A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

PubMed Central

Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

2009-01-01

RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea

PubMed Central

Ford, Kathryn L.; Baumgartner, Kendra; Henricot, Béatrice; Bailey, Andy M.; Foster, Gary D.

2016-01-01

Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled using yeast-based recombination methods. These have been designed to allow easy exchange of promoters and inclusion of introns. The vectors were first tested by transformation into basidiomycete Clitopilus passeckerianus to ascertain vector functionality then used to transform A. mellea. We show that heterologous promoters from the basidiomycetes Agaricus bisporus and Phanerochaete chrysosporium that were used successfully to control the hygromycin resistance cassette were not able to support expression of mRFP or GFP in A. mellea. The endogenous A. mellea gpd promoter delivered efficient expression, and we show that inclusion of an intron was also required for transgene expression. GFP and mRFP expression was stable in mycelia and fluorescence was visible in transgenic fruiting bodies and GFP was detectable in planta. Use of these vectors has been successful in giving expression of the fluorescent proteins GFP and mRFP in A. mellea, providing an additional molecular tool for this pathogen. PMID:27384974

Identification of Essential Genetic Baculoviral Elements for Recombinant Protein Expression by Transactivation in Sf21 Insect Cells.

PubMed

Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop

2016-01-01

The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.

Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

PubMed

Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

2017-07-01

Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

DOE PAGES

Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana; ...

2016-02-04

Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana

Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

Expression of the core antigen gene of hepatitis B virus (HBV) in Acetobacter methanolicus using broad-host-range vectors.

PubMed

Schröder, R; Maassen, A; Lippoldt, A; Börner, T; von Baehr, R; Dobrowolski, P

1991-08-01

Using the broad-host-range promoter probe vector pRS201 for cloning of phage Acm1 promoters, we established a convenient vector system for expression of heterologous genes in different Gram-negative bacteria. The usefulness of this system was demonstrated by expression of the HBV core gene in Acetobacter methanolicus. Plasmids carrying the HBV core gene downstream of different Acm1-phage promoters were transferred to A. methanolicus, a new potential host for recombinant DNA expression. Using enzyme immunoassay and immunoblot techniques, the amount and composition of core antigen produced in A. methanolicus were compared with that derived from Escherichia coli. The expression of immunoreactive core antigen in A. methanolicus exceeds by sevenfold that in E. coli using an expression system with tandemly arranged promoters. Morphological observations by electron microscopy show that the HBV core gene products isolated from both hosts are assembled into regular spherical particles with a diameter of about 28 nm that are comparable to original viral nucleocapsids.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

PubMed Central

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed Central

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.

A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.

PubMed

Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H

2016-01-01

The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.

Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

PubMed

Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

2007-06-15

A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

PubMed Central

Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria

2010-01-01

Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151

UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

PubMed

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Safety mechanism assisted by the repressor of tetracycline (SMART) vaccinia virus vectors for vaccines and therapeutics.

PubMed

Grigg, Patricia; Titong, Allison; Jones, Leslie A; Yilma, Tilahun D; Verardi, Paulo H

2013-09-17

Replication-competent viruses, such as Vaccinia virus (VACV), are powerful tools for the development of oncolytic viral therapies and elicit superior immune responses when used as vaccine and immunotherapeutic vectors. However, severe complications from uncontrolled viral replication can occur, particularly in immunocompromised individuals or in those with other predisposing conditions. VACVs constitutively expressing interferon-γ (IFN-γ) replicate in cell culture indistinguishably from control viruses; however, they replicate in vivo to low or undetectable levels, and are rapidly cleared even in immunodeficient animals. In an effort to develop safe and highly effective replication-competent VACV vectors, we established a system to inducibly express IFN-γ. Our SMART (safety mechanism assisted by the repressor of tetracycline) vectors are designed to express the tetracycline repressor under a constitutive VACV promoter and IFN-γ under engineered tetracycline-inducible promoters. Immunodeficient SCID mice inoculated with VACVs not expressing IFN-γ demonstrated severe weight loss, whereas those given VACVs expressing IFN-γ under constitutive VACV promoters showed no signs of infection. Most importantly, mice inoculated with a VACV expressing the IFN-γ gene under an inducible promoter remained healthy in the presence of doxycycline, but exhibited severe weight loss in the absence of doxycycline. In this study, we developed a safety mechanism for VACV based on the conditional expression of IFN-γ under a tightly controlled tetracycline-inducible VACV promoter for use in vaccines and oncolytic cancer therapies.

Gene transfer to brain using herpes simplex virus vectors.

PubMed

Glorioso, J C; Goins, W F; Meaney, C A; Fink, D J; DeLuca, N A

1994-01-01

Herpes simplex virus type 1 represents an ideal candidate for development as a vehicle for gene transfer to postmitotic neurons of the central nervous system. The natural biology of this virus makes it well suited for this purpose as it is capable of infecting a variety of neuronal cell types in the brain where the viral genome can persist indefinitely in a latent state. In latency, the viral lytic genes are transcriptionally silent and a unique set of latency-associated transcripts are expressed. Two impediments to using herpes simplex virus vectors must be overcome: (1) A noncytotoxic mutant virus backbone must be engineered, and (2) a suitable promoter-regulator that stably expresses foreign genes from the vector genome during latency must be constructed. Deletion of specific immediate early genes from the vector can render the virus nontoxic to neurons in culture and in vivo following stereotactic inoculation into specific regions of the brain. Because these viruses cannot replicate, they enter latency on infection of central nervous system neurons. A number of viral and cellular promoters have been tested for their ability to express genes during latency. Strong viral promoters and neurospecific promoters display transient activity. Although the promoter regions for the latency-associated transcripts are highly active in the peripheral nervous system, they show low-level but persistent activity in the brain. Experiments are in progress to exploit RNA polymerase III gene promoters or novel recombinant promoters capable of auto-inducing their own expression in order to increase gene expression during latency in brain neurons.

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

New Recombinant Mycobacterium bovis BCG Expression Vectors: Improving Genetic Control over Mycobacterial Promoters.

PubMed

Kanno, Alex I; Goulart, Cibelly; Rofatto, Henrique K; Oliveira, Sergio C; Leite, Luciana C C; McFadden, Johnjoe

2016-04-01

The expression of many antigens, stimulatory molecules, or even metabolic pathways in mycobacteria such as Mycobacterium bovis BCG or M. smegmatis was made possible through the development of shuttle vectors, and several recombinant vaccines have been constructed. However, gene expression in any of these systems relied mostly on the selection of natural promoters expected to provide the required level of expression by trial and error. To establish a systematic selection of promoters with a range of strengths, we generated a library of mutagenized promoters through error-prone PCR of the strong PL5 promoter, originally from mycobacteriophage L5. These promoters were cloned upstream of the enhanced green fluorescent protein reporter gene, and recombinant M. smegmatis bacteria exhibiting a wide range of fluorescence levels were identified. A set of promoters was selected and identified as having high (pJK-F8), intermediate (pJK-B7, pJK-E6, pJK-D6), or low (pJK-C1) promoter strengths in both M. smegmatis and M. bovisBCG. The sequencing of the promoter region demonstrated that it was extensively modified (6 to 11%) in all of the plasmids selected. To test the functionality of the system, two different expression vectors were demonstrated to allow corresponding expression levels of the Schistosoma mansoni antigen Sm29 in BCG. The approach used here can be used to adjust expression levels for synthetic and/or systems biology studies or for vaccine development to maximize the immune response. Copyright © 2016 Kanno et al.

Foamy Virus Vector Carries a Strong Insulator in Its Long Terminal Repeat Which Reduces Its Genotoxic Potential

PubMed Central

2017-01-01

ABSTRACT Strong viral enhancers in gammaretrovirus vectors have caused cellular proto-oncogene activation and leukemia, necessitating the use of cellular promoters in “enhancerless” self-inactivating integrating vectors. However, cellular promoters result in relatively low transgene expression, often leading to inadequate disease phenotype correction. Vectors derived from foamy virus, a nonpathogenic retrovirus, show higher preference for nongenic integrations than gammaretroviruses/lentiviruses and preferential integration near transcriptional start sites, like gammaretroviruses. We found that strong viral enhancers/promoters placed in foamy viral vectors caused extremely low immortalization of primary mouse hematopoietic stem/progenitor cells compared to analogous gammaretrovirus/lentivirus vectors carrying the same enhancers/promoters, an effect not explained solely by foamy virus' modest insertional site preference for nongenic regions compared to gammaretrovirus/lentivirus vectors. Using CRISPR/Cas9-mediated targeted insertion of analogous proviral sequences into the LMO2 gene and then measuring LMO2 expression, we demonstrate a sequence-specific effect of foamy virus, independent of insertional bias, contributing to reduced genotoxicity. We show that this effect is mediated by a 36-bp insulator located in the foamy virus long terminal repeat (LTR) that has high-affinity binding to the CCCTC-binding factor. Using our LMO2 activation assay, LMO2 expression was significantly increased when this insulator was removed from foamy virus and significantly reduced when the insulator was inserted into the lentiviral LTR. Our results elucidate a mechanism underlying the low genotoxicity of foamy virus, identify a novel insulator, and support the use of foamy virus as a vector for gene therapy, especially when strong enhancers/promoters are required. IMPORTANCE Understanding the genotoxic potential of viral vectors is important in designing safe and efficacious vectors for gene therapy. Self-inactivating vectors devoid of viral long-terminal-repeat enhancers have proven safe; however, transgene expression from cellular promoters is often insufficient for full phenotypic correction. Foamy virus is an attractive vector for gene therapy. We found foamy virus vectors to be remarkably less genotoxic, well below what was expected from their integration site preferences. We demonstrate that the foamy virus long terminal repeats contain an insulator element that binds CCCTC-binding factor and reduces its insertional genotoxicity. Our study elucidates a mechanism behind the low genotoxic potential of foamy virus, identifies a unique insulator, and supports the use of foamy virus as a vector for gene therapy. PMID:29046446

Better Targeting, Better Efficiency for Wide-Scale Neuronal Transduction with the Synapsin Promoter and AAV-PHP.B

PubMed Central

Jackson, Kasey L.; Dayton, Robert D.; Deverman, Benjamin E.; Klein, Ronald L.

2016-01-01

Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats. PMID:27867348

Better Targeting, Better Efficiency for Wide-Scale Neuronal Transduction with the Synapsin Promoter and AAV-PHP.B.

PubMed

Jackson, Kasey L; Dayton, Robert D; Deverman, Benjamin E; Klein, Ronald L

2016-01-01

Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats.

A helper virus-free HSV-1 vector containing the vesicular glutamate transporter-1 promoter supports expression preferentially in VGLUT1-containing glutamatergic neurons.

PubMed

Zhang, Guo-rong; Geller, Alfred I

2010-05-17

Multiple potential uses of direct gene transfer into neurons require restricting expression to specific classes of glutamatergic neurons. Thus, it is desirable to develop vectors containing glutamatergic class-specific promoters. The three vesicular glutamate transporters (VGLUTs) are expressed in distinct populations of neurons, and VGLUT1 is the predominant VGLUT in the neocortex, hippocampus, and cerebellar cortex. We previously reported a plasmid (amplicon) Herpes Simplex Virus (HSV-1) vector that placed the Lac Z gene under the regulation of the VGLUT1 promoter (pVGLUT1lac). Using helper virus-free vector stocks, we showed that this vector supported approximately 90% glutamatergic neuron-specific expression in postrhinal (POR) cortex, in rats sacrificed at either 4 days or 2 months after gene transfer. We now show that pVGLUT1lac supports expression preferentially in VGLUT1-containing glutamatergic neurons. pVGLUT1lac vector stock was injected into either POR cortex, which contains primarily VGLUT1-containing glutamatergic neurons, or into the ventral medial hypothalamus (VMH), which contains predominantly VGLUT2-containing glutamatergic neurons. Rats were sacrificed at 4 days after gene transfer, and the types of cells expressing ss-galactosidase were determined by immunofluorescent costaining. Cell counts showed that pVGLUT1lac supported expression in approximately 10-fold more cells in POR cortex than in the VMH, whereas a control vector supported expression in similar numbers of cells in these two areas. Further, in POR cortex, pVGLUT1lac supported expression predominately in VGLUT1-containing neurons, and, in the VMH, pVGLUT1lac showed an approximately 10-fold preference for the rare VGLUT1-containing neurons. VGLUT1-specific expression may benefit specific experiments on learning or specific gene therapy approaches, particularly in the neocortex. Copyright 2010 Elsevier B.V. All rights reserved.

Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-12-20

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-09-30

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

UMG Lenti: Novel Lentiviral Vectors for Efficient Transgene- and Reporter Gene Expression in Human Early Hematopoietic Progenitors

PubMed Central

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells. PMID:25502183

Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

USDA-ARS?s Scientific Manuscript database

A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

A novel pair of inducible expression vectors for use in Methylobacterium extorquens.

PubMed

Chubiz, Lon M; Purswani, Jessica; Carroll, Sean Michael; Marx, Chistopher J

2013-05-06

Due to the ever increasing use of diverse microbial taxa in basic research and industrial settings, there is a growing need for genetic tools to alter the physiology of these organisms. In particular, there is a dearth of inducible expression systems available for bacteria outside commonly used γ-proteobacteria, such as Escherichia coli or Pseudomonas species. To this end, we have sought to develop a pair of inducible expression vectors for use in the α-proteobacterium Methylobacterium extorquens, a model methylotroph. We found that the P(R) promoter from rhizobial phage 16-3 was active in M. extorquens and engineered the promoter to be inducible by either p-isopropyl benzoate (cumate) or anhydrotetracycline. These hybrid promoters, P(R/cmtO) and P(R/tetO), were found to have high levels of expression in M. extorquens with a regulatory range of 10-fold and 30-fold, respectively. Compared to an existing cumate-inducible (10-fold range), high-level expression system for M. extorquens, P(R/cmtO) and P(R/tetO) have 33% of the maximal activity but were able to repress gene expression 3 and 8-fold greater, respectively. Both promoters were observed to exhibit homogeneous, titratable activation dynamics rather than on-off, switch-like behavior. The utility of these promoters was further demonstrated by complementing loss of function of ftfL--essential for growth on methanol--where we show P(R/tetO) is capable of not only fully complementing function but also producing a conditional null phenotype. These promoters have been incorporated into a broad-host-range backbone allowing for potential use in a variety of bacterial hosts. We have developed two novel expression systems for use in M. extorquens. The expression range of these vectors should allow for increased ability to explore cellular physiology in M. extorquens. Further, the P(R/tetO) promoter is capable of producing conditional null phenotypes, previously unattainable in M. extorquens. As both expression systems rely on the use of membrane permeable inducers, we suspect these expression vectors will be useful for ectopic gene expression in numerous proteobacteria.

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

PubMed

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-06-01

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2018. Published by Elsevier Inc.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production.

PubMed

Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production

PubMed Central

Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731

GenoCAD Plant Grammar to Design Plant Expression Vectors for Promoter Analysis.

PubMed

Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean

2016-01-01

With the rapid advances in prediction tools for discovery of new promoters and their cis-elements, there is a need to improve plant expression methodologies in order to facilitate a high-throughput functional validation of these promoters in planta. The promoter-reporter analysis is an indispensible approach for characterization of plant promoters. It requires the design of complex plant expression vectors, which can be challenging. Here, we describe the use of a plant grammar implemented in GenoCAD that will allow the users to quickly design constructs for promoter analysis experiments but also for other in planta functional studies. The GenoCAD plant grammar includes a library of plant biological parts organized in structural categories to facilitate their use and management and a set of rules that guides the process of assembling these biological parts into large constructs.

The upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia.

PubMed

Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y

2013-11-01

Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. © 2013.

Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

PubMed Central

Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

2003-01-01

In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

Inhibition of histone deacetylation and DNA methylation improves gene expression mediated by the adeno-associated virus/phage in cancer cells.

PubMed

Kia, Azadeh; Yata, Teerapong; Hajji, Nabil; Hajitou, Amin

2013-10-22

Bacteriophage (phage), viruses that infect bacteria only, have become promising vectors for targeted systemic delivery of genes to cancer, although, with poor efficiency. We previously designed an improved phage vector by incorporating cis genetic elements of adeno-associated virus (AAV). This novel AAV/phage hybrid (AAVP) specifically targeted systemic delivery of therapeutic genes into tumors. To advance the AAVP vector, we recently introduced the stress-inducible Grp78 tumor specific promoter and found that this dual tumor-targeted AAVP provides persistent gene expression, over time, in cancer cells compared to silenced gene expression from the CMV promoter in the parental AAVP. Herein, we investigated the effect of histone deacetylation and DNA methylation on AAVP-mediated gene expression in cancer cells and explored the effect of cell confluence state on AAVP gene expression efficacy. Using a combination of AAVP expressing the GFP reporter gene, flow cytometry, inhibitors of histone deacetylation, and DNA methylation, we have demonstrated that histone deacetylation and DNA methylation are associated with silencing of gene expression from the CMV promoter in the parental AAVP. Importantly, inhibitors of histone deacetylases boost gene expression in cancer cells from the Grp78 promoter in the dual tumor-targeted AAVP. However, cell confluence had no effect on AAVP-guided gene expression. Our findings prove that combination of histone deacetylase inhibitor drugs with the Grp78 promoter is an effective approach to improve AAVP-mediated gene expression in cancer cells and should be considered for AAVP-based clinical cancer gene therapy.

Three gene expression vector sets for concurrently expressing multiple genes in Saccharomyces cerevisiae.

PubMed

Ishii, Jun; Kondo, Takashi; Makino, Harumi; Ogura, Akira; Matsuda, Fumio; Kondo, Akihiko

2014-05-01

Yeast has the potential to be used in bulk-scale fermentative production of fuels and chemicals due to its tolerance for low pH and robustness for autolysis. However, expression of multiple external genes in one host yeast strain is considerably labor-intensive due to the lack of polycistronic transcription. To promote the metabolic engineering of yeast, we generated systematic and convenient genetic engineering tools to express multiple genes in Saccharomyces cerevisiae. We constructed a series of multi-copy and integration vector sets for concurrently expressing two or three genes in S. cerevisiae by embedding three classical promoters. The comparative expression capabilities of the constructed vectors were monitored with green fluorescent protein, and the concurrent expression of genes was monitored with three different fluorescent proteins. Our multiple gene expression tool will be helpful to the advanced construction of genetically engineered yeast strains in a variety of research fields other than metabolic engineering. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Stable and Efficient Gene Transfer into the Retina Using an HIV-Based Lentiviral Vector

NASA Astrophysics Data System (ADS)

Miyoshi, Hiroyuki; Takahashi, Masayo; Gage, Fred H.; Verma, Inder M.

1997-09-01

The development of methods for efficient gene transfer to terminally differentiated retinal cells is important to study the function of the retina as well as for gene therapy of retinal diseases. We have developed a lentiviral vector system based on the HIV that can transduce terminally differentiated neurons of the brain in vivo. In this study, we have evaluated the ability of HIV vectors to transfer genes into retinal cells. An HIV vector containing a gene encoding the green fluorescent protein (GFP) was injected into the subretinal space of rat eyes. The GFP gene under the control of the cytomegalovirus promoter was efficiently expressed in both photoreceptor cells and retinal pigment epithelium. However, the use of the rhodopsin promoter resulted in expression predominantly in photoreceptor cells. Most successfully transduced eyes showed that photoreceptor cells in >80% of the area of whole retina expressed the GFP. The GFP expression persisted for at least 12 weeks with no apparent decrease. The efficient gene transfer into photoreceptor cells by HIV vectors will be useful for gene therapy of retinal diseases such as retinitis pigmentosa.

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

Generation of HIV-1 based bi-cistronic lentiviral vectors for stable gene expression and live cell imaging.

PubMed

Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N

2012-10-01

The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.

Transformation of Lesquerella fendleri with the new binary vector pGPro4-35S

USDA-ARS?s Scientific Manuscript database

Crop genetic engineering requires the use of various promoters to control the expression of introduced transgenes. Some of the binary vectors currently available for promoter characterization in dicotyledonous plants have pitfalls due to their construction, such as containing a selectable marker ca...

Immunological thresholds in neurological gene therapy: highly efficient elimination of transduced cells might be related to the specific formation of immunological synapses between T cells and virus-infected brain cells

PubMed Central

Barcia, Carlos; Gerdes, Christian; Xiong, Wei-Dong; Thomas, Clare E.; Liu, Chunyan; Kroeger, Kurt M.; Castro, Maria G.; Lowenstein, Pedro R.

2007-01-01

First-generation adenovirus can be engineered with powerful promoters to drive expression of therapeutic transgenes. Numerous clinical trials for glioblastoma multiforme using first generation adenoviral vectors have either been performed or are ongoing, including an ongoing, Phase III, multicenter trial in Europe and Israel (Ark Therapeutics, Inc.). Although in the absence of anti-adenovirus immune responses expression in the brain lasts 6–18 months, systemic infection with adenovirus induces immune responses that inhibit dramatically therapeutic transgene expression from first generation adenoviral vectors, thus, potentially compromising therapeutic efficacy. Here, we show evidence of an immunization threshold for the dose that generates an immune response strong enough to eliminate transgene expression from the CNS. For the systemic immunization to eliminate transgene expression from the brain, ≥1 × 107 infectious units (iu) of adenovirus need to be used as immunogen. Furthermore, this immune response eliminates >90% of transgene expression from 1 × 107–1 × 10³ iu of vector injected into the striatum 60 days earlier. Importantly, elimination of transgene expression is independent of the nature of the promoter that drives transgene expression and is accompanied by brain infiltration of CD8+ T cells and macrophages. In conclusion, once the threshold for systemic immunization (i.e. 1 × 107 iu) is crossed, the immune response eliminates transgene expression by >90% even from brains that receive as little as 1000 iu of adenoviral vectors, independently of the type of promoter that drives expression. PMID:18084640

Adenovirus vector expressing keratinocyte growth factor using CAG promoter impairs pulmonary function of mice with elastase-induced emphysema.

PubMed

Oki, Hiroshi; Yazawa, Takuya; Baba, Yasuko; Kanegae, Yumi; Sato, Hanako; Sakamoto, Seiko; Goto, Takahisa; Saito, Izumu; Kurahashi, Kiyoyasu

2017-07-01

Pulmonary emphysema impairs quality of life and increases mortality. It has previously been shown that administration of adenovirus vector expressing murine keratinocyte growth factor (KGF) before elastase instillation prevents pulmonary emphysema in mice. We therefore hypothesized that therapeutic administration of KGF would restore damage to lungs caused by elastase instillation and thus improve pulmonary function in an animal model. KGF expressing adenovirus vector, which prevented bleomycin-induced pulmonary fibrosis in a previous study, was constructed. Adenovirus vector (1.0 × 10 9 plaque-forming units) was administered intratracheally one week after administration of elastase into mouse lungs. One week after administration of KGF-vector, exercise tolerance testing and blood gas analysis were performed, after which the lungs were removed under deep anesthesia. KGF-positive pneumocytes were more numerous, surfactant protein secretion in the airspace greater and mean linear intercept of lungs shorter in animals that had received KGF than in control animals. Unexpectedly, however, arterial blood oxygenation was worse in the KGF group and maximum running speed, an indicator of exercise capacity, had not improved after KGF in mice with elastase-induced emphysema, indicating that KGF-expressing adenovirus vector impaired pulmonary function in these mice. Notably, vector lacking KGF-expression unit did not induce such impairment, implying that the KGF expression unit itself may cause the damage to alveolar cells. Possible involvement of the CAG promoter used for KGF expression in impairing pulmonary function is discussed. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Functional Analysis of Plant Promoter rpL34 Using the GUS Marker Gene in New Tr,tnsgene Expression Vector pZD428

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mauzey-Amato, Jacqueline M.; Dai, Ziyu

2000-11-01

Optimization of the transgene expression system is one of the critical steps for the high level production of heterologous proteins in plants, where the promoter is a key component regulating transgene expression. In this study, the activity of the rpL34 promoter was analyzed in transgenic tobacco (Nicotiana tabacum) NTI calli. A DNA fragment containing the rpL34 promoter and the reporter gene B-D-glucuronidase (GUS) were cloned into binary vector pZD427 to generate the transgene expression vector pZD428. The insertion was verified by enzyme restriction digestion and agarose gel electrophoresis analyses. The DNA fragment containing the rpL34 promoter and GUS reporter genemore » was then integrated into the tobacco genomes via Agrobacterium funiefaciens-mediated NT suspension cell transformation. The transformed CaNi were induced on Murashige and Skoog (MS) plates containing proper amounts of 2,4-D, cefotoxime, and kanamycin. Two hundred and sixty transformed calli were harvested for GUS activity and protein concentration measurements. GUS activity analyses revealed the specific activity up to 278,358 units per milligram total soluble protein. The GUS activity under the control of the rpL34 promoter is much higher than that under the control of the cauliflower mosaic virus 35S promoter, a commonly used promoter in plant biology. These results suggest that the rpL34 promoter is one of the most active promoters that can be used for heterologous protein production in calli and suspension cells.« less

Expression of the human blood coagulation protein factor XIIIa in Saccharomyces cerevisiae: dependence of the expression levels from host-vector systems and medium conditions.

PubMed

Bröker, M; Bäuml, O; Göttig, A; Ochs, J; Bodenbenner, M; Amann, E

1991-03-01

The human blood coagulation protein Factor XIIIa (FXIIIa) was expressed in Saccharomyces cerevisiae employing Escherichia coli-yeast shuttle vectors based on a 2-mu plasmid. Several factors affecting high production yield of recombinant FXIIIa were analysed. The use of the regulatable GAL-CYC1 hybrid promoter resulted in higher FXIIIa expression when compared with the constitutive ADCI promoter. Screening for suitable yeast strains for expression of FXIIIa under the transcriptional control of the GAL-CYC1 hybrid promoter revealed a broad spectrum of productivity. No obvious correlation between the expression rate and the genetic markers of the strains could be identified. The medium composition markedly influenced the FXIIIa expression rates. The expression of FXIIIa was strictly regulated by the carbon source. Glucose as the only sugar and energy source repressed the synthesis of FXIIIa, whereas addition of galactose induced FXIIIa expression. Special feeding schemes resulted in a productivity of up to 100 mg FXIIIa/l in shake flasks.

Transduction of skeletal muscles with common reporter genes can promote muscle fiber degeneration and inflammation.

PubMed

Winbanks, Catherine E; Beyer, Claudia; Qian, Hongwei; Gregorevic, Paul

2012-01-01

Recombinant adeno-associated viral vectors (rAAV vectors) are promising tools for delivering transgenes to skeletal muscle, in order to study the mechanisms that control the muscle phenotype, and to ameliorate diseases that perturb muscle homeostasis. Many studies have employed rAAV vectors carrying reporter genes encoding for β-galactosidase (β-gal), human placental alkaline phosphatase (hPLAP), and green fluorescent protein (GFP) as experimental controls when studying the effects of manipulating other genes. However, it is not clear to what extent these reporter genes can influence signaling and gene expression signatures in skeletal muscle, which may confound the interpretation of results obtained in experimentally manipulated muscles. Herein, we report a strong pro-inflammatory effect of expressing reporter genes in skeletal muscle. Specifically, we show that the administration of rAAV6:hPLAP vectors to the hind limb muscles of mice is associated with dose- and time-dependent macrophage recruitment, and skeletal muscle damage. Dose-dependent expression of hPLAP also led to marked activity of established pro-inflammatory IL-6/Stat3, TNFα, IKKβ and JNK signaling in lysates obtained from homogenized muscles. These effects were independent of promoter type, as expression cassettes featuring hPLAP under the control of constitutive CMV and muscle-specific CK6 promoters both drove cellular responses when matched for vector dose. Importantly, the administration of rAAV6:GFP vectors did not induce muscle damage or inflammation except at the highest doses we examined, and administration of a transgene-null vector (rAAV6:MCS) did not cause damage or inflammation at any of the doses tested, demonstrating that GFP-expressing, or transgene-null vectors may be more suitable as experimental controls. The studies highlight the importance of considering the potential effects of reporter genes when designing experiments that examine gene manipulation in vivo.

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

Independent and high-level dual-gene expression in adult stem-progenitor cells from a single lentiviral vector.

PubMed

Tian, J; Andreadis, S T

2009-07-01

Expression of multiple genes from the same target cell is required in several technological and therapeutic applications such as quantitative measurements of promoter activity or in vivo tracking of stem cells. In spite of such need, reaching independent and high-level dual-gene expression cannot be reliably accomplished by current gene transfer vehicles. To address this issue, we designed a lentiviral vector carrying two transcriptional units separated by polyadenylation, terminator and insulator sequences. With this design, the expression level of both genes was as high as that yielded from lentiviral vectors containing only a single transcriptional unit. Similar results were observed with several promoters and cell types including epidermal keratinocytes, bone marrow mesenchymal stem cells and hair follicle stem cells. Notably, we demonstrated quantitative dynamic monitoring of gene expression in primary cells with no need for selection protocols suggesting that this optimized lentivirus may be useful in high-throughput gene expression profiling studies.

Hypoxia/hepatoma dual specific suicide gene expression plasmid delivery using bio-reducible polymer for hepatocellular carcinoma therapy.

PubMed

Kim, Hyun Ah; Nam, Kihoon; Lee, Minhyung; Kim, Sung Wan

2013-10-10

Gene therapy is suggested as a promising alternative strategy of hepatocellular carcinoma (HCC, also called hepatoma) therapy. To achieve a successful and safe gene therapy, tight regulation of gene expression is required to minimize side-effects in normal tissues. In this study, we developed a novel hypoxia and hepatoma dual specific gene expression vector. The constructed vectors were transfected into various cell lines using bio-reducible polymer, PAM-ABP. First, pAFPS-Luc or pAFPL-Luc vector was constructed with the alpha-fectoprotein (AFP) promoter and enhancer for hepatoma tissue specific gene expression. Then, pEpo-AFPL-Luc was constructed by insertion of the erythropoietin (Epo) enhancer for hypoxic cancer specific gene expression. In vitro transfection assay showed that pEpo-AFPL-Luc transfected hepatoma cell increased gene expression under hypoxic condition. To confirm the therapeutic effect of dual specific vector, herpes simplex virus thymidine kinase (HSV-TK) gene was introduced for cancer cell killing. The pEpo-AFPL-TK was transfected into hepatoma cell lines in the presence of ganciclovir (GCV) pro-drug. Caspase-3/7, MTT and TUNEL assays elucidated that pEpo-AFPL-TK transfected cells showed significant increasing of death rate in hypoxic hepatoma cells compared to controls. Therefore, the hypoxia/hepatoma dual specific gene expression vector with the Epo enhancer and AFP promoter may be useful for hepatoma specific gene therapy. © 2013.

