants affected in the first and rate-limiting step in proline synthesis produce aberrant and infertile pollen grains, indicating that proline synthesis is required for pollen development and fertility. Concerning GABA, a large body of evidence points to this glutamate derivative as a key determinant of post-pollination fertilization. Intriguingly, proline has also been associated with pollination, another aspect of sexual reproduction, since honeybees were reported to show a strong preference for proline-enriched nectars. In this review, we survey current knowledge on the roles of proline and GABA in plant fertility, and discuss future perspectives potentially capable to improve our understanding on the functions of these amino acids in pollen development, pollination, and pollen tube guidance. PMID:26388884

Roles of conserved proline and glycosyltransferase motifs of EmbC in biosynthesis of lipoarabinomannan.

PubMed

Berg, Stefan; Starbuck, James; Torrelles, Jordi B; Vissa, Varalakshmi D; Crick, Dean C; Chatterjee, Delphi; Brennan, Patrick J

2005-02-18

D-Arabinans, composed of D-arabinofuranose (D-Araf), dominate the structure of mycobacterial cell walls in two settings, as part of lipoarabinomannan (LAM) and arabinogalactan, each with markedly different structures and functions. Little is known of the complexity of their biosynthesis. beta-D-Arabinofuranosyl-1-monophosphoryldecaprenol is the only known sugar donor. EmbA, EmbB, and EmbC, products of the paralogous genes embA, embB, and embC, the sites of resistance to the anti-tuberculosis drug ethambutol (EMB), are the only known implicated enzymes. EmbA and -B apparently contribute to the synthesis of arabinogalactan, whereas EmbC is reserved for the synthesis of LAM. The Emb proteins show no overall similarity to any known proteins beyond Mycobacterium and related genera. However, functional motifs, equivalent to a proline-rich motif of several bacterial polysaccharide co-polymerases and a superfamily of glycosyltransferases, were found. Site-directed mutagenesis in glycosyltransferase superfamily C resulted in complete ablation of LAM synthesis. Point mutations in three amino acids of the proline motif of EmbC resulted in marked reduction of LAM-arabinan synthesis and accumulation of an unknown intermediate and of the known precursor lipomannan. Yet the pattern of the differently linked d-Araf units observed in wild type LAM-arabinan was largely retained in the proline motif mutants. The results allow for the presentation of a unique model of arabinan synthesis.

The effect of selective D- or N(alpha)-methyl arginine substitution on the activity of the proline-rich antimicrobial peptide, Chex1-Arg20.

NASA Astrophysics Data System (ADS)

Li, Wenyi; Sun, Zhe; O'Brien-Simpson, Neil M.; Otvos, Laszlo; Reynolds, Eric C.; Hossain, Mohammed A.; Separovic, Frances; Wade, John D.

2017-01-01

In vivo pharmacokinetics studies have shown that the proline-rich antimicrobial peptide, A3-APO, which is a discontinuous dimer of the peptide, Chex1-Arg20, undergoes degradation to small fragments at positions Pro6-Arg7 and Val19-Arg20. With the aim of minimizing or abolishing this degradation, a series of Chex1-Arg20 analogues were prepared via Fmoc/tBu solid phase peptide synthesis with D-arginine or, in some cases, peptide backbone N-methylated arginine, substitution at these sites. All the peptides were tested for antibacterial activity against the Gram-negative bacterium Klebsiella pneumoniae. The resulting activity of position-7 substitution of Chex1-Arg20 analogues showed that arginine-7 is a crucial residue for maintaining activity against K. pneumoniae. However, arginine-20 substitution had a much less deleterious effect on the antibacterial activity of the peptide. Moreover, none of these peptides displayed any cytotoxicity to HEK and H-4-II-E mammalian cells. These results will aid the development of more effective and stable PrAMPs via judicious amino acid substitutions.

RNA sequencing and pathway analysis identify tumor necrosis factor alpha driven small proline-rich protein dysregulation in chronic rhinosinusitis.

PubMed

Ramakrishnan, Vijay R; Gonzalez, Joseph R; Cooper, Sarah E; Barham, Henry P; Anderson, Catherine B; Larson, Eric D; Cool, Carlyne D; Diller, John D; Jones, Kenneth; Kinnamon, Sue C

2017-09-01

Chronic rhinosinusitis (CRS) is a heterogeneous inflammatory disorder in which many pathways contribute to end-organ disease. Small proline-rich proteins (SPRR) are polypeptides that have recently been shown to contribute to epithelial biomechanical properties relevant in T-helper type 2 inflammation. There is evidence that genetic polymorphism in SPRR genes may predict the development of asthma in children with atopy and, correlatively, that expression of SPRRs is increased under allergic conditions, which leads to epithelial barrier dysfunction in atopic disease. RNAs from uncinate tissue specimens from patients with CRS and control subjects were compared by RNA sequencing by using Ingenuity Pathway Analysis (n = 4 each), and quantitative polymerase chain reaction (PCR) (n = 15). A separate cohort of archived sinus tissue was examined by immunohistochemistry (n = 19). A statistically significant increase of SPRR expression in CRS sinus tissue was identified that was not a result of atopic presence. SPRR1 and SPRR2A expressions were markedly increased in patients with CRS (p < 0.01) on RNA sequencing, with confirmation by using real-time PCR. Immunohistochemistry of archived surgical samples demonstrated staining of SPRR proteins within squamous epithelium of both groups. Pathway analysis indicated tumor necrosis factor (TNF) alpha as a master regulator of the SPRR gene products. Expression of SPRR1 and of SPRR2A is increased in mucosal samples from patients with CRS and appeared as a downstream result of TNF alpha modulation, which possibly resulted in epithelial barrier dysfunction.

l-Proline and RNA Duplex m-Value Temperature Dependence.

PubMed

Schwinefus, Jeffrey J; Baka, Nadia L; Modi, Kalpit; Billmeyer, Kaylyn N; Lu, Shutian; Haase, Lucas R; Menssen, Ryan J

2017-08-03

The temperature dependence of l-proline interactions with the RNA dodecamer duplex surface exposed after unfolding was quantified using thermal and isothermal titration denaturation monitored by uv-absorbance. The m-value quantifying proline interactions with the RNA duplex surface area exposed after unfolding was measured using RNA duplexes with GC content ranging between 17 and 83%. The m-values from thermal denaturation decreased with increasing GC content signifying increasingly favorable proline interactions with the exposed RNA surface area. However, m-values from isothermal titration denaturation at 25.0 °C were independent of GC content and less negative than those from thermal denaturation. The m-value from isothermal titration denaturation for a 50% GC RNA duplex decreased (became more negative) as the temperature increased and was in nearly exact agreement with the m-value from thermal denaturation. Since RNA duplex transition temperatures increased with GC content, the more favorable proline interactions with the high GC content duplex surface area observed from thermal denaturation resulted from the temperature dependence of proline interactions rather than the RNA surface chemical composition. The enthalpy contribution to the m-value was positive and small (indicating a slight increase in duplex unfolding enthalpy with proline) while the entropic contribution to the m-value was positive and increased with temperature. Our results will facilitate proline's use as a probe of solvent accessible surface area changes during biochemical reactions at different reaction temperatures.

Adaptation of an L-proline adenylation domain to use 4-propyl-L-proline in the evolution of lincosamide biosynthesis.

PubMed

Kadlčík, Stanislav; Kučera, Tomáš; Chalupská, Dominika; Gažák, Radek; Koběrská, Markéta; Ulanová, Dana; Kopecký, Jan; Kutejová, Eva; Najmanová, Lucie; Janata, Jiří

2013-01-01

Clinically used lincosamide antibiotic lincomycin incorporates in its structure 4-propyl-L-proline (PPL), an unusual amino acid, while celesticetin, a less efficient related compound, makes use of proteinogenic L-proline. Biochemical characterization, as well as phylogenetic analysis and homology modelling combined with the molecular dynamics simulation were employed for complex comparative analysis of the orthologous protein pair LmbC and CcbC from the biosynthesis of lincomycin and celesticetin, respectively. The analysis proved the compared proteins to be the stand-alone adenylation domains strictly preferring their own natural substrate, PPL or L-proline. The LmbC substrate binding pocket is adapted to accommodate a rare PPL precursor. When compared with L-proline specific ones, several large amino acid residues were replaced by smaller ones opening a channel which allowed the alkyl side chain of PPL to be accommodated. One of the most important differences, that of the residue corresponding to V306 in CcbC changing to G308 in LmbC, was investigated in vitro and in silico. Moreover, the substrate binding pocket rearrangement also allowed LmbC to effectively adenylate 4-butyl-L-proline and 4-pentyl-L-proline, substrates with even longer alkyl side chains, producing more potent lincosamides. A shift of LmbC substrate specificity appears to be an integral part of biosynthetic pathway adaptation to the PPL acquisition. A set of genes presumably coding for the PPL biosynthesis is present in the lincomycin--but not in the celesticetin cluster; their homologs are found in biosynthetic clusters of some pyrrolobenzodiazepines (PBD) and hormaomycin. Whereas in the PBD and hormaomycin pathways the arising precursors are condensed to another amino acid moiety, the LmbC protein is the first functionally proved part of a unique condensation enzyme connecting PPL to the specialized amino sugar building unit.

Investigation of the dynamics of aqueous proline solutions using neutron scattering and molecular dynamics simulations.

PubMed

Malo de Molina, Paula; Alvarez, Fernando; Frick, Bernhard; Wildes, Andrew; Arbe, Arantxa; Colmenero, Juan

2017-10-18

We applied quasielastic neutron scattering (QENS) techniques to samples with two different contrasts (deuterated solute/hydrogenated solvent and the opposite label) to selectively study the component dynamics of proline/water solutions. Results on diluted and concentrated solutions (31 and 6 water molecules/proline molecule, respectively) were analyzed in terms of the susceptibility and considering a recently proposed model for water dynamics [Arbe et al., Phys. Rev. Lett., 2016, 117, 185501] which includes vibrations and the convolution of localized motions and diffusion. We found that proline molecules not only reduce the average diffusion coefficient of water but also extend the time/frequency range of the crossover region ('cage') between the vibrations and purely diffusive behavior. For the high proline concentration we also found experimental evidence of water heterogeneous dynamics and a distribution of diffusion coefficients. Complementary molecular dynamics simulations show that water molecules start to perform rotational diffusion when they escape the cage regime but before the purely diffusive behavior is established. The rotational diffusion regime is also retarded by the presence of proline molecules. On the other hand, a strong coupling between proline and water diffusive dynamics which persists with decreasing temperature is directly observed using QENS. Not only are the temperature dependences of the diffusion coefficients of both components the same, but their absolute values also approach each other with increasing proline concentration. We compared our results with those reported using other techniques, in particular using dielectric spectroscopy (DS). A simple approach based on molecular hydrodynamics and a molecular treatment of DS allows rationalizing the a priori puzzling inconsistency between QENS and dielectric results regarding the dynamic coupling of the two components. The interpretation proposed is based on general grounds and therefore

Metallofullerenol Gd@C82(OH)22 distracts the proline-rich-motif from putative binding on the SH3 domain

NASA Astrophysics Data System (ADS)

Kang, Seung-Gu; Huynh, Tien; Zhou, Ruhong

2013-03-01

Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials.Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses

The colloidal state of tannins impacts the nature of their interaction with proteins: the case of salivary proline-rich protein/procyanidins binding.

PubMed

Cala, Olivier; Dufourc, Erick J; Fouquet, Eric; Manigand, Claude; Laguerre, Michel; Pianet, Isabelle

2012-12-18

While the definition of tannins has been historically associated with its propensity to bind proteins in a nonspecific way, it is now admitted that specific interaction also occurs. The case of the astringency perception is a good example to illustrate this phenomenon: astringency is commonly described as a tactile sensation induced by the precipitation of a complex composed of proline-rich proteins present in the human saliva and tannins present in beverages such as tea or red wines. In the present work, the interactions between a human saliva protein segment and three different procyanidins (B1, B3, and C2) were investigated at the atomic level by NMR and molecular dynamics. The data provided evidence for (i) an increase in affinity compared to shortest human saliva peptides, which is accounted for by protein "wraping around" the tannin, (ii) a specificity in the interaction below tannin critical micelle concentration (CMC) of ca. 10 mM, with an affinity scale such that C2 > B1 > B3, and (iii) a nonspecific binding above tannin CMC that conducts irremediably to the precipitation of the tannins/protein complex. Such physicochemical findings describe in accurate terms saliva protein-tannin interactions and provide support for a more subtle description by oenologists of wine astringency perception in the mouth.

Different Type 1 Fimbrial Genes and Tropisms of Commensal and Potentially Pathogenic Actinomyces spp. with Different Salivary Acidic Proline-Rich Protein and Statherin Ligand Specificities

PubMed Central

Li, Tong; Khah, Massoud Kheir; Slavnic, Snjezana; Johansson, Ingegerd; Strömberg, Nicklas

2001-01-01

Actinomyces spp. exhibit type 1 fimbria-mediated adhesion to salivary acidic proline-rich proteins (PRPs) and statherin ligands. Actinomyces spp. with different animal and tissue origins belong to three major adhesion types as relates to ligand specificity and type 1 fimbria genes. (i) In preferential acidic-PRP binding, strains of Actinomyces naeslundii genospecies 1 and 2 from human and monkey mouths displayed at least three ligand specificities characterized by preferential acidic-PRP binding. Slot blot DNA hybridization showed seven highly conserved type 1 fimbria genes (orf1- to -6 and fimP) in genospecies 1 and 2 strains, except that orf5 and orf3 were divergent in genospecies 1. (ii) In preferential statherin binding, oral Actinomyces viscosus strains of rat and hamster origin (and strain 19246 from a human case of actinomycosis) bound statherin preferentially. DNA hybridization and characterization of the type 1 fimbria genes from strain 19246 revealed a homologous gene cluster of four open reading frames (orfA to -C and fimP). Bioinformatics suggested sortase (orfB, orf4, and part of orf5), prepilin peptidase (orfC and orf6), fimbria subunit (fimP), and usher- and autotransporter-like (orfA and orf1 to -3) functions. Those gene regions corresponding to orf3 and orf5 were divergent, those corresponding to orf2, orf1, and fimP were moderately conserved, and those corresponding to orf4 and orf6 were highly conserved. Restriction fragment length polymorphism analyses using a fimP probe separated human and monkey and rat and hamster strains into phylogenetically different groups. (iii) In statherin-specific binding, strains of A. naeslundii genospecies 1 from septic and other human infections displayed a low-avidity binding to statherin. Only the orf4 and orf6 gene regions were highly conserved. Finally, rat saliva devoid of statherin bound bacterial strains avidly irrespective of ligand specificity, and specific antisera detected either type 1, type 2, or both

Comparative Aspects of Tissue Glutamine and Proline Metabolism

USDA-ARS?s Scientific Manuscript database

The cellular metabolism of glutamine and proline are closely interrelated since they can be interconverted with glutamate and ornithine via the mitochondrial pathway involving pyrolline-5-carboxylate (P5C). In adults, glutamine and proline are converted via P5C to citrulline in the gut, then citrul...

Enhancement of anthraquinone production in Morinda citrifolia cell suspension cultures after stimulation of the proline cycle with two proline analogs.

PubMed

Quevedo, Carla V; Perassolo, María; Giulietti, Ana M; Rodríguez Talou, Julián

2012-03-01

Synthesis of anthraquinones (AQs) involves the shikimate and 2-C-methyl-D-erythritol 4-phosphate pathways. The proline cycle is linked to the pentose phosphate pathway (PPP) to generate NADPH needed in the first steps of this pathway. The effect of two proline analogs, azetidine-2-carboxylic acid (A2C) and thiazolidine-4-carboxylic acid (T4C), were evaluated in Morinda citrifolia suspension cultures. Both analogs gave higher proline accumulation after 6 and 10 days (68 and 179% after 6 days with A2C at 25 and 50 μM, respectively, and 111% with T4C added at 100 μM). Induction of the proline cycle increased the AQ content after 6 days (~40% for 50 μM A2C and 100 μM T4C). Whereas A2C (50 μM) increased only AQ production, T4C also enhanced total phenolics. However, no induction of the PPP was observed with any of the treatments. This pathway therefore does not limit the supply of carbon skeletons to secondary metabolic pathways.

Distribution of sup 3 H-proline within transseptal fibers of the rat following release of orthodontic forces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Row, K.L.; Johnson, R.B.

1990-10-01

Maxillary right first molar teeth of rats were tipped mesially with an orthodontic appliance for 2 weeks (experimental group), {sup 3}H-proline was injected, and orthodontic forces were removed 6 hr later (time 0). The contralateral molar teeth of treated (internal control group) and age- and weight-matched untreated animals (external control group) were also studied. Diastemata were created between the molar teeth by the orthodontic appliance, and transseptal fibers between first and second (P less than 0.001) and second and third molars (P less than 0.005) were significantly lengthened as compared to external and internal controls at time 0. Diastemata betweenmore » molar teeth were closed 5 days after removal of orthodontic force. Transseptal fibers adjacent to the source of the orthodontic force (mesial region) had the highest mean number of {sup 3}H-proline-labeled proteins at time 0 and at all times following removal of the force (P less than 0.001), and had the highest rate of labeled protein removal (P less than 0.001). Half-lives for removal of 3H-proline-labeled transseptal fiber proteins were significantly greater in mesial and distal regions and significantly less in middle regions of experimentals than in corresponding regions of external controls (P less than 0.001).« less

Effect of Proline Mutations on the Monomer Conformations of Amylin

PubMed Central

Chiu, Chi-cheng; Singh, Sadanand; de Pablo, Juan J.

2013-01-01

The formation of human islet amyloid polypeptide (hIAPP) is implicated in the loss of pancreatic β-cells in type II diabetes. Rat amylin, which differs from human amylin at six residues, does not lead to formation of amyloid fibrils. Pramlintide is a synthetic analog of human amylin that shares three proline substitutions with rat amylin. Pramlintide has a much smaller propensity to form amyloid aggregates and has been widely prescribed in amylin replacement treatment. It is known that the three prolines attenuate β-sheet formation. However, the detailed effects of these proline substitutions on full-length hIAPP remain poorly understood. In this work, we use molecular simulations and bias-exchange metadynamics to investigate the effect of proline substitutions on the conformation of the hIAPP monomer. Our results demonstrate that hIAPP can adopt various β-sheet conformations, some of which have been reported in experiments. The proline substitutions perturb the formation of long β-sheets and reduce their stability. More importantly, we find that all three proline substitutions of pramlintide are required to inhibit β conformations and stabilize the α-helical conformation. Fewer substitutions do not have a significant inhibiting effect. PMID:24010666

Stabilization of an α/β-hydrolase by introducing proline residues: salicylic binding protein 2 from tobacco

PubMed Central

Huang, Jun; Jones, Bryan J.; Kazlauskas, Romas J.

2015-01-01

α/β-Hydrolases are important enzymes for biocatalysis, but their stability often limits their application. As a model α/β-hydrolase, we investigated a plant esterase, salicylic acid binding protein 2 (SABP2). SABP2 shows typical stability to urea (unfolding free energy 6.9±1.5 kcal/mol) and to heat inactivation (T1/215 min 49.2±0.5 °C). Denaturation in urea occurs in two steps, but heat inactivation occurs in a single step. The first unfolding step in urea eliminates catalytic activity. Surprisingly, we found that the first unfolding likely corresponds to the unfolding of the larger catalytic domain. Replacing selected amino acid residues with proline stabilized SABP2. Proline restricts the flexibility of the unfolded protein, thereby shifting the equilibrium toward the folded conformation. Seven locations for proline substitution were chosen either by amino acid sequence alignment with a more stable homolog or by targeting flexible regions in SABP2. Introducing proline in the catalytic domain stabilized SABP2 to the first unfolding in urea for three of five cases: L46P (+0.2 M urea), S70P (+0.1) and E215P (+0.9). Introducing proline in the cap domain did not (two of two cases), supporting the assignment that the first unfolding corresponds to the catalytic domain. Proline substitutions in both domains stabilized SABP2 to heat inactivation: L46P (ΔT1/215 min = +6.4 °C), S70P (+5.4), S115P (+1.8), S141P (+4.9), and E215P (+4.2). Combining substitutions did not further increase the stability to urea denaturation, but dramatically increased resistance to heat inactivation: L46P-S70P ΔT1/215 min = +25.7 °C. This straightforward proline substitution approach may also stabilize other α/β-hydrolases. PMID:26110207

Nucleosome exclusion from the interspecies-conserved central AT-rich region of the Ars insulator.

PubMed

Takagi, Haruna; Inai, Yuta; Watanabe, Shun-ichiro; Tatemoto, Sayuri; Yajima, Mamiko; Akasaka, Koji; Yamamoto, Takashi; Sakamoto, Naoaki

2012-01-01

The Ars insulator is a boundary element identified in the upstream region of the arylsulfatase (HpArs) gene in the sea urchin, Hemicentrotus pulcherrimus, and possesses the ability to both block enhancer-promoter communications and protect transgenes from silent chromatin. To understand the molecular mechanism of the Ars insulator, we investigated the correlation between chromatin structure, DNA structure and insulator activity. Nuclease digestion of nuclei isolated from sea urchin embryos revealed the presence of a nuclease-hypersensitive site within the Ars insulator. Analysis of micrococcal nuclease-sensitive sites in the Ars insulator, reconstituted with nucleosomes, showed the exclusion of nucleosomes from the central AT-rich region. Furthermore, the central AT-rich region in naked DNA was sensitive to nucleotide base modification by diethylpyrocarbonate (DEPC). These observations suggest that non-B-DNA structures in the central AT-rich region may inhibit nucleosomal formation, which leads to nuclease hypersensitivity. Furthermore, comparison of nucleotide sequences between the HpArs gene and its ortholog in Strongylocentrotus purpuratus revealed that the central AT-rich region of the Ars insulator is conserved, and this conserved region showed significant enhancer blocking activity. These results suggest that the central AT-rich nucleosome-free region plays an important role in the function of the Ars insulator.

Cargo crowding at actin-rich regions along axons causes local traffic jams.

PubMed

Sood, Parul; Murthy, Kausalya; Kumar, Vinod; Nonet, Michael L; Menon, Gautam I; Koushika, Sandhya P

2018-03-01

Steady axonal cargo flow is central to the functioning of healthy neurons. However, a substantial fraction of cargo in axons remains stationary up to several minutes. We examine the transport of precursors of synaptic vesicles (pre-SVs), endosomes and mitochondria in Caenorhabditis elegans touch receptor neurons, showing that stationary cargo are predominantly present at actin-rich regions along the neuronal process. Stationary vesicles at actin-rich regions increase the propensity of moving vesicles to stall at the same location, resulting in traffic jams arising from physical crowding. Such local traffic jams at actin-rich regions are likely to be a general feature of axonal transport since they also occur in Drosophila neurons. Repeated touch stimulation of C. elegans reduces the density of stationary pre-SVs, indicating that these traffic jams can act as both sources and sinks of vesicles. This suggests that vesicles trapped in actin-rich regions are functional reservoirs that may contribute to maintaining robust cargo flow in the neuron. A video abstract of this article can be found at: Video S1; Video S2. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Proline Dehydrogenase Regulates Redox State and Respiratory Metabolism in Trypanosoma cruzi

PubMed Central

Paes, Lisvane Silva; Suárez Mantilla, Brian; Zimbres, Flávia Menezes; Pral, Elisabeth Mieko Furusho; Diogo de Melo, Patrícia; Tahara, Erich B.; Kowaltowski, Alicia J.; Elias, Maria Carolina; Silber, Ariel Mariano

2013-01-01

Over the past three decades, L-proline has become recognized as an important metabolite for trypanosomatids. It is involved in a number of key processes, including energy metabolism, resistance to oxidative and nutritional stress and osmoregulation. In addition, this amino acid supports critical parasite life cycle processes by acting as an energy source, thus enabling host-cell invasion by the parasite and subsequent parasite differentiation. In this paper, we demonstrate that L-proline is oxidized to Δ1-pyrroline-5-carboxylate (P5C) by the enzyme proline dehydrogenase (TcPRODH, E.C. 1.5.99.8) localized in Trypanosoma cruzi mitochondria. When expressed in its active form in Escherichia coli, TcPRODH exhibits a Km of 16.58±1.69 µM and a Vmax of 66±2 nmol/min mg. Furthermore, we demonstrate that TcPRODH is a FAD-dependent dimeric state protein. TcPRODH mRNA and protein expression are strongly upregulated in the intracellular epimastigote, a stage which requires an external supply of proline. In addition, when Saccharomyces cerevisiae null mutants for this gene (PUT1) were complemented with the TcPRODH gene, diminished free intracellular proline levels and an enhanced sensitivity to oxidative stress in comparison to the null mutant were observed, supporting the hypothesis that free proline accumulation constitutes a defense against oxidative imbalance. Finally, we show that proline oxidation increases cytochrome c oxidase activity in mitochondrial vesicles. Overall, these results demonstrate that TcPRODH is involved in proline-dependant cytoprotection during periods of oxidative imbalance and also shed light on the participation of proline in energy metabolism, which drives critical processes of the T. cruzi life cycle. PMID:23894476

Position of Proline Mediates the Reactivity of S-Palmitoylation.

PubMed

Khanal, Neelam; Pejaver, Vikas; Li, Zhiyu; Radivojac, Predrag; Clemmer, David E; Mukhopadhyay, Suchetana

2015-11-20

Palmitoylation, a post-translational modification in which a saturated 16-carbon chain is added predominantly to a cysteine residue, participates in various biological functions. The position of proline relative to other residues being post-translationally modified has been previously reported as being important. We determined that proline is statistically enriched around cysteines known to be S-palmitoylated. The goal of this work was to determine how the position of proline influences the palmitoylation of the cysteine residue. We established a mass spectrometry-based approach to investigate time- and temperature-dependent kinetics of autopalmitoylation in vitro and to derive the thermodynamic parameters of the transition state associated with palmitoylation; to the best of our knowledge, our work is the first to study the kinetics and activation properties of the palmitoylation process. We then used these thermochemical parameters to determine if the position of proline relative to the modified cysteine is important for palmitoylation. Our results show that peptides with proline at the -1 position of cysteine in their sequence (PC) have lower enthalpic barriers and higher entropic barriers in comparison to the same peptides with proline at the +1 position of cysteine (CP); interestingly, the free-energy barriers for both pairs are almost identical. Molecular dynamics studies demonstrate that the flexibility of the cysteine backbone in the PC-containing peptide when compared to the CP-containing peptide explains the increased entropic barrier and decreased enthalpic barrier observed experimentally.

Pneumocandin biosynthesis: involvement of a trans-selective proline hydroxylase.

PubMed

Houwaart, Stefanie; Youssar, Loubna; Hüttel, Wolfgang

2014-11-03

Echinocandins are cyclic nonribosomal hexapeptides based mostly on nonproteinogenic amino acids and displaying strong antifungal activity. Despite previous studies on their biosynthesis by fungi, the origin of three amino acids, trans-4- and trans-3-hydroxyproline, as well as trans-3-hydroxy-4-methylproline, is still unknown. Here we describe the identification, overexpression, and characterization of GloF, the first eukaryotic α-ketoglutarate/Fe(II) -dependent proline hydroxylase from the pneumocandin biosynthesis cluster of the fungus Glarea lozoyensis ATCC 74030. In in vitro transformations with L-proline, GloF generates trans-4- and trans-3-hydroxyproline simultaneously in a ratio of 8:1; the latter reaction was previously unknown for proline hydroxylase catalysis. trans-4-Methyl-L-proline is converted into the corresponding trans-3-hydroxyproline. All three hydroxyprolines required for the biosynthesis of the echinocandins pneumocandins A0 and B0 in G. lozoyensis are thus provided by GloF. Sequence analyses revealed that GloF is not related to bacterial proline hydroxylases, and none of the putative proteins with high sequence similarity in the databases has been characterized so far. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ginkgotides: Proline-Rich Hevein-Like Peptides from Gymnosperm Ginkgo biloba.

PubMed

Wong, Ka H; Tan, Wei Liang; Serra, Aida; Xiao, Tianshu; Sze, Siu Kwan; Yang, Daiwen; Tam, James P

2016-01-01

Hevein and hevein-like peptides belong to the family of chitin-binding cysteine-rich peptides. They are classified into three subfamilies, the prototypic 8C- and the 6C- and 10C-hevein-like peptides. Thus far, only five 8C-hevein-like peptides have been characterized from three angiosperms and none from gymnosperm. To determine their occurrence and distribution in the gymnosperm, Ginkgo biloba leaves were examined. Here, we report the discovery and characterization of 11 novel 8C-hevein-like peptides, namely ginkgotides gB1-gB11. Proteomic analysis showed that the ginkgotides contain 41-44 amino acids (aa), a chitin-binding domain and are Pro-rich, a distinguishing feature that differs from other hevein-like peptides. Solution NMR structure determination revealed that gB5 contains a three β-stranded structure shaped by a cystine knot with an additional disulfide bond at the C-terminus. Transcriptomic analysis showed that the ginkgotide precursors contain a three-domain architecture, comprised of a C-terminal tail (20 aa) that is significantly shorter than those of other 8C- and 10C-hevein-like peptides, which generally contain a protein cargo such as a Barwin-like protein (126 aa) or class I chitinase (254 aa). Transcriptomic data mining found an additional 48 ginkgotide homologs in 39 different gymnosperms. Phylogenetic analysis revealed that ginkgotides and their homologs belong to a new class of 8C-hevein-like peptides. Stability studies showed that ginkgotides are highly resistant to thermal, acidic and endopeptidase degradation. Ginkgotides flanked at both the N- and C-terminal ends by Pro were resistant to exopeptidase degradation by carboxypeptidase A and aminopeptidase. Antifungal assays showed that ginkgotides inhibit the hyphal growth of phyto-pathogenic fungi. Taken together, ginkgotides represent the first suite of hevein-like peptides isolated and characterized from gymnosperms. As a group, they represent a novel class of 8C-hevein-like peptides that

Effect of proline mutations on the monomer conformations of amylin.

PubMed

Chiu, Chi-cheng; Singh, Sadanand; de Pablo, Juan J

2013-09-03

The formation of human islet amyloid polypeptide (hIAPP) is implicated in the loss of pancreatic β-cells in type II diabetes. Rat amylin, which differs from human amylin at six residues, does not lead to formation of amyloid fibrils. Pramlintide is a synthetic analog of human amylin that shares three proline substitutions with rat amylin. Pramlintide has a much smaller propensity to form amyloid aggregates and has been widely prescribed in amylin replacement treatment. It is known that the three prolines attenuate β-sheet formation. However, the detailed effects of these proline substitutions on full-length hIAPP remain poorly understood. In this work, we use molecular simulations and bias-exchange metadynamics to investigate the effect of proline substitutions on the conformation of the hIAPP monomer. Our results demonstrate that hIAPP can adopt various β-sheet conformations, some of which have been reported in experiments. The proline substitutions perturb the formation of long β-sheets and reduce their stability. More importantly, we find that all three proline substitutions of pramlintide are required to inhibit β conformations and stabilize the α-helical conformation. Fewer substitutions do not have a significant inhibiting effect. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Disentangling the determinants of species richness of vascular plants and mammals from national to regional scales

PubMed Central

Xu, Haigen; Cao, Mingchang; Wu, Yi; Cai, Lei; Cao, Yun; Wu, Jun; Lei, Juncheng; Le, Zhifang; Ding, Hui; Cui, Peng

2016-01-01

Understanding the spatial patterns in species richness gets new implication for biodiversity conservation in the context of climate change and intensified human intervention. Here, we created a database of the geographical distribution of 30,519 vascular plant species and 565 mammal species from 2,376 counties across China and disentangled the determinants that explain species richness patterns both at national and regional scales using spatial linear models. We found that the determinants of species richness patterns varied among regions: elevational range was the most powerful predictor for the species richness of plants and mammals across China. However, species richness patterns in the Qinghai-Tibetan Plateau Region (QTR) are quite unique, where net primary productivity was the most important predictor. We also detected that elevational range was positively related to plant species richness when it is less than 1,900 m, whereas the relationship was not significant when elevational range is larger than 1,900 m. It indicated that elevational range often emerges as the predominant controlling factor within the regions where energy is sufficient. The effects of land use on mammal species richness should attract special attention. Our study suggests that region-specific conservation policies should be developed based on the regional features of species richness. PMID:26902418

Disentangling the determinants of species richness of vascular plants and mammals from national to regional scales

NASA Astrophysics Data System (ADS)

Xu, Haigen; Cao, Mingchang; Wu, Yi; Cai, Lei; Cao, Yun; Wu, Jun; Lei, Juncheng; Le, Zhifang; Ding, Hui; Cui, Peng

2016-02-01

Understanding the spatial patterns in species richness gets new implication for biodiversity conservation in the context of climate change and intensified human intervention. Here, we created a database of the geographical distribution of 30,519 vascular plant species and 565 mammal species from 2,376 counties across China and disentangled the determinants that explain species richness patterns both at national and regional scales using spatial linear models. We found that the determinants of species richness patterns varied among regions: elevational range was the most powerful predictor for the species richness of plants and mammals across China. However, species richness patterns in the Qinghai-Tibetan Plateau Region (QTR) are quite unique, where net primary productivity was the most important predictor. We also detected that elevational range was positively related to plant species richness when it is less than 1,900 m, whereas the relationship was not significant when elevational range is larger than 1,900 m. It indicated that elevational range often emerges as the predominant controlling factor within the regions where energy is sufficient. The effects of land use on mammal species richness should attract special attention. Our study suggests that region-specific conservation policies should be developed based on the regional features of species richness.

Exogenous proline enhances the sensitivity of Tobacco BY-2 cells to arsenate.

PubMed

Nahar, Mst Nur-E-Nazmun; Islam, Mohammad Muzahidul; Hoque, Md Anamul; Yonezawa, Anna; Prodhan, Md Yeasin; Nakamura, Toshiyuki; Nakamura, Yoshimasa; Munemasa, Shintaro; Murata, Yoshiyuki

2017-09-01

Arsenic causes physiological and structural disorders in plants. Proline is accumulated as a compatible solute in plants under various stress conditions and mitigates stresses. Here, we investigated the effects of exogenous proline on tobacco Bright Yellow-2 (BY-2) cultured cells under [Formula: see text] stress. Arsenate did not inhibit BY-2 cell growth at 40 and 50 μM but did it at 60 μM. Proline at 0.5 to 10 mM did not affect the cell growth but delayed it at 20 mM. At 40 μM [Formula: see text], neither 0.5 mM nor 1 mM proline affected the cell growth but 10 mM proline inhibited it. In the presence of [Formula: see text], 10 mM proline increased the number of Evans Blue-stained (dead) cells and decreased the number of total cells. Together, our results suggest that exogenous proline does not alleviate arsenate toxicity but enhances the sensitivity of BY-2 cells to arsenate.

Cytosolic Accumulation of L-Proline Disrupts GABA-Ergic Transmission through GAD Blockade.

PubMed

Crabtree, Gregg W; Park, Alan J; Gordon, Joshua A; Gogos, Joseph A

2016-10-04

Proline dehydrogenase (PRODH), which degrades L-proline, resides within the schizophrenia-linked 22q11.2 deletion suggesting a role in disease. Supporting this, elevated L-proline levels have been shown to increase risk for psychotic disorders. Despite the strength of data linking PRODH and L-proline to neuropsychiatric diseases, targets of disease-relevant concentrations of L-proline have not been convincingly described. Here, we show that Prodh-deficient mice with elevated CNS L-proline display specific deficits in high-frequency GABA-ergic transmission and gamma-band oscillations. We find that L-proline is a GABA-mimetic and can act at multiple GABA-ergic targets. However, at disease-relevant concentrations, GABA-mimesis is limited to competitive blockade of glutamate decarboxylase leading to reduced GABA production. Significantly, deficits in GABA-ergic transmission are reversed by enhancing net GABA production with the clinically relevant compound vigabatrin. These findings indicate that accumulation of a neuroactive metabolite can lead to molecular and synaptic dysfunction and help to understand mechanisms underlying neuropsychiatric disease. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Docking and molecular dynamics simulations of the Fyn-SH3 domain with free and phospholipid bilayer-associated 18.5-kDa myelin basic protein (MBP)-Insights into a noncanonical and fuzzy interaction.

PubMed

Bessonov, Kyrylo; Vassall, Kenrick A; Harauz, George

2017-07-01

The molecular details of the association between the human Fyn-SH3 domain, and the fragment of 18.5-kDa myelin basic protein (MBP) spanning residues S38-S107 (denoted as xα2-peptide, murine sequence numbering), were studied in silico via docking and molecular dynamics over 50-ns trajectories. The results show that interaction between the two proteins is energetically favorable and heavily dependent on the MBP proline-rich region (P93-P98) in both aqueous and membrane environments. In aqueous conditions, the xα2-peptide/Fyn-SH3 complex adopts a "sandwich"-like structure. In the membrane context, the xα2-peptide interacts with the Fyn-SH3 domain via the proline-rich region and the β-sheets of Fyn-SH3, with the latter wrapping around the proline-rich region in a form of a clip. Moreover, the simulations corroborate prior experimental evidence of the importance of upstream segments beyond the canonical SH3-ligand. This study thus provides a more-detailed glimpse into the context-dependent interaction dynamics and importance of the β-sheets in Fyn-SH3 and proline-rich region of MBP. Proteins 2017; 85:1336-1350. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Unusual properties of aqueous solutions of L-proline: A molecular dynamics study

NASA Astrophysics Data System (ADS)

Civera, Monica; Sironi, Maurizio; Fornili, Sandro L.

2005-11-01

Aqueous solutions of the bioprotectant proline are simulated for solute molar fractions ranging from 2.0 × 10 -3 to 2.3 × 10 -1. Statistical analyses show that proline affects the water structure more strongly than glycine betaine and trimethylamine- N-oxide, two of the most effective bioprotectants widely diffuse in nature, and as strongly as tert-butyl alcohol, a protein denaturant which at high concentration self-aggregates. No evidence is found, however, that proline self-aggregates as it has been previously suggested to explain experimental findings on concentrated proline solutions. Nevertheless, the behavior of the diffusion coefficients of proline and water vs. solute concentration qualitatively agrees with such results.

Genetic variation in small proline rich protein 2B as a predictor for asthma among children with eczema

PubMed Central

Epstein, Tolly G.; LeMasters, Grace K.; Bernstein, David I.; Ericksen, Mark B.; Martin, Lisa J.; Ryan, Patrick H.; Biagini Myers, Jocelyn M.; Butsch Kovacic, Melinda S.; Lindsey, Mark A.; He, Hua; Reponen, Tiina; Villareal, Manuel S.; Lockey, James E.; Bernstein, Cheryl K.; Khurana Hershey, Gurjit K.

2013-01-01

Background Small proline rich protein 2B (SPRR2B) is a skin and lung epithelial protein associated with allergic inflammation in mice that has not been evaluated in human atopic diseases. Objective To determine whether single-nucleotide polymorphisms (SNPs) in SPRR2B are associated with childhood eczema and with the phenotype of childhood eczema combined with asthma. Methods Genotyping for SPRR2B and filaggrin (FLG) was performed in 2 independent populations: the Cincinnati Childhood Allergy & Air Pollution Study (CCAAPS; N = 762; birth-age, 4 years) and the Greater Cincinnati Pediatric Clinical Repository (GCPCR;N = 1152; ages 5–10 years). Eczema and eczema plus asthma were clinical outcomes based on parental report and clinician’s diagnosis. Genetic analyses were restricted to whites and adjusted for sex in both cohorts and adjusted for environmental covariates in CCAAPS. Results Variants in SPRR2B were not significantly associated with eczema in either cohort after Bonferroni adjustment. Children from both cohorts with the CC genotype of the SPRR2B rs6693927 SNP were at 4 times the risk for eczema plus asthma (adjusted odds ratio, 4.1; 95% confidence interval, 1.5– 10.9; P = .005 in CCAAPS; and adjusted odds ratio, 4.0; 95% confidence interval, 1.8 –9.1; P <.001 in the GCPCR), however. SNPs in SPRR2B were not in strong linkage disequilibrium with the R501X and del2282 FLG mutations, and these findings were independent of FLG. Conclusions An SNP in SPRR2B was predictive of asthma among white children with eczema from 2 independent populations. SPRR2B polymorphisms may serve as important predictive markers for the combined eczema plus asthma phenotype. PMID:22374195

Proline Editing: A General and Practical Approach to the Synthesis of Functionally and Structurally Diverse Peptides. Analysis of Steric versus Stereoelectronic Effects of 4-Substituted Prolines on Conformation within Peptides

PubMed Central

Pandey, Anil K.; Naduthambi, Devan; Thomas, Krista M.; Zondlo, Neal J.

2013-01-01

Functionalized proline residues have diverse applications. Herein we describe a practical approach, proline editing, for the synthesis of peptides with stereospecifically modified proline residues. Peptides are synthesized by standard solid-phase-peptide-synthesis to incorporate Fmoc-Hydroxyproline (4R-Hyp). In an automated manner, the Hyp hydroxyl is protected and the remainder of the peptide synthesized. After peptide synthesis, the Hyp protecting group is orthogonally removed and Hyp selectively modified to generate substituted proline amino acids, with the peptide main chain functioning to “protect” the proline amino and carboxyl groups. In a model tetrapeptide (Ac-TYPN-NH2), 4R-Hyp was stereospecifically converted to 122 different 4-substituted prolyl amino acids, with 4R or 4S stereochemistry, via Mitsunobu, oxidation, reduction, acylation, and substitution reactions. 4-Substituted prolines synthesized via proline editing include incorporated structured amino acid mimetics (Cys, Asp/Glu, Phe, Lys, Arg, pSer/pThr), recognition motifs (biotin, RGD), electron-withdrawing groups to induce stereoelectronic effects (fluoro, nitrobenzoate), handles for heteronuclear NMR (19F:fluoro; pentafluorophenyl or perfluoro-tert-butyl ether; 4,4-difluoro; 77SePh) and other spectroscopies (fluorescence, IR: cyanophenyl ether), leaving groups (sulfonate, halide, NHS, bromoacetate), and other reactive handles (amine, thiol, thioester, ketone, hydroxylamine, maleimide, acrylate, azide, alkene, alkyne, aryl halide, tetrazine, 1,2-aminothiol). Proline editing provides access to these proline derivatives with no solution phase synthesis. All peptides were analyzed by NMR to identify stereoelectronic and steric effects on conformation. Proline derivatives were synthesized to permit bioorthogonal conjugation reactions, including azide-alkyne, tetrazinetrans-cyclooctene, oxime, reductive amination, native chemical ligation, Suzuki, Sonogashira, cross-metathesis, and Diels

Ginkgotides: Proline-Rich Hevein-Like Peptides from Gymnosperm Ginkgo biloba

PubMed Central

Wong, Ka H.; Tan, Wei Liang; Serra, Aida; Xiao, Tianshu; Sze, Siu Kwan; Yang, Daiwen; Tam, James P.

2016-01-01

Hevein and hevein-like peptides belong to the family of chitin-binding cysteine-rich peptides. They are classified into three subfamilies, the prototypic 8C- and the 6C- and 10C-hevein-like peptides. Thus far, only five 8C-hevein-like peptides have been characterized from three angiosperms and none from gymnosperm. To determine their occurrence and distribution in the gymnosperm, Ginkgo biloba leaves were examined. Here, we report the discovery and characterization of 11 novel 8C-hevein-like peptides, namely ginkgotides gB1–gB11. Proteomic analysis showed that the ginkgotides contain 41–44 amino acids (aa), a chitin-binding domain and are Pro-rich, a distinguishing feature that differs from other hevein-like peptides. Solution NMR structure determination revealed that gB5 contains a three β-stranded structure shaped by a cystine knot with an additional disulfide bond at the C-terminus. Transcriptomic analysis showed that the ginkgotide precursors contain a three-domain architecture, comprised of a C-terminal tail (20 aa) that is significantly shorter than those of other 8C- and 10C-hevein-like peptides, which generally contain a protein cargo such as a Barwin-like protein (126 aa) or class I chitinase (254 aa). Transcriptomic data mining found an additional 48 ginkgotide homologs in 39 different gymnosperms. Phylogenetic analysis revealed that ginkgotides and their homologs belong to a new class of 8C-hevein-like peptides. Stability studies showed that ginkgotides are highly resistant to thermal, acidic and endopeptidase degradation. Ginkgotides flanked at both the N- and C-terminal ends by Pro were resistant to exopeptidase degradation by carboxypeptidase A and aminopeptidase. Antifungal assays showed that ginkgotides inhibit the hyphal growth of phyto-pathogenic fungi. Taken together, ginkgotides represent the first suite of hevein-like peptides isolated and characterized from gymnosperms. As a group, they represent a novel class of 8C-hevein-like peptides

Proline-rich antimicrobial peptide, PR-39 gene transduction altered invasive activity and actin structure in human hepatocellular carcinoma cells

PubMed Central

Ohtake, T; Fujimoto, Y; Ikuta, K; Saito, H; Ohhira, M; Ono, M; Kohgo, Y

1999-01-01

PR-39 is an endogenous proline-rich antimicrobial peptide which induces the synthesis of syndecan-1, a transmembrane heparan sulphate proteoglycan involved in cell-to-matrix interactions and wound healing. Previously, we revealed that the expression of syndecan-1 was reduced in human hepatocellular carcinomas with high metastatic potential and speculated that syndecan-1 played an important role in inhibition of invasion and metastasis. It is assumed that a modification of this process with PR-39 and syndecan-1 may result in a new strategy by which it can inhibit the invasion and metastasis. Therefore, we transduced a gene of PR-39 into human hepatocellular carcinoma cell line HLF, which shows a low expression of syndecan-1 and a high in vitro invasive activity, and examined whether this procedure could reduce the invasive activity of tumour cells. In two transfectants with PR-39 gene, the syndecan-1 expression was induced and the invasive activity in type I collagen-coated chamber was inhibited. Moreover, these transfectants showed the suppression of motile activity assayed by phagokinetic tracks in addition to the disorganization of actin filaments observed by a confocal imaging system. In contrast, five transfectants with syndecan-1 gene in the HLF cells revealed suppression of invasive activity but did not alter the motile activity and actin structures of the cell. These results suggest that PR-39 has functions involved in the suppression of motile activity and alteration of actin structure on human hepatocellular carcinoma cells in addition to the suppression of invasive activity which might result from the induction of syndecan-1 expression. © 1999 Cancer Research Campaign PMID:10507762

A proline-rich sequence unique to MEK1 and MEK2 is required for raf binding and regulates MEK function.

PubMed

Catling, A D; Schaeffer, H J; Reuter, C W; Reddy, G R; Weber, M J

1995-10-01

Mammalian MEK1 and MEK2 contain a proline-rich (PR) sequence that is absent both from the yeast homologs Ste7 and Byr1 and from a recently cloned activator of the JNK/stress-activated protein kinases, SEK1/MKK4. Since this PR sequence occurs in MEKs that are regulated by Raf family enzymes but is missing from MEKs and SEKs activated independently of Raf, we sought to investigate the role of this sequence in MEK1 and MEK2 regulation and function. Deletion of the PR sequence from MEK1 blocked the ability of MEK1 to associate with members of the Raf family and markedly attenuated activation of the protein in vivo following growth factor stimulation. In addition, this sequence was necessary for efficient activation of MEK1 in vitro by B-Raf but dispensable for activation by a novel MEK1 activator which we have previously detected in fractionated fibroblast extracts. Furthermore, we found that a phosphorylation site within the PR sequence of MEK1 was required for sustained MEK1 activity in response to serum stimulation of quiescent fibroblasts. Consistent with this observation, we observed that MEK2, which lacks a phosphorylation site at the corresponding position, was activated only transiently following serum stimulation. Finally, we found that deletion of the PR sequence from a constitutively activated MEK1 mutant rendered the protein nontransforming in Rat1 fibroblasts. These observations indicate a critical role for the PR sequence in directing specific protein-protein interactions important for the activation, inactivation, and downstream functioning of the MEKs.

A proline-rich sequence unique to MEK1 and MEK2 is required for raf binding and regulates MEK function.

PubMed Central

Catling, A D; Schaeffer, H J; Reuter, C W; Reddy, G R; Weber, M J

1995-01-01

Mammalian MEK1 and MEK2 contain a proline-rich (PR) sequence that is absent both from the yeast homologs Ste7 and Byr1 and from a recently cloned activator of the JNK/stress-activated protein kinases, SEK1/MKK4. Since this PR sequence occurs in MEKs that are regulated by Raf family enzymes but is missing from MEKs and SEKs activated independently of Raf, we sought to investigate the role of this sequence in MEK1 and MEK2 regulation and function. Deletion of the PR sequence from MEK1 blocked the ability of MEK1 to associate with members of the Raf family and markedly attenuated activation of the protein in vivo following growth factor stimulation. In addition, this sequence was necessary for efficient activation of MEK1 in vitro by B-Raf but dispensable for activation by a novel MEK1 activator which we have previously detected in fractionated fibroblast extracts. Furthermore, we found that a phosphorylation site within the PR sequence of MEK1 was required for sustained MEK1 activity in response to serum stimulation of quiescent fibroblasts. Consistent with this observation, we observed that MEK2, which lacks a phosphorylation site at the corresponding position, was activated only transiently following serum stimulation. Finally, we found that deletion of the PR sequence from a constitutively activated MEK1 mutant rendered the protein nontransforming in Rat1 fibroblasts. These observations indicate a critical role for the PR sequence in directing specific protein-protein interactions important for the activation, inactivation, and downstream functioning of the MEKs. PMID:7565670

Binding preference of carbon nanotube over proline-rich motif ligand on SH3-domain: a comparison with different force fields.

PubMed

Shi, Biyun; Zuo, Guanghong; Xiu, Peng; Zhou, Ruhong

2013-04-04

With the widespread applications of nanomaterials such as carbon nanotubes, there is a growing concern on the biosafety of these engineered nanoparticles, in particular their interactions with proteins. In molecular simulations of nanoparticle-protein interactions, the choice of empirical parameters (force fields) plays a decisive role, and thus is of great importance and should be examined carefully before wider applications. Here we compare three commonly used force fields, CHARMM, OPLSAA, and AMBER in study of the competitive binding of a single wall carbon nanotube (SWCNT) with a native proline-rich motif (PRM) ligand on its target protein SH3 domain, a ubiquitous protein-protein interaction mediator involved in signaling and regulatory pathways. We find that the SWCNT displays a general preference over the PRM in binding with SH3 domain in all the three force fields examined, although the degree of preference can be somewhat different, with the AMBER force field showing the highest preference. The SWCNT prevents the ligand from reaching its native binding pocket by (i) occupying the binding pocket directly, and (ii) binding with the ligand itself and then being trapped together onto some off-sites. The π-π stacking interactions between the SWCNT and aromatic residues are found to play a significant role in its binding to the SH3 domain in all the three force fields. Further analyses show that even the SWCNT-ligand binding can also be relatively more stable than the native ligand-protein binding, indicating a serious potential disruption to the protein SH3 function.

Conformational Preferences of α-Substituted Proline Analogues

PubMed Central

Flores-Ortega, Alejandra; Jiménez, Ana I.; Cativiela, Carlos; Nussinov, Ruth; Alemán, Carlos; Casanovas, Jordi

2009-01-01

DFT calculations at the B3LYP/6-31+G(d,p) level have been used to investigate how the replacement of the α hydrogen by a more sterically demanding group affects the conformational preferences of proline. Specifically, the N-acetyl-N’-methylamide derivatives of L-proline, L-α-methylproline and L-α-phenylproline have been calculated, with both the cis/trans isomerism of the peptide bonds and the puckering of the pyrrolidine ring being considered. The effects of solvation have been evaluated using a Self Consistent Reaction Field model. As expected, tetrasubstitution at the α carbon destabilizes the conformers with one or more peptide bonds arranged in cis. The lowest energy minimum has been found to be identical for the three compounds investigated, but important differences are observed regarding other energetically accessible backbone conformations. The results obtained provide evidence that the distinct steric requirements of the substituent at Cα may play a significant role in modulating the conformational preferences of proline. PMID:18351745

Crystal structures of resorcin[4]arene and pyrogallol[4]arene complexes with proline: A model for proline recognition through Csbnd H···π interaction

NASA Astrophysics Data System (ADS)

Fujisawa, Ikuhide; Kitamura, Yuji; Kato, Ryo; Aoki, Katsuyuki

2018-07-01

Resorcin[4]arene (resorcinol cyclic tetramer, abbreviated as RCT) or pyrogallol[4]arene (pyrogallol cyclic tetramer, PCT) form host-guest 1:1 complexes with DL-proline (DL-Pro) or L-proline (L-Pro), [RCT·DL-Pro]·2MeOH·3.5H2O (1) and 2[PCT·L-Pro]·2EtOH·10H2O (2), whose crystal structures have been determined. In each complex, the proline ligand is incorporated into the bowl-shaped cavity of RCT or PCT host molecules through Csbnd H … π interactions between alkyl protons of the pyrrolidine ring of proline and π-rings of RCT or PCT, forming an [RCT/PCT·Pro] structural fragment. In the crystal lattice, two [RCT/PCT·Pro] fragments self-associate to form a ligand-mediated dimeric structure, [RCT·D-Pro·L-Pro·RCT] in 1 or [PCT·L-Pro·L-Pro·PCT] in 2. A 1H NMR solution study gave the host‒ligand binding constants of 10.0 ± 1.1 M-1 for the RCT-DL-Pro system and 17.3 ± 1.3 M-1 for the PCT-L-Pro system. These complexes provide a synthetic model for the recognition of the proline residue in proline-containing substrates or inhibitors by enzymes through Csbnd H … π interaction. The CSD survey revealed that the absolute value of the torsion angle N-Cα-Csbnd O1 (O1 is cis to N) about the carboxyl Cα-C bond of proline is significantly smaller than that of the Cβ-Cα-Csbnd O2 (O2 is cis to Cβ) torsion angle.

Effect of l-Proline on Sake Brewing and Ethanol Stress in Saccharomyces cerevisiae

PubMed Central

Takagi, Hiroshi; Takaoka, Miki; Kawaguchi, Akari; Kubo, Yoshito

2005-01-01

During the fermentation of sake, cells of Saccharomyces cerevisiae are exposed to high concentrations of ethanol, thereby damaging the cell membrane and functional proteins. l-Proline protects yeast cells from damage caused by freezing or oxidative stress. In this study, we evaluated the role of intracellular l-proline in cells of S. cerevisiae grown under ethanol stress. An l-proline-accumulating laboratory strain carries a mutant allele of PRO1, pro1D154N, which encodes the Asp154Asn mutant γ-glutamyl kinase. This mutation increases the activity of γ-glutamyl kinase and γ-glutamyl phosphate reductase, which catalyze the first two steps of l-proline synthesis and which together may form a complex in vivo. When cultured in liquid medium in the presence of 9% and 18% ethanol under static conditions, the cell viability of the l-proline-accumulating laboratory strain is greater than the cell viability of the parent strain. This result suggests that intracellular accumulation of l-proline may confer tolerance to ethanol stress. We constructed a novel sake yeast strain by disrupting the PUT1 gene, which is required for l-proline utilization, and replacing the wild-type PRO1 allele with the pro1D154N allele. The resultant strain accumulated l-proline and was more tolerant to ethanol stress than was the control strain. We used the strain that could accumulate l-proline to brew sake containing five times more l-proline than what is found in sake brewed with the control strain, without affecting the fermentation profiles. PMID:16332860

Proline as a stress protectant in yeast: physiological functions, metabolic regulations, and biotechnological applications.

PubMed

Takagi, Hiroshi

2008-11-01

Proline is an important amino acid in terms of its biological functions and biotechnological applications. In response to osmotic stress, proline is accumulated in many bacterial and plant cells as an osmoprotectant. However, it has been shown that proline levels are not increased under various stress conditions in the yeast Saccharomyces cerevisiae cells. Proline is believed to serve multiple functions in vitro such as protein and membrane stabilization, lowering the T (m) of DNA, and scavenging of reactive oxygen species, but the mechanisms of these functions in vivo are poorly understood. Yeast cells biosynthesize proline from glutamate in the cytoplasm via the same pathway found in bacteria and plants and also convert excess proline to glutamate in the mitochondria. Based on the fact that proline has stress-protective activity, S. cerevisiae cells that accumulate proline were constructed by disrupting the PUT1 gene involved in the degradation pathway and by expressing the mutant PRO1 gene encoding the feedback inhibition-less sensitive gamma-glutamate kinase to enhance the biosynthetic activity. The engineered yeast strains successfully showed enhanced tolerance to many stresses, including freezing, desiccation, oxidation, and ethanol. However, the appropriate cellular level and localization of proline play pivotal roles in the stress-protective effect. These results indicate that the increased stress protection is observed in yeast cells under the artificial condition of proline accumulation. Proline is expected to contribute to yeast-based industries by improving the production of frozen dough and alcoholic beverages or breakthroughs in bioethanol production.

Prediction and Biochemical Demonstration of a Catabolic Pathway for the Osmoprotectant Proline Betaine

PubMed Central

Kumar, Ritesh; Zhao, Suwen; Vetting, Matthew W.; Wood, B. McKay; Sakai, Ayano; Cho, Kyuil; Solbiati, José; Almo, Steven C.; Sweedler, Jonathan V.; Jacobson, Matthew P.; Gerlt, John A.; Cronan, John E.

2014-01-01

ABSTRACT Through the use of genetic, enzymatic, metabolomic, and structural analyses, we have discovered the catabolic pathway for proline betaine, an osmoprotectant, in Paracoccus denitrificans and Rhodobacter sphaeroides. Genetic and enzymatic analyses showed that several of the key enzymes of the hydroxyproline betaine degradation pathway also function in proline betaine degradation. Metabolomic analyses detected each of the metabolic intermediates of the pathway. The proline betaine catabolic pathway was repressed by osmotic stress and cold stress, and a regulatory transcription factor was identified. We also report crystal structure complexes of the P. denitrificans HpbD hydroxyproline betaine epimerase/proline betaine racemase with l-proline betaine and cis-hydroxyproline betaine. PMID:24520058

Proline accumulation and its implication in cold tolerance of regenerable maize callus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, D.R.; Widholm, J.M.