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Promoter-Based Theranostics for Prostate Cancer

DTIC Science & Technology

2016-06-01

diagnosis vector consists of the tumor-specific PEG-promoter (PEG-Prom) and cDNA of human chorionic gonadotropin β chain (βhCG) as a reporter. We...transfection efficiency. We also used CpG-free cDNA of Figure 5. pCpGfree-PEGwt-HSV1-tk-neo vector expressed functional thymidine kinase in human

Regulated Expression of Adenoviral Vectors-Based Gene Therapies

PubMed Central

Curtin, James F.; Candolfi, Marianela; Puntel, Mariana; Xiong, Weidong; Muhammad, A. K. M.; Kroeger, Kurt; Mondkar, Sonali; Liu, Chunyan; Bondale, Niyati; Lowenstein, Pedro R.; Castro, Maria G.

2008-01-01

Summary Regulatable promoter systems allow gene expression to be tightly controlled in vivo. This is highly desirable for the development of safe, efficacious adenoviral vectors that can be used to treat human diseases in the clinic. Ideally, regulatable cassettes should have minimal gene expression in the “OFF” state, and expression should quickly reach therapeutic levels in the “ON” state. In addition, the components of regulatable cassettes should be non-toxic at physiological concentrations and should not be immunogenic, especially when treating chronic illness that requires long-lasting gene expression. In this chapter, we will describe in detail protocols to develop and validate first generation (Ad) and high-capacity adenoviral (HC-Ad) vectors that express therapeutic genes under the control of the TetON regulatable system. Our laboratory has successfully used these protocols to regulate the expression of marker genes, immune stimulatory genes, and toxins for cancer gene therapeutics, i.e., glioma that is a deadly form of brain cancer. We have shown that this third generation TetON regulatable system, incorporating a doxycycline (DOX)-sensitive rtTA2S-M2 inducer and tTSKid silencer, is non-toxic, relatively non-immunogenic, and can tightly regulate reporter transgene expression downstream of a TRE promoter from adenoviral vectors in vitro and also in vivo. PMID:18470649

A multisite gateway-based toolkit for targeted gene expression and hairpin RNA silencing in tomato fruits.

PubMed

Estornell, Leandro Hueso; Orzáez, Diego; López-Peña, Lucas; Pineda, Benito; Antón, María Teresa; Moreno, Vicente; Granell, Antonio

2009-04-01

A collection of fruit promoters, reporter genes and protein tags has been constructed in a triple-gateway format, a recombination-based cloning system that facilitates the tandem assembly of three DNA fragments into plant expression vectors. The new pENFRUIT collection includes, among others, the classical tomato-ripening promoters E8 and 2A11 and a set of six new tomato promoters. The new promoter activities were characterized in both transient assays and stable transgenic plants. The range of expression of the new promoters comprises strong (PNH, PLI), medium (PLE, PFF, PHD) and weak (PSN) promoters driving gene expression preferentially in the fruit, and covering a wide range of tissues and developmental stages. Together, a total of 78 possible combinations for the expression of a gene of interest in the fruit, plus a set of five reporters for new promoter analysis, was made available in the current collection. Moreover, the pENFRUIT promoter collection is adaptable to hairpin RNA strategies aimed at tissue/organ-specific gene silencing with only an additional cloning step. The pENFRUIT toolkit broadens the spectrum of promoter activities available for fruit biotechnology and fundamental research, and bypasses technical difficulties of current ligase-dependent cloning techniques in the construction of fruit expression cassettes. The pENFRUIT vector collection is available for the research community in a plasmid repository, facilitating its accessibility.

Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Hongwei; Department of Neurological Surgery, University of Virginia Health System, Charlottesville, VA 22908; Li Jinzhong

PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of themore » luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.« less

Establishing glucose- and ABA-regulated transcription networks in Arabidopsis by microarray analysis and promoter classification using a Relevance Vector Machine.

PubMed

Li, Yunhai; Lee, Kee Khoon; Walsh, Sean; Smith, Caroline; Hadingham, Sophie; Sorefan, Karim; Cawley, Gavin; Bevan, Michael W

2006-03-01

Establishing transcriptional regulatory networks by analysis of gene expression data and promoter sequences shows great promise. We developed a novel promoter classification method using a Relevance Vector Machine (RVM) and Bayesian statistical principles to identify discriminatory features in the promoter sequences of genes that can correctly classify transcriptional responses. The method was applied to microarray data obtained from Arabidopsis seedlings treated with glucose or abscisic acid (ABA). Of those genes showing >2.5-fold changes in expression level, approximately 70% were correctly predicted as being up- or down-regulated (under 10-fold cross-validation), based on the presence or absence of a small set of discriminative promoter motifs. Many of these motifs have known regulatory functions in sugar- and ABA-mediated gene expression. One promoter motif that was not known to be involved in glucose-responsive gene expression was identified as the strongest classifier of glucose-up-regulated gene expression. We show it confers glucose-responsive gene expression in conjunction with another promoter motif, thus validating the classification method. We were able to establish a detailed model of glucose and ABA transcriptional regulatory networks and their interactions, which will help us to understand the mechanisms linking metabolism with growth in Arabidopsis. This study shows that machine learning strategies coupled to Bayesian statistical methods hold significant promise for identifying functionally significant promoter sequences.

Manipulating the cell differentiation through lentiviral vectors.

PubMed

Coppola, Valeria; Galli, Cesare; Musumeci, Maria; Bonci, Désirée

2010-01-01

The manipulation of cell differentiation is important to create new sources for the treatment of degenerative diseases or solve cell depletion after aggressive therapy against cancer. In this chapter, the use of a tissue-specific promoter lentiviral vector to obtain a myocardial pure lineage from murine embryonic stem cells (mES) is described in detail. Since the cardiac isoform of troponin I gene product is not expressed in skeletal or other muscle types, short mouse cardiac troponin proximal promoter is used to drive reporter genes. Cells are infected simultaneously with two lentiviral vectors, the first expressing EGFP to monitor the transduction efficiency, and the other expressing a puromycin resistance gene to select the specific cells of interest. This technical approach describes a method to obtain a pure cardiomyocyte population and can be applied to other lineages of interest.

Gene Therapy Vectors with Enhanced Transfection Based on Hydrogels Modified with Affinity Peptides

PubMed Central

Shepard, Jaclyn A.; Wesson, Paul J.; Wang, Christine E.; Stevans, Alyson C.; Holland, Samantha J.; Shikanov, Ariella; Grzybowski, Bartosz A.; Shea, Lonnie D.

2011-01-01

Regenerative strategies for damaged tissue aim to present biochemical cues that recruit and direct progenitor cell migration and differentiation. Hydrogels capable of localized gene delivery are being developed to provide a support for tissue growth, and as a versatile method to induce the expression of inductive proteins; however, the duration, level, and localization of expression isoften insufficient for regeneration. We thus investigated the modification of hydrogels with affinity peptides to enhance vector retention and increase transfection within the matrix. PEG hydrogels were modified with lysine-based repeats (K4, K8), which retained approximately 25% more vector than control peptides. Transfection increased 5- to 15-fold with K8 and K4 respectively, over the RDG control peptide. K8- and K4-modified hydrogels bound similar quantities of vector, yet the vector dissociation rate was reduced for K8, suggesting excessive binding that limited transfection. These hydrogels were subsequently applied to an in vitro co-culture model to induce NGF expression and promote neurite outgrowth. K4-modified hydrogels promoted maximal neurite outgrowth, likely due to retention of both the vector and the NGF. Thus, hydrogels modified with affinity peptides enhanced vector retention and increased gene delivery, and these hydrogels may provide a versatile scaffold for numerous regenerative medicine applications. PMID:21514659

Efficient gusA transient expression in Porphyra yezoensis protoplasts mediated by endogenous beta-tubulin flanking sequences

NASA Astrophysics Data System (ADS)

Gong, Qianhong; Yu, Wengong; Dai, Jixun; Liu, Hongquan; Xu, Rifu; Guan, Huashi; Pan, Kehou

2007-01-01

Endogenous tubulin promoter has been widely used for expressing foreign genes in green algae, but the efficiency and feasibility of endogenous tubulin promoter in the economically important Porphyra yezoensis (Rhodophyta) are unknown. In this study, the flanking sequences of beta-tubulin gene from P. yezoensis were amplified and two transient expression vectors were constructed to determine their transcription promoting feasibility for foreign gene gusA. The testing vector pATubGUS was constructed by inserting 5'-and 3'-flanking regions ( Tub5' and Tub3') up-and down-stream of β-glucuronidase (GUS) gene ( gusA), respectively, into pA, a derivative of pCAT®3-enhancer vector. The control construct, pAGUSTub3, contains only gusA and Tub3'. These constructs were electroporated into P. yezoensis protoplasts and the GUS activities were quantitatively analyzed by spectrometry. The results demonstrated that gusA gene was efficiently expressed in P. yezoensis protoplasts under the regulation of 5'-flanking sequence of the beta-tubulin gene. More interestingly, the pATubGUS produced stronger GUS activity in P. yezoensis protoplasts when compared to the result from pBI221, in which the gusA gene was directed by a constitutive CaMV 35S promoter. The data suggest that the integration of P. yezoensis protoplast and its endogenous beta-tubulin flanking sequences is a potential novel system for foreign gene expression.

Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

PubMed

Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

1998-01-01

The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

pLR: a lentiviral backbone series to stable transduction of bicistronic genes and exchange of promoters.

PubMed

Vargas, José Eduardo; Salton, Gabrielle; Sodré de Castro Laino, Andressa; Pires, Tiago Dalberto; Bonamino, Martin; Lenz, Guido; Delgado-Cañedo, Andrés

2012-11-01

Gene transfer based on lentiviral vectors allow the integration of exogenous genes into the genome of a target cell, turning these vectors into one of the most used methods for stable transgene expression in mammalian cells, in vitro and in vivo. Currently, there are no lentivectors that allow the cloning of different genes to be regulated by different promoters. Also, there are none that permit the analysis of the expression through an IRES (internal ribosome entry site)-- reporter gene system. In this work, we have generated a series of lentivectors containing: (1) a malleable structure to allow the cloning of different target genes in a multicloning site (mcs); (2) unique site to exchange promoters, and (3) IRES followed by one of two reporter genes: eGFP or DsRed. The series of the produced vectors were named pLR (for lentivirus and RSV promoter) and were fairly efficient with a strong fluorescence of the reporter genes in direct transfection and viral transduction experiments. This being said, the pLR series have been found to be powerful biotechnological tools for stable gene transfer and expression. Copyright © 2012 Elsevier Inc. All rights reserved.

Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

PubMed

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

Design of a muscle cell-specific expression vector utilising human vascular smooth muscle alpha-actin regulatory elements.

PubMed

Keogh, M C; Chen, D; Schmitt, J F; Dennehy, U; Kakkar, V V; Lemoine, N R

1999-04-01

The facility to direct tissue-specific expression of therapeutic gene constructs is desirable for many gene therapy applications. We describe the creation of a muscle-selective expression vector which supports transcription in vascular smooth muscle, cardiac muscle and skeletal muscle, while it is essentially silent in other cell types such as endothelial cells, hepatocytes and fibroblasts. Specific transcriptional regulatory elements have been identified in the human vascular smooth muscle cell (VSMC) alpha-actin gene, and used to create an expression vector which directs the expression of genes in cis to muscle cells. The vector contains an enhancer element we have identified in the 5' flanking region of the human VSMC alpha-actin gene involved in mediating VSMC expression. Heterologous pairing experiments have shown that the enhancer does not interact with the basal transcription complex recruited at the minimal SV40 early promoter. Such a vector has direct application in the modulation of VSMC proliferation associated with intimal hyperplasia/restenosis.

Geminivirus vectors for high-level expression of foreign proteins in plant cells.

PubMed

Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

2003-02-20

Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

Development of Plant Gene Vectors for Tissue-Specific Expression Using GFP as a Reporter Gene

NASA Technical Reports Server (NTRS)

Jackson, Jacquelyn; Egnin, Marceline; Xue, Qi-Han; Prakash, C. S.

1997-01-01

Reporter genes are widely employed in plant molecular biology research to analyze gene expression and to identify promoters. Gus (UidA) is currently the most popular reporter gene but its detection requires a destructive assay. The use of jellyfish green fluorescent protein (GFP) gene from Aequorea Victoria holds promise for noninvasive detection of in vivo gene expression. To study how various plant promoters are expressed in sweet potato (Ipomoea batatas), we are transcriptionally fusing the intron-modified (mGFP) or synthetic (modified for codon-usage) GFP coding regions to these promoters: double cauliflower mosaic virus 35S (CaMV 35S) with AMV translational enhancer, ubiquitin7-intron-ubiquitin coding region (ubi7-intron-UQ) and sporaminA. A few of these vectors have been constructed and introduced into E. coli DH5a and Agrobacterium tumefaciens EHA105. Transient expression studies are underway using protoplast-electroporation and particle bombardment of leaf tissues.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Expression from cloned DNA of biologically active glycoprotein C of herpes simplex virus type 1 in mammalian cells.

PubMed

Ghosh-Choudhury, N; Butcher, M; Ghosh, H P

1990-03-01

A DNA fragment of the herpes simplex virus type 1 genome encoding glycoprotein C (gC-1) has been cloned into different eukaryotic expression vectors for transient and stable expression of the glycoprotein in a number of cell lines. All of these expression vectors use a non-HSV promoter, such as the adenovirus major late promoter or murine leukemia virus long terminal repeat promoter to express gC-1 in COS and CHO cells or 3T3 cells. The gC-1 protein synthesized was fully glycosylated with both N- and O-linked oligosaccharides. Synthesis of the mature 120K gC-1 glycoprotein involved partially glycosylated 100K and 105K proteins and the non-glycosylated 70K protein as intermediate molecules. Immunofluorescence studies showed that the expressed gC-1 was localized intracellularly in the nuclear envelope as well as on the cell surface. The expressed gC-1 was biologically active and could act as a receptor for the complement component C3b in the absence of other HSV proteins.

HBx drives alpha fetoprotein expression to promote initiation of liver cancer stem cells through activating PI3K/AKT signal pathway.

PubMed

Zhu, Mingyue; Li, Wei; Lu, Yan; Dong, Xu; Lin, Bo; Chen, Yi; Zhang, Xueer; Guo, Junli; Li, Mengsen

2017-03-15

Hepatitis B virus (HBV)-X protein (HBx) plays critical role in inducing the malignant transformation of liver cells. Alpha fetoprotein (AFP) expression is closely related to hepatocarcinogenesis. We report that Oct4, Klf4, Sox2 and c-myc expression positively associated with AFP(+)/HBV(+) hepatocellular carcinoma(HCC) tissues, and the expression of the stemness markers CD44, CD133 and EpCAM was significantly higher in AFP(+)/HBV(+) HCC tissues compared to normal liver tissues or AFP (-)/HBV(-) HCC tissues. AFP expression turned on prior to expression of Oct4, Klf4, Sox2 and c-myc, and the stemness markers CD44, CD133 and EpCAM in the normal human liver L-02 cell line or CHL cell lines upon transfection with MCV-HBx vectors. Stem-like cells generated more tumour colonies compared to primary cells, and xenografts induced tumourigenesis in nude mice. Expression of reprogramming-related proteins was significantly enhanced in HLE cells while transfected with pcDNA3.1-afp vectors. The specific PI3K inhibitor Ly294002 inhibited the effects of pcDNA3.1-afp vectors. AFP-siRNA vectors were able to inhibit tumour colony formation and reprogramming-related gene expression. Altogether, HBx stimulates AFP expression to induce natural reprogramming of liver cells, and AFP plays a critical role in promoting the initiation of HCC progenitor/stem cells. AFP may be a potential novel biotarget for combating HBV-induced hepatocarcinogenesis. © 2016 UICC.

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3.

PubMed

Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping

2015-08-15

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Single inverted terminal repeats of the Junonia coenia Densovirus promotes somatic chromosomal integration of vector plasmids in insect cells and supports high efficiency expression

USDA-ARS?s Scientific Manuscript database

Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...

A versatile Multisite Gateway-compatible promoter and transgenic line collection for cell type-specific functional genomics in Arabidopsis

PubMed Central

Platre, Matthieu Pierre; Barberon, Marie; Caillieux, Erwann; Colot, Vincent

2016-01-01

Summary Multicellular organisms are composed of many cell types that acquire their specific fate through a precisely controlled pattern of gene expression in time and space dictated in part by cell type-specific promoter activity. Understanding the contribution of highly specialized cell types in the development of a whole organism requires the ability to isolate or analyze different cell types separately. We have characterized and validated a large collection of root cell type-specific promoters and have generated cell type-specific marker lines. These benchmarked promoters can be readily used to evaluate cell type-specific complementation of mutant phenotypes, or to knockdown gene expression using targeted expression of artificial miRNA. We also generated vectors and characterized transgenic lines for cell type-specific induction of gene expression and cell type-specific isolation of nuclei for RNA and chromatin profiling. Vectors and seeds from transgenic Arabidopsis plants will be freely available, and will promote rapid progress in cell type-specific functional genomics. We demonstrate the power of this promoter set for analysis of complex biological processes by investigating the contribution of root cell types in the IRT1-dependent root iron uptake. Our findings revealed the complex spatial expression pattern of IRT1 in both root epidermis and phloem companion cells and the requirement for IRT1 to be expressed in both cell types for proper iron homeostasis. PMID:26662936

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

A microRNA embedded AAV alpha-synuclein gene silencing vector for dopaminergic neurons

PubMed Central

Han, Ye; Khodr, Christina E.; Sapru, Mohan K.; Pedapati, Jyothi; Bohn, Martha C.

2011-01-01

Alpha-synuclein (SNCA), an abundantly expressed presynaptic protein, is implicated in Parkinson disease (PD). Since over-expression of human SNCA (hSNCA) leads to death of dopaminergic (DA) neurons in human, rodent and fly brain, hSNCA gene silencing may reduce levels of toxic forms of SNCA and ameliorate degeneration of DA neurons in PD. To begin to develop a gene therapy for PD based on hSNCA gene silencing, two AAV gene silencing vectors were designed, and tested for efficiency and specificity of silencing, as well as toxicity in vitro. The same hSNCA silencing sequence (shRNA) was used in both vectors, but in one vector, the shRNA was embedded in a microRNA backbone and driven by a pol II promoter, and in the other the shRNA was not embedded in a microRNA and was driven by a pol III promoter. Both vectors silenced hSNCA to the same extent in 293T cells transfected with hSNCA. In DA PC12 cells, neither vector decreased expression of rat SNCA, tyrosine hydroxylase (TH), dopamine transporter (DAT) or the vesicular monoamine transporter (VMAT). However, the mir30 embedded vector was significantly less toxic to both PC12 and SH-SY5Y cells. Our in vitro data suggest that this miRNA-embedded silencing vector may be ideal for chronic in vivo SNCA gene silencing in DA neurons. PMID:21338582

Preparation for a first-in-man lentivirus trial in patients with cystic fibrosis

PubMed Central

Alton, Eric W F W; Beekman, Jeffery M; Boyd, A Christopher; Brand, June; Carlon, Marianne S; Connolly, Mary M; Chan, Mario; Conlon, Sinead; Davidson, Heather E; Davies, Jane C; Davies, Lee A; Dekkers, Johanna F; Doherty, Ann; Gea-Sorli, Sabrina; Gill, Deborah R; Griesenbach, Uta; Hasegawa, Mamoru; Higgins, Tracy E; Hironaka, Takashi; Hyndman, Laura; McLachlan, Gerry; Inoue, Makoto; Hyde, Stephen C; Innes, J Alastair; Maher, Toby M; Moran, Caroline; Meng, Cuixiang; Paul-Smith, Michael C; Pringle, Ian A; Pytel, Kamila M; Rodriguez-Martinez, Andrea; Schmidt, Alexander C; Stevenson, Barbara J; Sumner-Jones, Stephanie G; Toshner, Richard; Tsugumine, Shu; Wasowicz, Marguerite W; Zhu, Jie

2017-01-01

We have recently shown that non-viral gene therapy can stabilise the decline of lung function in patients with cystic fibrosis (CF). However, the effect was modest, and more potent gene transfer agents are still required. Fuson protein (F)/Hemagglutinin/Neuraminidase protein (HN)-pseudotyped lentiviral vectors are more efficient for lung gene transfer than non-viral vectors in preclinical models. In preparation for a first-in-man CF trial using the lentiviral vector, we have undertaken key translational preclinical studies. Regulatory-compliant vectors carrying a range of promoter/enhancer elements were assessed in mice and human air–liquid interface (ALI) cultures to select the lead candidate; cystic fibrosis transmembrane conductance receptor (CFTR) expression and function were assessed in CF models using this lead candidate vector. Toxicity was assessed and ‘benchmarked’ against the leading non-viral formulation recently used in a Phase IIb clinical trial. Integration site profiles were mapped and transduction efficiency determined to inform clinical trial dose-ranging. The impact of pre-existing and acquired immunity against the vector and vector stability in several clinically relevant delivery devices was assessed. A hybrid promoter hybrid cytosine guanine dinucleotide (CpG)- free CMV enhancer/elongation factor 1 alpha promoter (hCEF) consisting of the elongation factor 1α promoter and the cytomegalovirus enhancer was most efficacious in both murine lungs and human ALI cultures (both at least 2-log orders above background). The efficacy (at least 14% of airway cells transduced), toxicity and integration site profile supports further progression towards clinical trial and pre-existing and acquired immune responses do not interfere with vector efficacy. The lead rSIV.F/HN candidate expresses functional CFTR and the vector retains 90–100% transduction efficiency in clinically relevant delivery devices. The data support the progression of the F/HN-pseudotyped lentiviral vector into a first-in-man CF trial in 2017. PMID:27852956

Identifying and engineering promoters for high level and sustainable therapeutic recombinant protein production in cultured mammalian cells.

PubMed

Ho, Steven C L; Yang, Yuansheng

2014-08-01

Promoters are essential on plasmid vectors to initiate transcription of the transgenes when generating therapeutic recombinant proteins expressing mammalian cell lines. High and sustained levels of gene expression are desired during therapeutic protein production while gene expression is useful for cell engineering. As many finely controlled promoters exhibit cell and product specificity, new promoters need to be identified, optimized and carefully evaluated before use. Suitable promoters can be identified using techniques ranging from simple molecular biology methods to modern high-throughput omics screenings. Promoter engineering is often required after identification to either obtain high and sustained expression or to provide a wider range of gene expression. This review discusses some of the available methods to identify and engineer promoters for therapeutic recombinant protein expression in mammalian cells.

Construction of two vectors for gene expression in Trichoderma reesei.

PubMed

Lv, Dandan; Wang, Wei; Wei, Dongzhi

2012-01-01

We report the construction of two filamentous fungi Trichoderma reesei expression vectors, pWEF31 and pWEF32. Both vectors possess the hygromycin phosphotransferase B gene expression cassette and the strong promoter and terminator of the cellobiohydrolase 1 gene (cbh1) from T. reesei. The two newly constructed vectors can be efficiently transformed into T. reesei with Agrobacterium-mediated transformation. The difference between pWEF31 and pWEF32 is that pWEF32 has two longer homologous arms. As a result, pWEF32 easily undergoes homologous recombination. On the other hand, pWEF31 undergoes random recombination. The applicability of both vectors was tested by first generating the expression vectors pWEF31-red and pWEF32-red and then detecting the expression of the DsRed2 gene in T. reesei Rut C30. Additionally, we measured the exo-1,4-β-glucanase activity of the recombinant cells. Our work provides an effective transformation system for homologous and heterologous gene expression and gene knockout in T. reesei. It also provides a method for recombination at a specific chromosomal location. Finally, both vectors will be useful for the large-scale gene expression industry. Copyright © 2011 Elsevier Inc. All rights reserved.

A baculovirus dual expression vector derived from the Autographa californica nuclear polyhedrosis virus polyhedrin and p10 promoters: co-expression of two influenza virus genes in insect cells.

PubMed

Weyer, U; Possee, R D

1991-12-01

A baculovirus transfer vector, pAcUW3, was developed to facilitate the insertion of two influenza virus genes, those encoding the haemagglutinin (HA) and neuraminidase (NA) membrane glycoproteins, into the Autographa californica nuclear polyhedrosis virus genome in a single cotransfection experiment. The NA gene was inserted in place of the polyhedrin coding sequences under the control of the polyhedrin promoter, whereas the HA gene was placed under the control of a copy of the p10 promoter at a site upstream of and in opposite orientation to the polyhedrin promoter. After infection of Spodoptera frugiperda cells with the recombinant virus, AcUW3HANA, both HA and NA were expressed in the very late phase of infection and were shown to be functional in appropriate assays. Immunofluorescence assays demonstrated their localization at the surface of infected insect cells. The expression of both foreign genes in the recombinant virus was found to be stable for at least 12 passages in cell culture.

The prospect of gene therapy for prostate cancer: update on theory and status.

PubMed

Koeneman, K S; Hsieh, J T

2001-09-01

Molecularly based novel therapeutic agents are needed to address the problem of locally recurrent, or metastatic, advanced hormone-refractory prostate cancer. Recent basic science advances in mechanisms of gene expression, vector delivery, and targeting have rendered clinically relevant gene therapy to the prostatic fossa and distant sites feasible in the near future. Current research and clinical investigative efforts involving methods for more effective vector delivery and targeting, with enhanced gene expression to selected (specific) sites, are reviewed. These areas of research involve tissue-specific promoters, transgene exploration, vector design and delivery, and selective vector targeting. The 'vectorology' involved mainly addresses selective tissue homing with ligands, mechanisms of innate immune system evasion for durable transgene expression, and the possibility of repeat administration.

Virus vector-mediated genetic modification of brain tumor stromal cells after intravenous delivery.

PubMed

Volak, Adrienn; LeRoy, Stanley G; Natasan, Jeya Shree; Park, David J; Cheah, Pike See; Maus, Andreas; Fitzpatrick, Zachary; Hudry, Eloise; Pinkham, Kelsey; Gandhi, Sheetal; Hyman, Bradley T; Mu, Dakai; GuhaSarkar, Dwijit; Stemmer-Rachamimov, Anat O; Sena-Esteves, Miguel; Badr, Christian E; Maguire, Casey A

2018-05-16

The malignant primary brain tumor, glioblastoma (GBM) is generally incurable. New approaches are desperately needed. Adeno-associated virus (AAV) vector-mediated delivery of anti-tumor transgenes is a promising strategy, however direct injection leads to focal transgene spread in tumor and rapid tumor division dilutes out the extra-chromosomal AAV genome, limiting duration of transgene expression. Intravenous (IV) injection gives widespread distribution of AAV in normal brain, however poor transgene expression in tumor, and high expression in non-target cells which may lead to ineffective therapy and high toxicity, respectively. Delivery of transgenes encoding secreted, anti-tumor proteins to tumor stromal cells may provide a more stable and localized reservoir of therapy as they are more differentiated than fast-dividing tumor cells. Reactive astrocytes and tumor-associated macrophage/microglia (TAMs) are stromal cells that comprise a large portion of the tumor mass and are associated with tumorigenesis. In mouse models of GBM, we used IV delivery of exosome-associated AAV vectors driving green fluorescent protein expression by specific promoters (NF-κB-responsive promoter and a truncated glial fibrillary acidic protein promoter), to obtain targeted transduction of TAMs and reactive astrocytes, respectively, while avoiding transgene expression in the periphery. We used our approach to express the potent, yet toxic anti-tumor cytokine, interferon beta, in tumor stroma of a mouse model of GBM, and achieved a modest, yet significant enhancement in survival compared to controls. Noninvasive genetic modification of tumor microenvironment represents a promising approach for therapy against cancers. Additionally, the vectors described here may facilitate basic research in the study of tumor stromal cells in situ.

Lentiviral Vectors and Protocols for Creation of Stable hESC Lines for Fluorescent Tracking and Drug Resistance Selection of Cardiomyocytes

PubMed Central

Kita-Matsuo, Hiroko; Barcova, Maria; Prigozhina, Natalie; Salomonis, Nathan; Wei, Karen; Jacot, Jeffrey G.; Nelson, Brandon; Spiering, Sean; Haverslag, René; Kim, Changsung; Talantova, Maria; Bajpai, Ruchi; Calzolari, Diego; Terskikh, Alexey; McCulloch, Andrew D.; Price, Jeffrey H.; Conklin, Bruce R.; Chen, H. S. Vincent; Mercola, Mark

2009-01-01

Background Developmental, physiological and tissue engineering studies critical to the development of successful myocardial regeneration therapies require new ways to effectively visualize and isolate large numbers of fluorescently labeled, functional cardiomyocytes. Methodology/Principal Findings Here we describe methods for the clonal expansion of engineered hESCs and make available a suite of lentiviral vectors for that combine Blasticidin, Neomycin and Puromycin resistance based drug selection of pure populations of stem cells and cardiomyocytes with ubiquitous or lineage-specific promoters that direct expression of fluorescent proteins to visualize and track cardiomyocytes and their progenitors. The phospho-glycerate kinase (PGK) promoter was used to ubiquitously direct expression of histone-2B fused eGFP and mCherry proteins to the nucleus to monitor DNA content and enable tracking of cell migration and lineage. Vectors with T/Brachyury and α-myosin heavy chain (αMHC) promoters targeted fluorescent or drug-resistance proteins to early mesoderm and cardiomyocytes. The drug selection protocol yielded 96% pure cardiomyocytes that could be cultured for over 4 months. Puromycin-selected cardiomyocytes exhibited a gene expression profile similar to that of adult human cardiomyocytes and generated force and action potentials consistent with normal fetal cardiomyocytes, documenting these parameters in hESC-derived cardiomyocytes and validating that the selected cells retained normal differentiation and function. Conclusion/Significance The protocols, vectors and gene expression data comprise tools to enhance cardiomyocyte production for large-scale applications. PMID:19352491

Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.

PubMed

Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G

2008-12-01

With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.