1987-03-01

Embryogenic callus of maize (Zea mays L.) inbreds B37wx, H99, H99/sup 3/H95, Mo17, and Pa91 accumulated proline to levels 2.1 to 2.5 times that of control callus when subjected to mannitol-induced water stress, cool temperatures (19/sup 0/C) and abscisic acid (ABA). A combination of 0.53 molar mannitol plus 0.1 millimolar ABA induced a proline accumulation to about 4.5 times that of control callus, equivalent to approximately 0.18 millimoles proline per gram fresh weight of callus. Proline accumulation was directly related to the level of mannitol in the medium. Levels of ABA greater than 1.0 micromolar were required in the mediummore » to induce proline accumulation comparable to that induced by mannitol. Mannitol and ABA levels that induced maximum accumulation of proline also inhibited callus growth and increased tolerance to cold. Proline (12 millimolar) added to culture media also increased the tolerance of callus to 4/sup 0/C. The increased cold tolerance induced by the combination of mannitol and ABA has permitted the storage of the maize inbreds A632, A634Ht, B37wx, C103DTrf, Fr27rhm, H99, Pa91, Va35, and W117Ht at 4/sup 0/C for 90 days which is more than double the typical survival time of callus. These studies show that proline accumulation increase the cold tolerance of regenerable maize callus.« less

Proline accumulation in lemongrass (Cymbopogon flexuosus Stapf.) due to heavy metal stress.

PubMed

Handique, G K; Handique, A K

2009-03-01

Toxic heavy metals viz. lead, mercury and cadmium induced differential accumulation of proline in lemongrass (Cymbopogon flexuosus Stapf.) grown in soil amended with 50, 100, 200, 350 and 500 mg kg(-1) of the metals have been studied. Proline accumulation was found to be metal specific, organ specific and linear dose dependant. Further, proline accumulation following short term exposure (two months after transplantation) was higher than long term exposure (nine months after transplantation). Proline accumulation following short term exposure was 2.032 to 3.839 micro moles g(-1) for cadmium (50-200 mg kg(-1)); the corresponding range for mercury was 1.968 to 5.670 micro moles g(-1) and 0.830 to 4.567 micro moles g(-1) for lead (50-500 mg kg(-1) for mercury and lead). Proline accumulation was consistently higher in young tender leaf than old leaf, irrespective of the metal or duration of exposure. For cadmium treatment proline level was 2.032 to 3.839 micro moles g(-1) for young leaves while the corresponding value for old leaf was 1.728 to 2.396 micro moles g(-1) following short term exposure. The same trend was observed for the other two metals and duration of exposure. For control set proline accumulation in root was 0.425 micro moles g(-1) as against 0.805 and 0.533 micro moles g(-1) in young and old leaves respectively indicating that proline accumulation in root are lower than leaves, under both normal and stressed condition.

Biogeographical region and host trophic level determine carnivore endoparasite richness in the Iberian Peninsula.

PubMed

Rosalino, L M; Santos, M J; Fernandes, C; Santos-Reis, M

2011-05-01

We address the question of whether host and/or environmental factors might affect endoparasite richness and distribution, using carnivores as a model. We reviewed studies published in international peer-reviewed journals (34 areas in the Iberian Peninsula), describing parasite prevalence and richness in carnivores, and collected information on site location, host bio-ecology, climate and detected taxa (Helminths, Protozoa and Mycobacterium spp.). Three hypotheses were tested (i) host based, (ii) environmentally based, and (iii) hybrid (combination of environmental and host). Multicollinearity reduced candidate variable number for modelling to 5: host weight, phylogenetic independent contrasts (host weight), mean annual temperature, host trophic level and biogeographical region. General Linear Mixed Modelling was used and the best model was a hybrid model that included biogeographical region and host trophic level. Results revealed that endoparasite richness is higher in Mediterranean areas, especially for the top predators. We suggest that the detected parasites may benefit from mild environmental conditions that occur in southern regions. Top predators have larger home ranges and are likely to be subjected to cascading effects throughout the food web, resulting in more infestation opportunities and potentially higher endoparasite richness. This study suggests that richness may be more affected by historical and regional processes (including climate) than by host ecological processes.

Gas-phase conformation-specific photofragmentation of proline-containing peptide ions.

PubMed

Kim, Tae-Young; Valentine, Stephen J; Clemmer, David E; Reilly, James P

2010-08-01

Singly-protonated proline-containing peptides with N-terminal arginine are photodissociated with vacuum ultraviolet (VUV) light in an ESI linear ion trap/orthogonal-TOF (LIT/o-TOF). When proline is the nth residue from the N-terminus, unusual b(n) + 2 and a(n) + 2 ions are observed. Their formation is explained by homolytic cleavage of the C(alpha)-C bond in conjunction with a rearrangement of electrons and an amide hydrogen. The latter is facilitated by a proline-stabilized gas-phase peptide conformation. Copyright 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

UV photodissociation of proline-containing peptide ions: insights from molecular dynamics.

PubMed

Girod, Marion; Sanader, Zeljka; Vojkovic, Marin; Antoine, Rodolphe; MacAleese, Luke; Lemoine, Jérôme; Bonacic-Koutecky, Vlasta; Dugourd, Philippe

2015-03-01

UV photodissociation of proline-containing peptide ions leads to unusual product ions. In this paper, we report laser-induced dissociation of a series of proline-containing peptides at 213 nm. We observe specific fragmentation pathways corresponding to the formation of (y-2), (a + 2) and (b + 2) fragment ions. This was not observed at 266 nm or for peptides which do not contain proline residues. In order to obtain insights into the fragmentation dynamics at 213 nm, a small peptide (RPK for arginine-proline-lysine) was studied both theoretically and experimentally. Calculations of absorption spectra and non-adiabatic molecular dynamics (MD) were made. Second and third excited singlet states, S(2) and S(3), lie close to 213 nm. Non-adiabatic MD simulation starting from S(2) and S(3) shows that these transitions are followed by C-C and C-N bond activation close to the proline residue. After this first relaxation step, consecutive rearrangements and proton transfers are required to produce unusual (y-2), (a + 2) and (b + 2) fragment ions. These fragmentation mechanisms were confirmed by H/D exchange experiments.

UV Photodissociation of Proline-containing Peptide Ions: Insights from Molecular Dynamics

NASA Astrophysics Data System (ADS)

Girod, Marion; Sanader, Zeljka; Vojkovic, Marin; Antoine, Rodolphe; MacAleese, Luke; Lemoine, Jérôme; Bonacic-Koutecky, Vlasta; Dugourd, Philippe

2015-03-01

UV photodissociation of proline-containing peptide ions leads to unusual product ions. In this paper, we report laser-induced dissociation of a series of proline-containing peptides at 213 nm. We observe specific fragmentation pathways corresponding to the formation of (y-2), (a + 2) and (b + 2) fragment ions. This was not observed at 266 nm or for peptides which do not contain proline residues. In order to obtain insights into the fragmentation dynamics at 213 nm, a small peptide (RPK for arginine-proline-lysine) was studied both theoretically and experimentally. Calculations of absorption spectra and non-adiabatic molecular dynamics (MD) were made. Second and third excited singlet states, S2 and S3, lie close to 213 nm. Non-adiabatic MD simulation starting from S2 and S3 shows that these transitions are followed by C-C and C-N bond activation close to the proline residue. After this first relaxation step, consecutive rearrangements and proton transfers are required to produce unusual (y-2), (a + 2) and (b + 2) fragment ions. These fragmentation mechanisms were confirmed by H/D exchange experiments.

Proteomic analysis reveals diverse proline hydroxylation-mediated oxygen-sensing cellular pathways in cancer cells

PubMed Central

Liu, Bing; Gao, Yankun; Ruan, Hai-Bin; Chen, Yue

2016-01-01

Proline hydroxylation is a critical cellular mechanism regulating oxygen-response pathways in tumor initiation and progression. Yet, its substrate diversity and functions remain largely unknown. Here, we report a system-wide analysis to characterize proline hydroxylation substrates in cancer cells using an immunoaffinity-purification assisted proteomics strategy. We identified 562 sites from 272 proteins in HeLa cells. Bioinformatic analysis revealed that proline hydroxylation substrates are significantly enriched with mRNA processing and stress-response cellular pathways with canonical and diverse flanking sequence motifs. Structural analysis indicates a significant enrichment of proline hydroxylation participating in the secondary structure of substrate proteins. Our study identified and validated Brd4, a key transcription factor, as a novel proline hydroxylation substrate. Functional analysis showed that the inhibition of proline hydroxylation pathway significantly reduced the proline hydroxylation abundance on Brd4 and affected Brd4-mediated transcriptional activity as well as cell proliferation in AML leukemia cells. Taken together, our study identified a broad regulatory role of proline hydroxylation in cellular oxygen-sensing pathways and revealed potentially new targets that dynamically respond to hypoxia microenvironment in tumor cells. PMID:27764789

l-Proline, GABA Synthesis and Gamma Oscillations in Schizophrenia.

PubMed

Volk, David W; Gonzalez-Burgos, Guillermo; Lewis, David A

2016-12-01

Altered inhibition from parvalbumin-containing GABA neurons is thought to contribute to impaired gamma frequency oscillations and cognitive deficits in schizophrenia. Crabtree and colleagues report that proline dehydrogenase deficits produce excessive cytosolic levels of the GABA-mimetic l-proline which impairs GABA synthesis and gamma oscillations in a manner that mimics schizophrenia. Copyright © 2016 Elsevier Ltd. All rights reserved.

Synthesis of acrylic polymer beads for solid-supported proline-derived organocatalysts.

PubMed

Kristensen, Tor E; Vestli, Kristian; Fredriksen, Kim A; Hansen, Finn K; Hansen, Tore

2009-07-16

A completely non-chromatographic and highly large-scale adaptable synthesis of acrylic polymer beads containing proline and prolineamides has been developed. Novel monomeric proline (meth)acrylates are prepared from hydroxyproline in only one step. Free-radical copolymerization then gives solid-supported proline organocatalysts directly in as little as two steps overall, without using any prefabricated solid supports, by using either droplet or dispersion polymerization. These affordable acrylic beads have highly favorable and adjustable swelling characteristics and are excellent reusable catalysts for organocatalytic reactions.

Identification of polyproline II regions derived from the proline-rich nuclear receptor coactivators PNRC and PNRC2: new insights for ERα coactivator interactions.

PubMed

Byrne, C; Miclet, E; Broutin, I; Gallo, D; Pelekanou, V; Kampa, M; Castanas, E; Leclercq, G; Jacquot, Y

2013-10-01

Protein-protein interactions are crucial for signal transductions required for cell differentiation and proliferation. Their modulation is therefore key to the development of therapeutic alternatives, particularly in the context of cancer. According to literature data, the polyproline-rich nuclear receptor coactivators PNRC and PNRC2 interact with estrogen receptor (ERα) through their PxxP SH3-binding motifs. In a search to identify the molecular features governing this interaction, we explored using electronic circular dichroism (ECD) spectroscopy and molecular dynamics (MD) calculations, the capacity of a range of putative biologically active peptides derived from these proteins and containing this PxxP motif(s) to form polyproline II (PPII) domains. An additional more exhaustive structural study on a lead PPII peptide was also performed using 2D nuclear magnetic resonance (NMR) spectroscopy. With the exception of one of all the investigated peptides (PNRC-D), binding assays failed to detect any affinity for Grb2 SH3 domains, suggesting that PPII motifs issued from Grb2 antagonists have a binding mode distinct from those derived from Grb2 agonists. Instead, the peptides revealed a competitive binding ability against a synthetic peptide (ERα17p) with a putative PPII-cognate domain located within a coregulator recruitment region of ERα (AF-2 site). Our work, which constitutes the first structure-related interaction study concerning PNRC and PNRC2, supports not only the existence of PxxP-induced PPII sequences in these coregulators, but also confirms the presence of a PPII recognition site in the AF-2 of the steroid receptor ERα, a region important for transcription regulation. © 2013 Wiley Periodicals, Inc.

Novel proline-hydroxyproline glycopeptides from the dandelion (Taraxacum officinale Wigg.) flowers: de novo sequencing and biological activity.

PubMed

Astafieva, Alexandra A; Enyenihi, Atim A; Rogozhin, Eugene A; Kozlov, Sergey A; Grishin, Eugene V; Odintsova, Tatyana I; Zubarev, Roman A; Egorov, Tsezi A

2015-09-01

Two novel homologous peptides named ToHyp1 and ToHyp2 that show no similarity to any known proteins were isolated from Taraxacum officinale Wigg. flowers by multidimensional liquid chromatography. Amino acid and mass spectrometry analyses demonstrated that the peptides have unusual structure: they are cysteine-free, proline-hydroxyproline-rich and post-translationally glycosylated by pentoses, with 5 carbohydrates in ToHyp2 and 10 in ToHyp1. The ToHyp2 peptide with a monoisotopic molecular mass of 4350.3Da was completely sequenced by a combination of Edman degradation and de novo sequencing via top down multistage collision induced dissociation (CID) and higher energy dissociation (HCD) tandem mass spectrometry (MS(n)). ToHyp2 consists of 35 amino acids, contains eighteen proline residues, of which 8 prolines are hydroxylated. The peptide displays antifungal activity and inhibits growth of Gram-positive and Gram-negative bacteria. We further showed that carbohydrate moieties have no significant impact on the peptide structure, but are important for antifungal activity although not absolutely necessary. The deglycosylated ToHyp2 peptide was less active against the susceptible fungus Bipolaris sorokiniana than the native peptide. Unique structural features of the ToHyp2 peptide place it into a new family of plant defense peptides. The discovery of ToHyp peptides in T. officinale flowers expands the repertoire of molecules of plant origin with practical applications. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Quantum mechanical effects in zwitterionic amino acids: The case of proline, hydroxyproline, and alanine in water

NASA Astrophysics Data System (ADS)

Ulman, Kanchan; Busch, Sebastian; Hassanali, Ali A.

2018-06-01

In this work, we use ab initio molecular dynamics simulations to elucidate the electronic properties of three hydrated zwitterionic amino acids, namely proline, hydroxyproline, and alanine, the former two forming an important constituent of collagen. In all three systems, we find a substantial amount of charge transfer between the amino acids and surrounding solvent, which, rather surprisingly, also involves the reorganization of electron density near the hydrophobic non-polar groups. Water around proline appears to be slightly more polarized, as reflected by the enhanced water dipole moment in its hydration shell. This observation is also complemented by an examination of the IR spectra of the three systems where there is a subtle red and blue shift in the O-H stretch and bend regions, respectively, for proline. We show that polarizability of these amino acids as revealed by a dipole moment analysis involves a significant enhancement from the solvent and that this also involves non-polar groups. Our results suggest that quantum mechanical effects are likely to be important in understanding the coupling between biomolecules and water in general and in hydrophobic interactions.

Extraction of consensus protein patterns in regions containing non-proline cis peptide bonds and their functional assessment.

PubMed

Exarchos, Konstantinos P; Exarchos, Themis P; Rigas, Georgios; Papaloukas, Costas; Fotiadis, Dimitrios I

2011-05-10

In peptides and proteins, only a small percentile of peptide bonds adopts the cis configuration. Especially in the case of amide peptide bonds, the amount of cis conformations is quite limited thus hampering systematic studies, until recently. However, lately the emerging population of databases with more 3D structures of proteins has produced a considerable number of sequences containing non-proline cis formations (cis-nonPro). In our work, we extract regular expression-type patterns that are descriptive of regions surrounding the cis-nonPro formations. For this purpose, three types of pattern discovery are performed: i) exact pattern discovery, ii) pattern discovery using a chemical equivalency set, and iii) pattern discovery using a structural equivalency set. Afterwards, using each pattern as predicate, we search the Eukaryotic Linear Motif (ELM) resource to identify potential functional implications of regions with cis-nonPro peptide bonds. The patterns extracted from each type of pattern discovery are further employed, in order to formulate a pattern-based classifier, which is used to discriminate between cis-nonPro and trans-nonPro formations. In terms of functional implications, we observe a significant association of cis-nonPro peptide bonds towards ligand/binding functionalities. As for the pattern-based classification scheme, the highest results were obtained using the structural equivalency set, which yielded 70% accuracy, 77% sensitivity and 63% specificity.

Proline oxidase promotes tumor cell survival in hypoxic tumor microenvironments

PubMed Central

Liu, Wei; Glunde, Kristine; Bhujwalla, Zaver M.; Raman, Venu; Sharma, Anit; Phang, James M.

2012-01-01

Proline is a readily released stress substrate that can be metabolized by proline oxidase (POX) to generate either reactive oxygen species to induce apoptosis or autophagy or ATP during times of nutrient stress. However, the contribution of proline metabolism to tumorigenesis in hypoxic microenvironments has not been explored. In this study, we investigated the different functions of POX under hypoxia and glucose depletion. We found that hypoxia induced POX expression in cancer cells in vitro and that POX upregulation co-localized with hypoxic tissues in vivo. In addition, the combination of hypoxia and low-glucose showed additive effects on POX expression. Similar to conditions of low glucose, hypoxia-mediated POX induction was dependent on AMP-activated protein kinase (AMPK) activation, but was independent of HIF-1α and HIF-2α. Under low-glucose and combined low-glucose and hypoxic conditions, proline catabolized by POX was used preferentially for ATP production, whereas under hypoxia, POX mediated autophagic signaling for survival by generating ROS. Although the specific mechanism was different for hypoxia and glucose deprivation, POX consistently contributed to tumor cell survival under these conditions. Together, our findings offer new insights into the metabolic reprogramming of tumor cells present within a hostile microenvironment and suggest that proline metabolism is a potential target for cancer therapeutics. PMID:22609800

Proline Can Have Opposite Effects on Fast and Slow Protein Folding Phases

PubMed Central

Osváth, Szabolcs; Gruebele, Martin

2003-01-01

Proline isomerization is well known to cause additional slow phases during protein refolding. We address a new question: does the presence of prolines significantly affect the very fast kinetics that lead to the formation of folding intermediates? We examined both the very slow (10–100 min) and very fast (4 μs–2.5 ms) folding kinetics of the two-domain enzyme yeast phosphoglycerate kinase by temperature-jump relaxation. Phosphoglycerate kinase contains a conserved cis-proline in position 204, in addition to several trans-prolines. Native cis-prolines have the largest effect on folding kinetics because the unfolded state favors trans isomerization, so we compared the kinetics of a P204H mutant with the wild-type as a proof of principle. The presence of Pro-204 causes an additional slow phase upon refolding from the cold denatured state, as reported in the literature. Contrary to this, the fast folding events are sped up in the presence of the cis-proline, probably by restriction of the conformational space accessible to the molecule. The wild-type and Pro204His mutant would be excellent models for off-lattice simulations probing the effects of conformational restriction on short timescales. PMID:12885665

Self-cloning baker's yeasts that accumulate proline enhance freeze tolerance in doughs.

PubMed

Kaino, Tomohiro; Tateiwa, Tetsuya; Mizukami-Murata, Satomi; Shima, Jun; Takagi, Hiroshi

2008-09-01

We constructed self-cloning diploid baker's yeast strains by disrupting PUT1, encoding proline oxidase, and replacing the wild-type PRO1, encoding gamma-glutamyl kinase, with a pro1(D154N) or pro1(I150T) allele. The resultant strains accumulated intracellular proline and retained higher-level fermentation abilities in the frozen doughs than the wild-type strain. These results suggest that proline-accumulating baker's yeast is suitable for frozen-dough baking.

Osmoprotection of Bacillus subtilis through Import and Proteolysis of Proline-Containing Peptides

PubMed Central

Zaprasis, Adrienne; Brill, Jeanette; Thüring, Marietta; Wünsche, Guido; Heun, Magnus; Barzantny, Helena; Hoffmann, Tamara

2013-01-01

Bacillus subtilis can attain cellular protection against the detrimental effects of high osmolarity through osmotically induced de novo synthesis and uptake of the compatible solute l-proline. We have now found that B. subtilis can also exploit exogenously provided proline-containing peptides of various lengths and compositions as osmoprotectants. Osmoprotection by these types of peptides is generally dependent on their import via the peptide transport systems (Dpp, Opp, App, and DtpT) operating in B. subtilis and relies on their hydrolysis to liberate proline. The effectiveness with which proline-containing peptides confer osmoprotection varies considerably, and this can be correlated with the amount of the liberated and subsequently accumulated free proline by the osmotically stressed cell. Through gene disruption experiments, growth studies, and the quantification of the intracellular proline pool, we have identified the PapA (YqhT) and PapB (YkvY) peptidases as responsible for the hydrolysis of various types of Xaa-Pro dipeptides and Xaa-Pro-Xaa tripeptides. The PapA and PapB peptidases possess overlapping substrate specificities. In contrast, osmoprotection by peptides of various lengths and compositions with a proline residue positioned at their N terminus was not affected by defects in the PapA and PapB peptidases. Taken together, our data provide new insight into the physiology of the osmotic stress response of B. subtilis. They illustrate the flexibility of this ubiquitously distributed microorganism to effectively exploit environmental resources in its acclimatization to sustained high-osmolarity surroundings through the accumulation of compatible solutes. PMID:23144141

21 CFR 582.5650 - Proline.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...

21 CFR 582.5650 - Proline.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...

21 CFR 582.5650 - Proline.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...

21 CFR 582.5650 - Proline.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...

21 CFR 582.5650 - Proline.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS SUBSTANCES GENERALLY RECOGNIZED AS SAFE Nutrients and/or Dietary Supplements 1...

Randomized Subspace Learning for Proline Cis-Trans Isomerization Prediction.

PubMed

Al-Jarrah, Omar Y; Yoo, Paul D; Taha, Kamal; Muhaidat, Sami; Shami, Abdallah; Zaki, Nazar

2015-01-01

Proline residues are common source of kinetic complications during folding. The X-Pro peptide bond is the only peptide bond for which the stability of the cis and trans conformations is comparable. The cis-trans isomerization (CTI) of X-Pro peptide bonds is a widely recognized rate-limiting factor, which can not only induces additional slow phases in protein folding but also modifies the millisecond and sub-millisecond dynamics of the protein. An accurate computational prediction of proline CTI is of great importance for the understanding of protein folding, splicing, cell signaling, and transmembrane active transport in both the human body and animals. In our earlier work, we successfully developed a biophysically motivated proline CTI predictor utilizing a novel tree-based consensus model with a powerful metalearning technique and achieved 86.58 percent Q2 accuracy and 0.74 Mcc, which is a better result than the results (70-73 percent Q2 accuracies) reported in the literature on the well-referenced benchmark dataset. In this paper, we describe experiments with novel randomized subspace learning and bootstrap seeding techniques as an extension to our earlier work, the consensus models as well as entropy-based learning methods, to obtain better accuracy through a precise and robust learning scheme for proline CTI prediction.

Nitrogen availability regulates proline and ethylene production and alleviates salinity stress in mustard (Brassica juncea).

PubMed

Iqbal, Noushina; Umar, Shahid; Khan, Nafees A

2015-04-15

Proline content and ethylene production have been shown to be involved in salt tolerance mechanisms in plants. To assess the role of nitrogen (N) in the protection of photosynthesis under salt stress, the effect of N (0, 5, 10, 20 mM) on proline and ethylene was studied in mustard (Brassica juncea). Sufficient N (10 mM) optimized proline production under non-saline conditions through an increase in proline-metabolizing enzymes, leading to osmotic balance and protection of photosynthesis through optimal ethylene production. Excess N (20 mM), in the absence of salt stress, inhibited photosynthesis and caused higher ethylene evolution but lower proline production compared to sufficient N. In contrast, under salt stress with an increased demand for N, excess N optimized ethylene production, which regulates the proline content resulting in recovered photosynthesis. The effect of excess N on photosynthesis under salt stress was further substantiated by the application of the ethylene biosynthesis inhibitor, 1-aminoethoxy vinylglycine (AVG), which inhibited proline production and photosynthesis. Without salt stress, AVG promoted photosynthesis in plants receiving excess N by inhibiting stress ethylene production. The results suggest that a regulatory interaction exists between ethylene, proline and N for salt tolerance. Nitrogen differentially regulates proline production and ethylene formation to alleviate the adverse effect of salinity on photosynthesis in mustard. Copyright © 2015 Elsevier GmbH. All rights reserved.

The γ-Aminobutyrate Permease GabP Serves as the Third Proline Transporter of Bacillus subtilis

PubMed Central

Zaprasis, Adrienne; Hoffmann, Tamara; Stannek, Lorena; Gunka, Katrin; Commichau, Fabian M.

2014-01-01

PutP and OpuE serve as proline transporters when this imino acid is used by Bacillus subtilis as a nutrient or as an osmostress protectant, respectively. The simultaneous inactivation of the PutP and OpuE systems still allows the utilization of proline as a nutrient. This growth phenotype pointed to the presence of a third proline transport system in B. subtilis. We took advantage of the sensitivity of a putP opuE double mutant to the toxic proline analog 3,4-dehydro-dl-proline (DHP) to identify this additional proline uptake system. DHP-resistant mutants were selected and found to be defective in the use of proline as a nutrient. Whole-genome resequencing of one of these strains provided the lead that the inactivation of the γ-aminobutyrate (GABA) transporter GabP was responsible for these phenotypes. DNA sequencing of the gabP gene in 14 additionally analyzed DHP-resistant strains confirmed this finding. Consistently, each of the DHP-resistant mutants was defective not only in the use of proline as a nutrient but also in the use of GABA as a nitrogen source. The same phenotype resulted from the targeted deletion of the gabP gene in a putP opuE mutant strain. Hence, the GabP carrier not only serves as an uptake system for GABA but also functions as the third proline transporter of B. subtilis. Uptake studies with radiolabeled GABA and proline confirmed this conclusion and provided information on the kinetic parameters of the GabP carrier for both of these substrates. PMID:24142252

Responsiveness to 6-n-Propylthiouracil (PROP) Is Associated with Salivary Levels of Two Specific Basic Proline-Rich Proteins in Humans

PubMed Central

Cabras, Tiziana; Melis, Melania; Castagnola, Massimo; Padiglia, Alessandra; Tepper, Beverly J.; Messana, Irene; Tomassini Barbarossa, Iole

2012-01-01

Thiourea tasting can be predictive of individual differences in bitter taste responses, general food preferences and eating behavior, and could be correlated with saliva chemical composition. We investigated the possible relationship between PROP bitter taste responsiveness and the salivary proteome in subjects genotyped for TAS2R38 and gustin gene polymorphisms. Taste perception intensity evoked by PROP and NaCl solutions was measured in sixty-three volunteers (21 males, 42 females, age 25±3 y) to establish their PROP taster status, and 24 PROP super-tasters and 21 nontasters were selected to participate in the study. TAS2R38 and gustin gene molecular analysis were performed using PCR techniques. Qualitative and quantitative determination of salivary proteins was performed by HPLC-ESI-MS before and after PROP taste stimulation. PROP super-tastings was strongly associated with the ‘taster’ variant (PAV haplotype) of TAS2R38 and the A allele of rs2274333 polymorphism in the gustin gene and nontasting was associated with the minor alleles at both loci. ANOVA revealed that basal levels of II-2 and Ps-1 proteins, belonging to the basic proline-rich protein (bPRPs) family, were significantly higher in PROP super-taster than in nontaster un-stimulated saliva, and that PROP stimulation elicited a rapid increase in the levels of these same proteins only in PROP super-taster saliva. These data show for the first time that responsiveness to PROP is associated with salivary levels of II-2 peptide and Ps-1 protein, which are products of the PRB1 gene. These findings suggest that PRB1, in addition to TAS2R38 and gustin, could contribute to individual differences in thiourea sensitivity, and the expression of the PROP phenotype as a complex genetic trait. PMID:22312435

Responsiveness to 6-n-propylthiouracil (PROP) is associated with salivary levels of two specific basic proline-rich proteins in humans.

PubMed

Cabras, Tiziana; Melis, Melania; Castagnola, Massimo; Padiglia, Alessandra; Tepper, Beverly J; Messana, Irene; Tomassini Barbarossa, Iole

2012-01-01

Thiourea tasting can be predictive of individual differences in bitter taste responses, general food preferences and eating behavior, and could be correlated with saliva chemical composition. We investigated the possible relationship between PROP bitter taste responsiveness and the salivary proteome in subjects genotyped for TAS2R38 and gustin gene polymorphisms. Taste perception intensity evoked by PROP and NaCl solutions was measured in sixty-three volunteers (21 males, 42 females, age 25±3 y) to establish their PROP taster status, and 24 PROP super-tasters and 21 nontasters were selected to participate in the study. TAS2R38 and gustin gene molecular analysis were performed using PCR techniques. Qualitative and quantitative determination of salivary proteins was performed by HPLC-ESI-MS before and after PROP taste stimulation. PROP super-tastings was strongly associated with the 'taster' variant (PAV haplotype) of TAS2R38 and the A allele of rs2274333 polymorphism in the gustin gene and nontasting was associated with the minor alleles at both loci. ANOVA revealed that basal levels of II-2 and Ps-1 proteins, belonging to the basic proline-rich protein (bPRPs) family, were significantly higher in PROP super-taster than in nontaster un-stimulated saliva, and that PROP stimulation elicited a rapid increase in the levels of these same proteins only in PROP super-taster saliva. These data show for the first time that responsiveness to PROP is associated with salivary levels of II-2 peptide and Ps-1 protein, which are products of the PRB1 gene. These findings suggest that PRB1, in addition to TAS2R38 and gustin, could contribute to individual differences in thiourea sensitivity, and the expression of the PROP phenotype as a complex genetic trait.

Molecular mechanisms of cryoprotection in aqueous proline: light scattering and molecular dynamics simulations.

PubMed

Troitzsch, R Z; Vass, H; Hossack, W J; Martyna, G J; Crain, J

2008-04-10

Free proline amino acid is a natural cryoprotectant expressed by numerous organisms under low-temperature stress. Previous reports have suggested that complex assemblies underlie its functional properties. We investigate here aqueous proline solutions as a function of temperature using combinations of Raman spectroscopy, Rayleigh-Brillouin light scattering, and molecular dynamics simulations with the view to revealing the molecular origins of the mixtures' functionality as a cryoprotectant. The evolution of the Brillouin frequency shifts and line widths with temperature shows that, above a critical proline concentration, the water-like dynamics is suppressed and viscoelastic behavior emerges: Here, the Landau-Placzek ratio also shows a temperature-independent maximum arising from concentration fluctuations. Molecular dynamics simulations reveal that the water-water correlations in the mixtures depend much more weakly on temperature than does bulk water. By contrast, the water OH Raman bands exhibit strong red-shifts on cooling similar to those seen in ices; however, no evidence of ice lattice phonons is observed in the low-frequency spectrum. We attribute this primarily to enhanced proline-water hydrogen bonding. In general, the picture that emerges is that aqueous proline is a heterogeneous mixture on molecular length scales (characterized by significant concentration fluctuations rather than well-defined aggregates). Simulations reveal that proline also appears to suppress the normal dependence of water structure on temperature and preserves the ambient-temperature correlations even in very cold solutions. The water structure in cold proline solutions therefore appears to be similar to that at a higher effective temperature. This, coupled with the emergence of glassy dynamics offers a molecular explanation for the functional properties of proline as a cryoprotectant without the need to invoke previously proposed complex aggregates.

An N-terminal glycine-rich sequence contributes to retrovirus trimer of hairpins stability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, Kirilee A.; Maerz, Anne L.; Baer, Severine

2007-08-10

Retroviral transmembrane proteins (TMs) contain a glycine-rich segment linking the N-terminal fusion peptide and coiled coil core. Previously, we reported that the glycine-rich segment (Met-326-Ser-337) of the human T-cell leukemia virus type 1 (HTLV-1) TM, gp21, is a determinant of membrane fusion function [K.A. Wilson, S. Baer, A.L. Maerz, M. Alizon, P. Poumbourios, The conserved glycine-rich segment linking the N-terminal fusion peptide to the coiled coil of human T-cell leukemia virus type 1 transmembrane glycoprotein gp21 is a determinant of membrane fusion function, J. Virol. 79 (2005) 4533-4539]. Here we show that the reduced fusion activity of an I334A mutantmore » correlated with a decrease in stability of the gp21 trimer of hairpins conformation, in the context of a maltose-binding protein-gp21 chimera. The stabilizing influence of Ile-334 required the C-terminal membrane-proximal sequence Trp-431-Ser-436. Proline substitution of four of five Gly residues altered gp21 trimer of hairpins stability. Our data indicate that flexibility within and hydrophobic interactions mediated by this region are determinants of gp21 stability and membrane fusion function.« less

DFR1-Mediated Inhibition of Proline Degradation Pathway Regulates Drought and Freezing Tolerance in Arabidopsis.

PubMed

Ren, Yongbing; Miao, Min; Meng, Yun; Cao, Jiasheng; Fan, Tingting; Yue, Junyang; Xiao, Fangming; Liu, Yongsheng; Cao, Shuqing

2018-06-26

Proline accumulation is one of the most important adaptation mechanisms for plants to cope with environmental stresses, such as drought and freezing. However, the molecular mechanism of proline homeostasis under these stresses is largely unknown. Here, we identified a mitochondrial protein, DFR1, involved in the inhibition of proline degradation in Arabidopsis. DFR1 was strongly induced by drought and cold stresses. The dfr1 knockdown mutants showed hypersensitivity to drought and freezing stresses, whereas the DFR1 overexpression plants exhibited enhanced tolerance, which was positively correlated with proline levels. DFR1 interacts with proline degradation enzymes PDH1/2 and P5CDH and compromises their activities. Genetic analysis showed that DFR1 acts upstream of PDH1/2 and P5CDH to positively regulate proline accumulation. Our results demonstrate a regulatory mechanism by which, under drought and freezing stresses, DFR1 interacts with PDH1/2 and P5CDH to abrogate their activities to maintain proline homeostasis, thereby conferring drought and freezing tolerance. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Tetramer-organizing polyproline-rich peptides differ in CHO cell-expressed and plasma-derived human butyrylcholinesterase tetramers.

PubMed

Schopfer, Lawrence M; Lockridge, Oksana

2016-06-01

Tetrameric butyrylcholinesterase (BChE) in human plasma is the product of multiple genes, namely one BCHE gene on chromosome 3q26.1 and multiple genes that encode polyproline-rich peptides. The function of the polyproline-rich peptides is to assemble BChE into tetramers. CHO cells transfected with human BChE cDNA express BChE monomers and dimers, but only low quantities of tetramers. Our goal was to identify the polyproline-rich peptides in CHO-cell derived human BChE tetramers. CHO cell-produced human BChE tetramers were purified from serum-free culture medium. Peptides embedded in the tetramerization domain were released from BChE tetramers by boiling and identified by liquid chromatography-tandem mass spectrometry. A total of 270 proline-rich peptides were sequenced, ranging in size from 6-41 residues. The peptides originated from 60 different proteins that reside in multiple cell compartments including the nucleus, cytoplasm, and endoplasmic reticulum. No single protein was the source of the polyproline-rich peptides in CHO cell-expressed human BChE tetramers. In contrast, 70% of the tetramer-organizing peptides in plasma-derived BChE tetramers originate from lamellipodin. No protein source was identified for polyproline peptides containing up to 41 consecutive proline residues. In conclusion, the use of polyproline-rich peptides as a tetramerization motif is documented only for the cholinesterases, but is expected to serve other tetrameric proteins as well. The CHO cell data suggest that the BChE tetramer-organizing peptide can arise from a variety of proteins. Copyright © 2016 Elsevier B.V. All rights reserved.

Solvent and conformation dependence of amide I vibrations in peptides and proteins containing proline

NASA Astrophysics Data System (ADS)

Roy, Santanu; Lessing, Joshua; Meisl, Georg; Ganim, Ziad; Tokmakoff, Andrei; Knoester, Jasper; Jansen, Thomas L. C.

2011-12-01

We present a mixed quantum-classical model for studying the amide I vibrational dynamics (predominantly CO stretching) in peptides and proteins containing proline. There are existing models developed for determining frequencies of and couplings between the secondary amide units. However, these are not applicable to proline because this amino acid has a tertiary amide unit. Therefore, a new parametrization is required for infrared-spectroscopic studies of proteins that contain proline, such as collagen, the most abundant protein in humans and animals. Here, we construct the electrostatic and dihedral maps accounting for solvent and conformation effects on frequency and coupling for the proline unit. We examine the quality and the applicability of these maps by carrying out spectral simulations of a number of peptides with proline in D2O and compare with experimental observations.

Solvent and conformation dependence of amide I vibrations in peptides and proteins containing proline.

PubMed

Roy, Santanu; Lessing, Joshua; Meisl, Georg; Ganim, Ziad; Tokmakoff, Andrei; Knoester, Jasper; Jansen, Thomas L C

2011-12-21

We present a mixed quantum-classical model for studying the amide I vibrational dynamics (predominantly CO stretching) in peptides and proteins containing proline. There are existing models developed for determining frequencies of and couplings between the secondary amide units. However, these are not applicable to proline because this amino acid has a tertiary amide unit. Therefore, a new parametrization is required for infrared-spectroscopic studies of proteins that contain proline, such as collagen, the most abundant protein in humans and animals. Here, we construct the electrostatic and dihedral maps accounting for solvent and conformation effects on frequency and coupling for the proline unit. We examine the quality and the applicability of these maps by carrying out spectral simulations of a number of peptides with proline in D(2)O and compare with experimental observations.

Proline adsorption on TiO 2(1 1 0) single crystal surface: A study by high resolution photoelectron spectroscopy

NASA Astrophysics Data System (ADS)

Fleming, G. J.; Adib, K.; Rodriguez, J. A.; Barteau, M. A.; Idriss, H.

2007-12-01

The surface chemistry and binding of DL-proline were investigated on the oxidised (stoichiometric) and reduced (sub-stoichiometric) TiO 2(1 1 0) single crystal surfaces. TiO 2 was chosen as the substrate as it best represents the surface of a biomedical implant, which bio-molecules interact with during the healing of bone/teeth fractures (molecular recognition). High resolution X-ray photoelectron spectroscopy (HR-XPS) studies of the C1s and N1s regions revealed that DL-proline is present in two forms (dissociated and zwitterionic) on the oxidised TiO 2 surface. On TiO 2(1 1 0) surfaces reduced by Ar + sputtering, a significant increase in the amount of zwitterionic proline at the surface was detected when compared with the oxidised surface. Study of the temperature effect showed that in both cases the zwitterionic structure was the less stable structure. The reason for its relative instability appears to be thermodynamic.

Oxidation of Proline by Mitochondria Isolated from Water-Stressed Maize Shoots 1

PubMed Central

Sells, Gary D.; Koeppe, David E.

1981-01-01

Proline oxidation and coupled phosphorylation were measured in mitochondria after isolation from shoots of water-stressed, etiolated maize (Zea mays L.) seedlings. Both state III and state IV rates of proline oxidation decreased as a logarithmic function of increased seedling water stress between −5 and −10 bars. Proline oxidation rates decreased 62% (state III) and 58% (state IV) as seedling water potentials were decreased from −5 to −10 bars. By comparison, oxidation of succinate, exogenous NADH, or malate + pyruvate decreased only 10 to 15% in this stress range. These decreases were a linear function of increased stress and were comparable to oxidation rates of mitochondria subjected to varying in vitro osmotic potentials. Osmotically induced in vitro stress reduced proline oxidation rates linearly with more negative osmotic potentials, a decrease that was similar to the responses of the other substrates to more negative osmotic potentials. Some decrease in coupling, with all substrates as determined by ADP/O ratios, was observed under osmotic stress. Mitochondria were also isolated from shoot tissue that had been stressed and then rewatered. On a percentage basis, the recovery of proline oxidation was greater than that of the other substrates. The decreases in the proline oxidase activity of mitochondria after only slight stress indicate a mitochondrial sensitivity to water stress at significantly less negative water potentials than previously reported for measurements of maize membrane permeability and respiratory activity. PMID:16662051

The relationship of proline content and metabolism on the productivity of maize plants

PubMed Central

Špoljarević, Marija; Agić, Dejan; Lisjak, Miroslav; Gumze, Andrej; Wilson, Ian D; Hancock, John T

2011-01-01

The free proline content in maize ear-leaves, silk and pollen were analyzed in field grown plants which had matured to the pollination stage. Using maize hybrids PR34F02, PR35P12 and PR36B08 field trials were set up at two locations in eastern Croatia in two different years. Two enzymes of proline metabolism were analyzed in the same leaf samples and specific activities of synthetase (P5CS) and proline dehydrogenase (PDH). Plant productivity was evaluated at harvest by the estimation of total and fully developed grain number per ear and per plant, the mean single grain mass, and the mass of grain per plant. The year in which the plants were grown had a very significant effect on the free proline content in the leaf and pollen, as well as on the enzyme activities assayed. The differences between the plants from the two localities were very significant in all tested parameters of plant grain productivity. There was a significant genotype effect on proline content and P5CS total activity in leaf and on all the productivity parameters. Some of the correlations established suggest that the rate of proline synthesis and degradation in maize ear-leaf at pollination might contribute to the final grain production of the maize plant. Multiple regression analyses was used to further analyze the relationship between proline and grain productivity, but it is clear that future work should include other environmental conditions, plant species and organs such as roots. PMID:21415600

Proline induced disruption of the structure and dynamics of water.

PubMed

Yu, Dehong; Hennig, Marcus; Mole, Richard A; Li, Ji Chen; Wheeler, Cheryl; Strässle, Thierry; Kearley, Gordon J

2013-12-21

We use quasi-elastic neutron scattering spectroscopy to study the diffusive motion of water molecules at ambient temperature as a function of the solute molar fraction of the amino acid, proline. We validate molecular dynamics simulations against experimental quasielastic neutron scattering data and then use the simulations to reveal, and understand, a strong dependence of the translational self-diffusion coefficient of water on the distance to the amino acid molecule. An analysis based on the juxtaposition of water molecules in the simulation shows that the rigidity of proline imposes itself on the local water structure, which disrupts the hydrogen-bond network of water leading to an increase in the mean lifetime of hydrogen bonds. The net effect is some distortion of the proline molecule and a slowing down of the water mobility.

Simultaneous accumulation of proline and trehalose in industrial baker's yeast enhances fermentation ability in frozen dough.

PubMed

Sasano, Yu; Haitani, Yutaka; Hashida, Keisuke; Ohtsu, Iwao; Shima, Jun; Takagi, Hiroshi

2012-05-01

Freeze tolerance is a necessary characteristic for industrial baker's yeast because frozen-dough baking is one of the key technologies for supplying oven-fresh bakery products to consumers. Both proline and trehalose are known to function as cryoprotectants in yeast cells. In order to enhance the freeze tolerance of yeast cells, we constructed a self-cloning diploid baker's yeast strain with simultaneous accumulation of proline, by expressing the PRO1-I150T allele, encoding the proline-feedback inhibition-less sensitive γ-glutamyl kinase, and trehalose, by disrupting the NTH1 gene, encoding neutral trehalase. The resultant strain retained higher tolerance to oxidative and freezing stresses than did the single proline- or trehalose-accumulating strain. Interestingly, our results suggest that proline and trehalose protect yeast cells from short-term and long-term freezing, respectively. Simultaneous accumulation of proline and trehalose in industrial baker's yeast also enhanced the fermentation ability in the frozen dough compared with the single accumulation of proline or trehalose. These results indicate that baker's yeast that accumulates both proline and trehalose is applicable for frozen-dough baking. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Biogeographic affinity helps explain productivity-richness relationships at regional and local scales

USGS Publications Warehouse

Harrison, S.; Grace, J.B.

2007-01-01

The unresolved question of what causes the observed positive relationship between large-scale productivity and species richness has long interested ecologists and evolutionists. Here we examine a potential explanation that we call the biogeographic affinity hypothesis, which proposes that the productivity-richness relationship is a function of species' climatic tolerances that in turn are shaped by the earth's climatic history combined with evolutionary niche conservatism. Using botanical data from regions and sites across California, we find support for a key prediction of this hypothesis, namely, that the productivity-species richness relationship differs strongly and predictably among groups of higher taxa on the basis of their biogeographic affinities (i.e., between families or genera primarily associated with north-temperate, semiarid, or desert zones). We also show that a consideration of biogeographic affinity can yield new insights on how productivity-richness patterns at large geographic scales filter down to affect patterns of species richness and composition within local communities. ?? 2007 by The University of Chicago. All rights reserved.

Enthalpy characteristics of L-proline dissolution in certain water-organic mixtures at 298.15 K

NASA Astrophysics Data System (ADS)

Badelin, V. G.; Smirnov, V. I.

2017-01-01

A thermochemical study of the processes of L-proline dissolution in aqueous solutions of acetonitrile, 1,4-dioxane, acetone, dimethyl sulfoxide, nitromethane and tetrahydrofuran at T = 298.15 K in the range of organic solvent concentrations x2 = 0-0.25 mole fractions is performed. Standard values of the enthalpies of solution and transfer of L-proline from water to mixed solvent, and the enthalpy coefficients of pairwise interactions between L-proline and molecules of organic solvents, are calculated. The effect the composition of a water-organic mixture and the structure of organic solvents have on the enthalpy characteristics of L-proline dissolution and transfer is examined. The effect the energy properties of intermolecular interactions between components of a mixed solvent has on the intermolecular interactions between L-proline and molecules of cosolvent is estimated. The correlation between the enthalpy characteristics of L-proline dissolution and electron-donor properties of organic cosolvent in aqueous solutions is determined.

HR-MAS NMR metabolomics of 'Swingle' citrumelo rootstock genetically modified to overproduce proline.

PubMed

de Oliveira, Caroline S; Carlos, Eduardo F; Vieira, Luiz G E; Lião, Luciano M; Alcantara, Glaucia B

2014-08-01

The accumulation of proline is a typical physiological response to abiotic stresses in higher plants. 'Swingle' citrumelo, an important rootstock for citrus production, has been modified with a mutated Δ(1)-pyrroline-5-carboxylate synthetase gene (VaP5CSF129A) linked to the cauliflower mosaic virus 35S promoter to induce the overproduction of free proline. This paper presents a comparative metabolomic study of nontransgenic versus transgenic 'Swingle' citrumelo plants with high endogenous proline. (1)H high-resolution magic angle spinning nuclear magnetic resonance spectroscopy and multivariate analysis showed significant differences in some metabolites between the nontransgenic and transgenic leaves and roots. The overproduction of proline has reduced the sucrose content in transgenic leaves, revealing a metabolic cost for these plants. In roots, the high level of free proline acts for the adjustment of cation-anion balance, causing the reduction of acetic acid content. The same sucrose level in roots indicates that they can be considered as sucrose sink. Similar behavior may be waited for fruits produced on transgenic rootstock. Copyright © 2014 John Wiley & Sons, Ltd.

Use of prolines for improving growth and other properties of plants and algae

DOEpatents

Unkefer, Pat J.; Knight, Thomas J.; Martinez, Rodolfo A.

2003-07-15

Increasing the concentration of prolines, such as 2-hydroxy-5-oxoproline, in the foliar portions of plants has been shown to cause an increase in carbon dioxide fixation, growth rate, dry weight, nutritional value (amino acids), nodulation and nitrogen fixation, photosynthetically derived chemical energy, and resistance to insect pests over the same properties for wild type plants. This can be accomplished in four ways: (1) the application of a solution of the proline directly to the foliar portions of the plant by spraying these portions; (2) applying a solution of the proline to the plant roots; (3) genetically engineering the plant and screening to produce lines that over-express glutamine synthetase in the leaves which gives rise to increased concentration of the metabolite, 2-hydroxy-5-oxoproline (this proline is also known as 2-oxoglutaramate); and (4) impairing the glutamine synthetase activity in the plant roots which causes increased glutamine synthetase activity in the leaves which gives rise to increased concentration of 2-hydroxy-5-oxoproline. Prolines have also been found to induce similar effects in algae.

Use of prolines for improving growth and other properties of plants and algae

DOEpatents

Unkefer, Pat J.; Knight, Thomas J.; Martinez, Rodolfo A.

2004-12-14

Increasing the concentration of prolines, such as 2-hydroxy-5-oxoproline, in the foliar portions of plants has been shown to cause an increase in carbon dioxide fixation, growth rate, dry weight, nutritional value (amino acids), nodulation and nitrogen fixation, photosynthetically derived chemical energy, and resistance to insect pests over the same properties for wild type plants. This can be accomplished in four ways: (1) the application of a solution of the proline directly to the foliar portions of the plant by spraying these portions; (2) applying a solution of the proline to the plant roots; (3) genetically engineering the plant and screening to produce lines that over-express glutamine synthetase in the leaves which gives rise to increased concentration of the metabolite, 2-hydroxy-5-oxoproline (this proline is also known as 2-oxoglutaramate); and (4) impairing the glutamine synthetase activity in the plant roots which causes increased glutamine synthetase activity in the leaves which gives rise to increased concentration of 2-hydroxy-5-oxoproline. Prolines have also been found to induce similar effects in algae.

Use of prolines for improving growth and other properties of plants and algae

DOEpatents

Unkefer, Pat J.; Knight, Thomas J.; Martinez, Rodolfo A.

2003-04-29

Increasing the concentration of prolines such as 2-hydroxy-5-oxoproline, in the foliar portions of plants has been shown to cause an increase in carbon dioxide fixation, growth rate, dry weight, nutritional value (amino acids), nodulation and nitrogen fixation, photosynthetically derived chemical energy, and resistance to insect pests over the same properties for wild type plants. This can be accomplished in four ways: (1) the application of a solution of the proline directly to the foliar portions of the plant by spraying these portions; (2) applying a solution of the proline to the plant roots; (3) genetically engineering the plant and screening to produce lines that overexpress glutamine synthetase in the leaves which gives rise to increased concentration of the metabolite, 2-hydroxy-5-oxoproline (this proline is also known as 2-oxoglutaramnate); and (4) impairing the glutamine synthetase activity in the plant roots which causes increased glutamine synthetase activity in the leaves which gives rise to increased concentration of 2-hydroxy-5-oxoproline. Prolines have also been found to induce similar effects in algae.

Central l-proline attenuates stress-induced dopamine and serotonin metabolism in the chick forebrain.

PubMed

Hamasu, Kousuke; Shigemi, Kazutaka; Kabuki, Yusuke; Tomonaga, Shozo; Denbow, D Michael; Furuse, Mitsuhiro

2009-08-21

Using microdialysis, we investigated the effect of l-proline on monoamine release in the medio-rostral neostriatum/hyperstriatum ventrale (MNH) of freely moving and restricted chicks. A 30 min handling-stress resulted in a significant increase in extracellular homovallinic acid (HVA), a dopamine metabolite, and 5-hydroxyindoleacetic acid (5-HIAA), a serotonin metabolite, in the MNH. l-Proline, perfused through the microdialysis probe into the MNH during the stressed condition, significantly attenuated the average dialysate concentration of HVA produced by handling-stress. Handling-stress resulted in a significant increase in 5-HIAA levels in the control group, which were attenuated by profusion with l-proline. l-Proline did not significantly modify basal concentrations of HVA or 5-HIAA in the MNH during control conditions. These results show that perfusion of l-proline modified the turnover/metabolism of dopamine and serotonin in the MNH caused by handling-stress.

Despite sequence homologies to gluten, salivary proline-rich proteins do not elicit immune responses central to the pathogenesis of celiac disease.

PubMed

Tian, Na; Leffler, Daniel A; Kelly, Ciaran P; Hansen, Joshua; Marietta, Eric V; Murray, Joseph A; Schuppan, Detlef; Helmerhorst, Eva J

2015-12-01

Celiac disease (CD) is an inflammatory disorder triggered by ingested gluten, causing immune-mediated damage to the small-intestinal mucosa. Gluten proteins are strikingly similar in amino acid composition and sequence to proline-rich proteins (PRPs) in human saliva. On the basis of this feature and their shared destination in the gastrointestinal tract, we hypothesized that salivary PRPs may modulate gluten-mediated immune responses in CD. Parotid salivary secretions were collected from CD patients, refractory CD patients, non-CD patients with functional gastrointestinal complaints, and healthy controls. Structural similarities of PRPs with gluten were probed with anti-gliadin antibodies. Immune responses to PRPs were investigated toward CD patient-derived peripheral blood mononuclear cells and in a humanized transgenic HLA-DQ2/DQ8 mouse model for CD. Anti-gliadin antibodies weakly cross-reacted with the abundant salivary amylase but not with PRPs. Likewise, the R5 antibody, recognizing potential antigenic gluten epitopes, showed negligible reactivity to salivary proteins from all groups. Inflammatory responses in peripheral blood mononuclear cells were provoked by gliadins whereas responses to PRPs were similar to control levels, and PRPs did not compete with gliadins in immune stimulation. In vivo, PRP peptides were well tolerated and nonimmunogenic in the transgenic HLA-DQ2/DQ8 mouse model. Collectively, although structurally similar to dietary gluten, salivary PRPs were nonimmunogenic in CD patients and in a transgenic HLA-DQ2/DQ8 mouse model for CD. It is possible that salivary PRPs play a role in tolerance induction to gluten early in life. Deciphering the structural basis for the lack of immunogenicity of salivary PRPs may further our understanding of the toxicity of gluten. Copyright © 2015 the American Physiological Society.

Interaction of flavan-3-ol derivatives and different caseins is determined by more than proline content and number of proline repeats.

PubMed

Bohin, Maxime C; Vincken, Jean-Paul; Westphal, Adrie H; Tripp, Annelise M; Dekker, Peter; van der Hijden, Harry T W M; Gruppen, Harry

2014-09-01

Interactions of Type A and B flavan-3-ol dimers (procyanidins) and several monomeric flavan-3-ols, with α-casein and β-casein, were investigated. Binding affinities measured were related to the ligands structure, including several properties (e.g. intrinsic flexibility (number of rotatable bonds) and hydrophobicity), and to the amino-acid composition of the caseins. A monomeric flavan-3-ol esterified with gallic acid (EGCG) had a five to ten times higher affinity to caseins compared to the non-galloylated dimeric flavan-3-ols. In this case, the larger number of rotatable bonds in EGCG might be accountable for this difference. Comparing flavan-3-ol dimers, intrinsic flexibility did not consistently promote interactions, as procyanidin A1 displayed a higher affinity to α-casein than the supposedly more flexible B-type dimers investigated. Despite its higher content of proline, compared to α-casein, β-casein did not always have a higher affinity for the ligands investigated (e.g. no interaction with procyanidin A1 detected). These results suggest that more factors than proline content and the number of proline repeats govern phenolic-casein interactions. Copyright © 2014 Elsevier Ltd. All rights reserved.

Responses of Reactive Oxygen Scavenging Enzymes, Proline and Malondialdehyde to Water Deficits among Six Secondary Successional Seral Species in Loess Plateau

PubMed Central

Du, Feng; Shi, Huijun; Zhang, Xingchang; Xu, Xuexuan

2014-01-01

Drought can impact local vegetation dynamics in a long term. In order to predict the possible successional pathway of local community under drought, the responses of some drought resistance indices of six successional seral species in the semi-arid Loss Hilly Region of China were illustrated and compared on three levels of soil water deficits along three growing months (7, 8 and 9). The results showed that: 1) the six species had significant differences in SOD, POD activities and MDA content. The rank correlations between SOD, POD activities and the successional niche positions of the six species were positive, and the correlation between MDA content and the niche positions was negative; 2) activities of SOD, CAT and POD, and content of proline and MDA had significant differences among the three months; 3) there existed significant interactions of SOD, CAT, POD activities and MDA content between months and species. With an exception, no interaction of proline was found. Proline in leaves had a general decline in reproductive month; 4) SOD, CAT, POD activities and proline content had negative correlations with MDA content. Among which, the correlation between SOD activity and MDA content was significant. The results implied that, in arid or semiarid region, the species at later successional stage tend to have strong drought resistance than those at early stage. Anti-drought indices can partially interpret the pathway of community succession in the drought impacted area. SOD activity is more distinct and important on the scope of protecting membrane damage through the scavenging of ROS on exposure to drought. PMID:24914928

Pyrrhocoricin, a proline-rich antimicrobial peptide derived from insect, inhibits the translation process in the cell-free Escherichia coli protein synthesis system.

PubMed

Taniguchi, Masayuki; Ochiai, Akihito; Kondo, Hiroshi; Fukuda, Shun; Ishiyama, Yohei; Saitoh, Eiichi; Kato, Tetsuo; Tanaka, Takaaki

2016-05-01

Previous studies have shown that pyrrhocoricin, a proline-rich antimicrobial peptide (PrAMP), killed sensitive species in a dose-dependent manner by specifically binding to DnaK. Here, on the basis of the finding that DnaK-deficient Escherichia coli strains are susceptible to PrAMPs, we used pyrrhocoricin to investigate internal targets other than DnaK. Using conventional antibiotics (bleomycin, streptomycin, and fosfomycin) that have known modes of action, first, we validated the availability of an assay using a cell-free rapid translation system (RTS), which is an in vitro protein synthesis system based on E. coli lysate, for evaluating inhibition of protein synthesis. We found that, similarly to bleomycin and streptomycin, pyrrhocoricin inhibited GFP synthesis in RTS in a concentration-dependent manner. In addition, blockage of transcription and translation steps in RTS was individually estimated using RT-PCR after gene expression to determine mRNA products and using sodium dodecyl sulfate-polyacrylamide gel electrophoresis to determine the amounts of GFP expressed from purified mRNA, respectively. The results demonstrated that this inhibition of GFP synthesis by pyrrhocoricin did not occur at the transcription step but rather at the translation step, in a manner similar to that of GFP synthesis by streptomycin, an inhibitor of the translation step by causing misreading of tRNA. These results suggest that RTS is a powerful assay system for determining if antimicrobial peptides inhibit protein synthesis and its transcription and/or translation steps. This is the first study to have shown that pyrrhocoricin inhibited protein synthesis by specifically repressing the translation step. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Assessment of the influence of different sample processing and cold storage duration on plant free proline content analyses.

PubMed

Teklić, Tihana; Spoljarević, Marija; Stanisavljević, Aleksandar; Lisjak, Miroslav; Vinković, Tomislav; Parađiković, Nada; Andrić, Luka; Hancock, John T

2010-01-01

A method which is widely accepted for the analysis of free proline content in plant tissues is based on the use of 3% sulfosalicylic acid as an extractant, followed by spectrophotometric quantification of a proline-ninhydrin complex in toluene. However, sample preparation and storage may influence the proline actually measured. This may give misleading or difficult to compare data. To evaluate free proline levels fresh and frozen strawberry (Fragaria × ananassa Duch.) leaves and soybean [Glycine max (L.) Merr.] hypocotyl tissues were used. These were ground with or without liquid nitrogen and proline extracted with sulfosalicylic acid. A particular focus was the influence of plant sample cold storage duration (1, 4 and 12 weeks at -20°C) on tissue proline levels measured. The free proline content analyses, carried out in leaves of Fragaria × ananassa Duch. as well as in hypocotyls of Glycine max (L.) Merr., showed a significant influence of the sample preparation method and cold storage period. Long-term storage of up to 12 weeks at -20°C led to a significant increase in the measured proline in all samples analysed. The observed changes in proline content in plant tissue samples stored at -20°C indicate the likelihood of the over-estimation of the proline content if the proline analyses are delayed. Plant sample processing and cold storage duration seem to have an important influence on results of proline analyses. Therefore it is recommended that samples should be ground fresh and analysed immediately. Copyright © 2010 John Wiley & Sons, Ltd.

Poly-proline-based chiral stationary phases: a molecular dynamics study of triproline, tetraproline, pentaproline and hexaproline interfaces.

PubMed

Ashtari, M; Cann, N M

2012-11-23

Poly-proline chains and derivatives have been recently examined as the basis for new chiral stationary phases in high performance liquid chromatography. The selectivity of poly-proline has been measured for peptides with up to ten proline units. In this article, we employ molecular dynamics simulations to examine the interfacial structure and solvation of surface-bound poly-proline chiral selectors. Specifically, we study the interfacial structure of trimethylacetyl-terminated poly-proline chains with three-to-six prolines. The surface includes silanol groups and end-caps, to better capture the characteristics of the stationary phase, and the solvent is either a polar water/methanol or a relatively apolar n-hexane/2-propanol mixture. We begin with a comprehensive ab initio study of the conformers, their energies, and an assessment of conformer flexibility. Force fields have been developed for each poly-proline selector. Molecular dynamics simulations are employed to study the preferred backbone conformations and solvent hydrogen bonding for different poly-proline/solvent interfaces. For triproline, the effect of two different terminal groups, trimethylacetyl and t-butyl carbamate are compared. Copyright © 2012 Elsevier B.V. All rights reserved.

Proline accumulation protects Saccharomyces cerevisiae cells in stationary phase from ethanol stress by reducing reactive oxygen species levels.

PubMed

Takagi, Hiroshi; Taguchi, Junpei; Kaino, Tomohiro

2016-08-01

During fermentation processes, Saccharomyces cerevisiae cells are exposed to multiple stresses, including a high concentration of ethanol that represents toxicity through intracellular reactive oxygen species (ROS) generation. We previously reported that proline protected yeast cells from damage caused by various stresses, such as freezing and ethanol. As an anti-oxidant, proline is suggested to scavenge intracellular ROS. In this study, we examined the role of intracellular proline during ethanol treatment in S. cerevisiae strains that accumulate different concentrations of proline. When cultured in YPD medium, there was a significant accumulation of proline in the put1 mutant strain, which is deficient in proline oxidase, in the stationary phase. Expression of the mutant PRO1 gene, which encodes the γ-glutamyl kinase variant (Asp154Asn or Ile150Thr) with desensitization to feedback inhibition by proline in the put1 mutant strain, showed a prominent increase in proline content as compared with that of the wild-type strain. The oxidation level was clearly increased in wild-type cells after exposure to ethanol, indicating that the generation of ROS occurred. Interestingly, proline accumulation significantly reduces the ROS level and increases the survival rate of yeast cells in the stationary phase under ethanol stress conditions. However, there was not a clear correlation between proline content and survival rate in yeast cells. An appropriate level of intracellular proline in yeast might be important for its stress-protective effect. Hence, the engineering of proline metabolism could be promising for breeding stress-tolerant industrial yeast strains. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Proline analogue of nitrosourea as a new cytotoxic prodrug.

PubMed

Stankiewicz-Kranc, Anna; Bielawska, Anna; Bielawski, Krzysztof; Skrzydlewska, Elzbieta

2009-11-01

Carmustine is frequently used as anticancer drug. High toxicity and low selectivity reduces the application of this drug. Though, there is a necessity to find new compounds characterized by similar therapeutic effects but a higher selectivity and safety. As a result, the proline analogue of nitrosourea, N-[N'-(2-bromophenyl)-N'-nitrosocarbamoyl]proline (AC), has been synthesized. The aim of this study was to compare the influence of carmustine and the proline analogue of nitrosourea on the antioxidant abilities of fibroblasts and leukemia cells, MOLT4. It was shown that carmustine as well as AC cause an increase in hydrogen peroxide concentration in normal and neoplastic cells. Incubation with both compounds led to a diminution of the activity of antioxidant enzymes such as superoxide dismutase, glutathione peroxidase, and reductase. Changes in activity / level of antioxidant parameters were accompanied by augmentation of lipid and oxidative protein modifications. In conclusion, carmustine and AC cause changes in the antioxidative system of normal and MOLT4 cells and are a reason of oxidative stress formation.

Proline Oxidase (POX) as A Target for Cancer Therapy.

PubMed

Kononczuk, Joanna; Czyzewska, Urszula; Moczydlowska, Joanna; Surażyński, Arkadiusz; Palka, Jerzy; Miltyk, Wojciech

2015-01-01

Proline dehydrogenase/proline oxidase (PRODH/POX) is an enzyme catalyzing the first step of proline degradation, during which ROS and/or ATP is generated. POX is widely distributed in living organisms and is responsible for a number of regulatory processes such as redox homeostasis, osmotic adaptation, cell signaling and oxidative stress. Recent data provided evidence that POX plays an important role in carcinogenesis and tumor growth. POX may induce apoptosis in both intrinsic and extrinsic way. Due to ROS generation, POX may induce caspase-9 activity, which mediates mitochondrial apoptosis (intrinsic apoptosis pathway). POX can also stimulate TRAIL (tumor necrosis factorrelated apoptosis inducing ligand) and DR5 (death receptor 5) expression, resulting in cleavage of procaspase-8 and thus extrinsic apoptotic pathway. However, this tumor suppressor in certain environmental conditions may act as a prosurvival factor. Genotoxic, inflammatory and metabolic stress may switch POX from tumor growth inhibiting to tumor growth supporting factor. The potential mechanisms which may regulate switching of POX mode are discussed in this review.

Proline Residues as Switches in Conformational Changes Leading to Amyloid Fibril Formation

PubMed Central

Taler-Verčič, Ajda; Hasanbašić, Samra; Berbić, Selma; Stoka, Veronika; Turk, Dušan; Žerovnik, Eva

2017-01-01

Here we discuss studies of the structure, folding, oligomerization and amyloid fibril formation of several proline mutants of human stefin B, which is a protein inhibitor of lysosomal cysteine cathepsins and a member of the cystatin family. The structurally important prolines in stefin B are responsible for the slow folding phases and facilitate domain swapping (Pro 74) and loop swapping (Pro 79). Moreover, our findings are compared to β2-microglobulin, a protein involved in dialysis-related amyloidosis. The assessment of the contribution of proline residues to the process of amyloid fibril formation may shed new light on the critical molecular events involved in conformational disorders. PMID:28272335

Occurrence, Functions and Biological Significance of Arginine-Rich Proteins.

PubMed

Chandana, Thimmegowda; Venkatesh, Yeldur P

2016-01-01

Arginine, the most basic among the 20 amino acids, occurs less frequently than lysine in proteins despite being coded by six codons. Only a few important proteins of biological significance have been found to be abundant in arginine. It has been established that these arginine-rich proteins have been assigned important roles in the biological systems. Arginine-rich cationic proteins are known to stabilize macromolecular structures by establishing appropriate interactions (salt bridges, hydrogen bonds and cation-π interactions). These proteins are also known to be the key members of many regulatory pathways such as gene expression, chromatin stability, expurgation of introns from naïve mRNA, mRNA splicing, membrane-penetrating activity and pathogenesis-related defense, to name a few. Further, arginine occurs in various combinations with other amino acids (serine, lysine, proline, tryptophan, valine, glycine and glutamic acid) which diversify the potential functions of arginine-rich proteins. Arginine-rich proteins known till date from dietary sources have been described in terms of their structure and functional properties. A variety of activities such as bactericidal, membrane-penetrating, antimicrobial, anti-hypertensive, pro-angiogenic and others have been reported for arginine-rich proteins. This review attempts to collate the occurrence, functions and the biological significance of this unique class of proteins rich in arginine.

Proline zwitterion dynamics in solution, glass, and crystalline state.

PubMed

Kapitán, Josef; Baumruk, Vladimír; Kopecký, Vladimír; Pohl, Radek; Bour, Petr

2006-10-18

Raman and Raman optical activity spectra of L- and D-proline zwitterionic (PROZW) forms were recorded for H(2)O and D(2)O solutions in a wide frequency range and analyzed with respect to the motion of the proline ring and rotation of the carbonyl group. The solution spectra were additionally compared to Raman scattering of glass and crystalline powder proline. Solution and glass spectral band broadenings are similar and reveal information about the extent of internal molecular motion. Two distinct but equally populated flexible forms were found in the glass and the solution. The equal population is consistent with NMR data, temperature, and concentration dependencies. The molecular flexibility is reduced significantly in the crystal, however, where only one conformer is present. Consequently, the crystal bands are narrow and exhibit minor frequency shifts. The spectra were interpreted with the aid of density functional theory computations involving both continuum and explicit solvent. A two-dimensional potential energy surface pertaining to the five-member ring puckering coordinates was constructed and used for dynamical averaging of spectral properties. Comparison of the computed and experimental bandwidths suggests that the puckering is strongly correlated with the carbonyl rotation. An averaging over these two motions produces similar results. The interpretation of the Raman experiments with the aid of the simulation techniques also indicates that the environment modulates properties of the hydrophobic part of the molecule indirectly by interacting with the ionic group. Such behavior may be important for the reactivity and biological activity of proline-containing peptides and proteins.

Alanine and proline content modulate global sensitivity to discrete perturbations in disordered proteins

PubMed Central

Perez, Romel B.; Tischer, Alexander; Auton, Matthew; Whitten, Steven T.

2014-01-01

Molecular transduction of biological signals is understood primarily in terms of the cooperative structural transitions of protein macromolecules, providing a mechanism through which discrete local structure perturbations affect global macromolecular properties. The recognition that proteins lacking tertiary stability, commonly referred to as intrinsically disordered proteins, mediate key signaling pathways suggests that protein structures without cooperative intramolecular interactions may also have the ability to couple local and global structure changes. Presented here are results from experiments that measured and tested the ability of disordered proteins to couple local changes in structure to global changes in structure. Using the intrinsically disordered N-terminal region of the p53 protein as an experimental model, a set of proline and alanine to glycine substitution variants were designed to modulate backbone conformational propensities without introducing non-native intramolecular interactions. The hydrodynamic radius (Rh) was used to monitor changes in global structure. Circular dichroism spectroscopy showed that the glycine substitutions decreased polyproline II (PPII) propensities relative to the wild type, as expected, and fluorescence methods indicated that substitution-induced changes in Rh were not associated with folding. The experiments showed that changes in local PPII structure cause changes in Rh that are variable and that depend on the intrinsic chain propensities of proline and alanine residues, demonstrating a mechanism for coupling local and global structure changes. Molecular simulations that model our results were used to extend the analysis to other proteins and illustrate the generality of the observed proline and alanine effects on the structures of intrinsically disordered proteins. PMID:25244701

An evaluation of the role of a pyroglutamyl peptidase, a post-proline cleaving enzyme and a post-proline dipeptidyl amino peptidase, each purified from the soluble fraction of guinea-pig brain, in the degradation of thyroliberin in vitro.

PubMed

Browne, P; O'Cuinn, G

1983-12-01

The degradation of thyroliberin (less than Glu-His-Pro-NH2) to its component amino acids by the soluble fraction of guinea pig brain is catalysed by four enzymes namely a pyroglutamate aminopeptidase, a post-proline cleaving enzyme, a post-proline dipeptidyl aminopeptidase and a proline dipeptidase. 1. The pyroglutamate aminopeptidase was purified to over 90% homogeneity with a purification factor of 2868-fold and a yield of 5.7%. In addition to catalysing the hydrolysis of thyroliberin, acid thyroliberin and pyroglutamate-7-amido-4-methylcoumarin the pyroglutamate aminopeptidase catalysed the hydrolysis of the peptide bond adjacent to the pyroglutamic acid residue in luliberin, neurotensin bombesin, bradykinin-potentiating peptide B, the anorexogenic peptide and the dipeptides pyroglutamyl alanine and pyroglutamyl valine. Pyroglutamyl proline and eledoisin were not hydrolysed. 2. The post-proline cleaving enzyme was purified to apparent electrophoretic homogeneity with a purification factor of 2298-fold and a yield of 10.6%. The post-proline cleaving enzyme catalysed the hydrolysis of thyroliberin and N-benzyloxycarbonyl-glycylproline-7-amido-4-methylcoumarin. It did not catalyse the hydrolysis of glycylproline-7-amido-4-methylcoumarin or His-Pro-NH2. 3. The post-proline dipeptidyl aminopeptidase was partially purified with a purification factor of 301-fold and a yield of 8.9%. The post-proline dipeptidyl aminopeptidase catalysed the hydrolysis of His-Pro-NH2 and glycylproline-7-amido-4-methylcoumarin but did not exhibit any post-proline cleaving endopeptidase activity against thyroliberin or N-benzyloxycarbonyl-glycylproline-7-amido-4-methylcoumarin. 4. Studies with various functional reagents indicated that the pyroglutamate aminopeptidase could be specifically inhibited by 2-iodoacetamide (100% inhibition at an inhibitor concentration of 5 microM), the post-proline cleaving enzyme by bacitracin (IC50 = 42 microM) and the post-proline dipeptidyl aminopeptidase

Influence of proline upon the folding and geometry of the WALP19 transmembrane peptide.

PubMed

Thomas, Rachel; Vostrikov, Vitaly V; Greathouse, Denise V; Koeppe, Roger E

2009-12-22

The orientations, geometries, and lipid interactions of designed transmembrane (TM) peptides have attracted significant experimental and theoretical interest. Because the amino acid proline will introduce a known discontinuity into an alpha helix, we have sought to measure the extent of helix kinking caused by a single proline within the isolated TM helical domain of WALP19. For this purpose, we synthesized acetyl-GWWLALALAP(10)ALALALWWA-ethanolamide and included pairs of deuterated alanines by using 60-100% Fmoc-l-Ala-d(4) at selected sequence positions. Solid-state deuterium ((2)H) magnetic resonance spectra from oriented, hydrated samples (1/40, peptide/lipid; using several lipids) reveal signals from many of the alanine backbone C(alpha) deuterons as well as the alanine side-chain C(beta) methyl groups, whereas signals from C(alpha) deuterons generally have not been observed for similar peptides without proline. It is conceivable that altered peptide dynamics may be responsible for the apparent "unmasking" of the backbone resonances in the presence of the proline. Data analysis using the geometric analysis of labeled alanines (GALA) method reveals that the peptide helix is distorted due to the presence of the proline. To provide additional data points for evaluating the segmental tilt angles of the two halves of the peptide, we substituted selected leucines with l-Ala-d(4). Using this approach, we were able to deduce that the apparent average tilt of the C-terminal increases from approximately 4 degrees to approximately 12 degrees when Pro(10) is introduced. The segment N-terminal to proline is more complex and possibly is more dynamically flexible; Leu to Ala mutations within the N-terminal segment alter the average orientations of alanines in both segments. Nevertheless, in DOPC, we could estimate an apparent kink angle of approximately 19 degrees . Together, the results suggest that the central proline influences not only the geometry but also the dynamics

Dual palladium- and proline-catalyzed allylic alkylation of enolizable ketones and aldehydes with allylic alcohols.

PubMed

Usui, Ippei; Schmidt, Stefan; Breit, Bernhard

2009-03-19

The dual Pd/proline-catalyzed alpha-allylation reaction of a variety of enolizable ketones and aldehydes with allylic alcohols is described. In this reaction, the choice of a large-bite angle ligand Xantphos and proline as the organocatalyst was essential for generation of the crucial pi-allyl Pd intermediate from allylic alcohol, followed by nucleophilic attack of the enamine formed in situ from the corresponding enolizable carbonyl substrate and proline.

L-Proline uptake in Saccharomyces cerevisiae mitochondria can contribute to bioenergetics during nutrient stress as alternative mitochondrial fuel.

PubMed

Pallotta, Maria Luigia

2014-01-01

L-Proline (pyrrolidine-2-carboxylic acid) is a distinctive metabolite both biochemically and biotechnologically and is currently recognized to have a cardinal role in gene expression and cellular signaling pathways in stress response. Proline-fueled mitochondrial metabolism involves the oxidative conversion of L-Proline to L-Glutamate in two enzymatic steps by means of Put1p and Put2p that help Saccharomyces cerevisiae to respond to changes in the nutritional environment by initiating the breakdown of L-Proline as a source for nitrogen, carbon, and energy. Compartmentalization of L-Proline catabolic pathway implies that extensive L-Proline transport must take place between the cytosol where its biogenesis via Pro1p, Pro2p, Pro3p occurs and mitochondria. L-Proline uptake in S. cerevisiae purified and active mitochondria was investigated by swelling experiments, oxygen uptake and fluorimetric measurement of a membrane potential generation (ΔΨ). Our results strongly suggest that L-Proline uptake occurs via a carried-mediated process as demonstrated by saturation kinetics and experiments with N-ethylmaleimide, a pharmacological compound that is a cysteine-modifying reagent in hydrophobic protein domains and that inhibited mitochondrial transport. Plasticity of S. cerevisiae cell biochemistry according to background fluctuations is an important factor of adaptation to stress. Thus L-Proline → Glutamate route feeds Krebs cycle providing energy and anaplerotic carbon for yeast survival.

Proline accumulation in baker's yeast enhances high-sucrose stress tolerance and fermentation ability in sweet dough.

PubMed

Sasano, Yu; Haitani, Yutaka; Ohtsu, Iwao; Shima, Jun; Takagi, Hiroshi

2012-01-03

During bread-making processes, yeast cells are exposed to various baking-associated stresses. High-sucrose concentrations exert severe osmotic stress that seriously damages cellular components by generation of reactive oxygen species (ROS). Previously, we found that the accumulation of proline conferred freeze-thaw stress tolerance and the baker's yeast strain that accumulated proline retained higher-level fermentation abilities in frozen doughs than the wild-type strain. In this study, we constructed self-cloning diploid baker's yeast strains that accumulate proline. These resultant strains showed higher cell viability and lower intracellular oxidation levels than that observed in the wild-type strain under high-sucrose stress condition. Proline accumulation also enhanced the fermentation ability in high-sucrose-containing dough. These results demonstrate the usefulness of proline-accumulating baker's yeast for sweet dough baking. Copyright © 2011 Elsevier B.V. All rights reserved.

Organic-rich source beds and hydrocarbon production in Gulf Coast region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, D.F.; Lerche, I.

1988-09-01

Two models (I and II) are presented that relate the production of hydrocarbons in the Gulf Coast region to organic-rich source beds of ancient intraslope basins. Model I is empirical, based on present-day depositional environments like the anoxic Orca basin of the northern Gulf of Mexico and the Bannock basin of the eastern Mediterranean Sea. Model I proposed that low oxygen levels in intraslope basins of the northwestern Gulf of Mexico (GOM) have been a common mechanism for the accumulation of sediments with significantly increased amounts of marine organic carbon. In Model I progradation of the shelf-slope and regional saltmore » tectonics control the occurrence and stratigraphic distribution of source beds throughout the Tertiary of the GOM. In turn, the maturation history of these organic-rich sediments is influenced by the high thermal conductivity of the underlying salt structures. Model II is statistical; it uses random number theory to suggest that the occurrence of organic-rich black muds in intraslope basins of the northwestern GOM had sufficient capacity to account for a dynamic range estimate of 30 to 500 billion bbl oil total and 30 to 300 bcf/million years per ephemeral basin of gas. These estimates, while approximate, clearly indicate the enormous hydrocarbon potential for generating oil and gas reserves in the Gulf Coast geosyncline. Such estimates underscore the need for a better understanding of intraslope basins of the northwestern GOM.« less

Proline 68 enhances photoisomerization yield in photoactive yellow protein.

PubMed

Rupenyan, Alisa B; Vreede, Jocelyne; van Stokkum, Ivo H M; Hospes, Marijke; Kennis, John T M; Hellingwerf, Klaas J; Groot, Marie Louise

2011-05-26

In proteins and enzymes, the local environment of an active cofactor plays an important role in controlling the outcome of a functional reaction. In photoactive yellow protein (PYP), it ensures photoisomerization of the chromophore, a prerequisite for formation of a signaling state. PYP is the prototype of a PAS domain, and the preferred model system for the studies of molecular mechanisms of biological light sensing. We investigated the effect of replacing proline-68, positioned near but not in direct contact with the chromophore, with other neutral amino acids (alanine, glycine, and valine), using ultrafast spectroscopy probing the visible and the mid-IR spectral regions, and molecular simulation to understand the interactions tuning the efficiency of light signaling. Transient absorption measurements indicate that the quantum yield of isomerization in the mutants is lower than the yield observed for the wild type. Subpicosecond mid-IR spectra and molecular dynamics simulations of the four proteins reveal that the hydrogen bond interactions around the chromophore and the access of water molecules in the active site of the protein determine the efficiency of photoisomerization. The mutants provide additional hydrogen bonds to the chromophore, directly and by allowing more water molecules access to its binding pocket. We conclude that proline-68 in the wild type protein optimizes the yield of photochemistry by maintaining a weak hydrogen bond with the chromophore, at the same time restraining the entrance of water molecules close to the alkylic part of pCa. This study provides a molecular basis for the structural optimization of biological light sensing.

Synthetic bovine proline-rich-polypeptides generate hydroxyl radicals and fail to protect dopaminergic neurons against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced dopaminergic neurotoxicity in mice.

PubMed

Knaryan, Varduhi H; Samantaray, Supriti; Varghese, Merina; Srinivasan, Ambika; Galoyan, Armen A; Mohanakumar, Kochupurackal P

2006-08-01

Proline-rich-polypeptides (PRPs) isolated from bovine hypothalamus have been shown to render protection against neuronal injury of the brain and spinal cord. We examined two PRPs containing 15 and 10 amino acid residues (PRP-1 and PRP-4 synthetic polypeptide) for their effect, if any, on dopaminergic neuronal damage caused by the parkinsonian neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Effects of these PRPs on hydroxyl radical ((*)OH) generation in a Fenton-like reaction as well as from isolated mitochondria were monitored, employing a sensitive salicylate hydroxylation procedure. Balb/c mice treated (i.p., twice, 16 h apart) with MPTP (30 mg/kg) or PRP-1 (1.6 mg/kg), but not PRP-4 (1.6 mg/kg) showed significant loss of striatal dopamine and norepinephrine as assayed by an HPLC-electrochemical procedure. Pretreatment with the PRPs, 30 min prior to the neurotoxin administration failed to attenuate MPTP-induced striatal dopamine or norepinephrine depletion, but significantly attenuated the MPTP-induced decrease in dopamine turnover. A significant increase in the generation of (*)OH by the PRPs in a Fenton-like reaction or from isolated mitochondria suggests their pro-oxidant action, and explains their failure to protect against MPTP-induced parkinsonism in mice.

Ehrlichia chaffeensis Proliferation Begins with NtrY/NtrX and PutA/GlnA Upregulation and CtrA Degradation Induced by Proline and Glutamine Uptake

PubMed Central

Cheng, Zhihui; Lin, Mingqun

2014-01-01

ABSTRACT How the obligatory intracellular bacterium Ehrlichia chaffeensis begins to replicate upon entry into human monocytes is poorly understood. Here, we examined the potential role of amino acids in initiating intracellular replication. PutA converts proline to glutamate, and GlnA converts glutamate to glutamine. E. chaffeensis PutA and GlnA complemented Escherichia coli putA and glnA mutants. Methionine sulfoximine, a glutamine synthetase inhibitor, inhibited E. chaffeensis GlnA activity and E. chaffeensis infection of human cells. Incubation of E. chaffeensis with human cells rapidly induced putA and glnA expression that peaked at 24 h postincubation. E. chaffeensis took up proline and glutamine but not glutamate. Pretreatment of E. chaffeensis with a proline transporter inhibitor (protamine), a glutamine transporter inhibitor (histidine), or proline analogs inhibited E. chaffeensis infection, whereas pretreatment with proline or glutamine enhanced infection and upregulated putA and glnA faster than no treatment or glutamate pretreatment. The temporal response of putA and glnA expression was similar to that of NtrY and NtrX, a two-component system, and electrophoretic mobility shift assays showed specific binding of recombinant E. chaffeensis NtrX (rNtrX) to the promoter regions of E. chaffeensis putA and glnA. Furthermore, rNtrX transactivated E. chaffeensis putA and glnA promoter-lacZ fusions in E. coli. Growth-promoting activities of proline and glutamine were also accompanied by rapid degradation of the DNA-binding protein CtrA. Our results suggest that proline and glutamine uptake regulates putA and glnA expression through NtrY/NtrX and facilitates degradation of CtrA to initiate a new cycle of E. chaffeensis growth. PMID:25425236

Large structural modification with conserved conformation: analysis of delta(3)-fused aryl prolines in model beta-turns.

PubMed

Jeannotte, Guillaume; Lubell, William D

2004-11-10

For the first time, the influence of a fused Delta3-arylproline on peptide conformation has been studied by the synthesis and comparison of the conformations of peptides containing proline and pyrrolo-proline, 3 (PyPro). Pyrrolo-proline was demonstrated to be a conservative replacement for Pro in model beta-turns, 4 and 5, as shown by their similar DMSO titration curves, cis/trans-isomer populations, and NOESY spectral data. Pyrrolo-proline may thus be used for studying the structure activity relationships of Pro-containing peptides with minimal modification of secondary structures.

Does proline isomerization shape the folding funnel of the wild type and mutant staphylococcal nuclease?

NASA Astrophysics Data System (ADS)

Tsong, Tian Yow; Su, Zheng-Ding

1999-10-01

Cis/trans isomerization of proline residues is known to exhibit high activation energies. These kinetic barriers often dominate the energy landscape of protein folding. There are 6 proline residues (at positions 11, 31, 42, 47, 56 and 117) in staphylococcal nuclease (SNase) [EC 3.1.31.1]. Stopped-flow CD222nm measuring the evolution of the secondary structure of protein has detected 5 kinetic barriers in SNase folding (ΔG≠ for τfr<15, τf1 16.9, τf2 18.5, τf3 19.5, and τfs 21.8 kcal/mol) and 3 kinetic barriers in unfolding (ΔG≠ for τur<15, τu1 17.4, τus 21.6 kcal/mol). To investigate systematically how individual proline residues and 6 proline residues in toto can shape the folding funnel we have expediently constructed 7 proline mutants for study. They are 6 single-proline-substituted mutants (P11A, P31A, P42A, P47A, P56A and P117A) and 1 proline-free mutant (PallA). Study of equilibrium folding/unfolding and stopped-flow kinetics of the wildtype and the 7 mutants of SNase have allowed us to identify sources of 3 main kinetic barriers in the SNase folding. The highest barrier (ΔG≠=21.8 kcal) belongs to the cis/trans isomerization of Pro117. The next barrier (ΔG≠=19.5 kcal) involves synergetic effects of proline residues which limits the rate of folding of the oligonucleotide binding (OB) domain in all 7 proline-containing SNase. For the proline-free mutant (PallA) the OB domain folds rapidly. Furthermore, we have found that the equilibrium folding/unfolding properties of these proline mutants are remarkably similar to that of the wildtype despite their startlingly different folding/unfolding kinetics. These results lead us to conclude that while free energy of folding (ΔGF=-4.5 kcal/mol) provides the driving force, it is the activation energy that forms a conduit or shapes a kinetic funnel for SNase folding. The landscape for SNase folding is extremely rugged. Data support our previously proposed Least Activation Path (LAP) model for protein

Elucidating proline dynamics in spider dragline silk fibre using 2H-13C HETCOR MAS NMR.

PubMed

Shi, Xiangyan; Yarger, Jeffery L; Holland, Gregory P

2014-05-14

(2)H-(13)C HETCOR MAS NMR is performed on (2)H/(13)C/(15)N-Pro enriched A. aurantia dragline silk. Proline dynamics are extracted from (2)H NMR line shapes and T1 in a site-specific manner to elucidate the backbone and side chain molecular dynamics for the MaSp2 GPGXX β-turn regions for spider dragline silk in the dry and wet, supercontracted states.

Low-energy electron collisions with proline and pyrrolidine: A comparative study

NASA Astrophysics Data System (ADS)

Barbosa, Alessandra Souza; Freitas, Thiago Corrêa; Bettega, M. H. F.

2018-02-01

We present a comparative study on the calculated cross sections obtained for the elastic collisions of low-energy electrons with the amino acid proline (C5H9NO2) and its building block pyrrolidine (C4H9N). We employed the Schwinger multichannel method implemented with pseudopotentials to compute integral, differential, and momentum transfer cross sections in the static-exchange plus polarization approximation, for energies up to 15 eV. We report three shape resonances for proline at around 1.7 eV, 6.8 eV, and 10 eV and two shape resonances for pyrrolidine centered at 7 eV and 10.2 eV. The present resonance energies are compared with available experimental data on vertical attachment energies and dissociative electron attachment, where a good agreement is found. From the comparison of the present results with available calculated cross sections for the simplest carboxylic acid, formic acid (HCOOH), and from electronic structure calculations, we found that the first resonance of proline, at 1.7 eV, is due the presence of the carboxylic group, whereas the other two structures, at 6.8 eV and 10 eV, clearly arise from the pyrrolidine ring. A comparison between the differential cross sections for proline and pyrrolidine at some selected energies of the incident electron is also reported in this paper.

Evidence for a role of proline and hypothalamic astrocytes in the regulation of glucose metabolism in rats.

PubMed

Arrieta-Cruz, Isabel; Su, Ya; Knight, Colette M; Lam, Tony K T; Gutiérrez-Juárez, Roger

2013-04-01

The metabolism of lactate to pyruvate in the mediobasal hypothalamus (MBH) regulates hepatic glucose production. Because astrocytes and neurons are functionally linked by metabolic coupling through lactate transfer via the astrocyte-neuron lactate shuttle (ANLS), we reasoned that astrocytes might be involved in the hypothalamic regulation of glucose metabolism. To examine this possibility, we used the gluconeogenic amino acid proline, which is metabolized to pyruvate in astrocytes. Our results showed that increasing the availability of proline in rats either centrally (MBH) or systemically acutely lowered blood glucose. Pancreatic clamp studies revealed that this hypoglycemic effect was due to a decrease of hepatic glucose production secondary to an inhibition of glycogenolysis, gluconeogenesis, and glucose-6-phosphatase flux. The effect of proline was mimicked by glutamate, an intermediary of proline metabolism. Interestingly, proline's action was markedly blunted by pharmacological inhibition of hypothalamic lactate dehydrogenase (LDH) suggesting that metabolic flux through LDH was required. Furthermore, short hairpin RNA-mediated knockdown of hypothalamic LDH-A, an astrocytic component of the ANLS, also blunted the glucoregulatory action of proline. Thus our studies suggest not only a new role for proline in the regulation of hepatic glucose production but also indicate that hypothalamic astrocytes are involved in the regulatory mechanism as well.

Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation.

PubMed

Tian, Jian; Wang, Ping; Gao, Shan; Chu, Xiaoyu; Wu, Ningfeng; Fan, Yunliu

2010-12-01

Protein thermostability can be increased by some glycine to proline mutations in a target protein. However, not all glycine to proline mutations can improve protein thermostability, and this method is suitable only at carefully selected mutation sites that can accommodate structural stabilization. In this study, homology modeling and molecular dynamics simulations were used to select appropriate glycine to proline mutations to improve protein thermostability, and the effect of the selected mutations was proved by the experiments. The structure of methyl parathion hydrolase (MPH) from Ochrobactrum sp. M231 (Ochr-MPH) was constructed by homology modeling, and molecular dynamics simulations were performed on the modeled structure. A profile of the root mean square fluctuations of Ochr-MPH was calculated at the nanosecond timescale, and an eight-amino acid loop region (residues 186-193) was identified as having high conformational fluctuation. The two glycines nearest to this region were selected as mutation targets that might affect protein flexibility in the vicinity. The structures and conformational fluctuations of two single mutants (G194P and G198P) and one double mutant (G194P/G198P) were modeled and analyzed using molecular dynamics simulations. The results predicted that the mutant G194P had the decreased conformational fluctuation in the loop region and might increase the thermostability of Ochr-MPH. The thermostability and kinetic behavior of the wild-type and three mutant enzymes were measured. The results were consistent with the computational predictions, and the mutant G194P was found to have higher thermostability than the wild-type enzyme. © 2010 The Authors Journal compilation © 2010 FEBS.

Role of cis-trans proline isomerization in the function of pathogenic enterobacterial Periplasmic Binding Proteins

PubMed Central

Cortes-Hernandez, Paulina

2017-01-01

Periplasmic Binding Proteins (PBPs) trap nutrients for their internalization into bacteria by ABC transporters. Ligand binding triggers PBP closure by bringing its two domains together like a Venus flytrap. The atomic determinants that control PBP opening and closure for nutrient capture and release are not known, although it is proposed that opening and ligand release occur while in contact with the ABC transporter for concurrent substrate translocation. In this paper we evaluated the effect of the isomerization of a conserved proline, located near the binding site, on the propensity of PBPs to open and close. ArgT/LAO from Salmonella typhimurium and HisJ from Escherichia coli were studied through molecular mechanics at two different temperatures: 300 and 323 K. Eight microseconds were simulated per protein to analyze protein opening and closure in the absence of the ABC transporter. We show that when the studied proline is in trans, closed empty LAO and HisJ can open. In contrast, with the proline in cis, opening transitions were much less frequent and characterized by smaller changes. The proline in trans also renders the open trap prone to close over a ligand. Our data suggest that the isomerization of this conserved proline modulates the PBP mechanism: the proline in trans allows the exploration of conformational space to produce trap opening and closure, while in cis it restricts PBP movement and could limit ligand release until in productive contact with the ABC transporter. This is the first time that a proline isomerization has been related to the control of a large conformational change like the PBP flytrap mechanism. PMID:29190818

Vitamin B6 Generated by Obligate Symbionts Is Critical for Maintaining Proline Homeostasis and Fecundity in Tsetse Flies

PubMed Central

Michalkova, Veronika; Weiss, Brian L.; Attardo, Geoffrey M.; Aksoy, Serap

2014-01-01

The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. PMID:25038091

A Solution NMR Investigation into the Murine Amelogenin Splice-Variant LRAP (Leucine-Rich Amelogenin Protein).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchko, Garry W.; Tarasevich, Barbara J.; Roberts, Jacky

2010-09-01

Amelogenins are the dominant proteins present in ameloblasts during the early stages of enamel biomineralization, making up >90% of the matrix protein. Along with the full-length protein there are several splice-variant isoforms of amelogenin present including LRAP (Leucine-Rich Amelogenin Protein), a protein that consists of the first 33 and the last 26 residues of full-length amelogenin. Using solution-state NMR spectroscopy we have assigned the 1H-15N HSQC spectrum of murine LRAP (rp(H)LRAP) in 2% acetic acid at pH 3.0 by making extensive use of previous chemical shift assignments for full-length murine amelogenin (rp(H)M180). This correlation was possible because LRAP, like themore » full-length protein, is intrinsically disordered under these solution conditions. The major difference between the 1H-15N HSQC spectra of rp(H)M180 and rp(H)LRAP was an additional set of amide resonances for each of the seven non-proline residues between S12* and Y12 at the N-terminus of rp(H)LRAP indicating that the N-terminal region of LRAP exists in two different conformations. Analysis of the proline carbon chemical shifts suggest that the molecular basis for the two states is not a cis-trans isomerization of one or more of the proline residues in the N-terminal region and is likely due to a slow exchange process. As observed with rp(H)M180, residue specific changes in molecular dynamics, manifested by the reduction in intensity and disappearance of 1H-15N HSQC cross peaks, were observed with the addition of NaCl to rp(H)LRAP. These perturbations may signal early events governing supramolecular self-assembly of rp(H)LRAP into nanospheres. However, the different pattern of 1H-15N HSQC cross peak perturbation between rp(H)LRAP and rp(H)M180 in high salt suggest that the termini may behave differently in their respective nanospheres, and perhaps, these differences account for the cell signaling properties attributable to LRAP but not the full-length protein.« less

A new charge-tagged proline-based organocatalyst for mechanistic studies using electrospray mass spectrometry

PubMed Central

Willms, J Alexander; Beel, Rita; Schmidt, Martin L; Mundt, Christian

2014-01-01

Summary A new 4-hydroxy-L-proline derivative with a charged 1-ethylpyridinium-4-phenoxy substituent has been synthesized with the aim of facilitating mechanistic studies of proline-catalyzed reactions by ESI mass spectrometry. The charged residue ensures a strongly enhanced ESI response compared to neutral unmodified proline. The connection by a rigid linker fixes the position of the charge tag far away from the catalytic center in order to avoid unwanted interactions. The use of a charged catalyst leads to significantly enhanced ESI signal abundances for every catalyst-derived species which are the ones of highest interest present in a reacting solution. The new charged proline catalyst has been tested in the direct asymmetric inverse aldol reaction between aldehydes and diethyl ketomalonate. Two intermediates in accordance with the List–Houk mechanism for enamine catalysis have been detected and characterized by gas-phase fragmentation. In addition, their temporal evolution has been followed using a microreactor continuous-flow technique. PMID:25246962

Process optimization for enhancing production of cis-4-hydroxy-L-proline by engineered Escherichia coli.

PubMed

Chen, Kequan; Pang, Yang; Zhang, Bowen; Feng, Jiao; Xu, Sheng; Wang, Xin; Ouyang, Pingkai

2017-11-22

Understanding the bioprocess limitations is critical for the efficient design of biocatalysts to facilitate process feasibility and improve process economics. In this study, a proline hydroxylation process with recombinant Escherichia coli expressing L-proline cis-4-hydroxylase (SmP4H) was investigated. The factors that influencing the metabolism of microbial hosts and process economics were focused on for the optimization of cis-4-hydroxy-L-proline (CHOP) production. In recombinant E. coli, SmP4H synthesis limitation was observed. After the optimization of expression system, CHOP production was improved in accordance with the enhanced SmP4H synthesis. Furthermore, the effects of the regulation of proline uptake and metabolism on whole-cell catalytic activity were investigated. The improved CHOP production by repressing putA gene responsible for L-proline degradation or overexpressing L-proline transporter putP on CHOP production suggested the important role of substrate uptake and metabolism on the whole-cell biocatalyst efficiency. Through genetically modifying these factors, the biocatalyst activity was significantly improved, and CHOP production was increased by twofold. Meanwhile, to further improve process economics, a two-strain coupling whole-cell system was established to supply co-substrate (α-ketoglutarate, α-KG) with a cheaper chemical L-glutamate as a starting material, and 13.5 g/L of CHOP was successfully produced. In this study, SmP4H expression, and L-proline uptake and degradation, were uncovered as the hurdles for microbial production of CHOP. Accordingly, the whole-cell biocatalysts were metabolically engineered for enhancing CHOP production. Meanwhile, a two-strain biotransformation system for CHOP biosynthesis was developed aiming at supplying α-KG more economically. Our work provided valuable insights into the design of recombinant microorganism to improve the biotransformation efficiency that catalyzed by Fe

Vitamin B6 generated by obligate symbionts is critical for maintaining proline homeostasis and fecundity in tsetse flies.

PubMed

Michalkova, Veronika; Benoit, Joshua B; Weiss, Brian L; Attardo, Geoffrey M; Aksoy, Serap

2014-09-01

The viviparous tsetse fly utilizes proline as a hemolymph-borne energy source. In tsetse, biosynthesis of proline from alanine involves the enzyme alanine-glyoxylate aminotransferase (AGAT), which requires pyridoxal phosphate (vitamin B6) as a cofactor. This vitamin can be synthesized by tsetse's obligate symbiont, Wigglesworthia glossinidia. In this study, we examined the role of Wigglesworthia-produced vitamin B6 for maintenance of proline homeostasis, specifically during the energetically expensive lactation period of the tsetse's reproductive cycle. We found that expression of agat, as well as genes involved in vitamin B6 metabolism in both host and symbiont, increases in lactating flies. Removal of symbionts via antibiotic treatment of flies (aposymbiotic) led to hypoprolinemia, reduced levels of vitamin B6 in lactating females, and decreased fecundity. Proline homeostasis and fecundity recovered partially when aposymbiotic tsetse were fed a diet supplemented with either yeast or Wigglesworthia extracts. RNA interference-mediated knockdown of agat in wild-type flies reduced hemolymph proline levels to that of aposymbiotic females. Aposymbiotic flies treated with agat short interfering RNA (siRNA) remained hypoprolinemic even upon dietary supplementation with microbial extracts or B vitamins. Flies infected with parasitic African trypanosomes display lower hemolymph proline levels, suggesting that the reduced fecundity observed in parasitized flies could result from parasite interference with proline homeostasis. This interference could be manifested by competition between tsetse and trypanosomes for vitamins, proline, or other factors involved in their synthesis. Collectively, these results indicate that the presence of Wigglesworthia in tsetse is critical for the maintenance of proline homeostasis through vitamin B6 production. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Theoretical and NMR conformational studies of β-proline oligopeptides with alternating chirality of pyrrolidine units

NASA Astrophysics Data System (ADS)

Mantsyzov, Alexey B.; Savelyev, Oleg Y.; Ivantcova, Polina M.; Bräse, Stefan; Kudryavtsev, Konstantin V.; Polshakov, Vladimir I.

2018-03-01

Synthetic β-peptides are potential functional mimetics of native α-proteins. A recently developed, novel, synthetic approach provides an effective route to the broad group of β-proline oligomers with alternating patterns of stereogenic centers. Conformation of the pyrrolidine ring, Z/E isomerism of β-peptide bonds, and hindered rotation of the neighboring monomers determine the spatial structure of this group of β-proline oligopeptides. Preferences in structural organization and corresponding thermodynamic properties are determined by NMR spectroscopy, restrained molecular dynamics and quantum mechanics. The studied β-proline oligopeptides exist in dimethyl sulfoxide solution in a limited number of conformers, with compatible energy of formation and different spatial organization. In the β-proline tetrapeptide with alternating chirality of composing pyrrolidine units, one of three peptide bonds may exist in an E configuration. For the alternating β-proline pentapeptide, the presence of an E configuration for at least of one β-peptide bond is mandatory. In this case, three peptide bonds synchronously change their configurations. Larger polypeptides may only exist in the presence of several E configurations of β-peptide bonds forming a wave-like extended structure.

Theoretical and NMR Conformational Studies of β-Proline Oligopeptides With Alternating Chirality of Pyrrolidine Units.

PubMed

Mantsyzov, Alexey B; Savelyev, Oleg Y; Ivantcova, Polina M; Bräse, Stefan; Kudryavtsev, Konstantin V; Polshakov, Vladimir I

2018-01-01

Synthetic β-peptides are potential functional mimetics of native α-proteins. A recently developed, novel, synthetic approach provides an effective route to the broad group of β-proline oligomers with alternating patterns of stereogenic centers. Conformation of the pyrrolidine ring, Z / E isomerism of β-peptide bonds, and hindered rotation of the neighboring monomers determine the spatial structure of this group of β-proline oligopeptides. Preferences in their structural organization and corresponding thermodynamic properties are determined by NMR spectroscopy, restrained molecular dynamics and quantum mechanics. The studied β-proline oligopeptides exist in dimethyl sulfoxide solution in a limited number of conformers, with compatible energy of formation and different spatial organization. In the β-proline tetrapeptide with alternating chirality of composing pyrrolidine units, one of three peptide bonds may exist in an E configuration. For the alternating β-proline pentapeptide, the presence of an E configuration for at least of one β-peptide bond is mandatory. In this case, three peptide bonds synchronously change their configurations. Larger polypeptides may only exist in the presence of several E configurations of β-peptide bonds forming a wave-like extended structure.

The role of proline-containing peptide triads in β-sheet formation: A kinetic study.

PubMed

Takor, Gaius A; Higashiya, Seiichiro; Sikirzhytski, Vitali K; Seeley, Jason P; Lednev, Igor K; Welch, John T

2015-06-01

The design of biomimetic materials through molecular self-assembly is a growing area of modern nanotechnology. With problems of protein folding, self-assembly, and sequence-structure relationships as essential in nanotechnology as in biology, the effect of the nucleation of β-hairpin formation by proline on the folding process has been investigated in model studies. Previously such studies were limited to investigations of the influence of proline on the formation of turns in short peptide sequences. The effect of proline-based triads on the folding of an 11-kDa amyloidogenic peptide GH6[(GA)3GY(GA)3GE]8 GAH6 (YE8) was investigated by selective substitution of the proline-substituted triads at the γ-turn sites. The folding and fibrillation of the singly proline-substituted polypeptides, e.g., GH6-[(GA)3GY(GA)3GE]7(GA)3GY(GA)3PD-GAH6 (8PD), and doubly proline-substituted polypeptides, e.g., GH6-[(GA)3GY(GA)3GE]3(GA)3GY(GA)3PD[(GA)3GY(GA)3GE]3(GA)3GY(GA)3PD-GAH6 (4,8PD), were directly monitored by circular dichroism and deep UV resonance Raman and fluorescence spectroscopies. These findings were used to identify the essential folding domains, i.e., the minimum number of β-strands necessary for stable folding. These experimental findings may be especially useful in the design and construction of peptidic materials for a wide range of applications as well as in understanding the mechanisms of folding critical to fibril formation. © 2015 Wiley Periodicals, Inc.

Isolation of baker's yeast mutants with proline accumulation that showed enhanced tolerance to baking-associated stresses.

PubMed

Tsolmonbaatar, Ariunzaya; Hashida, Keisuke; Sugimoto, Yukiko; Watanabe, Daisuke; Furukawa, Shuhei; Takagi, Hiroshi

2016-12-05

During bread-making processes, yeast cells are exposed to baking-associated stresses such as freeze-thaw, air-drying, and high-sucrose concentrations. Previously, we reported that self-cloning diploid baker's yeast strains that accumulate proline retained higher-level fermentation abilities in both frozen and sweet doughs than the wild-type strain. Although self-cloning yeasts do not have to be treated as genetically modified yeasts, the conventional methods for breeding baker's yeasts are more acceptable to consumers than the use of self-cloning yeasts. In this study, we isolated mutants resistant to the proline analogue azetidine-2-carboxylate (AZC) derived from diploid baker's yeast of Saccharomyces cerevisiae. Some of the mutants accumulated a greater amount of intracellular proline, and among them, 5 mutants showed higher cell viability than that observed in the parent wild-type strain under freezing or high-sucrose stress conditions. Two of them carried novel mutations in the PRO1 gene encoding the Pro247Ser or Glu415Lys variant of γ-glutamyl kinase (GK), which is a key enzyme in proline biosynthesis in S. cerevisiae. Interestingly, we found that these mutations resulted in AZC resistance of yeast cells and desensitization to proline feedback inhibition of GK, leading to intracellular proline accumulation. Moreover, baker's yeast cells expressing the PRO1 P247S and PRO1 E415K gene were more tolerant to freezing stress than cells expressing the wild-type PRO1 gene. The approach described here could be a practical method for the breeding of proline-accumulating baker's yeasts with higher tolerance to baking-associated stresses. Copyright © 2016 Elsevier B.V. All rights reserved.

Landscape correlates of breeding bird richness across the United States mid-Atlantic region

USGS Publications Warehouse

Jones, K.B.; Neale, A.C.; Nash, M.S.; Riitters, K.H.; Wickham, J.D.; O'Neill, R. V.; Van Remortel, R. D.

2000-01-01

Using a new set of landscape indicator data generated by the U.S.EPA, and a comprehensive breeding bird database from the National Breeding Bird Survey, we evaluated associations between breeding bird richness and landscape characteristics across the entire mid-Atlantic region of the United States. We evaluated how these relationships varied among different groupings (guilds) of birds based on functional, structural, and compositional aspects of individual species demographics. Forest edge was by far the most important landscape attribute affecting the richness of the lumped specialist and generalist guilds; specialist species richness was negatively associated with forest edge and generalist richness was positively associated with forest edge. Landscape variables (indicators) explained a greater proportion of specialist species richness than the generalist guild (46% and 31%, respectively). The lower value in generalists may reflect freer-scale distributions of open habitat that go undetected by the Landsat satellite, open habitats created by roads (the areas from which breeding bird data are obtained), and the lumping of a wide variety of species into the generalist category. A further breakdown of species into 16 guilds showed considerable variation in the response of breeding birds to landscape conditions; forest obligate species had the strongest association with landscape indicators measured in this study (55% of the total variation explained) and forest generalists and open ground nesters the lowest (17% of the total variation explained). The variable response of guild species richness to landscape pattern suggests that one must consider species' demographics when assessing the consequences of landscape change on breeding birds.Using a new set of landscape indicator data generated by the U.S. EPA, and a comprehensive breeding bird database from the National Breeding Bird Survey, we evaluated associations between breeding bird richness and landscape

Landscape Correlates of Breeding Bird Richness Across the United States Mid-Atlantic Region

Treesearch

K. Bruce Jones; Anne C. Neale; Maliha S. Nash; Kurt H. Riitters; James D. Wickham; Robert V. O' Neill; Rick D. van Remortel

2000-01-01

Using a new set of landscape indicator data generated by the U.S. EPA, and a comprhensive breeding database from the National Breeding Bird Survey, we evaluated associations between breeding bird richness and landscape characteristics across the entire mid-Atlantic region of the United States.

Evidence for a Role of Proline and Hypothalamic Astrocytes in the Regulation of Glucose Metabolism in Rats

PubMed Central

Arrieta-Cruz, Isabel; Su, Ya; Knight, Colette M.; Lam, Tony K.T.; Gutiérrez-Juárez, Roger

2013-01-01

The metabolism of lactate to pyruvate in the mediobasal hypothalamus (MBH) regulates hepatic glucose production. Because astrocytes and neurons are functionally linked by metabolic coupling through lactate transfer via the astrocyte-neuron lactate shuttle (ANLS), we reasoned that astrocytes might be involved in the hypothalamic regulation of glucose metabolism. To examine this possibility, we used the gluconeogenic amino acid proline, which is metabolized to pyruvate in astrocytes. Our results showed that increasing the availability of proline in rats either centrally (MBH) or systemically acutely lowered blood glucose. Pancreatic clamp studies revealed that this hypoglycemic effect was due to a decrease of hepatic glucose production secondary to an inhibition of glycogenolysis, gluconeogenesis, and glucose-6-phosphatase flux. The effect of proline was mimicked by glutamate, an intermediary of proline metabolism. Interestingly, proline’s action was markedly blunted by pharmacological inhibition of hypothalamic lactate dehydrogenase (LDH) suggesting that metabolic flux through LDH was required. Furthermore, short hairpin RNA–mediated knockdown of hypothalamic LDH-A, an astrocytic component of the ANLS, also blunted the glucoregulatory action of proline. Thus our studies suggest not only a new role for proline in the regulation of hepatic glucose production but also indicate that hypothalamic astrocytes are involved in the regulatory mechanism as well. PMID:23274895

Proline Scan of the hERG Channel S6 Helix Reveals the Location of the Intracellular Pore Gate

PubMed Central

Thouta, Samrat; Sokolov, Stanislav; Abe, Yuki; Clark, Sheldon J.; Cheng, Yen M.; Claydon, Tom W.

2014-01-01

In Shaker-like channels, the activation gate is formed at the bundle crossing by the convergence of the inner S6 helices near a conserved proline-valine-proline motif, which introduces a kink that allows for electromechanical coupling with voltage sensor motions via the S4-S5 linker. Human ether-a-go-go-related gene (hERG) channels lack the proline-valine-proline motif and the location of the intracellular pore gate and how it is coupled to S4 movement is less clear. Here, we show that proline substitutions within the S6 of hERG perturbed pore gate closure, trapping channels in the open state. Performing a proline scan of the inner S6 helix, from Ile655 to Tyr667 revealed that gate perturbation occurred with proximal (I655P-Q664P), but not distal (R665P-Y667P) substitutions, suggesting that Gln664 marks the position of the intracellular gate in hERG channels. Using voltage-clamp fluorimetry and gating current analysis, we demonstrate that proline substitutions trap the activation gate open by disrupting the coupling between the voltage-sensing unit and the pore of the channel. We characterize voltage sensor movement in one such trapped-open mutant channel and demonstrate the kinetics of what we interpret to be intrinsic hERG voltage sensor movement. PMID:24606930

Toll like receptors TLR1/2, TLR6 and MUC5B as binding interaction partners with cytostatic proline rich polypeptide 1 in human chondrosarcoma.

PubMed

Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen

2018-01-01

Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function.

Toll like receptors TLR1/2, TLR6 and MUC5B as binding interaction partners with cytostatic proline rich polypeptide 1 in human chondrosarcoma

PubMed Central

Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen

2018-01-01

Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function. PMID:29138803

Male-specific expression of Sox9 during gonad development of crocodile and mouse is mediated by alternative splicing of its proline-glutamine-alanine rich domain.

PubMed

Agrawal, Raman; Wessely, Oliver; Anand, Amit; Singh, Lalji; Aggarwal, Ramesh K

2009-08-01

The initial trigger for sexual differentiation is regulated by multiple ways during embryonic development. In vertebrates, chromosome-based mechanisms generally known as genetic sex determination are prevalent; however, some species, such as many reptilians, display temperature-dependent sex determination. The Sry-related transcription factor, Sox9, which is expressed by an evolutionary conserved gene, has been shown to be a key player in the process of sex determination. In the present study, we report the identification and expression of crocodile homolog of Sox9 (cpSox9) from the Indian Mugger, Crocodylus palustris. We show that cpSox9 undergoes extensive alternative splicing around the proline-glutamine-alanine rich transactivation domain that results in cpSox9 variants with presumably impaired or reduced transactivation potential. The multiple isoforms were also detected in various embryonic tissues, with some of them displaying a differential expression profile. With respect to sex differentiation, a putative unspliced full-length cpSox9 could be detected only in the genital ridge-adrenal-mesonephros complex of male, but not female embryos during the temperature-sensitive period. Importantly, we further show that this phenomenon was not restricted to the temperature-dependent sex determination species C. palustris, but was also observed in the mouse, a species exhibiting genetic sex determination. Thus, the present study describes, for the first time, a complete coding locus of Sox9 homolog from a temperature-dependent sex determination species. More importantly, we demonstrate an evolutionarily conserved role of alternative splicing resulting in transcriptional diversity and male-sex specific expression of Sox9 during testis development in vertebrates (i.e. irrespective of their underlying sex-determination mechanisms).

Identification of two proline transport systems in Staphylococcus aureus and their possible roles in osmoregulation.

PubMed

Bae, J H; Miller, K J

1992-02-01

The food-borne pathogen Staphylococcus aureus is distinguished from other food-borne pathogens by its ability to grow at water activity values below 0.90. Previous studies have indicated that proline accumulation mediated by transport represents a primary osmoregulatory strategy utilized by this bacterium (C. B. Anderson and L. D. Witter, Appl. Environ, Microbiol. 43:1501-1503, 1982; I. Koujima, H. Hayashi, K. Tomochika, A. Okabe, and Y. Kanemasa, Appl. Environ. Microbiol. 35:467-470, 1978; K. J. Miller, S. C. Zelt, and J.-H. Bae, Curr. Microbiol. 23:131-137, 1991). In this study, we demonstrate the presence of two proline transport systems within whole cells of S. aureus, a high-affinity transport system (Km, 7 microM) and a low-affinity transport system (Km, 420 microM). Our results indicate that the low-affinity proline transport system is osmotically activated and is the primary system responsible for the accumulation of proline by this pathogen during growth at low water activity.

Effect of proline kinks on the mechanical unfolding of α-helices

NASA Astrophysics Data System (ADS)

Arteca, Gustavo A.; Li, Zhiying

2004-12-01

Proteins unfold by applying an external force, although the microscopic mechanism is still not well understood. In this work, we use steered molecular dynamics to probe fundamental aspects of the stretching transition of α-helices, in particular how proline kinks and side chain dynamics would influence their ability to resist the applied force. We find that proline residues effectively 'cut' a helix in half when introduced on stable homopolymers, whereas their effect is smaller when present in helices that are more easily deformed. Our findings provide insight into the factors that may regulate the mechanical stretching of realistic protein domains.

Cyclophilin A catalyzes proline isomerization by an electrostatic handle mechanism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Camilloni, Carlo; Sahakyan, Aleksander B.; Holliday, Michael

2014-07-15

Proline isomerization is a ubiquitous process that plays a key role in the folding of proteins and in the regulation of their functions1-3. Different families of enzymes, known as peptidyl-prolyl isomerases (PPIases), catalyse this reaction, which involves the interconversion between the cis and trans isomers of the Nterminal amide bond of the amino acid proline2,3. A complete description of the mechanisms by which these enzymes function, however, has remained elusive. Here, we show that cyclophilin A, one of the most common PPIases4, provides a catalytic environment that acts on the substrate through an electrostatic lever mechanism. In this mechanism, themore » electrostatic field in the catalytic site turns the electric dipole associated with the carboxylic group of the amino acid preceding the proline in the substrate, thus causing the rotation of the peptide bond between the two residues. This mechanism resulted from the analysis of an ensemble of conformations populated by cyclophilin A during the enzymatic reaction using a combination of NMR measurements, molecular dynamics simulations and density functional theory calculations. We anticipate that this approach will be helpful in elucidating whether the electrostatic lever mechanism that we describe is common to other PPIases, and more generally to characterise other enzymatic processes.« less

Cyclophilin A catalyzes proline isomerization by an electrostatic handle mechanism

PubMed Central

Camilloni, Carlo; Sahakyan, Aleksandr B.; Holliday, Michael J.; Isern, Nancy G.; Zhang, Fengli; Eisenmesser, Elan Z.; Vendruscolo, Michele

2014-01-01

Proline isomerization is a ubiquitous process that plays a key role in the folding of proteins and in the regulation of their functions. Different families of enzymes, known as “peptidyl-prolyl isomerases” (PPIases), catalyze this reaction, which involves the interconversion between the cis and trans isomers of the N-terminal amide bond of the amino acid proline. However, complete descriptions of the mechanisms by which these enzymes function have remained elusive. We show here that cyclophilin A, one of the most common PPIases, provides a catalytic environment that acts on the substrate through an electrostatic handle mechanism. In this mechanism, the electrostatic field in the catalytic site turns the electric dipole associated with the carbonyl group of the amino acid preceding the proline in the substrate, thus causing the rotation of the peptide bond between the two residues. We identified this mechanism using a combination of NMR measurements, molecular dynamics simulations, and density functional theory calculations to simultaneously determine the cis-bound and trans-bound conformations of cyclophilin A and its substrate as the enzymatic reaction takes place. We anticipate that this approach will be helpful in elucidating whether the electrostatic handle mechanism that we describe here is common to other PPIases and, more generally, in characterizing other enzymatic processes. PMID:24982184

Cyclophilin A catalyzes proline isomerization by an electrostatic handle mechanism.