Using HSV-TK/GCV suicide gene therapy to inhibit lens epithelial cell proliferation for treatment of posterior capsular opacification

PubMed Central

Jiang, Yong-Xiang; Liu, Tian-Jing; Yang, Jin; Chen, Yan; Fang, Yan-Wen

2011-01-01

Purpose To establish a novel, targeted lentivirus-based HSV-tk (herpes simplex virus thymidine kinase)/GCV (ganciclovir) gene therapy system to inhibit lens epithelial cell proliferation for treatment of posterior capsular opacification (PCO) after cataract surgery. Methods An enhanced Cre recombinase (Cre/loxP) system with a lentiviral vector expressing Cre under the control of the lens-specific promoter LEP503 (Lenti-LEP503-HSVtk-Cre [LTKCRE]) was constructed, as well as another lentiviral vector containing a switching unit. The latter vector contains a stuffer sequence encoding EGFP (Lenti-hPGK-Loxp-EGFP-pA-Loxp-HSVtk [PGFPTK]) with a functional polyadenylation signal between two loxP sites, followed by the herpes simplex virus thymidine kinase (HSV-tk) gene, both under the control of the human posphoglycerate kinase (hPGK) promoter. Expression of the downstream gene (HSV-tk) is activated by co-expression of Cre. Human lens epithelial cells (HLECs) or retinal pigmental epithelial cells (RPECs) were co-infected with LTKCRE and PGFPTK. The inhibitory effects on HLECs and RPECs infected by the enhanced specific lentiviral vector combination at the concentration of 20 µg/ml GCV were assayed and compared. Results The specific gene expression of Cre and HSV-tk in HLECs is activated by the LEP503 promoter. LTKCRE and PGFPTK co-infected HLECs, but not RPECs, expressed high levels of the HSV-tk protein. After 96 h of GCV treatment, the percentage of apoptotic HLECs infected by the enhanced specific lentiviral vector combination was 87.23%, whereas that of apoptotic RPECs was only 10.12%. Electron microscopy showed that GCV induced apoptosis and necrosis of the infected HLECs. Conclusions The enhanced specific lentiviral vector combination selectively and effectively expressed HSV-tk in HLECs. A concentration of 20 µg/ml, GCV is effective against the proliferation of HLECs in vitro. This cell-type-specific gene therapy using a Cre/loxP lentivirus system may be a feasible treatment strategy to prevent PCO. PMID:21283526

Development of a new vector using Soybean yellow common mosaic virus for gene function study or heterologous protein expression in soybeans.

PubMed

Lim, Seungmo; Nam, Moon; Kim, Kil Hyun; Lee, Su-Heon; Moon, Jung-Kyung; Lim, Hyoun-Sub; Choung, Myoung-Gun; Kim, Sang-Mok; Moon, Jae Sun

2016-02-01

A new vector using Soybean yellow common mosaic virus (SYCMV) was constructed for gene function study or heterologous protein expression in soybeans. The in vitro transcript with a 5' cap analog m7GpppG from an SYCMV full-length infectious vector driven by a T7 promoter infected soybeans (pSYCMVT7-full). The symptoms observed in the soybeans infected with either the sap from SYCMV-infected leaves or pSYCMVT7-full were indistinguishable, suggesting that the vector exhibits equivalent biological activity as the virus itself. To utilize the vector further, a DNA-based vector driven by the Cauliflower mosaic virus (CaMV) 35S promoter was constructed. The complete sequence of the SYCMV genome was inserted into a binary vector flanked by a CaMV 35S promoter at the 5' terminus of the SYCMV genome and a cis-cleaving ribozyme sequence followed by a nopaline synthase terminator at the 3' terminus of the SYCMV genome (pSYCMV-full). The SYCMV-derived vector was tested for use as a virus-induced gene silencing (VIGS) vector for the functional analysis of soybean genes. VIGS constructs containing either a fragment of the Phytoene desaturase (PDS) gene (pSYCMV-PDS1) or a fragment of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) gene (pSYCMV-RbcS2) were constructed. Plants infiltrated with each vector using the Agrobacterium-mediated inoculation method exhibited distinct symptoms, such as photo-bleaching in plants infiltrated with pSYCMV-PDS1 and yellow or pale green coloring in plants infiltrated with pSYCMV-RbcS2. In addition, down-regulation of the transcripts of the two target genes was confirmed via northern blot analysis. Particle bombardment and direct plasmid DNA rubbing were also confirmed as alternative inoculation methods. To determine if the SYCMV vector can be used for the expression of heterologous proteins in soybean plants, the vector encoding amino acids 135-160 of VP1 of Foot-and-mouth disease virus (FMDV) serotype O1 Campos (O1C) was constructed (pSYCMV-FMDV). Plants infiltrated with pSYCMV-FMDV were only detected via western blotting using the O1C antibody. Based on these results, we propose that the SYCMV-derived vector can be used for gene function study or expression of useful heterologous proteins in soybeans. Copyright © 2015 Elsevier B.V. All rights reserved.

Configurations of a two-tiered amplified gene expression system in adenoviral vectors designed to improve the specificity of in vivo prostate cancer imaging

PubMed Central

Sato, M; Figueiredo, ML; Burton, JB; Johnson, M; Chen, M; Powell, R; Gambhir, SS; Carey, M; Wu, L

2009-01-01

Effective treatment for recurrent, disseminated prostate cancer is notably limited. We have developed adenoviral vectors with a prostate-specific two-step transcriptional amplification (TSTA) system that would express therapeutic genes at a robust level to target metastatic disease. The TSTA system employs the prostate-specific antigen (PSA) promoter/enhancer to drive a potent synthetic activator, which in turn activates the expression of the therapeutic gene. In this study, we explored different configurations of this bipartite system and discovered that physical separation of the two TSTA components into E1 and E3 regions of adenovirus was able to enhance androgen regulation and cell-discriminatory expression. The TSTA vectors that express imaging reporter genes were assessed by noninvasive imaging technologies in animal models. The improved selectivity of the E1E3 configured vector was reflected in silenced ectopic expression in the lung. Significantly, the enhanced specificity of the E1E3 vector enabled the detection of lung metastasis of prostate cancer. An E1E3 TSTA vector that expresses the herpes simplex virus thymidine kinase gene can effectively direct positron emission tomography (PET) imaging of the tumor. The prostate-targeted gene delivery vectors with robust and cell-specific expression capability will advance the development of safe and effective imaging guided therapy for recurrent metastatic stages of prostate cancer. PMID:18305574

A C. trachomatis Cloning Vector and the Generation of C. trachomatis Strains Expressing Fluorescent Proteins under the Control of a C. trachomatis Promoter

PubMed Central

Agaisse, Hervé; Derré, Isabelle

2013-01-01

Here we describe a versatile cloning vector for conducting genetic experiments in C. trachomatis. We successfully expressed various fluorescent proteins (i.e. GFP, mCherry and CFP) from C. trachomatis regulatory elements (i.e. the promoter and terminator of the incDEFG operon) and showed that the transformed strains produced wild type amounts of infectious particles and recapitulated major features of the C. trachomatis developmental cycle. C. trachomatis strains expressing fluorescent proteins are valuable tools for studying the C. trachomatis developmental cycle. For instance, we show the feasibility of investigating the dynamics of inclusion fusion and interaction with host proteins and organelles by time-lapse video microscopy. PMID:23441233

Generation of a neurodegenerative disease mouse model using lentiviral vectors carrying an enhanced synapsin I promoter.

PubMed

Matsuzaki, Yasunori; Oue, Miho; Hirai, Hirokazu

2014-02-15

Certain inherited progressive neurodegenerative disorders, such as spinocerebellar ataxia (SCA), affect neurons in large areas of the central nervous system (CNS). The selective expression of disease-causing and therapeutic genes in susceptible regions and cell types is critical for the generation of animal models and development of gene therapies for these diseases. Previous studies have demonstrated the advantages of the short synapsin I (SynI) promoter (0.5 kb) as a neuron-specific promoter for robust transgene expression. However, the short SynI promoter has also shown some promoter activity in glia and a lack of transgene expression in significant areas of the CNS. New methods: To improve the SynI promoter, we used a SynI promoter that is twice as long (1.0 kb) as the short SynI promoter and incorporated a minimal CMV (minCMV) sequence. We observed that the 1.0 kb rat SynI promoter with minCMV [rSynI(1.0)-minCMV] exhibited robust promoter strength, excellent neuronal specificity and wide-ranging transgene expression throughout the CNS. Comparison with existing methods: Compared with the two previously reported short (0.5 kb) promoters, the new promoter was superior with respect to neuronal specificity and more efficiently transduced neurons. Moreover, transgenic mice expressing the mutant protein ATXN1[Q98], which causes SCA type 1 (SCA1), under the control of the rSynI(1.0)-minCMV promoter showed robust transgene expression specifically in neurons throughout the CNS and exhibited progressive ataxia. rSynI(1.0)-minCMV drives robust and neuron-specific transgene expression throughout the CNS and is therefore useful for viral vector-mediated neuron-specific gene delivery and generation of neuron-specific transgenic animals. Copyright © 2013 Elsevier B.V. All rights reserved.

Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

PubMed

Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

2010-01-01

Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

Promoters and proteins from Clostridium thermocellum and uses thereof

DOEpatents

Wu, J. H. David; Newcomb, Michael

2012-11-13

The present invention relates to an inducible and a high expression nucleic acid promoter isolated from Clostridium thermocellum. These promoters are useful for directing expression of a protein or polypeptide encoded by a nucleic acid molecule operably associated with the nucleic acid promoters. The present invention also relates to nucleic acid constructs including the C. thermocellum promoters, and expression vectors and hosts containing such nucleic acid constructs. The present invention also relates to protein isolated from Clostridium thermocellum, including a repressor protein. The present invention also provides methods of using the isolated promoters and proteins from Clostridium thermocellum, including methods for directing inducible in vitro and in vivo expression of a protein or polypeptide in a host, and methods of producing ethanol from a cellulosic biomass.

Tissue-specific, tumor-selective, replication-competent adenovirus vector for cancer gene therapy.

PubMed

Doronin, K; Kuppuswamy, M; Toth, K; Tollefson, A E; Krajcsi, P; Krougliak, V; Wold, W S

2001-04-01

We have previously described two replication-competent adenovirus vectors, named KD1 and KD3, for potential use in cancer gene therapy. KD1 and KD3 have two small deletions in the E1A gene that restrict efficient replication of these vectors to human cancer cell lines. These vectors also have increased capacity to lyse cells and spread from cell to cell because they overexpress the adenovirus death protein, an adenovirus protein required for efficient cell lysis and release of adenovirus from the cell. We now describe a new vector, named KD1-SPB, which is the KD1 vector with the E4 promoter replaced by the promoter for surfactant protein B (SPB). SPB promoter activity is restricted in the adult to type II alveolar epithelial cells and bronchial epithelial cells. Because KD1-SPB has the E1A mutations, it should replicate within and destroy only alveolar and bronchial cancer cells. We show that KD1-SPB replicates, lyses cells, and spreads from cell to cell as well as does KD1 in H441 cells, a human cancer cell line where the SPB promoter is active. KD1-SPB replicates, lyses cells, and spreads only poorly in Hep3B liver cancer cells. Replication was determined by expression of the E4ORF3 protein, viral DNA accumulation, fiber synthesis, and virus yield. Cell lysis and vector spread were measured by lactate dehydrogenase release and a "vector spread" assay. In addition to Hep3B cells, KD1-SPB also did not express E4ORF3 in HT29.14S (colon), HeLa (cervix), KB (nasopharynx), or LNCaP (prostate) cancer cell lines, in which the SPB promoter is not expected to be active. Following injection into H441 or Hep3B tumors growing in nude mice, KD1-SPB caused a three- to fourfold suppression of growth of H441 tumors, similar to that seen with KD1. KD1-SPB had only a minimal effect on the growth of Hep3B tumors, whereas KD1 again caused a three- to fourfold suppression. These results establish that the adenovirus E4 promoter can be replaced by a tissue-specific promoter in a replication-competent vector. The vector has three engineered safety features: the tissue-specific promoter, the mutations in E1A that preclude efficient replication in nondividing cells, and a deletion of the E3 genes which shield the virus from attack by the immune system. KD1-SPB may have use in treating human lung cancers in which the SPB promoter is active.

Increased efficacy of an adenovirus-vectored foot-and-mouth disease capsid subunit vaccine expressing nonstructural protein 2B is associated with a specific T cell response

USDA-ARS?s Scientific Manuscript database

We previously demonstrated that an adenovirus-based FMDV serotype A24 subunit vaccine, Ad5-A24, expressed under the control of a cytomegalovirus promoter (CMV) can protect swine and bovines against homologous challenge, but swine vaccinated with an Ad5-vectored FMDV O1 Campos vaccine, Ad5-O1Campos (...

Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

PubMed

Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

2010-09-01

As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

Intramuscular injection of AAV8 in mice and macaques is associated with substantial hepatic targeting and transgene expression.

PubMed

Greig, Jenny A; Peng, Hui; Ohlstein, Jason; Medina-Jaszek, C Angelica; Ahonkhai, Omua; Mentzinger, Anne; Grant, Rebecca L; Roy, Soumitra; Chen, Shu-Jen; Bell, Peter; Tretiakova, Anna P; Wilson, James M

2014-01-01

Intramuscular (IM) administration of adeno-associated viral (AAV) vectors has entered the early stages of clinical development with some success, including the first approved gene therapy product in the West called Glybera. In preparation for broader clinical development of IM AAV vector gene therapy, we conducted detailed pre-clinical studies in mice and macaques evaluating aspects of delivery that could affect performance. We found that following IM administration of AAV8 vectors in mice, a portion of the vector reached the liver and hepatic gene expression contributed significantly to total expression of secreted transgenes. The contribution from liver could be controlled by altering injection volume and by the use of traditional (promoter) and non-traditional (tissue-specific microRNA target sites) expression control elements. Hepatic distribution of vector following IM injection was also noted in rhesus macaques. These pre-clinical data on AAV delivery should inform safe and efficient development of future AAV products.

Construction of fusion vectors of corynebacteria: expression of glutathione-S-transferase fusion protein in Corynebacterium acetoacidophilum ATCC 21476.

PubMed

Srivastava, Preeti; Deb, J K

2002-07-02

A series of fusion vectors containing glutathione-S-transferase (GST) were constructed by inserting GST fusion cassette of Escherichia coli vectors pGEX4T-1, -2 and -3 in corynebacterial vector pBK2. Efficient expression of GST driven by inducible tac promoter of E. coli was observed in Corynebacterium acetoacidophilum. Fusion of enhanced green fluorescent protein (EGFP) and streptokinase genes in this vector resulted in the synthesis of both the fusion proteins. The ability of this recombinant organism to produce several-fold more of the product in the extracellular medium than in the intracellular space would make this system quite attractive as far as the downstream processing of the product is concerned.

Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

PubMed Central

Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

2009-01-01

The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

Rule-Based Design of Plant Expression Vectors Using GenoCAD.

PubMed

Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean

2015-01-01

Plant synthetic biology requires software tools to assist on the design of complex multi-genic expression plasmids. Here a vector design strategy to express genes in plants is formalized and implemented as a grammar in GenoCAD, a Computer-Aided Design software for synthetic biology. It includes a library of plant biological parts organized in structural categories and a set of rules describing how to assemble these parts into large constructs. Rules developed here are organized and divided into three main subsections according to the aim of the final construct: protein localization studies, promoter analysis and protein-protein interaction experiments. The GenoCAD plant grammar guides the user through the design while allowing users to customize vectors according to their needs. Therefore the plant grammar implemented in GenoCAD will help plant biologists take advantage of methods from synthetic biology to design expression vectors supporting their research projects.

A human parvovirus, adeno-associated virus, as a eucaryotic vector: Transient expression and encapsidation of the procaryotic gene for chloramphenicol acetyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tratschin, J.D.; West, M.H.P.; Sandbank, T.

1984-10-01

The authors have used the defective human parvovirus adeno-associated virus (AAV) as a novel eurocaryotic vector (parvector) for the expression of a foreign gene in human cells. The recombinant, pAV2, contains the AAV genome in a pBR322-derived bacterial plasmid. When pAV2 is transfected into human cells together with helper adenovirus particles, the AAV genome is rescued from the recombinant plasmid and replicated to produce infectious AAV particles at high efficiency. To create a vector, we inserted a procaryotic sequence coding for chloramphenicol acetyltransferase (CAT) into derivatives of pAV2 following either of the AAV promoters p/sub 40/ (pAVHiCAT) and p/sub 19/more » (pAVBcCAT). When transfected into human 293 cells or HeLa cells, pAVHiCAT expressed CAT activity in the absence of adenovirus. In the presence of adenovirus, this vector produced increased amounts of CAT activity and the recombinant AAV-CAT genome was replicated. In 293 cells, pAVBcCAT expressed a similar amount of CAT activity in the absence or presence of adenovirus and the recombinant AAV-CAT genome was not replicated. In HeLa cells, pAVBcCAT expressed low levels of CAT activity, but this level was elevated by coinfection with adenovirus particles or by cotransfection with a plasmid which expressed the adenovirus early region 1A (E1A) product. The E1A product is a transcriptional activator and is expressed in 293 cells. Thus, expression from two AAV promoters is differentially regulated: expression from p/sub 19/ is increased by E1A, whereas p/sub 40/ yields high levels of constitutive expression in the absence of E1A. Both AAV vectors were packaged into AAV particles by complementation with wild-type AAV and yielded CAT activity when subsequently infected into cells in the presence of adenovirus.« less

Next generation tools for high-throughput promoter and expression analysis employing single-copy knock-ins at the Hprt1 locus.

PubMed

Yang, G S; Banks, K G; Bonaguro, R J; Wilson, G; Dreolini, L; de Leeuw, C N; Liu, L; Swanson, D J; Goldowitz, D; Holt, R A; Simpson, E M

2009-03-01

We have engineered a set of useful tools that facilitate targeted single copy knock-in (KI) at the hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1) locus. We employed fine scale mapping to delineate the precise breakpoint location at the Hprt1(b-m3) locus allowing allele specific PCR assays to be established. Our suite of tools contains four targeting expression vectors and a complementing series of embryonic stem cell lines. Two of these vectors encode enhanced green fluorescent protein (EGFP) driven by the human cytomegalovirus immediate-early enhancer/modified chicken beta-actin (CAG) promoter, whereas the other two permit flexible combinations of a chosen promoter combined with a reporter and/or gene of choice. We have validated our tools as part of the Pleiades Promoter Project (http://www.pleiades.org), with the generation of brain-specific EGFP positive germline mouse strains.

Expression Plasmids for Use in Candida glabrata

PubMed Central

Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.

2013-01-01

We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

Efficacy and safety of a clinically relevant foamy vector design in human hematopoietic repopulating cells.

PubMed

Everson, Elizabeth M; Hocum, Jonah D; Trobridge, Grant D

2018-06-23

Previous studies have shown that foamy viral (FV) vectors are a promising alternative to gammaretroviral and lentiviral vectors and insulators can improve FV vector safety. However, in a previous analysis of insulator effects on FV vector safety, strong viral promoters were used to elicit genotoxic events. Here we developed and analyzed the efficacy and safety of a high-titer, clinically relevant FV vector driven by the housekeeping promoter elongation factor-1α and insulated with an enhancer blocking A1 insulator (FV-EGW-A1). Human CD34 + cord blood cells were exposed to an enhanced green fluorescent protein expressing vector, FV-EGW-A1, at a multiplicity of infection of 10 and then maintained in vitro or transplanted into immunodeficient mice. Flow cytometry was used to measure engraftment and marking in vivo. FV vector integration sites were analyzed to assess safety. FV-EGW-A1 resulted in high-marking, multi-lineage engraftment of human repopulating cells with no evidence of silencing. Engraftment was highly polyclonal with no clonal dominance and a promising safety profile based on integration site analysis. An FV vector with an elongation factor-1α promoter and an A1 insulator is a promising vector design for use in the clinic. This article is protected by copyright. All rights reserved.

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

PubMed Central

Kon, Tatsuya; Yoshikawa, Nobuyuki

2014-01-01

Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

Green fluorescent protein is lighting up fungal biology

USGS Publications Warehouse

Lorang, J.M.; Tuori, R.P; Martinez, J.P; Sawyer, T.L.; Redman, R.S.; Rollins, J. A.; Wolpert, T.J.; Johnson, K.B.; Rodriguez, R.J.; Dickman, M. B.; Ciuffetti, L.M.

2001-01-01

Expression of gfp in filamentous fungi requires agfp variant that is efficiently translated in fungi, a transformation system, and a fungal promoter that satisfies the requirements of a given experimental objective. Transformation of fungi has recently been reviewed by Gold et al. (26). Robinson and Sharon (44) suggest that GFP can actually be used to optimize transformation protocols. In addition to reporting the construction of a new fungal transformation vector that expressesSGFP under the control of the ToxA gene promoter from Pyrenophora tritici-repentis (12) and demonstrating its use in plant pathogens belonging to eight different genera of filamentous fungi (Fusarium, Botrytis, Pyrenophora, Alternaria, Cochliobolus, Sclerotinia, Colletotrichum, andVerticillium), in this review we also enumerate and describe a comprehensive list of vectors for expressing GFP in fungi.

Use of CYP52A2A promoter to increase gene expression in yeast

DOEpatents

Craft, David L.; Wilson, C. Ron; Eirich, Dudley; Zhang, Yeyan

2004-01-06

A nucleic acid sequence including a CYP promoter operably linked to nucleic acid encoding a heterologous protein is provided to increase transcription of the nucleic acid. Expression vectors and host cells containing the nucleic acid sequence are also provided. The methods and compositions described herein are especially useful in the production of polycarboxylic acids by yeast cells.

A lentiviral vector with expression controlled by E2F-1: A potential tool for the study and treatment of proliferative diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauss, Bryan E.; Patricio, Juliana Rotelli; Program in Biotechnology, University of Sao Paulo

2006-10-06

We have constructed a lentiviral vector with expression limited to cells presenting active E2F-1 protein, a potential advantage for gene therapy of proliferative diseases. For the FE2FLW vector, the promoter region of the human E2F-1 gene was utilized to drive expression of luciferase cDNA, included as a reporter of viral expression. Primary, immortalized, and transformed cells were transduced with the FE2FLW vector and cell cycle alterations were induced with serum starvation/replacement, contact inhibition or drug treatment, revealing cell cycle-dependent changes in reporter activity. Forced E2F-1 expression, but not E2F-2 or E2F-3, increased reporter activity, indicating a major role for thismore » factor in controlling expression from the FE2FLW virus. We show the utility of this vector as a reporter of E2F-1 and proliferation-dependent cellular alterations upon cytotoxic/cytostatic treatment, such as the introduction of tumor suppressor genes. We propose that the FE2FLW vector may be a starting point for the development of gene therapy strategies for proliferative diseases, such as cancer or restinosis.« less

AAVPG: A vigilant vector where transgene expression is induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

2013-12-15

Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

Targeting MOG expression to dendritic cells delays onset of experimental autoimmune disease.

PubMed

Ko, Hyun-Ja; Chung, Jie-Yu; Nasa, Zeyad; Chan, James; Siatskas, Christopher; Toh, Ban-Hock; Alderuccio, Frank

2011-05-01

Haematopoietic stem cell (HSC) transfer coupled with gene therapy is a powerful approach to treating fatal diseases such as X-linked severe combined immunodeficiency. This ability to isolate and genetically manipulate HSCs also offers a strategy for inducing immune tolerance through ectopic expression of autoantigens. We have previously shown that retroviral transduction of bone marrow (BM) with vectors encoding the autoantigen, myelin oligodendrocyte glycoprotein (MOG), can prevent the induction of experimental autoimmune encephalomyelitis (EAE). However, ubiquitous cellular expression of autoantigen driven by retroviral promoters may not be the best approach for clinical translation and a targeted expression approach may be more acceptable. As BM-derived dendritic cells (DCs) play a major role in tolerance induction, we asked whether targeted expression of MOG, a target autoantigen in EAE, to DCs can promote tolerance induction and influence the development of EAE. Self-inactivating retroviral vectors incorporating the mouse CD11c promoter were generated and used to transduce mouse BM cells. Transplantation of gene-modified cells into irradiated recipients resulted in the generation of chimeric mice with transgene expression limited to DCs. Notably, chimeric mice transplanted with MOG-expressing BM cells manifest a significant delay in the development of EAE suggesting that targeted antigen expression to tolerogenic cell types may be a feasible approach to inducing antigen-specific tolerance.

A Potent, Imaging Adenoviral Vector Driven by the Cancer-selective Mucin-1 Promoter That Targets Breast Cancer Metastasis

PubMed Central

Huyn, Steven T.; Burton, Jeremy B.; Sato, Makoto; Carey, Michael; Gambhir, Sanjiv S.; Wu, Lily

2009-01-01

Purpose With breast cancer, early detection and proper staging are critical, and will often influence both the treatment regimen and the therapeutic outcome for those affected with this disease. Improvements in these areas will play a profound role in reducing mortality from breast cancer. Experimental Design In this work we developed a breast cancer – targeted serotype 5 adenoviral vector, utilizing the tumor-specific mucin-1 promoter in combination with the two-step transcriptional amplification system, a system used to augment the activity of weak tissue – specific promoters. Results We showed the strong specificity of this tumor-selective adenovirus to express the luciferase optical imaging gene, leading to diagnostic signals that enabled detection of sentinel lymph node metastasis of breast cancer. Furthermore, we were able to target hepatic metastases following systemic administration of this mucin-1 selective virus. Conclusions Collectively, we showed that the amplified mucin-1 promoter – driven vector is able to deliver to and selectively express a desirable transgene in metastatic lesions of breast tumors. This work has strong clinical relevance to current diagnostic staging approaches, and could add to targeted therapeutic strategies to advance the fight against breast cancer. PMID:19366829

A novel expression system for intracellular production and purification of recombinant affinity-tagged proteins in Aspergillus niger.

PubMed

Roth, Andreas H F J; Dersch, Petra

2010-03-01

A set of different integrative expression vectors for the intracellular production of recombinant proteins with or without affinity tag in Aspergillus niger was developed. Target genes can be expressed under the control of the highly efficient, constitutive pkiA promoter or the novel sucrose-inducible promoter of the beta-fructofuranosidase (sucA) gene of A. niger in the presence or absence of alternative carbon sources. All expression plasmids contain an identical multiple cloning sequence that allows parallel construction of N- or C-terminally His6- and StrepII-tagged versions of the target proteins. Production of two heterologous model proteins, the green fluorescence protein and the Thermobifida fusca hydrolase, proved the functionality of the vector system. Efficient production and easy detection of the target proteins as well as their fast purification by a one-step affinity chromatography, using the His6- or StrepII-tag sequence, was demonstrated.

Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

DOEpatents

Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

2002-10-15

The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

DOEpatents

Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

2003-03-04

The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

Development of a GFP expression vector for Cucurbit chlorotic yellows virus.

PubMed

Wei, Ying; Han, Xiaoyu; Wang, Zhenyue; Gu, Qinsheng; Li, Honglian; Chen, Linlin; Sun, Bingjian; Shi, Yan

2018-05-24

Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date. We constructed a CCYV GFP expression vector using the "add a gene" strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFP SGC , pCCYVGFP CGC , and pCCYVGFP CGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFP CGC -infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFP SGC and pCCYVGFP CGS were mainly found in single cells. Further observation of pCCYVGFP CGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves. We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.

Cre-lox Univector acceptor vectors for functional screening in protoplasts: analysis of Arabidopsis donor cDNAs encoding ABSCISIC ACID INSENSITIVE1-Like protein phosphatases

PubMed Central

Jia, Fan; Gampala, Srinivas S.L.; Mittal, Amandeep; Luo, Qingjun; Rock, Christopher D.

2009-01-01

The 14,200 available full length Arabidopsis thaliana cDNAs in the Universal Plasmid System (UPS) donor vector pUNI51 should be applied broadly and efficiently to leverage a “functional map-space” of homologous plant genes. We have engineered Cre-lox UPS host acceptor vectors (pCR701- 705) with N-terminal epitope tags in frame with the loxH site and downstream from the maize Ubiquitin promoter for use in transient protoplast expression assays and particle bombardment transformation of monocots. As an example of the utility of these vectors, we recombined them with several Arabidopsis cDNAs encoding Ser/Thr protein phosphatase type 2C (PP2Cs) known from genetic studies or predicted by hierarchical clustering meta-analysis to be involved in ABA and stress responses. Our functional results in Zea mays mesophyll protoplasts on ABA-inducible expression effects on the Late Embryogenesis Abundant promoter ProEm:GUS reporter were consistent with predictions and resulted in identification of novel activities of some PP2Cs. Deployment of these vectors can facilitate functional genomics and proteomics and identification of novel gene activities. PMID:19499346

Long-term and stable correction of uremic anemia by intramuscular injection of plasmids containing hypoxia-regulated system of erythropoietin expression

PubMed Central

Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang

2012-01-01

Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115

[Novel bidirectional promoter from human genome].

PubMed

Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M

2011-01-01

In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells.

Expanding the genetic toolbox for Leptospira species by generation of fluorescent bacteria.

PubMed

Aviat, Florence; Slamti, Leyla; Cerqueira, Gustavo M; Lourdault, Kristel; Picardeau, Mathieu

2010-12-01

Our knowledge of the genetics and molecular basis of the pathogenesis associated with Leptospira, in comparison to those of other bacterial species, is very limited. An improved understanding of pathogenic mechanisms requires reliable genetic tools for functional genetic analysis. Here, we report the expression of gfp and mRFP1 genes under the control of constitutive spirochetal promoters in both saprophytic and pathogenic Leptospira strains. We were able to reliably measure the fluorescence of Leptospira by fluorescence microscopy and a fluorometric microplate reader-based assay. We showed that the expression of the gfp gene had no significant effects on growth in vivo and pathogenicity in L. interrogans. We constructed an expression vector for L. biflexa that contains the lacI repressor, an inducible lac promoter, and gfp as the reporter, demonstrating that the lac system is functional in Leptospira. Green fluorescent protein (GFP) expression was induced by the addition of isopropyl-β-d-thiogalactopyranoside (IPTG) in L. biflexa transformants harboring the expression vector. Finally, we showed that GFP can be used as a reporter to assess promoter activity in different environmental conditions. These results may facilitate further advances for studying the genetics of Leptospira spp.