PubMed

Camilloni, Carlo; Sahakyan, Aleksandr B; Holliday, Michael J; Isern, Nancy G; Zhang, Fengli; Eisenmesser, Elan Z; Vendruscolo, Michele

2014-07-15

Proline isomerization is a ubiquitous process that plays a key role in the folding of proteins and in the regulation of their functions. Different families of enzymes, known as "peptidyl-prolyl isomerases" (PPIases), catalyze this reaction, which involves the interconversion between the cis and trans isomers of the N-terminal amide bond of the amino acid proline. However, complete descriptions of the mechanisms by which these enzymes function have remained elusive. We show here that cyclophilin A, one of the most common PPIases, provides a catalytic environment that acts on the substrate through an electrostatic handle mechanism. In this mechanism, the electrostatic field in the catalytic site turns the electric dipole associated with the carbonyl group of the amino acid preceding the proline in the substrate, thus causing the rotation of the peptide bond between the two residues. We identified this mechanism using a combination of NMR measurements, molecular dynamics simulations, and density functional theory calculations to simultaneously determine the cis-bound and trans-bound conformations of cyclophilin A and its substrate as the enzymatic reaction takes place. We anticipate that this approach will be helpful in elucidating whether the electrostatic handle mechanism that we describe here is common to other PPIases and, more generally, in characterizing other enzymatic processes.

Uptake of Amino Acids and Their Metabolic Conversion into the Compatible Solute Proline Confers Osmoprotection to Bacillus subtilis

PubMed Central

Zaprasis, Adrienne; Bleisteiner, Monika; Kerres, Anne; Hoffmann, Tamara

2014-01-01

The data presented here reveal a new facet of the physiological adjustment processes through which Bacillus subtilis can derive osmostress protection. We found that the import of proteogenic (Glu, Gln, Asp, Asn, and Arg) and of nonproteogenic (Orn and Cit) amino acids and their metabolic conversion into proline enhances growth under otherwise osmotically unfavorable conditions. Osmoprotection by amino acids depends on the functioning of the ProJ-ProA-ProH enzymes, but different entry points into this biosynthetic route are used by different amino acids to finally yield the compatible solute proline. Glu, Gln, Asp, and Asn are used to replenish the cellular pool of glutamate, the precursor for proline production, whereas Arg, Orn, and Cit are converted into γ-glutamic semialdehyde/Δ1-pyrroline-5-carboxylate, an intermediate in proline biosynthesis. The import of Glu, Gln, Asp, Asn, Arg, Orn, and Cit did not lead to a further increase in the size of the proline pool that is already present in osmotically stressed cells. Hence, our data suggest that osmoprotection of B. subtilis by this group of amino acids rests on the savings in biosynthetic building blocks and energy that would otherwise have to be devoted either to the synthesis of the proline precursor glutamate or of proline itself. Since glutamate is the direct biosynthetic precursor for proline, we studied its uptake and found that GltT, an Na+-coupled symporter, is the main uptake system for both glutamate and aspartate in B. subtilis. Collectively, our data show how effectively B. subtilis can exploit environmental resources to derive osmotic-stress protection through physiological means. PMID:25344233

Proline biosynthesis genes and their regulation under salinity stress in the euryhaline copepod Tigriopus californicus.

PubMed

Willett, Christopher S; Burton, Ronald S

2002-08-01

Diverse organisms regulate concentrations of intracellular organic osmolytes in response to changes in environmental salinity or desiccation. In marine crustaceans, accumulation of high concentrations of proline is a dominant component of response to hyperosmotic stress. In the euryhaline copepod Tigriopus californicus, synthesis of proline from its metabolic precursor glutamate is tightly regulated by changes in environmental salinity. Here, for the first time in a marine invertebrate, the genes responsible for this pathway have been cloned and characterized. The two proteins display the sequence features of homologous enzymes identified from other eukaryotes. One of the cloned genes, delta1-pyrroline-5-carboxylase reductase (P5CR), is demonstrated to have the reductase enzyme activity when expressed in proline-auxotroph bacteria, while the second, delta1-pyrroline-5-carboxylase synthase (P5CS), does not rescue proline-auxotroph bacteria. In contrast to results from higher plants, neither levels of P5CS nor P5CR mRNAs increase in response to salinity stress in T. californicus. Hence, regulation of proline synthesis during osmotic stress in T. californicus is likely mediated by some form of post-transcriptional regulation of either P5CS or P5CR. Understanding the regulation this pathway may elucidate the mechanisms limiting the salinity ranges of marine taxa. Copyright 2002 Elsevier Science Inc.

Proline/pipecolinic acid-promoted copper-catalyzed P-arylation.

PubMed

Huang, Cheng; Tang, Xu; Fu, Hua; Jiang, Yuyang; Zhao, Yufen

2006-06-23

We have developed a convenient and efficient approach for P-arylation of organophosphorus compounds containing P-H. Using commercially available and inexpensive proline and pipecolinic acid as the ligands greatly improved the efficiency of the coupling reactions, so the method can provide an entry to arylphosphonates, arylphosphinates and arylphosphine oxides.

Selective vulnerability of Rich Club brain regions is an organizational principle of structural connectivity loss in Huntington's disease.

PubMed

McColgan, Peter; Seunarine, Kiran K; Razi, Adeel; Cole, James H; Gregory, Sarah; Durr, Alexandra; Roos, Raymund A C; Stout, Julie C; Landwehrmeyer, Bernhard; Scahill, Rachael I; Clark, Chris A; Rees, Geraint; Tabrizi, Sarah J

2015-11-01

Huntington's disease can be predicted many years before symptom onset, and thus makes an ideal model for studying the earliest mechanisms of neurodegeneration. Diffuse patterns of structural connectivity loss occur in the basal ganglia and cortex early in the disease. However, the organizational principles that underlie these changes are unclear. By understanding such principles we can gain insight into the link between the cellular pathology caused by mutant huntingtin and its downstream effect at the macroscopic level. The 'rich club' is a pattern of organization established in healthy human brains, where specific hub 'rich club' brain regions are more highly connected to each other than other brain regions. We hypothesized that selective loss of rich club connectivity might represent an organizing principle underlying the distributed pattern of structural connectivity loss seen in Huntington's disease. To test this hypothesis we performed diffusion tractography and graph theoretical analysis in a pseudo-longitudinal study of 50 premanifest and 38 manifest Huntington's disease participants compared with 47 healthy controls. Consistent with our hypothesis we found that structural connectivity loss selectively affected rich club brain regions in premanifest and manifest Huntington's disease participants compared with controls. We found progressive network changes across controls, premanifest Huntington's disease and manifest Huntington's disease characterized by increased network segregation in the premanifest stage and loss of network integration in manifest disease. These regional and whole brain network differences were highly correlated with cognitive and motor deficits suggesting they have pathophysiological relevance. We also observed greater reductions in the connectivity of brain regions that have higher network traffic and lower clustering of neighbouring regions. This provides a potential mechanism that results in a characteristic pattern of structural

Increased plasma proline concentrations are associated with sarcopenia in the elderly

PubMed Central

Adachi, Yusuke; Imaizumi, Akira; Hakamada, Tomomi; Abe, Yasuko; Kaneko, Eiji; Takahashi, Soiciro; Shimokado, Kentaro

2017-01-01

Background and purpose Metabolome analyses have shown that plasma amino acid profiles reflect various pathological conditions, such as cancer and diabetes mellitus. It remains unclear, however, whether plasma amino acid profiles change in patients with sarcopenia. This study therefore aimed to investigate whether sarcopenia-specific changes occur in plasma amino acid profiles. Methods A total of 153 community-dwelling and seven institutionalized elderly individuals (56 men, 104 women; mean age, 77.7±7.0 years) were recruited for this cross-sectional analysis. We performed a comprehensive geriatric assessment, which included an evaluation of hand grip strength, gait speed, muscle mass and blood chemistry, including the concentration of 18 amino acids. Results Twenty-eight of the 160 participants met the criteria for sarcopenia established by the Asian Working Group on Sarcopenia in Older People. Univariate analysis revealed associations between the presence of sarcopenia and a higher plasma concentration of proline and glutamine, lower concentrations of histidine and tryptophan. Multivariable analysis revealed that a higher concentration of proline was the only variable independently associated with sarcopenia. Conclusions The plasma concentration of proline may be useful for understanding the underlying pathophysiology of sarcopenia. PMID:28934309

Increased plasma proline concentrations are associated with sarcopenia in the elderly.

PubMed

Toyoshima, Kenji; Nakamura, Marie; Adachi, Yusuke; Imaizumi, Akira; Hakamada, Tomomi; Abe, Yasuko; Kaneko, Eiji; Takahashi, Soiciro; Shimokado, Kentaro

2017-01-01

Metabolome analyses have shown that plasma amino acid profiles reflect various pathological conditions, such as cancer and diabetes mellitus. It remains unclear, however, whether plasma amino acid profiles change in patients with sarcopenia. This study therefore aimed to investigate whether sarcopenia-specific changes occur in plasma amino acid profiles. A total of 153 community-dwelling and seven institutionalized elderly individuals (56 men, 104 women; mean age, 77.7±7.0 years) were recruited for this cross-sectional analysis. We performed a comprehensive geriatric assessment, which included an evaluation of hand grip strength, gait speed, muscle mass and blood chemistry, including the concentration of 18 amino acids. Twenty-eight of the 160 participants met the criteria for sarcopenia established by the Asian Working Group on Sarcopenia in Older People. Univariate analysis revealed associations between the presence of sarcopenia and a higher plasma concentration of proline and glutamine, lower concentrations of histidine and tryptophan. Multivariable analysis revealed that a higher concentration of proline was the only variable independently associated with sarcopenia. The plasma concentration of proline may be useful for understanding the underlying pathophysiology of sarcopenia.

Selective vulnerability of Rich Club brain regions is an organizational principle of structural connectivity loss in Huntington’s disease

PubMed Central

Seunarine, Kiran K.; Razi, Adeel; Cole, James H.; Gregory, Sarah; Durr, Alexandra; Roos, Raymund A. C.; Stout, Julie C.; Landwehrmeyer, Bernhard; Scahill, Rachael I.; Clark, Chris A.; Rees, Geraint

2015-01-01

Huntington’s disease can be predicted many years before symptom onset, and thus makes an ideal model for studying the earliest mechanisms of neurodegeneration. Diffuse patterns of structural connectivity loss occur in the basal ganglia and cortex early in the disease. However, the organizational principles that underlie these changes are unclear. By understanding such principles we can gain insight into the link between the cellular pathology caused by mutant huntingtin and its downstream effect at the macroscopic level. The ‘rich club’ is a pattern of organization established in healthy human brains, where specific hub ‘rich club’ brain regions are more highly connected to each other than other brain regions. We hypothesized that selective loss of rich club connectivity might represent an organizing principle underlying the distributed pattern of structural connectivity loss seen in Huntington’s disease. To test this hypothesis we performed diffusion tractography and graph theoretical analysis in a pseudo-longitudinal study of 50 premanifest and 38 manifest Huntington’s disease participants compared with 47 healthy controls. Consistent with our hypothesis we found that structural connectivity loss selectively affected rich club brain regions in premanifest and manifest Huntington’s disease participants compared with controls. We found progressive network changes across controls, premanifest Huntington’s disease and manifest Huntington’s disease characterized by increased network segregation in the premanifest stage and loss of network integration in manifest disease. These regional and whole brain network differences were highly correlated with cognitive and motor deficits suggesting they have pathophysiological relevance. We also observed greater reductions in the connectivity of brain regions that have higher network traffic and lower clustering of neighbouring regions. This provides a potential mechanism that results in a characteristic

Proline-poor hydrophobic domains modulate the assembly and material properties of polymeric elastin.

PubMed

Muiznieks, Lisa D; Reichheld, Sean E; Sitarz, Eva E; Miao, Ming; Keeley, Fred W

2015-10-01

Elastin is a self-assembling extracellular matrix protein that provides elasticity to tissues. For entropic elastomers such as elastin, conformational disorder of the monomer building block, even in the polymeric form, is essential for elastomeric recoil. The highly hydrophobic monomer employs a range of strategies for maintaining disorder and flexibility within hydrophobic domains, particularly involving a minimum compositional threshold of proline and glycine residues. However, the native sequence of hydrophobic elastin domain 30 is uncharacteristically proline-poor and, as an isolated polypeptide, is susceptible to formation of amyloid-like structures comprised of stacked β-sheet. Here we investigated the biophysical and mechanical properties of multiple sets of elastin-like polypeptides designed with different numbers of proline-poor domain 30 from human or rat tropoelastins. We compared the contributions of these proline-poor hydrophobic sequences to self-assembly through characterization of phase separation, and to the tensile properties of cross-linked, polymeric materials. We demonstrate that length of hydrophobic domains and propensity to form β-structure, both affecting polypeptide chain flexibility and cross-link density, play key roles in modulating elastin mechanical properties. This study advances the understanding of elastin sequence-structure-function relationships, and provides new insights that will directly support rational approaches to the design of biomaterials with defined suites of mechanical properties. © 2015 Wiley Periodicals, Inc.

Global Metabolic Profiling Identifies a Pivotal Role of Proline and Hydroxyproline Metabolism in Supporting Hypoxic Response in Hepatocellular Carcinoma.

PubMed

Tang, Ling; Zeng, Jun; Geng, Pengyu; Fang, Chengnan; Wang, Yang; Sun, Mingju; Wang, Changsong; Wang, Jiao; Yin, Peiyuan; Hu, Chunxiu; Guo, Lei; Yu, Jane; Gao, Peng; Li, Enyou; Zhuang, Zhengping; Xu, Guowang; Liu, Yang

2018-01-15

Purpose: Metabolic reprogramming is frequently identified in hepatocellular carcinoma (HCC), which is the most common type of liver malignancy. The reprogrammed cellular metabolisms promote tumor cell survival, proliferation, angiogenesis, and metastasis. However, the mechanisms of this process remain unclear in HCC. Experimental Design: The global nontargeted metabolic study in 69 paired hepatic carcinomas and adjacent tissue specimens was performed using capillary electrophoresis-time of flight mass spectrometry-based approach. Key findings were validated by targeted metabolomic approach. Biological studies were also performed to investigate the role of proline biosynthesis in HCC pathogenesis. Results: Proline metabolism was markedly changed in HCC tumor tissue, characterized with accelerated consumption of proline and accumulation of hydroxyproline, which significantly correlated with α-fetoprotein levels and poor prognosis in HCC. In addition, we found that hydroxyproline promoted hypoxia- and HIF-dependent phenotype in HCC. Moreover, we demonstrated that hypoxia activated proline biosynthesis via upregulation of ALDH18A1 , subsequently leading to accumulation of hydroxyproline via attenuated PRODH2 activity. More importantly, we showed that glutamine, proline, and hydroxyproline metabolic axis supported HCC cell survival through modulating HIF1α stability in response to hypoxia. Finally, inhibition of proline biosynthesis significantly enhanced cytotoxicity of sorafenib in vitro and in vivo Conclusions: Our results demonstrate that hypoxic microenvironment activates proline metabolism, resulting in accumulation of hydroxyproline that promotes HCC tumor progression and sorafenib resistance through modulating HIF1α. These findings provide the proof of concept for targeting proline metabolism as a potential therapeutic strategy for HCC. Clin Cancer Res; 24(2); 474-85. ©2017 AACR . ©2017 American Association for Cancer Research.

13C multiplet nuclear magnetic resonance relaxation-derived ring puckering and backbone dynamics in proline-containing glycine-based peptides.

PubMed Central

Mikhailov, D; Daragan, V A; Mayo, K H

1995-01-01

13CH2-multiplet nuclear magnetic resonance relaxation studies on proline (P)-containing glycine (G)-based peptides, GP, PG, GPG, PGG, and GPGG, provided numerous dipolar auto- and cross-correlation times for various motional model analyses of backbone and proline-ring bond rotations. Molecular dynamics simulations and bond rotation energy profiles were calculated to assess which motions could contribute most to observed relaxation phenomena. Results indicate that proline restricts backbone psi 1, psi 2, and phi 2 motions by 50% relative to those found for a polyglycine control peptide. psi 1 rotations are more restricted in the trans-proline isomer state than in the cis form. A two-state jump model best approximates proline ring puckering which in water could occur either by the C gamma endo-exo or by the C2 interconversion mechanism. The temperature dependence (5 degrees to 75 degrees C) of C beta, and C gamma, and C delta angular changes is rather flat, suggesting a near zero enthalpic contribution to the ring puckering process. In lower dielectric solvents, dimethylsulfoxide and methanol, which may mimic the hydrophobic environment within a protein, the endo-exo mechanism is preferred. PMID:7787039

Functional Consequences of Intracellular Proline Levels Manipulation Affecting PRODH/POX-Dependent Pro-Apoptotic Pathways in a Novel in Vitro Cell Culture Model.

PubMed

Zareba, Ilona; Surazynski, Arkadiusz; Chrusciel, Marcin; Miltyk, Wojciech; Doroszko, Milena; Rahman, Nafis; Palka, Jerzy

2017-01-01

The effect of impaired intracellular proline availability for proline dehydrogenase/proline oxidase (PRODH/POX)-dependent apoptosis was studied. We generated a constitutively knocked-down PRODH/POX MCF-7 breast cancer cell line (MCF-7shPRODH/POX) as a model to analyze the functional consequences of impaired intracellular proline levels. We have used inhibitor of proline utilization in collagen biosynthesis, 2-metoxyestradiol (MOE), inhibitor of prolidase that generate proline, rapamycin (Rap) and glycyl-proline (GlyPro), substrate for prolidase. Collagen and DNA biosynthesis were evaluated by radiometric assays. Cell viability was determined using Nucleo-Counter NC-3000. The activity of prolidase was determined by colorimetric assay. Expression of proteins was assessed by Western blot and immunofluorescence bioimaging. Concentration of proline was analyzed by liquid chromatography with mass spectrometry. PRODH/POX knockdown decreased DNA and collagen biosynthesis, whereas increased prolidase activity and intracellular proline level in MCF-7shPRODH/POX cells. All studied compounds decreased cell viability in MCF-7 and MCF-7shPRODH/POX cells. DNA biosynthesis was similarly inhibited by Rap and MOE in both cell lines, but GlyPro inhibited the process only in MCF-7shPRODH/POX and MOE+GlyPro only in MCF-7 cells. All the compounds inhibited collagen biosynthesis, increased prolidase activity and cytoplasmic proline level in MCF-7shPRODH/POX cells and contributed to the induction of pro-survival mode only in MCF-7shPRODH/POX cells. In contrast, all studied compounds upregulated expression of pro-apoptotic protein only in MCF-7 cells. PRODH/POX was confirmed as a driver of apoptosis and proved the eligibility of MCF-7shPRODH/POX cell line as a highly effective model to elucidate the different mechanisms underlying proline utilization or generation in PRODH/POX-dependent pro-apoptotic pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

Expression and substrate specificity of betaine/proline transporters suggest a novel choline transport mechanism in sugar beet.

PubMed

Yamada, Nana; Sakakibara, Shota; Tsutsumi, Koichi; Waditee, Rungaroon; Tanaka, Yoshito; Takabe, Teruhiro

2011-09-15

Proline transporters (ProTs) originally described as highly selective transporters for proline, have been shown to also transport glycinebetaine (betaine). Here we examined and compared the transport properties of Bet/ProTs from betaine accumulating (sugar beet, Amaranthus, and Atriplex,) and non-accumulating (Arabidopsis) plants. Using a yeast mutant deficient for uptake of proline and betaine, it was shown that all these transporters exhibited higher affinity for betaine than proline. The uptake of betaine and proline was pH-dependent and inhibited by the proton uncoupler carbonylcyanide m-chlorophenylhydrazone (CCCP). We also investigated choline transport by using a choline transport-deficient yeast mutant. Results revealed that these transporters exhibited a higher affinity for choline uptake rather than betaine. Uptake of choline by sugar beet BvBet/ProT1 was independent of the proton gradient and the inhibition by CCCP was reduced compared with that for uptake of betaine, suggesting different proton binding properties between the transport of choline and betaine. Additionally, in situ hybridization experiments revealed the localization of sugar beet BvBet/ProT1 in phloem and xylem parenchyma cells. Copyright © 2011 Elsevier GmbH. All rights reserved.

Reprogramming of proline and glutamine metabolism contributes to the proliferative and metabolic responses regulated by oncogenic transcription factor c-MYC

PubMed Central

Liu, Wei; Le, Anne; Hancock, Chad; Lane, Andrew N.; Dang, Chi V.; Fan, Teresa W.-M.; Phang, James M.

2012-01-01

In addition to glycolysis, the oncogenic transcription factor c-MYC (MYC) stimulates glutamine catabolism to fuel growth and proliferation of cancer cells through up-regulating glutaminase (GLS). Glutamine is converted to glutamate by GLS, entering the tricarboxylic acid cycle as an important energy source. Less well-recognized, glutamate can also be converted to proline through Δ1-pyrroline-5-carboxylate (P5C) and vice versa. This study suggests that some MYC-induced cellular effects are due to MYC regulation of proline metabolism. Proline oxidase, also known as proline dehydrogenase (POX/PRODH), the first enzyme in proline catabolism, is a mitochondrial tumor suppressor that inhibits proliferation and induces apoptosis. MiR-23b* mediates POX/PRODH down-regulation in human kidney tumors. MiR-23b* is processed from the same transcript as miR-23b; the latter inhibits the translation of GLS. Using MYC-inducible human Burkitt lymphoma model P493 and PC3 human prostate cancer cells, we showed that MYC suppressed POX/PRODH expression primarily through up-regulating miR-23b*. The growth inhibition in the absence of MYC was partially reversed by POX/PRODH knockdown, indicating the importance of suppression of POX/PRODH in MYC-mediated cellular effects. Interestingly, MYC not only inhibited POX/PRODH, but also markedly increased the enzymes of proline biosynthesis from glutamine, including P5C synthase and P5C reductase 1. MYC-induced proline biosynthesis from glutamine was directly confirmed using 13C,15N-glutamine as a tracer. The metabolic link between glutamine and proline afforded by MYC emphasizes the complexity of tumor metabolism. Further studies of the relationship between glutamine and proline metabolism should provide a deeper understanding of tumor metabolism while enabling the development of novel therapeutic strategies. PMID:22615405

Hydrophytes lack potential to exhibit cadmium stress induced enhancement in lipid peroxidation and accumulation of proline.

PubMed

Dhir, Bhupinder; Sharmila, P; Saradhi, P Pardha

2004-02-10

Investigations were carried out to evaluate if hydrophytes (viz. Ceratophyllum, Wolffia, and Hydrilla) can be used as markers to assess the level of heavy metal pollution in aquatic bodies. The potential of these hydrophytes for lipid peroxidation and accumulation of proline in response to cadmium (Cd2+) pollution was studied. Hydrophytes were raised in artificial pond water (APW) supplemented with various levels of Cd2+. Interestingly, unlike mesophytes none of the hydrophytes showed ability to accumulate proline. Infact, in response to Cd2+ pollution hydrophytes exhibited a decline in proline levels in comparison to controls but mesophytes (viz. Brassica juncea, Vigna radiata and Triticum aestivum) showed progressive increase in the level of proline with increase in the extent of Cd2+ pollution. Mesophytes showed six to nine-fold increase in the level of proline in response to 1 mM Cd2+. The potential of the above hydrophytes for lipid peroxidation was also low under Cd2+ stress. In contrast, as expected a significant enhancement in the lipid peroxidation was observed in all three mesophytes in response to their exposure to Cd2+. About two-fold increase in production of malondialdehyde (a cytotoxic product of lipid peroxidation) was recorded in mesophytes exposed to 1 mM Cd2+. However, a decline in chlorophyll (Chl a and Chl b) levels was recorded in response to Cd2+pollution both in hydrophytes as well as mesophytes. In summary, hydrophytes neither have potential to accumulate proline nor have ability to accelerate lipid peroxidation under heavy metal stress. This suggests that the adaptive mechanism(s) existing in hydrophytes to tackle heavy metal stress is distinct from that in mesophytes.

Hydrogen rich gas generator

NASA Technical Reports Server (NTRS)

Houseman, J. (Inventor)

1976-01-01

A process and apparatus is described for producing a hydrogen rich gas by introducing a liquid hydrocarbon fuel in the form of a spray into a partial oxidation region and mixing with a mixture of steam and air that is preheated by indirect heat exchange with the formed hydrogen rich gas, igniting the hydrocarbon fuel spray mixed with the preheated mixture of steam and air within the partial oxidation region to form a hydrogen rich gas.

Variation in relative water content, proline accumulation and stress gene expression in two cowpea landraces under drought.

PubMed

Zegaoui, Zahia; Planchais, Séverine; Cabassa, Cécile; Djebbar, Reda; Abrous Belbachir, Ouzna; Carol, Pierre

2017-11-01

Many landraces of cowpea [Vigna unguiculata (L.) Walp.] are adapted to particular geographical and climatic conditions. Here we describe two landraces grown respectively in arid and temperate areas of Algeria and assess their physiological and molecular responses to drought stress. As expected, when deprived of water cowpea plants lose water over time with a gradual reduction in transpiration rate. The landraces differed in their relative water content (RWC) and whole plant transpiration rate. The landrace from Menia, an arid area, retained more water in adult leaves. Both landraces responded to drought stress at the molecular level by increasing expression of stress-related genes in aerial parts, including proline metabolism genes. Expression of gene(s) encoding proline synthesis enzyme P5CS was up regulated and gene expression of ProDH, a proline catabolism enzyme, was down regulated. Relatively low amounts of proline accumulated in adult leaves with slight differences between the two landraces. During drought stress the most apical part of plants stayed relatively turgid with a high RWC compared to distal parts that wilted. Expression of key stress genes was higher and more proline accumulated at the apex than in distal leaves indicating that cowpea has a non-uniform stress response at the whole plant level. Our study reveals a developmental control of water stress through preferential proline accumulation in the upper tier of the cowpea plant. We also conclude that cowpea landraces display physiological adaptations to water stress suited to the arid and temperate climates in which they are cultivated. Copyright © 2017 Elsevier GmbH. All rights reserved.

Myotonia-related mutations in the distal C-terminus of ClC-1 and ClC-0 chloride channels affect the structure of a poly-proline helix

PubMed Central

Macías, María J.; Teijido, Oscar; Zifarelli, Giovanni; Martin, Pau; Ramirez-Espain, Ximena; Zorzano, Antonio; Palacín, Manuel; Pusch, Michael; Estévez, Raúl

2006-01-01

Myotonia is a state of hyperexcitability of skeletal-muscle fibres. Mutations in the ClC-1 Cl− channel cause recessive and dominant forms of this disease. Mutations have been described throughout the protein-coding region, including three sequence variations (A885P, R894X and P932L) in a distal C-terminal stretch of residues [CTD (C-terminal domain) region] that are not conserved between CLC proteins. We show that surface expression of these mutants is reduced in Xenopus oocytes compared with wild-type ClC-1. Functional, biochemical and NMR spectroscopy studies revealed that the CTD region encompasses a segment conserved in most voltage-dependent CLC channels that folds with a secondary structure containing a short type II poly-proline helix. We found that the myotonia-causing mutation A885P disturbs this structure by extending the poly-proline helix. We hypothesize that this structural modification results in the observed alteration of the common gate that acts on both pores of the channel. We provide the first experimental investigation of structural changes resulting from myotonia-causing mutations. PMID:17107341

Motility Determinants in WASP Family ProteinsD⃞

PubMed Central

Yarar, Defne; D'Alessio, Joseph A.; Jeng, Robert L.; Welch, Matthew D.

2002-01-01

In response to upstream signals, proteins in the Wiskott-Aldrich Syndrome protein (WASP) family regulate actin nucleation via the Arp2/3 complex. Despite intensive study of the function of WASP family proteins in nucleation, it is not yet understood how their distinct structural organization contributes to actin-based motility. Herein, we analyzed the activities of WASP and Scar1 truncation derivatives by using a bead-based motility assay. The minimal region of WASP sufficient to direct movement was the C-terminal WCA fragment, whereas the corresponding region of Scar1 was insufficient. In addition, the proline-rich regions of WASP and Scar1 and the Ena/VASP homology 1 (EVH1) domain of WASP independently enhanced motility rates. The contributions of these regions to motility could not be accounted for by their direct effects on actin nucleation with the Arp2/3 complex, suggesting that they stimulate motility by recruiting additional factors. We have identified profilin as one such factor. WASP- and Scar1-coated bead motility rates were significantly reduced by depletion of profilin and VASP and could be more efficiently rescued by a combination of VASP and wild-type profilin than by VASP and a mutant profilin that cannot bind proline-rich sequences. Moreover, motility of WASP WCA beads was not affected by the depletion or addback of VASP and profilin. Our results suggest that recruitment of factors, including profilin, by the proline-rich regions of WASP and Scar1 and the EVH1 domain of WASP stimulates cellular actin-based motility. PMID:12429845

Unusual reversal of enantioselectivity in the proline-mediated alpha-amination of aldehydes induced by tertiary amine additives.

PubMed

Blackmond, Donna G; Moran, Antonio; Hughes, Matthew; Armstrong, Alan

2010-06-09

An intriguing reversal in product enantioselectivity accompanied by a change in the kinetic profile is observed in the alpha-amination of aldehydes catalyzed by proline in the presence of organic bases. Implications for the prevailing stereochemical models for proline and related aminocatalytic transformations are discussed.

Does the colonization of new biogeographic regions influence the diversification and accumulation of clade richness among the Corvides (Aves: Passeriformes)?

PubMed

Kennedy, Jonathan D; Borregaard, Michael K; Jønsson, Knud A; Holt, Ben; Fjeldså, Jon; Rahbek, Carsten

2017-01-01

Regional variation in clade richness can be vast, reflecting differences in the dynamics of historical dispersal and diversification among lineages. Although it has been proposed that dispersal into new biogeographic regions may facilitate diversification, to date there has been limited assessment of the importance of this process in the generation, and maintenance, of broad-scale biodiversity gradients. To address this issue, we analytically derive biogeographic regions for a global radiation of passerine birds (the Corvides, c. 790 species) that are highly variable in the geographic and taxonomic distribution of species. Subsequently, we determine rates of historical dispersal between regions, the dynamics of diversification following regional colonization, and spatial variation in the distribution of species that differ in their rates of lineage diversification. The results of these analyses reveal spatiotemporal differences in the build-up of lineages across regions. The number of regions occupied and the rate of transition between regions both predict family richness well, indicating that the accumulation of high clade richness is associated with repeated expansion into new geographic areas. However, only the largest family (the Corvidae) had significantly heightened rates of both speciation and regional transition, implying that repeated regional colonization is not a general mechanism promoting lineage diversification among the Corvides. © 2016 The Author(s). Evolution © 2016 The Society for the Study of Evolution.

Validation and application of an improved method for the rapid determination of proline in grape berries.

PubMed

Rienth, Markus; Romieu, Charles; Gregan, Rebecca; Walsh, Caroline; Torregrosa, Laurent; Kelly, Mary T

2014-04-16

A rapid and sensitive method is presented for the determination of proline in grape berries. Following acidification with formic acid, proline is derivatized by heating at 100 °C for 15 min with 3% ninhydrin in dimethyl sulfoxide, and the absorbance, which is stable for at least 60 min, is read at 520 nm. The method was statistically validated in the concentration range from 2.5 to 15 mg/L, giving a repeatability and intermediate precision of generally <3%; linearity was determined using the lack of fit test. Results obtained with this method concurred (r = 0.99) with those obtained for the same samples on an amino acid analyzer. In terms of sample preparation, a simple dilution (5-20-fold) is required, and sugars, primary amino acids, and anthocyanins were demonstrated not to interfere, as the latter are bleached by ninhydrin under the experimental conditions. The method was applied to the study of proline accumulation in the fruits of microvines grown in phytotrons, and it was established that proline accumulation and concentrations closely resemble those of field-grown macrovines.

Tetrahelical structural family adopted by AGCGA-rich regulatory DNA regions

NASA Astrophysics Data System (ADS)

Kocman, Vojč; Plavec, Janez

2017-05-01

Here we describe AGCGA-quadruplexes, an unexpected addition to the well-known tetrahelical families, G-quadruplexes and i-motifs, that have been a focus of intense research due to their potential biological impact in G- and C-rich DNA regions, respectively. High-resolution structures determined by solution-state nuclear magnetic resonance (NMR) spectroscopy demonstrate that AGCGA-quadruplexes comprise four 5'-AGCGA-3' tracts and are stabilized by G-A and G-C base pairs forming GAGA- and GCGC-quartets, respectively. Residues in the core of the structure are connected with edge-type loops. Sequences of alternating 5'-AGCGA-3' and 5'-GGG-3' repeats could be expected to form G-quadruplexes, but are shown herein to form AGCGA-quadruplexes instead. Unique structural features of AGCGA-quadruplexes together with lower sensitivity to cation and pH variation imply their potential biological relevance in regulatory regions of genes responsible for basic cellular processes that are related to neurological disorders, cancer and abnormalities in bone and cartilage development.

Unique Structural Features and Sequence Motifs of Proline Utilization A (PutA)

PubMed Central

Singh, Ranjan K.; Tanner, John J.

2013-01-01

Proline utilization A proteins (PutAs) are bifunctional enzymes that catalyze the oxidation of proline to glutamate using spatially separated proline dehydrogenase and pyrroline-5-carboxylate dehydrogenase active sites. Here we use the crystal structure of the minimalist PutA from Bradyrhizobium japonicum (BjPutA) along with sequence analysis to identify unique structural features of PutAs. This analysis shows that PutAs have secondary structural elements and domains not found in the related monofunctional enzymes. Some of these extra features are predicted to be important for substrate channeling in BjPutA. Multiple sequence alignment analysis shows that some PutAs have a 17-residue conserved motif in the C-terminal 20–30 residues of the polypeptide chain. The BjPutA structure shows that this motif helps seal the internal substrate-channeling cavity from the bulk medium. Finally, it is shown that some PutAs have a 100–200 residue domain of unknown function in the C-terminus that is not found in minimalist PutAs. Remote homology detection suggests that this domain is homologous to the oligomerization beta-hairpin and Rossmann fold domain of BjPutA. PMID:22201760

Seasonal acclimatization of thallus proline contents of Mastocarpus stellatus and Chondrus crispus: intertidal rhodophytes that differ in freezing tolerance.

PubMed

Harris, Jonathan P; Logan, Barry A

2018-02-17

Mastocarpus stellatus and Chondrus crispus often co-occur in the lower intertidal of Northern Atlantic rocky shorelines. At our field site along the Maine coast (USA), Mastocarpus stellatus thalli possessed greater contents of proline when compared with thalli of Chondrus crispus. In addition, M. stellatus thalli acclimated to colder growth conditions in winter/early spring by increasing proline content several fold; no seasonal acclimation in proline content was observed in C. crispus. Proline accumulates in the tissues of a broad diversity of freezing-tolerant organisms and is among the most common cryoprotectant molecules. Thus, our observations provide a basis for the previously well-documented greater freezing tolerance of Mastocarpus stellatus when compared with Chondrus crispus. © 2018 Phycological Society of America.

Design of cyclic peptides featuring proline predominantly in the cis conformation under physiological conditions.

PubMed

Malešević, Miroslav; Schumann, Michael; Jahreis, Günther; Fischer, Gunter; Lücke, Christian

2012-09-24

Turns are secondary-structure elements that are omnipresent in natively folded polypeptide chains. A large variety of four-residue β-turns exist, which differ mainly in the backbone dihedral angle values of the two central residues i+1 and i+2. The βVI-type turns are of particular biological interest because the i+2 residue is always a proline in the cis conformation and might thus serve as target of peptidyl prolyl cis/trans isomerases (PPIases). We have designed cyclic hexapeptides containing two proline residues that predominantly adopt the cis conformation in aqueous solution. NMR data and MD calculations indicated that the cyclic peptide sequences c-(-DXaa-Ser-Pro-DXaa-Lys-Pro-) result in highly symmetric backbone structures when both prolines are in the cis conformation and the D-amino acids are either alanine or phenylalanine residues. Replacement of the serine residue either by phosphoserine or by tyrosine compromises this symmetry, but further increases the cis conformation content of both prolines. As a result, we obtained a cyclic hexapeptide that exists almost exclusively as the cis-Pro/cis-Pro conformer but shows no cis/trans interconversion even in the presence of the PPIase Pin1, apparently due to an energetically quite favorable but highly restricted conformational space. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Kinetic profiling of prolinate-catalyzed α-amination of aldehydes.

PubMed

Hein, Jason E; Armstrong, Alan; Blackmond, Donna G

2011-08-19

Deconvolution of the role of off-cycle species from the desired catalytic cycle leads to an optimized protocol for the prolinate-catalyzed amination of aldehydes. The scope of complex reaction networks will be greatly broadened by understanding ancillary rate processes that influence the productive catalytic pathway. © 2011 American Chemical Society

Doublecortin associates with microtubules preferentially in regions of the axon displaying actin-rich protrusive structures

PubMed Central

Tint, Irina; Jean, Daphney; Baas, Peter W.; Black, Mark M.

2009-01-01

Here we studied doublecortin (DCX) in cultured hippocampal and sympathetic neurons during axonal development. In both types of neurons, DCX is abundant in the growth cone, where it primarily localizes with microtubules. Its abundance is lowest on microtubules in the neck region of the growth cone and highest on microtubules extending into the actin-rich lamellar regions. Interestingly, the microtubule polymer richest in DCX is also deficient in tau. In hippocampal neurons but not sympathetic neurons, discrete focal patches of microtubules rich in DCX and deficient in tau are present along the axonal shaft. Invariably, these patches have actin-rich protrusions resembling those of growth cones. Many of the DCX/actin filament patches exhibit vigorous protrusive activity and also undergo a proximal-to-distal redistribution within the axon at average rates ≈ 2 μm/min, and thus closely resemble the growth-cone-like waves described by previous authors. Depletion of DCX using siRNA had little effect on the appearance of the growth cone or on axonal growth in either type of neuron. However, DCX depletion significantly delayed collateral branching in hippocampal neurons and also significantly lowered the frequency of actin-rich patches along hippocampal axons. Branching by sympathetic neurons, which occurs by growth cone splitting, was not impaired by DCX depletion. These findings reveal a functional relationship between the DCX/actin filament patches and collateral branching. Based on the striking resemblance of these patches to growth cones, we discuss the possibility that they reflect a mechanism for locally boosting morphogenetic activity to facilitate axonal growth and collateral branching. PMID:19726658

Geographic analysis of species richness and community attributes of forest birds from survey data in the mid-Atlantic integrated assessment region

USGS Publications Warehouse

Cam, E.; Sauer, J.R.; Nichols, J.D.; Hines, J.E.; Flather, C.H.

2000-01-01

Species richness of local communities is a state variable commonly used in community ecology and conservation biology. Investigation of spatial and temporal variations in richness and identification of factors associated with these variations form a basis for specifying management plans, evaluating these plans, and for testing hypotheses of theoretical interest. However, estimation of species richness is not trivial: species can be missed by investigators during sampling sessions. Sampling artifacts can lead to erroneous conclusions on spatial and temporal variation in species richness. Here we use data from the North American Breeding Bird Survey to estimate parameters describing the state of bird communities in the Mid-Atlantic Assessment (MAIA) region: species richness, extinction probability, turnover and relative species richness. We use a recently developed approach to estimation of species richness and related parameters that does not require the assumption that all the species are detected during sampling efforts. The information presented here is intended to visualize the state of bird communities in the MAIA region. We provide information on 1975 and 1990. We also quantified the changes between these years. We summarized and mapped the community attributes at a scale of management interest (watershed units).

Proline supplementation to parenteral nutrition results in greater rates of protein synthesis in the muscle, skin, and small intestine in neonatal Yucatan miniature piglets.

PubMed

Brunton, Janet A; Baldwin, Mark P; Hanna, Rodney A; Bertolo, Robert F

2012-06-01

Proline and arginine are each indispensable during parenteral feeding due to limited interconversion by an atrophied gut. Commercial amino acid parenteral products designed for neonates contain proline concentrations that differ by almost 4-fold. To assess the adequacy of the lowest concentration of proline provided in commercial total parenteral nutrition (TPN) products, we compared rates of tissue-specific protein synthesis and nitrogen balance in neonatal piglets provided TPN at 2 different proline concentrations. Yucatan miniature piglets (9-11 d old, n = 12) were randomized to complete isonitrogenous TPN diets with low proline (LP; L-proline as 3% of amino acids) or proline supplemented (PS; 9%). After 7 d of receiving TPN, rates of protein synthesis in liver, gastrocnemius muscle, jejunal mucosa, and skin were determined by the flooding dose technique and tissue free amino acids were measured. Nitrogen balance was assessed during the last 3 d. The LP TPN resulted in lower free proline concentrations in plasma, muscle, and skin (P < 0.05) and lower rates of protein synthesis in the jejunum (by 25%; P = 0.02), muscle (by 45%; P = 0.015), and skin (by 60%; P = 0.01); there was no difference in liver. Nitrogen retention was 20% lower in the LP group (P = 0.01). In conclusion, muscle and skin protein synthesis was profoundly sensitive to parenteral proline supply and the reduced protein synthesis in the intestine could affect intestinal integrity. Low-proline TPN solutions that are currently in wide use in neonatal care may result in impaired tissue growth.

Trans−cis Switching Mechanisms in Proline Analogues and Their Relevance for the Gating of the 5-HT3 Receptor

PubMed Central

2009-01-01

Trans−cis isomerization of a proline peptide bond is a potential mechanism to open the channel of the 5-HT3 receptor. Here, we have used the metadynamics method to theoretically explore such a mechanism. We have determined the free energy surfaces in aqueous solution of a series of dipeptides of proline analogues and evaluated the free energy difference between the cis and trans isomers. These theoretical results were then compared with data from mutagenesis experiments, in which the response of the 5-HT3 receptor was measured when the proline at the apex of the M2-M3 transmembrane domain loop was mutated. The strong correlation between the experimental and the theoretical data supports the existence of a trans−cis proline switch for opening the 5-HT3 receptor ion channel. PMID:19663504

Trans-cis switching mechanisms in proline analogues and their relevance for the gating of the 5-HT3 receptor.

PubMed

Melis, Claudio; Bussi, Giovanni; Lummis, Sarah C R; Molteni, Carla

2009-09-03

Trans-cis isomerization of a proline peptide bond is a potential mechanism to open the channel of the 5-HT(3) receptor. Here, we have used the metadynamics method to theoretically explore such a mechanism. We have determined the free energy surfaces in aqueous solution of a series of dipeptides of proline analogues and evaluated the free energy difference between the cis and trans isomers. These theoretical results were then compared with data from mutagenesis experiments, in which the response of the 5-HT(3) receptor was measured when the proline at the apex of the M2-M3 transmembrane domain loop was mutated. The strong correlation between the experimental and the theoretical data supports the existence of a trans-cis proline switch for opening the 5-HT(3) receptor ion channel.

Nine of 16 stereoisomeric polyhydroxylated proline amides are potent β-N-acetylhexosaminidase inhibitors.

PubMed

Ayers, Benjamin J; Glawar, Andreas F G; Martínez, R Fernando; Ngo, Nigel; Liu, Zilei; Fleet, George W J; Butters, Terry D; Nash, Robert J; Yu, Chu-Yi; Wormald, Mark R; Nakagawa, Shinpei; Adachi, Isao; Kato, Atsushi; Jenkinson, Sarah F

2014-04-18

All 16 stereoisomeric N-methyl 5-(hydroxymethyl)-3,4-dihydroxyproline amides have been synthesized from lactones accessible from the enantiomers of glucuronolactone. Nine stereoisomers, including all eight with a (3R)-hydroxyl configuration, are low to submicromolar inhibitors of β-N-acetylhexosaminidases. A structural correlation between the proline amides is found with the ADMDP-acetamide analogues bearing an acetamidomethylpyrrolidine motif. The proline amides are generally more potent than their ADMDP-acetamide equivalents. β-N-Acetylhexosaminidase inhibition by an azetidine ADMDP-acetamide analogue is compared to an azetidine carboxylic acid amide. None of the amides are good α-N-acetylgalactosaminidase inhibitors.

Two Proline-Rich Nuclear Localization Signals in the Amino- and Carboxyl-Terminal Regions of the Borna Disease Virus Phosphoprotein

PubMed Central

Shoya, Yuko; Kobayashi, Takeshi; Koda, Toshiaki; Ikuta, Kazuyoshi; Kakinuma, Mitsuaki; Kishi, Masahiko

1998-01-01

Borna disease virus (BDV) uses a unique strategy of replication and transcription which takes place in the nucleus, unlike other known, nonsegmented, negative-stranded RNA viruses of animal origin. In this process, viral constituents necessary for replication must be transported to the nucleus from the cytoplasm. We report here the evidence that BDV P protein, which may play an important role in viral replication and transcription, is transported into the nucleus in the absence of other viral constituents. This transportation is accomplished by its own nuclear localization signals (NLSs), which are present in both N-terminal (29PRPRKIPR36) and C-terminal (181PPRIYPQLPSAPT193) regions of the protein. These two NLSs can function independently and both have several Pro residues as key amino acids. PMID:9811710

Engineering a trifunctional proline utilization A chimaera by fusing a DNA-binding domain to a bifunctional PutA.

PubMed

Arentson, Benjamin W; Hayes, Erin L; Zhu, Weidong; Singh, Harkewal; Tanner, John J; Becker, Donald F

2016-12-01

Proline utilization A (PutA) is a bifunctional flavoenzyme with proline dehydrogenase (PRODH) and Δ 1 -pyrroline-5-carboxylate (P5C) dehydrogenase (P5CDH) domains that catalyses the two-step oxidation of proline to glutamate. Trifunctional PutAs also have an N-terminal ribbon-helix-helix (RHH) DNA-binding domain and moonlight as autogenous transcriptional repressors of the put regulon. A unique property of trifunctional PutA is the ability to switch functions from DNA-bound repressor to membrane-associated enzyme in response to cellular nutritional needs and proline availability. In the present study, we attempt to construct a trifunctional PutA by fusing the RHH domain of Escherichia coli PutA (EcRHH) to the bifunctional Rhodobacter capsulatus PutA (RcPutA) in order to explore the modular design of functional switching in trifunctional PutAs. The EcRHH-RcPutA chimaera retains the catalytic properties of RcPutA while acquiring the oligomeric state, quaternary structure and DNA-binding properties of EcPutA. Furthermore, the EcRHH-RcPutA chimaera exhibits proline-induced lipid association, which is a fundamental characteristic of functional switching. Unexpectedly, RcPutA lipid binding is also activated by proline, which shows for the first time that bifunctional PutAs exhibit a limited form of functional switching. Altogether, these results suggest that the C-terminal domain (CTD), which is conserved by trifunctional PutAs and certain bifunctional PutAs, is essential for functional switching in trifunctional PutAs. © 2016 The Author(s).

Engineering a trifunctional proline utilization A chimaera by fusing a DNA-binding domain to a bifunctional PutA

PubMed Central

Arentson, Benjamin W.; Hayes, Erin L.; Zhu, Weidong; Singh, Harkewal; Tanner, John J.; Becker, Donald F.

2016-01-01

Proline utilization A (PutA) is a bifunctional flavoenzyme with proline dehydrogenase (PRODH) and Δ1-pyrroline-5-carboxylate (P5C) dehydrogenase (P5CDH) domains that catalyses the two-step oxidation of proline to glutamate. Trifunctional PutAs also have an N-terminal ribbon–helix–helix (RHH) DNA-binding domain and moonlight as autogenous transcriptional repressors of the put regulon. A unique property of trifunctional PutA is the ability to switch functions from DNA-bound repressor to membrane-associated enzyme in response to cellular nutritional needs and proline availability. In the present study, we attempt to construct a trifunctional PutA by fusing the RHH domain of Escherichia coli PutA (EcRHH) to the bifunctional Rhodobacter capsulatus PutA (RcPutA) in order to explore the modular design of functional switching in trifunctional PutAs. The EcRHH–RcPutA chimaera retains the catalytic properties of RcPutA while acquiring the oligomeric state, quaternary structure and DNA-binding properties of EcPutA. Furthermore, the EcRHH–RcPutA chimaera exhibits proline-induced lipid association, which is a fundamental characteristic of functional switching. Unexpectedly, RcPutA lipid binding is also activated by proline, which shows for the first time that bifunctional PutAs exhibit a limited form of functional switching. Altogether, these results suggest that the C-terminal domain (CTD), which is conserved by trifunctional PutAs and certain bifunctional PutAs, is essential for functional switching in trifunctional PutAs. PMID:27742866

High-Throughput Quantitation of Proline Betaine in Foods and Suitability as a Valid Biomarker for Citrus Consumption.

PubMed

Lang, Roman; Lang, Tatjana; Bader, Matthias; Beusch, Anja; Schlagbauer, Verena; Hofmann, Thomas

2017-03-01

Proline betaine has been proposed as a candidate dietary biomarker for citrus intake. To validate its suitability as a dietary biomarker and to gain insight into the range of this per-methylated amino acid in foods and beverages, a quick and accurate stable isotope dilution assay was developed for quantitative high-throughput HILIC-MS/MS screening of proline betaine in foods and urine after solvent-mediated matrix precipitation. Quantitative analysis of a variety of foods confirmed substantial amounts of proline betaine in citrus juices (140-1100 mg/L) and revealed high abundance in tubers of the vegetable Stachys affinis, also known as Chinese artichocke (∼700 mg/kg). Seafood including clams, shrimp, and lobster contained limited amounts (1-95 mg/kg), whereas only traces were detected in fish, cuttlefish, fresh meat, dairy products, fresh vegetable (<3 mg/kg), coffee, tea, beer, and wine (<7 mg/L). The human excretion profiles of proline betaine in urine were comparable when common portions of orange juice or fried Stachys tubers were consumed. Neither mussels nor beer provided enough proline betaine to detect significant differences between morning urine samples collected before and after consumption. As Stachys is a rather rare vegetable and not part of peoples' daily diet, the data reported here will help to monitor the subject's compliance in future nutritional human studies on citrus products or the exclusion of citrus products in the wash-out phase of an intervention study. Moreover, proline betaine measurement can contribute to the establishment of a toolbox of valid dietary biomarkers reflecting wider aspects of diet to assess metabolic profiles as measures of dietary exposure and indicators of dietary patterns, dietary changes, or effectiveness of dietary interventions.

Molecular Dynamics of the Proline Switch and Its Role in Crk Signaling

PubMed Central

2015-01-01

The Crk adaptor proteins play a central role as a molecular timer for the formation of protein complexes including various growth and differentiation factors. The loss of regulation of Crk results in many kinds of cancers. A self-regulatory mechanism for Crk was recently proposed, which involves domain–domain rearrangement. It is initiated by a cis–trans isomerization of a specific proline residue (Pro238 in chicken Crk II) and can be accelerated by Cyclophilin A. To understand how the proline switch controls the autoinhibition at the molecular level, we performed large-scale molecular dynamics and metadynamics simulations in the context of short peptides and multidomain constructs of chicken Crk II. We found that the equilibrium and kinetic properties of the macrostates are regulated not only by the local environments of specified prolines but also by the global organization of multiple domains. We observe the two macrostates (cis closed/autoinhibited and trans open/uninhibited) consistent with NMR experiments and predict barriers. We also propose an intermediate state, the trans closed state, which interestingly was reported to be a prevalent state in human Crk II. The existence of this macrostate suggests that the rate of switching off the autoinhibition by Cyp A may be limited by the relaxation rate of this intermediate state. PMID:24702481

Molecular dynamics of the proline switch and its role in Crk signaling.

PubMed

Xia, Junchao; Levy, Ronald M

2014-05-01

The Crk adaptor proteins play a central role as a molecular timer for the formation of protein complexes including various growth and differentiation factors. The loss of regulation of Crk results in many kinds of cancers. A self-regulatory mechanism for Crk was recently proposed, which involves domain-domain rearrangement. It is initiated by a cis-trans isomerization of a specific proline residue (Pro238 in chicken Crk II) and can be accelerated by Cyclophilin A. To understand how the proline switch controls the autoinhibition at the molecular level, we performed large-scale molecular dynamics and metadynamics simulations in the context of short peptides and multidomain constructs of chicken Crk II. We found that the equilibrium and kinetic properties of the macrostates are regulated not only by the local environments of specified prolines but also by the global organization of multiple domains. We observe the two macrostates (cis closed/autoinhibited and trans open/uninhibited) consistent with NMR experiments and predict barriers. We also propose an intermediate state, the trans closed state, which interestingly was reported to be a prevalent state in human Crk II. The existence of this macrostate suggests that the rate of switching off the autoinhibition by Cyp A may be limited by the relaxation rate of this intermediate state.

Testis-specific glyceraldehyde-3-phosphate dehydrogenase: origin and evolution

PubMed Central

2011-01-01

Background Glyceraldehyde-3-phosphate dehydrogenase (GAPD) catalyses one of the glycolytic reactions and is also involved in a number of non-glycolytic processes, such as endocytosis, DNA excision repair, and induction of apoptosis. Mammals are known to possess two homologous GAPD isoenzymes: GAPD-1, a well-studied protein found in all somatic cells, and GAPD-2, which is expressed solely in testis. GAPD-2 supplies energy required for the movement of spermatozoa and is tightly bound to the sperm tail cytoskeleton by the additional N-terminal proline-rich domain absent in GAPD-1. In this study we investigate the evolutionary history of GAPD and gain some insights into specialization of GAPD-2 as a testis-specific protein. Results A dataset of GAPD sequences was assembled from public databases and used for phylogeny reconstruction by means of the Bayesian method. Since resolution in some clades of the obtained tree was too low, syntenic analysis was carried out to define the evolutionary history of GAPD more precisely. The performed selection tests showed that selective pressure varies across lineages and isoenzymes, as well as across different regions of the same sequences. Conclusions The obtained results suggest that GAPD-1 and GAPD-2 emerged after duplication during the early evolution of chordates. GAPD-2 was subsequently lost by most lineages except lizards, mammals, as well as cartilaginous and bony fishes. In reptilians and mammals, GAPD-2 specialized to a testis-specific protein and acquired the novel N-terminal proline-rich domain anchoring the protein in the sperm tail cytoskeleton. This domain is likely to have originated by exonization of a microsatellite genomic region. Recognition of the proline-rich domain by cytoskeletal proteins seems to be unspecific. Besides testis, GAPD-2 of lizards was also found in some regenerating tissues, but it lacks the proline-rich domain due to tissue-specific alternative splicing. PMID:21663662

Testis-specific glyceraldehyde-3-phosphate dehydrogenase: origin and evolution.

PubMed

Kuravsky, Mikhail L; Aleshin, Vladimir V; Frishman, Dmitrij; Muronetz, Vladimir I

2011-06-10

Glyceraldehyde-3-phosphate dehydrogenase (GAPD) catalyses one of the glycolytic reactions and is also involved in a number of non-glycolytic processes, such as endocytosis, DNA excision repair, and induction of apoptosis. Mammals are known to possess two homologous GAPD isoenzymes: GAPD-1, a well-studied protein found in all somatic cells, and GAPD-2, which is expressed solely in testis. GAPD-2 supplies energy required for the movement of spermatozoa and is tightly bound to the sperm tail cytoskeleton by the additional N-terminal proline-rich domain absent in GAPD-1. In this study we investigate the evolutionary history of GAPD and gain some insights into specialization of GAPD-2 as a testis-specific protein. A dataset of GAPD sequences was assembled from public databases and used for phylogeny reconstruction by means of the Bayesian method. Since resolution in some clades of the obtained tree was too low, syntenic analysis was carried out to define the evolutionary history of GAPD more precisely. The performed selection tests showed that selective pressure varies across lineages and isoenzymes, as well as across different regions of the same sequences. The obtained results suggest that GAPD-1 and GAPD-2 emerged after duplication during the early evolution of chordates. GAPD-2 was subsequently lost by most lineages except lizards, mammals, as well as cartilaginous and bony fishes. In reptilians and mammals, GAPD-2 specialized to a testis-specific protein and acquired the novel N-terminal proline-rich domain anchoring the protein in the sperm tail cytoskeleton. This domain is likely to have originated by exonization of a microsatellite genomic region. Recognition of the proline-rich domain by cytoskeletal proteins seems to be unspecific. Besides testis, GAPD-2 of lizards was also found in some regenerating tissues, but it lacks the proline-rich domain due to tissue-specific alternative splicing.

A Simplified Model of Local Structure in Aqueous Proline Amino Acid Revealed by First-Principles Molecular Dynamics Simulations

PubMed Central

Troitzsch, Raphael Z.; Tulip, Paul R.; Crain, Jason; Martyna, Glenn J.

2008-01-01

Aqueous proline solutions are deceptively simple as they can take on complex roles such as protein chaperones, cryoprotectants, and hydrotropic agents in biological processes. Here, a molecular level picture of proline/water mixtures is developed. Car-Parrinello ab initio molecular dynamics (CPAIMD) simulations of aqueous proline amino acid at the B-LYP level of theory, performed using IBM's Blue Gene/L supercomputer and massively parallel software, reveal hydrogen-bonding propensities that are at odds with the predictions of the CHARMM22 empirical force field but are in better agreement with results of recent neutron diffraction experiments. In general, the CPAIMD (B-LYP) simulations predict a simplified structural model of proline/water mixtures consisting of fewer distinct local motifs. Comparisons of simulation results to experiment are made by direct evaluation of the neutron static structure factor S(Q) from CPAIMD (B-LYP) trajectories as well as to the results of the empirical potential structure refinement reverse Monte Carlo procedure applied to the neutron data. PMID:18790850

A simplified model of local structure in aqueous proline amino acid revealed by first-principles molecular dynamics simulations.