Lentiviral Vectors Bearing the Cardiac Promoter of the Na+-Ca2+ Exchanger Report Cardiogenic Differentiation in Stem Cells

PubMed Central

Barth, Andreas S; Kizana, Eddy; Smith, Rachel R; Terrovitis, John; Dong, Peihong; Leppo, Michelle K; Zhang, Yiqiang; Miake, Junichiro; Olson, Eric N; Schneider, Jay W; Abraham, M Roselle; Marbán, Eduardo

2009-01-01

Cardiosphere-derived resident cardiac stem cells (CDCs) are readily isolated from adult hearts and confer functional benefit in animal models of heart failure. To study cardiogenic differentiation in CDCs, we developed a method to genetically label and selectively enrich for cells that have acquired a cardiac phenotype. Lentiviral vectors achieved significantly higher transduction efficiencies in CDCs than any of the nine adeno-associated viral (AAV) serotypes tested. To define the most suitable vector system for reporting cardiogenic differentiation, we compared the cell specificity of five commonly-used cardiac-specific promoters in the context of lentiviral vectors. The promoter of the cardiac sodium-calcium exchanger (NCX1) conveyed the highest degree of cardiac specificity, as assessed by transducing seven cell types with each vector and measuring fluorescence intensity by flow cytometry. NCX1-GFP-positive CDC subpopulations, demonstrating prolonged expression of a variety of cardiac markers, could be isolated and expanded in vitro. Finally, we used chemical biology to validate that lentiviral vectors bearing the cardiac NCX1-promoter can serve as a highly accurate biosensor of cardiogenic small molecules in stem cells. The ability to accurately report cardiac fate and selectively enrich for cardiomyocytes and their precursors has important implications for drug discovery and the development of cell-based therapies. PMID:18388932

Helper-Free Foamy Virus Vectors

PubMed Central

TROBRIDGE, GRANT D.; RUSSELL, DAVID W.

2010-01-01

Retroviral vectors based on human foamy virus (HFV) have been developed and show promise as gene therapy vehicles. Here we describe a method for the production of HFV vector stocks free of detectable helper virus. The helper and vector plasmid constructs used both lack the HFV bel genes, so recombination between these constructs cannot create a wild-type virus. A fusion promoter that combines portions of the cytomegalovirus (CMV) immediate-early and HFV long terminal repeat (LTR) promoters was used to drive expression of both the helper and vector constructs. The CMV–LTR fusion promoter allows for HFV vector production in the absence of the Bel-1 trans-activator protein, which would otherwise be necessary for efficient transcription from the HFV LTR. Vector stocks containing either neomycin phosphotransferase or alkaline phosphatase reporter genes were produced by transient transfection at titers greater than 105 transducing units/ml. G418-resistant BHK-21 cells obtained by transduction with neo vectors contained randomly integrated HFV vector proviruses without detectable deletions or rearrangements. The vector stocks generated were free of replication-competent retrovirus (RCR), as determined by assays for LTR trans-activation and a marker rescue assay developed here for the detection of Bel-independent RCR. OVERVIEW SUMMARY Vectors based on human foamy virus have been developed but low titers and the presence of replication-competent retrovirus (RCR) in vector stocks have prevented their use in preclinical animal experiments. We have developed a transient transfection method that can be used to produce replication-incompetent HFV vector stocks at titers greater than 105/ml, and that does not produce contaminating RCR. The use of CMV-HFV LTR fusion promoters in the helper and vector constructs has circumvented the requirement for the HFV Bel-1 trans-activator protein. Consequently, the potential for generating wild-type HFV by recombination between helper and vector constructs during vector production has been eliminated. Here we describe HFV vector production using this Bel-independent system. PMID:9853518

“Stealth” Adenoviruses Blunt Cell-Mediated and Humoral Immune Responses against the Virus and Allow for Significant Gene Expression upon Readministration in the Lung

PubMed Central

Croyle, Maria A.; Chirmule, Narendra; Zhang, Yi; Wilson, James M.

2001-01-01

Most of the early gene therapy trials for cystic fibrosis have been with adenovirus vectors. First-generation viruses with E1a and E1b deleted are limited by transient expression of the transgene and substantial inflammatory responses. Gene transfer is also significantly curtailed following a second dose of virus. In an effort to reduce adenovirus-associated inflammation, capsids of first-generation vectors were modified with various activated monomethoxypolyethylene glycols. Cytotoxic T-lymphocyte production was significantly reduced in C57BL/6 mice after a single intratracheal administration of modified vectors, and length of gene expression was extended from 4 to 42 days. T-cell subsets from mice exposed to the conjugated vectors demonstrated a marked decrease in Th1 responses and slight enhancement of Th2 responses compared to animals dosed with native virus. Neutralizing antibodies (NAB) against adenovirus capsid proteins were reduced in serum and bronchoalveolar lavage fluid of animals after a single dose of modified virus, allowing significant levels of gene expression upon rechallenge with native adenovirus. Modification with polyethylene glycol (PEG) also allowed substantial gene expression from the new vectors in animals previously immunized with unmodified virus. However, gene expression was significantly reduced after two doses of the same PEG-conjugated vector. Alternating the activation group of PEG between doses did produce significant gene expression upon readministration. This technology in combination with second-generation or helper-dependent adenovirus could produce dosing strategies which promote successful readministration of vector in clinical trials and marked expression in patients with significant anti-adenovirus NAB levels and reduce the possibility of immune reactions against viral vectors for gene therapy. PMID:11312351

A novel, broad-range, CTXΦ-derived stable integrative expression vector for functional studies.

PubMed

Das, Bhabatosh; Kumari, Reena; Pant, Archana; Sen Gupta, Sourav; Saxena, Shruti; Mehta, Ojasvi; Nair, Gopinath Balakrish

2014-12-01

CTXΦ, a filamentous vibriophage encoding cholera toxin, uses a unique strategy for its lysogeny. The single-stranded phage genome forms intramolecular base-pairing interactions between two inversely oriented XerC and XerD binding sites (XBS) and generates a functional phage attachment site, attP(+), for integration. The attP(+) structure is recognized by the host-encoded tyrosine recombinases XerC and XerD (XerCD), which enables irreversible integration of CTXΦ into the chromosome dimer resolution site (dif) of Vibrio cholerae. The dif site and the XerCD recombinases are widely conserved in bacteria. We took advantage of these conserved attributes to develop a broad-host-range integrative expression vector that could irreversibly integrate into the host chromosome using XerCD recombinases without altering the function of any known open reading frame (ORF). In this study, we engineered two different arabinose-inducible expression vectors, pBD62 and pBD66, using XBS of CTXΦ. pBD62 replicates conditionally and integrates efficiently into the dif of the bacterial chromosome by site-specific recombination using host-encoded XerCD recombinases. The expression level of the gene of interest could be controlled through the PBAD promoter by modulating the functions of the vector-encoded transcriptional factor AraC. We validated the irreversible integration of pBD62 into a wide range of pathogenic and nonpathogenic bacteria, such as V. cholerae, Vibrio fluvialis, Vibrio parahaemolyticus, Escherichia coli, Salmonella enterica, and Klebsiella pneumoniae. Gene expression from the PBAD promoter of integrated vectors was confirmed in V. cholerae using the well-studied reporter genes mCherry, eGFP, and lacZ. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Development of a domain-specific genetic language to design Chlamydomonas reinhardtii expression vectors.

PubMed

Wilson, Mandy L; Okumoto, Sakiko; Adam, Laura; Peccoud, Jean

2014-01-15

Expression vectors used in different biotechnology applications are designed with domain-specific rules. For instance, promoters, origins of replication or homologous recombination sites are host-specific. Similarly, chromosomal integration or viral delivery of an expression cassette imposes specific structural constraints. As de novo gene synthesis and synthetic biology methods permeate many biotechnology specialties, the design of application-specific expression vectors becomes the new norm. In this context, it is desirable to formalize vector design strategies applicable in different domains. Using the design of constructs to express genes in the chloroplast of Chlamydomonas reinhardtii as an example, we show that a vector design strategy can be formalized as a domain-specific language. We have developed a graphical editor of context-free grammars usable by biologists without prior exposure to language theory. This environment makes it possible for biologists to iteratively improve their design strategies throughout the course of a project. It is also possible to ensure that vectors designed with early iterations of the language are consistent with the latest iteration of the language. The context-free grammar editor is part of the GenoCAD application. A public instance of GenoCAD is available at http://www.genocad.org. GenoCAD source code is available from SourceForge and licensed under the Apache v2.0 open source license.

Cytomegalovirus vector expressing RAE-1γ induces enhanced anti-tumor capacity of murine CD8+ T cells.

PubMed

Tršan, Tihana; Vuković, Kristina; Filipović, Petra; Brizić, Ana Lesac; Lemmermann, Niels A W; Schober, Kilian; Busch, Dirk H; Britt, William J; Messerle, Martin; Krmpotić, Astrid; Jonjić, Stipan

2017-08-01

Designing CD8 + T-cell vaccines, which would provide protection against tumors is still considered a great challenge in immunotherapy. Here we show the robust potential of cytomegalovirus (CMV) vector expressing the NKG2D ligand RAE-1γ as CD8 + T cell-based vaccine against malignant tumors. Immunization with the CMV vector expressing RAE-1γ, delayed tumor growth or even provided complete protection against tumor challenge in both prophylactic and therapeutic settings. Moreover, a potent tumor control in mice vaccinated with this vector can be further enhanced by blocking the immune checkpoints TIGIT and PD-1. CMV vector expressing RAE-1γ potentiated expansion of KLRG1 + CD8 + T cells with enhanced effector properties. This vaccination was even more efficient in neonatal mice, resulting in the expansion and long-term maintenance of epitope-specific CD8 + T cells conferring robust resistance against tumor challenge. Our data show that immunomodulation of CD8 + T-cell responses promoted by herpesvirus expressing a ligand for NKG2D receptor can provide a powerful platform for the prevention and treatment of CD8 + T-cell sensitive tumors. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Disclosing the Parameters Leading to High Productivity of Retroviral Producer Cells Lines: Evaluating Random Versus Targeted Integration.

PubMed

Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S

2017-04-01

Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.

Modification of the Creator recombination system for proteomics applications--improved expression by addition of splice sites.

PubMed

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-03-06

Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics.

Modification of the Creator recombination system for proteomics applications – improved expression by addition of splice sites

PubMed Central

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-01-01

Background Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. Results To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. Conclusion The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics. PMID:16519801

[Progress in application of targeting viral vector regulated by microRNA in gene therapy: a review].

PubMed

Zhang, Guohai; Wang, Qizhao; Zhang, Jinghong; Xu, Ruian

2010-06-01

A safe and effective targeting viral vector is the key factor for successful clinical gene therapy. microRNA, a class of small, single-stranded endogenous RNAs, act as post-transcriptional regulators of gene expression. The discovery of these kind regulatory elements provides a new approach to regulate gene expression more accurately. In this review, we elucidated the principle of microRNA in regulation of targeting viral vector. The applications of microRNA in the fields of elimination contamination from replication competent virus, reduction of transgene-specific immunity, promotion of cancer-targeted gene therapy and development of live attenuated vaccines were also discussed.

AAV-mediated RLBP1 gene therapy improves the rate of dark adaptation in Rlbp1 knockout mice

PubMed Central

Choi, Vivian W; Bigelow, Chad E; McGee, Terri L; Gujar, Akshata N; Li, Hui; Hanks, Shawn M; Vrouvlianis, Joanna; Maker, Michael; Leehy, Barrett; Zhang, Yiqin; Aranda, Jorge; Bounoutas, George; Demirs, John T; Yang, Junzheng; Ornberg, Richard; Wang, Yu; Martin, Wendy; Stout, Kelly R; Argentieri, Gregory; Grosenstein, Paul; Diaz, Danielle; Turner, Oliver; Jaffee, Bruce D; Police, Seshidhar R; Dryja, Thaddeus P

2015-01-01

Recessive mutations in RLBP1 cause a form of retinitis pigmentosa in which the retina, before its degeneration leads to blindness, abnormally slowly recovers sensitivity after exposure to light. To develop a potential gene therapy for this condition, we tested multiple recombinant adeno-associated vectors (rAAVs) composed of different promoters, capsid serotypes, and genome conformations. We generated rAAVs in which sequences from the promoters of the human RLBP1, RPE65, or BEST1 genes drove the expression of a reporter gene (green fluorescent protein). A promoter derived from the RLBP1 gene mediated expression in the retinal pigment epithelium and Müller cells (the intended target cell types) at qualitatively higher levels than in other retinal cell types in wild-type mice and monkeys. With this promoter upstream of the coding sequence of the human RLBP1 gene, we compared the potencies of vectors with an AAV2 versus an AAV8 capsid in transducing mouse retinas, and we compared vectors with a self-complementary versus a single-stranded genome. The optimal vector (scAAV8-pRLBP1-hRLBP1) had serotype 8 capsid and a self-complementary genome. Subretinal injection of scAAV8-pRLBP1-hRLBP1 in Rlbp1 nullizygous mice improved the rate of dark adaptation based on scotopic (rod-plus-cone) and photopic (cone) electroretinograms (ERGs). The effect was still present after 1 year. PMID:26199951

Akt/protein kinase B activation by adenovirus vectors contributes to NFkappaB-dependent CXCL10 expression.

PubMed

Liu, Qiang; White, Lindsay R; Clark, Sharon A; Heffner, Daniel J; Winston, Brent W; Tibbles, Lee Anne; Muruve, Daniel A

2005-12-01

In gene therapy, the innate immune system is a significant barrier to the effective application of adenovirus (Ad) vectors. In kidney epithelium-derived (REC) cells, serotype 5 Ad vectors induce the expression of the chemokine CXCL10 (IP-10), a response that is dependent on NFkappaB. Compared to the parental vector AdLuc, transduction with the RGD-deleted vector AdL.PB resulted in reduced CXCL10 activation despite increasing titers, implying that RGD-alpha(V) integrin interactions contribute to adenovirus induction of inflammatory genes. Akt, a downstream effector of integrin signaling, was activated within 10 min of transduction with Ad vectors in a dose-dependent manner. Akt activation was not present following transduction with AdL.PB, confirming the importance of capsid-alpha(V) integrin interactions in Ad vector Akt activation. Inhibition of the phosphoinositide-3-OH kinase/Akt pathway by Wortmannin or Ly294002 compounds decreased Ad vector induction of CXCL10 mRNA. Similarly, adenovirus-mediated overexpression of the dominant negative AktAAA decreased CXCL10 mRNA expression compared to the reporter vector AdLacZ alone. The effect of Akt on CXCL10 mRNA expression occurred via NFkappaB-dependent transcriptional activation, since AktAAA overexpression and Ly294002 both inhibited CXCL10 and NFkappaB promoter activation in luciferase reporter experiments. These results show that Akt plays a role in the Ad vector activation of NFkappaB and CXCL10 expression. Understanding the mechanism underlying the regulation of host immunomodulatory genes by adenovirus vectors will lead to strategies that will improve the efficacy and safety of these agents for clinical use.

Improved vectors for transcriptional/translational signal screening in corynebacteria using the melC operon from Streptomyces glaucescens as reporter.

PubMed

Adham, Sirin A I; Rodríguez, Sonia; Ramos, Angelina; Santamaría, Ramón I; Gil, José A

2003-07-01

The tyrosinase operon ( melC) from Streptomyces glaucescens was cloned and functionally expressed in Brevibacterium lactofermentum and Corynebacterium glutamicum under the control of the promoter of the kan gene from Tn 5. Recombinant corynebacterial cells containing the tyrosinase operon produced melanin on agar plates and in liquid culture when supplemented with copper and tyrosine. A conjugative bifunctional replacement vector for transcriptional/translational signal screening (pEMel-1) was constructed using expression of the melC operon from S. glaucescens, which can be used for cloning promoter sequences as EcoRI- NdeI fragments. When the DNA fragments with promoter activity such as cspBp or trpp were inserted into pEMel-1, B. lactofermentum harboring the chimeric plasmids produced melanin at different stages of growth, allowing temporal detection of promoter activity. The vector was also used to detect the activity of a Streptomyces promoter ( xysAp), which was inactive in B. lactofermentum, after PCR mutagenesis. The melC operon can be used for the visual, inexpensive (compared to the high price of starch azure for amylase detection), and non-selective (in contrast to the kan or cat genes) screening of several thousand clones at high colony density without killing of the transformants due to the presence of iodine (as in the case of amylase assay).

Gene transfer with a vector expressing Maxi-K from a smooth muscle-specific promoter restores erectile function in the aging rat.

PubMed

Melman, A; Biggs, G; Davies, K; Zhao, W; Tar, M T; Christ, G J

2008-03-01

Previous reports have demonstrated that gene transfer with the alpha, or pore-forming, subunit of the human Maxi-K channel (hSlo) restores the decline in erectile capacity observed in established rat models of diabetes and aging. Preliminary data from a human clinical trial also showed safety and potential efficacy in 11 men treated with the same plasmid construct expressing the Maxi-K channel. In all instances, the original plasmid was driven by the heterologous cytomegalovirus promoter which is broadly active in a wide variety of cell and tissue types. To more precisely determine the contribution of the corporal myocyte to the observed physiological effects in vivo, we report here our initial work using a distinct vector (pSMAA-hSlo) in which hSlo gene expression was driven off the mouse smooth muscle alpha-actin (SMAA) promoter. Specifically, older rats, with diminished erectile capacity, were given a single intracorporal injection with either 100 mug pVAX-hSlo or 10, 100 or 1000 mug pSMAA-hSlo, or vector or vehicle alone. Significantly increased intracavernous pressure (ICP) responses to cavernous nerve stimulation were observed for all doses of both plasmids encoding hSlo, relative to control injections. These data confirm and extend previous observations to document that smooth muscle cell-specific expression of hSlo in corporal tissue is both necessary and sufficient to restore erectile function in aging rats.

Role of promoter element in c-mpl gene expression induced by TPO.

PubMed

Sunohara, Masataka; Morikawa, Shigeru; Fuse, Akira; Sato, Iwao

2013-01-01

Thrombopoietin (TPO) and its receptor, c-Mpl, play the crucial role for the development of megakaryocyte and considered to regulate megakaryocytopoiesis. Previously we reported that TPO increased the c-mpl promoter activity determined by a transient expression system using a vector containing the luciferase gene as a reporter and the expression of the c-mpl gene is modulated by transcription through a protein kinase C (PKC)-dependent pathway in the megakaryoblastic cells. In this research, to elucidate the required elements in c-mpl promoter, the promoter activity of the deletion constructs and site-directed mutagenesis were measured by a transient transfection assay system. Destruction of -77GATA in c-mpl promoter decreased the activity by 22.8%. Our study elucidated that -77GATA involved in TPO-induced c-mpl gene expression in a human megakaryoblastic cell line, CMK.

Modification of the hTERT promoter by heat shock elements enhances the efficiency and specificity of cancer targeted gene therapy.

PubMed

Wang, Xiaolong; Zhou, PeiHua; Sun, XueJun; Wei, GuangBing; Zhang, Li; Wang, Hui; Yao, JianFeng; Jia, PengBo; Zheng, JianBao

2016-05-01

One of the current challenges facing cancer gene therapy is the tumour-specific targeting of therapeutic genes. Effective targeting in gene therapy requires accurate spatial and temporal control of gene expression. To develop a sufficient and accurate tumour-targeting method for cancer gene therapy, we have investigated the use of hyperthermia to control the expression of a transgene under the control of the human telomerase reverse transcriptase (hTERT) promoter and eight heat shock elements (8HSEs). Luciferase reporters were constructed by inserting eight HSEs and the hTERT promoter (8HSEs-hTERTp) upstream of the pGL4.20 vector luciferase gene. The luciferase activity of the hTERT promoter and 8HSEs-hTERT promoter were then compared in the presence and absence of heat. The differences in luciferase activity were analysed using dual luciferase assays in SW480 (high hTERT expression), MKN28 and MRC-5 cells (low hTERT expression). The luciferase activity of the Hsp70B promoter was also compared to the 8HSEs-hTERT promoter in the above listed cell lines. Lentiviral vector and heat-induced expression of EGFP expression under the control of the 8HSEs-hTERT promoter in cultured cells and mouse tumour xenografts was measured by reverse transcription polymerase (RT-PCR), Western blot and immunofluorescence assays. hTERT promoter activity was higher in SW480 cells than in MKN28 or MRC-5 cells. At 43 °C, the luciferase activity of the 8HSEs-hTERT promoter was significantly increased in SW480 cells, but not in MKN28 or MRC-5 cells. Importantly, the differences in luciferase activity were much more obvious in both high (SW480) and low (MKN28 and MRC-5) hTERT expressing cells when the activity of the 8HSEs-hTERT promoter was compared to the Hsp70B promoter. Moreover, under the control of 8HSEs-hTERT promoter in vitro and in vivo, EGFP expression was obviously increased by heat treatment in SW480 cells but not in MKN28 or MRC-5 cells, nor was expression increased under normal temperature conditions. The hTERT promoter is a potentially powerful tumour-specific promoter and gene therapy tool for cancer treatment. Incorporating heat-inducible therapeutic elements (8HSEs) into the hTERT promoter may enhance the efficiency and specificity of cancer targeting gene therapy under hyperthermic clinical conditions.

Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

PubMed

Seal, S N; Davis, D L; Burch, J B

1991-05-01

The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

PubMed

Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

2010-05-15

DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells. Copyright 2010 Elsevier Inc. All rights reserved.

A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea

USDA-ARS?s Scientific Manuscript database

Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled u...

Ectopic ERK Expression Induces Phenotypic Conversion of C10 Cells and Alters DNA Methyltransferase Expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sontag, Ryan L.; Weber, Thomas J.

2012-05-04

In some model systems constitutive extracellular signal regulated kinase (ERK) activation is sufficient to promote an oncogenic phenotype. Here we investigate whether constitutive ERK expression influences phenotypic conversion in murine C10 type II alveolar epithelial cells. C10 cells were stably transduced with an ERK1-green fluorescent protein (ERK1-GFP) chimera or empty vector and ectopic ERK expression was associated with the acquisition of soft agar focus-forming potential in late passage, but not early passage cells. Late passage ERK1-GFP cells exhibited a significant increase in the expression of DNA methyl transferases (DNMT1 and 3b) and a marked increase in sensitivity to 5-azacytidine (5-azaC)-mediatedmore » toxicity, relative to early passage ERK1-GFP cells and vector controls. The expression of xeroderma pigmentosum complementation group A (XPA) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) were significantly increased in late passage cells, suggesting enhanced DNA damage recognition and repair activity which we interpret as a reflection of genomic instability. Phospho-ERK levels were dramatically decreased in late passage ERK1-GFP cells, relative to early passage and vector controls, and phospho-ERK levels were restored by treatment with sodium orthovanadate, indicating a role for phosphatase activity in this response. Collectively these observations suggest that ectopic ERK expression promotes phenotypic conversion of C10 cells that is associated with latent effects on epigenetic programming and phosphatase activities.« less

Tissue-specific expression of silkmoth chorion genes in vivo using Bombyx mori nuclear polyhedrosis virus as a transducing vector.

PubMed Central

Iatrou, K; Meidinger, R G

1990-01-01

A pair of silkmoth chorion chromosomal genes, HcA.12-HcB.12, was inserted into a baculovirus transfer vector, pBmp2, derived from the nuclear polyhedrosis virus of Bombyx mori. This vector, which permits the insertion of foreign genetic material in the vicinity of a mutationally inactivated polyhedrin gene, was used to acquire the corresponding recombinant virus. Injection of mutant silkmoth pupae that lack all Hc chorion genes with the recombinant virus resulted in the infection of all internal organs including follicular tissue. Analysis of RNA from infected tissues has demonstrated that the two chorion genes present in the viral genome are correctly transcribed under the control of their own promoter in follicular cells, the tissue in which chorion genes are normally expressed. The chorion primary transcripts are also correctly processed in the infected follicular cells and yield mature mRNAs indistinguishable from authentic chorion mRNAs present in wild-type follicles. These results demonstrate that recombinant nuclear polyhedrosis viruses can be used as transducing vectors for introducing genetic material of host origin into the cells of the organism and that the transduced genes are transiently expressed in a tissue-specific manner under the control of their resident regulatory sequences. Thus we show the in vivo expression of cloned genes under cellular promoter control in an insect other than Drosophila melanogaster. The approach should be applicable to all insect systems that are subject to nuclear polyhedrosis virus infection. Images PMID:2187186

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

PubMed Central

2013-01-01

Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector.

PubMed

Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs

2013-08-20

Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System

PubMed Central

Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M.

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health. PMID:26458221

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System.

PubMed

López-Vidal, Javier; Gómez-Sebastián, Silvia; Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health.

Assessing the potential for AAV vector genotoxicity in a murine model

PubMed Central

Li, Hojun; Malani, Nirav; Hamilton, Shari R.; Schlachterman, Alexander; Bussadori, Giulio; Edmonson, Shyrie E.; Shah, Rachel; Arruda, Valder R.; Mingozzi, Federico; Fraser Wright, J.; Bushman, Frederic D.

2011-01-01

Gene transfer using adeno-associated virus (AAV) vectors has great potential for treating human disease. Recently, questions have arisen about the safety of AAV vectors, specifically, whether integration of vector DNA in transduced cell genomes promotes tumor formation. This study addresses these questions with high-dose liver-directed AAV-mediated gene transfer in the adult mouse as a model (80 AAV-injected mice and 52 controls). After 18 months of follow-up, AAV-injected mice did not show a significantly higher rate of hepatocellular carcinoma compared with controls. Tumors in mice treated with AAV vectors did not have significantly different amounts of vector DNA compared with adjacent normal tissue. A novel high-throughput method for identifying AAV vector integration sites was developed and used to clone 1029 integrants. Integration patterns in tumor tissue and adjacent normal tissue were similar to each other, showing preferences for active genes, cytosine-phosphate-guanosine islands, and guanosine/cysteine-rich regions. Gene expression data showed that genes near integration sites did not show significant changes in expression patterns compared with genes more distal to integration sites. No integration events were identified as causing increased oncogene expression. Thus, we did not find evidence that AAV vectors cause insertional activation of oncogenes and subsequent tumor formation. PMID:21106988

Molecular design for recombinant adeno-associated virus (rAAV) vector production.

PubMed

Aponte-Ubillus, Juan Jose; Barajas, Daniel; Peltier, Joseph; Bardliving, Cameron; Shamlou, Parviz; Gold, Daniel

2018-02-01

Recombinant adeno-associated virus (rAAV) vectors are increasingly popular tools for gene therapy applications. Their non-pathogenic status, low inflammatory potential, availability of viral serotypes with different tissue tropisms, and prospective long-lasting gene expression are important attributes that make rAAVs safe and efficient therapeutic options. Over the last three decades, several groups have engineered recombinant AAV-producing platforms, yielding high titers of transducing vector particles. Current specific productivity yields from different platforms range from 10 3 to 10 5 vector genomes (vg) per cell, and there is an ongoing effort to improve vector yields in order to satisfy high product demands required for clinical trials and future commercialization.Crucial aspects of vector production include the molecular design of the rAAV-producing host cell line along with the design of AAV genes, promoters, and regulatory elements. Appropriately, configuring and balancing the expression of these elements not only contributes toward high productivity, it also improves process robustness and product quality. In this mini-review, the rational design of rAAV-producing expression systems is discussed, with special attention to molecular strategies that contribute to high-yielding, biomanufacturing-amenable rAAV production processes. Details on molecular optimization from four rAAV expression systems are covered: adenovirus, herpesvirus, and baculovirus complementation systems, as well as a recently explored yeast expression system.

Development of an Expression Vector to Overexpress or Downregulate Genes in Curvularia protuberata.

PubMed

Liu, Chengke; Cleckler, Blake; Morsy, Mustafa

2018-05-05

Curvularia protuberata , an endophytic fungus in the Ascomycota, provides plants with thermotolerance only when it carries a mycovirus known as Curvularia thermotolerance virus (CThTV), and forms a three-way symbiotic relationship among these organisms. Under heat stress, several genes are expressed differently between virus-free C. protuberata (VF) and C. protuberata carrying CThTV (AN). We developed an expression vector, pM2Z-fun, carrying a zeocin resistance gene driven by the ToxA promoter, to study gene functions in C. protuberata to better understand this three-way symbiosis. Using this new 3.7-kb vector, five genes that are differentially expressed in C. protuberata —including genes involved in the trehalose, melanin, and catalase biosynthesis pathways—were successfully overexpressed or downregulated in VF or AN C. protuberata strains, respectively. The VF overexpression lines showed higher metabolite and enzyme activity than in the control VF strain. Furthermore, downregulation of expression of the same genes in the AN strain resulted in lower metabolite and enzyme activity than in the control AN strain. The newly generated expression vector, pM2Z-fun, has been successfully used to express target genes in C. protuberata and will be useful in further functional expression studies in other Ascomycota fungi.

Recombinant adeno-associated virus targets passenger gene expression to cones in primate retina

NASA Astrophysics Data System (ADS)

Mancuso, Katherine; Hendrickson, Anita E.; Connor, Thomas B., Jr.; Mauck, Matthew C.; Kinsella, James J.; Hauswirth, William W.; Neitz, Jay; Neitz, Maureen

2007-05-01

Recombinant adeno-associated virus (rAAV) is a promising vector for gene therapy of photoreceptor-based diseases. Previous studies have demonstrated that rAAV serotypes 2 and 5 can transduce both rod and cone photoreceptors in rodents and dogs, and it can target rods, but not cones in primates. Here we report that using a human cone-specific enhancer and promoter to regulate expression of a green fluorescent protein (GFP) reporter gene in an rAAV-5 vector successfully targeted expression of the reporter gene to primate cones, and the time course of GFP expression was able to be monitored in a living animal using the RetCam II digital imaging system.

The myeloid-binding peptide adenoviral vector enables multi-organ vascular endothelial gene targeting.

PubMed

Lu, Zhi Hong; Kaliberov, Sergey; Zhang, Jingzhu; Muz, Barbara; Azab, Abdel K; Sohn, Rebecca E; Kaliberova, Lyudmila; Du, Yingqiu; Curiel, David T; Arbeit, Jeffrey M

2014-08-01

Vascular endothelial cells (ECs) are ideal gene therapy targets as they provide widespread tissue access and are the first contact surfaces following intravenous vector administration. Human recombinant adenovirus serotype 5 (Ad5) is the most frequently used gene transfer system because of its appreciable transgene payload capacity and lack of somatic mutation risk. However, standard Ad5 vectors predominantly transduce liver but not the vasculature following intravenous administration. We recently developed an Ad5 vector with a myeloid cell-binding peptide (MBP) incorporated into the knob-deleted, T4 fibritin chimeric fiber (Ad.MBP). This vector was shown to transduce pulmonary ECs presumably via a vector handoff mechanism. Here we tested the body-wide tropism of the Ad.MBP vector, its myeloid cell necessity, and vector-EC expression dose response. Using comprehensive multi-organ co-immunofluorescence analysis, we discovered that Ad.MBP produced widespread EC transduction in the lung, heart, kidney, skeletal muscle, pancreas, small bowel, and brain. Surprisingly, Ad.MBP retained hepatocyte tropism albeit at a reduced frequency compared with the standard Ad5. While binding specifically to myeloid cells ex vivo, multi-organ Ad.MBP expression was not dependent on circulating monocytes or macrophages. Ad.MBP dose de-escalation maintained full lung-targeting capacity but drastically reduced transgene expression in other organs. Swapping the EC-specific ROBO4 for the CMV promoter/enhancer abrogated hepatocyte expression but also reduced gene expression in other organs. Collectively, our multilevel targeting strategy could enable therapeutic biological production in previously inaccessible organs that pertain to the most debilitating or lethal human diseases.