PubMed

Troitzsch, Raphael Z; Tulip, Paul R; Crain, Jason; Martyna, Glenn J

2008-12-01

Aqueous proline solutions are deceptively simple as they can take on complex roles such as protein chaperones, cryoprotectants, and hydrotropic agents in biological processes. Here, a molecular level picture of proline/water mixtures is developed. Car-Parrinello ab initio molecular dynamics (CPAIMD) simulations of aqueous proline amino acid at the B-LYP level of theory, performed using IBM's Blue Gene/L supercomputer and massively parallel software, reveal hydrogen-bonding propensities that are at odds with the predictions of the CHARMM22 empirical force field but are in better agreement with results of recent neutron diffraction experiments. In general, the CPAIMD (B-LYP) simulations predict a simplified structural model of proline/water mixtures consisting of fewer distinct local motifs. Comparisons of simulation results to experiment are made by direct evaluation of the neutron static structure factor S(Q) from CPAIMD (B-LYP) trajectories as well as to the results of the empirical potential structure refinement reverse Monte Carlo procedure applied to the neutron data.

Effect of WAVE2 phosphorylation on activation of the Arp2/3 complex.

PubMed

Nakanishi, Osamu; Suetsugu, Shiro; Yamazaki, Daisuke; Takenawa, Tadaomi

2007-03-01

Members of the family of WASP-family Verprolin homologous proteins (WAVEs) activate the Arp2/3 complex to induce actin polymerization. The WAVE family comprises three proteins, namely, WAVE1, WAVE2 and WAVE3. Among them, WAVE2 is crucial for activation of the Arp2/3 complex for the formation of branched actin filaments in lamellipodia. Activation of mitogen-activated protein (MAP) kinase signalling results in the phosphorylation of the WAVE family proteins; however, which of the three WAVE proteins is phosphorylated is unclear. We found that in vitro WAVE2 is directly phosphorylated by a MAP kinase, i.e. extracellular signal-regulated kinase (ERK) 2. The proline-rich region and the verprolin, cofilin and acidic (VCA) region of WAVE2 were phosphorylated. Interestingly, the phosphorylated VCA region had a higher affinity for the Arp2/3 complex. However, the phosphorylation of the VCA region resulted in reduced induction of Arp2/3-mediated actin polymerization in vitro. The role of the phosphorylation of the proline-rich region was not determined.

The Smad3 linker region contains a transcriptional activation domain

PubMed Central

2004-01-01

Transforming growth factor-β (TGF-β)/Smads regulate a wide variety of biological responses through transcriptional regulation of target genes. Smad3 plays a key role in TGF-β/Smad-mediated transcriptional responses. Here, we show that the proline-rich linker region of Smad3 contains a transcriptional activation domain. When the linker region is fused to a heterologous DNA-binding domain, it activates transcription. We show that the linker region physically interacts with p300. The adenovirus E1a protein, which binds to p300, inhibits the transcriptional activity of the linker region, and overexpression of p300 can rescue the linker-mediated transcriptional activation. In contrast, an adenovirus E1a mutant, which cannot bind to p300, does not inhibit the linker-mediated transcription. The native Smad3 protein lacking the linker region is unable to mediate TGF-β transcriptional activation responses, although it can be phosphorylated by the TGF-β receptor at the C-terminal tail and has a significantly increased ability to form a heteromeric complex with Smad4. We show further that the linker region and the C-terminal domain of Smad3 synergize for transcriptional activation in the presence of TGF-β. Thus our findings uncover an important function of the Smad3 linker region in Smad-mediated transcriptional control. PMID:15588252

The Smad3 linker region contains a transcriptional activation domain.

PubMed

Wang, Guannan; Long, Jianyin; Matsuura, Isao; He, Dongming; Liu, Fang

2005-02-15

Transforming growth factor-beta (TGF-beta)/Smads regulate a wide variety of biological responses through transcriptional regulation of target genes. Smad3 plays a key role in TGF-beta/Smad-mediated transcriptional responses. Here, we show that the proline-rich linker region of Smad3 contains a transcriptional activation domain. When the linker region is fused to a heterologous DNA-binding domain, it activates transcription. We show that the linker region physically interacts with p300. The adenovirus E1a protein, which binds to p300, inhibits the transcriptional activity of the linker region, and overexpression of p300 can rescue the linker-mediated transcriptional activation. In contrast, an adenovirus E1a mutant, which cannot bind to p300, does not inhibit the linker-mediated transcription. The native Smad3 protein lacking the linker region is unable to mediate TGF-beta transcriptional activation responses, although it can be phosphorylated by the TGF-beta receptor at the C-terminal tail and has a significantly increased ability to form a heteromeric complex with Smad4. We show further that the linker region and the C-terminal domain of Smad3 synergize for transcriptional activation in the presence of TGF-beta. Thus our findings uncover an important function of the Smad3 linker region in Smad-mediated transcriptional control.

Proline Kink Angle Distributions for GWALP23 in Lipid Bilayers of Different Thickness†

PubMed Central

Rankenberg, Johanna M.; Vostrikov, Vitaly V.; DuVall, Christopher D.; Greathouse, Denise V.; Koeppe, Roger E.; Grant, Christopher V.; Opella, Stanley J.

2013-01-01

By using selected 2H and 15N labels, we have examined the influence of a central proline residue upon the properties of a defined peptide that spans lipid bilayer membranes by solid-state NMR spectroscopy. For this purpose, GWALP23 (acetyl-GGALW5LALALALALALALW19LAGA-ethanolamide) is a suitable model peptide that employs—for the purpose of interfacial anchoring—only one tryptophan residue on either end of a central alpha-helical core sequence. Because of its systematic behavior in lipid bilayer membranes of differing thickness (see J. Biol. Chem. 285, 31723), we utilize GWALP23 as a well-characterized framework for introducing guest residues within a transmembrane sequence; for example, a central proline yields acetyl-GGALW5LALALAP12ALALALW19LAGA-ethanolamide. We synthesized the GWALP23-P12 with specifically placed 2H and 15N labels for solid-state NMR spectroscopy, and examined the peptide orientation and segmental tilt in oriented DMPC lipid bilayer membranes using combined (2H)-GALA and (15N-1H) high resolution separated local field methods. In DMPC bilayer membranes, the peptide segments N-terminal and C-terminal to the proline are both tilted substantially with respect to the bilayer normal, by about 34° and 29° (± 5°), respectively. While the tilt increases for both segments when proline is present, the range and extent of the individual segment motions are comparable or less than those of the entire GWALP23 peptide in bilayer membranes. In DMPC, the proline induces a kink of about 30° (± 5°), with an apparent helix unwinding or “swivel” angle of about 70°. In DLPC and DOPC, based on 2H NMR data only, the kink angle and swivel angle probability distributions overlap those of DMPC, yet the most probable kink angle appears somewhat smaller than in DMPC. As has been described for GWALP23 itself, the C-terminal helix ends before Ala-21 in the phospholipids DMPC and DLPC, yet remains intact through Ala-21 in DOPC. The dynamics of bilayer

Role of proline and pyrroline-5-carboxylate metabolism in plant defense against invading pathogens

PubMed Central

Qamar, Aarzoo; Mysore, Kirankumar S.; Senthil-Kumar, Muthappa

2015-01-01

Pyrroline-5-carboxylate (P5C) is an intermediate product of both proline biosynthesis and catabolism. Recent evidences indicate that proline-P5C metabolism is tightly regulated in plants, especially during pathogen infection and abiotic stress. However, role of P5C and its metabolism in plants has not yet been fully understood. Studies indicate that P5C synthesized in mitochondria has a role in both resistance (R)-gene-mediated and non-host resistance against invading pathogens. Proline dehydrogenase and delta-ornithine amino transferase-encoding genes, both involved in P5C synthesis in mitochondria are implicated in defense response of Nicotiana benthamiana and Arabidopsis thaliana against bacterial pathogens. Such defense response is proposed to involve salicylic acid-dependent pathway, reactive oxygen species (ROS) and hypersensitive response (HR)-associated cell death. Recently HR, a form of programmed cell death (PCD), has been proposed to be induced by changes in mitochondrial P5C synthesis or the increase in P5C levels per se in plants inoculated with either a host pathogen carrying suitable avirulent (Avr) gene or a non-host pathogen. Consistently, A. thaliana mutant plants deficient in P5C catabolism showed HR like cell death when grown in external P5C or proline supplemented medium. Similarly, yeast and plant cells under oxidative stress were shown to increase ROS production and PCD due to increase in P5C levels. Similar mechanism has also been reported as one of the triggers for apoptosis in mammalian cells. This review critically analyzes results from various studies and enumerates the pathways for regulation of P5C levels in the plant cell, especially in mitochondria, during pathogen infection. Further, mechanisms regulating P5C- mediated defense responses, namely HR are outlined. This review also provides new insights into the differential role of proline-P5C metabolism in plants exposed to pathogen infection. PMID:26217357

Intron-mediated alternative splicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation

PubMed Central

Kesari, Ravi; Lasky, Jesse R.; Villamor, Joji Grace; Des Marais, David L.; Chen, Ying-Jiun C.; Liu, Tzu-Wen; Juenger, Thomas E.; Verslues, Paul E.

2012-01-01

Drought-induced proline accumulation is widely observed in plants but its regulation and adaptive value are not as well understood. Proline accumulation of the Arabidopsis accession Shakdara (Sha) was threefold less than that of Landsberg erecta (Ler) and quantitative trait loci mapping identified a reduced function allele of the proline synthesis enzyme Δ1-pyrroline-5-carboxylate synthetase1 (P5CS1) as a basis for the lower proline of Sha. Sha P5CS1 had additional TA repeats in intron 2 and a G-to-T transversion in intron 3 that were sufficient to promote alternative splicing and production of a nonfunctional transcript lacking exon 3 (exon 3-skip P5CS1). In Sha, and additional accessions with the same intron polymorphisms, the nonfunctional exon 3-skip P5CS1 splice variant constituted as much as half of the total P5CS1 transcript. In a larger panel of Arabidopsis accessions, low water potential-induced proline accumulation varied by 10-fold and variable production of exon 3-skip P5CS1 among accessions was an important, but not the sole, factor underlying variation in proline accumulation. Population genetic analyses suggest that P5CS1 may have evolved under positive selection, and more extensive correlation of exon 3-skip P5CS1 production than proline abundance with climate conditions of natural accessions also suggest a role of P5CS1 in local adaptation to the environment. These data identify a unique source of alternative splicing in plants, demonstrate a role of exon 3-skip P5CS1 in natural variation of proline metabolism, and suggest an association of P5CS1 and its alternative splicing with environmental adaptation. PMID:22615385

Properties of a proline-containing glass ionomer dental cement.

PubMed

Ansari, Sahar; Moshaverinia, Maryam; Roohpour, Nima; Chee, Winston W L; Schricker, Scott R; Moshaverinia, Alireza

2013-11-01

Proline-containing glass ionomers are promising fast-set dental restorative materials with superior mechanical properties; however, little information is available on other physical properties of this type of glass ionomer. The objectives of this study were to synthesize and characterize a polyacrylic acid terpolymer containing proline derivative (PD) and to investigate the physical properties of this glass ionomer cement (GIC) and its cytotoxicity in vitro. A terpolymer of AA (acrylic acid), IA (itaconic acid), and proline derivative (MP) with an 8:1:1 molar ratio was synthesized and characterized. Experimental GIC specimens were made from the synthetized terpolymer with Fuji IX (GC America, Alsip, Ill) commercial glass ionomer powder as recommended by the manufacturer. Specimens were mixed and fabricated at room temperature and were conditioned in distilled water at 37°C for 1 day and 1 week. Vickers hardness was determined with a microhardness tester. The water sorption characteristics and fluoride releasing properties of the specimens were investigated. The in vitro cytotoxicity of the experimental glass ionomer was assessed by evaluating the C2C12 cell metabolism with methyltetrazolium (MTT) assay. Commercial Fuji IX was used as a control for comparison. The data obtained for the experimental GIC (PD) were compared with the control group by using 1- and 2-way ANOVA and the Tukey multiple range test at α=.05. Proline-modified GIC (PD) exhibited significantly higher surface hardness values (Vickers hardness number [VHN] 58 ±6.1) in comparison to Fuji IX GIC (VHN 47 ±5.3) after 1 week of maturation. Statistical analysis of data showed that the water sorption properties of the experimental cement (PD) were significantly greater than those of the control group (P<.05). The experimental GIC showed a significant increase in the amounts of initial fluoride release (P<.05) with continued fluoride release from the bulk of the material. The experimental group

Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

PubMed

Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

2015-03-01

Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

A carbon-rich region in Miller Range 091004 and implications for ureilite petrogenesis

NASA Astrophysics Data System (ADS)

Day, James M. D.; Corder, Christopher A.; Cartigny, Pierre; Steele, Andrew M.; Assayag, Nelly; Rumble, Douglas; Taylor, Lawrence A.

2017-02-01

Ureilite meteorites are partially melted asteroidal-peridotite residues, or more rarely, cumulates that can contain greater than three weight percent carbon. Here we describe an exceptional C-rich lithology, composed of 34 modal % large (up to 0.8 mm long) crystalline graphite grains, in the Antarctic ureilite meteorite Miller Range (MIL) 091004. This C-rich lithology is embedded within a silicate region composed dominantly of granular olivine with lesser quantities of low-Ca pyroxene, and minor FeNi metal, high-Ca pyroxene, spinel, schreibersite and troilite. Petrological evidence indicates that the graphite was added after formation of the silicate region and melt depletion. Associated with graphite is localized reduction of host olivine (Fo88-89) to nearly pure forsterite (Fo99), which is associated with FeNi metal grains containing up to 11 wt.% Si. The main silicate region is typical of ureilite composition, with highly siderophile element (HSE) abundances ∼0.3 × chondrite, 187Os/188Os of 0.1260-0.1262 and Δ17O of -0.81 ± 0.16‰. Mineral trace-element analyses reveal that the rare earth elements (REE) and the HSE are controlled by pyroxene and FeNi metal phases in the meteorite, respectively. Modeling of bulk-rock REE and HSE abundances indicates that the main silicate region experienced ∼6% silicate and >50% sulfide melt extraction, which is at the lower end of partial melt removal estimated for ureilites. Miller Range 091004 demonstrates heterogeneous distribution of carbon at centimeter scales and a limited range in Mg/(Mg + Fe) compositions of silicate grain cores, despite significant quantities of carbon. These observations demonstrate that silicate rim reduction was a rapid disequilibrium process, and came after silicate and sulfide melt removal in MIL 091004. The petrography and mineral chemistry of MIL 091004 is permissive of the graphite representing late-stage C-rich melt that pervaded silicates, or carbon that acted as a lubricant during

Molecular evolution and transcriptional regulation of the oilseed rape proline dehydrogenase genes suggest distinct roles of proline catabolism during development.

PubMed

Faës, Pascal; Deleu, Carole; Aïnouche, Abdelkader; Le Cahérec, Françoise; Montes, Emilie; Clouet, Vanessa; Gouraud, Anne-Marie; Albert, Benjamin; Orsel, Mathilde; Lassalle, Gilles; Leport, Laurent; Bouchereau, Alain; Niogret, Marie-Françoise

2015-02-01

Six BnaProDH1 and two BnaProDH2 genes were identified in Brassica napus genome. The BnaProDH1 genes are mainly expressed in pollen and roots' organs while BnaProDH2 gene expression is associated with leaf vascular tissues at senescence. Proline dehydrogenase (ProDH) catalyzes the first step in the catabolism of proline. The ProDH gene family in oilseed rape (Brassica napus) was characterized and compared to other Brassicaceae ProDH sequences to establish the phylogenetic relationships between genes. Six BnaProDH1 genes and two BnaProDH2 genes were identified in the B. napus genome. Expression of the three paralogous pairs of BnaProDH1 genes and the two homoeologous BnaProDH2 genes was measured by real-time quantitative RT-PCR in plants at vegetative and reproductive stages. The BnaProDH2 genes are specifically expressed in vasculature in an age-dependent manner, while BnaProDH1 genes are strongly expressed in pollen grains and roots. Compared to the abundant expression of BnaProDH1, the overall expression of BnaProDH2 is low except in roots and senescent leaves. The BnaProDH1 paralogs showed different levels of expression with BnaA&C.ProDH1.a the most strongly expressed and BnaA&C.ProDH1.c the least. The promoters of two BnaProDH1 and two BnaProDH2 genes were fused with uidA reporter gene (GUS) to characterize organ and tissue expression profiles in transformed B. napus plants. The transformants with promoters from different genes showed contrasting patterns of GUS activity, which corresponded to the spatial expression of their respective transcripts. ProDHs probably have non-redundant functions in different organs and at different phenological stages. In terms of molecular evolution, all BnaProDH sequences appear to have undergone strong purifying selection and some copies are becoming subfunctionalized. This detailed description of oilseed rape ProDH genes provides new elements to investigate the function of proline metabolism in plant development.

Actinomyces naeslundii Displays Variant fimP and fimA Fimbrial Subunit Genes Corresponding to Different Types of Acidic Proline-Rich Protein and β-Linked Galactosamine Binding Specificity

PubMed Central

Hallberg, K.; Holm, C.; Öhman, U.; Strömberg, N.

1998-01-01

Actinomyces naeslundii genospecies 1 and 2 bind to acidic proline-rich proteins (APRPs) and statherin via type 1 fimbriae and to β-linked galactosamine (GalNAcβ) structures via type 2 fimbriae. In addition, A. naeslundii displays two types of binding specificity for both APRPs-statherin and GalNAcβ, while Actinomyces odontolyticus binds to unknown structures. To study the molecular basis for these binding specificities, DNA fragments spanning the entire or central portions of fimP (type 1) and fimA (type 2) fimbrial subunit genes were amplified by PCR from strains of genospecies 1 and 2 and hybridized with DNA from two independent collections of oral Actinomyces isolates. Isolates of genospecies 1 and 2 and A. odontolyticus, but no other Actinomyces species, were positive for hybridization with fimP and fimA full-length probes irrespective of binding to APRPs and statherin, GalNAcβ, or unknown structures. Isolates of genospecies 1 and 2, with deviating patterns of GalNAcβ1-3Galα-O-ethyl-inhibitable coaggregation with Streptococcus oralis Ss34 and MPB1, were distinguished by a fimA central probe from genospecies 1 and 2, respectively. Furthermore, isolates of genospecies 1 and 2 displaying preferential binding to APRPs over statherin were positive with a fimP central probe, while a genospecies 2 strain with the opposite binding preference was not. The sequences of fimP and fimA central gene segments were highly conserved among isolates with the same, but diversified between those with a variant, binding specificity. In conclusion, A. naeslundii exhibits variant fimP and fimA genes corresponding to diverse APRP and GalNAcβ specificities, respectively, while A. odontolyticus has a genetically related but distinct adhesin binding specificity. PMID:9712794

Systematic Analysis of Intracellular-targeting Antimicrobial Peptides, Bactenecin 7, Hybrid of Pleurocidin and Dermaseptin, Proline-Arginine-rich Peptide, and Lactoferricin B, by Using Escherichia coli Proteome Microarrays.

PubMed

Ho, Yu-Hsuan; Shah, Pramod; Chen, Yi-Wen; Chen, Chien-Sheng

2016-06-01

Antimicrobial peptides (AMPs) act either through membrane lysis or by attacking intracellular targets. Intracellular targeting AMPs are a resource for antimicrobial agent development. Several AMPs have been identified as intracellular targeting peptides; however, the intracellular targets of many of these peptides remain unknown. In the present study, we used an Escherichia coli proteome microarray to systematically identify the protein targets of three intracellular targeting AMPs: bactenecin 7 (Bac7), a hybrid of pleurocidin and dermaseptin (P-Der), and proline-arginine-rich peptide (PR-39). In addition, we also included the data of lactoferricin B (LfcinB) from our previous study for a more comprehensive analysis. We analyzed the unique protein hits of each AMP in the Kyoto Encyclopedia of Genes and Genomes. The results indicated that Bac7 targets purine metabolism and histidine kinase, LfcinB attacks the transcription-related activities and several cellular carbohydrate biosynthetic processes, P-Der affects several catabolic processes of small molecules, and PR-39 preferentially recognizes proteins involved in RNA- and folate-metabolism-related cellular processes. Moreover, both Bac7 and LfcinB target purine metabolism, whereas LfcinB and PR-39 target lipopolysaccharide biosynthesis. This suggested that LfcinB and Bac7 as well as LfcinB and PR-39 have a synergistic effect on antimicrobial activity, which was validated through antimicrobial assays. Furthermore, common hits of all four AMPs indicated that all of them target arginine decarboxylase, which is a crucial enzyme for Escherichia coli survival in extremely acidic environments. Thus, these AMPs may display greater inhibition to bacterial growth in extremely acidic environments. We have also confirmed this finding in bacterial growth inhibition assays. In conclusion, this comprehensive identification and systematic analysis of intracellular targeting AMPs reveals crucial insights into the intracellular

Arginine and proline applied as food additives stimulate high freeze tolerance in larvae of Drosophila melanogaster.

PubMed

Koštál, Vladimír; Korbelová, Jaroslava; Poupardin, Rodolphe; Moos, Martin; Šimek, Petr

2016-08-01

The fruit fly Drosophila melanogaster is an insect of tropical origin. Its larval stage is evolutionarily adapted for rapid growth and development under warm conditions and shows high sensitivity to cold. In this study, we further developed an optimal acclimation and freezing protocol that significantly improves larval freeze tolerance (an ability to survive at -5°C when most of the freezable fraction of water is converted to ice). Using the optimal protocol, freeze survival to adult stage increased from 0.7% to 12.6% in the larvae fed standard diet (agar, sugar, yeast, cornmeal). Next, we fed the larvae diets augmented with 31 different amino compounds, administered in different concentrations, and observed their effects on larval metabolomic composition, viability, rate of development and freeze tolerance. While some diet additives were toxic, others showed positive effects on freeze tolerance. Statistical correlation revealed tight association between high freeze tolerance and high levels of amino compounds involved in arginine and proline metabolism. Proline- and arginine-augmented diets showed the highest potential, improving freeze survival to 42.1% and 50.6%, respectively. Two plausible mechanisms by which high concentrations of proline and arginine might stimulate high freeze tolerance are discussed: (i) proline, probably in combination with trehalose, could reduce partial unfolding of proteins and prevent membrane fusions in the larvae exposed to thermal stress (prior to freezing) or during freeze dehydration; (ii) both arginine and proline are exceptional among amino compounds in their ability to form supramolecular aggregates which probably bind partially unfolded proteins and inhibit their aggregation under increasing freeze dehydration. © 2016. Published by The Company of Biologists Ltd.

Role of oral nitrate in the nitrosation of ( UC)proline by conventional microflora and germ-free rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mallett, A.K.; Rowland, I.R.; Walters, D.G.

1985-11-01

The urinary excretion of N-nitroso-L-(U- UC)proline by conventional microflora and germ free rats was used to assess the role of the gut bacteria and oral nitrate in the endogenous formation of N-nitroso compounds. The formation of nitrosoproline was qualitatively similar in conventional and germfree rats suggesting no involvement of the intestinal flora in this reaction. Furthermore, nitrosamino acid production was similar following the administration of nitrate and (U- UC)proline or (U- UC)proline alone, demonstrating no involvement of exogenous nitrate under the conditions of the experiment. Dietary contamination with nitrate/nitrite was negligible. The results are consistent with the suggestion that nitrate/nitritemore » reserves in the body are important in the formation of nitrosoproline in vivo.« less

Durum wheat dehydrin (DHN-5) confers salinity tolerance to transgenic Arabidopsis plants through the regulation of proline metabolism and ROS scavenging system.

PubMed

Saibi, Walid; Feki, Kaouthar; Ben Mahmoud, Rihem; Brini, Faiçal

2015-11-01

The wheat dehydrin (DHN-5) gives birth to salinity tolerance to transgenic Arabidopsis plants by the regulation of proline metabolism and the ROS scavenging system. Dehydrins (DHNs) are involved in plant abiotic stress tolerance. In this study, we reported that salt tolerance of transgenic Arabidopsis plants overexpressing durum wheat dehydrin (DHN-5) was closely related to the activation of the proline metabolism enzyme (P5CS) and some antioxidant biocatalysts. Indeed, DHN-5 improved P5CS activity in the transgenic plants generating a significant proline accumulation. Moreover, salt tolerance of Arabidopsis transgenic plants was accompanied by an excellent activation of antioxidant enzymes like catalase (CAT), superoxide dismutase (SOD) and peroxide dismutase (POD) and generation of a lower level of hydrogen peroxide (H2O2) in leaves compared to the wild-type plants. The enzyme activities were enhanced in these transgenic plants in the presence of exogenous proline. Nevertheless, proline accumulation was slightly reduced in transgenic plants promoting chlorophyll levels. All these results suggest the crucial role of DHN-5 in response to salt stress through the activation of enzymes implicated in proline metabolism and in ROS scavenging enzymes.

Nucleotide sequence of the Saccharomyces cerevisiae PUT4 proline-permease-encoding gene: similarities between CAN1, HIP1 and PUT4 permeases.

PubMed

Vandenbol, M; Jauniaux, J C; Grenson, M

1989-11-15

The complete nucleotide (nt) sequence of the PUT4 gene, whose product is required for high-affinity proline active transport in the yeast Saccharomyces cerevisiae, is presented. The sequence contains a single long open reading frame of 1881 nt, encoding a polypeptide with a calculated Mr of 68,795. The predicted protein is strongly hydrophobic and exhibits six potential glycosylation sites. Its hydropathy profile suggests the presence of twelve membrane-spanning regions flanked by hydrophilic N- and C-terminal domains. The N terminus does not resemble signal sequences found in secreted proteins. These features are characteristic of integral membrane proteins catalyzing translocation of ligands across cellular membranes. Protein sequence comparisons indicate strong resemblance to the arginine and histidine permeases of S. cerevisiae, but no marked sequence similarity to the proline permease of Escherichia coli or to other known prokaryotic or eukaryotic transport proteins. The strong similarity between the three yeast amino acid permeases suggests a common ancestor for the three proteins.

δ(15) N from soil to wine in bulk samples and proline.

PubMed

Paolini, Mauro; Ziller, Luca; Bertoldi, Daniela; Bontempo, Luana; Larcher, Roberto; Nicolini, Giorgio; Camin, Federica

2016-09-01

The feasibility of using δ(15) N as an additional isotopic marker able to link wine to its area of origin was investigated. The whole production chain (soil-leaves-grape-wine) was considered. Moreover, the research included evaluation of the effect of the fermentation process, the use of different types of yeast and white and red vinification, the addition of nitrogen adjuvants and ultrasound lysis simulating wine ageing. The δ(15) N of grapes and wine was measured in bulk samples and compounds, specifically in proline, for the first time. Despite isotopic fractionation from soil to wine, the δ(15) N values of leaves, grapes, wine and particularly must and wine proline conserved the variability of δ(15) N in the growing soil. Fermentation and ultrasound treatment did not affect the δ(15) N values of grape must, which was therefore conserved in wine. The addition of inorganic or organic adjuvants was able to influence the δ(15) N of bulk wine, depending on the amount and the difference between the δ(15) N of must and that of the adjuvant. The δ(15) N of wine proline was not influenced by adjuvant addition and is therefore the best marker for tracing the geographical origin of wine. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Proline-linked nitrosoureas as prolidase-convertible prodrugs in human breast cancer cells.

PubMed

Bielawski, Krzysztof; Bielawska, Anna; Słodownik, Tomasz; Bołkun-Skórnicka, Urszula; Muszyńska, Anna

2008-01-01

A number of novel proline-linked nitrosoureas (1-4) were synthesized and examined for cytotoxicity and influence on DNA and collagen biosynthesis in MDA-MB-231 and MCF-7 human breast cancer cells. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [(3)H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that compound 2, the most active of the series, proved to be only slightly less potent than carmustine. It has also been found that carmustine did not inhibit MCF&-7 cells prolidase activity, while compounds 1-4 significantly increased its activity, when used at 50-250 microM concentrations. Proline-linked nitrosoureas (1-4) also had lower ability to inhibit collagen biosynthesis in MCF-7 cells, compared to carmustine. The expression of beta(1)-integrin receptor and phosphorylated MAPK, ERK(1) and ERK(2) was significantly decreased in MCF-7 cells incubated for 24 h with 60 microM of compounds 2 and 4 compared to the control, untreated cells, whereas under the same conditions carmustine did not evoke any changes in expression of all these signaling proteins, as shown by Western immunoblot analysis. These results indicate the proline-linked nitrosoureas (1-4), represent multifunctional inhibitors of breast cancer cell growth and metabolism.

Variability in Proline-Accumulating Ability of Barley (Hordeum vulgare L.) Cultivars Induced by Vapor Pressure Deficit 1

PubMed Central

Naidu, Bodapati P.; Aspinall, Donald; Paleg, Leslie G.

1992-01-01

This work was undertaken in an effort to reconcile the conflicting proline-accumulating responses of the barley (Hordeum vulgare L.) cultivars, Excelsior and Proctor, reported by Singh et al. (1972) and Hanson et al. (1976). It deals with the effects of different vapor pressure deficits (VPD) during growth and subsequent drought stress on several barley cultivars. A higher VPD (1.2 kilopascals) during Clipper seedling growth resulted in higher solute-accumulating ability, seemingly independently of leaf water potential, than a lower VPD (0.12 kilopascals). The higher VPD during stress also resulted in higher solute contents, and this response may be more closely related to leaf water potential. When the responses of Excelsior and Proctor were examined in detail, it was found that the relative proline-accumulating ability of the two cultivars was dependent upon the VPD under which they were grown. At low VPD, Proctor accumulated significantly more proline than did Excelsior; whereas at higher VPD, Excelsior accumulated more proline than did Proctor. The crossover occurred at a VPD of about 0.72 kilopascals. This reversal of cultivar response was enhanced by multiplying seed under the two VPD extremes. Glycinebetaine accumulation did not demonstrate the crossover effect, although the concentration of this compound in all cultivars also depended on the VPD prevailing during growth and/or stress. Solute levels, in general, were more closely related to the decrease in relative water content than to a decrease in leaf water potential. It is concluded that the conflicting proline-accumulating responses of Excelsior and Proctor could be explained by these findings. PMID:16668700

WHY IS A FLARE-RICH ACTIVE REGION CME-POOR?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Lijuan; Wang, Yuming; Shen, Chenglong

Solar active regions (ARs) are the major sources of two of the most violent solar eruptions, namely flares and coronal mass ejections (CMEs). The largest AR in the past 24 years, NOAA AR 12192, which crossed the visible disk from 2014 October 17 to 30, unusually produced more than one hundred flares, including 32 M-class and 6 X-class ones, but only one small CME. Flares and CMEs are believed to be two phenomena in the same eruptive process. Why is such a flare-rich AR so CME-poor? We compared this AR with other four ARs; two were productive in both andmore » two were inert. The investigation of the photospheric parameters based on the SDO /HMI vector magnetogram reveals that the flare-rich AR 12192, as with the other two productive ARs, has larger magnetic flux, current, and free magnetic energy than the two inert ARs but, in contrast to the two productive ARs, it has no strong, concentrated current helicity along both sides of the flaring neutral line, indicating the absence of a mature magnetic structure consisting of highly sheared or twisted field lines. Furthermore, the decay index above the AR 12192 is relatively low, showing strong constraint. These results suggest that productive ARs are always large and have enough current and free energy to power flares, but whether or not a flare is accompanied by a CME is seemingly related to (1) the presence of a mature sheared or twisted core field serving as the seed of the CME, or (2) a weak enough constraint of the overlying arcades.« less

Quantifying Additive Interactions of the Osmolyte Proline with Individual Functional Groups of Proteins: Comparisons with Urea and Glycine Betaine, Interpretation of m-Values

PubMed Central

Diehl, Roger C.; Guinn, Emily J.; Capp, Michael W.; Tsodikov, Oleg V.; Record, M. Thomas

2013-01-01

To quantify interactions of the osmolyte L-proline with protein functional groups and predict its effects on protein processes, we use vapor pressure osmometry to determine chemical potential derivatives dµ2/dm3 = µ23 quantifying preferential interactions of proline (component 3) with 21 solutes (component 2) selected to display different combinations of aliphatic or aromatic C, amide, carboxylate, phosphate or hydroxyl O, and/or amide or cationic N surface. Solubility data yield µ23 values for 4 less-soluble solutes. Values of µ23 are dissected using an ASA-based analysis to test the hypothesis of additivity and obtain α-values (proline interaction potentials) for these eight surface types and three inorganic ions. Values of µ23 predicted from these α-values agree with experiment, demonstrating additivity. Molecular interpretation of α-values using the solute partitioning model yields partition coefficients (Kp) quantifying the local accumulation or exclusion of proline in the hydration water of each functional group. Interactions of proline with native protein surface and effects of proline on protein unfolding are predicted from α-values and ASA information and compared with experimental data, with results for glycine betaine and urea, and with predictions from transfer free energy analysis. We conclude that proline stabilizes proteins because of its unfavorable interactions with (exclusion from) amide oxygens and aliphatic hydrocarbon surface exposed in unfolding, and that proline is an effective in vivo osmolyte because of the osmolality increase resulting from its unfavorable interactions with anionic (carboxylate and phosphate) and amide oxygens and aliphatic hydrocarbon groups on the surface of cytoplasmic proteins and nucleic acids. PMID:23909383

Structure Of Neutron-Rich Nuclei In A˜100 Region Observed In Fusion-Fission Reactions

NASA Astrophysics Data System (ADS)

Wu, C. Y.; Hua, H.; Cline, D.; Hayes, A. B.; Teng, R.; Clark, R. M.; Fallon, P.; Görgen, A.; Macchiavelli, A. O.; Vetter, K.

2003-03-01

Neutron-rich nuclei around A˜100 were populated as fission fragments produced by the 238U(α,f) fusion-fission reaction. The deexcitation γ rays were detected by Gammasphere in coincidence with the detection of both fission fragments by the Rochester 4π heavy-ion detector array, CHICO. This technique allows Doppler-shift corrections to be applied for the observed γ rays on an event-by-event basis thus establishing the origin of γ rays from either fission fragment. In addition, it allows observation of γ-ray transitions from states with short lifetimes and offers the opportunity to study nuclear species beyond the reach of the spontaneous fission process. With these advantages, one can extend the spectroscopic study to higher spins than those derived using the thick-target technique, and to more neutron-rich nuclei than those derived from spontaneous fissions. Among the new and interesting phenomena identified in this rapid shape-changing region, the most distinct result is the evidence for a prolate-to-oblate shape transition occurring at 116Pd, which may have important implications to our understanding of the shell structure for neutron-rich nuclei.

Proline kink angle distributions for GWALP23 in lipid bilayers of different thicknesses.

PubMed

Rankenberg, Johanna M; Vostrikov, Vitaly V; DuVall, Christopher D; Greathouse, Denise V; Koeppe, Roger E; Grant, Christopher V; Opella, Stanley J

2012-05-01

By using selected (2)H and (15)N labels, we have examined the influence of a central proline residue on the properties of a defined peptide that spans lipid bilayer membranes by solid-state nuclear magnetic resonance (NMR) spectroscopy. For this purpose, GWALP23 (acetyl-GGALW(5)LALALALALALALW(19)LAGA-ethanolamide) is a suitable model peptide that employs, for the purpose of interfacial anchoring, only one tryptophan residue on either end of a central α-helical core sequence. Because of its systematic behavior in lipid bilayer membranes of differing thicknesses [Vostrikov, V. V., et al. (2010) J. Biol. Chem. 285, 31723-31730], we utilize GWALP23 as a well-characterized framework for introducing guest residues within a transmembrane sequence; for example, a central proline yields acetyl-GGALW(5)LALALAP(12)ALALALW(19)LAGA-ethanolamide. We synthesized GWALP23-P12 with specifically placed (2)H and (15)N labels for solid-state NMR spectroscopy and examined the peptide orientation and segmental tilt in oriented DMPC lipid bilayer membranes using combined (2)H GALA and (15)N-(1)H high-resolution separated local field methods. In DMPC bilayer membranes, the peptide segments N-terminal and C-terminal to the proline are both tilted substantially with respect to the bilayer normal, by ~34 ± 5° and 29 ± 5°, respectively. While the tilt increases for both segments when proline is present, the range and extent of the individual segment motions are comparable to or smaller than those of the entire GWALP23 peptide in bilayer membranes. In DMPC, the proline induces a kink of ~30 ± 5°, with an apparent helix unwinding or "swivel" angle of ~70°. In DLPC and DOPC, on the basis of (2)H NMR data only, the kink angle and swivel angle probability distributions overlap those of DMPC, yet the most probable kink angle appears to be somewhat smaller than in DMPC. As has been described for GWALP23 itself, the C-terminal helix ends before Ala(21) in the phospholipids DMPC and DLPC yet

Cold and desiccation stress induced changes in the accumulation and utilization of proline and trehalose in seasonal populations of Drosophila immigrans.

PubMed

Tamang, Aditya Moktan; Kalra, Bhawna; Parkash, Ravi

2017-01-01

Changes in the levels of energy metabolites can limit survival ability of Drosophila species under stressful conditions but this aspect has received less attention in wild populations collected in different seasons. We tested cold or desiccation triggered changes in the accumulation or utilization of two energy metabolites (trehalose and proline) in Drosophila immigrans flies reared under season specific environmental conditions. Such D.immigrans populations were subjected to different durations of cold (0°C) or desiccation stress (5% RH) or dual stress. We found stress induced effects of cold vs desiccation on the levels of trehalose as well as for proline. Different durations of cold stress led to accumulation of trehalose while desiccation stress durations revealed utilization of trehalose. In contrast, there was accumulation of proline under desiccation and utilization of proline with cold stress. Since accumulation levels were higher than utilization of each energy metabolite, the effects of dual stress showed additive effect. However, there was no utilization of total body lipids under cold or desiccation stress. We observed significant season specific differences in the amount of energy metabolites but the rate of metabolism did not vary across seasons. Stress triggered changes in trehalose and proline suggest possible link between desiccation and cold tolerance. Finally, stress specific (cold or desiccation) compensatory changes in the levels of trehalose and proline suggest possible energetic homeostasis in D.immigrans living under harsh climatic conditions of montane localities. Copyright © 2016 Elsevier Inc. All rights reserved.

Structure of the cyclic peptide [W8S]contryphan Vn: effect of the tryptophan/serine substitution on trans-cis proline isomerization.

PubMed

Nepravishta, Ridvan; Mandaliti, Walter; Melino, Sonia; Eliseo, Tommaso; Paci, Maurizio

2014-12-01

The structural characterization of [W8S]contryphan Vn, an analogue of Contryphan Vn with tryptophan 8 substituted with a serine residue (W8S), was performed by NMR spectroscopy, molecular dynamics simulations and fluorescence spectroscopy. Contryphan Vn, a bioactive cyclic peptide from the venom of the cone snail Conus ventricosus, contains an S-S bridge between two cysteines and a D-tryptophan. Like other Contryphans, [W8S]contryphan Vn has proline 7 isomerized trans, while the proline 4 has nearly equivalent populations of cis and trans configurations. The thermodynamic and kinetic parameters of the trans-cis isomerization of proline 4 were measured. The isomers of [W8S]contryphan Vn with proline 4 in cis and trans show structural differences. The absence of the salt bridge between the same Asp2 and Lys6, present in Contryphan Vn, may be attributed to the lack of the hydrophobic side chain of Trp8 where it likely protects the electrostatic interactions. These results may contribute to identifying, in these cyclic peptides, the structural determinants of the mechanism of proline trans-cis isomerization, this being also an important step in protein folding.

Development of a simple fluorescence-based microplate method for the high-throughput analysis of proline in wine samples.

PubMed

Robert-Peillard, Fabien; Boudenne, Jean-Luc; Coulomb, Bruno

2014-05-01

This paper presents a simple, accurate and multi-sample method for the determination of proline in wines thanks to a 96-well microplate technique. Proline is the most abundant amino acid in wine and is an important parameter related to wine characteristics or maturation processes of grape. In the current study, an improved application of the general method based on sodium hypochlorite oxidation and o-phthaldialdehyde (OPA)-thiol spectrofluorometric detection is described. The main interfering compounds for specific proline detection in wines are strongly reduced by selective reaction with OPA in a preliminary step under well-defined pH conditions. Application of the protocol after a 500-fold dilution of wine samples provides a working range between 0.02 and 2.90gL(-1), with a limit of detection of 7.50mgL(-1). Comparison and validation on real wine samples by ion-exchange chromatography prove that this procedure yields accurate results. Simplicity of the protocol used, with no need for centrifugation or filtration, organic solvents or high temperature enables its full implementation in plastic microplates and efficient application for routine analysis of proline in wines. Copyright © 2013 Elsevier Ltd. All rights reserved.

The aberrant cell walls of boron-deficient bean root nodules have no covalently bound hydroxyproline-/proline-rich proteins.

PubMed Central

Bonilla, I; Mergold-Villaseñor, C; Campos, M E; Sánchez, N; Pérez, H; López, L; Castrejón, L; Sánchez, F; Cassab, G I

1997-01-01

B-deficient bean (Phaseolus vulgaris L.) nodules examined by light microscopy showed dramatic anatomical changes, mainly in the parenchyma region. Western analysis of total nodule extracts examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis showed that one 116-kD polypeptide was recognized by antibodies raised against hydroxyproline-rich glycoproteins (HRGPs) from the soybean (Glycine max) seed coat. A protein with a comparable molecular mass of 116 kD was purified from the cell walls of soybean root nodules. The amino acid composition of this protein is similar to the early nodulin (ENOD2) gene. Immunoprecipitation of the soybean ENOD2 in vitro translation product showed that the soybean seed coat anti-HRGP antibodies recognized this early nodulin. Furthermore, we used these antibodies to localize the ENOD2 homolog in bean nodules. Immunocytochemistry revealed that in B-deficient nodules ENOD2 was absent in the walls of the nodule parenchyma. The absence of ENOD2 in B-deficient nodules was corroborated by performing hydroxyproline assays. Northern analysis showed that ENOD2 mRNA is present in B-deficient nodules; therefore, the accumulation of ENOD2 is not affected by B deficiency, but its assembly into the cell wall is. B-deficient nodules fix much less N2 than control nodules, probably because the nodule parenchyma is no longer an effective O2 barrier. PMID:9414547

Discovery and SAR studies of methionine-proline anilides as dengue virus NS2B-NS3 protease inhibitors.

PubMed

Zhou, Guo-Chun; Weng, Zhibing; Shao, Xiaoxia; Liu, Fang; Nie, Xin; Liu, Jinsong; Wang, Decai; Wang, Chunguang; Guo, Kai

2013-12-15

A series of methionine-proline dipeptide derivatives and their analogues were designed, synthesized and assayed against the serotype 2 dengue virus NS2B-NS3 protease, and methionine-proline anilides 1 and 2 were found to be the most active DENV 2 NS2B-NS3 competitive inhibitors with Ki values of 4.9 and 10.5 μM. The structure and activity relationship and the molecular docking revealed that L-proline, L-methionine and p-nitroaniline in 1 and 2 are the important characters in blocking the active site of NS2B-NS3 protease. Our current results suggest that the title dipeptidic scaffold represents a promising structural core to discover a new class of active NS2B-NS3 competitive inhibitors. Copyright © 2013 Elsevier Ltd. All rights reserved.

l-Proline Accumulation and Freeze Tolerance in Saccharomyces cerevisiae Are Caused by a Mutation in the PRO1 Gene Encoding γ-Glutamyl Kinase

PubMed Central

Morita, Yuko; Nakamori, Shigeru; Takagi, Hiroshi

2003-01-01

We previously isolated a mutant which showed a high tolerance to freezing that correlated with higher levels of intracellular l-proline derived from l-proline analogue-resistant mutants. The mutation responsible for the analogue resistance and l-proline accumulation was a single nuclear dominant mutation. By introducing the mutant-derived genomic library into a non-l-proline-utilizing strain, the mutant was found to carry an allele of the wild-type PRO1 gene encoding γ-glutamyl kinase, which resulted in a single amino acid replacement; Asp (GAC) at position 154 was replaced by Asn (AAC). Interestingly, the allele of PRO1 was shown to enhance the activities of γ-glutamyl kinase and γ-glutamyl phosphate reductase, both of which catalyze the first two steps of l-proline synthesis from l-glutamate and which together may form a complex in vivo. When cultured in liquid minimal medium, yeast cells expressing the mutated γ-glutamyl kinase were found to accumulate intracellular l-proline and showed a prominent increase in cell viability after freezing at −20°C compared to the viability of cells harboring the wild-type PRO1 gene. These results suggest that the altered γ-glutamyl kinase results in stabilization of the complex or has an indirect effect on γ-glutamyl phosphate reductase activity, which leads to an increase in l-proline production in Saccharomyces cerevisiae. The approach described in this paper could be a practical method for breeding novel freeze-tolerant yeast strains. PMID:12513997

AoS28D, a proline-Xaa carboxypeptidase secreted by Aspergillus oryzae.

PubMed

Salamin, Karine; Eugster, Philippe J; Jousson, Olivier; Waridel, Patrice; Grouzmann, Eric; Monod, Michel

2017-05-01

Prolyl peptidases of the MEROPS S28 family are of particular interest because they are key enzymes in the digestion of proline-rich peptides. A BLAST analysis of the Aspergillus oryzae genome revealed sequences coding for four proteases of the S28 family. Three of these proteases, AoS28A, AoS28B, and AoS28C, were previously characterized as acidic prolyl endopeptidases. The fourth protease, AoS28D, showed high sequence divergence with other S28 proteases and belongs to a phylogenetically distinct cluster together with orthologous proteases from other Aspergillus species. The objective of the present paper was to characterize AoS28D protease in terms of substrate specificity and activity. AoS28D produced by gene overexpression in A. oryzae and in Pichia pastoris was a 70-kDa glycoprotein with a 10-kDa sugar moiety. In contrast with other S28 proteases, AoS28D did not hydrolyze internal Pro-Xaa bonds of several tested peptides. Similarly, to human lysosomal Pro-Xaa carboxypeptidase, AoS28D demonstrated selectivity for cleaving C-terminal Pro-Xaa bonds which are resistant to carboxypeptidases of the S10 family concomitantly secreted by A. oryzae. Therefore, AoS28D could act in synergy with these enzymes during sequential degradation of a peptide from its C-terminus.

Use of proline mutants to help solve the NMR solution structure of type III antifreeze protein.

PubMed Central

Chao, H.; Davies, P. L.; Sykes, B. D.; Sönnichsen, F. D.

1993-01-01

To help understand the structure/function relationships in antifreeze proteins (AFP), and to define the motifs required for ice binding, a Type III AFP suitable for two-dimensional (2D) NMR studies was produced in Escherichia coli. A synthetic gene for one of the Type III AFP isoforms was assembled in a T7 polymerase-directed expression vector. The 67-amino acid-long gene product differed from the natural AFP by inclusion of an N-terminal methionine but was indistinguishable in activity. The NMR spectra of this AFP were complicated by cis-trans proline isomerization from the C-terminal sequence YPPA. Substitution of this sequence by YAA eliminated isomer signals without altering the activity or structure of the mutant AFP. This variant (rQAE m1.1) was selected for sequential assignment and the secondary structure determination using 2D 1H NMR spectroscopy. Nine beta-strands are paired to form two triple-stranded antiparallel sheets and one double-stranded antiparallel sheet. Two further proline replacements, P29A and P33A, were made to delineate the role of conserved prolines in Type III AFP. These mutants were valuable in clarifying ambiguous NMR spectral assignments amongst the remaining six prolines of rQAE m1.1. In contrast to the replacement of the C-terminal prolyl residues, the exchange of P29 and P33 caused some structural changes and significantly decreased protein solubility and antifreeze activity. PMID:8401227

Identification and Disruption of the proBA Locus in Listeria monocytogenes: Role of Proline Biosynthesis in Salt Tolerance and Murine Infection

PubMed Central

Sleator, Roy D.; Gahan, Cormac G. M.; Hill, Colin

2001-01-01

Intracellular accumulation of the amino acid proline has previously been linked to the salt tolerance and virulence potential of a number of bacteria. Taking advantage of the proBA mutant Escherichia coli CSH26, we identified a listerial proBA operon coding for enzymes functionally similar to the glutamyl kinase (GK) and glutamylphosphate reductase (GPR) enzyme complex which catalyzes the first and second steps of proline biosynthesis in E. coli. The first gene of the operon, proB, is predicted to encode GK, a 276-residue protein with a calculated molecular mass of 30.03 kDa and pl of 5.2. Distal to the promoter and overlapping the 3′ end of proB by 17 bp is proA, which encodes GPR, a 415-residue protein with a calculated molecular mass of 45.50 kDa (pl 5.3). Using this information, we created a chromosomal deletion mutant by allelic exchange which is auxotrophic for proline. This mutant was used to assess the contribution of proline anabolism to osmotolerance and virulence. While inactivation of proBA had no significant effect on virulence in mouse assays (either perorally or intraperitoneally), growth at low (2 to 4% NaCl) and high (>6% NaCl) salt concentrations in complex media was significantly reduced in the absence of efficient proline synthesis. We conclude that while proline biosynthesis plays little, if any, role in the intracellular life cycle and infectious nature of Listeria monocytogenes, it can play an important role in survival in osmolyte-depleted environments of elevated osmolarity. PMID:11375165

Identification of Trans-4-Hydroxy-L-Proline as a Compatible Solute and Its Biosynthesis and Molecular Characterization in Halobacillus halophilus.

PubMed

Kim, Kyung Hyun; Jia, Baolei; Jeon, Che Ok

2017-01-01

Halobacillus halophilus , a moderately halophilic bacterium, accumulates a variety of compatible solutes including glycine betaine, glutamate, glutamine, proline, and ectoine to cope with osmotic stress. Non-targeted analysis of intracellular organic compounds using 1 H-NMR showed that a large amount of trans-4-hydroxy-L-proline (Hyp), which has not been reported as a compatible solute in H. halophilus , was accumulated in response to high NaCl salinity, suggesting that Hyp may be an important compatible solute in H. halophilus . Candidate genes encoding proline 4-hydroxylase (PH-4), which hydroxylates L-proline to generate Hyp, were retrieved from the genome of H. halophilus through domain searches based on the sequences of known PH-4 proteins. A gene, HBHAL_RS11735, which was annotated as a multidrug DMT transporter permease in GenBank, was identified as the PH-4 gene through protein expression analysis in Escherichia coli . The PH-4 gene constituted a transcriptional unit with a promoter and a rho-independent terminator, and it was distantly located from the proline biosynthetic gene cluster ( pro operon). Transcriptional analysis showed that PH-4 gene expression was NaCl concentration-dependent, and was specifically induced by chloride anion, similar to the pro operon. Accumulation of intracellular Hyp was also observed in other bacteria, suggesting that Hyp may be a widespread compatible solute in halophilic and halotolerant bacteria.

Identification of Trans-4-Hydroxy-L-Proline as a Compatible Solute and Its Biosynthesis and Molecular Characterization in Halobacillus halophilus

PubMed Central

Kim, Kyung Hyun; Jia, Baolei; Jeon, Che Ok

2017-01-01

Halobacillus halophilus, a moderately halophilic bacterium, accumulates a variety of compatible solutes including glycine betaine, glutamate, glutamine, proline, and ectoine to cope with osmotic stress. Non-targeted analysis of intracellular organic compounds using 1H-NMR showed that a large amount of trans-4-hydroxy-L-proline (Hyp), which has not been reported as a compatible solute in H. halophilus, was accumulated in response to high NaCl salinity, suggesting that Hyp may be an important compatible solute in H. halophilus. Candidate genes encoding proline 4-hydroxylase (PH-4), which hydroxylates L-proline to generate Hyp, were retrieved from the genome of H. halophilus through domain searches based on the sequences of known PH-4 proteins. A gene, HBHAL_RS11735, which was annotated as a multidrug DMT transporter permease in GenBank, was identified as the PH-4 gene through protein expression analysis in Escherichia coli. The PH-4 gene constituted a transcriptional unit with a promoter and a rho-independent terminator, and it was distantly located from the proline biosynthetic gene cluster (pro operon). Transcriptional analysis showed that PH-4 gene expression was NaCl concentration-dependent, and was specifically induced by chloride anion, similar to the pro operon. Accumulation of intracellular Hyp was also observed in other bacteria, suggesting that Hyp may be a widespread compatible solute in halophilic and halotolerant bacteria. PMID:29104571

Evidence for Reduced, Carbon-rich Regions in the Solar Nebula from an Unusual Cometary Dust Particle

NASA Astrophysics Data System (ADS)

De Gregorio, Bradley T.; Stroud, Rhonda M.; Nittler, Larry R.; Kilcoyne, A. L. David

2017-10-01

Geochemical indicators in meteorites imply that most formed under relatively oxidizing conditions. However, some planetary materials, such as the enstatite chondrites, aubrite achondrites, and Mercury, were produced in reduced nebular environments. Because of large-scale radial nebular mixing, comets and other Kuiper Belt objects likely contain some primitive material related to these reduced planetary bodies. Here, we describe an unusual assemblage in a dust particle from comet 81P/Wild 2 captured in silica aerogel by the NASA Stardust spacecraft. The bulk of this ˜20 μm particle is comprised of an aggregate of nanoparticulate Cr-rich magnetite, containing opaque sub-domains composed of poorly graphitized carbon (PGC). The PGC forms conformal shells around tiny 5-15 nm core grains of Fe carbide. The C, N, and O isotopic compositions of these components are identical within errors to terrestrial standards, indicating a formation inside the solar system. Magnetite compositions are consistent with oxidation of reduced metal, similar to that seen in enstatite chondrites. Similarly, the core-shell structure of the carbide + PGC inclusions suggests a formation via FTT reactions on the surface of metal or carbide grains in warm, reduced regions of the solar nebula. Together, the nanoscale assemblage in the cometary particle is most consistent with the alteration of primary solids condensed from a C-rich, reduced nebular gas. The nanoparticulate components in the cometary particle provide the first direct evidence from comets of reduced, carbon-rich regions that were present in the solar nebula.

Primary afferent depolarization and changes in extracellular potassium concentration induced by L-glutamate and L-proline in the isolated spinal cord of the frog.

PubMed

Vyklický, L; Vyskocil, F; Kolaj, M; Jastreboff, P

1982-10-08

To test the hypothesis that L-proline acts as an antagonist on glutamate receptors [17, 18], the interaction between L-glutamate and L-proline was studied in the isolated spinal cord of the frog. Glutamate at concentrations of 10(-6) -5 x 10(-3) mol/l depolarized the primary afferent fibres and increased extracellular potassium concentration, [K+]e, by 0.3-4 mmol/l. Repeated applications lead to inactivation of the response. L-Proline at 5 x 10(-3) -10(-2) mol/l, also depolarized the primary afferents and increased [K+]e by 0.5-2 mmol/l, but there was only a slight decrease of the effects after repeated application. The effects were additive when the amino acids were applied simultaneously. The effect of L-proline was still present when it was applied during inactivation of the glutamate receptors. This suggests that L-glutamate and L-proline act on different receptors.

Ribosomal L1 domain and lysine-rich region are essential for CSIG/ RSL1D1 to regulate proliferation and senescence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma, Liwei; Zhao, Wenting; Zheng, Quanhui

2016-01-15

The expression change of cellular senescence-associated genes is underlying the genetic foundation of cellular senescence. Using a suppressive subtractive hybridization system, we identified CSIG (cellular senescence-inhibited gene protein; RSL1D1) as a novel senescence-associated gene. CSIG is implicated in various process including cell cycle regulation, apoptosis, and tumor metastasis. We previously showed that CSIG plays an important role in regulating cell proliferation and cellular senescence progression through inhibiting PTEN, however, which domain or region of CSIG contributes to this function? To clarify this question, we investigated the functional importance of ribosomal L1 domain and lysine (Lys) -rich region of CSIG. Themore » data showed that expression of CSIG potently reduced PTEN expression, increased cell proliferation rates, and reduced the senescent phenotype (lower SA-β-gal activity). By contrast, neither the expression of CSIG N- terminal (NT) fragment containing the ribosomal L1 domain nor C-terminal (CT) fragment containing Lys-rich region could significantly altered the levels of PTEN; instead of promoting cell proliferation and delaying cellular senescence, expression of CSIG-NT or CSIG-CT inhibited cell proliferation and accelerated cell senescence (increased SA-β-gal activity) compared to either CSIG over-expressing or control (empty vector transfected) cells. The further immunofluorescence analysis showed that CSIG-CT and CSIG-NT truncated proteins exhibited different subcellular distribution with that of wild-type CSIG. Conclusively, both ribosomal L1 domain and Lys-rich region of CSIG are critical for CSIG to act as a regulator of cell proliferation and cellular senescence. - Highlights: • The ribosomal L1 domain and lysine-rich region of CSIG were expressed. • They are critical for CSIG to regulate proliferation and senescence. • CSIG and its domains exhibit different subcellular distribution.« less

Selective CB2 receptor agonists. Part 2: Structure-activity relationship studies and optimization of proline-based compounds.

PubMed

Riether, Doris; Zindell, Renee; Wu, Lifen; Betageri, Raj; Jenkins, James E; Khor, Someina; Berry, Angela K; Hickey, Eugene R; Ermann, Monika; Albrecht, Claudia; Ceci, Angelo; Gemkow, Mark J; Nagaraja, Nelamangala V; Romig, Helmut; Sauer, Achim; Thomson, David S

2015-02-01

Through a ligand-based pharmacophore model (S)-proline based compounds were identified as potent cannabinoid receptor 2 (CB2) agonists with high selectivity over the cannabinoid receptor 1 (CB1). Structure-activity relationship investigations for this compound class lead to oxo-proline compounds 21 and 22 which combine an impressive CB1 selectivity profile with good pharmacokinetic properties. In a streptozotocin induced diabetic neuropathy model, 22 demonstrated a dose-dependent reversal of mechanical hyperalgesia. Copyright © 2014 Elsevier Ltd. All rights reserved.

L-proline-based deep eutectic solvents (DESs) for deep catalytic oxidative desulfurization (ODS) of diesel.

PubMed

Hao, Lingwan; Wang, Meiri; Shan, Wenjuan; Deng, Changliang; Ren, Wanzhong; Shi, Zhouzhou; Lü, Hongying

2017-10-05

A series of L-proline-based DESs was prepared through an atom economic reaction between L-proline (L-Pro) and four different kinds of organic acids. The DESs were characterized by Fourier transform infrared spectroscopy (FT-IR), H nuclear magnetic resonance ( 1 HNMR), cyclic voltammogram (CV) and the Hammett method. The synthesized DESs were used for the oxidative desulfurization and the L-Pro/p-toluenesultonic acid (L-Pro/p-TsOH) system shows the highest catalytic activity that the removal of dibenzothiophene (DBT) reached 99% at 60°C in 2h, which may involve the dual activation of the L-Pro/p-TsOH. The acidity of four different L-proline-based DESs was measured and the results show that it could not simply conclude that the correlation between the acidity of DESs and desulfurization capability was positive or negative. The electrochemical measurements evidences and recycling experiment indicate a good stability performance of L-Pro/p-TsOH in desulfurization. This work will provide a novel and potential method for the deep oxidation desulfurization. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparison of influence of carmustine and new proline analog of nitrosourea on antioxidant system in breast carcinoma cells (MCF-7).