Preclinical evaluation of transcriptional targeting strategies for carcinoma of the breast in a tissue slice model system

PubMed Central

Stoff-Khalili, Mariam A; Stoff, Alexander; Rivera, Angel A; Banerjee, Nilam S; Everts, Maaike; Young, Scott; Siegal, Gene P; Richter, Dirk F; Wang, Minghui; Dall, Peter; Mathis, J Michael; Zhu, Zeng B; Curiel, David T

2005-01-01

Introduction In view of the limited success of available treatment modalities for metastatic breast cancer, alternative and complementary strategies need to be developed. Adenoviral vector mediated strategies for breast cancer gene therapy and virotherapy are a promising novel therapeutic platform for the treatment of breast cancer. However, the promiscuous tropism of adenoviruses (Ads) is a major concern. Employing tissue specific promoters (TSPs) to restrict transgene expression or viral replication is an effective way to increase specificity towards tumor tissues and to reduce adverse effects in non-target tissues such as the liver. In this regard, candidate breast cancer TSPs include promoters of the genes for the epithelial glycoprotein 2 (EGP-2), cyclooxygenase-2 (Cox-2), α-chemokine SDF-1 receptor (stromal-cell-derived factor, CXCR4), secretory leukoprotease inhibitor (SLPI) and survivin. Methods We employed E1-deleted Ads that express the reporter gene luciferase under the control of the promoters of interest. We evaluated this class of vectors in various established breast cancer cell lines, primary breast cancer cells and finally in the most stringent preclinical available substrate system, constituted by precision cut tissue slices of human breast cancer and liver. Results Overall, the CXCR4 promoter exhibited the highest luciferase activity in breast cancer cell lines, primary breast cancer cells and breast cancer tissue slices. Importantly, the CXCR4 promoter displayed a very low activity in human primary fibroblasts and human liver tissue slices. Interestingly, gene expression profiles correlated with the promoter activities both in breast cancer cell lines and primary breast cancer cells. Conclusion These data suggest that the CXCR4 promoter has an ideal 'breast cancer-on/liver-off' profile, and could, therefore, be a powerful tool in Ad vector based gene therapy or virotherapy of the carcinoma of the breast. PMID:16457694

[Zinc-dependent metalloprotease 1 promotes apoptosis of RAW264.7 macrophages].

PubMed

Li, Peng; He, Yonglin; Zhang, Jiming; Fang, Chencheng

2015-12-01

To construct the eukaryotic expression vector of zinc-dependent metalloprotease 1 (zmp1) gene from Bacillus Calmette-Guerin (BCG) and investigate its impact on the apoptosis of RAW264.7 macrophages. Zmp1 gene was amplified from the genome of BCG by PCR. The zmp1 gene fragment was inserted into multiple cloning sites of pEGFP-N1 to construct the eukaryotic expression vector pEGFP-N1-zmp1. The constructed pEGFP-N1-zmp1 was transfected into RAW264.7 cells by Lipofectamine(TM) 2000. The expression of green fluorescent protein (GFP) was observed by fluorescence microscopy. The zmp1 mRNA was detected by quantitative real-time PCR (qR-PCR). The effect of Zmp1 protein on the apoptosis of RAW264.7 macrophages was detected by flow cytometry (FCM). With zmp1 gene amplified by PCR, we successfully constructed the recombinant vector pEGFP-N1-zmp1 as demonstrated by restriction enzyme analysis and sequencing. GFP was seen in RAW264.7 cells 24 hours after transfected with the recombinant plasmid. As qRT-PCR showed, the expression level of zmp1 mRNA was up-regulated. The early apoptotic rate increased 48 hours after transfection. The increased expression of Zmp1 in RAW264.7 cells promotes the apoptosis of RAW264.7 cells.

Cloning and characterization of a tuberous root-specific promoter from cassava (Manihot esculenta Crantz).

PubMed

Koehorst-van Putten, Herma J J; Wolters, Anne-Marie A; Pereira-Bertram, Isolde M; van den Berg, Hans H J; van der Krol, Alexander R; Visser, Richard G F

2012-12-01

In order to obtain a tuberous root-specific promoter to be used in the transformation of cassava, a 1,728 bp sequence containing the cassava granule-bound starch synthase (GBSSI) promoter was isolated. The sequence proved to contain light- and sugar-responsive cis elements. Part of this sequence (1,167 bp) was cloned into binary vectors to drive expression of the firefly luciferase gene. Cassava cultivar Adira 4 was transformed with this construct or a control construct in which the luciferase gene was cloned behind the 35S promoter. Luciferase activity was measured in leaves, stems, roots and tuberous roots. As expected, the 35S promoter induced luciferase activity in all organs at similar levels, whereas the GBSSI promoter showed very low expression in leaves, stems and roots, but very high expression in tuberous roots. These results show that the cassava GBSSI promoter is an excellent candidate to achieve tuberous root-specific expression in cassava.

Preclinical Demonstration of Lentiviral Vector-mediated Correction of Immunological and Metabolic Abnormalities in Models of Adenosine Deaminase Deficiency

PubMed Central

Carbonaro, Denise A; Zhang, Lin; Jin, Xiangyang; Montiel-Equihua, Claudia; Geiger, Sabine; Carmo, Marlene; Cooper, Aaron; Fairbanks, Lynette; Kaufman, Michael L; Sebire, Neil J; Hollis, Roger P; Blundell, Michael P; Senadheera, Shantha; Fu, Pei-Yu; Sahaghian, Arineh; Chan, Rebecca Y; Wang, Xiaoyan; Cornetta, Kenneth; Thrasher, Adrian J; Kohn, Donald B; Gaspar, H Bobby

2014-01-01

Gene transfer into autologous hematopoietic stem cells by γ-retroviral vectors (gRV) is an effective treatment for adenosine deaminase (ADA)–deficient severe combined immunodeficiency (SCID). However, current gRV have significant potential for insertional mutagenesis as reported in clinical trials for other primary immunodeficiencies. To improve the efficacy and safety of ADA-SCID gene therapy (GT), we generated a self-inactivating lentiviral vector (LV) with a codon-optimized human cADA gene under the control of the short form elongation factor-1α promoter (LV EFS ADA). In ADA−/− mice, LV EFS ADA displayed high-efficiency gene transfer and sufficient ADA expression to rescue ADA−/− mice from their lethal phenotype with good thymic and peripheral T- and B-cell reconstitution. Human ADA-deficient CD34+ cells transduced with 1–5 × 107 TU/ml had 1–3 vector copies/cell and expressed 1–2x of normal endogenous levels of ADA, as assayed in vitro and by transplantation into immune-deficient mice. Importantly, in vitro immortalization assays demonstrated that LV EFS ADA had significantly less transformation potential compared to gRV vectors, and vector integration-site analysis by nrLAM-PCR of transduced human cells grown in immune-deficient mice showed no evidence of clonal skewing. These data demonstrated that the LV EFS ADA vector can effectively transfer the human ADA cDNA and promote immune and metabolic recovery, while reducing the potential for vector-mediated insertional mutagenesis. PMID:24256635

TGF-beta1 expression in EL4 lymphoma cells overexpressing growth hormone.

PubMed

Farmer, John T; Weigent, Douglas A

2006-03-01

Our previous studies show that growth hormone overexpression (GHo) upregulates the expression of the IGF-1R and IGF-2R resulting in the protection of the EL4 lymphoma cell line from apoptosis. In this study, we report that GHo also increases TGF-beta1 protein expression measured by luciferase promoter assay, Western analysis, and ELISA. Further, the data show that antibody to TGF-betaR2 decreases TGF-beta1 promoter activity to the level of vector alone control cells. GHo cells treated with (125)I-rh-latent TGF-beta1 showed increased activation of latent TGF-beta1 as measured by an increase in the active 24kDa, TGF-beta1 compared to vector alone control cells. The ability of endogenous GH to increase TGF-beta1 expression is blocked in EL4 cells by antisense but not sense oligodeoxynucleotides or in cells cultured with antibody to growth hormone (GH). The data suggest that endogenous GH may protect from apoptosis through the IGF-1R receptor while limiting cellular growth through increased expression and activation of TGF-beta1.

MicroRNA Silencing Improves the Tumor Specificity of Adenoviral Transgene Expression

PubMed Central

Card, Paul B.; Hogg, Richard T.; del Alcazar, Carlos Gil

2012-01-01

Adenoviral technology has been thoroughly evaluated for delivering genetic material to tumor tissue and the surrounding microenvironment. Almost any gene can be cloned into an adenovirus (Ad) vector, which when combined with strong, constitutively active promoters permit up to a million-fold amplification of the transgene in a single adenoviral particle, thus facilitating their use in cancer therapy and imaging. However, widespread infection of the liver and other non-targeted tissues by Ad vectors is a substantial problem that often results in significant liver inflammation and hepatotoxicity at doses required to achieve efficient tumor transduction. miR-122 is a highly expressed liver-specific microRNA that provides a unique opportunity for down-regulating adenoviral transgene expression in liver tissue. The binding of endogenous miRNAs to complementary miRNA targeting elements (miRTs) incorporated into the 3′ untranslated region of adenoviral transgenes interferes with message stability and/or protein translation, and miRT elements against miR-122 (miRT-122) can selectively reduce adenoviral transgene expression in the liver. Previous studies using miR-122-based regulation, with and without other types of transcriptional targeting, have yielded promising preliminary results. However, investigations to date evaluating miRT-122 elements for improving tumor specificity have used either non-tumor bearing animals or direct intratumoral injection as the mode of delivery. In the present study, we confirmed the ability of miRT-122 sequences to selectively down-regulate adenoviral luciferase expression in the liver in vitro and in vivo, and show that this strategy can improve tumor specific transgene expression in a HT1080 human fibrosarcoma model. Rapid growth and the inefficient flow of blood through tumor neovasculature often results in profound hypoxia, which provides additional opportunities for targeting solid tumors and their microenvironment using vectors incorporating hypoxia-responsive promoters to drive transgene expression. We therefore employed a combinatorial approach using miRT-122 elements with hypoxia-responsive transcriptional targeting to further improve the tumor specific expression of an adenoviral reporter gene. Results from this investigation reveal that miRT122 elements alone decrease off-target liver expression and improve tumor specificity of adenoviral vectors. Furthermore, increased tumor specificity can be achieved by combining miRT-122 elements with hypoxia-responsive promoters. PMID:22555510

A Dual Luciferase Reporter System for B. burgdorferi Measures Transcriptional Activity during Tick-Pathogen Interactions

PubMed Central

Adams, Philip P.; Flores Avile, Carlos; Jewett, Mollie W.

2017-01-01

Knowledge of the transcriptional responses of vector-borne pathogens at the vector-pathogen interface is critical for understanding disease transmission. Borrelia (Borreliella) burgdorferi, the causative agent of Lyme disease in the United States, is transmitted by the bite of infected Ixodes sp. ticks. It is known that B. burgdorferi has altered patterns of gene expression during tick acquisition, persistence and transmission. Recently, we and others have discovered in vitro expression of RNAs found internal, overlapping, and antisense to annotated open reading frames in the B. burgdorferi genome. However, there is a lack of molecular genetic tools for B. burgdorferi for quantitative, strand-specific, comparative analysis of these transcripts in distinct environments such as the arthropod vector. To address this need, we have developed a dual luciferase reporter system to quantify B. burgdorferi promoter activities in a strand-specific manner. We demonstrate that constitutive expression of a B. burgdorferi codon-optimized Renilla reniformis luciferase gene (rlucBb) allows normalization of the activity of a promoter of interest when fused to the B. burgdorferi codon-optimized Photinus pyralis luciferase gene (flucBb) on the same plasmid. Using the well characterized, differentially regulated, promoters for flagellin (flaBp), outer surface protein A (ospAp) and outer surface protein C (ospCp), we document the efficacy of the dual luciferase system for quantitation of promoter activities during in vitro growth and in infected ticks. Cumulatively, the dual luciferase method outlined herein is the first dual reporter system for B. burgdorferi, providing a novel and highly versatile approach for strand-specific molecular genetic analyses. PMID:28620587

A Dual Luciferase Reporter System for B. burgdorferi Measures Transcriptional Activity during Tick-Pathogen Interactions.

PubMed

Adams, Philip P; Flores Avile, Carlos; Jewett, Mollie W

2017-01-01

Knowledge of the transcriptional responses of vector-borne pathogens at the vector-pathogen interface is critical for understanding disease transmission. Borrelia ( Borreliella ) burgdorferi , the causative agent of Lyme disease in the United States, is transmitted by the bite of infected Ixodes sp . ticks. It is known that B. burgdorferi has altered patterns of gene expression during tick acquisition, persistence and transmission. Recently, we and others have discovered in vitro expression of RNAs found internal, overlapping, and antisense to annotated open reading frames in the B. burgdorferi genome. However, there is a lack of molecular genetic tools for B. burgdorferi for quantitative, strand-specific, comparative analysis of these transcripts in distinct environments such as the arthropod vector. To address this need, we have developed a dual luciferase reporter system to quantify B. burgdorferi promoter activities in a strand-specific manner. We demonstrate that constitutive expression of a B. burgdorferi codon-optimized Renilla reniformis luciferase gene ( rluc Bb ) allows normalization of the activity of a promoter of interest when fused to the B. burgdorferi codon-optimized Photinus pyralis luciferase gene ( fluc Bb ) on the same plasmid. Using the well characterized, differentially regulated, promoters for flagellin ( flaBp ), outer surface protein A ( ospAp ) and outer surface protein C ( ospCp ), we document the efficacy of the dual luciferase system for quantitation of promoter activities during in vitro growth and in infected ticks. Cumulatively, the dual luciferase method outlined herein is the first dual reporter system for B. burgdorferi , providing a novel and highly versatile approach for strand-specific molecular genetic analyses.

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression.

PubMed

Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John

2010-06-20

We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.

Genome-wide computational analysis reveals cardiomyocyte-specific transcriptional Cis-regulatory motifs that enable efficient cardiac gene therapy.

PubMed

Rincon, Melvin Y; Sarcar, Shilpita; Danso-Abeam, Dina; Keyaerts, Marleen; Matrai, Janka; Samara-Kuko, Ermira; Acosta-Sanchez, Abel; Athanasopoulos, Takis; Dickson, George; Lahoutte, Tony; De Bleser, Pieter; VandenDriessche, Thierry; Chuah, Marinee K

2015-01-01

Gene therapy is a promising emerging therapeutic modality for the treatment of cardiovascular diseases and hereditary diseases that afflict the heart. Hence, there is a need to develop robust cardiac-specific expression modules that allow for stable expression of the gene of interest in cardiomyocytes. We therefore explored a new approach based on a genome-wide bioinformatics strategy that revealed novel cardiac-specific cis-acting regulatory modules (CS-CRMs). These transcriptional modules contained evolutionary-conserved clusters of putative transcription factor binding sites that correspond to a "molecular signature" associated with robust gene expression in the heart. We then validated these CS-CRMs in vivo using an adeno-associated viral vector serotype 9 that drives a reporter gene from a quintessential cardiac-specific α-myosin heavy chain promoter. Most de novo designed CS-CRMs resulted in a >10-fold increase in cardiac gene expression. The most robust CRMs enhanced cardiac-specific transcription 70- to 100-fold. Expression was sustained and restricted to cardiomyocytes. We then combined the most potent CS-CRM4 with a synthetic heart and muscle-specific promoter (SPc5-12) and obtained a significant 20-fold increase in cardiac gene expression compared to the cytomegalovirus promoter. This study underscores the potential of rational vector design to improve the robustness of cardiac gene therapy.

Visualizing the activity of Escherichia coli divergent promoters and probing their dependence on superhelical density using dual-colour fluorescent reporter vector

PubMed Central

Masulis, Irina S.; Babaeva, Zaira Sh.; Chernyshov, Sergey V.; Ozoline, Olga N.

2015-01-01

Mosaic pattern of transcription in alternating directions is a common feature of prokaryotic and eukaryotic genomes which rationality and origin remain enigmatic. In Escherichia coli approximately 25% of genes comprise pairs of topologically linked divergently transcribed units. Given that transcriptional complex formation at each promoter in the pair induces topological changes and is itself sensitive to DNA structural perturbations, study of the functional anatomy in such areas requires special approaches. Here we suggested the dual-colour promoter probe vector which may become an ideal tool for divergent transcription profiling. The vector was used to characterize the specific genomic region nearby appY with multiple bidirectional promoters predicted in silico. Only three promoters of this region were shown to be engaged in the transcription initiation resulting in the expression of reporter genes. RNA product transcribed in antisense direction is suggested as a novel RNA. Nalidixin-induced topological modulation differentially affected transcription in sense and antisense directions thus exemplifying anticooperative mode in the response to topological alterations. PMID:26081797

Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

PubMed

Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

2016-05-01

On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

Generation of mammalian cells stably expressing multiple genes at predetermined levels.

PubMed

Liu, X; Constantinescu, S N; Sun, Y; Bogan, J S; Hirsch, D; Weinberg, R A; Lodish, H F

2000-04-10

Expression of cloned genes at desired levels in cultured mammalian cells is essential for studying protein function. Controlled levels of expression have been difficult to achieve, especially for cell lines with low transfection efficiency or when expression of multiple genes is required. An internal ribosomal entry site (IRES) has been incorporated into many types of expression vectors to allow simultaneous expression of two genes. However, there has been no systematic quantitative analysis of expression levels in individual cells of genes linked by an IRES, and thus the broad use of these vectors in functional analysis has been limited. We constructed a set of retroviral expression vectors containing an IRES followed by a quantitative selectable marker such as green fluorescent protein (GFP) or truncated cell surface proteins CD2 or CD4. The gene of interest is placed in a multiple cloning site 5' of the IRES sequence under the control of the retroviral long terminal repeat (LTR) promoter. These vectors exploit the approximately 100-fold differences in levels of expression of a retrovirus vector depending on its site of insertion in the host chromosome. We show that the level of expression of the gene downstream of the IRES and the expression level and functional activity of the gene cloned upstream of the IRES are highly correlated in stably infected target cells. This feature makes our vectors extremely useful for the rapid generation of stably transfected cell populations or clonal cell lines expressing specific amounts of a desired protein simply by fluorescent activated cell sorting (FACS) based on the level of expression of the gene downstream of the IRES. We show how these vectors can be used to generate cells expressing high levels of the erythropoietin receptor (EpoR) or a dominant negative Smad3 protein and to generate cells expressing two different cloned proteins, Ski and Smad4. Correlation of a biologic effect with the level of expression of the protein downstream of the IRES provides strong evidence for the function of the protein placed upstream of the IRES.

Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2008-01-01

Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing

PubMed Central

de Solis, Christopher A.; Ho, Anthony; Holehonnur, Roopashri; Ploski, Jonathan E.

2016-01-01

The RNA-guided Cas9 nuclease, from the type II prokaryotic Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) adaptive immune system, has been adapted and utilized by scientists to edit the genomes of eukaryotic cells. Here, we report the development of a viral mediated CRISPR/Cas9 system that can be rendered inducible utilizing doxycycline (Dox) and can be delivered to cells in vitro and in vivo utilizing adeno-associated virus (AAV). Specifically, we developed an inducible gRNA (gRNAi) AAV vector that is designed to express the gRNA from a H1/TO promoter. This AAV vector is also designed to express the Tet repressor (TetR) to regulate the expression of the gRNAi in a Dox dependent manner. We show that H1/TO promoters of varying length and a U6/TO promoter can edit DNA with similar efficiency in vitro, in a Dox dependent manner. We also demonstrate that our inducible gRNAi vector can be used to edit the genomes of neurons in vivo within the mouse brain in a Dox dependent manner. Genome editing can be induced in vivo with this system by supplying animals Dox containing food for as little as 1 day. This system might be cross compatible with many existing S. pyogenes Cas9 systems (i.e., Cas9 mouse, CRISPRi, etc.), and therefore it likely can be used to render these systems inducible as well. PMID:27587996

Gene therapy using retrovirus vectors: vector development and biosafety at clinical trials.

PubMed

Doi, Knayo; Takeuchi, Yasuhiro

2015-01-01

Retrovirus vectors (gammaretroviral and lentiviral vectors) have been considered as promising tools to transfer therapeutic genes into patient cells because they can permanently integrate into host cellular genome. To treat monogenic, inherited diseases, retroviral vectors have been used to add correct genes into patient cells. Conventional gammaretroviral vectors achieved successful results in clinical trials: treated patients had therapeutic gene expression in target cells and had improved symptoms of diseases. However, serious side-effects of leukemia occurred, caused by retroviral insertional mutagenesis (IM). These incidences stressed the importance of monitoring vector integration sites in patient cells as well as of re-consideration on safer vectors. More recently lentiviral vectors which can deliver genes into non-dividing cells started to be used in clinical trials including neurological disorders, showing their efficacy. Vector integration site analysis revealed that lentiviruses integrate less likely to near promoter regions of oncogenes than gammaretroviruses and no adverse events have been reported in lentiviral vector-mediated gene therapy clinical trials. Therefore lentiviral vectors have promises to be applied to a wide range of common diseases in near future. For example, T cells from cancer patients were transduced to express chimeric T cell receptors recognizing their tumour cells enhancing patients' anti-cancer immunity.

Alpharetroviral Vector-mediated Gene Therapy for X-CGD: Functional Correction and Lack of Aberrant Splicing

PubMed Central

Kaufmann, Kerstin B.; Brendel, Christian; Suerth, Julia D.; Mueller-Kuller, Uta; Chen-Wichmann, Linping; Schwäble, Joachim; Pahujani, Shweta; Kunkel, Hana; Schambach, Axel; Baum, Christopher; Grez, Manuel

2013-01-01

Comparative integrome analysis has revealed that the most neutral integration pattern among retroviruses is attributed to alpharetroviruses. We chose X-linked chronic granulomatous disease (X-CGD) as model to evaluate the potential of self-inactivating (SIN) alpharetroviral vectors for gene therapy of monogenic diseases. Therefore, we combined the alpharetroviral vector backbone with the elongation factor-1α short promoter, both considered to possess a low genotoxic profile, to drive transgene (gp91phox) expression. Following efficient transduction transgene expression was sustained and provided functional correction of the CGD phenotype in a cell line model at low vector copy number. Further analysis in a murine X-CGD transplantation model revealed gene-marking of bone marrow cells and oxidase positive granulocytes in peripheral blood. Transduction of human X-CGD CD34+ cells provided functional correction up to wild-type levels and long-term expression upon transplantation into a humanized mouse model. In contrast to lentiviral vectors, no aberrantly spliced transcripts containing cellular exons fused to alpharetroviral sequences were found in transduced cells, implying that the safety profile of alpharetroviral vectors may extend beyond their neutral integration profile. Taken together, this highlights the potential of this SIN alpharetroviral system as a platform for new candidate vectors for future gene therapy of hematopoietic disorders. PMID:23207695

A Molecular Toolbox for Rapid Generation of Viral Vectors to Up- or Down-Regulate Neuronal Gene Expression in vivo

PubMed Central

White, Melanie D.; Milne, Ruth V. J.; Nolan, Matthew F.

2011-01-01

We introduce a molecular toolbox for manipulation of neuronal gene expression in vivo. The toolbox includes promoters, ion channels, optogenetic tools, fluorescent proteins, and intronic artificial microRNAs. The components are easily assembled into adeno-associated virus (AAV) or lentivirus vectors using recombination cloning. We demonstrate assembly of toolbox components into lentivirus and AAV vectors and use these vectors for in vivo expression of inwardly rectifying potassium channels (Kir2.1, Kir3.1, and Kir3.2) and an artificial microRNA targeted against the ion channel HCN1 (HCN1 miRNA). We show that AAV assembled to express HCN1 miRNA produces efficacious and specific in vivo knockdown of HCN1 channels. Comparison of in vivo viral transduction using HCN1 miRNA with mice containing a germ line deletion of HCN1 reveals similar physiological phenotypes in cerebellar Purkinje cells. The easy assembly and re-usability of the toolbox components, together with the ability to up- or down-regulate neuronal gene expression in vivo, may be useful for applications in many areas of neuroscience. PMID:21772812

[Construction and expression analysis of the zebrafish heart-specific transgenetic vector based on Tol2 transposable element].

PubMed

Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun

2010-02-01

In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.

Anaerobically controlled expression system derived from the arcDABC operon of Pseudomonas aeruginosa: application to lipase production.

PubMed Central

Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D

1996-01-01

The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231

SUMO-Specific Cysteine Protease 1 Promotes Epithelial Mesenchymal Transition of Prostate Cancer Cells via Regulating SMAD4 deSUMOylation.

PubMed

Zhang, Xiaoyan; Wang, Hao; Wang, Hua; Xiao, Fengjun; Seth, Prem; Xu, Weidong; Jia, Qinghua; Wu, Chutse; Yang, Yuefeng; Wang, Lisheng

2017-04-12

In advanced prostate cancer, small ubiquitin-like modifier (SUMO)-specific cysteine protease 1 (SENP1) is up-regulated. However, the role of SENP1 in regulating deSUMOylation of TGF-β/SMADs signaling is unknown. In this study, we developed a lentiviral vector, PLKO.1-shSENP1, to silence SENP1 in prostate cancer cells with high metastatic characteristics (PC3M). Likewise, we also created an adenovirus vector, Ad5/F11p-SENP1 to over-express SENP1 in prostate cancer cells with low metastatic potential (LNCaP). We showed that silencing of SENP1 promoted cellular apoptosis, and inhibited proliferation and migration of PC3M cells. Moreover, SENP1 silencing increased the SMAD4 expression at protein level, up-regulated E-cadherin and down-regulated Vimentin expression, indicating the inhibition of epithelial mesenchymal transition (EMT). Furthermore, SMAD4 interference abolished SENP1-mediated up-regulation of E-cadherin, suggesting that SENP1 regulated E-cadherin expression via SMAD4. SENP1 over-expression in LNCaP cells reduced SMAD4 protein, and promoted EMT via decreasing E-cadherin and increasing Vimentin. Moreover, down-regulation of SMAD4 and E-cadherin were blocked, after transfection with two SUMOylation sites mutated SMAD4, suggesting that SENP1 might reduce SMAD4 levels to regulate E-cadherin expression via deSUMOylation of SMAD4. In conclusion, SENP1 deSUMOylated SMAD4 to promote EMT via up-regulating E-cadherin in prostate cancer cells. Therefore, SENP1 is a potential target for treatment of advanced prostate cancer.

[Cloning and expression of Micrococcus luteus IAM 14879 Rpf and its role in the recovery of the VBNC state in Rhodococcus sp. DS471].

PubMed

Ding, Linxian; Zhang, Pinghua; Hong, Huachang; Lin, Hongjun; Yokota, Akira

2012-01-01

The purpose of the present study was to produce the Rpf (resuscitation promoting factor) protein by cloning and expressing the rpf gene, secreted by Micrococcus luteus IAM 14879, in Escherichia coli and to evaluate its role in the recovery of the VBNC (viable but non-culturable) state in high-GC Gram-positive bacteria. Genomic DNA was extracted from Micrococcus luteus IAM 14879 and the rpf gene was amplified by PCR using specific primers. The PCR products was purified, cloned into a pET15b expression vector, and transformed into Escherichia coli BL21 (DE3). Then the pET15b plasmid expression vector was used to confirm the purification of the recombinant proteins via SDS-PAGE. The VBNC state cells from the high-GC Gram-positive bacteria, Rhodococcus sp. DS471, were used to confirm the promotion and recovery of growth capacity. Rhodococcus sp. DS471 were isolated from soil and closely related to Micrococcus luteus IAM 14879. The gene sequences confirmed that the rpf gene from Micrococcus luteus IAM 14879 that was expressed in Escherichia coli, was 672 bp. SDS-PAGE analysis showed that the recombinant Rpf protein was obtained successfully, and further studies showed it capable of promoting the recovery of the VBNC state by about 100-fold relative to the control. Rpf of Micrococus luteus IAM 14879 can be successfully cloned and expressed in Escherichia coli and shows a strong ability to promote the recovery of the VBNC state of cells of Rhodococcus sp. DS471.

A synthetic promoter library for constitutive gene expression in Lactobacillus plantarum.

PubMed

Rud, Ida; Jensen, Peter Ruhdal; Naterstad, Kristine; Axelsson, Lars

2006-04-01

A synthetic promoter library (SPL) for Lactobacillus plantarum has been developed, which generalizes the approach for obtaining synthetic promoters. The consensus sequence, derived from rRNA promoters extracted from the L. plantarum WCFS1 genome, was kept constant, and the non-consensus sequences were randomized. Construction of the SPL was performed in a vector (pSIP409) previously developed for high-level, inducible gene expression in L. plantarum and Lactobacillus sakei. A wide range of promoter strengths was obtained with the approach, covering 3-4 logs of expression levels in small increments of activity. The SPL was evaluated for the ability to drive beta-glucuronidase (GusA) and aminopeptidase N (PepN) expression. Protein production from the synthetic promoters was constitutive, and the most potent promoters gave high protein production with levels comparable to those of native rRNA promoters, and production of PepN protein corresponding to approximately 10-15 % of the total cellular protein. High correlation was obtained between the activities of promoters when tested in L. sakei and L. plantarum, which indicates the potential of the SPL for other Lactobacillus species. The SPL enables fine-tuning of stable gene expression for various applications in L. plantarum.

Expression of human factor IX gene in murine plasma through lentiviral vector-infected haematopoietic stem cells.

PubMed

Chen, Haoming; Yao, Hengmei; Huang, Lu; Shen, Qi; Jia, William; Xue, Jinglun

2006-12-01

1. Haematopoietic stem cells (HSC) are an attractive target for gene therapy. Gene transfer to HSC can provide a potential cure for many inherited diseases. Moreover, recombinant lentiviral vectors can transfer genes efficiently to HSC. In the present study, we used the recombinant lentiviruses FUGW (Flip, ubiquitin promoter, GFP and WRE vector) and FUXW (Flip, ubiquitin promoter, F IX and WRE vector), which carry the enhanced green fluorescent protein (EGFP) and human factor IX (hFIX) gene, respectively, to infect HSC. 2. High titres of recombinant lentivirus were prepared from 293T cells by calcium phosphate-mediated transient cotransfection. Murine mononuclear cells (MNC) separated from murine bone marrow and HSC separated by magnetic cell sorting were cultured in vitro. Cells they were infected by the recombinant lentiviruses FUGW and FUXW. The expression of EGFP was observed under a fluorescent microscope and was analysed by fluorescence-activated cell sorting, whereas the expression of hFIX was detected by ELISA. 3. The results show that the lentiviral vectors can efficiently infect murine HSC in vitro and that transduction was more efficient following cytokine treatment with interleukin (IL)-3, IL-6 and stem cell factor. 4. Haematopoietic stem cells infected with lentivirus FUXW were transplanted into [(60)Co]-irradiated non-obese diabetic/severe combined immunodeficiency (NOD-SCID) mice. The expression of hFIX in the blood plasma of the transplanted mice reached a peak of 44.9 +/- 7.6 ng/mL on Day 7. An assay of transaminase levels and a histological study of the liver showed that there was no significant damage following HSC transplantation to mice. 5. The results of the present study suggest that transplantation of HSC results in the persistant expression of hFIX in mice, which may be useful in haemophilia B gene therapy.

[Cloning and sequence analysis of tomato fruit-specific E8 promoter from Lycopersicon esculentum (Zhongshu No.5)].

PubMed

Zhou, Xiao-hong; Chen, Xiao-guang; Zhang, Xiao-dong; Wang, Ya-nan; Li, Lin; Xi, Jia-fei; Hu, Jian-jun

2003-01-01

To obtain the gene encoding tomato fruit-specific E8 promoter therefore to prepare for exogenous gene transcription and expression in transgenic tomato fruit. The cotyledons of tomato Lycopersicon esculentum (Zhongshu No.5) were collected for extracting the genomic DNA of this plant. The fruit-specific E81.1 and E82.2 promoter DNA were then amplified by PCR, the product of which was subcloned into pGEM-T vector. After identification by restriction enzymes, the recombinant T-vectors were subjected to sequence analysis. The fragments of the promoter as amplified by PCR were of predicted length. Digestion with Xba I and Hind III /BamH I proved correct insertion of the target fragments with expected length into the recombinant T vectors. As indicated by homology analysis, the resultant tomato fruit-specific E8 promoter was highly conservative, and E82.2 promoter of Zhongshu No.5, with GenBank submission number of AF515784, proved to share 99% homology with E82.2 promoter of Zhongshu No.5 Cherry as reported by Deikman J. Tomato fruit-specific E8 promoter of Zhongshu No.5 has been successfully cloned, thus making possible the subsequent research in oral vaccine of transgenic tomato.

Development of Transcriptional Fusions to Assess Leptospira interrogans Promoter Activity

PubMed Central

Cerqueira, Gustavo M.; Souza, Natalie M.; Araújo, Eduardo R.; Barros, Aline T.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Nascimento, Ana L. T. O.

2011-01-01

Background Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. Methodology and Principal Findings A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP) were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA) and Sphingomielynase 2 (sph2) promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. Conclusions The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa. PMID:21445252

A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

PubMed

Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

2016-05-01

Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. © 2016 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Polycistronic lentiviral vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells.

PubMed

Chang, Chia-Wei; Lai, Yi-Shin; Pawlik, Kevin M; Liu, Kaimao; Sun, Chiao-Wang; Li, Chao; Schoeb, Trenton R; Townes, Tim M

2009-05-01

We report the derivation of induced pluripotent stem (iPS) cells from adult skin fibroblasts using a single, polycistronic lentiviral vector encoding the reprogramming factors Oct4, Sox2, and Klf4. Porcine teschovirus-1 2A sequences that trigger ribosome skipping were inserted between human cDNAs for these factors, and the polycistron was subcloned downstream of the elongation factor 1 alpha promoter in a self-inactivating (SIN) lentiviral vector containing a loxP site in the truncated 3' long terminal repeat (LTR). Adult skin fibroblasts from a humanized mouse model of sickle cell disease were transduced with this single lentiviral vector, and iPS cell colonies were picked within 30 days. These cells expressed endogenous Oct4, Sox2, Nanog, alkaline phosphatase, stage-specific embryonic antigen-1, and other markers of pluripotency. The iPS cells produced teratomas containing tissue derived from all three germ layers after injection into immunocompromised mice and formed high-level chimeras after injection into murine blastocysts. iPS cell lines with as few as three lentiviral insertions were obtained. Expression of Cre recombinase in these iPS cells resulted in deletion of the lentiviral vector, and sequencing of insertion sites demonstrated that remnant 291-bp SIN LTRs containing a single loxP site did not interrupt coding sequences, promoters, or known regulatory elements. These results suggest that a single, polycistronic "hit and run" vector can safely and effectively reprogram adult dermal fibroblasts into iPS cells.

GUS expression in sweet oranges (Citrus sinensis L. Osbeck) driven by three different phloem-specific promoters.

PubMed

Miyata, Luzia Yuriko; Harakava, Ricardo; Stipp, Liliane Cristina Libório; Mendes, Beatriz Madalena Januzzi; Appezzato-da-Glória, Beatriz; de Assis Alves Mourão Filho, Francisco

2012-11-01

Huanglongbing (HLB) is associated with Candidatus Liberibacter spp., endogenous, sieve tube-restricted bacteria that are transmitted by citrus psyllid insect vectors. Transgenic expression in the phloem of specific genes that might affect Ca. Liberibacter spp. growth and development may be an adequate strategy to improve citrus resistance to HLB. To study specific phloem gene expression in citrus, we developed three different binary vector constructs with expression cassettes bearing the β-glucuronidase (GUS) reporter gene (uidA) under the control of one of the three different promoters: Citrus phloem protein 2 (CsPP2), Arabidopsis thaliana phloem protein 2 (AtPP2), and Arabidopsis thaliana sucrose transporter 2 (AtSUC2). Transgenic lines of 'Hamlin', 'Pera', and 'Valencia' sweet oranges [Citrus sinensis (L.) Osbeck] were produced via Agrobacterium tumefaciens transformation. The epicotyl segments collected from in vitro germinated seedlings were used as explants. The gene nptII, which confers resistance to the antibiotic kanamycin, was used for selection. The transformation efficiency was expressed as the number of GUS-positive shoots over the total number of explants and varied from 1.54 to 6.08 % among the three cultivars and three constructs studied. Several lines of the three sweet orange cultivars analyzed using PCR and Southern blot analysis were genetically transformed with the three constructs evaluated. The histological GUS activity in the leaves indicates that the uidA gene was preferentially expressed in the phloem, which suggests that the use of the three promoters might be adequate for producing HLB-resistant transgenic sweet oranges. The results reported here conclusively demonstrate the preferential expression of GUS in the phloem driven by two heterologous and one homologous gene promoters. Key message The results reported here conclusively demonstrate the preferential expression of GUS in the phloem driven by two heterologous and one homologous gene promoters.

A Baculovirus Immediate-Early Gene, ie1, Promoter Drives Efficient Expression of a Transgene in Both Drosophila melanogaster and Bombyx mori

PubMed Central

Masumoto, Mika; Ohde, Takahiro; Shiomi, Kunihiro; Yaginuma, Toshinobu; Niimi, Teruyuki

2012-01-01

Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV) could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively); however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole) in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species. PMID:23152896

Use of rhenium-188 for in vivo imaging and treatment of human cervical cancer cells transfected with lentivirus expressing sodium iodide symporter.

PubMed

Zhang, Min; Shi, Shuo; Guo, Rui; Miao, Yin; Li, Biao

2016-10-01

Although survival rates for cervical cancer have improved, they need further improvement in patients with distant metastases. The sodium iodine symporter (NIS) gene has often been used in cancer therapy and imaging. We examined the therapeutic effects of rhenium-188 (188Re) in a cervical cancer xenograft model expressing the NIS gene under the control of the tumor-specific human telomerase reverse transcriptase (hTERT) promoter. We constructed two recombinant lentiviral vectors expressing enhanced green fluorescent protein (eGFP) or the NIS gene driven by the hTERT promoter. To determine the tumor-specific transcriptional activity of the hTERT promoter, the eGFP-expressing vector was stably transfected into tumor cells and normal cells. A cervical cancer HeLa cell line stably expressing NIS (HeLa-TERTNIS) was created and examined in a similar way. HeLa and HeLa-TERTNIS tumor xenografts were transplanted in nude mice, and in vivo 188Re distribution was measured using micro-SPECT/CT imaging. The therapeutic effects of 188Re were assessed over 21 days on the basis of tumor volume and the immunohistochemical findings of excised tumors. eGFP expression controlled by the hTERT promoter was substantially higher in the tumor cells than normal cells. Quantitative PCR and western blotting confirmed that HeLa-TERTNIS cells expressed high levels of NIS mRNA and protein, respectively. Further, 188Re uptake and accumulation were significantly higher in HeLa-TERTNIS cells and xenografts than HeLa cells and xenografts. In vitro and in vivo, 188Re significantly reduced the survival of HeLa-TERTNIS cells and inhibited the growth of HeLa-TERTNIS xenografts, respectively. Immunohistochemical staining showed that HeLa-TERTNIS xenograft tumors expressed higher levels of NIS and caspase-3 and lower levels of Ki-67 than HeLa xenograft tumors. Our findings indicated that hTERT promoter-driven expression of the NIS gene in HeLa cells led to 188Re uptake and therapeutic effects. Thus, NIS-based gene therapy and imaging using the hTERT promoter and 188Re may be possible.

A Luciferase Functional Quantitative Assay for Measuring NF-ĸB Promoter Transactivation Mediated by HTLV-1 and HTLV-2 Tax Proteins.

PubMed

Bergamo, Elisa; Diani, Erica; Bertazzoni, Umberto; Romanelli, Maria Grazia

2017-01-01

HTLV-1 and HTLV-2 viruses express Tax transactivator proteins required for viral genome transcription and capable of transforming cells in vivo and in vitro. Although Tax oncogenic potential needs to be further elucidated, it is well established that Tax proteins activate, among others, transcription factors of the NF-ĸB family, which are involved in immune and inflammatory responses, cell growth, apoptosis, stress responses and oncogenesis. Here, we describe a reporter gene assay applied for quantitative analysis of Tax-dependent NF-ĸB activation. The procedure is based on co-transfection of two individual vectors containing the cDNA for firefly and Renilla luciferase enzymes and vectors expressing Tax proteins. The luciferase expression is driven by cis-NF-ĸB promoter regulatory elements responsive to Tax transactivating factor. This assay is particularly useful to investigate Tax influence on NF-ĸB activation mediated by viral or host factors.

Expression of exogenous human hepatic nuclear factor-1α by a lentiviral vector and its interactions with Plasmodium falciparum subtilisin-like protease 2.

PubMed

Liao, Shunyao; Liu, Yunqiang; Zheng, Bing; Cho, Pyo Yun; Song, Hyun Ok; Lee, Yun-Seok; Jung, Suk-Yul; Park, Hyun

2011-12-01

The onset, severity, and ultimate outcome of malaria infection are influenced by parasite-expressed virulence factors as well as by individual host responses to these determinants. In both humans and mice, liver injury follows parasite entry, persisting to the erythrocytic stage in the case of infection with the fatal strain of Plasmodium falciparum. Hepatic nuclear factor (HNF)-1α is a master regulator of not only the liver damage and adaptive responses but also diverse metabolic functions. In this study, we analyzed the expression of host HNF-1α in relation to malaria infection and evaluated its interaction with the 5'-untranslated region of subtilisin-like protease 2 (subtilase, Sub2). Recombinant human HNF-1α expressed by a lentiviral vector (LV HNF-1α) was introduced into mice. Interestingly, differences in the activity of the 5'-untranslated region of the Pf-Sub2 promoter were detected in 293T cells, and LV HNF-1α was observed to influence promoter activity, suggesting that host HNF-1α interacts with the Sub2 gene.

Core labeling of adenovirus with EGFP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Le, Long P.; Le, Helen N.; Nelson, Amy R.

2006-08-01

The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expressionmore » vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology.« less

Optogenetic approaches to characterize the long-range synaptic pathways from the hypothalamus to brain stem autonomic nuclei

PubMed Central

Piñol, Ramón A.; Bateman, Ryan; Mendelowitz, David

2012-01-01

Recent advances in optogenetic methods demonstrate the feasibility of selective photoactivation at the soma of neurons that express channelrhodopsin-2 (ChR2), but a comprehensive evaluation of different methods to selectively evoke transmitter release from distant synapses using optogenetic approaches is needed. Here we compared different lentiviral vectors, with sub-population-specific and strong promoters, and transgenic methods to express and photostimulate ChR2 in the long-range projections of paraventricular nucleus of the hypothalamus (PVN) neurons to brain stem cardiac vagal neurons (CVNs). Using PVN subpopulation-specific promoters for vasopressin and oxytocin, we were able to depolarize the soma of these neurons upon photostimulation, but these promoters were not strong enough to drive sufficient expression for optogenetic stimulation and synaptic release from the distal axons. However, utilizing the synapsin promoter photostimulation of distal PVN axons successfully evoked glutamatergic excitatory post-synaptic currents in CVNs. Employing the Cre/loxP system, using the Sim-1 Cre-driver mouse line, we found that the Rosa-CAG-LSL-ChR2-EYFP Cre-responder mice expressed higher levels of ChR2 than the Rosa-CAG-LSL-ChR2-tdTomato line in the PVN, judged by photo-evoked currents at the soma. However, neither was able to drive sufficient expression to observe and photostimulate the long-range projections to brainstem autonomic regions. We conclude that a viral vector approach with a strong promoter is required for successful optogenetic stimulation of distal axons to evoke transmitter release in pre-autonomic PVN neurons. This approach can be very useful to study important hypothalamus-brainstem connections, and can be easily modified to selectively activate other long-range projections within the brain. PMID:22890236

A lentiviral vector with a short troponin-I promoter for tracking cardiomyocyte differentiation of human embryonic stem cells.

PubMed

Gallo, P; Grimaldi, S; Latronico, M V G; Bonci, D; Pagliuca, A; Gallo, P; Ausoni, S; Peschle, C; Condorelli, G

2008-02-01

Human embryonic stem cells (hESCs) may become important for cardiac repair due to their potentially unlimited ability to generate cardiomyocytes (CMCs). Moreover, genetic manipulation of hESC-derived CMCs would be a very promising technique for curing myocardial disorders. At the present time, however, inducing the differentiation of hESCs into CMCs is extremely difficult and, therefore, an easy and standardizable technique is needed to evaluate differentiation strategies. Vectors driving cardiac-specific expression may represent an important tool not only for monitoring new cardiac-differentiation strategies, but also for the manipulation of cardiac differentiation of ESCs. To this aim, we generated cardiac-specific lentiviral vectors (LVVs) in which expression is driven by a short fragment of the cardiac troponin-I proximal promoter (TNNI3) with a human cardiac alpha-actin enhancer, and tested its suitability in inducing tissue-specific gene expression and ability to track the CMC lineage during differentiation of ESCs. We determined that (1) TNNI3-LVVs efficiently drive cardiac-specific gene expression and mark the cardiomyogenic lineage in human and mouse ESC differentiation systems (2) the cardiac alpha-actin enhancer confers a further increase in gene-expression specificity of TNNI3-LVVs in hESCs. Although this technique may not be useful in tracking small numbers of cells, data suggested that TNNI3-based LVVs are a powerful tool for manipulating human ESCs and modifying hESC-derived CMCs.

Sustainability of keratinocyte gene transfer and cell survival in vivo.

PubMed

Choate, K A; Khavari, P A

1997-05-20

The epidermis is an attractive site for therapeutic gene delivery because it is accessible and capable of delivering polypeptides to the systemic circulation. A number of difficulties, however, have emerged in attempts at cutaneous gene delivery, and central among these is an inability to sustain therapeutic gene production. We have examined two major potential contributing factors, viral vector stamina and involvement of long-lived epidermal progenitor cells. Human keratinocytes were either untreated or transduced with a retroviral vector for beta-galactosidase (beta-Gal) at > 99% efficiency and then grafted onto immunodeficient mice to regenerate human epidermis. Human epidermis was monitored in vivo after grafting for clinical and histologic appearance as well as for gene expression. Although integrated vector sequences persisted unchanged in engineered epidermis at 10 weeks post-grafting, retroviral long terminal repeat (LTR)-driven beta-Gal expression ceased in vivo after approximately 4 weeks. Endogenous cellular promoters, however, maintained consistently normal gene expression levels without evidence of time-dependent decline, as determined by immunostaining with species-specific antibodies for human involucrin, filaggrin, keratinocyte transglutaminase, keratin 10, type VII collagen, and Laminin 5 proteins out to week 14 post-grafting. Transduced human keratinocytes generated multilayer epidermis sustained through multiple epidermal turnover cycles; this epidermis demonstrated retention of a spatially appropriate pattern of basal and suprabasal epidermal marker gene expression. These results confirm previous findings suggesting that viral promoter-driven gene expression is not durable and demonstrate that keratinocytes passaged in vitro can regenerate and sustain normal epidermis for prolonged periods.

Rev-erb beta regulates the Srebp-1c promoter and mRNA expression in skeletal muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramakrishnan, Sathiya N.; Lau, Patrick; Crowther, Lisa M.

2009-10-30

The nuclear hormone receptor, Rev-erb beta operates as a transcriptional silencer. We previously demonstrated that exogenous expression of Rev-erb{beta}{Delta}E in skeletal muscle cells increased Srebp-1c mRNA expression. We validated these in vitro observations by injection of an expression vector driving Rev-erb{beta}{Delta}E expression into mouse tibialis muscle that resulted in increased Srebp-1c mRNA expression. Paradoxically, Rev-erb{beta} siRNA expression in skeletal muscle cells repressed Srebp-1c expression, and indicated that Rev-erb{beta} expression was necessary for Srebp-1c expression. ChIP analysis demonstrated that Rev-erb{beta} was recruited to the Srebp-1c promoter. Moreover, Rev-erb{beta} trans-activated the Srebp-1c promoter, in contrast, Rev-erb{beta} efficiently repressed the Rev-erb{alpha} promoter, amore » previously characterized target gene. Finally, treatment with the Rev-erb agonist (hemin) (i) increased the trans-activation of the Srebp-1c promoter by Rev-erb{beta}; and (ii) increased Rev-erb{beta} and Srebp-1c mRNA expression. These data suggest that Rev-erb{beta} has the potential to activate gene expression, and is a positive regulator of Srebp-1c, a regulator of lipogenesis.« less

A minimal peach type II chlorophyll a/b-binding protein promoter retains tissue-specificity and light regulation in tomato

PubMed Central

Bassett, Carole L; Callahan, Ann M; Artlip, Timothy S; Scorza, Ralph; Srinivasan, Chinnathambi

2007-01-01

Background Promoters with tissue-specificity are desirable to drive expression of transgenes in crops to avoid accumulation of foreign proteins in edible tissues/organs. Several photosynthetic promoters have been shown to be strong regulators of expression of transgenes in light-responsive tissues and would be good candidates for leaf and immature fruit tissue-specificity, if expression in the mature fruit were minimized. Results A minimal peach chlorophyll a/b-binding protein gene (Lhcb2*Pp1) promoter (Cab19) was isolated and fused to an uidA (β-glucuronidase [GUS]) gene containing the PIV2 intron. A control vector carrying an enhanced mas35S CaMV promoter fused to uidA was also constructed. Two different orientations of the Cab19::GUS fusion relative to the left T-DNA border of the binary vector were transformed into tomato. Ten independent regenerants of each construct and an untransformed control line were assessed both qualitatively and quantitatively for GUS expression in leaves, fruit and flowers, and quantitatively in roots. Conclusion The minimal CAB19 promoter conferred GUS activity primarily in leaves and green fruit, as well as in response to light. GUS activity in the leaves of both Cab19 constructs averaged about 2/3 that observed with mas35S::GUS controls. Surprisingly, GUS activity in transgenic green fruit was considerably higher than leaves for all promoter constructs; however, in red, ripe fruit activities were much lower for the Cab19 promoter constructs than the mas35S::GUS. Although GUS activity was readily detectable in flowers and roots of mas35S::GUStransgenic plants, little activity was observed in plants carrying the Cab19 promoter constructs. In addition, the light-inducibility of the Cab19::GUS constructs indicated that all the requisite cis-elements for light responsiveness were contained on the Cab19 fragment. The minimal Cab19 promoter retains both tissue-specificity and light regulation and can be used to drive expression of foreign genes with minimal activity in mature, edible fruit. PMID:17697347

Selective and augmented β-glucuronidase expression combined with DOX-GA3 application elicits the potent suppression of prostate cancer.

PubMed

Wang, Longxin; Dong, Jie; Wei, Ming; Wen, Weihong; Gao, Jianping; Zhang, Zhengyu; Qin, Weijun

2016-03-01

The present study was carried out to evaluate the specific and amplified β-glucuronidase (βG) expression in prostate cancer cells by using a prostate‑specific antigen (PSA) promoter-controlled bicistronic adenovirus and to evaluate the specific killing of prostate cancer cells after the application of the prodrug DOX‑GA3. Bicistronic adenoviral expression vectors were constructed, and the effectiveness of specific and amplified expression was evaluated using luciferase and EGFP as reporter genes. βG expression was detected in LNCaP cells after they were infected with the βG‑expressing PSA promoter-controlled bicistronic adenovirus. MTT assays were conducted to evaluate the cytoxicity on the infected cells after the application of the prodrug DOX‑GA3. Tumor growth inhibition was also evaluated in nude mice after treatment with the βG‑expressing adenovirus and DOX‑GA3. Selective and amplified expression was observed in the PSA-producing LNCaP cells, but not in the PSA‑non‑producing DU145 cells. Potent cytotoxity and a strong bystander effect were observed in the LNCaP cells after infection with the βG‑expressing adenovirus and the application of DOX‑GA3. Intravenous injection of a GAL4 regulated bicistronic adenovirus vector constructed to express βG under the control of the PSA promoter (Ad/PSAP‑GV16‑βG) and the application of DOX‑GA3 strongly inhibited tumor growth and prolonged the survival time of tumor‑bearing nude mice. Selective and amplified βG expression together with the prodrug DOX‑GA3 had an increased antitumor effect, showing great potential for prostate cancer therapy.

Alphavirus replicon approach to promoterless analysis of IRES elements.

PubMed

Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

2007-04-10

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

PubMed Central

Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

2007-01-01

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis

PubMed Central

Aalbers, Caroline J.; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J. Fraser; Mingozzi, Federico; Tak, Paul P.; Vervoordeldonk, Margriet J.

2015-01-01

Introduction Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). Methods The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Results Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. Conclusions These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA. PMID:26107769

Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis.

PubMed

Aalbers, Caroline J; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J Fraser; Mingozzi, Federico; Tak, Paul P; Vervoordeldonk, Margriet J

2015-01-01

Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA.

Pancreatic Transduction by Helper-Dependent Adenoviral Vectors via Intraductal Delivery

PubMed Central

Morró, Meritxell; Teichenne, Joan; Jimenez, Veronica; Kratzer, Ramona; Marletta, Serena; Maggioni, Luca; Mallol, Cristina; Ruberte, Jesus; Kochanek, Stefan; Bosch, Fatima

2014-01-01

Abstract Pancreatic gene transfer could be useful to treat several diseases, such as diabetes mellitus, cystic fibrosis, chronic pancreatitis, or pancreatic cancer. Helper-dependent adenoviral vectors (HDAds) are promising tools for gene therapy because of their large cloning capacity, high levels of transgene expression, and long-term persistence in immunocompetent animals. Nevertheless, the ability of HDAds to transduce the pancreas in vivo has not been investigated yet. Here, we have generated HDAds carrying pancreas-specific expression cassettes, that is, driven either by the elastase or insulin promoter, using a novel and convenient plasmid family and homologous recombination in bacteria. These HDAds were delivered to the pancreas of immunocompetent mice via intrapancreatic duct injection. HDAds, encoding a CMV-GFP reporter cassette, were able to transduce acinar and islet cells, but transgene expression was lost 15 days postinjection in correlation with severe lymphocytic infiltration. When HDAds encoding GFP under the control of the specific elastase promoter were used, expression was detected in acinar cells, but similarly, the expression almost disappeared 30 days postinjection and lymphocytic infiltration was also observed. In contrast, long-term transgene expression (>8 months) was achieved with HDAds carrying the insulin promoter and the secretable alkaline phosphatase as the reporter gene. Notably, transduction of the liver, the preferred target for adenovirus, was minimal by this route of delivery. These data indicate that HDAds could be used for pancreatic gene therapy but that selection of the expression cassette is of critical importance to achieve long-term expression of the transgene in this tissue. PMID:25046147

Promotion of Flowering by Apple Latent Spherical Virus Vector and Virus Elimination at High Temperature Allow Accelerated Breeding of Apple and Pear.

PubMed

Yamagishi, Norioko; Li, Chunjiang; Yoshikawa, Nobuyuki

2016-01-01

Plant viral vectors are superior tools for genetic manipulation, allowing rapid induction or suppression of expression of a target gene in plants. This is a particularly effective technology for use in breeding fruit trees, which are difficult to manipulate using recombinant DNA technologies. We reported previously that if apple seed embryos (cotyledons) are infected with an Apple latent spherical virus (ALSV) vector (ALSV-AtFT/MdTFL1) concurrently expressing the Arabidopsis thaliana florigen (AtFT) gene and suppressing the expression of the apple MdTFL1-1 gene, the period prior to initial flowering (generally lasts 5-12 years) will be reduced to about 2 months. In this study, we examined whether or not ALSV vector technology can be used to promote flowering in pear, which undergoes a very long juvenile period (germination to flowering) similar to that of apple. The MdTFL1 sequence in ALSV-AtFT/MdTFL1 was replaced with a portion of the pear PcTFL1-1 gene. The resulting virus (ALSV-AtFT/PcTFL1) and ALSV-AtFT/MdTFL1 were used individually for inoculation to pear cotyledons immediately after germination in two inoculation groups. Those inoculated with ALSV-AtFT/MdTFL1 and ALSV-AtFT/PcTFL1 then initiated flower bud formation starting one to 3 months after inoculation, and subsequently exhibited continuous flowering and fruition by pollination. Conversely, Japanese pear exhibited extremely low systemic infection rates when inoculated with ALSV-AtFT/MdTFL1, and failed to exhibit any induction of flowering. We also developed a simple method for eliminating ALSV vectors from infected plants. An evaluation of the method for eliminating the ALSV vectors from infected apple and pear seedlings revealed that a 4-week high-temperature (37°C) incubation of ALSV-infected apples and pears disabled the movement of ALSV to new growing tissues. This demonstrates that only high-temperature treatment can easily eliminate ALSV from infected fruit trees. A method combining the promotion of flowering in apple and pear by ALSV vector with an ALSV elimination technique is expected to see future application as a new plant breeding technique that can significantly shorten the breeding periods of apple and pear.

The impact of cHS4 insulators on DNA transposon vector mobilization and silencing in retinal pigment epithelium cells.

PubMed

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5'-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells.

The Impact of cHS4 Insulators on DNA Transposon Vector Mobilization and Silencing in Retinal Pigment Epithelium Cells

PubMed Central

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O.; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5′-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells. PMID:23110238

Development of an IP-Free Biotechnology Platform for Constitutive Production of HPV16 L1 Capsid Protein Using the Pichia pastoris PGK1 Promoter.

PubMed

Mariz, F C; Coimbra, E C; Jesus, A L S; Nascimento, L M; Torres, F A G; Freitas, A C

2015-01-01

The human papillomavirus (HPV) L1 major capsid protein, which forms the basis of the currently available vaccines against cervical cancer, self-assembles into virus-like particles (VLPs) when expressed heterologously. We report the development of a biotechnology platform for HPV16 L1 protein expression based on the constitutive PGK1 promoter (PPGK1) from the methylotrophic yeast Pichia pastoris. The L1 gene was cloned under regulation of PPGK1 into pPGKΔ3 expression vector to achieve intracellular expression. In parallel, secretion of the L1 protein was obtained through the use of an alternative vector called pPGKΔ3α, in which a codon optimized α-factor signal sequence was inserted. We devised a work-flow based on the detection of the L1 protein by dot blot, colony blot, and western blot to classify the positive clones. Finally, intracellular HPV VLPs assembly was demonstrated for the first time in yeast cells. This study opens up perspectives for the establishment of an innovative platform for the production of HPV VLPs or other viral antigens for vaccination purposes, based on constitutive expression in P. pastoris.

A rapid generation of adenovirus vector with a genetic modification in hexon protein.

PubMed

Di, Bingyan; Mao, Qinwen; Zhao, Junli; Li, Xing; Wang, Dongyang; Xia, Haibin

2012-02-10

The generation of hexon-modified adenovirus vector has proven difficult. In this paper, we developed a novel method for rapid generation of hexon-modified adenoviral vector via one step ligation in vitro followed by quick white/blue color screening. The new system has the following features. First, eGFP expression driven by the CMV promoter in E1 region functions as a reporter to evaluate the tropism of hexon-modified adenovirus in vitro. Second, it has two unique restriction enzyme sites with sticky ends located in the hexon HVR5 region. Third, a lacZ expression cassette under the control of plac promoter is placed between the two restriction enzyme sites, which allows recombinants to be selected using blue/white screening. To prove the principle of the method, genetically modified adenoviruses were successfully produced by insertion of NGR, RGD or Tat PTD peptide into hexon HVR5. Furthermore, the transduction efficiency of the Tat PTD modified virus was shown to be a significant enhancement in A172 and CHO-K1 cells. In conclusion, the novel system makes the production of truly retargeted vectors more promising, which would be of substantial benefit for cancer gene therapy. Copyright © 2012 Elsevier B.V. All rights reserved.

Dual targeting of gene delivery by genetic modification of adenovirus serotype 5 fibers and cell-selective transcriptional control.