PubMed

Stankiewicz-Kranc, Anna; Miltyk, Wojciech; Skrzydlewska, Elzbieta

2010-01-01

The high toxicity and low selectivity of carmustine restrict its application in anticancer therapy. Therefore, proline analogs of nitrosourea have been synthesized to obtain compounds whose action on neoplastic cells is characterized by higher selectivity. The present studies have aimed at examining the influence of carmustine and a new proline analog of nitrosourea on the redox system of fibroblasts and breast cancer cells (MCF-7). Carmustine and the proline analog of nitrosourea caused an increase in hydrogen peroxide concentration both in fibroblasts and MCF-7 cells. Moreover, administration of carmustine and the new analog of nitrosourea caused a decrease in the activity of antioxidant enzymes. Observed changes in the antioxidant system correlated with an increase in concentration of dityrosine, as well as a decrease in tryptophan concentration. Changes in the antioxidant system were also accompanied by intensification of the lipid peroxidation process. In conclusion, carmustine and proline analog of nitrosourea produce similar changes in the antioxidant system in normal and cancer cells and are responsible for oxidative stress.

Impact of proline application on cadmium accumulation, mineral nutrition and enzymatic antioxidant defense system of Olea europaea L. cv Chemlali exposed to cadmium stress.

PubMed

Zouari, Mohamed; Ben Ahmed, Chedlia; Elloumi, Nada; Bellassoued, Khaled; Delmail, David; Labrousse, Pascal; Ben Abdallah, Ferjani; Ben Rouina, Bechir

2016-06-01

Proline plays an important role in plant response to various environmental stresses. However, its involvement in mitigation of heavy metal stress in plants remains elusive. In this study, we examined the effectiveness of exogenous proline (10 and 20 mM) in alleviating cadmium induced inhibitory effects in young olive plants (Olea europaea L. cv. Chemlali) exposed to two Cd levels (10 and 30 mg CdCl2 kg(-1) soil). The Cd treatment induced substantial accumulation of Cd in both root and leaf tissues and a decrease in gas exchange, photosynthetic pigments contents, uptake of essential elements (Ca, Mg and K) and plant biomass. Furthermore, an elevation of antioxidant enzymes activities (superoxide dismutase, catalase, glutathione peroxydase) and proline content in association with relatively high amounts of hydrogen peroxide, thiobarbituric acid reactive substances and electrolyte leakage were observed. Interestingly, the application of exogenous proline alleviated the oxidative damage induced by Cd accumulation. In fact, Cd-stressed olive plants treated with proline showed an increase of antioxidant enzymes activities, photosynthetic activity, nutritional status, plant growth and oil content of olive fruit. Generally, it seems that proline supplementation alleviated the deleterious effects of young olive plants exposed to Cd stress. Copyright © 2016 Elsevier Inc. All rights reserved.

Resolving the cofactor-binding site in the proline biosynthetic enzyme human pyrroline-5-carboxylate reductase 1

PubMed Central

Christensen, Emily M.; Patel, Sagar M.; Korasick, David A.; Campbell, Ashley C.; Krause, Kurt L.; Becker, Donald F.; Tanner, John J.

2017-01-01

Pyrroline-5-carboxylate reductase (PYCR) is the final enzyme in proline biosynthesis, catalyzing the NAD(P)H-dependent reduction of Δ1-pyrroline-5-carboxylate (P5C) to proline. Mutations in the PYCR1 gene alter mitochondrial function and cause the connective tissue disorder cutis laxa. Furthermore, PYCR1 is overexpressed in multiple cancers, and the PYCR1 knock-out suppresses tumorigenic growth, suggesting that PYCR1 is a potential cancer target. However, inhibitor development has been stymied by limited mechanistic details for the enzyme, particularly in light of a previous crystallographic study that placed the cofactor-binding site in the C-terminal domain rather than the anticipated Rossmann fold of the N-terminal domain. To fill this gap, we report crystallographic, sedimentation-velocity, and kinetics data for human PYCR1. Structures of binary complexes of PYCR1 with NADPH or proline determined at 1.9 Å resolution provide insight into cofactor and substrate recognition. We see NADPH bound to the Rossmann fold, over 25 Å from the previously proposed site. The 1.85 Å resolution structure of a ternary complex containing NADPH and a P5C/proline analog provides a model of the Michaelis complex formed during hydride transfer. Sedimentation velocity shows that PYCR1 forms a concentration-dependent decamer in solution, consistent with the pentamer-of-dimers assembly seen crystallographically. Kinetic and mutational analysis confirmed several features seen in the crystal structure, including the importance of a hydrogen bond between Thr-238 and the substrate as well as limited cofactor discrimination. PMID:28258219

Effect of proline and glycine residues on dynamics and barriers of loop formation in polypeptide chains.

PubMed

Krieger, Florian; Möglich, Andreas; Kiefhaber, Thomas

2005-03-16

Glycine and proline residues are frequently found in turn and loop structures of proteins and are believed to play an important role during chain compaction early in folding. We investigated their effect on the dynamics of intrachain loop formation in various unstructured polypeptide chains. Loop formation is significantly slower around trans prolyl peptide bonds and faster around glycine residues compared to any other amino acid. However, short loops are formed fastest around cis prolyl bonds with a time constant of 6 ns for end-to-end contact formation in a four-residue loop. Formation of short loops encounters activation energies in the range of 15 to 30 kJ/mol. The altered dynamics around glycine and trans prolyl bonds can be mainly ascribed to their effects on the activation energy. The fast dynamics around cis prolyl bonds, in contrast, originate in a higher Arrhenius pre-exponential factor, which compensates for an increased activation energy for loop formation compared to trans isomers. All-atom simulations of proline-containing peptides indicate that the conformational space for cis prolyl isomers is largely restricted compared to trans isomers. This leads to decreased average end-to-end distances and to a smaller loss in conformational entropy upon loop formation in cis isomers. The results further show that glycine and proline residues only influence formation of short loops containing between 2 and 10 residues, which is the typical loop size in native proteins. Formation of larger loops is not affected by the presence of a single glycine or proline residue.

Multiple Determinants of Anuran Richness and Occurrence in an Agricultural Region in South-Eastern Brazil

NASA Astrophysics Data System (ADS)

Prado, Vitor H. M.; Rossa-Feres, Denise de C.

2014-04-01

In agricultural landscapes, studies that identify factors driving species richness and occupancy are important because they can guide farmers to use conservation practices that minimize species loss. In this context, anurans are threatened by habitat loss because they depend on the characteristics of both local water bodies and adjacent landscapes. We used a model selection approach to evaluate the influence of local and landscape variables in determining anuran species richness and occurrence in 40 freshwater bodies in a heavily deforested region of semideciduous Atlantic Forest in southeastern Brazil. Our aim was to develop recommendations for conservation of anuran communities in rural areas. Pond hydroperiod and area were the most important variables for explaining anuran species richness and occupancy, with greatest species richness being found in water bodies with intermediate hydroperiod and area. Other important variables that reflected individual species occupancies were the number of vegetation types and pond isolation. In addition, recent studies evidenced that water bodies near forest fragments have higher anuran abundance or diversity. In conclusion, we suggest the maintenance of semi-permanent ponds, isolated from large rivers or reservoirs and near forest fragments, as an effective strategy to conserve anuran fauna in agricultural landscapes of southeastern Brazil. Brazilian government requires the maintenance of forests as legal reserve in each farm, and farmers need to maintain ponds as drinking water for cattle or crop irrigation. For this reason, the guidelines suggested in the present study can be easily adopted, without additional costs to rural productivity.

Multi-wavelength Morphological Study Of Star Forming Regions In Nearby Cluster-rich Lirgs

NASA Astrophysics Data System (ADS)

Vavilkin, Tatjana; Evans, A.; Mazzarella, J.; Surace, J.; Kim, D.; Howell, J.; Armus, L.; GOALS Team

2009-05-01

Luminous Infrared Galaxies (LIRGs) are believed to play an important role in star formation history of the universe. Many LIRGs undergo intense bursts of star formation as a result of interaction/merger process. Given the dusty nature of LIRGs, it is necessary to probe Luminous Infrared Galaxies at multiple wavelengths. The Great Observatories All-sky LIRG Survey (GOALS) combines data from NASA's Spitzer, Hubble, Chandra and GALEX observatories and offers a unique opportunity to gain insights into the physical processes in these highly dust enshrouded systems. We examine a sample of 11 nearby (z < 0.03) cluster-rich (> 200 clusters as seen in HST ACS images) LIRG systems at various interaction stages. The combined HST ACS optical imaging, Spitzer IRAC 8 micron channel and GALEX near-UV imaging allows us to access the properties of visible and obscured star forming regions. We study the spatial distribution of star forming regions at these wavelengths, correlate locations of young stellar clusters with PAH and UV emission regions and trace changes with merger stage.

Structural and functional characterization of EIAV gp45 fusion peptide proximal region and asparagine-rich layer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duan, Liangwei; Du, Jiansen; Wang, Xuefeng

Equine infectious anaemia virus (EIAV) and human immunodeficiency virus (HIV) are members of the lentiviral genus. Similar to HIV gp41, EIAV gp45 is a fusogenic protein that mediates fusion between the viral particle and the host cell membrane. The crystal structure of gp45 reported reveals a different conformation in the here that includes the fusion peptide proximal region (FPPR) and neighboring asparagine-rich layer compared with previous HIV-1 gp41 structures. A complicated hydrogen-bond network containing a cluster of solvent molecules appears to be critical for the stability of the gp45 helical bundle. Interestingly, viral replication was relatively unaffected by site-directed mutagenesismore » of EIAV, in striking contrast to that of HIV-1. Based on these observations, we speculate that EIAV is more adaptable to emergent mutations, which might be important for the evolution of EIAV as a quasi-species, and could potentially contribute to the success of the EIAV vaccine. - Highlights: • The crystal structure of EIAV gp45 was determined. • The fusion peptide proximal region adopts a novel conformation different to HIV-1. • The asparagine-rich layer includes an extensive hydrogen-bond network. • These regions of EIAV are highly tolerant to mutations. • The results provide insight into the mechanism of gp41/gp45-mediated membrane fusion.« less

Synthesis of fluorescent label, DBD-beta-proline, and the resolution efficiency for chiral amines by reversed-phase chromatography.

PubMed

Min, Jun Zhe; Toyo'oka, Toshimasa; Kato, Masaru; Fukushima, Takeshi

2005-01-01

DBD-d(and l)-beta-proline, new fluorescent chiral derivatization reagents, were synthesized from the reaction of 4-(N,N-dimethylaminosulfonyl)-7- fl uoro-2,1,3-benzoxadiazole (DBD-F) with beta-proline. The racemic mixture synthesized was separated by a chiral stationary phase (CSP) column, Chiralpak AD-H, with n-hexane-EtOH-TFA-diethylamine (70:30:0.1:0.1) as the mobile phase. The dl-forms were decided according to the results obtained from a circular dichroism (CD) detector after separation by the CSP column. The fractionated enantiomers reacted with chiral amine to produce a couple of diastereomers. The labeling proceeded in the presence of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and pyridine as the activation reagents. The reaction conditions were mild and no racemization occurred during the diastereomer formation. The resulting diastereomers fluoresced at around 570 nm (excitation at around 460 nm). Good linearity of the calibration curves was obtained in the range 1-75 pmol and the detection limits on chromatogram were less than 1 pmol. The separability of the diastereomers was compared with the diastereomers derived from DBD-d(or l)-proline. The resolution values (Rs) obtained from the diastereomers of three chiral amines with DBD-d(or l)-beta-proline were higher than those derived from DBD-d(or l)-proline, e.g. dl-phenylalanine methylester (dl-PAME), 2.23 vs 1.37; (R)(S)-1-phenylethylamine [(R)(S)-PEA], 2.09 vs 1.13; and (R)(S)-1-(1-naphthyl)ethylamines [(R)(S)-NEA], 5.19 vs 1.23. The results suggest that the position of COOH group on pyrrolidine moiety in the structures is one of the important factors for the efficient separation of a couple of the diastereomers.

The adsorption and reactions of the amino acid proline on rutile TiO 2(1 1 0) surfaces

NASA Astrophysics Data System (ADS)

Fleming, G. J.; Adib, K.; Rodriguez, J. A.; Barteau, M. A.; White, J. M.; Idriss, H.

2008-06-01

The reaction of the amino acid DL-proline is studied over stoichiometric and Ar-ions sputtered (reduced) TiO 2(1 1 0) single crystal surfaces by synchrotron High Resolution X-ray Photoelectron Spectroscopy (HRXPS). On the stoichiometric surface proline gives two different species at 300 K: dissociated and zwitterionic. Upon heating the zwitterionic structure is removed first from the surface followed by the dissociated form. The C1s signal for the COO function is found close to 288.5 eV for both forms while the N 1s for the dissociated form is found at 400.0 eV and that of the zwitterionic from close to 401.8 eV. From the attenuation of the Ti 2p signal the surface coverage was estimated less than ½ (about 0.35). This smaller coverage than dissociatively adsorbed carboxylic acids on this surface (usually close to ½), is attributed to lateral repulsion caused by the ring of adjacent proline molecules adsorbed on five-fold coordinated Ti cations along the [0 0 1] direction. On the reduced surface the amount of zwitterion structure is found two times higher than that on the stoichiometric surface, at 300 K, most likely due to the considerable decrease of the amount of surface oxygen available. The stability of the zwitterionic structure on this surface is however found similar to that found on the stoichiometric surface. In addition, evidence of oxidation of reduced Ti cations upon adsorption at 300 K is noticed and explained as breaking of the carbon-oxygen bond of a fraction of adsorbed proline. Variable temperature HRXPS has been collected and results indicated that proline is more stable on the reduced surface compared to the stoichiometric surface.

Evidence for Reduced, Carbon-rich Regions in the Solar Nebula from an Unusual Cometary Dust Particle

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Gregorio, Bradley T.; Stroud, Rhonda M.; Nittler, Larry R.

Geochemical indicators in meteorites imply that most formed under relatively oxidizing conditions. However, some planetary materials, such as the enstatite chondrites, aubrite achondrites, and Mercury, were produced in reduced nebular environments. Because of large-scale radial nebular mixing, comets and other Kuiper Belt objects likely contain some primitive material related to these reduced planetary bodies. Here, we describe an unusual assemblage in a dust particle from comet 81P/Wild 2 captured in silica aerogel by the NASA Stardust spacecraft. The bulk of this ∼20 μ m particle is comprised of an aggregate of nanoparticulate Cr-rich magnetite, containing opaque sub-domains composed of poorlymore » graphitized carbon (PGC). The PGC forms conformal shells around tiny 5–15 nm core grains of Fe carbide. The C, N, and O isotopic compositions of these components are identical within errors to terrestrial standards, indicating a formation inside the solar system. Magnetite compositions are consistent with oxidation of reduced metal, similar to that seen in enstatite chondrites. Similarly, the core–shell structure of the carbide + PGC inclusions suggests a formation via FTT reactions on the surface of metal or carbide grains in warm, reduced regions of the solar nebula. Together, the nanoscale assemblage in the cometary particle is most consistent with the alteration of primary solids condensed from a C-rich, reduced nebular gas. The nanoparticulate components in the cometary particle provide the first direct evidence from comets of reduced, carbon-rich regions that were present in the solar nebula.« less

Similarity of different beta-strands flanked in loops by glycines and prolines from distinct (alpha/beta)8-barrel enzymes: chance or a homology?

PubMed Central

Janecek, S.

1995-01-01

Many (alpha/beta)8-barrel enzymes contain their conserved sequence regions at or around the beta-strand segments that are often preceded and succeeded by glycines and prolines, respectively. alpha-Amylase is one of these enzymes. Its sequences exhibit a very low degree of similarity, but strong conservation is seen around its beta-strands. These conserved regions were used in the search for similarities with beta-strands of other (alpha/beta)8-barrel enzymes. The analysis revealed an interesting similarity between the segment around the beta 2-strand of alpha-amylase and the one around the beta 4-strand of glycolate oxidase that are flanked in loops by glycines and prolines. The similarity can be further extended on other members of the alpha-amylase and glycolate oxidase subfamilies, i.e., cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, and flavocytochrome b2, respectively. Moreover, the alpha-subunit of tryptophan synthase, the (alpha/beta)8-barrel enzyme belonging to the other subfamily of (alpha/beta)8-barrels, has both investigated strands, beta 2 and beta 4, similar to beta 2 of alpha-amylase and beta 4 of glycolate oxidase. The possibilities of whether this similarity exists only by chance or is a consequence of some processes during the evolution of (alpha/beta)8-barrel proteins are briefly discussed. PMID:7549888

Similarity of different beta-strands flanked in loops by glycines and prolines from distinct (alpha/beta)8-barrel enzymes: chance or a homology?

PubMed

Janecek, S

1995-06-01

Many (alpha/beta)8-barrel enzymes contain their conserved sequence regions at or around the beta-strand segments that are often preceded and succeeded by glycines and prolines, respectively. alpha-Amylase is one of these enzymes. Its sequences exhibit a very low degree of similarity, but strong conservation is seen around its beta-strands. These conserved regions were used in the search for similarities with beta-strands of other (alpha/beta)8-barrel enzymes. The analysis revealed an interesting similarity between the segment around the beta 2-strand of alpha-amylase and the one around the beta 4-strand of glycolate oxidase that are flanked in loops by glycines and prolines. The similarity can be further extended on other members of the alpha-amylase and glycolate oxidase subfamilies, i.e., cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, and flavocytochrome b2, respectively. Moreover, the alpha-subunit of tryptophan synthase, the (alpha/beta)8-barrel enzyme belonging to the other subfamily of (alpha/beta)8-barrels, has both investigated strands, beta 2 and beta 4, similar to beta 2 of alpha-amylase and beta 4 of glycolate oxidase. The possibilities of whether this similarity exists only by chance or is a consequence of some processes during the evolution of (alpha/beta)8-barrel proteins are briefly discussed.

Parenterally fed neonatal piglets have a low rate of endogenous arginine synthesis from circulating proline.

PubMed

Urschel, Kristine L; Evans, Amanda R; Wilkinson, Craig W; Pencharz, Paul B; Ball, Ronald O

2007-03-01

Parenterally fed neonatal piglets cannot synthesize sufficient arginine to maintain arginine status, presumably due to the intestinal atrophy that occurs with parenteral feeding. Parenteral feeding-induced atrophy can be reduced by the infusion of glucagon-like peptide 2 (GLP-2). GLP-2 infusion was hypothesized to increase the rate of endogenous arginine synthesis from proline, the major arginine precursor, in parenterally fed piglets receiving an arginine-deficient diet. Male piglets, fitted with jugular vein catheters for diet and isotope infusion, and femoral vein catheters for blood sampling (d 0), were allocated to a continuous infusion of either GLP-2 (n = 5; 10 nmol x kg(-1) x d(-1)) or saline (n = 5) for 7 d. Piglets received 2 d of a complete diet, followed by 5 d of an arginine-deficient [0.60 g x kg(-1) x d(-1)] diet. Piglets received primed, constant infusions of [guanido-(14)C]arginine to measure arginine flux (d 6) and [U-(14)C]proline (d 7) to measure proline conversion to arginine. Plasma arginine concentrations and arginine fluxes indicated a similar whole-body arginine status. Piglets receiving GLP-2 showed improvements in intestinal variables, including mucosal mass (P < 0.01) and villus height (P < 0.001), and a greater rate of arginine synthesis (micromol x kg(-1) x h(-1)) from proline (11.6 vs. 6.3) (P = 0.03). Mucosal mass (R(2) = 0.71; P = 0.002) and villus height were correlated (R(2) = 0.66; P = 0.004) with arginine synthesis. This study was the first to quantitate arginine synthesis in parenterally fed neonates and showed that although GLP-2 infusion increased arginine synthesis in a manner directly related to mucosal mass, this increased arginine synthesis was insufficient to improve whole-body arginine status in piglets receiving a low arginine diet.

Phosphorylation effects on cis/trans isomerization and the backbone conformation of serine-proline motifs: accelerated molecular dynamics analysis.

PubMed

Hamelberg, Donald; Shen, Tongye; McCammon, J Andrew

2005-02-16

The presence of serine/threonine-proline motifs in proteins provides a conformational switching mechanism of the backbone through the cis/trans isomerization of the peptidyl-prolyl (omega) bond. The reversible phosphorylation of the serine/threonine modulates this switching in regulatory proteins to alter signaling and transcription. However, the mechanism is not well understood. This is partly because cis/trans isomerization is a very slow process and, hence, difficult to study. We have used our accelerated molecular dynamics method to study the cis/trans proline isomerization, preferred backbone conformation of a serine-proline motif, and the effects of phosphorylation of the serine residue. We demonstrate that, unlike normal molecular dynamics, the accelerated molecular dynamics allows for the system to escape very easily from the trans isomer to cis isomer, and vice versa. Moreover, for both the unphosphorylated and phosphorylated peptides, the statistical thermodynamic properties are recaptured, and the results are consistent with experimental values. Isomerization of the proline omega bond is shown to be asymmetric and strongly dependent on the psi backbone angle before and after phosphorylation. The rates of escape decrease after phosphorylation. Also, the alpha-helical backbone conformation is more favored after phosphorylation. This accelerated molecular dynamics approach provides a general approach for enhancing the conformational transitions of molecular systems without having prior knowledge of the location of the minima and barriers on the potential-energy landscape.

Latitudinal concordance between biogeographic regionalization, community structure, and richness patterns: a study on the reptiles of China

NASA Astrophysics Data System (ADS)

Chen, Youhua; Srivastava, Diane S.

2015-02-01

Latitudinal patterns in species richness may be affected by both continuous variations in macroecological factors as well as discrete change between biogeographic regions. We examined whether latitudinal reptilian richness and community structure in China were best explained by three macroecological patterns (mid-domain effects, Rapoport's rule effects, or environmental correlates) within or across the ranges of biogeographic realms. The results showed that (1) there was a weak mid-domain effect within the Oriental Realm. However, the mid-domain effect was detected neither at the overall regional scale nor in the Palaearctic Realm. (2) Rapoport's rule was only weakly supported for reptilian fauna in China at lower latitudinal areas. (3) Environmental variables were more strongly correlated with species' latitudinal community structure and richness patterns at the scale of biogeographic realms. Based on the faunal similarity of reptilian community across latitudinal bands, we proposed a latitudinal delineation scheme at 34° N for dividing East Asia into Oriental and Palaearctic biogeographic realms. At last, at the functional group level, we also evaluated the relevant ecological patterns for lizard and snake species across different latitudinal bins, showing that the distributions of lizards presented strong mid-domain effects at the latitudinal ranges within the Oriental Realm and over the whole range but did not support Rapoport's rule. In comparison, snake species supported Rapoport's rule at low latitudinal zones but did not present any remarkable mid-domain effects at any spatial extents. In conclusion, biogeographic realms are an appropriate scale for studying macroecological patterns. Reptilian latitudinal richness patterns of China were explained by a combination of environmental factors and geometric constraints, while the latitudinal community structure patterns were greatly affected by environmental gradients. Functional guilds present differentiated

Biochemical characterization of the triticale TsPAP1, a new type of plant prolyl aminopeptidase, and its impact on proline content and flowering time in transgenic Arabidopsis plants.

PubMed

Zdunek-Zastocka, Edyta; Grabowska, Agnieszka; Branicki, Tomasz; Michniewska, Beata

2017-07-01

Proline aminopeptidase (PAP, EC 3.4.11.5) is the only enzyme that effectively releases proline from the N-termini of peptides. The amino acid sequence of the PAP from Triticosecale, TsPAP1, comprises conserved regions, characteristic of the monomeric forms of PAP found in bacteria but not yet identified in plants. Therefore, we aimed to obtain and biochemically characterize the TsPAP1 protein. The recombinant TsPAP1 protein was received through heterologous expression of the TsPAP1 coding sequence in a bacterial expression system and purified with affinity chromatography. Gel filtration chromatography and SDS electrophoresis revealed that TsPAP1 is a monomer with a molecular mass of 37.5 kDa. TsPAP1 prefers substrates with proline at the N-terminus but is also capable of hydrolyzing β-naphthylamides of hydroxyproline and alanine. Among the peptides tested, the most preferred were di- and tripeptides, especially those with glycine in the Y position. The use of diagnostic inhibitors indicated that TsPAP1 is a serine peptidase; however, further characterization revealed that the SH residues are also important for maintaining its activity. To examine the role of TsPAP1 under physiological conditions, we developed transgenic Arabidopsis plants overexpressing TsPAP1. Compared with wild-type plants, the transgenic lines accumulated more proline, flowered an average of 3.5 days earlier, and developed more siliques than did untransformed controls. Our paper is the first to describe the biochemical properties of a novel monomeric plant PAP and contributes to the functional characterization of PAP proteins in plants. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Conformational dynamics of minimal elastin-like polypeptides: the role of proline revealed by molecular dynamics and nuclear magnetic resonance.

PubMed

Glaves, Rachel; Baer, Marcel; Schreiner, Eduard; Stoll, Raphael; Marx, Dominik

2008-12-22

Previous molecular dynamics studies of the elastin-like peptide (ELP) GVG(VPGVG) predict that this ELP undergoes a conformational transition from an open to a more compact closed state upon an increase in temperature. These structural changes occurring in this minimal elastin model at the so-called inverse temperature transition (ITT), which takes place when elastin is heated to temperatures of about 20-40 (omicron)C, are investigated further in this work by means of a combined theoretical and experimental approach. To do this, additional extensive classical molecular dynamics (MD) simulations of the capped octapeptide are carried out, analyzed, and compared to data obtained from homonuclear magnetic resonance (NMR) spectroscopy of the same octapeptide. Moreover, in the previous simulations, the proline residue in the ELP is found to act as a hinge, thereby allowing for the large-amplitude opening and closing conformational motion of the ITT. To explore the role of proline in such elastin repeating units, a point mutant (P5I), which replaces the proline residue with an isoleucine residue, is also investigated using the aforementioned theoretical and experimental techniques. The results show that the site-directed mutation completely alters the properties of this ELP, thus confirming the importance of the highly conserved proline residue in the ITT. Furthermore, a correlation between the two different methods employed is seen. Both methods predict the mutant ELP to be present in an unstructured form and the wild type ELP to have a beta-turn-like structure. Finally, the role of the peptidyl cis to trans isomerization of the proline hinge is assessed in detail.

Importance of the High-Expression of Proline Transporter PutP to the Adaptation of Escherichia coli to High Salinity.

PubMed

Sasaki, Hideaki; Sato, Daichi; Oshima, Akinobu

2017-01-01

　The effect of the amount of the proline transporter PutP expression on the mechanism of adaptation of E. coli cells to high salinity was analyzed. The PutP gene derived from the E. coli expression plasmid was introduced into the E. coli cell, and a high PutP expression strain was developed. At 1.2 M NaCl culture condition, the growth of normal E. coli cells was inhibited, whereas high ProP expression cells showed growth under 2.5 M NaCl conditions. The uptake of proline by E. coli as a compatible solute and substrate for metabolization was in good accordance with those seen in cell growth. These data suggested that the amount of the proline transporter PutP expression played an important role in the adaptation of E. coli cells to high saline conditions.

BAF57 Modulation of Androgen Receptor Action and Prostate Cancer Progression

DTIC Science & Technology

2007-12-01

mapped the AR binding site on BAF57 to the N-terminus (proline-rich region). Furthermore, the DBD and hinge region of AR also appear to play a...Accomplishments of Task 1: BAF57 binds to DNA binding domain ( DBD ) and hinge region of AR As outlined in the initial proposal, the first task...the above construct are the well-characterized zinc finger DNA binding domain ( DBD ) and the hinge region. Given the significant role of these two

A concise and practical stereoselective synthesis of ipragliflozin L-proline

PubMed Central

Ma, Shuai; Liu, Zhenren; Pan, Jing; Zhang, Shunli

2017-01-01

A concise and practical stereoselective synthesis of ipragliflozin L-proline was presented starting from 2-[(5-iodo-2-fluorophenyl)methyl]-1-benzothiophene and 2,3,4,6-tetra-O-pivaloyl-α-D-glucopyranosyl bromide without catalyst via iodine–lithium–zinc exchange. The overall yield was 52% in three steps and the product purity was excellent. Two key diastereomers were prepared with efficient and direct access to the α-C-arylglucoside. PMID:28684985

Isolation of cis-3-Amino-l-Proline from Cultured Mycelia of Morchella esculenta Fr

PubMed Central

Moriguchi, Mitsuaki; Sada, Shin-Ichi; Hatanaka, Shin-Ichi

1979-01-01

cis-3-Amino-l-proline, identified once as a nonprotein amino acid from the fruiting bodies of Morchella esculenta Fr., was isolated also from the growth medium and cultured mycelia of the same fungus. PMID:16345456

Exogenous proline mediates alleviation of cadmium stress by promoting photosynthetic activity, water status and antioxidative enzymes activities of young date palm (Phoenix dactylifera L.).

PubMed

Zouari, M; Ben Ahmed, Ch; Zorrig, W; Elloumi, N; Rabhi, M; Delmail, D; Ben Rouina, B; Labrousse, P; Ben Abdallah, F

2016-06-01

The ability of exogenous compatible solutes, such as proline, to counteract cadmium (Cd) inhibitory effects in young date palm plants (Phoenix dactylifera L. cv Deglet Nour) was investigated. Two-year-old date palm plants were subjected for five months at different Cd stress levels (0, 10 and 30 mg CdCl2 kg(-1) soil) whether supplied or not with exogenous proline (20mM) added through the irrigation water. Different levels of Cd stress altered plant growth, gas exchanges and chlorophyll content as well as water status, but at different extent among them. In contrast, an increase of antioxidant enzymes activities of Cd-treated plants in association with high amounts of proline content, hydrogen peroxide (H2O2), thiobarbituric acid reactive substances (TBARS) and electrolyte leakage (EL) were observed. Interestingly, exogenous proline mitigated the adverse effects of Cd on young date palm. Indeed, it alleviated the oxidative damage induced by Cd accumulation and established better levels of plant growth, water status and photosynthetic activity. Moreover, proline-treated plants showed high antioxidant enzymes activities (superoxide dismutase, catalase and glutathione peroxydase) in roots and leaves as compared to Cd-treated plants. Copyright © 2016 Elsevier Inc. All rights reserved.

Hydrogen rich gas generator

NASA Technical Reports Server (NTRS)

Houseman, J.; Rupe, J. H.; Kushida, R. O. (Inventor)

1976-01-01

A process and apparatus is described for producing a hydrogen rich gas by injecting air and hydrocarbon fuel at one end of a cylindrically shaped chamber to form a mixture and igniting the mixture to provide hot combustion gases by partial oxidation of the hydrocarbon fuel. The combustion gases move away from the ignition region to another region where water is injected to be turned into steam by the hot combustion gases. The steam which is formed mixes with the hot gases to yield a uniform hot gas whereby a steam reforming reaction with the hydrocarbon fuel takes place to produce a hydrogen rich gas.

Structure of aqueous proline via parallel tempering molecular dynamics and neutron diffraction.

PubMed

Troitzsch, R Z; Martyna, G J; McLain, S E; Soper, A K; Crain, J

2007-07-19

The structure of aqueous L-proline amino acid has been the subject of much debate centering on the validity of various proposed models, differing widely in the extent to which local and long-range correlations are present. Here, aqueous proline is investigated by atomistic, replica exchange molecular dynamics simulations, and the results are compared to neutron diffraction and small angle neutron scattering (SANS) data, which have been reported recently (McLain, S.; Soper, A.; Terry, A.; Watts, A. J. Phys. Chem. B 2007, 111, 4568). Comparisons between neutron experiments and simulation are made via the static structure factor S(Q) which is measured and computed from several systems with different H/D isotopic compositions at a concentration of 1:20 molar ratio. Several different empirical water models (TIP3P, TIP4P, and SPC/E) in conjunction with the CHARMM22 force field are investigated. Agreement between experiment and simulation is reasonably good across the entire Q range although there are significant model-dependent variations in some cases. In general, agreement is improved slightly upon application of approximate quantum corrections obtained from gas-phase path integral simulations. Dimers and short oligomeric chains formed by hydrogen bonds (frequently bifurcated) coexist with apolar (hydrophobic) contacts. These emerge as the dominant local motifs in the mixture. Evidence for long-range association is more equivocal: No long-range structures form spontaneously in the MD simulations, and no obvious low-Q signature is seen in the SANS data. Moreover, associations introduced artificially to replicate a long-standing proposed mesoscale structure for proline correlations as an initial condition are annealed out by parallel tempering MD simulations. However, some small residual aggregates do remain, implying a greater degree of long-range order than is apparent in the SANS data.

Structural Basis of Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA

PubMed Central

Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.

2009-01-01

Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5′-GTTGCA-3′, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of −1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269

Global hotspots and correlates of alien species richness across taxonomic groups

USGS Publications Warehouse

Dawson, Wayne; Moser, Dietmar; van Kleunen, Mark; Kreft, Holger; Pergl, Jan; Pysek, Petr; Weigelt, Patrick; Winter, Marten; Lenzner, Bernd; Blackburn, Tim M.; Dyer, Ellie; Cassey, Phillip; Scrivens, Sally-Louise; Economo, Evan P.; Guenard, Benoit; Capinha, Cesar; Seebens, Hanno; Garcia-Diaz, Pablo; Nentwig, Wolfgang; Garcia-Berthou, Emili; Casal, Christine; Mandrak, Nicholas E.; Fuller, Pam; Meyer, Carsten; Essl, Franz

2017-01-01

Human-mediated transport beyond biogeographic barriers has led to the introduction and establishment of alien species in new regions worldwide. However, we lack a global picture of established alien species richness for multiple taxonomic groups. Here, we assess global patterns and potential drivers of established alien species richness across eight taxonomic groups (amphibians, ants, birds, freshwater fishes, mammals, vascular plants, reptiles and spiders) for 186 islands and 423 mainland regions. Hotspots of established alien species richness are predominantly island and coastal mainland regions. Regions with greater gross domestic product per capita, human population density, and area have higher established alien richness, with strongest effects emerging for islands. Ants and reptiles, birds and mammals, and vascular plants and spiders form pairs of taxonomic groups with the highest spatial congruence in established alien richness, but drivers explaining richness differ between the taxa in each pair. Across all taxonomic groups, our results highlight the need to prioritize prevention of further alien species introductions to island and coastal mainland regions globally.

Photosynthetic and antioxidant responses of Liquidambar formosana and Schima superba seedlings to sulfuric-rich and nitric-rich simulated acid rain.

PubMed

Chen, Juan; Wang, Wen-Hua; Liu, Ting-Wu; Wu, Fei-Hua; Zheng, Hai-Lei

2013-03-01

To study whether differential responses occur in photosynthesis and antioxidant system for seedlings of Liquidambar formosana, an acid rain (AR)-sensitive tree species and Schima superba, an AR-tolerant tree species treated with three types of pH 3.0 simulated AR (SiAR) including sulfuric-rich (S-SiAR), nitric-rich (N-SiAR), sulfate and nitrate mixed (SN-SiAR), we investigated the changes of leaf necrosis, chlorophyll content, soluble protein and proline content, photosynthesis and chlorophyll fluorescence characteristics, reactive oxygen species production, membrane lipid peroxidation, small molecular antioxidant content, antioxidant enzyme activities and related protein expressions. Our results showed that SiAR significantly caused leaf necrosis, inhibited photosynthesis, induced superoxide radical and hydrogen peroxide generation, aggravated membrane lipid peroxidation, changed antioxidant enzyme activities, modified related protein expressions such as Cu/Zn superoxide dismutase (SOD), l-ascorbate peroxidase (APX, EC 1. 11. 1. 11), glutathione S transferase (GST, EC 2. 5. 1. 18) and Rubisco large subunit (RuBISCO LSU), altered non-protein thiols (NPT) and glutathione (GSH) content in leaves of L. formosana and S. superba. Taken together, we concluded that the damages caused by SiAR in L. formosana were more severe and suffered from more negative impacts than in S. superba. S-SiAR induced more serious damages for the plants than did SN-SiAR and N-SiAR. Crown Copyright © 2013. Published by Elsevier Masson SAS. All rights reserved.

Biomass Yield and Steviol Glycoside Production in Callus and Suspension Culture of Stevia rebaudiana Treated with Proline and Polyethylene Glycol.

PubMed

Gupta, Pratibha; Sharma, Satyawati; Saxena, Sanjay

2015-06-01

Enhanced production of steviol glycosides (SGs) was observed in callus and suspension culture of Stevia rebaudiana treated with proline and polyethylene glycol (PEG). To study their effect, yellow-green and compact calli obtained from in vitro raised Stevia leaves were sub-cultured on MS medium supplemented with 2.0 mg l(-1) NAA and different concentrations of proline (2.5-10 mM) and PEG (2.5-10 %) for 2 weeks, and incubated at 24 ± 1 °C and 22.4 μmol m(-2) s(-1) light intensity provided by white fluorescent tubes for 16 h. Callus and suspension culture biomass (i.e. both fresh and dry weight content) was increased with 5 mM proline and 5 % PEG, while at further higher concentrations, they got reduced. Further, quantification of SGs content in callus (collected at 15th day) and suspension culture (collected at 10th and 15th day) treated with and without elicitors was analysed by HPLC. It was observed that chemical stress enhanced the production of SGs significantly. In callus, the content of SGs increased from 0.27 (control) to 1.09 and 1.83 % with 7.5 mM proline and 5 % PEG, respectively, which was about 4.0 and 7.0 times higher than control. However, in the case of suspension culture, the same concentrations of proline and polyethylene glycol enhanced the SG content from 1.36 (control) to 5.03 and 6.38 %, respectively, on 10th day which were 3.7 times and 4.7 times higher than control.

A Randomized, Placebo-controlled Trial of Roflumilast. Effect on Proline-Glycine-Proline and Neutrophilic Inflammation in Chronic Obstructive Pulmonary Disease.

PubMed

Wells, J Michael; Jackson, Patricia L; Viera, Liliana; Bhatt, Surya P; Gautney, Joshua; Handley, Guy; King, R Wilson; Xu, Xin; Gaggar, Amit; Bailey, William C; Dransfield, Mark T; Blalock, J Edwin

2015-10-15

Roflumilast is a therapeutic agent in the treatment of chronic obstructive pulmonary disease (COPD). It has antiinflammatory effects; however, it is not known whether it can affect a biologic pathway implicated in COPD pathogenesis and progression. The self-propagating acetyl-proline-glycine-proline (AcPGP) pathway is a novel means of neutrophilic inflammation that is pathologic in the development of COPD. AcPGP is produced by extracellular matrix collagen breakdown with prolyl endopeptidase and leukotriene A4 hydrolase serving as the enzymes responsible for its production and degradation, respectively. We hypothesized that roflumilast would decrease AcPGP, halting the feed-forward cycle of inflammation. We conducted a single-center, placebo-controlled, randomized study investigating 12 weeks of roflumilast treatment added to current therapy in moderate-to-severe COPD with chronic bronchitis. Subjects underwent sputum and blood analyses, pulmonary function testing, exercise tolerance, and quality-of-life assessment at 0, 4, and 12 weeks. Twenty-seven patients were enrolled in the intention-to-treat analysis. Roflumilast treatment decreased sputum AcPGP by more than 50% (P < 0.01) and prolyl endopeptidase by 46% (P = 0.02), without significant improvement in leukotriene A4 hydrolase activity compared with placebo. Roflumilast also reduces other inflammatory markers. There were no significant changes in lung function, quality of life, or exercise tolerance between roflumilast- and placebo-treated groups. Roflumilast reduces pulmonary inflammation through decreasing prolyl endopeptidase activity and AcPGP. As expected for lower AcPGP levels, markers of neutrophilic inflammation are blunted. Inhibiting this self-propagating pathway lessens the overall inflammatory burden, which may alter the natural history of COPD, including the risk of exacerbation. Clinical trial registered with www.clinicaltrials.gov (NCT 01572948).

Identification of New Neutron-Rich Isotopes in the Rare-Earth Region Produced by 345 MeV/nucleon 238U

NASA Astrophysics Data System (ADS)

Fukuda, Naoki; Kubo, Toshiyuki; Kameda, Daisuke; Inabe, Naohito; Suzuki, Hiroshi; Shimizu, Yohei; Takeda, Hiroyuki; Kusaka, Kensuke; Yanagisawa, Yoshiyuki; Ohtake, Masao; Tanaka, Kanenobu; Yoshida, Koichi; Sato, Hiromi; Baba, Hidetada; Kurokawa, Meiko; Ohnishi, Tetsuya; Iwasa, Naohito; Chiba, Ayuko; Yamada, Taku; Ideguchi, Eiji; Go, Shintaro; Yokoyama, Rin; Fujii, Toshihiko; Nishibata, Hiroki; Ieki, Kazuo; Murai, Daichi; Momota, Sadao; Nishimura, Daiki; Sato, Yoshiteru; Hwang, Jongwon; Kim, Sunji; Tarasov, Oleg B.; Morrissey, David J.; Simpson, Gary

2018-01-01

A search for new isotopes in the neutron-rich rare-earth region has been carried out using a 345 MeV/nucleon 238U beam at the RIKEN Nishina Center RI Beam Factory. Fragments produced were analyzed and identified using the BigRIPS in-flight separator. We observed a total of 29 new neutron-rich isotopes: 153Ba, 154,155,156La, 156,157,158Ce, 156,157,158,159,160,161Pr, 162,163Nd, 164,165Pm, 166,167Sm, 169Eu, 171Gd, 173,174Tb, 175,176Dy, 177,178Ho, and 179,180Er.

Proline-catalysed asymmetric amination of alpha,alpha-disubstituted aldehydes: synthesis of configurationally stable enantioenriched alpha-aminoaldehydes.

PubMed

Vogt, Henning; Vanderheiden, Sylvia; Bräse, Stefan

2003-10-07

Proline-catalysed amination of alpha,alpha-disubstituted racemic aldehydes with azodicarboxylates proceeds smoothly to give configurationally stable scalemic aldehydes and oxazolidinones in up to 86% ee.

Projected impacts of climate change on regional capacities for global plant species richness.

PubMed

Sommer, Jan Henning; Kreft, Holger; Kier, Gerold; Jetz, Walter; Mutke, Jens; Barthlott, Wilhelm

2010-08-07

Climate change represents a major challenge to the maintenance of global biodiversity. To date, the direction and magnitude of net changes in the global distribution of plant diversity remain elusive. We use the empirical multi-variate relationships between contemporary water-energy dynamics and other non-climatic predictor variables to model the regional capacity for plant species richness (CSR) and its projected future changes. We find that across all analysed Intergovernmental Panel on Climate Change emission scenarios, relative changes in CSR increase with increased projected temperature rise. Between now and 2100, global average CSR is projected to remain similar to today (+0.3%) under the optimistic B1/+1.8 degrees C scenario, but to decrease significantly (-9.4%) under the 'business as usual' A1FI/+4.0 degrees C scenario. Across all modelled scenarios, the magnitude and direction of CSR change are geographically highly non-uniform. While in most temperate and arctic regions, a CSR increase is expected, the projections indicate a strong decline in most tropical and subtropical regions. Countries least responsible for past and present greenhouse gas emissions are likely to incur disproportionately large future losses in CSR, whereas industrialized countries have projected moderate increases. Independent of direction, we infer that all changes in regional CSR will probably induce on-site species turnover and thereby be a threat to native floras.

Cyclopropyl glycine and proline-containing preparation noopept evoke two types of membrane potential responses in synaptoneurosomes.

PubMed

Lutsenko, V K; Vukolova, M N; Gudasheva, T A

2003-06-01

Proline, cyclo(Pro-Gly), and acyl-prolyl-containing dipeptide GVS-111 decreased synaptoneurosome membrane potential in a Ca2+-free medium. The efficiency of these preparations decreased in the following order: GVS>cyclo(Pro-Gly)>proline. Depolarization responses induced by endogenous nootropic agent cyclo(Pro-Gly) was dose-dependent and saturable; the threshold concentration of cyclo(Pro-Gly) was 10(-9) M. In a Ca2+-containing medium GVS and cyclo(Pro-Gly) induced both hyperpolarizing and depolarizing membrane responses of synaptoneurosomes. Possible mechanisms underlying changes in the membrane potential of synaptoneurosomes induced by nootropic agents are discussed. It was interesting whether modulation of electrogenesis can improve memory and potentiate the neuroprotective effect of the test nootropic agents.

Isotope Effects Reveal the Mechanism of Enamine Formation in l-Proline-Catalyzed α-Amination of Aldehydes.

PubMed

Ashley, Melissa A; Hirschi, Jennifer S; Izzo, Joseph A; Vetticatt, Mathew J

2016-02-17

The mechanism of l-proline-catalyzed α-amination of 3-phenylpropionaldehyde was studied using a combination of experimental kinetic isotope effects (KIEs) and theoretical calculations. Observation of a significant carbonyl (13)C KIE and a large primary α-deuterium KIE support rate-determining enamine formation. Theoretical predictions of KIEs exclude the widely accepted mechanism of enamine formation via intramolecular deprotonation of an iminium carboxylate intermediate. An E2 elimination mechanism catalyzed by a bifunctional base that directly forms an N-protonated enamine species from an oxazolidinone intermediate accounts for the experimental KIEs. These findings provide the first experimental picture of the transition-state geometry of enamine formation and clarify the role of oxazolidinones as nonparasitic intermediates in proline catalysis.

Second-site changes affect viability of amphotropic/ecotropic chimeric enveloped murine leukemia viruses.

PubMed

O'Reilly, L; Roth, M J

2000-01-01

Chimeras were previously generated between the ecotropic (Moloney-MuLV) and amphotropic (4070A) SU and TM proteins of murine leukemia virus (MuLV). After passage in D17 cells, three chimeras with junctions in the C terminus of SU (AE5, AE6, and AE7), showed improved kinetics of viral spreading, suggesting that they had adapted. Sequencing of the viruses derived from the D17 cell lines revealed second-site changes within the env gene. Changes were detected in the receptor binding domain, the proline-rich region, the C terminus of SU, and the ectodomain of TM. Second-site changes were subcloned into the parental DNA, singly and in combination, and tested for viability. All viruses had maintained their original cloned mutations and junctions. Reconstruction and passage of AE7 or AE6 virus with single point mutations recovered the additional second-site changes identified in the parental population. The AE5 isolate required changes in the VRA, the VRC, the VRB-hinge region, and the C terminus of SU for efficient infection. Passage of virus, including the parental 4070A, in D17 cells resulted in a predominant G100R mutation within the receptor binding domain. Viruses were subjected to titer determination in three cell types, NIH 3T3, canine D17, and 293T. AE6 viruses with changes in the proline-rich region initially adapted for growth on D17 cells could infect all cell types tested. AE6-based chimeras with additional mutations in the C terminus of SU could infect D17 and 293T cells. Infection of NIH 3T3 cells was dependent on the proline-rich mutation. AE7-based chimeras encoding L538Q and G100R were impaired in infecting NIH 3T3 and 293T cells.

Second-Site Changes Affect Viability of Amphotropic/Ecotropic Chimeric Enveloped Murine Leukemia Viruses

PubMed Central

O'Reilly, Lucille; Roth, Monica J.

2000-01-01

Chimeras were previously generated between the ecotropic (Moloney-MuLV) and amphotropic (4070A) SU and TM proteins of murine leukemia virus (MuLV). After passage in D17 cells, three chimeras with junctions in the C terminus of SU (AE5, AE6, and AE7), showed improved kinetics of viral spreading, suggesting that they had adapted. Sequencing of the viruses derived from the D17 cell lines revealed second-site changes within the env gene. Changes were detected in the receptor binding domain, the proline-rich region, the C terminus of SU, and the ectodomain of TM. Second-site changes were subcloned into the parental DNA, singly and in combination, and tested for viability. All viruses had maintained their original cloned mutations and junctions. Reconstruction and passage of AE7 or AE6 virus with single point mutations recovered the additional second-site changes identified in the parental population. The AE5 isolate required changes in the VRA, the VRC, the VRB-hinge region, and the C terminus of SU for efficient infection. Passage of virus, including the parental 4070A, in D17 cells resulted in a predominant G100R mutation within the receptor binding domain. Viruses were subjected to titer determination in three cell types, NIH 3T3, canine D17, and 293T. AE6 viruses with changes in the proline-rich region initially adapted for growth on D17 cells could infect all cell types tested. AE6-based chimeras with additional mutations in the C terminus of SU could infect D17 and 293T cells. Infection of NIH 3T3 cells was dependent on the proline-rich mutation. AE7-based chimeras encoding L538Q and G100R were impaired in infecting NIH 3T3 and 293T cells. PMID:10623753

BAF57 Modulation of Androgen Receptor Action and Prostate Cancer Progression

DTIC Science & Technology

2006-12-01

has fine mapped the AR binding site on BAF57 to the N-terminus (proline-rich region). Furthermore, the DBD and hinge region of AR also appear to...Accomplishments of Task 1: BAF57 binds to DNA binding domain ( DBD ) and hinge region of AR As outlined in the initial proposal, the first task was to...construct are the well-characterized zinc finger DNA binding domain ( DBD ) and the hinge region. Given the significant role of these two domains in AR

The role of COMT and plasma proline in the variable penetrance of autistic spectrum symptoms in 22q11.2 deletion syndrome.

PubMed

Hidding, E; Swaab, H; de Sonneville, L M J; van Engeland, H; Vorstman, J A S

2016-11-01

This paper examines how COMT 158 genotypes and plasma proline levels are associated with variable penetrance of social behavioural and social cognitive problems in 22q11.2 deletion syndrome (22q11DS). Severity of autistic spectrum symptoms of 45 participants with 22q11DS was assessed using the Autism Diagnostic Interview Revised. Face and facial emotion recognition was evaluated using standardized computer-based test-paradigms. Associations with COMT 158 genotypes and proline levels were examined. High proline levels and poor face recognition in individuals with the COMT MET allele, and poor facial emotion recognition, explained almost 50% of the variance in severity of autism symptomatology in individuals with 22q11DS. High proline levels and a decreased capacity to break down dopamine as a result of the COMT MET variant are both relevant in the expression of the social phenotype in patients. This epistatic interaction effect between the COMT 158 genotype and proline on the expression of social deficits in 22q11DS shows how factors other than the direct effects of the deletion itself can modulate the penetrance of associated cognitive and behavioural outcomes. These findings are not only relevant to our insight into 22q11DS, but also provide a model to better understand the phenomenon of variable penetrance in other pathogenic genetic variants. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Non-disulfide-bridged peptides from Tityus serrulatus venom: Evidence for proline-free ACE-inhibitors.

PubMed

Pucca, Manuela Berto; Cerni, Felipe Augusto; Pinheiro-Junior, Ernesto Lopes; Zoccal, Karina Furlani; Bordon, Karla de Castro Figueiredo; Amorim, Fernanda Gobbi; Peigneur, Steve; Vriens, Kim; Thevissen, Karin; Cammue, Bruno Philippe Angelo; Júnior, Ronaldo Bragança Martins; Arruda, Eurico; Faccioli, Lúcia Helena; Tytgat, Jan; Arantes, Eliane Candiani

2016-08-01

The present study purifies two T. serrulatus non-disulfide-bridged peptides (NDBPs), named venom peptides 7.2 (RLRSKG) and 8 (KIWRS) and details their synthesis and biological activity, comparing to the synthetic venom peptide 7.1 (RLRSKGKK), previously identified. The synthetic replicate peptides were subjected to a range of biological assays: hemolytic, antifungal, antiviral, electrophysiological, immunological and angiotensin-converting enzyme (ACE) inhibition activities. All venom peptides neither showed to be cytolytic nor demonstrated significant antifungal or antiviral activities. Interestingly, peptides were able to modulate macrophages' responses, increasing IL-6 production. The three venom peptides also demonstrated potential to inhibit ACE in the following order: 7.2>7.1>8. The ACE inhibition activity was unexpected, since peptides that display this function are usually proline-rich peptides. In attempt to understand the origin of such small peptides, we discovered that the isolated peptides 7.2 and 8 are fragments of the same molecule, named Pape peptide precursor. Furthermore, the study discusses that Pape fragments could be originated from a post-splitting mechanism resulting from metalloserrulases and other proteinases cleavage, which can be seen as a clever mechanism used by the scorpion to enlarge its repertoire of venom components. Scorpion venom remains as an interesting source of bioactive proteins and this study advances our knowledge about three NDBPs and their biological activities. Copyright © 2016. Published by Elsevier Inc.

Enhancement of the proline and nitric oxide synthetic pathway improves fermentation ability under multiple baking-associated stress conditions in industrial baker's yeast

PubMed Central

2012-01-01

Background During the bread-making process, industrial baker's yeast, mostly Saccharomyces cerevisiae, is exposed to baking-associated stresses, such as air-drying and freeze-thaw stress. These baking-associated stresses exert severe injury to yeast cells, mainly due to the generation of reactive oxygen species (ROS), leading to cell death and reduced fermentation ability. Thus, there is a great need for a baker's yeast strain with higher tolerance to baking-associated stresses. Recently, we revealed a novel antioxidative mechanism in a laboratory yeast strain that is involved in stress-induced nitric oxide (NO) synthesis from proline via proline oxidase Put1 and N-acetyltransferase Mpr1. We also found that expression of the proline-feedback inhibition-less sensitive mutant γ-glutamyl kinase (Pro1-I150T) and the thermostable mutant Mpr1-F65L resulted in an enhanced fermentation ability of baker's yeast in bread dough after freeze-thaw stress and air-drying stress, respectively. However, baker's yeast strains with high fermentation ability under multiple baking-associated stresses have not yet been developed. Results We constructed a self-cloned diploid baker's yeast strain with enhanced proline and NO synthesis by expressing Pro1-I150T and Mpr1-F65L in the presence of functional Put1. The engineered strain increased the intracellular NO level in response to air-drying stress, and the strain was tolerant not only to oxidative stress but also to both air-drying and freeze-thaw stresses probably due to the reduced intracellular ROS level. We also showed that the resultant strain retained higher leavening activity in bread dough after air-drying and freeze-thaw stress than that of the wild-type strain. On the other hand, enhanced stress tolerance and fermentation ability did not occur in the put1-deficient strain. This result suggests that NO is synthesized in baker's yeast from proline in response to oxidative stresses that induce ROS generation and that increased NO

Enhancement of the proline and nitric oxide synthetic pathway improves fermentation ability under multiple baking-associated stress conditions in industrial baker's yeast.

PubMed

Sasano, Yu; Haitani, Yutaka; Hashida, Keisuke; Ohtsu, Iwao; Shima, Jun; Takagi, Hiroshi

2012-04-01

During the bread-making process, industrial baker's yeast, mostly Saccharomyces cerevisiae, is exposed to baking-associated stresses, such as air-drying and freeze-thaw stress. These baking-associated stresses exert severe injury to yeast cells, mainly due to the generation of reactive oxygen species (ROS), leading to cell death and reduced fermentation ability. Thus, there is a great need for a baker's yeast strain with higher tolerance to baking-associated stresses. Recently, we revealed a novel antioxidative mechanism in a laboratory yeast strain that is involved in stress-induced nitric oxide (NO) synthesis from proline via proline oxidase Put1 and N-acetyltransferase Mpr1. We also found that expression of the proline-feedback inhibition-less sensitive mutant γ-glutamyl kinase (Pro1-I150T) and the thermostable mutant Mpr1-F65L resulted in an enhanced fermentation ability of baker's yeast in bread dough after freeze-thaw stress and air-drying stress, respectively. However, baker's yeast strains with high fermentation ability under multiple baking-associated stresses have not yet been developed. We constructed a self-cloned diploid baker's yeast strain with enhanced proline and NO synthesis by expressing Pro1-I150T and Mpr1-F65L in the presence of functional Put1. The engineered strain increased the intracellular NO level in response to air-drying stress, and the strain was tolerant not only to oxidative stress but also to both air-drying and freeze-thaw stresses probably due to the reduced intracellular ROS level. We also showed that the resultant strain retained higher leavening activity in bread dough after air-drying and freeze-thaw stress than that of the wild-type strain. On the other hand, enhanced stress tolerance and fermentation ability did not occur in the put1-deficient strain. This result suggests that NO is synthesized in baker's yeast from proline in response to oxidative stresses that induce ROS generation and that increased NO plays an important

Application of L-proline derivatives as chiral shift reagents for enantiomeric recognition of carboxylic acids.

PubMed

Naziroglu, Hayriye Nevin; Durmaz, Mustafa; Bozkurt, Selahattin; Sirit, Abdulkadir

2011-07-01

Four proline-derived chiral receptors 5-8 were readily synthesized starting from L-proline. The enantiomeric recognition ability of chiral receptors was examined with a series of carboxylic acids by (1) H NMR spectroscopy. The molar ratio and the association constants of the chiral compounds with each of the enantiomers of guest molecules were determined by using Job plots and a nonlinear least-squares fitting method, respectively. The Job plots indicate that the hosts form 1:1 instantaneous complexes with all guests. The receptors exhibited different chiral recognition abilities toward the enantiomers of racemic guests. Among the chiral receptors used in this study, prolinamide 6 was found to be the best chiral shift reagent and is effective for the determination of the enantiomeric excess of chiral carboxylic acids. Copyright © 2011 Wiley-Liss, Inc.

Proline transport in Leishmania donovani amastigotes: dependence on pH gradients and membrane potential.

PubMed

Glaser, T A; Mukkada, A J

1992-03-01

Amastigotes of Leishmania donovani develop and multiply within the acidic phagolysosomes of mammalian macrophages. Isolated amastigotes are acidophilic; they catabolize substrates and synthesize macromolecules optimally at pH 5.5. Substrate transport in amastigotes has not been characterized. Here we show that amastigotes exhibit an uphill transport of proline (active transport) with an acid pH optimum (pH 5.5). It is dependent upon metabolic energy and is driven by proton motive force. Agents which selectively disturb the component forces of proton motive force, such as carbonyl cyanide chlorophenylhydrazone, nigericin and valinomycin, inhibit proline transport. Transport is sensitive to dicyclohexylcarbodiimide and insensitive to ouabain, demonstrating the involvement of a proton ATPase in the maintenance of proton motive force. It is suggested that the plasma membrane pH gradient probably makes the greatest contribution to proton motive force that drives substrate transport in the amastigote stage.

Effective Phytoextraction of Cadmium (Cd) with Increasing Concentration of Total Phenolics and Free Proline in Cannabis sativa (L) Plant Under Various Treatments of Fertilizers, Plant Growth Regulators and Sodium Salt.

PubMed

Ahmad, Ayaz; Hadi, Fazal; Ali, Nasir

2015-01-01

The comparative effect of fertilizers (NPK), plant growth regulators (GA3, IAA, Zeatin) and sodium chloride (NaCl) on Cd phytoaccumulation, proline and phenolics production in Cannabis sativa was evaluated. Proline and phenolices were correlated with Cd contents in plant. Cd significantly reduced the plant growth. Fertilizers application (in combination) most significantly increased the growth (19 cm root and 47 cm shoot) on Cd contaminated soil. All treatments increased the Cd contents in plant tissues. This increase was highly significant in fertilizers treated plants (1101, 121 and 544 ppm in roots, stem and leaves respectively). Significantly positive correlation was found between Cd concentration and dry biomass of root (R2=0.7511) and leaves (R2=0.5524). All treatments significantly increased the proline and total phenolics and maximum was recorded in NaCl treated plants followed by fertilizers. Proline was higher in roots while phenolics in leaves. The correlation between proline and phenolics was positive in leaf (R2=0.8439) and root (R2=0.5191). Proline and phenolics showed positive correlation with Cd concentration in plant. Conclusively, fertilizers in combination seem to be the better option for Cd phytoextraction. Further investigation is suggested to study the role of phenolics and proline in Cd phytoextraction.

In situ catalyst improvement in the proline-mediated alpha-amination of aldehydes.

PubMed

Iwamura, Hiroshi; Mathew, Suju P; Blackmond, Donna G

2004-09-29

Kinetic investigations show that the proline-mediated alpha-amination of aldehydes exhibits autoinductive rate behavior and amplification of product enantiomeric excess. Further experiments highlight the role of product, offering suggestions for the design of catalysts of improved efficiency for such transformations. The unusual characteristics exhibited by these reactions implicate amino acid catalysis in rationalizations of the origin of biological homochirality.

Synthesis of aryl azides and vinyl azides via proline-promoted CuI-catalyzed coupling reactions.

PubMed

Zhu, Wei; Ma, Dawei

2004-04-07

The coupling reaction of aryl halides or vinyl iodide with sodium azide under catalysis of CuI/L-proline works at relatively low temperature to provide aryl azides or vinyl azides in good to excellent yields.

Proline-induced kink in a helix arises primarily from dihedral angle energy: a molecular dynamics simulation on alamethicin

NASA Astrophysics Data System (ADS)

Cheng, Shu-Fang; Chang, Ding-Kwo

1999-03-01

To investigate the cause of the kink in a helix induced by proline, a restrained molecular dynamics simulation was performed on alamethicin (Alm), a channel-forming peptide. Results on the linear and kinked helices indicated that the kinked form has lower energy than the linear one and the difference can be attributed largely to the dihedral angle term. The argument is strengthened by calculated results on the peptide in which proline 14 was substituted by alanine. The kinked and linear forms had virtually the same total and dihedral angle energies for the alanine analog. Possible implications for Alm voltage-gating are discussed.

2,3-trans-3,4-trans-3,4-Dihydroxy-L-proline: An amino acid in toxic peptides of Amanita virosa mushrooms

PubMed Central

Buku, A.; Faulstich, H.; Wieland, T.; Dabrowski, J.

1980-01-01

Among the four possible stereoisomers of 3,4-dihydroxy-L-proline,2,3-trans-3,4-trans-3,4-dihydroxy-L-proline (IV) had not been found in nature previously. It has now been detected as a component of virotoxins, toxic peptides of Amanita virosa mushrooms. Because periodate failed to effect an oxidative glycol splitting reaction, the two hydroxyl groups in positions 3 and 4 were expected to be in a trans configuration. Furthermore, the formation of a 4-lactone on treatment with acids pointed to the carboxyl group and the hydroxyl group at position 4 being in a cis configuration. These results are in agreement with structure IV only. Final proof for structure IV was given by NMR spectroscopy and direct comparison with the 2,3-cis-3,4-trans-3,4-dihydroxy-L-proline isomer. PMID:16592813

Tuberous sclerosis: aberrant metabolism of ornithine, proline and glutamate in cultured fibroblasts.

PubMed

Tanaka, H; Nakazawa, K; Arima, M; Hayashi, A

1987-01-01

To investigate aberrant metabolism of proline (Pro) and its precursors in tuberous sclerosis (TS), 6, 7 and 5 strains of control, TS (normal skin) and TS (tumor) fibroblasts, respectively, were cultured in Eagle's MEM containing dialyzed fetal bovine serum with or without 0.1 mM ornithine (Orn). Ornithine aminotransferase (OAT) activity was decreased in TS, especially in TS (tumor) after mild sonication treatment. The yield of the OAT protein was inhibited in TS (tumor) when cultured without Orn. Free glutamate (Glu) in the medium was significantly increased in TS (tumor). Free proline (Pro) in cells was significantly decreased in TS (tumor) when cultured with Orn, but protein-bound Pro was not. The relative concentration of free Glu to glutamine (Gln) in the medium and that of free Glu to Pro in cells cultured with Orn were increased in TS (tumor). These results suggest that the requirement for Orn, increased turnover of Pro to Glu and increased elimination of Glu into the medium occur in TS (tumor). Aberrant regulation or turnover of Pro and Glu metabolism may occur in TS, especially in tumor cells.

Influence of NaCl on Growth, Proline, and Phosphoenolpyruvate Carboxylase Levels in Mesembryanthemum crystallinum Suspension Cultures 1

PubMed Central

Thomas, John C.; De Armond, Richard L.; Bohnert, Hans J.

1992-01-01

The facultative halophyte Mesembryanthemum crystallinum responds to salt stress by increasing the levels of phosphoenolpyruvate carboxylase (PEPCase) and other enzymes associated with Crassulacean acid metabolism. A more common response to salt stress in sensitive and tolerant species, including M. crystallinum, is the accumulation of proline. We have established M. crystallinum suspension cultures to investigate whether both these salt-induced responses occur at the cellular level. Leaf-and root-derived cultures maintain 5% of the total soluble amino acids as proline. Cell culture growth slows upon addition of 400 millimolar NaCl, and proline levels increase to 40% of the total soluble amino acids. These results suggest a functional salt-stress and response program in Mesembryanthemum cells. Suspension cultures grown with or without 400 millimolar NaCl have PEPCase levels that compare with those from roots and unstressed leaves. The predominant protein cross-reacting with an anti-PEPCase antibody corresponds to 105 kilodaltons (apparent molecular mass), whereas a second species of approximately 110 kilodaltons is present at low levels. In salt-stressed leaves, the 110 kilodalton protein is more prevalent. Levels of mRNA for both ppc1 (salt stress induced in leaves) and ppc2 (constitutive) genes in salt-treated suspensions cultures are equal to unstressed leaves, and only twice the levels found in untreated suspension cultures. Whereas cells accumulate proline in response to NaCl, PEPCase protein amounts remain similar in salt-treated and untreated cultures. The induction upon salt stress of the 110 kilodalton PEPCase protein and other Crassulacean acid metabolism enzymes in organized tissues is not observed in cell culture and may depend on tissue-dependent or photoautotrophy-dependent programs. ImagesFigure 4Figure 5 PMID:16668687

A leucine-to-proline substitution causes a defective [alpha]-antichymotrypsin allele associated with familial obstructive lung disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poller, W.; Scholz, S.; Fischer, M.

1993-09-01

Using denaturing gradient gel electrophoresis and direct sequencing of amplified genomic DNA, the authors have identified two defective mutants of the human [alpha][sub 1]-antichymotrypsin (ACT) gene associated with chronic obstructive pulmonary disease (COPD). A leucine 55-to-proline substitution causing a defective ACT allele (Bochum-1) was observed in a family with COPD in three subsequent generations. Another mutation, proline 229-to-alanine (Bonn-1), was associated with ACT serum deficiency in four patients with a positive family history. These mutations were not detected among 100 healthy control subjects, suggesting a possible pathogenetic role of ACT gene defects in a subset of patients with COPD. 14more » refs., 1 fig., 1 tab.« less

Thermally reversible gels based on acryloyl- L-proline methyl ester as drug delivery systems

NASA Astrophysics Data System (ADS)

Martellini, Flavia; Higa, Olga Z.; Takacs, Erzsebet; Safranj, Agneza; Yoshida, Masaru; Katakai, Ryoichi; Carenza, Mario

1999-06-01

Thermally reversible hydrogels were synthesized by radiation-induced copolymerization of acryloyl- L-proline methyl ester with hydrophilic or hydrophobic monomers. The swelling behaviour was found to be affected by a proper balance of the latter. In particular, the transition temperature of the different hydrogels shifted to higher or lower values depending on the presence of hydrophilic or hydrophobic moieties in the polymer chain, respectively. Acetaminophen, an analgesic and antipyretic drug, was entrapped into some hydrogels and a wide range of release rates was obtained according to the nature of the comonomers. A novel thermoresponsive hydrogel was also prepared by radiation polymerization of acryloyl- L-proline methyl ester in the presence of 4-acryloyloxy acetanilide, an acrylic derivative of acetaminophen. Again, the swelling curves showed an inverse function of temperature. It was shown that with this hydrogel bearing the drug covalently attached to the polymer backbone, the hydrolysis process was the rate-determining process of the drug release.

Expression of small leucine-rich proteoglycans in rat anterior pituitary gland.

PubMed

Horiguchi, Kotaro; Syaidah, Rahimi; Fujiwara, Ken; Tsukada, Takehiro; Ramadhani, Dini; Jindatip, Depicha; Kikuchi, Motoshi; Yashiro, Takashi

2013-01-01

Proteoglycans are components of the extracellular matrix and comprise a specific core protein substituted with covalently linked glycosaminoglycan chains. Small leucine-rich proteoglycans (SLRPs) are a major family of proteoglycans and have key roles as potent effectors in cellular signaling pathways. Research during the last two decades has shown that SLRPs regulate biological functions in many tissues such as skin, tendon, kidney, liver, and heart. However, little is known of the expression of SLRPs, or the characteristics of the cells that produce them, in the anterior pituitary gland. Therefore, we have determined whether SLRPs are present in rat anterior pituitary gland. We have used real-time reverse transcription with the polymerase chain reaction to analyze the expression of SLRP genes and have identified the cells that produce SLRPs by using in situ hybridization with a digoxigenin-labeled cRNA probe. We have clearly detected the mRNA expression of SLRP genes, and cells expressing decorin, biglycan, fibromodulin, lumican, proline/arginine-rich end leucine-rich repeat protein (PRELP), and osteoglycin are located in the anterior pituitary gland. We have also investigated the possible double-staining of SLRP mRNA and pituitary hormones, S100 protein (a marker of folliculostellate cells), desmin (a marker of capillary pericytes), and isolectin B4 (a marker of endothelial cells). Decorin, biglycan, fibromodulin, lumican, PRELP, and osteoglycin mRNA have been identified in S100-protein-positive and desmin-positive cells. Thus, we conclude that folliculostellate cells and pericytes produce SLRPs in rat anterior pituitary gland.

Vertebrate richness and biogeography in the Big Thicket of Texas

Treesearch

Michael H MacRoberts; Barbara R. MacRoberts; D. Craig Rudolph

2010-01-01

The Big Thicket of Texas has been described as rich in species and a “crossroads:” a place where organisms from many different regions meet. We examine the species richness and regional affiliations of Big Thicket vertebrates. We found that the Big Thicket is neither exceptionally rich in vertebrates nor is it a crossroads for vertebrates. Its vertebrate fauna is...

cis-Proline-mediated Ser(P)[superscript 5] Dephosphorylation by the RNA Polymerase II C-terminal Domain Phosphatase Ssu72

DOE Office of Scientific and Technical Information (OSTI.GOV)

Werner-Allen, Jon W.; Lee, Chul-Jin; Liu, Pengda

2012-05-16

RNA polymerase II coordinates co-transcriptional events by recruiting distinct sets of nuclear factors to specific stages of transcription via changes of phosphorylation patterns along its C-terminal domain (CTD). Although it has become increasingly clear that proline isomerization also helps regulate CTD-associated processes, the molecular basis of its role is unknown. Here, we report the structure of the Ser(P){sup 5} CTD phosphatase Ssu72 in complex with substrate, revealing a remarkable CTD conformation with the Ser(P){sup 5}-Pro{sup 6} motif in the cis configuration. We show that the cis-Ser(P){sup 5}-Pro{sup 6} isomer is the minor population in solution and that Ess1-catalyzed cis-trans-proline isomerizationmore » facilitates rapid dephosphorylation by Ssu72, providing an explanation for recently discovered in vivo connections between these enzymes and a revised model for CTD-mediated small nuclear RNA termination. This work presents the first structural evidence of a cis-proline-specific enzyme and an unexpected mechanism of isomer-based regulation of phosphorylation, with broad implications for CTD biology« less

CO2 and CH4 emissions from streams in a lake-rich landscape: Patterns, controls, and regional significance

USGS Publications Warehouse

Crawford, John T.; Lottig, Noah R.; Stanley, Emily H.; Walker, John F.; Hanson, Paul C.; Finlay, Jacques C.; Striegl, Robert G.

2014-01-01

Aquatic ecosystems are important components of landscape carbon budgets. In lake-rich landscapes, both lakes and streams may be important sources of carbon gases (CO2 and CH4) to the atmosphere, but the processes that control gas concentrations and emissions in these interconnected landscapes have not been adequately addressed. We use multiple data sets that vary in their spatial and temporal extent during 2001–2012 to investigate the carbon gas source strength of streams in a lake-rich landscape and to determine the contribution of lakes, metabolism, and groundwater to stream CO2 and CH4. We show that streams emit roughly the same mass of CO2 (23.4 Gg C yr−1; 0.49 mol CO2 m−2 d−1) as lakes at a regional scale (27 Gg C yr−1) and that stream CH4 emissions (189 Mg C yr−1; 8.46 mmol CH4 m−2 d−1) are an important component of the regional greenhouse gas balance. Gas transfer velocity variability (range = 0.34 to 13.5 m d−1) contributed to the variability of gas flux in this landscape. Groundwater inputs and in-stream metabolism control stream gas supersaturation at the landscape scale, while carbon cycling in lakes and deep groundwaters does not control downstream gas emissions. Our results indicate the need to consider connectivity of all aquatic ecosystems (lakes, streams, wetlands, and groundwater) in lake-rich landscapes and their connections with the terrestrial environment in order to understand the full nature of the carbon cycle.

Microscopic multiphonon approach to spectroscopy in the neutron-rich oxygen region

NASA Astrophysics Data System (ADS)

De Gregorio, G.; Knapp, F.; Lo Iudice, N.; Veselý, P.

2018-03-01

Background: A fairly rich amount of experimental spectroscopic data have disclosed intriguing properties of the nuclei in the region of neutron rich oxygen isotopes up to the neutron dripline. They, therefore, represent a unique laboratory for studying the evolution of nuclear structure away from the stability line. Purpose: We intend to give an exhaustive microscopic description of low and high energy spectra, dipole response, weak, and electromagnetic properties of the even 22O and the odd 23O and 23F. Method: An equation of motion phonon method generates an orthonormal basis of correlated n -phonon states (n =0 ,1 ,2 ,⋯ ) built of constituent Tamm-Dancoff phonons. This basis is adopted to solve the full eigenvalue equations in even nuclei and to construct an orthonormal particle-core basis for the eigenvalue problem in odd nuclei. No approximations are involved and the Pauli principle is taken into full account. The method is adopted to perform self-consistent, parameter free, calculations using an optimized chiral nucleon-nucleon interaction in a space encompassing up to two-phonon basis states. Results: The computed spectra in 22O and 23O and the dipole cross section in 22O are in overall agreement with the experimental data. The calculation describes poorly the spectrum of 23F. Conclusions: The two-phonon configurations play a crucial role in the description of spectra and transitions. The large discrepancies concerning the spectra of 23F are ultimately traced back to the large separation between the Hartree-Fock levels belonging to different major shells. We suggest that a more compact single particle spectrum is needed and can be generated by a new chiral potential which includes explicitly the contribution of the three-body forces.

Water footprint characteristic of less developed water-rich regions: Case of Yunnan, China.

PubMed

Qian, Yiying; Dong, Huijuan; Geng, Yong; Zhong, Shaozhuo; Tian, Xu; Yu, Yanhong; Chen, Yihui; Moss, Dana Avery

2018-03-30

Rapid industrialization and urbanization pose pressure on water resources in China. Virtual water trade proves to be an increasingly useful tool in water stress alleviation for water-scarce regions, while bringing opportunities and challenges for less developed water-rich regions. In this study, Yunnan, a typical province in southwest China, was selected as the case study area to explore its potential in socio-economic development in the context of water sustainability. Both input-output analysis and structural decomposition analysis on Yunnan's water footprint for the period of 2002-2012 were performed at not only an aggregated level but also a sectoral level. Results show that although the virtual water content of all economic sectors decreased due to technological progress, Yunnan's total water footprint still increased as a result of economic scale expansion. From the sectoral perspective, sectors with large water footprints include construction sector, agriculture sector, food manufacturing & processing sector, and service sector, while metal products sector and food manufacturing & processing sector were the major virtual water exporters, and textile & clothing sector and construction sector were the major importers. Based on local conditions, policy suggestions were proposed, including economic structure and efficiency optimization, technology promotion and appropriate virtual water trade scheme. This study provides valuable insights for regions facing "resource curse" by exploring potential socio-economic progress while ensuring water security. Copyright © 2018 Elsevier Ltd. All rights reserved.

Bridge over troubled proline: assignment of intrinsically disordered proteins using (HCA)CON(CAN)H and (HCA)N(CA)CO(N)H experiments concomitantly with HNCO and i(HCA)CO(CA)NH.

PubMed

Hellman, Maarit; Piirainen, Henni; Jaakola, Veli-Pekka; Permi, Perttu

2014-01-01

NMR spectroscopy is by far the most versatile and information rich technique to study intrinsically disordered proteins (IDPs). While NMR is able to offer residue level information on structure and dynamics, assignment of chemical shift resonances in IDPs is not a straightforward process. Consequently, numerous pulse sequences and assignment protocols have been developed during past several years, targeted especially for the assignment of IDPs, including experiments that employ H(N), H(α) or (13)C detection combined with two to six indirectly detected dimensions. Here we propose two new HN-detection based pulse sequences, (HCA)CON(CAN)H and (HCA)N(CA)CO(N)H, that provide correlations with (1)H(N)(i - 1), (13)C'(i - 1) and (15)N(i), and (1)H(N)(i + 1), (13)C'(i) and (15)N(i) frequencies, respectively. Most importantly, they offer sequential links across the proline bridges and enable filling the single proline gaps during the assignment. We show that the novel experiments can efficiently complement the information available from existing HNCO and intraresidual i(HCA)CO(CA)NH pulse sequences and their concomitant usage enabled >95 % assignment of backbone resonances in cytoplasmic tail of adenosine receptor A2A in comparison to 73 % complete assignment using the HNCO/i(HCA)CO(CA)NH data alone.

The structure of Medicago truncatula δ 1-pyrroline-5-carboxylate reductase provides new insights into regulation of proline biosynthesis in plants

DOE PAGES

Ruszkowski, Milosz; Nocek, Boguslaw; Forlani, Giuseppe; ...

2015-10-30

The two pathways for proline biosynthesis in higher plants share the last step, the conversion of δ 1-pyrroline-5-carboxylate (P5C) to L-proline, which is catalyzed by P5C reductase (P5CR, EC 1.5.1.2) with the use of NAD(P)H as a coenzyme. There is increasing amount of evidence to suggest a complex regulation of P5CR activity at the post-translational level, yet the molecular basis of these mechanisms is unknown. Here we report the three-dimensional structure of the P5CR enzyme from the model legume Medicago truncatula (Mt). The crystal structures of unliganded MtP5CR decamer, and its complexes with the products NAD +, NADP +, andmore » L-proline were refined using x-ray diffraction data (at 1.7, 1.85, 1.95, and 2.1 Å resolution, respectively). Based on the presented structural data, the coenzyme preference for NADPH over NADH was explained, and NADPH is suggested to be the only coenzyme used by MtP5CR in vivo. Moreover, the insensitivity of MtP5CR to feed-back inhibition by proline, revealed by enzymatic analysis, was correlated with structural features. Additionally, a mechanism for the modulation of enzyme activity by chloride anions is discussed, as well as the rationale for the possible development of effective enzyme inhibitors.« less

Ketonization of Proline Residues in the Peptide Chains of Actinomycins by a 4-Oxoproline Synthase.

PubMed

Semsary, Siamak; Crnovčić, Ivana; Driller, Ronja; Vater, Joachim; Loll, Bernhard; Keller, Ullrich

2018-04-04

X-type actinomycins (Acms) contain 4-hydroxyproline (Acm X 0 ) or 4-oxoproline (Acm X 2 ) in their β-pentapeptide lactone rings, whereas their α ring contains proline. We demonstrate that these Acms are formed through asymmetric condensation of Acm half molecules (Acm halves) containing proline with 4-hydroxyproline- or 4-oxoproline-containing Acm halves. In turn, we show-using an artificial Acm half analogue (PPL 1) with proline in its peptide chain-their conversion into the 4-hydroxyproline- and 4-oxoproline-containing Acm halves, PPL 0 and PPL 2, in mycelial suspensions of Streptomyces antibioticus. Two responsible genes of the Acm X biosynthetic gene cluster of S. antibioticus, saacmM and saacmN, encoding a cytochrome P450 monooxygenase (Cyp) and a ferredoxin were identified. After coexpression in Escherichia coli, their gene products converted PPL 1 into PPL 0 and PPL 2 in vivo as well as in situ in permeabilized cell of the transformed E. coli strain in conjunction with the host-encoded ferredoxin reductase in a NADH (NADPH)-dependent manner. saAcmM has high sequence similarity to the Cyp107Z (Ema) family of Cyps, which can convert avermectin B1 into its keto derivative, 4''-oxoavermectin B1. Determination of the structure of saAcmM reveals high similarity to the Ema structure but with significant differences in residues decorating their active sites, which defines saAcmM and its orthologues as a distinct new family of peptidylprolineketonizing Cyp. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Proline Accumulation in Maize (Zea mays L.) Primary Roots at Low Water Potentials. II. Metabolic Source of Increased Proline Deposition in the Elongation Zone1

PubMed Central

Verslues, Paul E.; Sharp, Robert E.

1999-01-01

The proline (Pro) concentration increases greatly in the growing region of maize (Zea mays L.) primary roots at low water potentials (ψw), largely as a result of an increased net rate of Pro deposition. Labeled glutamate (Glu), ornithine (Orn), or Pro was supplied specifically to the root tip of intact seedlings in solution culture at high and low ψw to assess the relative importance of Pro synthesis, catabolism, utilization, and transport in root-tip Pro deposition. Labeling with [3H]Glu indicated that Pro synthesis from Glu did not increase substantially at low ψw and accounted for only a small fraction of the Pro deposition. Labeling with [14C]Orn showed that Pro synthesis from Orn also could not be a substantial contributor to Pro deposition. Labeling with [3H]Pro indicated that neither Pro catabolism nor utilization in the root tip was decreased at low ψw. Pro catabolism occurred at least as rapidly as Pro synthesis from Glu. There was, however, an increase in Pro uptake at low ψw, which suggests increased Pro transport. Taken together, the data indicate that increased transport of Pro to the root tip serves as the source of low-ψw-induced Pro accumulation. The possible significance of Pro catabolism in sustaining root growth at low ψw is also discussed. PMID:10198094

Effect of water withdrawal on formation of free radical, proline accumulation and activities of antioxidant enzymes in ZAT12-transformed transgenic tomato plants.

PubMed

Chandra Rai, Avinash; Singh, Major; Shah, Kavita

2012-12-01

Water stress often leads to the accumulation of reactive oxygen species (ROS) and their excessive production alters the activities of enzymes involved in their removal. ZAT12 is a member of stress-responsive C(2)H(2) type Zinc Finger Protein (ZFP) reported to control the expression of several stress-activated genes in plants through ROS signaling. The ZAT12-transformed tomato lines (cv. H-86 variety Kashi Vishesh) when subjected to water withdrawal for 7, 14 and 21 days revealed significant and consistent changes in activities of enzymes SOD, CAT, APX, GR and POD paralleled with an increased proline levels. Unlike that in wild-type tomato, the leaf superoxide anion and hydrogen peroxide concentrations in the transformed tomato plants did not alter much, suggesting a well regulated formation of free radicals suppressing oxidative stress in the latter. Results suggest BcZAT12-transformed tomato lines ZT1, ZT2 and ZT6 to be better adapted to drought stress tolerance by accumulation of osmolyte proline and increased antioxidant response triggered by the ZAT12 gene. Therefore, the ZAT12-transformed tomato cv. H-86 lines will prove useful for higher yield of tomato crop in regions affected with severe drought stress. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Searching for high-K isomers in the proton-rich A ˜ 80 mass region

NASA Astrophysics Data System (ADS)

Bai, Zhi-Jun; Jiao, Chang-Feng; Gao, Yuan; Xu, Fu-Rong

2016-09-01

Configuration-constrained potential-energy-surface calculations have been performed to investigate the K isomerism in the proton-rich A ˜ 80 mass region. An abundance of high-K states are predicted. These high-K states arise from two and four-quasi-particle excitations, with Kπ = 8+ and Kπ = 16+, respectively. Their excitation energies are comparatively low, making them good candidates for long-lived isomers. Since most nuclei under study are prolate spheroids in their ground states, the oblate shapes of the predicted high-K states may indicate a combination of K isomerism and shape isomerism. Supported by National Key Basic Research Program of China (2013CB834402) and National Natural Science Foundation of China (11235001, 11320101004 and 11575007)

Silica-rich deposits and hydrated minerals at Gusev Crater, Mars: Vis-NIR spectral characterization and regional mapping

USGS Publications Warehouse

Rice, M.S.; Bell, J.F.; Cloutis, E.A.; Wang, A.; Ruff, S.W.; Craig, M.A.; Bailey, D.T.; Johnson, J. R.; De Souza, P.A.; Farrand, W. H.

2010-01-01

The Mars Exploration Rover (MER) Spirit has discovered surprisingly high concentrations of amorphous silica in soil and nodular outcrops in the Inner Basin of the Columbia Hills. In Pancam multispectral observations, we find that an absorption feature at the longest Pancam wavelength (1009 nm) appears to be characteristic of these silica-rich materials; however, spectral analyses of amorphous silica suggest that the ???1009 nm spectral feature is not a direct reflection of their silica-rich nature. Based on comparisons with spectral databases, we hypothesize that the presence of H2O or OH, either free (as water ice), adsorbed or bound in a mineral structure, is responsible for the spectral feature observed by Pancam. The Gertrude Weise soil, which is nearly pure opaline silica, may have adsorbed water cold-trapped on mineral grains. The origin of the ???1009 nm Pancam feature observed in the silica-rich nodular outcrops may result from the presence of additional hydrated minerals (specific sulfates, halides, chlorides, sodium silicates, carbonates or borates). Using the ???1009 nm feature with other spectral parameters as a "hydration signature" we have mapped the occurrence of hydrated materials along the extent of Spirit's traverse across the Columbia Hills from West Spur to Home Plate (sols 155-1696). We have also mapped this hydration signature across large panoramic images to understand the regional distribution of materials that are spectrally similar to the silica-rich soil and nodular outcrops. Our results suggest that hydrated materials are common in the Columbia Hills. ?? 2009 Elsevier Inc.

Proline and COMT Status Affect Visual Connectivity in Children with 22q11.2 Deletion Syndrome

PubMed Central

Magnée, Maurice J. C. M.; Lamme, Victor A. F.; de Sain-van der Velden, Monique G. M.; Vorstman, Jacob A. S.; Kemner, Chantal

2011-01-01

Background Individuals with the 22q11.2 deletion syndrome (22q11DS) are at increased risk for schizophrenia and Autism Spectrum Disorders (ASDs). Given the prevalence of visual processing deficits in these three disorders, a causal relationship between genes in the deleted region of chromosome 22 and visual processing is likely. Therefore, 22q11DS may represent a unique model to understand the neurobiology of visual processing deficits related with ASD and psychosis. Methodology We measured Event-Related Potentials (ERPs) during a texture segregation task in 58 children with 22q11DS and 100 age-matched controls. The C1 component was used to index afferent activity of visual cortex area V1; the texture negativity wave provided a measure for the integrity of recurrent connections in the visual cortical system. COMT genotype and plasma proline levels were assessed in 22q11DS individuals. Principal Findings Children with 22q11DS showed enhanced feedforward activity starting from 70 ms after visual presentation. ERP activity related to visual feedback activity was reduced in the 22q11DS group, which was seen as less texture negativity around 150 ms post presentation. Within the 22q11DS group we further demonstrated an association between high plasma proline levels and aberrant feedback/feedforward ratios, which was moderated by the COMT 158 genotype. Conclusions These findings confirm the presence of early visual processing deficits in 22q11DS. We discuss these in terms of dysfunctional synaptic plasticity in early visual processing areas, possibly associated with deviant dopaminergic and glutamatergic transmission. As such, our findings may serve as a promising biomarker related to the development of schizophrenia among 22q11DS individuals. PMID:21998713

The use of Proline (Prothioconazole) to control pitch canker, Rhizoctonia foliage blight, and Fusiform rust in forest seedling nurseries and efforts to acquire registration

Treesearch

Tom E. Starkey; Scott A. Enebak

2011-01-01

Laboratory, greenhouse, and field trials have shown Proline® to be efficacious against three fungal pathogens that cause damage and seedling mortality in forest seedling nurseries. Disease control using Proline® has been obtained at 365 ml/ha (5 fl oz/ac) for the control of fusiform rust (Cronartium quercuum f.sp. fusiforme) on loblolly pine (Pinus taeda) in both...

Conformation of a Group 2 Late Embryogenesis Abundant Protein from Soybean. Evidence of Poly (l-Proline)-type II Structure1

PubMed Central

Soulages, Jose L.; Kim, Kangmin; Arrese, Estela L.; Walters, Christina; Cushman, John C.

2003-01-01

Late embryogenesis abundant (LEA) proteins are members of a large group of hydrophilic, glycine-rich proteins found in plants, algae, fungi, and bacteria known collectively as hydrophilins that are preferentially expressed in response to dehydration or hyperosmotic stress. Group 2 LEA (dehydrins or responsive to abscisic acid) proteins are postulated to stabilize macromolecules against damage by freezing, dehydration, ionic, or osmotic stress. However, the structural and physicochemical properties of group 2 LEA proteins that account for such functions remain unknown. We have analyzed the structural properties of a recombinant form of a soybean (Glycine max) group 2 LEA (rGmDHN1). Differential scanning calorimetry of purified rGmDHN1 demonstrated that the protein does not display a cooperative unfolding transition upon heating. Ultraviolet absorption and circular dichroism spectroscopy revealed that the protein is in a largely hydrated and unstructured conformation in solution. However, ultraviolet absorption and circular dichroism measurements collected at different temperatures showed that the protein exists in equilibrium between two extended conformational states: unordered and left-handed extended helical or poly (l-proline)-type II structures. It is estimated that 27% of the residues of rGmDHN1 adopt or poly (l-proline)-type II-like helical conformation at 12°C. The content of extended helix gradually decreases to 15% as the temperature is increased to 80°C. Studies of the conformation of the protein in solution in the presence of liposomes, trifluoroethanol, and sodium dodecyl sulfate indicated that rGmDHN1 has a very low intrinsic ability to adopt α-helical structure and to interact with phospholipid bilayers through amphipathic α-helices. The ability of the protein to remain in a highly extended conformation at low temperatures could constitute the basis of the functional role of GmDHN1 in the prevention of freezing, desiccation, ionic, or osmotic

Skipper Richness (Hesperiidae) Along Elevational Gradients in Brazilian Atlantic Forest.

PubMed

Carneiro, E; Mielke, O H H; Casagrande, M M; Fiedler, K

2014-02-01

Hesperiidae are claimed to be a group of elusive butterflies that need major effort for sampling, thus being frequently omitted from tropical butterfly surveys. As no studies have associated species richness patterns of butterflies with environmental gradients of high altitudes in Brazil, we surveyed Hesperiidae ensembles in Serra do Mar along elevational transects (900-1,800 m above sea level) on three mountains. Transects were sampled 11-12 times on each mountain to evaluate how local species richness is influenced by mountain region, vegetation type, and elevational zones. Patterns were also analyzed for the subfamilies, and after disregarding species that exhibit hilltopping behavior. Species richness was evaluated by the observed richness, Jacknife2 estimator and Chao 1 estimator standardized by sample coverage. Overall, 155 species were collected, but extrapolation algorithms suggest a regional richness of about 220 species. Species richness was far higher in forest than in early successional vegetation or grassland. Richness decreased with elevation, and was higher on Anhangava mountain compared with the two others. Patterns were similar between observed and extrapolated Jacknife2 richness, but vegetation type and mountain richness became altered using sample coverage standardization. Hilltopping species were more easily detected than species that do not show this behavior; however, their inclusion did neither affect estimated richness nor modify the shape of the species accumulation curve. This is the first contribution to systematically study highland butterflies in southern Brazil where all records above 1,200 m are altitudinal extensions of the known geographical ranges of skipper species in the region.

Pathogenic proline mutation in the linker between spectrin repeats: disease caused by spectrin unfolding

PubMed Central

Johnson, Colin P.; Gaetani, Massimiliano; Ortiz, Vanessa; Bhasin, Nishant; Harper, Sandy

2007-01-01

Pathogenic mutations in α and β spectrin result in a variety of syndromes, including hereditary elliptocytosis (HE), hereditary pyropoikilocytosis (HPP), and hereditary spherocytosis (HS). Although some mutations clearly lie at sites of interaction, such as the sites of spectrin α-βtetramer formation, a surprising number of HE-causing mutations have been identified within linker regions between distal spectrin repeats. Here we apply solution structural and single molecule methods to the folding and stability of recombinant proteins consisting of the first 5 spectrin repeats of α-spectrin, comparing normal spectrin with a pathogenic linker mutation, Q471P, between repeats R4 and R5. Results show that the linker mutation destabilizes a significant fraction of the 5-repeat construct at 37°C, whereas the WT remains fully folded well above body temperature. In WT protein, helical linkers propagate stability from one repeat to the next, but the mutation disrupts the stabilizing influence of adjacent repeats. The results suggest a molecular mechanism for the high frequency of disease caused by proline mutations in spectrin linkers. PMID:17192394

Isolation of glycine betaine and proline betaine from human urine. Assessment of their role as osmoprotective agents for bacteria and the kidney.

PubMed Central

Chambers, S T; Kunin, C M

1987-01-01

Human urine is osmoprotective for enteric bacteria, permitting E. coli to grow with high concentrations of NaCl and other salts and even higher concentrations of sucrose and mannitol but not urea. The active material in urine is soluble in methanol and is precipitated by ammonium reineckate at acid pH. Using gel filtration and high-pressure liquid chromatography, we have identified two major osmoprotective compounds in urine. One is glycine betaine; the other is proline betaine as demonstrated by nuclear magnetic resonance, mass spectrum scanning, and chemical synthesis. Proline betaine has not been described previously to our knowledge in vertebrate tissues. It is known to be a cell volume-regulating agent for marine red algae and the euryhaline mollusk Elysia chloritica. We suggest that the presence of glycine and proline betaines in human urine may reflect an osmoprotective role for the kidney and that they protect bacteria in the urine only fortuitously. PMID:3546377

Glioma Specific Extracellular Missense Mutations in the First Cysteine Rich Region of Epidermal Growth Factor Receptor (EGFR) Initiate Ligand Independent Activation

PubMed Central

Ymer, Susie I.; Greenall, Sameer A.; Cvrljevic, Anna; Cao, Diana X.; Donoghue, Jacqui F.; Epa, V. Chandana; Scott, Andrew M.; Adams, Timothy E.; Johns, Terrance G.

2011-01-01

The epidermal growth factor receptor (EGFR) is overexpressed or mutated in glioma. Recently, a series of missense mutations in the extracellular domain (ECD) of EGFR were reported in glioma patients. Some of these mutations clustered within a cysteine-rich region of the EGFR targeted by the therapeutic antibody mAb806. This region is only exposed when EGFR activates and appears to locally misfold during activation. We expressed two of these mutations (R324L and E330K) in NR6 mouse fibroblasts, as they do not express any EGFR-related receptors. Both mutants were autophosphorylated in the absence of ligand and enhanced cell survival and anchorage-independent and xenograft growth. The ECD truncation that produces the de2-7EGFR (or EGFRvIII), the most common EGFR mutation in glioma, generates a free cysteine in this same region. Using a technique optimized for detecting disulfide-bonded dimers, we definitively demonstrated that the de2-7EGFR is robustly dimerized and that ablation of the free cysteine prevents dimerization and activation. Modeling of the R324L mutation suggests it may cause transient breaking of disulfide bonds, leading to similar disulfide-bonded dimers as seen for the de2-7EGFR. These ECD mutations confirm that the cysteine-rich region of EGFR around the mAb806 epitope has a significant role in receptor activation. PMID:24212795

Structural and functional analysis of the yeast N-acetyltransferase Mpr1 involved in oxidative stress tolerance via proline metabolism

PubMed Central

Nasuno, Ryo; Hirano, Yoshinori; Itoh, Takafumi; Hakoshima, Toshio; Hibi, Takao; Takagi, Hiroshi

2013-01-01

Mpr1 (sigma1278b gene for proline-analog resistance 1), which was originally isolated as N-acetyltransferase detoxifying the proline analog l-azetidine-2-carboxylate, protects yeast cells from various oxidative stresses. Mpr1 mediates the l-proline and l-arginine metabolism by acetylating l-Δ1-pyrroline-5-carboxylate, leading to the l-arginine–dependent production of nitric oxide, which confers oxidative stress tolerance. Mpr1 belongs to the Gcn5-related N-acetyltransferase (GNAT) superfamily, but exhibits poor sequence homology with the GNAT enzymes and unique substrate specificity. Here, we present the X-ray crystal structure of Mpr1 and its complex with the substrate cis-4-hydroxy-l-proline at 1.9 and 2.3 Å resolution, respectively. Mpr1 is folded into α/β-structure with eight-stranded mixed β-sheets and six α-helices. The substrate binds to Asn135 and the backbone amide of Asn172 and Leu173, and the predicted acetyl-CoA–binding site is located near the backbone amide of Phe138 and the side chain of Asn178. Alanine substitution of Asn178, which can interact with the sulfur of acetyl-CoA, caused a large reduction in the apparent kcat value. The replacement of Asn135 led to a remarkable increase in the apparent Km value. These results indicate that Asn178 and Asn135 play an important role in catalysis and substrate recognition, respectively. Such a catalytic mechanism has not been reported in the GNAT proteins. Importantly, the amino acid substitutions in these residues increased the l-Δ1-pyrroline-5-carboxylate level in yeast cells exposed to heat stress, indicating that these residues are also crucial for its physiological functions. These studies provide some benefits of Mpr1 applications, such as the breeding of industrial yeasts and the development of antifungal drugs. PMID:23818613

An N-terminal di-proline motif is essential for fatty acid–dependent degradation of Δ9-desaturase in Drosophila

PubMed Central

Murakami, Akira; Nagao, Kohjiro; Juni, Naoto; Hara, Yuji; Umeda, Masato

2017-01-01

The Δ9-fatty acid desaturase introduces a double bond at the Δ9 position of the acyl moiety of acyl-CoA and regulates the cellular levels of unsaturated fatty acids. However, it is unclear how Δ9-desaturase expression is regulated in response to changes in the levels of fatty acid desaturation. In this study, we found that the degradation of DESAT1, the sole Δ9-desaturase in the Drosophila cell line S2, was significantly enhanced when the amounts of unsaturated acyl chains of membrane phospholipids were increased by supplementation with unsaturated fatty acids, such as oleic and linoleic acids. In contrast, inhibition of DESAT1 activity remarkably suppressed its degradation. Of note, removal of the DESAT1 N-terminal domain abolished the responsiveness of DESAT1 degradation to the level of fatty acid unsaturation. Further truncation and amino acid replacement analyses revealed that two sequential prolines, the second and third residues of DESAT1, were responsible for the unsaturated fatty acid–dependent degradation. Although degradation of mouse stearoyl-CoA desaturase 1 (SCD1) was unaffected by changes in fatty acid unsaturation, introduction of the N-terminal sequential proline residues into SCD1 conferred responsiveness to unsaturated fatty acid–dependent degradation. Furthermore, we also found that the Ca2+-dependent cysteine protease calpain is involved in the sequential proline–dependent degradation of DESAT1. In light of these findings, we designated the sequential prolines at the second and third positions of DESAT1 as a “di-proline motif,” which plays a crucial role in the regulation of Δ9-desaturase expression in response to changes in the level of cellular unsaturated fatty acids. PMID:28972163

Determination of proline in honey: comparison between official methods, optimization and validation of the analytical methodology.

PubMed

Truzzi, Cristina; Annibaldi, Anna; Illuminati, Silvia; Finale, Carolina; Scarponi, Giuseppe

2014-05-01

The study compares official spectrophotometric methods for the determination of proline content in honey - those of the International Honey Commission (IHC) and the Association of Official Analytical Chemists (AOAC) - with the original Ough method. Results show that the extra time-consuming treatment stages added by the IHC method with respect to the Ough method are pointless. We demonstrate that the AOACs method proves to be the best in terms of accuracy and time saving. The optimized waiting time for the absorbance recording is set at 35min from the removal of reaction tubes from the boiling bath used in the sample treatment. The optimized method was validated in the matrix: linearity up to 1800mgL(-1), limit of detection 20mgL(-1), limit of quantification 61mgL(-1). The method was applied to 43 unifloral honey samples from the Marche region, Italy. Copyright © 2013 Elsevier Ltd. All rights reserved.

Climate-induced lake drying causes heterogeneous reductions in waterfowl species richness

USGS Publications Warehouse

Roach, Jennifer K.; Griffith, Dennis B.

2015-01-01

ContextLake size has declined on breeding grounds for international populations of waterfowl.ObjectivesOur objectives were to (1) model the relationship between waterfowl species richness and lake size; (2) use the model and trends in lake size to project historical, contemporary, and future richness at 2500+ lakes; (3) evaluate mechanisms for the species–area relationship (SAR); and (4) identify species most vulnerable to shrinking lakes.MethodsMonte Carlo simulations of the richness model were used to generate projections. Correlations between richness and both lake size and habitat diversity were compared to identify mechanisms for the SAR. Patterns of nestedness were used to identify vulnerable species.ResultsSpecies richness was greatest at lakes that were larger, closer to rivers, had more wetlands along their perimeters and were within 5 km of a large lake. Average richness per lake was projected to decline by 11 % from 1986 to 2050 but was heterogeneous across sub-regions and lakes. Richness in sub-regions with species-rich lakes was projected to remain stable, while richness in the sub-region with species-poor lakes was projected to decline. Lake size had a greater effect on richness than did habitat diversity, suggesting that large lakes have more species because they provide more habitat but not more habitat types. The vulnerability of species to shrinking lakes was related to species rarity rather than foraging guild.ConclusionsOur maps of projected changes in species richness and rank-ordered list of species most vulnerable to shrinking lakes can be used to identify targets for conservation or monitoring.

Effect of addition of Proline, ionic liquid [Choline][Pro] on CO2 separation properties of poly(amidoamine) dendrimer / poly(ethylene glycol) hybrid membranes

NASA Astrophysics Data System (ADS)

Duan, S. H.; Kai, T.; Chowdhury, F. A.; Taniguchi, I.; Kazama, S.

2018-01-01

Poly(amidoamine) (PAMAM) dendrimers were incorporated into cross-linked poly(ethylene glycol) (PEGDMA) matrix to improve carbon dioxide (CO2) separation performance at elevated pressures. In our previous studies, PAMAM/PEGDMA hybrid membranes showed high CO2 separation properties from CO2/H2 mixed gases. In this study, proline, choline and ionic liquid [Choline][Pro] compounds were selected as rate promoters that were used to prepare PAMAM/PEGDMA hybrid membranes. The effect of addition of proline, choline, IL [Choline][Pro] on separation performance of PAMAM/PEGDMA) hybrid membranes for CO2/H2 separation was investigated. Amino acid proline, choline, and IL [Choline][Pro] were used to promote CO2 and amine reaction. With the addition of [Choline][Pro] into PAMAM/PEG membrane, CO2 permeance of PAMAM/PEG hybrid membranes are increased up to 46% without any change of selectivity of membrane for CO2.

Variation and Evolution in the Glutamine-Rich Repeat Region of Drosophila Argonaute-2

PubMed Central

Palmer, William H.; Obbard, Darren J.

2016-01-01

RNA interference pathways mediate biological processes through Argonaute-family proteins, which bind small RNAs as guides to silence complementary target nucleic acids . In insects and crustaceans Argonaute-2 silences viral nucleic acids, and therefore acts as a primary effector of innate antiviral immunity. Although the function of the major Argonaute-2 domains, which are conserved across most Argonaute-family proteins, are known, many invertebrate Argonaute-2 homologs contain a glutamine-rich repeat (GRR) region of unknown function at the N-terminus . Here we combine long-read amplicon sequencing of Drosophila Genetic Reference Panel (DGRP) lines with publicly available sequence data from many insect species to show that this region evolves extremely rapidly and is hyper-variable within species. We identify distinct GRR haplotype groups in Drosophila melanogaster, and suggest that one of these haplotype groups has recently risen to high frequency in a North American population. Finally, we use published data from genome-wide association studies of viral resistance in D. melanogaster to test whether GRR haplotypes are associated with survival after virus challenge. We find a marginally significant association with survival after challenge with Drosophila C Virus in the DGRP, but we were unable to replicate this finding using lines from the Drosophila Synthetic Population Resource panel. PMID:27317784

Ethephon increases photosynthetic-nitrogen use efficiency, proline and antioxidant metabolism to alleviate decrease in photosynthesis under salinity stress in mustard.

PubMed

Iqbal, Noushina; Umar, Shahid; Per, Tasir S; Khan, Nafees A

2017-05-04

Salinity is a serious threat to plant growth and development worldwide reducing agricultural productivity each year. Ethylene is an important phytohormone that affects plants performance under normal and abiotic stress conditions. In this study, role of ethylene was investigated in mitigating salinity stress (100 mM NaCl) effects on photosynthesis in mustard plants subjected to different nitrogen (N; 5 and 10 mM) levels. Plants under salinity stress exhibited marked increase in proline and reduced glutathione (GSH) content and activity of antioxidant enzymes. Nitrogen supplementation at 10 mM was better than 200 µl l -1 ethephon treatment under no stress. However, under salinity stress, both N and ethephon were equally effective. The combined application of 10 mM N and ethephon to salinity stressed plants produced greatest increase in photosynthesis by increasing proline and antioxidant metabolism. Ethylene evolution was high under salinity stress, but treatment of 10 mM N and 200 µl l -1 ethephon greatly decreased ethylene evolution that was equivalent to the 10 mM N treatment alone. This concentration of ethylene decreased the oxidative stress and increased the photosynthetic nitrogen use efficiency (NUE) maximally to increase photosynthesis. The use of ethylene action inhibitor, norbornadiene (NBD) showed reduction in ethylene mediated effects in alleviating salinity. Norbornadiene decreased the photosynthetic-NUE, proline and GSH content that resulted in decrease in photosynthesis under salinity stress. This study indicated that ethylene regulated the proline and antioxidant metabolism under salinity stress to increase photosynthetic functions of mustard grown with low and optimum N. The modulation of ethylene could be adopted in agricultural practices to increase photosynthesis under salinity stress.

Molecular building kit of fused-proline-derived peptide mimetics allowing specific adjustment of the dihedral Psi angle.

PubMed

Einsiedel, Juergen; Lanig, Harald; Waibel, Reiner; Gmeiner, Peter

2007-11-23

Proline-derived peptide mimetics have become an area of paramount importance in peptide and protein chemistry. Since protein crystal structures frequently display Psi angles of 140-170 degrees for prolyl moieties, our intention was to design a completely novel series of 2,3-fused-proline-derived lactams covering this particular conformational space. Extending our recently described toolset of spirocyclic reverse-turn mimetics, we synthesized pyrrolidinyl-fused seven-, eight-, and nine-membered unsaturated lactam model peptides taking advantage of Grubbs' ring-closing metathesis. Investigating the seven-membered lactam 3a by means of IR and NMR spectroscopy and semiempirical molecular dynamics simulations, we could not observe a U-turn conformation; however, increasing the ring size to give eight- and nine-membered congeners revealed moderate and high type IotaIota beta-turn inducing properties. Interestingly, the conformational properties of our model systems depend on both the ring size of the fused dehydro-Freidinger lactam and the position of the endocyclic double bond. Superior reverse-turn inducing properties could be observed for the fused azacyclononenone 3e. According to diagnostic transanular NOEs, a discrete folding principle of the lactam ring strongly deviating from the regioisomeric lactams 3c,f explains the conformational behavior. Hence, we were able to establish a molecular building kit that allows adjustments of a wide range of naturally occurring proline Psi angles and thus can be exploited to probe molecular recognition and functional properties of biological systems.

Ameliorating Effects of Exogenously Applied Proline on Seed Composition, Seed Oil Quality and Oil Antioxidant Activity of Maize (Zea mays L.) under Drought Stress

PubMed Central

Ali, Qasim; Anwar, Farooq; Ashraf, Muhammad; Saari, Nazamid; Perveen, Rashida

2013-01-01

This study was carried out to appraise whether or not the exogenous application of a potential osmoprotectant, proline, could ameliorate the adverse effects of drought stress on maize seed and seed oil composition, as well as oil antioxidant activity. Water stress reduced the kernel sugar, oil, protein and moisture contents and most of the seed macro- and micro-elements analyzed in both maize cultivars but it increased the contents of seed fiber and ash. Water stress increased the oil oleic acid content with a subsequent decrease in the amount of linoleic acid, resulting in an increased oil oleic/linoleic ratio for both maize cultivars. However, no variation was observed in oil stearic and palmitic acids content due to water stress. A considerable drought induced an increase in seed oil α-, γ-, δ- and total tocopherols and flavonoids were observed in both maize cultivars. However, oil phenolic and carotenoid content as well as 1,1-diphenyl-2-picryl-hydrazyl (DPPH) free radical scavenging activity decreased. Foliar-applied proline significantly increased the content of seed sugar, oil, protein, moisture, fiber and ash in both maize cultivars under well irrigated and water deficit conditions. Furthermore, exogenous application of proline increased the oil oleic and linoleic acid contents. The concentrations of antioxidant compounds namely phenolics, carotenoids, flavonoids and tocopherols estimated in the seed oil increased due to foliar-applied proline under water deficit conditions that was positively correlated with the enhanced oil DPPH free radical scavenging activity. Moreover, the increase in the contents of these antioxidant compounds and oil antioxidant activity due to the foliar application of proline was noted to be more pronounced under water deficit conditions. PMID:23344043

Proline levels, oxidative metabolism and photosynthetic pigments during in vitro growth and acclimatization of Pitcairnia encholirioides L.B. Sm. (Bromeliaceae).

PubMed

Resende, C F; Braga, V F; Pereira, P F; Silva, C J; Vale, V F; Bianchetti, R E; Forzza, R C; Ribeiro, C; Peixoto, P H P

2016-02-01

This study aimed to evaluate the variation in the levels of proline, oxidative metabolism and photosynthetic pigments in plants of Pitcairnia encholirioides grown in vitro under different conditions and after acclimatization. The analyses were performed after 150 days of in vitro cultivation in MS media supplemented with 10 µM GA3 or 0.2 µM NAA, sucrose at 15 or 30 g L-1, in test tubes which allowed gas exchange or in a hermetically sealed system, and 180 days after acclimatization. The in vitro maintenance in hermetically sealed flasks, with GA3 and 15 g L-1 sucrose had adverse metabolic effects, which was demonstrated by the lower proline and photosynthetic pigments accumulation and by the increase in antioxidant enzymes activities. After acclimatization, differences for proline and photosynthetic pigments were no longer found and the enzymatic activities ranged unevenly. The results suggest that the in vitro cultivation in media with 0.2 µM NAA and 30 g L-1 sucrose, in test tubes capped with closures which allowed gas exchange, is more suitable for micropropagation of P. encholirioides, providing a prolonged maintenance of in vitro cultures and plantlets with superior quality for ex vitro development.

CuI/L-proline-catalyzed coupling reactions of aryl halides with activated methylene compounds.

PubMed

Xie, Xiaoan; Cai, Guorong; Ma, Dawei

2005-10-13

[reaction: see text] The arylation of ethyl acetoacetate, ethyl benzoyl acetate, and diethyl malonate under the catalysis of CuI/L-proline in DMSO proceeds smoothly at 40-50 degrees C in the presence of Cs2CO3 to provide the 2-aryl-1,3-dicarbonyl compounds in good yields. Both aryl iodides and aryl bromides are compatible with these reaction conditions.

Species richness patterns and water-energy dynamics in the drylands of Northwest China.

PubMed

Li, Liping; Wang, Zhiheng; Zerbe, Stefan; Abdusalih, Nurbay; Tang, Zhiyao; Ma, Ming; Yin, Linke; Mohammat, Anwar; Han, Wenxuan; Fang, Jingyun

2013-01-01

Dryland ecosystems are highly vulnerable to climatic and land-use changes, while the mechanisms underlying patterns of dryland species richness are still elusive. With distributions of 3637 native vascular plants, 154 mammals, and 425 birds in Xinjiang, China, we tested the water-energy dynamics hypothesis for species richness patterns in Central Asian drylands. Our results supported the water-energy dynamics hypothesis. We found that species richness of all three groups was a hump-shaped function of energy availability, but a linear function of water availability. We further found that water availability had stronger effects on plant richness, but weaker effects on vertebrate richness than energy availability. We conducted piecewise linear regressions to detect the breakpoints in the relationship between species richness and potential evapotranspiration which divided Xinjiang into low and high energy regions. The concordance between mammal and plant richness was stronger in high than in low energy regions, which was opposite to that between birds and plants. Plant richness had stronger effects than climate on mammal richness regardless of energy levels, but on bird richness only in high energy regions. The changes in the concordance between vertebrate and plant richness along the climatic gradient suggest that cautions are needed when using concordance between taxa in conservation planning.

Species Richness Patterns and Water-Energy Dynamics in the Drylands of Northwest China

PubMed Central

Zerbe, Stefan; Abdusalih, Nurbay; Tang, Zhiyao; Ma, Ming; Yin, Linke; Mohammat, Anwar; Han, Wenxuan; Fang, Jingyun

2013-01-01

Dryland ecosystems are highly vulnerable to climatic and land-use changes, while the mechanisms underlying patterns of dryland species richness are still elusive. With distributions of 3637 native vascular plants, 154 mammals, and 425 birds in Xinjiang, China, we tested the water-energy dynamics hypothesis for species richness patterns in Central Asian drylands. Our results supported the water-energy dynamics hypothesis. We found that species richness of all three groups was a hump-shaped function of energy availability, but a linear function of water availability. We further found that water availability had stronger effects on plant richness, but weaker effects on vertebrate richness than energy availability. We conducted piecewise linear regressions to detect the breakpoints in the relationship between species richness and potential evapotranspiration which divided Xinjiang into low and high energy regions. The concordance between mammal and plant richness was stronger in high than in low energy regions, which was opposite to that between birds and plants. Plant richness had stronger effects than climate on mammal richness regardless of energy levels, but on bird richness only in high energy regions. The changes in the concordance between vertebrate and plant richness along the climatic gradient suggest that cautions are needed when using concordance between taxa in conservation planning. PMID:23840472

An improved colorimetric method for the determination of proline in the presence of other ninhydrin-positive compounds

PubMed Central

Wren, J. J.; Wiggall, P. H.

1965-01-01

1. The conditions required for sensitive and specific colorimetric determination of proline with acidified ninhydrin were investigated. 2. A method applicable to protein samples was developed. 3. The only compound found to interfere appreciably was a hydroxyproline. PMID:14342233

Isotopic evidence for the formation of unusually humus-rich soils in the Baltic region

NASA Astrophysics Data System (ADS)

Leinweber, Peter; Acksel, Andre; Kühn, Peter

2017-04-01

Arable mineral soils in the Pleistocene landscape of Northern Germany usually contain about 4 to 8 kg of organic C (Corg) per m2, most of which is visually recognizable concentrated in the tilled topsoil horizon. Some unusually humus-rich (10 to 20 kg Corg m-2), and deeply (> 70 cm) dark-colored soils in coastal regions with mollic properties have been classified as Chernozems. Their location far away from the middle German and Central European Chernozem regions, absence of steppe vegetation and semi-arid climate conditions make classical pedogenetic theories doubtful. However, non-targeted mass spectrometric analyses of soil organic matter (SOM) composition revealed great similarities with typical Chernozems worldwide (Thiele-Bruhn et al., 2014) and made alternative (e.g. waterlogged) pathways of SOM accumulation unlikely. Subsequent detailed multi-method SOM analyses down the soil profiles revealed relative enrichments in cyclic ("black carbon") and heterocyclic organic compounds in the deeper, bioturbated horizons. These were plausibly explained by the input of combustion residues, likely originating from anthropogenic activities because spots of these soils coincided with archeological artifacts of early settlements (Acksel et al., 2016). However, these finding could not completely explain the genesis of Chernozems in the Baltic region. Therefore, we actually explored isotope analyses (12/13C, 13/14C, 14/15N, 32/34S) to find out the origin of these unusual SOM enrichments and the time period in which it occurred. The results will be compiled to a consistent hypothesis on the formation of these soils in the Baltic and other Northern European regions. References Acksel, A., W. Amelung, P. Kühn, E. Gehrt, T. Regier, P. Leinweber. 2016. Soil organic matter characteristics as indicator of Chernozem genesis in the Baltic Sea region. Geoderma Regional 7, 187-200. Thiele-Bruhn, S., Leinweber P., Eckhardt K.-U., Siem H.K., Blume H.-P. 2014. Identifying Chernozem

Inactivation of neurotensin by rat brain synaptic membranes. Cleavage at the Pro10-Tyr11 bond by endopeptidase 24.11 (enkephalinase) and a peptidase different from proline-endopeptidase.