PubMed

Work, L M; Ritchie, N; Nicklin, S A; Reynolds, P N; Baker, A H

2004-08-01

Adenovirus (Ad)-mediated gene delivery is a promising approach for genetic manipulation of the vasculature and is being used in both preclinical models and clinical trials. However, safety concerns relating to infection of nontarget tissue and the poor infectivity of vascular cells compared to other cell types necessitates Ad vector refinement. Here, we combine a transductional targeting approach to improve vascular cell infectivity through RGD peptide insertion into adenovirus fibers, combined with transcriptional targeting to endothelial cells using a approximately 1 kb fragment of the fms-like tyrosine kinase receptor-1 (FLT-1) promoter. Single- and double-modified vectors were characterized in human cell lines that either support or have silenced FLT-1 expression. In rat hepatocytes and endothelial cells, the double modification substantially shifted transduction profiles toward vascular endothelial cells. Furthermore, in intact aortae derived from spontaneously hypertensive rats that display enhanced alphav integrin expression on dysfunctional endothelium, enhanced levels of transduction were observed using the double-modified vector but not in aortae derived from normotensive control rats. Our data indicate that Ad-mediated transduction can be beneficially modified in vitro and in vivo by combining fiber modification and a cell-selective promoter within a single-component vector system.

SUMO-Specific Cysteine Protease 1 Promotes Epithelial Mesenchymal Transition of Prostate Cancer Cells via Regulating SMAD4 deSUMOylation

PubMed Central

Zhang, Xiaoyan; Wang, Hao; Wang, Hua; Xiao, Fengjun; Seth, Prem; Xu, Weidong; Jia, Qinghua; Wu, Chutse; Yang, Yuefeng; Wang, Lisheng

2017-01-01

In advanced prostate cancer, small ubiquitin-like modifier (SUMO)-specific cysteine protease 1 (SENP1) is up-regulated. However, the role of SENP1 in regulating deSUMOylation of TGF-β/SMADs signaling is unknown. In this study, we developed a lentiviral vector, PLKO.1-shSENP1, to silence SENP1 in prostate cancer cells with high metastatic characteristics (PC3M). Likewise, we also created an adenovirus vector, Ad5/F11p-SENP1 to over-express SENP1 in prostate cancer cells with low metastatic potential (LNCaP). We showed that silencing of SENP1 promoted cellular apoptosis, and inhibited proliferation and migration of PC3M cells. Moreover, SENP1 silencing increased the SMAD4 expression at protein level, up-regulated E-cadherin and down-regulated Vimentin expression, indicating the inhibition of epithelial mesenchymal transition (EMT). Furthermore, SMAD4 interference abolished SENP1-mediated up-regulation of E-cadherin, suggesting that SENP1 regulated E-cadherin expression via SMAD4. SENP1 over-expression in LNCaP cells reduced SMAD4 protein, and promoted EMT via decreasing E-cadherin and increasing Vimentin. Moreover, down-regulation of SMAD4 and E-cadherin were blocked, after transfection with two SUMOylation sites mutated SMAD4, suggesting that SENP1 might reduce SMAD4 levels to regulate E-cadherin expression via deSUMOylation of SMAD4. In conclusion, SENP1 deSUMOylated SMAD4 to promote EMT via up-regulating E-cadherin in prostate cancer cells. Therefore, SENP1 is a potential target for treatment of advanced prostate cancer. PMID:28417919

Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

PubMed

Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

2016-06-21

To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

Biological and immunogenic properties of rabies virus glycoprotein expressed by canine herpesvirus vector.

PubMed

Xuan, X; Tuchiya, K; Sato, I; Nishikawa, Y; Onoderaz, Y; Takashima, Y; Yamamoto, A; Katsumata, A; Iwata, A; Ueda, S; Mikami, T; Otsuka, H

1998-01-01

In order to evaluate whether canine herpesvirus (CHV) could be used as a live vector for the expression of heterologous immunogenes, we constructed a recombinant canine herpesvirus (CHV) expressing glycoprotein (G protein) of rabies virus (RV). The gene of G protein was inserted within the thymidine kinase gene of CHV YP11mu strain under the control of the human cytomegalovirus immediate early promoter. The G protein expressed by the recombinant CHV was processed and transported to the cell surface as in RV infected cells, and showed the same biological activities such as low pH dependent cell fusion and hemadsorption. The antigenic authenticity of the recombinant G protein was confirmed by a panel of monoclonal antibodies specific for G protein. Dogs inoculated intransally with the recombinant CHV produced higher titres of virus neutralizing antibodies against RV than those inoculated with a commercial, inactivated rabies vaccine. These results suggest that the CHV recombinant expressing G protein can be used as a vaccine to control canine rabies and that CHV may be useful as a vector to develop live recombinant against other infectious diseases in dogs.

Repressor-mediated tissue-specific gene expression in plants

DOEpatents

Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

2009-02-17

Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

PubMed

Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

2017-01-01

Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

A simple and robust vector-based shRNA expression system used for RNA interference.

PubMed

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

Tissue-Specific Expression of Herpes Simplex Virus Thymidine Kinase Gene Delivered by Adeno-Associated Virus Inhibits the Growth of Human Hepatocellular Carcinoma in Athymic Mice

NASA Astrophysics Data System (ADS)

Su, Hua; Lu, Ronghua; Chang, Judy C.; Kan, Yuet Wai

1997-12-01

About 70% of hepatocellular carcinomas are known to express α -fetoprotein, which is normally expressed in fetal but not in adult livers. To induce herpes simplex virus-thymidine kinase expression in these cancer cells, we constructed an adeno-associated viral vector containing the HSV-TK gene under the control of the α -fetoprotein enhancer and albumin promoter. We previously demonstrated in vitro that although this vector can transduce a variety of human cells, only transduced AFP and albumin-expressing hepatocellular carcinoma cell lines were sensitive to killing by ganciclovir (GCV). In the present study, we explored the effect of this vector on hepatocellular carcinoma cells in vivo. Subcutaneous tumors generated in nude mice by implanting hepatocellular carcinoma cells previously transduced with this vector shrank dramatically after treatment with GCV. Bystander effect was also observed on the tumors generated by mixing transduced and untransduced cells. To test whether the tumor cells can be transduced by the virus in vivo, we injected the recombinant adeno-associated virus into tumors generated by untransduced hepatocarcinoma cell line. Tumor growth were retarded after treatment with GCV. These experiments demonstrate the feasibility of in vivo transduction of tumor cell with rAAV.

Repeat Transduction in the Mouse Lung by Using Adeno-Associated Virus Vectors with Different Serotypes

PubMed Central

Halbert, Christine L.; Rutledge, Elizabeth A.; Allen, James M.; Russell, David W.; Miller, A. Dusty

2000-01-01

Vectors derived from adeno-associated virus type 2 (AAV2) promote gene transfer and expression in the lung; however, we have found that while gene expression can persist for at least 8 months in mice, it was reduced dramatically in rabbits over a period of 2 months. The efficiency and persistence of AAV2-mediated gene expression in the human lung have yet to be determined, but it seems likely that readministration will be necessary over the lifetime of an individual. Unfortunately, we have found that transduction by a second administration of an AAV2 vector is blocked, presumably due to neutralizing antibodies generated in response to the primary vector exposure. Here, we have explored the use of AAV2 vectors pseudotyped with capsid proteins from AAV serotypes 2, 3, and 6 for readministration in the mouse lung. We found that an AAV6 vector transduced airway epithelial and alveolar cells in the lung at rates that were at least as high as those of AAV2 pseudotype vectors, while transduction rates mediated by AAV3 were much lower. AAV6 pseudotype vector transduction was unaffected by prior administration of an AAV2 or AAV3 vector, and transduction by an AAV2 pseudotype vector was unaffected by prior AAV6 vector administration, showing that cross-reactive neutralizing antibodies against AAV2 and AAV6 are not generated in mice. Interestingly, while prior administration of an AAV2 vector completely blocked transduction by a second AAV2 pseudotype vector, prior administration of an AAV6 vector only partially inhibited transduction by a second administration of an AAV6 pseudotype vector. Analysis of sera obtained from mice and humans showed that AAV6 is less immunogenic than AAV2, which helps explain this finding. These results support the development of AAV6 vectors for lung gene therapy both alone and in combination with AAV2 vectors. PMID:10627564

A modular toolset for recombination transgenesis and neurogenetic analysis of Drosophila.

PubMed

Wang, Ji-Wu; Beck, Erin S; McCabe, Brian D

2012-01-01

Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues.

Vascular smooth muscle-specific knockdown of the noncardiac form of the L-type calcium channel by microRNA-based short hairpin RNA as a potential antihypertensive therapy.

PubMed

Rhee, Sung W; Stimers, Joseph R; Wang, Wenze; Pang, Li

2009-05-01

In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (Ca(L)) current and vascular tone is increased because of increased expression of the noncardiac form of the Ca(L) (Ca(v)1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Ca(v)1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Ca(v)1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Ca(v)1.2 expression by 61% and decreased the Ca(L) current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Ca(v)1.2, it did not affect the Ca(L) expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Ca(v)1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Ca(v)1.2 siRNA without similarly affecting cardiac Ca(L) expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension.

Vascular Smooth Muscle-Specific Knockdown of the Noncardiac Form of the L-Type Calcium Channel by MicroRNA-Based Short Hairpin RNA as a Potential Antihypertensive Therapy

PubMed Central

Rhee, Sung W.; Stimers, Joseph R.; Wang, Wenze; Pang, Li

2009-01-01

In different rodent models of hypertension, vascular voltage-gated L-type calcium channel (CaL) current and vascular tone is increased because of increased expression of the noncardiac form of the CaL (Cav1.2). The objective of this study was to develop a small interfering RNA (siRNA) expression system against the noncardiac form of Cav1.2 to reduce its expression in vascular smooth muscle cells (VSMCs). siRNAs expressing plasmids and appropriate controls were constructed and first screened in human embryonic kidney (HEK) 293 cells cotransfected with a rat Cav1.2 expression vector. The most effective gene silencing was achieved with a modified mir-30a-based short hairpin RNA (shRNAmir) driven by the cytomegalovirus promoter. In A7r5 cells, a vascular smooth muscle cell line, two copies of shRNAmir driven by a chimeric VSMC-specific enhancer/promoter reduced endogenous Cav1.2 expression by 61% and decreased the CaL current carried by barium by 47%. Moreover, the chimeric vascular smooth muscle-specific enhancer/promoter displayed almost no activity in non-VSMCs (PC-12 and HEK 293). Because the proposed siRNA was designed to only target the noncardiac form of Cav1.2, it did not affect the CaL expression and function in cultured cardiomyocytes, even when driven by a stronger cytomegalovirus promoter. In conclusion, vascular Cav1.2 expression and function were effectively reduced by VSMC-specific delivery of the noncardiac form of Cav1.2 siRNA without similarly affecting cardiac CaL expression and function. When coupled with a viral vector, this molecular intervention in vivo may provide a novel long-term vascular-specific gene therapy for hypertension. PMID:19244098

Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

PubMed Central

Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

2010-01-01

Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

Mechanism of estrogen activation of c-myc oncogene expression.

PubMed

Dubik, D; Shiu, R P

1992-08-01

The estrogen receptor complex is a known trans-acting factor that regulates transcription of specific genes through an interaction with a specific estrogen-responsive cis-acting element (ERE). In previous studies we have shown that in estrogen-responsive human breast cancer cells estrogen rapidly activates c-myc expression. This activated expression occurs through enhanced transcription and does not require the synthesis of new protein intermediates; therefore, an ERE is present in the human c-myc gene regulatory region. To localize the ERE, constructs containing varying lengths of the c-myc 5'-flanking region ranging from -2327 to +25 (relative to the P1 promoter) placed adjacent to the chloramphenicol acetyl transferase reporter gene (CAT) were prepared. They were used in transient transfection studies in MCF-7 and HeLa cells co-transfected with an estrogen receptor expression vector. These studies reveal that all constructs containing the P2 promoter region exhibited estrogen-regulated CAT expression and that a 116-bp region upstream and encompassing the P2 TATA box is necessary for this activity. Analysis of this 116-bp region failed to identify a cis-acting element with sequences resembling the consensus ERE; however, co-transfection studies with mutant estrogen receptor expression vectors showed that the DNA-binding domain of the receptor is essential for estrogen-regulated CAT gene expression. We have also observed that anti-estrogen receptor complexes can weakly trans-activate from this 116-bp region but fail to do so from the ERE-containing ApoVLDLII-CAT construct. To explain these results we propose a new mechanism of estrogen trans-activation in the c-myc gene promoter.

Evaluation of agrobacterium-mediated transformation of Agaricus bisporus using a range of promoters linked to hygromycin resistance.

PubMed

Burns, C; Leach, K M; Elliott, T J; Challen, M P; Foster, G D; Bailey, A

2006-02-01

There is interest in establishing genetic modification technologies for the cultivated mushroom Agaricus bisporus, both for improved crop characteristics and for molecular pharming. For these methods to be successful, it is necessary to establish a set of transformation systems that include robust and reliable vectors for gene manipulation. In this article, we report the evaluation of a series of promoters for driving expression of the Escherichia coli hph gene encoding hygromycin phosphotransferase. This was achieved using the Aspergillus nidulans gpdA and the A. bisporus gpdII and trp2 promoters. The Coprinus cinereus beta-tubulin promoter gave contrasting results depending on the size of promoter used, with a 393-bp region being effective, whereas the longer 453-bp fragment failed to yield any hygromycin-resistant transformants. The C. cinereus trp1 and the A. bisporus lcc1 promoters both failed to yield transformants. We also show that transformation efficiency may be improved by careful selection of both appropriate Agrobacterium strains, with AGL-1 yielding more than LBA1126 and by the choice of the binary vectors used to mobilize the DNA, with pCAMBIA vectors appearing to be more efficient than either pBIN19- or pGREEN-based systems.

Elimination of both E1 and E2 from adenovirus vectors further improves prospects for in vivo human gene therapy.

PubMed Central

Gorziglia, M I; Kadan, M J; Yei, S; Lim, J; Lee, G M; Luthra, R; Trapnell, B C

1996-01-01

A novel recombinant adenovirus vector, Av3nBg, was constructed with deletions in adenovirus E1, E2a, and E3 regions and expressing a beta-galactosidase reporter gene. Av3nBg can be propagated at a high titer in a corresponding A549-derived cell line, AE1-2a, which contains the adenovirus E1 and E2a region genes inducibly expressed from separate glucocorticoid-responsive promoters. Av3nBg demonstrated gene transfer and expression comparable to that of Av1nBg, a first-generation adenovirus vector with deletions in E1 and E3. Several lines of evidence suggest that this vector is significantly more attenuated than E1 and E3 deletion vectors. Metabolic DNA labeling studies showed no detectable de novo vector DNA synthesis or accumulation, and metabolic protein labeling demonstrated no detectable de novo hexon protein synthesis for Av3nBg in naive A549 cells even at a multiplicity of infection of up to 3,000 PFU per cell. Additionally, naive A549 cells infected by Av3nBg did not accumulate infectious virions. In contrast, both Av1nBg and Av2Lu vectors showed DNA replication and hexon protein synthesis at multiplicities of infection of 500 PFU per cell. Av2Lu has a deletion in E1 and also carries a temperature-sensitive mutation in E2a. Thus, molecular characterization has demonstrated that the Av3nBg vector is improved with respect to the potential for vector DNA replication and hexon protein expression compared with both first-generation (Av1nBg) and second-generation (Av2Lu) adenoviral vectors. These observations may have important implications for potential use of adenovirus vectors in human gene therapy. PMID:8648763

Enhancer activity of Helitron in sericin-1 gene promoter from Bombyx mori.

PubMed

Huang, Ke; Li, Chun-Feng; Wu, Jie; Wei, Jun-Hong; Zou, Yong; Han, Min-Jin; Zhou, Ze-Yang

2016-06-01

Sericin is a kind of water-soluble protein expressed specifically in the middle silk gland of Bombyx mori. When the sericin-1 gene promoter was cloned and a transgenic vector was constructed to express a foreign protein, a specific Helitron, Bmhel-8, was identified in the sericin-1 gene promoter sequence in some genotypes of Bombyx mori and Bombyx mandarina. Given that the Bmhel-8 Helitron transposon was present only in some genotypes, it could be the source of allelic variation in the sericin-1 promoter. The length of the sericin-1 promoter sequence is approximately 1063 or 643 bp. The larger size of the sequence or allele is ascribed to the presence of Bmhel-8. Silkworm genotypes can be homozygous for either the shorter or larger promoter sequence or heterozygous, containing both alleles. Bmhel-8 in the sericin-1 promoter exhibits enhancer activity, as demonstrated by a dual-luciferase reporter system in BmE cell lines. Furthermore, Bmhel-8 displays enhancer activity in a sericin-1 promoter-driven gene expression system but does not regulate the tissue-specific expression of sericin-1. © 2016 Institute of Zoology, Chinese Academy of Sciences.

Isolation and functional characterization of Lycopene β-cyclase (CYC-B) promoter from Solanum habrochaites

PubMed Central

2010-01-01

Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B) promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908 to -437 bp 5' to ATG led to significant increase in the activity of GUS in the transgenic plants. Promoter deletion analysis led to the identification of a short promoter region (-436 bp to ATG) that exhibited a higher promoter strength but similar developmental expression pattern as compared with the full-length ShCYC-B promoter. Conclusion Functional characterization of the full-length ShCYC-B promoter and its deletion fragments in transient expression system in fruto as well as in stable transgenic tomato revealed that the promoter is developmentally regulated and its expression is upregulated in chromoplast-rich flowers and fruits. Our study identified a short promoter region with functional activity and developmental expression pattern similar to that of the full-length ShCYC-B promoter. This 436 bp promoter region can be used in promoter::reporter fusion molecular genetic screens to identify mutants impaired in CYC-B expression, and thus can be a valuable tool in understanding carotenoid metabolism in tomato. Moreover, this short promoter region of ShCYC-B may be useful in genetic engineering of carotenoid content and other agronomic traits in tomato fruits. PMID:20380705

Efficient construction of producer cell lines for a SIN lentiviral vector for SCID-X1 gene therapy by concatemeric array transfection

PubMed Central

Throm, Robert E.; Ouma, Annastasia A.; Zhou, Sheng; Chandrasekaran, Anantharaman; Lockey, Timothy; Greene, Michael; De Ravin, Suk See; Moayeri, Morvarid; Malech, Harry L.; Sorrentino, Brian P.

2009-01-01

Retroviral vectors containing internal promoters, chromatin insulators, and self-inactivating (SIN) long terminal repeats (LTRs) may have significantly reduced genotoxicity relative to the conventional retroviral vectors used in recent, otherwise successful clinical trials. Large-scale production of such vectors is problematic, however, as the introduction of SIN vectors into packaging cells cannot be accomplished with the traditional method of viral transduction. We have derived a set of packaging cell lines for HIV-based lentiviral vectors and developed a novel concatemeric array transfection technique for the introduction of SIN vector genomes devoid of enhancer and promoter sequences in the LTR. We used this method to derive a producer cell clone for a SIN lentiviral vector expressing green fluorescent protein, which when grown in a bioreactor generated more than 20 L of supernatant with titers above 107 transducing units (TU) per milliliter. Further refinement of our technique enabled the rapid generation of whole populations of stably transformed cells that produced similar titers. Finally, we describe the construction of an insulated, SIN lentiviral vector encoding the human interleukin 2 receptor common γ chain (IL2RG) gene and the efficient derivation of cloned producer cells that generate supernatants with titers greater than 5 × 107 TU/mL and that are suitable for use in a clinical trial for X-linked severe combined immunodeficiency (SCID-X1). PMID:19286997

Double promoter expression systems for recombinant protein production by industrial microorganisms.

PubMed

Öztürk, Sibel; Ergün, Burcu Gündüz; Çalık, Pınar

2017-10-01

Using double promoter expression systems is a promising approach to increase heterologous protein production. In this review, current double promoter expression systems for the production of recombinant proteins (r-proteins) by industrially important bacteria, Bacillus subtilis and Escherichia coli; and yeasts, Saccharomyces cerevisiae and Pichia pastoris, are discussed by assessing their potentials and drawbacks. Double promoter expression systems need to be designed to maintain a higher specific product formation rate within the production domain. While bacterial double promoter systems have been constructed as chimeric tandem promoters, yeast dual promoter systems have been developed as separate expression cassettes. To increase production and productivity, the optimal transcriptional activity should be justified either by simultaneously satisfying the requirements of both promoters, or by consecutively stimulating the changeover from one to another in a biphasic process or via successive-iterations. Thus, considering the dynamics of a fermentation process, double promoters can be classified according to their operational mechanisms, as: i) consecutively operating double promoter systems, and ii) simultaneously operating double promoter systems. Among these metabolic design strategies, extending the expression period with two promoters activated under different conditions, or enhancing the transcriptional activity with two promoters activated under similar conditions within the production domain, can be applied independently from the host. Novel studies with new insights, which aim a rational systematic design and construction of dual promoter expression vectors with tailored transcriptional activity, will empower r-protein production with enhanced production and productivity. Finally, the current state-of-the-art review emphasizes the advantages of double promoter systems along with the necessity for discovering new promoters for the development of more effective and adaptive processes to meet the increasing demand of r-protein industry.

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

Protein expression vector and secretion signal peptide optimization to drive the production, secretion, and functional expression of the bacteriocin enterocin A in lactic acid bacteria.

PubMed

Borrero, Juan; Jiménez, Juan J; Gútiez, Loreto; Herranz, Carmen; Cintas, Luis M; Hernández, Pablo E

2011-10-20

Replacement of the leader sequence (LS) of the bacteriocin enterocin A (LS(entA)) by the signal peptides (SP) of the protein Usp45 (SP(usp45)), and the bacteriocins enterocin P (SP(entP)), and hiracin JM79 (SP(hirJM79)) permits the production, secretion, and functional expression of EntA by different lactic acid bacteria (LAB). Chimeric genes encoding the SP(usp45), the SP(entP), and the SP(hirJM79) fused to mature EntA plus the EntA immunity genes (entA+entiA) were cloned into the expression vectors pNZ8048 and pMSP3545, under control of the inducible P(nisA) promoter, and in pMG36c, under control of the constitutive P(32) promoter. The amount, antimicrobial activity, and specific antimicrobial activity of the EntA produced by the recombinant Lactococcus lactis, Enterococcus faecium, E. faecalis, Lactobacillus sakei and Pediococcus acidilactici hosts varied depending on the signal peptide, the expression vector, and the host strain. However, the antimicrobial activity and the specific antimicrobial activity of the EntA produced by most of the LAB transformants was lower than expected from their production. The supernatants of the recombinant L. lactis NZ9000 (pNZUAI) and L. lactis NZ9000 (pNZHAI), overproducers of EntA, showed a 1.2- to 5.1-fold higher antimicrobial activity than that of the natural producer E. faecium T136 against different Listeria spp. Copyright © 2011 Elsevier B.V. All rights reserved.

An agmatine-inducible system for the expression of recombinant proteins in Enterococcus faecalis.

PubMed

Linares, Daniel M; Perez, Marta; Ladero, Victor; Del Rio, Beatriz; Redruello, Begoña; Martin, M Cruz; Fernandez, María; Alvarez, Miguel A

2014-12-04

Scientific interest in Enterococcus faecalis has increased greatly over recent decades. Some strains are involved in food fermentation and offer health benefits, whereas others are vancomycin-resistant and cause infections that are difficult to treat. The limited availability of vectors able to express cloned genes efficiently in E. faecalis has hindered biotechnological studies on the bacterium's regulatory and pathogenicity-related genes. The agmatine deiminase (AGDI) pathway of E. faecalis, involved in the conversion of agmatine into putrescine, is driven by a response inducer gene aguR. This study describes that the exposure to the induction factor (agmatine) results in the transcription of genes under the control of the aguB promoter, including the aguBDAC operon. A novel E. faecalis expression vector, named pAGEnt, combining the aguR inducer gene and the aguB promoter followed by a cloning site and a stop codon was constructed. pAGEnt was designed for the overexpression and purification of a protein fused to a 10-amino-acid His-tag at the C-terminus. The use of GFP as a reporter of gene expression in E. faecalis revealed that under induction with 60 mM agmatine, fluorescence reached 40 arbitrary units compared to 0 in uninduced cells. pAGEnt vector can be used for the overexpression of recombinant proteins under the induction of agmatine in E. faecalis, with a close correlation between agmatine concentration and fluorescence when GFP was used as reporter.

Widespread transduction of astrocytes and neurons in the mouse central nervous system after systemic delivery of a self-complementary AAV-PHP.B vector.

PubMed

Rincon, Melvin Y; de Vin, Filip; Duqué, Sandra I; Fripont, Shelly; Castaldo, Stephanie A; Bouhuijzen-Wenger, Jessica; Holt, Matthew G

2018-04-01

Until recently, adeno-associated virus 9 (AAV9) was considered the AAV serotype most effective in crossing the blood-brain barrier (BBB) and transducing cells of the central nervous system (CNS), following systemic injection. However, a newly engineered capsid, AAV-PHP.B, is reported to cross the BBB at even higher efficiency. We investigated how much we could boost CNS transgene expression by using AAV-PHP.B carrying a self-complementary (sc) genome. To allow comparison, 6 weeks old C57BL/6 mice received intravenous injections of scAAV2/9-GFP or scAAV2/PHP.B-GFP at equivalent doses. Three weeks postinjection, transgene expression was assessed in brain and spinal cord. We consistently observed more widespread CNS transduction and higher levels of transgene expression when using the scAAV2/PHP.B-GFP vector. In particular, we observed an unprecedented level of astrocyte transduction in the cortex, when using a ubiquitous CBA promoter. In comparison, neuronal transduction was much lower than previously reported. However, strong neuronal expression (including spinal motor neurons) was observed when the human synapsin promoter was used. These findings constitute the first reported use of an AAV-PHP.B capsid, encapsulating a scAAV genome, for gene transfer in adult mice. Our results underscore the potential of this AAV construct as a platform for safer and more efficacious gene therapy vectors for the CNS.

Efficient repair of DNA double-strand breaks in malignant cells with structural instability

PubMed Central

Cheng, Yue; Zhang, Zhenhua; Keenan, Bridget; Roschke, Anna V.; Nakahara, Kenneth; Aplan, Peter D.

2009-01-01

Aberrant repair of DNA double strand breaks (DSBs) is thought to be important in the generation of gross chromosomal rearrangements (GCRs). To examine how DNA DSBs might lead to GCRs, we investigated the repair of a single DNA DSB in a structurally unstable cell line. An I-SceI recognition site was introduced into OVCAR-8 cells between a constitutive promoter (EF1α) and the Herpes simplex virus thymidine kinase (TK) gene, which confers sensitivity to gancyclovir (GCV). Expression of I-SceI in these cells caused a single DSB. Clones with aberrant repair could acquire resistance to GCV by separation of the EF1α promoter from the TK gene, or deletion of either the EF1α promoter or the TK gene. All mutations that we identified were interstitial deletions. Treatment of cells with etoposide or bleomycin, agents known to produce DNA DSBs following expression of I-SceI also did not generate GCRs. Because we identified solely interstitial deletions using the aforementioned negative selection system, we developed a positive selection system to produce GCR. A construct containing an I-SceI restriction site immediately followed by a hygromycin phosphotransferase cDNA, with no promoter, was stably integrated into OVCAR-8 cells. DNA DSBs were produced by an I-SceI expression vector. None of the hygromycin resistant clones recovered had linked the hygromycin phosphotransferase cDNA to an endogenous promoter, but had instead captured a portion of the I-SceI expression vector. These results indicate that even in a structurally unstable malignant cell line, the majority of DNA DSBs are repaired by religation of the two broken chromosome ends, without the introduction of a GCR. PMID:19909760

Efficient repair of DNA double-strand breaks in malignant cells with structural instability.

PubMed

Cheng, Yue; Zhang, Zhenhua; Keenan, Bridget; Roschke, Anna V; Nakahara, Kenneth; Aplan, Peter D

2010-01-05

Aberrant repair of DNA double-strand breaks (DSBs) is thought to be important in the generation of gross chromosomal rearrangements (GCRs). To examine how DNA DSBs might lead to GCRs, we investigated the repair of a single DNA DSB in a structurally unstable cell line. An I-SceI recognition site was introduced into OVCAR-8 cells between a constitutive promoter (EF1alpha) and the Herpes simplex virus thymidine kinase (TK) gene, which confers sensitivity to gancyclovir (GCV). Expression of I-SceI in these cells caused a single DSB. Clones with aberrant repair could acquire resistance to GCV by separation of the EF1alpha promoter from the TK gene, or deletion of either the EF1alpha promoter or the TK gene. All mutations that we identified were interstitial deletions. Treatment of cells with etoposide or bleomycin, agents known to produce DNA DSBs following expression of I-SceI also did not generate GCRs. Because we identified solely interstitial deletions using the aforementioned negative selection system, we developed a positive selection system to produce GCR. A construct containing an I-SceI restriction site immediately followed by a hygromycin phosphotransferase cDNA, with no promoter, was stably integrated into OVCAR-8 cells. DNA DSBs were produced by an I-SceI expression vector. None of the hygromycin resistant clones recovered had linked the hygromycin phosphotransferase cDNA to an endogenous promoter, but had instead captured a portion of the I-SceI expression vector. These results indicate that even in a structurally unstable malignant cell line, the majority of DNA DSBs are repaired by religation of the two broken chromosome ends, without the introduction of a GCR.

Regulatable Transgene Expression for Prevention of Chemotherapy-Induced Peripheral Neuropathy.

PubMed

Kawata, Daisuke; Wu, Zetang

2017-09-15

Chemotherapy-induced peripheral neuropathy (CIPN) is a debilitating complication associated with drug treatment of cancer for which there are no effective strategies of prevention or treatment. In this study, we examined the effect of intermittent expression of neurotophin-3 (NT-3) or interleukin-10 (IL-10) from replication-defective herpes simplex virus (HSV)-based regulatable vectors delivered by subcutaneous inoculation to the dorsal root ganglion (DRG) on the development of paclitaxel-induced peripheral neuropathy. We constructed two different tetracycline (tet)-on-based regulatable HSV vectors, one expressing NT-3 and the other expressing IL-10, in which the transactivator expression in the tet-on system was under the control of HSV latency-associated promoter 2 (LAP-2), and expression of the transgene was controlled by doxycycline (DOX). We examined the therapeutic effect of intermittent expression of the transgene in animals with paclitaxel-induced peripheral neuropathy modeled by intraperitoneal injection of paclitaxel (16 mg/kg) once a week for 5 weeks. Intermittent expression of either NT-3 or IL-10 3 days before and 1 day after paclitaxel administration protected animals against paclitaxel-induced peripheral neuropathy over the course of 5 weeks. These results suggest the potential of regulatable vectors for prevention of chemotherapy-induced peripheral neuropathy.