PubMed

Checler, F; Emson, P C; Vincent, J P; Kitabgi, P

1984-11-01

It was shown previously that the tridecapeptide neurotensin is inactivated by rat brain synaptic membranes and that one of the primary inactivating cleavages occurs at the Pro10-Try11 peptide bond, leading to the formation of NT1-10 and NT11-13. The present study was designed to investigate the possibility that this cleavage was catalyzed by proline endopeptidase and/or endopeptidase 24.11 (enkephalinase). Purified rat brain synaptic membranes were found to contain a N-benzyloxycarbonyl-Gly-Pro-4-methyl-coumarinyl-7-amide-hydrolyzin g activity that was markedly inhibited (93%) by the proline endopeptidase inhibitor N-benzyloxycarbonyl-Pro-Prolinal and partially blocked (25%) by an antiproline endopeptidase antiserum. In contrast, the cleavage of neurotensin at the Pro10-Tyr11 bond by synaptic membranes was not affected by N-benzyloxycarbonyl-Pro-Prolinal and the antiserum. When the conversion of NT1-10 to NT1-8 by angiotensin converting enzyme was blocked by captopril and when the processing of NT11-13 by aminopeptidase(s) was inhibited by bestatin, it was found that thiorphan, a potent endopeptidase 24.11 inhibitor, partially decreased the formation of NT1-10 and NT11-13 by synaptic membranes. (1) proline endopeptidase, although it is present in synaptic membranes, is not involved in the cleavage of neurotensin at the Pro10-Tyr11 bond; (2) endopeptidase 24.11 only partially contributes to this cleavage; (3) there exists in rat brain synaptic membranes a peptidase different from proline endopeptidase and endopeptidase 24.11 that is mainly responsible for inactivating neurotensin by cleaving at the Pro10-Tyr11 bond.

Proline-coated column for the capillary electrochromatographic separation of amino acids by in-column derivatization.

PubMed

Lin, Chun-Chi; Liu, Chuen-Ying

2004-10-01

With 3-trimethoxysilylpropyl chloride as the spacer, a proline-coated capillary column was prepared for the capillary electrochromatographic (CEC) separation of amino acids by in-column derivatization. Nine standard mixtures, including aspartic acid, glutamic acid, valine, phenylalanine, alanine, isoleucine, leucine, tyrosine, and tryptophan, were injected. o-Phthalaldehyde (OPA), OPA/2-mercaptoethanol (2-ME) and OPA/N-acetylcysteine (NAC) in borate buffer were tested as the derivatizing agent. Among them, OPA (50 mM) in borate buffer (pH 9.5, 50 mM) gave the best performance. The formation of isoindole could be detected by UV detection. The sandwich-type injection was carried out in hydrostatic mode (10 cm) with the program R(10 s)S(10 s) R(10 s)W(10 min) with R, S, and W being the reagent, sample, and waiting times. Mesityl oxide, benzyl alcohol, and acetone showed some interaction with the column. A current monitoring method was used instead of the determination of the electroosmotic flow (EOF). The direction of EOF was from anode to cathode even under acidic condition lower than the pI value (6.31) of the bonded group due to some unreacted silanol groups. Some parameters including pH, nature, and concentration of the mobile phase and the effect of organic modifier with regard to the CEC separation were investigated. With the proline-coated column (75 (50) cm x 75 microm ID) the best separation was performed in phosphate buffer (pH 4.00, 100 mM) with an applied voltage of -15 kV. The established method was also compared with those precolumn derivatized prior to the separation with proline-coated column as well as with in-capillary derivatization and separation with a bare fused-silica column. Copyright 2004 WILEY-VCH Verlag GmbH & Co.

Proline N-oxides: modulators of the 3D conformation of linear peptides through "NO-turns".

PubMed

Farahani, Majid D; Honarparvar, Bahareh; Albericio, Fernando; Maguire, Glenn E M; Govender, Thavendran; Arvidsson, Per I; Kruger, Hendrik G

2014-07-07

Small peptides are essential mediators of numerous physiological processes. Consequently, there is huge interest in the de novo design of peptides with a predictable folding and related biological activity. In this study, we investigate the possibility of modulating the secondary structure of tetrapeptides through proline N-oxide moieties and N-methylation of the peptide backbone. A series of tetrapeptides were synthesised to investigate the combined effect of Pro N-oxide and N-methylation of the amide bond on the (n + 1) residue in terms of cis- and trans-isomerization, as well as how these modifications direct potential intramolecular hydrogen bonding interactions. The right combination of both these parameters led to a trans to cis-conformational interconversion and a change in the nature of the hydrogen bonding interactions, as demonstrated by NMR spectroscopic, molecular modeling analysis and thermal coefficient studies. Proline N-oxide residues were proposed to induce turns we named as NO-γ-turns and NO-β-turns based on their similarity to traditional γ- and β-turns.

Insights into the Evolution of Hydroxyproline-Rich Glycoproteins from 1000 Plant Transcriptomes.

PubMed

Johnson, Kim L; Cassin, Andrew M; Lonsdale, Andrew; Wong, Gane Ka-Shu; Soltis, Douglas E; Miles, Nicholas W; Melkonian, Michael; Melkonian, Barbara; Deyholos, Michael K; Leebens-Mack, James; Rothfels, Carl J; Stevenson, Dennis W; Graham, Sean W; Wang, Xumin; Wu, Shuangxiu; Pires, J Chris; Edger, Patrick P; Carpenter, Eric J; Bacic, Antony; Doblin, Monika S; Schultz, Carolyn J

2017-06-01

The carbohydrate-rich cell walls of land plants and algae have been the focus of much interest given the value of cell wall-based products to our current and future economies. Hydroxyproline-rich glycoproteins (HRGPs), a major group of wall glycoproteins, play important roles in plant growth and development, yet little is known about how they have evolved in parallel with the polysaccharide components of walls. We investigate the origins and evolution of the HRGP superfamily, which is commonly divided into three major multigene families: the arabinogalactan proteins (AGPs), extensins (EXTs), and proline-rich proteins. Using motif and amino acid bias, a newly developed bioinformatics pipeline, we identified HRGPs in sequences from the 1000 Plants transcriptome project (www.onekp.com). Our analyses provide new insights into the evolution of HRGPs across major evolutionary milestones, including the transition to land and the early radiation of angiosperms. Significantly, data mining reveals the origin of glycosylphosphatidylinositol (GPI)-anchored AGPs in green algae and a 3- to 4-fold increase in GPI-AGPs in liverworts and mosses. The first detection of cross-linking (CL)-EXTs is observed in bryophytes, which suggests that CL-EXTs arose though the juxtaposition of preexisting SP n EXT glycomotifs with refined Y-based motifs. We also detected the loss of CL-EXT in a few lineages, including the grass family (Poaceae), that have a cell wall composition distinct from other monocots and eudicots. A key challenge in HRGP research is tracking individual HRGPs throughout evolution. Using the 1000 Plants output, we were able to find putative orthologs of Arabidopsis pollen-specific GPI-AGPs in basal eudicots. © 2017 American Society of Plant Biologists. All Rights Reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Existence of an 16O-rich gaseous reservoir in the solar nebula.

PubMed

Krot, Alexander N; McKeegan, Kevin D; Leshin, Laurie A; MacPherson, Glenn J; Scott, Edward R D

2002-02-08

Carbonaceous chondrite condensate olivine grains from two distinct petrographic settings, calcium-aluminum-rich inclusion (CAI) accretionary rims and amoeboid olivine aggregates (AOAs), are oxygen-16 (16O) enriched at the level previously observed inside CAIs. This requires that the gas in the nebular region where these grains condensed was 16O-rich. This contrasts with an 16O-poor gas present during the formation of chondrules, suggesting that CAIs and AOAs formed in a spatially restricted region of the solar nebula containing 16O-rich gas. The 16O-rich gas composition may have resulted either from mass-independent isotopic chemistry or from evaporation of regions with enhanced dust/gas ratios, possibly in an X-wind environment near the young Sun.

Genomic Mapping of Human DNA provides Evidence of Difference in Stretch between AT and GC rich regions

NASA Astrophysics Data System (ADS)

Reifenberger, Jeffrey; Dorfman, Kevin; Cao, Han

Human DNA is a not a polymer consisting of a uniform distribution of all 4 nucleic acids, but rather contains regions of high AT and high GC content. When confined, these regions could have different stretch due to the extra hydrogen bond present in the GC basepair. To measure this potential difference, human genomic DNA was nicked with NtBspQI, labeled with a cy3 like fluorophore at the nick site, stained with YOYO, loaded into a device containing an array of nanochannels, and imaged. Over 473,000 individual molecules of DNA, corresponding to roughly 30x coverage of a human genome, were collected and aligned to the human reference. Based on the known AT/GC content between aligned pairs of labels, the stretch was measured for regions of similar size but different AT/GC content. We found that regions of high GC content were consistently more stretched than regions of high AT content between pairs of labels varying in size between 2.5 kbp and 500 kbp. We measured that for every 1% increase in GC content there was roughly a 0.06% increase in stretch. While this effect is small, it is important to take into account differences in stretch between AT and GC rich regions to improve the sensitivity of detection of structural variations from genomic variations. NIH Grant: R01-HG006851.

Towards Understanding the Tandem Mass Spectra of Protonated Oligopeptides. 2: The Proline Effect in Collision-Induced Dissociation of Protonated Ala-Ala-Xxx-Pro-Ala (Xxx = Ala, Ser, Leu, Val, Phe, and Trp)

NASA Astrophysics Data System (ADS)

Bleiholder, Christian; Suhai, Sándor; Harrison, Alex G.; Paizs, Béla

2011-06-01

The product ion spectra of proline-containing peptides are commonly dominated by y n ions generated by cleavage at the N-terminal side of proline residues. This proline effect is investigated in the current work by collision-induced dissociation (CID) of protonated Ala-Ala-Xxx-Pro-Ala (Xxx includes Ala, Ser, Leu, Val, Phe, and Trp) in an electrospray/quadrupole/time-of-flight (QqTOF) mass spectrometer and by quantum chemical calculations on protonated Ala-Ala-Ala-Pro-Ala. The CID spectra of all investigated peptides show a dominant y 2 ion (Pro-Ala sequence). Our computational results show that the proline effect mainly arises from the particularly low threshold energy for the amide bond cleavage N-terminal to the proline residue, and from the high proton affinity of the proline-containing C-terminal fragment produced by this cleavage. These theoretical results are qualitatively supported by the experimentally observed y 2 / b 3 abundance ratios for protonated Ala-Ala-Xxx-Pro-Ala (Xxx = Ala, Ser, Leu, Val, Phe, and Trp). In the post-cleavage phase of fragmentation the N-terminal oxazolone fragment with the Ala-Ala-Xxx sequence and Pro-Ala compete for the ionizing proton for these peptides. As the proton affinity of the oxazolone fragment increases, the y 2 / b 3 abundance ratio decreases.

Towards understanding the tandem mass spectra of protonated oligopeptides. 2: The proline effect in collision-induced dissociation of protonated Ala-Ala-Xxx-Pro-Ala (Xxx = Ala, Ser, Leu, Val, Phe, and Trp).

PubMed

Bleiholder, Christian; Suhai, Sándor; Harrison, Alex G; Paizs, Béla

2011-06-01

The product ion spectra of proline-containing peptides are commonly dominated by y(n) ions generated by cleavage at the N-terminal side of proline residues. This proline effect is investigated in the current work by collision-induced dissociation (CID) of protonated Ala-Ala-Xxx-Pro-Ala (Xxx includes Ala, Ser, Leu, Val, Phe, and Trp) in an electrospray/quadrupole/time-of-flight (QqTOF) mass spectrometer and by quantum chemical calculations on protonated Ala-Ala-Ala-Pro-Ala. The CID spectra of all investigated peptides show a dominant y(2) ion (Pro-Ala sequence). Our computational results show that the proline effect mainly arises from the particularly low threshold energy for the amide bond cleavage N-terminal to the proline residue, and from the high proton affinity of the proline-containing C-terminal fragment produced by this cleavage. These theoretical results are qualitatively supported by the experimentally observed y(2)/b(3) abundance ratios for protonated Ala-Ala-Xxx-Pro-Ala (Xxx = Ala, Ser, Leu, Val, Phe, and Trp). In the post-cleavage phase of fragmentation the N-terminal oxazolone fragment with the Ala-Ala-Xxx sequence and Pro-Ala compete for the ionizing proton for these peptides. As the proton affinity of the oxazolone fragment increases, the y(2)/b(3) abundance ratio decreases.

Abnormal rich club organization and functional brain dynamics in schizophrenia.

PubMed

van den Heuvel, Martijn P; Sporns, Olaf; Collin, Guusje; Scheewe, Thomas; Mandl, René C W; Cahn, Wiepke; Goñi, Joaquín; Hulshoff Pol, Hilleke E; Kahn, René S

2013-08-01

The human brain forms a large-scale structural network of regions and interregional pathways. Recent studies have reported the existence of a selective set of highly central and interconnected hub regions that may play a crucial role in the brain's integrative processes, together forming a central backbone for global brain communication. Abnormal brain connectivity may have a key role in the pathophysiology of schizophrenia. To examine the structure of the rich club in schizophrenia and its role in global functional brain dynamics. Structural diffusion tensor imaging and resting-state functional magnetic resonance imaging were performed in patients with schizophrenia and matched healthy controls. Department of Psychiatry, Rudolf Magnus Institute of Neuroscience, University Medical Center Utrecht, Utrecht, the Netherlands. Forty-eight patients and 45 healthy controls participated in the study. An independent replication data set of 41 patients and 51 healthy controls was included to replicate and validate significant findings. MAIN OUTCOME(S) AND MEASURES: Measures of rich club organization, connectivity density of rich club connections and connections linking peripheral regions to brain hubs, measures of global brain network efficiency, and measures of coupling between brain structure and functional dynamics. Rich club organization between high-degree hub nodes was significantly affected in patients, together with a reduced density of rich club connections predominantly comprising the white matter pathways that link the midline frontal, parietal, and insular hub regions. This reduction in rich club density was found to be associated with lower levels of global communication capacity, a relationship that was absent for other white matter pathways. In addition, patients had an increase in the strength of structural connectivity-functional connectivity coupling. Our findings provide novel biological evidence that schizophrenia is characterized by a selective

Understanding the antimicrobial properties/activity of an 11-residue Lys homopeptide by alanine and proline scan.

PubMed

Carvajal-Rondanelli, P; Aróstica, M; Álvarez, C A; Ojeda, C; Albericio, F; Aguilar, L F; Marshall, S H; Guzmán, F

2018-05-01

Previous work demonstrated that lysine homopeptides adopt a polyproline II (PPII) structure. Lysine homopeptides with odd number of residues, especially with 11 residues (K11), were capable of inhibiting the growth of a broader spectrum of bacteria than those with an even number. Confocal studies also determined that K11 was able to localize exclusively in the bacterial membrane, leading to cell death. In this work, the mechanism of action of this peptide was further analyzed focused on examining the structural changes in bacterial membrane induced by K11, and in K11 itself when interacting with bacterial membrane lipids. Moreover, alanine and proline scans were performed for K11 to identify relevant positions in structure conformation and antibacterial activity. To do so, circular dichroism spectroscopy (CD) was conducted in saline phosphate buffer (PBS) and in lipidic vesicles, using large unilamellar vesicles (LUV), composed of 2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) or bacterial membrane lipid. Antimicrobial activity of K11 and their analogs was evaluated in Gram-positive and Gram-negative bacterial strains. The scanning electron microscopy (SEM) micrographs of Staphylococcus aureus ATCC 25923 exposed to the Lys homopeptide at MIC concentration showed blisters and bubbles formed on the bacterial surface, suggesting that K11 exerts its action by destabilizing the bacterial membrane. CD analysis revealed a remarkably enhanced PPII structure of K11 when replacing some of its central residues by proline in PBS. However, when such peptide analogs were confronted with either DMPG-LUV or membrane lipid extract-LUV, the tendency to form PPII structure was severely weakened. On the contrary, K11 peptide showed a remarkably enhanced PPII structure in the presence of DMPG-LUV. Antibacterial tests revealed that K11 was able to inhibit all tested bacteria with an MIC value of 5 µM, while proline and alanine analogs have a reduced activity on Listeria

Relative species richness and community completeness: avian communities and urbanization in the mid-Atlantic states

USGS Publications Warehouse

Cam, E.; Nichols, J.D.; Sauer, J.R.; Hines, J.E.; Flather, C.H.

2000-01-01

The idea that local factors govern local richness has been dominant for years, but recent theoretical and empirical studies have stressed the influence of regional factors on local richness. Fewer species at a site could reflect not only the influence of local factors, but also a smaller regional pool. The possible dependency of local richness on the regional pool should be taken into account when addressing the influence of local factors on local richness. It is possible to account for this potential dependency by comparing relative species richness among sites, rather than species richness per se. We consider estimation of a metric permitting assessment of relative species richness in a typical situation in which not all species are detected during sampling sessions. In this situation, estimates of absolute or relative species richness need to account for variation in species detection probability if they are to be unbiased. We present a method to estimate relative species richness based on capture-recapture models. This approach involves definition of a species list from regional data, and estimation of the number of species in that list that are present at a site-year of interest. We use this approach to address the influence of urbanization on relative richness of avian communities in the Mid-Atlantic region of the United States. There is a negative relationship between relative richness and landscape variables describing the level of urban development. We believe that this metric should prove very useful for conservation and management purposes because it is based on an estimator of species richness that both accounts for potential variation in species detection probability and allows flexibility in the specification of a 'reference community.' This metric can be used to assess ecological integrity, the richness of the community of interest relative to that of the 'original' community, or to assess change since some previous time in a community.

The dynamics, structure, and conformational free energy of proline-containing antifreeze glycoprotein.

PubMed

Nguyen, Dat H; Colvin, Michael E; Yeh, Yin; Feeney, Robert E; Fink, William H

2002-06-01

Recent NMR studies of the solution structure of the 14-amino acid antifreeze glycoprotein AFGP-8 have concluded that the molecule lacks long-range order. The implication that an apparently unstructured molecule can still have a very precise function as a freezing inhibitor seems startling at first consideration. To gain insight into the nature of conformations and motions in AFGP-8, we have undertaken molecular dynamics simulations augmented with free energy calculations using a continuum solvation model. Starting from 10 different NMR structures, 20 ns of dynamics of AFGP were explored. The dynamics show that AFGP structure is composed of four segments, joined by very flexible pivots positioned at alanine 5, 8, and 11. The dynamics also show that the presence of prolines in this small AFGP structure facilitates the adoption of the poly-proline II structure as its overall conformation, although AFGP does adopt other conformations during the course of dynamics as well. The free energies calculated using a continuum solvation model show that the lowest free energy conformations, while being energetically equal, are drastically different in conformations. In other words, this AFGP molecule has many structurally distinct and energetically equal minima in its energy landscape. In addition, conformational, energetic, and hydrogen bond analyses suggest that the intramolecular hydrogen bonds between the N-acetyl group and the protein backbone are an important integral part of the overall stability of the AFGP molecule. The relevance of these findings to the mechanism of freezing inhibition is discussed.

Core Transmembrane Domain 6 Plays a Pivotal Role in the Transport Cycle of the Sodium/Proline Symporter PutP*

PubMed Central

Bracher, Susanne; Schmidt, Claudia C.; Dittmer, Sophie I.; Jung, Heinrich

2016-01-01

Crystal structures of transporters with a LeuT-type structural fold assign core transmembrane domain 6 (TM6′) a central role in substrate binding and translocation. Here, the function of TM6′ in the sodium/proline symporter PutP, a member of the solute/sodium symporter family, was investigated. A complete scan of TM6′ identified eight amino acids as particularly important for PutP function. Of these residues, Tyr-248, His-253, and Arg-257 impact sodium binding, whereas Arg-257 and Ala-260 may participate in interactions leading to closure of the inner gate. Furthermore, the previous suggestion of an involvement of Trp-244, Tyr-248, and Pro-252 in proline binding is further supported. In addition, substitution of Gly-245, Gly-247, and Gly-250 affects the amount of PutP in the membrane. A Cys accessibility analysis suggests an involvement of the inner half of TM6′ in the formation of a hydrophilic pathway that is open to the inside in the absence of ligands and closed in the presence of sodium and proline. In conclusion, the results demonstrate that TM6′ plays a central role in substrate binding and release on the inner side of the membrane also in PutP and extend the knowledge on functionally relevant amino acids in transporters with a LeuT-type structural fold. PMID:27793991

Cadmium-cysteine coordination in the BK inner pore region and its structural and functional implications.

PubMed

Zhou, Yu; Xia, Xiao-Ming; Lingle, Christopher J

2015-04-21

To probe structure and gating-associated conformational changes in BK-type potassium (BK) channels, we examined consequences of Cd(2+) coordination with cysteines introduced at two positions in the BK inner pore. At V319C, the equivalent of valine in the conserved Kv proline-valine-proline (PVP) motif, Cd(2+) forms intrasubunit coordination with a native glutamate E321, which would place the side chains of V319C and E321 much closer together than observed in voltage-dependent K(+) (Kv) channel structures, requiring that the proline between V319C and E321 introduces a kink in the BK S6 inner helix sharper than that observed in Kv channel structures. At inner pore position A316C, Cd(2+) binds with modest state dependence, suggesting the absence of an ion permeation gate at the cytosolic side of BK channel. These results highlight fundamental structural differences between BK and Kv channels in their inner pore region, which likely underlie differences in voltage-dependent gating between these channels.

[Hydroxyproline: Rich glycoproteins of the plant and cell wall

DOE Office of Scientific and Technical Information (OSTI.GOV)

Varner, J.E.

1993-01-01

Since xylem tissue includes the main cell types which are lignified, we are interested in gene expression of glycine-rich proteins and proline-rich proteins, and other proteins which are involved in secondary cell wall thickening during xylogenesis. Since the main feature of xylogenesis is the deposition of additional wall components, study of the mechanism of xylogenesis will greatly advance our knowledge of the synthesis and assembly of wall macromolecules. We are using the in vitro xylogenesis system from isolated Zinnia mesophyll cells to isolate genes which are specifically expressed during xylogenesis. We have used subtractive hybridization methods to isolate a numbermore » of cDNA clones for differentially regulated genes from the cells after hormonal induction. So far, we have partially characterized 18 different cDNA clones from 239 positive clones. These differentially regulated genes can be divided into three sets according to the characteristics of gene expression in the induction medium and the control medium. The first set is induced in both the induction medium and the control medium without hormones. The second set is induced mainly in the induction medium and in the control medium with the addition of NAA alone. Two of thesegenes are exclusively induced by auxin. The third set of genes is induced mainly in the induction medium. Since these genes are not induced by either auxin or cytokinin alone, they may be directly involved in the process of xylogenesis. Our experiments on the localization of H[sub 2]O[sub 2] production reinforce the earlier ideas of others that H[sub 2]O[sub 2] is involved in normal lignification.« less

Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

PubMed Central

Janecek, S.

1996-01-01

The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the

Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

PubMed

Janecek, S

1996-06-01

The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the

Effect of Salt Stress on Growth, Na+ Accumulation and Proline Metabolism in Potato (Solanum tuberosum) Cultivars

PubMed Central

Jaarsma, Rinse; de Vries, Rozemarijn S. M.; de Boer, Albertus H.

2013-01-01

Potato (Solanum tuberosum) is a major crop world-wide and the productivity of currently used cultivars is strongly reduced at high soil salt levels. We compared the response of six potato cultivars to increased root NaCl concentrations. Cuttings were grown hydroponically and treated with 0 mM, 60 mM and 180 mM NaCl for one week. Growth reduction on salt was strongest for the cultivars Mozart and Mona Lisa with a severe senescence response at 180 mM NaCl and Mozart barely survived the treatment. The cultivars Desiree and Russett Burbank were more tolerant showing no senescence after salt treatment. A clear difference in Na+ homeostasis was observed between sensitive and tolerant cultivars. The salt sensitive cultivar Mozart combined low Na+ levels in root and stem with the highest leaf Na+ concentration of all cultivars, resulting in a high Na+ shoot distribution index (SDI) for Mozart as compared to Desiree. Overall, a positive correlation between salt tolerance and stem Na+ accumulation was found and the SDI for Na+ points to a role of stem Na+ accumulation in tolerance. In stem tissue, Mozart accumulated more H2O2 and less proline compared to the tolerant cultivars. Analysis of the expression of proline biosynthesis genes in Mozart and Desiree showed a clear reduction in proline dehydrogenase (PDH) expression in both cultivars and an increase in pyrroline-5-carboxylate synthetase 1 (P5CS1) gene expression in Desiree, but not in Mozart. Taken together, current day commercial cultivars show promising differences in salt tolerance and the results suggest that mechanisms of tolerance reside in the capacity of Na+ accumulation in stem tissue, resulting in reduced Na+ transport to the leaves. PMID:23533673

Effect of saline irrigation water on gas exchange and proline metabolism in ber (Ziziphus).

PubMed

Bagdi, D L; Bagri, G K

2016-09-01

An experiment was conducted in pots of 25 kg capacity to study the effect of saline irrigation (EC 0,5,10,15 and 20 dSm-1) prepared by mixing NaCl, NaSO4, CaCl and MgCl2 in 3:1 ratio of chloride and sulphate on gas exchange traits, membrane stability, chlorophyll stability index and osmolytic defense mechanism in Ziziphus rotundifolia and Ziziphus nummularia species of Indian jujube (Z.mauritiana). Result showed that net photosynthetic rate (PN), transpiration (e) and stomatal conductance were comparatively lower in Ziziphus nummularia, which further declined with increasing level of saline irrigation water. Chlorophyll stability and membrane stability also declined significantly in salt stress, with higher magnitude in Ziziphus nummularia. The activity of proline anabolic enzymes; Δ1-Pyrrolline-5-carboxylate reductase, Δ1-Pyrrolline-5-carboxylate synthetase and Ornithine-δ-aminotransferase were recorded higher in Ziziphus rotundifolia with decrease in proline dehydrogenase. The sodium content was observed higher in roots of Ziziphus rotundifolia and leaves of Ziziphus nummularia. Therefore, it is suggested that salt tolerance mechanism was more efficiently operative in Ziziphus rotundifolia owing to better management of physiological attributes, osmolytic defense mechanism and restricted translocation of sodium from root to leaves along with larger accumulation of potassium in its leaves.

Unraveling the role of water in the stereoselective step of aqueous proline-catalyzed aldol reactions.

PubMed

Ribas-Arino, Jordi; Carvajal, Maria Angels; Chaumont, Alain; Masia, Marco

2012-12-03

A multiscale computational study was performed with the aim of tracing the source of stereoselectivity and disclosing the role of water in the stereoselective step of propionaldehyde aldol self-condensation catalyzed by proline amide in water, a reaction that serves as a model for aqueous organocatalytic aldol condensations. Solvent mixing and hydration behavior were assessed by classical molecular dynamics simulations, which show that the reaction between propanal and the corresponding enamine takes place in a fully hydrated environment. First-principles molecular dynamics simulations were used to study the free-energy profile of four possible reaction paths, each of which yields a different stereoisomer, and high-level static first-principles calculations were employed to characterize the transition states for microsolvated species. The first solvation shell of the oxygen atom of the electrophilic aldehyde at the transition states contains two water molecules, each of which donates one hydrogen bond to the nascent alkoxide and thereby largely stabilizes its excess electron density. The stereoselectivity originates in an extra hydrogen bond donated by the amido group of proline amide in two reaction paths. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The "Boom" and "Bust" Patterns of Communities within the Energy Rich Region of West Virginia: A Case Study of Moundsville

NASA Astrophysics Data System (ADS)

Kiger, Brandon S.

The increasing worldwide demand for energy will provide Energy Rich Regions (ERRs) the opportunity to increase their wealth and quality of living. However, a reoccurring pattern of boom and bust cycles in ERRs suggests the need for more sustainable development strategies. A mixed methods approach (case study) is employed to explore the "wicked human problems" occurring in one community, Moundsville, WV and to discover development patterns that might inform sustainable development strategies for the future. This study explores briefly the distant past development patterns, and in greater detail the pre-boom and most current boom in natural gas. First, data will be derived from a conceptual "Energy Rich Region Template" that explores the sustainability of development from the inclusive wealth forms of natural, human, and physical capital. The qualitative data analysis software (MAXQDA) is used to systematically collect and organize data and information into a community-wide knowledge base (specifically the seven years of city council minutes). This framework can assist future research dedicated to similar cases. Furthermore, this case may support communities and or policymakers in the development of a programming guide for converting the natural capital into other reproducible capital forms, thus avoiding the development cycle of boom and bust.

Structural and functional rich club organization of the brain in children and adults.

PubMed

Grayson, David S; Ray, Siddharth; Carpenter, Samuel; Iyer, Swathi; Dias, Taciana G Costa; Stevens, Corinne; Nigg, Joel T; Fair, Damien A

2014-01-01

Recent studies using Magnetic Resonance Imaging (MRI) have proposed that the brain's white matter is organized as a rich club, whereby the most highly connected regions of the brain are also highly connected to each other. Here we use both functional and diffusion-weighted MRI in the human brain to investigate whether the rich club phenomena is present with functional connectivity, and how this organization relates to the structural phenomena. We also examine whether rich club regions serve to integrate information between distinct brain systems, and conclude with a brief investigation of the developmental trajectory of rich-club phenomena. In agreement with prior work, both adults and children showed robust structural rich club organization, comprising regions of the superior medial frontal/dACC, medial parietal/PCC, insula, and inferior temporal cortex. We also show that these regions were highly integrated across the brain's major networks. Functional brain networks were found to have rich club phenomena in a similar spatial layout, but a high level of segregation between systems. While no significant differences between adults and children were found structurally, adults showed significantly greater functional rich club organization. This difference appeared to be driven by a specific set of connections between superior parietal, insula, and supramarginal cortex. In sum, this work highlights the existence of both a structural and functional rich club in adult and child populations with some functional changes over development. It also offers a potential target in examining atypical network organization in common developmental brain disorders, such as ADHD and Autism.

Region-specific role of water in collagen unwinding and assembly.

PubMed

Ravikumar, Krishnakumar M; Hwang, Wonmuk

2008-09-01

Conformational stability of the collagen triple helix affects its turnover and determines tissue homeostasis. Although it is known that the presence of imino acids (prolines or hydroxyprolines) confer stability to the molecule, little is known regarding the stability of the imino-poor region lacking imino acids, which plays a key role in collagen cleavage. In particular, there have been continuing debates about the role of water in collagen stability. We addressed these issues using molecular dynamics simulations on 30-residue long collagen triple helices, including a structure that has a biologically relevant 9-residue imino-poor region from type III collagen (PDB ID: 1BKV). A torsional map approach was used to characterize the conformational motion of the molecule that differ between imino-rich and imino-poor regions. At temperatures 300 K and above, unwinding initiates at a common cleavage site, the glycine-isoleucine bond in the imino-poor region. This provides a linkage between previous observations that unwinding of the imino-poor region is a requirement for collagenase cleavage, and that isolated collagen molecules are unstable at body temperature. We found that unwinding of the imino-poor region is controlled by dynamic water bridges between backbone atoms with average lifetimes on the order of a few picoseconds, as the degree of unwinding strongly correlated with the loss of water bridges, and unwinding could be either prevented or enhanced, respectively by enforcing or forbidding water bridge formation. While individual water bridges were short-lived in the imino-poor region, the hydration shell surrounding the entire molecule was stable even at 330 K. The diameter of the hydrated collagen including the first hydration shell was about 14 A, in good agreement with the experimentally measured inter-collagen distances. These results elucidate the general role of water in collagen turnover: water not only affects collagen cleavage by controlling its torsional

Mechanistic consideration of the photochemical transformation of domoic acid (algal toxin) in DOM-Rich brackish water.

PubMed

Jin, Hangxing; Lian, Lushi; Zhou, Huaxi; Yan, Shuwen; Song, Weihua

2018-06-14

Domoic acid (DA) is a neurotoxin generated by several diatom species in harmful algae blooms (HABs). We report the photo-induced transformation products (TPs) and degradation mechanisms of DA in dissolved organic matter (DOM)-rich freshwater and brackish water. High-resolution quadrupole time-of-flight mass spectrometry (QTOF-MS) and the multivariate statistical strategy orthogonal partial least-squares discriminant analysis (OPLS-DA) identified 36 and 23 potential TPs in DOM-rich freshwater and brackish water, respectively. The main reactive sites of DA are the conjugated double bond and proline ring. Isomerization is the predominant transformation pathway induced by excited-state triplet DOM ( 3 DOM ∗ ). The second-order rate constant of the isomerization reaction was measured as (3.8 ± 0.2) × 10 8  M -1  s -1 . The inverse correlation between the dissolved oxygen (DO) concentration and the rate of photo-induced DA isomerization was revealed. Furthermore, under halide-present conditions, halide radicals are mainly responsible for the differentiation of products by quenching hydroxyl radicals and generating unique organic peroxide products. Our results indicated that halide radicals could be important in the photochemical transformation of organic contaminants in high saline environments. Copyright © 2018 Elsevier Ltd. All rights reserved.

Structure and Activity of the Peptidyl-Prolyl Isomerase Domain from the Histone Chaperone Fpr4 toward Histone H3 Proline Isomerization*

PubMed Central

Monneau, Yoan R.; Soufari, Heddy; Nelson, Christopher J.; Mackereth, Cameron D.

2013-01-01

The FK506-binding protein (FKBP) family of peptidyl-prolyl isomerases (PPIases) is characterized by a common catalytic domain that binds to the inhibitors FK506 and rapamycin. As one of four FKBPs within the yeast Saccharomyces cerevisiae, Fpr4 has been described as a histone chaperone, and is in addition implicated in epigenetic function in part due to its mediation of cis-trans conversion of proline residues within histone tails. To better understand the molecular details of this activity, we have determined the solution structure of the Fpr4 C-terminal PPIase domain by using NMR spectroscopy. This canonical FKBP domain actively increases the rate of isomerization of three decapeptides derived from the N terminus of yeast histone H3, whereas maintaining intrinsic cis and trans populations. Observation of the uncatalyzed and Fpr4-catalyzed isomerization rates at equilibrium demonstrate Pro16 and Pro30 of histone H3 as the major proline targets of Fpr4, with little activity shown against Pro38. This alternate ranking of the three target prolines, as compared with affinity determination or the classical chymotrypsin-based fluorescent assay, reveals the mechanistic importance of substrate residues C-terminal to the peptidyl-prolyl bond. PMID:23888048

The dynamics, structure, and conformational free energy of proline-containing antifreeze glycoprotein.

PubMed Central

Nguyen, Dat H; Colvin, Michael E; Yeh, Yin; Feeney, Robert E; Fink, William H

2002-01-01

Recent NMR studies of the solution structure of the 14-amino acid antifreeze glycoprotein AFGP-8 have concluded that the molecule lacks long-range order. The implication that an apparently unstructured molecule can still have a very precise function as a freezing inhibitor seems startling at first consideration. To gain insight into the nature of conformations and motions in AFGP-8, we have undertaken molecular dynamics simulations augmented with free energy calculations using a continuum solvation model. Starting from 10 different NMR structures, 20 ns of dynamics of AFGP were explored. The dynamics show that AFGP structure is composed of four segments, joined by very flexible pivots positioned at alanine 5, 8, and 11. The dynamics also show that the presence of prolines in this small AFGP structure facilitates the adoption of the poly-proline II structure as its overall conformation, although AFGP does adopt other conformations during the course of dynamics as well. The free energies calculated using a continuum solvation model show that the lowest free energy conformations, while being energetically equal, are drastically different in conformations. In other words, this AFGP molecule has many structurally distinct and energetically equal minima in its energy landscape. In addition, conformational, energetic, and hydrogen bond analyses suggest that the intramolecular hydrogen bonds between the N-acetyl group and the protein backbone are an important integral part of the overall stability of the AFGP molecule. The relevance of these findings to the mechanism of freezing inhibition is discussed. PMID:12023212

Climate patterns as predictors of amphibians species richness and indicators of potential stress

USGS Publications Warehouse

Battaglin, W.; Hay, L.; McCabe, G.; Nanjappa, P.; Gallant, Alisa L.

2005-01-01

Amphibians occupy a range of habitats throughout the world, but species richness is greatest in regions with moist, warm climates. We modeled the statistical relations of anuran and urodele species richness with mean annual climate for the conterminous United States, and compared the strength of these relations at national and regional levels. Model variables were calculated for county and subcounty mapping units, and included 40-year (1960-1999) annual mean and mean annual climate statistics, mapping unit average elevation, mapping unit land area, and estimates of anuran and urodele species richness. Climate data were derived from more than 7,500 first-order and cooperative meteorological stations and were interpolated to the mapping units using multiple linear regression models. Anuran and urodele species richness were calculated from the United States Geological Survey's Amphibian Research and Monitoring Initiative (ARMI) National Atlas for Amphibian Distributions. The national multivariate linear regression (MLR) model of anuran species richness had an adjusted coefficient of determination (R2) value of 0.64 and the national MLR model for urodele species richness had an R2 value of 0.45. Stratifying the United States by coarse-resolution ecological regions provided models for anUrans that ranged in R2 values from 0.15 to 0.78. Regional models for urodeles had R2 values. ranging from 0.27 to 0.74. In general, regional models for anurans were more strongly influenced by temperature variables, whereas precipitation variables had a larger influence on urodele models.

Impact of adenosine nucleotide translocase (ANT) proline isomerization on Ca2+-induced cysteine relative mobility/mitochondrial permeability transition pore.

PubMed

Pestana, Cezar R; Silva, Carlos H T P; Uyemura, Sérgio A; Santos, Antonio C; Curti, Carlos

2010-08-01

Mitochondrial membrane carriers containing proline and cysteine, such as adenine nucleotide translocase (ANT), are potential targets of cyclophilin D (CyP-D) and potential Ca(2+)-induced permeability transition pore (PTP) components or regulators; CyP-D, a mitochondrial peptidyl-prolyl cis-trans isomerase, is the probable target of the PTP inhibitor cyclosporine A (CsA). In the present study, the impact of proline isomerization (from trans to cis) on the mitochondrial membrane carriers containing proline and cysteine was addressed using ANT as model. For this purpose, two different approaches were used: (i) Molecular dynamic (MD) analysis of ANT-Cys(56) relative mobility and (ii) light scattering techniques employing rat liver isolated mitochondria to assess both Ca(2+)-induced ANT conformational change and mitochondrial swelling. ANT-Pro(61) isomerization increased ANT-Cys(56) relative mobility and, moreover, desensitized ANT to the prevention of this effect by ADP. In addition, Ca(2+) induced ANT "c" conformation and opened PTP; while the first effect was fully inhibited, the second was only attenuated by CsA or ADP. Atractyloside (ATR), in turn, stabilized Ca(2+)-induced ANT "c" conformation, rendering the ANT conformational change and PTP opening less sensitive to the inhibition by CsA or ADP. These results suggest that Ca(2+) induces the ANT "c" conformation, apparently associated with PTP opening, but requires the CyP-D peptidyl-prolyl cis-trans isomerase activity for sustaining both effects.

Developmental localization and the role of hydroxyproline rich glycoproteins during somatic embryogenesis of banana (Musa spp. AAA)

PubMed Central

2011-01-01

Background Hydroxyproline rich glycoproteins (HRGPs) are implicated to have a role in many aspects of plant growth and development but there is limited knowledge about their localization and function during somatic embryogenesis of higher plants. In this study, the localization and function of hydroxyproline rich glycoproteins in embryogenic cells (ECs) and somatic embryos of banana were investigated by using immunobloting and immunocytochemistry with monoclonal JIM11 and JIM20 antibodies as well as by treatment with 3,4-dehydro-L-proline (3,4-DHP, an inhibitor of extensin biosynthesis), and by immunomodulation with the JIM11 antibody. Results Immunofluorescence labelling of JIM11 and JIM20 hydroxyproline rich glycoprotein epitopes was relatively weak in non-embryogenic cells (NECs), mainly on the edge of small cell aggregates. On the other hand, hydroxyproline rich glycoprotein epitopes were found to be enriched in early embryogenic cells as well as in various developmental stages of somatic embryos. Embryogenic cells (ECs), proembryos and globular embryos showed strong labelling of hydroxyproline rich glycoprotein epitopes, especially in their cell walls and outer surface layer, so-called extracellular matrix (ECM). This hydroxyproline rich glycoprotein signal at embryo surfaces decreased and/or fully disappeared during later developmental stages (e.g. pear-shaped and cotyledonary stages) of embryos. In these later developmental embryogenic stages, however, new prominent hydroxyproline rich glycoprotein labelling appeared in tri-cellular junctions among parenchymatic cells inside these embryos. Overall immunofluorescence labelling of late stage embryos with JIM20 antibody was weaker than that of JIM11. Western blot analysis supported the above immunolocalization data. The treatment with 3,4-DHP inhibited the development of embryogenic cells and decreased the rate of embryo germination. Embryo-like structures, which developed after 3,4-DHP treatment showed

Conformational profile of a proline-arginine hybrid

PubMed Central

Revilla-López, Guillermo; Jiménez, Ana I.; Cativiela, Carlos; Nussinov, Ruth; Alemán, Carlos; Zanuy, David

2010-01-01

The intrinsic conformational preferences of a new non-proteinogenic amino acid have been explored by computational methods. This tailored molecule, named (βPro)Arg, is conceived as a replacement for arginine in bioactive peptides when the stabilization of folded turn-like conformations is required. The new residue features a proline skeleton that bears the guanidilated side chain of arginine at the Cβ position of the five-membered pyrrolidine ring, either in a cis or a trans orientation with respect to the carboxylic acid. The conformational profile of the N-acetyl-N'-methylamide derivatives of the cis and trans isomers of (βPro)Arg has been examined in the gas phase and in solution by B3LYP/6–31+G(d,p) calculations and molecular dynamics simulations. The main conformational features of both isomers represent a balance between geometric restrictions imposed by the five-membered pyrrolidine ring and the ability of the guanidilated side chain to interact with the backbone through hydrogen-bonds. Thus, both cis and trans (βPro)Arg exhibit a preference for the αL conformation as a consequence of the interactions established between the guanidinium moiety and the main-chain amide groups. PMID:20886854

Conformational profile of a proline-arginine hybrid.

PubMed

Revilla-López, Guillermo; Jiménez, Ana I; Cativiela, Carlos; Nussinov, Ruth; Alemán, Carlos; Zanuy, David

2010-10-25

The intrinsic conformational preferences of a new nonproteinogenic amino acid have been explored by computational methods. This tailored molecule, named ((β)Pro)Arg, is conceived as a replacement for arginine in bioactive peptides when the stabilization of folded turn-like conformations is required. The new residue features a proline skeleton that bears the guanidilated side chain of arginine at the C(β) position of the five-membered pyrrolidine ring, in either a cis or a trans orientation with respect to the carboxylic acid. The conformational profiles of the N-acetyl-N'-methylamide derivatives of the cis and trans isomers of ((β)Pro)Arg have been examined in the gas phase and in solution by B3LYP/6-31+G(d,p) calculations and molecular dynamics simulations. The main conformational features of both isomers represent a balance between geometric restrictions imposed by the five-membered pyrrolidine ring and the ability of the guanidilated side chain to interact with the backbone through hydrogen bonds. Thus, both cis- and trans-((β)Pro)Arg exhibit a preference for the α(L) conformation as a consequence of the interactions established between the guanidinium moiety and the main-chain amide groups.

Pin1 promotes transforming growth factor-beta-induced migration and invasion.

PubMed

Matsuura, Isao; Chiang, Keng-Nan; Lai, Chen-Yu; He, Dongming; Wang, Guannan; Ramkumar, Romila; Uchida, Takafumi; Ryo, Akihide; Lu, Kunping; Liu, Fang

2010-01-15

Transforming growth factor-beta (TGF-beta) regulates a wide variety of biological activities. It induces potent growth-inhibitory responses in normal cells but promotes migration and invasion of cancer cells. Smads mediate the TGF-beta responses. TGF-beta binding to the cell surface receptors leads to the phosphorylation of Smad2/3 in their C terminus as well as in the proline-rich linker region. The serine/threonine phosphorylation sites in the linker region are followed by the proline residue. Pin1, a peptidyl-prolyl cis/trans isomerase, recognizes phosphorylated serine/threonine-proline motifs. Here we show that Smad2/3 interacts with Pin1 in a TGF-beta-dependent manner. We further show that the phosphorylated threonine 179-proline motif in the Smad3 linker region is the major binding site for Pin1. Although epidermal growth factor also induces phosphorylation of threonine 179 and other residues in the Smad3 linker region the same as TGF-beta, Pin1 is unable to bind to the epidermal growth factor-stimulated Smad3. Further analysis suggests that phosphorylation of Smad3 in the C terminus is necessary for the interaction with Pin1. Depletion of Pin1 by small hairpin RNA does not significantly affect TGF-beta-induced growth-inhibitory responses and a number of TGF-beta/Smad target genes analyzed. In contrast, knockdown of Pin1 in human PC3 prostate cancer cells strongly inhibited TGF-beta-mediated migration and invasion. Accordingly, TGF-beta induction of N-cadherin, which plays an important role in migration and invasion, is markedly reduced when Pin1 is depleted in PC3 cells. Because Pin1 is overexpressed in many cancers, our findings highlight the importance of Pin1 in TGF-beta-induced migration and invasion of cancer cells.

The ring residue proline 8 is crucial for the thermal stability of the lasso peptide caulosegnin II.

PubMed

Hegemann, Julian D; Fage, Christopher D; Zhu, Shaozhou; Harms, Klaus; Di Leva, Francesco Saverio; Novellino, Ettore; Marinelli, Luciana; Marahiel, Mohamed A

2016-04-01

Lasso peptides are fascinating natural products with a unique structural fold that can exhibit tremendous thermal stability. Here, we investigate factors responsible for the thermal stability of caulosegnin II. By employing X-ray crystallography, mutational analysis and molecular dynamics simulations, the ring residue proline 8 was proven to be crucial for thermal stability.

Insights into the Evolution of Hydroxyproline-Rich Glycoproteins from 1000 Plant Transcriptomes1[OPEN

PubMed Central

Cassin, Andrew M.; Soltis, Douglas E.; Miles, Nicholas W.; Melkonian, Michael; Melkonian, Barbara; Wu, Shuangxiu; Edger, Patrick P.; Carpenter, Eric J.

2017-01-01

The carbohydrate-rich cell walls of land plants and algae have been the focus of much interest given the value of cell wall-based products to our current and future economies. Hydroxyproline-rich glycoproteins (HRGPs), a major group of wall glycoproteins, play important roles in plant growth and development, yet little is known about how they have evolved in parallel with the polysaccharide components of walls. We investigate the origins and evolution of the HRGP superfamily, which is commonly divided into three major multigene families: the arabinogalactan proteins (AGPs), extensins (EXTs), and proline-rich proteins. Using motif and amino acid bias, a newly developed bioinformatics pipeline, we identified HRGPs in sequences from the 1000 Plants transcriptome project (www.onekp.com). Our analyses provide new insights into the evolution of HRGPs across major evolutionary milestones, including the transition to land and the early radiation of angiosperms. Significantly, data mining reveals the origin of glycosylphosphatidylinositol (GPI)-anchored AGPs in green algae and a 3- to 4-fold increase in GPI-AGPs in liverworts and mosses. The first detection of cross-linking (CL)-EXTs is observed in bryophytes, which suggests that CL-EXTs arose though the juxtaposition of preexisting SPn EXT glycomotifs with refined Y-based motifs. We also detected the loss of CL-EXT in a few lineages, including the grass family (Poaceae), that have a cell wall composition distinct from other monocots and eudicots. A key challenge in HRGP research is tracking individual HRGPs throughout evolution. Using the 1000 Plants output, we were able to find putative orthologs of Arabidopsis pollen-specific GPI-AGPs in basal eudicots. PMID:28446636

Role of Conserved Proline Residues in Human Apolipoprotein A-IV Structure and Function*

PubMed Central

Deng, Xiaodi; Walker, Ryan G.; Morris, Jamie; Davidson, W. Sean; Thompson, Thomas B.

2015-01-01

Apolipoprotein (apo)A-IV is a lipid emulsifying protein linked to a range of protective roles in obesity, diabetes, and cardiovascular disease. It exists in several states in plasma including lipid-bound in HDL and chylomicrons and as monomeric and dimeric lipid-free/poor forms. Our recent x-ray crystal structure of the central domain of apoA-IV shows that it adopts an elongated helical structure that dimerizes via two long reciprocating helices. A striking feature is the alignment of conserved proline residues across the dimer interface. We speculated that this plays important roles in the structure of the lipid-free protein and its ability to bind lipid. Here we show that the systematic conversion of these prolines to alanine increased the thermodynamic stability of apoA-IV and its propensity to oligomerize. Despite the structural stabilization, we noted an increase in the ability to bind and reorganize lipids and to promote cholesterol efflux from cells. The novel properties of these mutants allowed us to isolate the first trimeric form of an exchangeable apolipoprotein and characterize it by small-angle x-ray scattering and chemical cross-linking. The results suggest that the reciprocating helix interaction is a common feature of all apoA-IV oligomers. We propose a model of how self-association of apoA-IV can result in spherical lipoprotein particles, a model that may have broader applications to other exchangeable apolipoprotein family members. PMID:25733664

Local richness along gradients in the Siskiyou herb flora: R.H. Whittaker revisited

USGS Publications Warehouse

Grace, James B.; Harrison, Susan; Damschen, Ellen Ingman

2011-01-01

In his classic study in the Siskiyou Mountains (Oregon, USA), one of the most botanically rich forested regions in North America, R. H. Whittaker (1960) foreshadowed many modern ideas on the multivariate control of local species richness along environmental gradients related to productivity. Using a structural equation model to analyze his data, which were never previously statistically analyzed, we demonstrate that Whittaker was remarkably accurate in concluding that local herb richness in these late-seral forests is explained to a large extent by three major abiotic gradients (soils, topography, and elevation), and in turn, by the effects of these gradients on tree densities and the numbers of individual herbs. However, while Whittaker also clearly appreciated the significance of large-scale evolutionary and biogeographic influences on community composition, he did not fully articulate the more recent concept that variation in the species richness of local communities could be explained in part by variation in the sizes of regional species pools. Our model of his data is among the first to use estimates of regional species pool size to explain variation in local community richness along productivity-related gradients. We find that regional pool size, combined with a modest number of other interacting abiotic and biotic factors, explains most of the variation in local herb richness in the Siskiyou biodiversity hotspot.

The maturation rate of girls living in rich and poor rural regions of Poland before and after the transformation of 1989.

PubMed

Laska-Mierzejewska, T; Olszewska, E

2004-01-01

The aim of this study was to find out whether the political and economic system transformation in Poland in 1989 had an influence on the rate of maturation of girls from various categories of the rural population in two regions, differing in wealth. The stratification of the villagers was based on the source of the family income (farmers, farmer-workers and non-farmers), on parents' education, and on the number of children per family. The age at menarche (AM) was used as biological indicator of living conditions. Rural girls aged 9.5-18.5 years were studied in 1987 in Leszno (L), a rich region (n = 2049), and in 1989 in Suwałki (S), a poor region (n = 2077). The study was repeated in 2001 in the same villages, the numbers of subjects amounting to 2440 and 2122, respectively. In the 1980s, AM in regions L and S amounted to 13.18 and 13.88 years, respectively, and was strongly related to social stratification. The earliest AM was found in daughters of non-farmers and the latest in the girls from farmers' families. In 2001, the acceleration in AM amounted to 0.14 years in the rich region and to 0.46 years in the poor region. The percentage of families owning a car, freezer, colour TV and automatic washing machine markedly increased and the education of parents improved. Such results are indicative of an improvement in the living standard of the groups investigated, but the villagers regard themselves as the losers as a result of the system transformation in Poland. Since the Polish population is considered as ethnically homogenous, the great differences in AM within the rural population, as well as the differences between the inhabitants of villages and large cities should be regarded as biological effects of social inequalities. Such differences indicate that Polish rural girls are far below the genetic potential for menarcheal age.

The Aspergillus nidulans Proline Permease as a Model for Understanding the Factors Determining Substrate Binding and Specificity of Fungal Amino Acid Transporters*

PubMed Central

Gournas, Christos; Evangelidis, Thomas; Athanasopoulos, Alexandros; Mikros, Emmanuel; Sophianopoulou, Vicky

2015-01-01

Amino acid uptake in fungi is mediated by general and specialized members of the yeast amino acid transporter (YAT) family, a branch of the amino acid polyamine organocation (APC) transporter superfamily. PrnB, a highly specific l-proline transporter, only weakly recognizes other Put4p substrates, its Saccharomyces cerevisiae orthologue. Taking advantage of the high sequence similarity between the two transporters, we combined molecular modeling, induced fit docking, genetic, and biochemical approaches to investigate the molecular basis of this difference and identify residues governing substrate binding and specificity. We demonstrate that l-proline is recognized by PrnB via interactions with residues within TMS1 (Gly56, Thr57), TMS3 (Glu138), and TMS6 (Phe248), which are evolutionary conserved in YATs, whereas specificity is achieved by subtle amino acid substitutions in variable residues. Put4p-mimicking substitutions in TMS3 (S130C), TMS6 (F252L, S253G), TMS8 (W351F), and TMS10 (T414S) broadened the specificity of PrnB, enabling it to recognize more efficiently l-alanine, l-azetidine-2-carboxylic acid, and glycine without significantly affecting the apparent Km for l-proline. S253G and W351F could transport l-alanine, whereas T414S, despite displaying reduced proline uptake, could transport l-alanine and glycine, a phenotype suppressed by the S130C mutation. A combination of all five Put4p-ressembling substitutions resulted in a functional allele that could also transport l-alanine and glycine, displaying a specificity profile impressively similar to that of Put4p. Our results support a model where residues in these positions determine specificity by interacting with the substrates, acting as gating elements, altering the flexibility of the substrate binding core, or affecting conformational changes of the transport cycle. PMID:25572393

What explains high plant richness in East Asia? Time and diversification in the tribe Lysimachieae (Primulaceae).

PubMed

Yan, Hai-Fei; Zhang, Cai-Yun; Anderberg, Arne A; Hao, Gang; Ge, Xue-Jun; Wiens, John J

2018-04-17

What causes the disparity in biodiversity among regions is a fundamental question in biogeography, ecology, and evolutionary biology. Evolutionary and biogeographic processes (speciation, extinction, dispersal) directly determine species richness patterns, and can be studied using integrative phylogenetic approaches. However, the strikingly high richness of East Asia relative to other Northern Hemisphere regions remains poorly understood from this perspective. Here, for the first time, we test two general hypotheses (older colonization time, faster diversification rate) to explain this pattern, using the plant tribe Lysimachieae (Primulaceae) as a model system. We generated a new time-calibrated phylogeny for Lysimachieae (13 genes, 126 species), to estimate colonization times and diversification rates for each region and to test the relative importance of these two factors for explaining regional richness patterns. We find that neither time nor diversification rates alone explain richness patterns among regions in Lysimachieae. Instead, a new index that combines both factors explains global richness patterns in the group and their high East Asian biodiversity. Based on our results from Lysimachieae, we suggest that the high richness of plants in East Asia may be explained by a combination of older colonization times and faster diversification rates in this region. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

Antisense Proline-Arginine RAN dipeptides linked to C9ORF72-ALS/FTD form toxic nuclear aggregates that initiate in vitro and in vivo neuronal death

PubMed Central

Wen, Xinmei; Tan, Wenzhi; Westergard, Thomas; Krishnamurthy, Karthik; ShamamandriMarkandaiah, Shashirekha; Shi, Yingxiao; Lin, Shaoyu; Shneider, Neil A.; Monaghan, John; Pandey, Udai B.; Pasinelli, Piera; Ichida, Justin K.; Trotti, Davide

2015-01-01

SUMMARY Expanded GGGGCC nucleotide repeats within the C9ORF72 gene are the most common genetic mutation associated with both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Sense and antisense transcripts of these expansions are translated to form five dipeptide repeat proteins (DRPs). We employed primary cortical and motor neuron cultures, live-cell imaging, and transgenic fly models and found that the arginine-rich dipeptides, in particular Proline-Arginine (PR), are potently neurotoxic. Factors that anticipated their neurotoxicity included aggregation in nucleoli, decreased number of processing bodies, and stress granules formation, implying global translational dysregulation as path accountable for toxicity. Nuclear PR aggregates were also found in human-induced motor neurons and postmortem spinal cord tissues from C9ORF72 ALS and ALS/FTD patients. Intronic G4C2 transcripts, but not loss of C9ORF72 protein, are also toxic to motor and cortical neurons. Interestingly, G4C2 transcript-mediated neurotoxicity synergizes with that of PR aggregates, suggesting convergence of mechanisms. PMID:25521377

Regional Variation in Parasite Species Richness and Abundance in the Introduced Range of the Invasive Lionfish, Pterois volitans.

PubMed

Sellers, Andrew J; Ruiz, Gregory M; Leung, Brian; Torchin, Mark E

2015-01-01

Parasites can play an important role in biological invasions. While introduced species often lose parasites from their native range, they can also accumulate novel parasites in their new range. The accumulation of parasites by introduced species likely varies spatially, and more parasites may shift to new hosts where parasite diversity is high. Considering that parasitism and disease are generally more prevalent at lower latitudes, the accumulation of parasites by introduced hosts may be greater in tropical regions. The Indo-Pacific lionfish (Pterois volitans) has become widely distributed across the Western Atlantic. In this study, we compared parasitism across thirteen locations in four regions, spanning seventeen degrees of latitude in the lionfish's introduced range to examine potential spatial variation in parasitism. In addition, as an initial step to explore how indirect effects of parasitism might influence interactions between lionfish and ecologically similar native hosts, we also compared parasitism in lionfish and two co-occurring native fish species, the graysby grouper, Cephalopholis cruentata, and the lizardfish, Synodus intermedius, in the southernmost region, Panama. Our results show that accumulation of native parasites on lionfish varies across broad spatial scales, and that colonization by ectoparasites was highest in Panama, relative to the other study sites. Endoparasite richness and abundance, on the other hand, were highest in Belize where lionfish were infected by twice as many endoparasite species as lionfish in other regions. The prevalence of all but two parasite species infecting lionfish was below 25%, and we did not detect an association between parasite abundance and host condition, suggesting a limited direct effect of parasites on lionfish, even where parasitism was highest. Further, parasite species richness and abundance were significantly higher in both native fishes compared to lionfish, and parasite abundance was negatively

Regional Variation in Parasite Species Richness and Abundance in the Introduced Range of the Invasive Lionfish, Pterois volitans