Construction of a Shuttle Vector for Heterologous Expression of a Novel Fungal α-Amylase Gene in Aspergillus oryzae.

PubMed

Yin, Yanchen; Mao, Youzhi; Yin, Xiaolie; Gao, Bei; Wei, Dongzhi

2015-07-01

The filamentous fungus Aspergillus oryzae is a well-known expression host used to express homologous and heterologous proteins in a number of industrial applications. To facilitate higher yields of proteins of interest, we constructed the pAsOP vector to express heterologous proteins in A. oryzae. pAsOP carries a selectable marker, pyrG, derived from Aspergillus nidulans, and a strong promoter and a terminator of the amyB gene derived from A. oryzae. pAsOP transformed A. oryzae efficiently via the PEG-CaCl2-mediated transformation method. As proof of concept, green fluorescent protein (GFP) was successfully expressed in A. oryzae transformed by pAsOP-GFP. Additionally, we identified a novel fungal α-amylase (PcAmy) gene from Penicillium sp. and cloned the gene into the vector. After transformation by pAsOPPcAmy, the α-amylase PcAmy from Penicillium sp. was successfully expressed in a heterologous host system for the first time. The α-amylase activity in the A. oryzae transformant was increased by 62.3% compared with the untransformed A. oryzae control. The PcAmy protein produced in the system had an optimum pH of 5.0 and optimum temperature of 30°C. As a cold-adapted enzyme, PcAmy shows potential value in industrial applications because of its high catalytic activity at low temperature. Furthermore, the expression vector reported in this study provides promising utility for further scientific research and biotechnological applications.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koener, J.F.; Leong, J.A.C.

A cDNA fragment containing the gene encoding the glycoprotein of infectious hematopoietic necrosis virus was inserted into Autographa californica baculovirus vectors under the control of the polyhedrin promoter. A 66-kilodalton protein, identical in size to the glycosylated glycoprotein of infectious hematopoietic necrosis virus, was expressed at high levels in Spodoptera frugiperda cells infected with the recombinant viruses. The expressed protein reacted with antiserum to the glycoprotein on Western blots.

The effect of eukaryotic expression vectors and adjuvants on DNA vaccines in chickens using an avian influenza model.

PubMed

Suarez, D L; Schultz-Cherry, S

2000-01-01

Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.

Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles

PubMed Central

Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J

2012-01-01

Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168

Construction of pTM series plasmids for gene expression in Brucella species.

PubMed

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

Human heme oxygenase-1 gene transfer lowers blood pressure and promotes growth in spontaneously hypertensive rats.

PubMed

Sabaawy, H E; Zhang, F; Nguyen, X; ElHosseiny, A; Nasjletti, A; Schwartzman, M; Dennery, P; Kappas, A; Abraham, N G

2001-08-01

Heme oxygenase (HO) catalyzes the conversion of heme to biliverdin, with release of free iron and carbon monoxide. Both heme and carbon monoxide have been implicated in the regulation of vascular tone. A retroviral vector containing human HO-1 cDNA (LSN-HHO-1) was constructed and subjected to purification and concentration of the viral particles to achieve 5x10(9) to 1x10(10) colony-forming units per milliliter. The ability of concentrated infectious viral particles to express human HO-1 (HHO-1) in vivo was tested. A single intracardiac injection of the concentrated infectious viral particles (expressing HHO-1) to 5-day-old spontaneously hypertensive rats resulted in functional expression of the HHO-1 gene and attenuation of the development of hypertension. Rats expressing HHO-1 showed a significant decrease in urinary excretion of a vasoconstrictor arachidonic acid metabolite and a reduction in myogenic responses to increased intraluminal pressure in isolated arterioles. Unexpectedly, HHO-1 chimeric rats showed a simultaneous significant proportionate increase in somatic growth. Thus, delivery of HHO-1 gene by retroviral vector attenuates the development of hypertension and promotes body growth in spontaneously hypertensive rats.

Optimization of Retinal Gene Therapy for X-Linked Retinitis Pigmentosa Due to RPGR Mutations.

PubMed

Beltran, William A; Cideciyan, Artur V; Boye, Shannon E; Ye, Guo-Jie; Iwabe, Simone; Dufour, Valerie L; Marinho, Luis Felipe; Swider, Malgorzata; Kosyk, Mychajlo S; Sha, Jin; Boye, Sanford L; Peterson, James J; Witherspoon, C Douglas; Alexander, John J; Ying, Gui-Shuang; Shearman, Mark S; Chulay, Jeffrey D; Hauswirth, William W; Gamlin, Paul D; Jacobson, Samuel G; Aguirre, Gustavo D

2017-08-02

X-linked retinitis pigmentosa (XLRP) caused by mutations in the RPGR gene is an early onset and severe cause of blindness. Successful proof-of-concept studies in a canine model have recently shown that development of a corrective gene therapy for RPGR-XLRP may now be an attainable goal. In preparation for a future clinical trial, we have here optimized the therapeutic AAV vector construct by showing that GRK1 (rather than IRBP) is a more efficient promoter for targeting gene expression to both rods and cones in non-human primates. Two transgenes were used in RPGR mutant (XLPRA2) dogs under the control of the GRK1 promoter. First was the previously developed stabilized human RPGR (hRPGRstb). Second was a new full-length stabilized and codon-optimized human RPGR (hRPGRco). Long-term (>2 years) studies with an AAV2/5 vector carrying hRPGRstb under control of the GRK1 promoter showed rescue of rods and cones from degeneration and retention of vision. Shorter term (3 months) studies demonstrated comparable preservation of photoreceptors in canine eyes treated with an AAV2/5 vector carrying either transgene under the control of the GRK1 promoter. These results provide the critical molecular components (GRK1 promoter, hRPGRco transgene) to now construct a therapeutic viral vector optimized for RPGR-XLRP patients. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Involvement of Sp1 elements in the promoter activity of genes affected in keratoconus.

PubMed

Maruyama, Y; Wang, X; Li, Y; Sugar, J; Yue, B Y

2001-08-01

Keratoconus is a progressive disease that thins and scars the corneal stroma. In keratoconus corneas, levels of degradative enzymes, including lysosomal acid phosphatase (LAP) and cathepsin B, are elevated, and those of the inhibitors alpha1-proteinase inhibitor (alpha 1-PI) and alpha 2-macroglobulin (alpha 2-M) are reduced, especially in the epithelial layer. An increased expression of the transcription factor Sp1 was also demonstrated. The role of Sp1 in regulation of the genes affected in keratoconus was examined in this study. DNA segments, containing 5'-flanking promoter sequences of the alpha 1-PI, LAP, cathepsin B, and alpha 2-M genes were ligated into the secreted alkaline phosphatase (SEAP) reporter gene vector. These constructs, along with the pSV beta-galactosidase control vector, were transfected into cultured human corneal epithelial and stromal cells and skin fibroblasts. Cotransfection with the Sp1 expression vector was performed in parallel. SEAP and beta-galactosidase enzyme activities were assayed. In corneal epithelial cells, as in stromal cells, alpha 1-PI promoter activity was suppressed by cotransfection of pPacSp1. The LAP, cathepsin B, and alpha 2-M promoters were functional in corneal cells, whereas activities of these promoters were much lower in skin fibroblasts. Cotransfection experiments indicated that the up- or downregulation of LAP, cathepsin B, and alpha 2-M observed in keratoconus-affected corneas was not mediated by Sp1. These results support the theory that the corneal epithelium, along with the stroma, is involved in keratoconus. An upstream role of Sp1 is indicated and the Sp1-mediated downregulation of the alpha 1-PI gene may be a key event in the disease development.

Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors

PubMed Central

Uhrig-Schmidt, Silke; Geiger, Matthias; Luippold, Gerd; Birk, Gerald; Mennerich, Detlev; Neubauer, Heike; Grimm, Dirk; Wolfrum, Christian; Kreuz, Sebastian

2014-01-01

In recent years, the increasing prevalence of obesity and obesity-related co-morbidities fostered intensive research in the field of adipose tissue biology. To further unravel molecular mechanisms of adipose tissue function, genetic tools enabling functional studies in vitro and in vivo are essential. While the use of transgenic animals is well established, attempts using viral and non-viral vectors to genetically modify adipocytes in vivo are rare. Therefore, we here characterized recombinant Adeno-associated virus (rAAV) vectors regarding their potency as gene transfer vehicles for adipose tissue. Our results demonstrate that a single dose of systemically applied rAAV8-CMV-eGFP can give rise to remarkable transgene expression in murine adipose tissues. Upon transcriptional targeting of the rAAV8 vector to adipocytes using a 2.2 kb fragment of the murine adiponectin (mAP2.2) promoter, eGFP expression was significantly decreased in off-target tissues while efficient transduction was maintained in subcutaneous and visceral fat depots. Moreover, rAAV8-mAP2.2-mediated expression of perilipin A – a lipid-droplet-associated protein – resulted in significant changes in metabolic parameters only three weeks post vector administration. Taken together, our findings indicate that rAAV vector technology is applicable as a flexible tool to genetically modify adipocytes for functional proof-of-concept studies and the assessment of putative therapeutic targets in vivo. PMID:25551639

Development of Bacteriocinogenic Strains of Saccharomyces cerevisiae Heterologously Expressing and Secreting the Leaderless Enterocin L50 Peptides L50A and L50B from Enterococcus faecium L50▿

PubMed Central

Basanta, Antonio; Herranz, Carmen; Gutiérrez, Jorge; Criado, Raquel; Hernández, Pablo E.; Cintas, Luis M.

2009-01-01

A segregationally stable expression and secretion vector for Saccharomyces cerevisiae, named pYABD01, was constructed by cloning the yeast gene region encoding the mating pheromone α-factor 1 secretion signal (MFα1s) into the S. cerevisiae high-copy-number expression vector pYES2. The structural genes of the two leaderless peptides of enterocin L50 (EntL50A and EntL50B) from Enterococcus faecium L50 were cloned, separately (entL50A or entL50B) and together (entL50AB), into pYABD01 under the control of the galactose-inducible promoter PGAL1. The generation of recombinant S. cerevisiae strains heterologously expressing and secreting biologically active EntL50A and EntL50B demonstrates the suitability of the MFα1s-containing vector pYABD01 to direct processing and secretion of these antimicrobial peptides through the S. cerevisiae Sec system. PMID:19218405

Expression of insulin-like growth factor-2 receptors on EL4 lymphoma cells overexpressing growth hormone.

PubMed

Farmer, John T; Weigent, Douglas A

2007-01-01

In the present study, we report the upregulation of functional IGF-2Rs in cells overexpressing growth hormone (GH). EL4 lymphoma cells stably transfected with an rGH cDNA overexpression vector (GHo) exhibited an increase in the binding of (125)I-IGF-2 with no change in the binding affinity compared to vector alone controls. An increase in the expression of the insulin-like growth factor-2 receptor (IGF-2R) in cells overexpressing GH was confirmed by Western blot analysis and IGF-2R promoter luciferase assays. EL4 cells produce insulin-like growth factor-2 (IGF-2) as detected by the reverse transcription-polymerase chain reaction (RT-PCR); however, no IGF-2 protein was detected by Western analysis. The increase in the expression of the IGF-2R resulted in greater levels of IGF-2 uptake in GHo cells compared to vector alone controls. The data suggest that one of the consequences of the overexpression of GH is an increase in the expression of the IGF-2R.

The construction and use of versatile binary vectors carrying pyrG auxotrophic marker and fluorescent reporter genes for Agrobacterium-mediated transformation of Aspergillus oryzae.

PubMed

Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Pham, Thu Ha; Phan, Tuan-Nghia; Tran, Van-Tuan

2016-12-01

Aspergillus oryzae is a safe mold widely used in food industry. It is also considered as a microbial cell factory for production of recombinant proteins and enzymes. Currently, genetic manipulation of filamentous fungi is achieved via Agrobacterium tumefaciens-mediated transformation methods usually employing antibiotic resistance markers. These methods are hardly usable for A. oryzae due to its strong resistance to the common antifungal compounds used for fungal transformation. In this study, we have constructed two binary vectors carrying the pyrG gene from A. oryzae as a biochemical marker than an antibiotic resistance marker, and an expression cassette for GFP or DsRed reporter gene under control of the constitutive gpdA promoter from Aspergillus nidulans. All components of these vectors are changeable to generate new versions for specific research purposes. The developed vectors are fully functional for heterologous expression of the GFP and DsRed fluorescent proteins in the uridine/uracil auxotrophic A. oryzae strain. Our study provides a new approach for A. oryzae transformation using pyrG as the selectable auxotrophic marker, A. tumefaciens as the DNA transfer tool and fungal spores as the transformation material. The binary vectors constructed can be used for gene expression studies in this industrially important filamentous fungus.

Targeted genome editing in a quail cell line using a customized CRISPR/Cas9 system.

PubMed

Ahn, Jinsoo; Lee, Joonbum; Park, Ju Yeon; Oh, Keon Bong; Hwang, Seongsoo; Lee, Chang-Won; Lee, Kichoon

2017-05-01

Soon after RNA-guided Cas9 (CRISPR-associated protein 9) endonuclease opened a new era of targeted genome editing, the CRISPR/Cas9 platform began to be extensively used to modify genes in various types of cells and organisms. However, successful CRISPR/Cas9-mediated insertion/deletion (indel) mutation remains to be demonstrated in avian cell lines. The objective of this study was to design a poultry-specific CRISPR/Cas9 system to efficiently introduce targeted deletion mutation in chromosomes of the quail muscle clone 7 (QM7) cell line using a customized quail CRISPR vector. In this study, two avian-specific promoters, quail 7SK (q7SK) promoter and CBh promoter, the hybrid form of cytomegalovirus and chicken β-actin promoters, were cloned into a CRISPR vector for the expression of guide RNA and Cas9 protein, respectively. Then, guide RNA, which was designed to target 20-base pair (bp) nucleotides in the quail melanophilin (MLPH) locus, was ligated to the modified CRISPR vector and transfected to QM7 cells. Our results showed multiple indel mutations in the quail MLPH locus in nearly half of the alleles being tested, suggesting the high efficiency of the system for targeted gene modification. The new CRISPR vector developed from this study has the potential application to generate knockout avian cell lines and knockout poultry. © 2016 Poultry Science Association Inc.

Compositions and methods for xylem-specific expression in plant cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Kyung-Hwan; Ko, Jae-Heung

The invention provides promoter sequences that regulate specific expression of operably linked sequences in developing xylem cells and/or in developing xylem tissue. The developing xylem-specific sequences are exemplified by the DX5, DX8, DX11, and DX15 promoters, portions thereof, and homologs thereof. The invention further provides expression vectors, cells, tissues and plants that contain the invention's sequences. The compositions of the invention and methods of using them are useful in, for example, improving the quantity (biomass) and/or the quality (wood density, lignin content, sugar content etc.) of expressed biomass feedstock products that may be used for bioenergy, biorefinary, and generating woodmore » products such as pulp, paper, and solid wood.« less

Characterization of BRCA2 Transcriptional Regulation

DTIC Science & Technology

2000-08-01

Renilla luciferase vector (Promega) with 4 ll of Fugene-6 was used for each transfection. The pRL-TK Renilla luciferase activity was used to control for...experiments, cells received 0.5 jig of BRCA2 promoter construct, 0.1 jig of pRL-TK Renilla luciferase vector, and 0.5 jig of the indicated expression...Myc, and pCMV-Max. Firefly lucifer- ase and renilla luciferase assays were performed using the Dual-Luciferase Reporter Assay Sys- tem (Promega

Stable integration and expression of heterologous genes in several lactobacilli using an integration vector constructed from the integrase and attP sequences of phage ΦAT3 isolated from Lactobacillus casei ATCC 393.

PubMed

Lin, Chao-Fen; Lo, Ta-Chun; Kuo, Yang-Cheng; Lin, Thy-Hou

2013-04-01

An integration vector capable of stably integrating and maintaining in the chromosomes of several lactobacilli over hundreds of generations has been constructed. The major integration machinery used is based on the ΦAT3 integrase (int) and attP sequences determined previously. A novel core sequence located at the 3' end of the tRNA(leu) gene is identified in Lactobacillus fermentum ATCC 14931 as the integration target by the integration vector though most of such sequences found in other lactobacilli are similar to that determined previously. Due to the lack of an appropriate attB site in Lactococcus lactis MG1363, the integration vector is found to be unable to integrate into the chromosome of the strain. However, such integration can be successfully restored by cotransforming the integration vector with a replicative one harboring both attB and erythromycin resistance sequences into the strain. Furthermore, the integration vector constructed carries a promoter region of placT from the chromosome of Lactobacillus rhamnosus TCELL-1 which is used to express green fluorescence and luminance protein genes in the lactobacilli studied.

Molecular biological enhancement of coal biodesulfurization. [Quarterly] technical report, December 1, 1993--February 28, 1994

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kilbane, J.J. II

1994-06-01

IGT has developed a microbial culture of Rhodococcus rhodochrous, IGTS8, that is capable of specifically cleaving carbon-sulfur bonds in a range of organosulfur model compounds and is capable of removing organic sulfur from coal and petroleum. Although IGTS8 possesses the ability to specifically remove organic sulfur from coal, a major research need is to develop improved strain`s of microorganisms that possess higher levels of desulfurization activity and therefore wall permit more favorable biodesulfurization process conditions: faster rates, mare complete removal, and smaller reactor size. Strain improvement is the single most important aspect to the development of a practical coal biodesulfurizationmore » process and accordingly is the focus of research in this project. Several possible strong promoters have been isolated and are in the process of being analyzed. When these promoters have been characterized for inducibility, strength, transcriptional start sites and other physical properties, they will be placed in front of the desulfurization genes and expression will be monitored. Improved promoter probe vectors have been constructed, allowing a conclusive screen of all putative Rhodococcus promoters. With the improved methodologies in the handling of Rhodococcus RNA, we have begun to gauge promoter expression using Northern blots. During this quarter we have constructed and successfully used a promoter probe vector using the {beta}-galactosidane gene from E. coli. A chromosomal promoter library was constructed upstream from the {beta}-galactosidase gene. Over 200 colonies were isolated that yielded {beta}-galactosidase activity.« less

In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering

PubMed Central

Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

2017-01-01

Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids. PMID:28871270

In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering.

PubMed

Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

2017-01-01

Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5' untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3'UTR from the E. coli ribosomal RNA operon rrnB . Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.

Amelioration of murine beta-thalassemia through drug selection of hematopoietic stem cells transduced with a lentiviral vector encoding both gamma-globin and the MGMT drug-resistance gene.

PubMed

Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A

2009-06-04

Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.

Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells.

PubMed

Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G; Martin, Francisco

2016-11-17

Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny.

Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells

PubMed Central

Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G.; Martin, Francisco

2016-01-01

Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny. PMID:27853296

Safeguarding Stem Cell-Based Regenerative Therapy against Iatrogenic Cancerogenesis: Transgenic Expression of DNASE1, DNASE1L3, DNASE2, DFFB Controlled By POLA1 Promoter in Proliferating and Directed Differentiation Resisting Human Autologous Pluripotent Induced Stem Cells Leads to their Death

PubMed Central

Malecki, Marek; LaVanne, Christine; Alhambra, Dominique; Dodivenaka, Chaitanya; Nagel, Sarah; Malecki, Raf

2014-01-01

Introduction The worst possible complication of using stem cells for regenerative therapy is iatrogenic cancerogenesis. The ultimate goal of our work is to develop a self-triggering feedback mechanism aimed at causing death of all stem cells, which resist directed differentiation, keep proliferating, and can grow into tumors. Specific aim The specific aim was threefold: (1) to genetically engineer the DNA constructs for the human, recombinant DNASE1, DNASE1L3, DNASE2, DFFB controlled by POLA promoter; (2) to bioengineer anti-SSEA-4 antibody guided vectors delivering transgenes to human undifferentiated and proliferating pluripotent stem cells; (3) to cause death of proliferating and directed differentiation resisting stem cells by transgenic expression of the human recombinant the DNases (hrDNases). Methods The DNA constructs for the human, recombinant DNASE1, DNASE1L3, DNASE2, DFFB controlled by POLA promoter were genetically engineered. The vectors targeting specifically SSEA-4 expressing stem cells were bioengineered. The healthy volunteers’ bone marrow mononuclear cells (BMMCs) were induced into human, autologous, pluripotent stem cells with non-integrating plasmids. Directed differentiation of the induced stem cells into endothelial cells was accomplished with EGF and BMP. The anti-SSEA 4 antibodies’ guided DNA vectors delivered the transgenes for the human recombinant DNases’ into proliferating stem cells. Results Differentiation of the pluripotent induced stem cells into the endothelial cells was verified by highlighting formation of tight and adherens junctions through transgenic expression of recombinant fluorescent fusion proteins: VE cadherin, claudin, zona occludens 1, and catenin. Proliferation of the stem cells was determined through highlighting transgenic expression of recombinant fluorescent proteins controlled by POLA promoter, while also reporting expression of the transgenes for the hrDNases. Expression of the transgenes for the DNases resulted in complete collapse of the chromatin architecture and degradation of the proliferating cells’ genomic DNA. The proliferating stem cells, but not the differentiating ones, were effectively induced to die. Conclusion Herein, we describe attaining the proof-of-concept for the strategy, whereby transgenic expression of the genetically engineered human recombinant DNases in proliferating and directed differentiation resisting stem cells leads to their death. This novel strategy reduces the risk of iatrogenic neoplasms in stem cell therapy. PMID:25045589

Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease

PubMed Central

Trapani, Ivana; Toriello, Elisabetta; de Simone, Sonia; Colella, Pasqualina; Iodice, Carolina; Polishchuk, Elena V.; Sommella, Andrea; Colecchi, Linda; Rossi, Settimio; Simonelli, Francesca; Giunti, Massimo; Bacci, Maria L.; Polishchuk, Roman S.; Auricchio, Alberto

2015-01-01

Stargardt disease (STGD1) due to mutations in the large ABCA4 gene is the most common inherited macular degeneration in humans. We have shown that dual adeno-associated viral (AAV) vectors effectively transfer ABCA4 to the retina of Abca4−/− mice. However, they express both lower levels of transgene compared with a single AAV and truncated proteins. To increase productive dual AAV concatemerization, which would overcome these limitations, we have explored the use of either various regions of homology or heterologous inverted terminal repeats (ITR). In addition, we tested the ability of various degradation signals to decrease the expression of truncated proteins. We found the highest levels of transgene expression using regions of homology based on either alkaline phosphatase or the F1 phage (AK). The use of heterologous ITR does not decrease the levels of truncated proteins relative to full-length ABCA4 and impairs AAV vector production. Conversely, the inclusion of the CL1 degradation signal results in the selective degradation of truncated proteins from the 5′-half without affecting full-length protein production. Therefore, we developed dual AAV hybrid ABCA4 vectors including homologous ITR2, the photoreceptor-specific G protein-coupled receptor kinase 1 promoter, the AK region of homology and the CL1 degradation signal. We show that upon subretinal administration these vectors are both safe in pigs and effective in Abca4−/− mice. Our data support the use of improved dual AAV vectors for gene therapy of STGD1. PMID:26420842

Genomic Analysis and Isolation of RNA Polymerase II Dependent Promoters from Spodoptera frugiperda.

PubMed

Bleckmann, Maren; Fritz, Markus H-Y; Bhuju, Sabin; Jarek, Michael; Schürig, Margitta; Geffers, Robert; Benes, Vladimir; Besir, Hüseyin; van den Heuvel, Joop

2015-01-01

The Baculoviral Expression Vector System (BEVS) is the most commonly used method for high expression of recombinant protein in insect cells. Nevertheless, expression of some target proteins--especially those entering the secretory pathway--provides a severe challenge for the baculovirus infected insect cells, due to the reorganisation of intracellular compounds upon viral infection. Therefore, alternative strategies for recombinant protein production in insect cells like transient plasmid-based expression or stable expression cell lines are becoming more popular. However, the major bottleneck of these systems is the lack of strong endogenous polymerase II dependent promoters, as the strong baculoviral p10 and polH promoters used in BEVS are only functional in presence of the viral transcription machinery during the late phase of infection. In this work we present a draft genome and a transcriptome analysis of Sf21 cells for the identification of the first known endogenous Spodoptera frugiperda promoters. Therefore, putative promoter sequences were identified and selected because of high mRNA level or in analogy to other strong promoters in other eukaryotic organism. The chosen endogenous Sf21 promoters were compared to early viral promoters for their efficiency to trigger eGFP expression using transient plasmid based transfection in a BioLector Microfermentation system. Furthermore, promoter activity was not only shown in Sf21 cells but also in Hi5 cells. The novel endogenous Sf21 promoters were ranked according to their activity and expand the small pool of available promoters for stable insect cell line development and transient plasmid expression in insect cells. The best promoter was used to improve plasmid based transient transfection in insect cells substantially.

Dual‑sensitive HRE/Egr1 promoter regulates Smac overexpression and enhances radiation‑induced A549 human lung adenocarcinoma cell death under hypoxia.

PubMed

Li, Chang-Feng; Chen, Li-Bo; Li, Dan-Dan; Yang, Lei; Zhang, Bao-Gang; Jin, Jing-Peng; Zhang, Ying; Zhang, Bin

2014-08-01

The aim of this study was to construct an expression vector carrying the hypoxia/radiation dual‑sensitive chimeric hypoxia response element (HRE)/early growth response 1 (Egr‑1) promoter in order to overexpress the therapeutic second mitochondria‑derived activator of caspases (Smac). Using this expression vector, the present study aimed to explore the molecular mechanism underlying radiotherapy‑induced A549 human lung adenocarcinoma cell death and apoptosis under hypoxia. The plasmids, pcDNA3.1‑Egr1‑Smac (pE‑Smac) and pcDNA3.1‑HRE/Egr-1‑Smac (pH/E‑Smac), were constructed and transfected into A549 human lung adenocarcinoma cells using the liposome method. CoCl2 was used to chemically simulate hypoxia, followed by the administration of 2 Gy X‑ray irradiation. An MTT assay was performed to detect cell proliferation and an Annexin V‑fluorescein isothiocyanate apoptosis detection kit was used to detect apoptosis. Quantitative polymerase chain reaction and western blot analyses were used for the detection of mRNA and protein expression, respectively. Infection with the pE‑Smac and pH/E‑Smac plasmids in combination with radiation and/or hypoxia was observed to enhance the expression of Smac. Furthermore, Smac overexpression was found to enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis. The cytochrome c/caspase‑9/caspase‑3 pathway was identified to be involved in this regulation of apoptosis. Plasmid infection in combination with X‑ray irradiation was found to markedly induce cell death under hypoxia. In conclusion, the hypoxia/radiation dual‑sensitive chimeric HRE/Egr‑1 promoter was observed to enhance the expression of the therapeutic Smac, as well as enhance the radiation‑induced inhibition of cell proliferation and promotion of cycle arrest and apoptosis under hypoxia. This apoptosis was found to involve the mitochondrial pathway.

A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila

PubMed Central

Wang, Ji-Wu; Beck, Erin S.; McCabe, Brian D.

2012-01-01

Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues. PMID:22848718

Green fluorescent protein as a reporter of gene expression and protein localization.

PubMed

Kain, S R; Adams, M; Kondepudi, A; Yang, T T; Ward, W W; Kitts, P

1995-10-01

The green fluorescent protein (GFP) from the jellyfish Aequorea victoria is rapidly becoming an important reporter molecule for monitoring gene expression and protein localization in vivo, in situ and in real time. GFP emits bright green light (lambda max = 509 nm) when excited with UV or blue light (lambda max = 395 nm, minor peak at 470 nm). The fluorescence excitation and emission spectra of GFP are similar to those of fluorescein, and the conditions used to visualize this fluorophore are also suitable for GFP. Unlike other bioluminescent reporters, the chromophore in GFP is intrinsic to the primary structure of the protein, and GFP fluorescence does not require a substrate or cofactor. GFP fluorescence is stable, species-independent and can be monitored non-invasively in living cells and, in the case of transparent organisms, whole animals. Here we demonstrate GFP fluorescence in bacterial and mammalian cells and introduce our Living Colors line of GFP reporter vectors, GFP protein and anti-GFP antiserum. The reporter vectors for GFP include a promoterless GFP vector for monitoring the expression of cloned promoters/enhancers in mammalian cells and a series of six vectors for creating fusion protein to either the N or C terminus of GFP.

Biosynthetic Approaches to Isotope Enrichment for Applications in Neutron Scattering and High Field NMR Spectroscopy: Methylotrophic

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mary E. lidstrom

Limitations in current isotopic labeling methods present a substantial bottleneck for the application of advanced structural techniques to many important biochemical problems. New tools are required to efficiently produce the necessary labeling patterns in biochemical precursors and incorporate them into protein molecules for structural studies. This project proposed involved one aspect of this problem, the development of expression vectors for a methylotrophic bacterium, Methylobacterium extorquens AM1. If high-level, efficient expression could be obtained in such a bacterium, it would be possible to use low-cost {sup 2}H- and/or {sup 13}C-labeled substrates such as methanol to label proteins. The Lidstrom laboratory atmore » the University of Washington worked closely with the collaborators at Los Alamos National Laboratories in the development and use of these vectors. (1) Overexpression of a target gene, bacterial dehalogenase--This enzyme was expressed in Methylobacterium extorquens AM1 using a high level methanol-inducible promoter, the mxaF promoter. High expression was achieved, but most was in an insoluble form. They expressed this protein in a mutant lacking polybetahydroxybutyrate granules, and high expression was achieved, up to 10% of the total soluble protein. The recombinant protein was purified and shown to be active, with characteristics similar to the enzyme produced in E. coli. (2) Development of regulated expression systems--A number of regulated promoters were tested in M. extorquens AM1, the most promising of which appeared to be the E. coli lac promoter coupled to the Laciq regulator. The repressor was shown to be active and a chromosomal insertion construct was generated that repressed the low-level lac promoter activity in M. extorquens AM1. However, IPTG induced this system only poorly. A number of studies were carried out leading to the conclusion that IPTG entered the cell but was exported by one or more export pumps. Target genes for such pumps were mutated but none of these showed increased induction. A number of methods were used to permeabilize the cell, and a 2-fold increase in induction was obtained with one of these. The activity of the lac promoter was increased by inserting a recently-identified M. extorquens AM1 enhancer element upstream. The promoter increased in activity 5-6 fold with this addition. In summary, they have developed a suite of expression tools and host mutant strains for expressing a variety of heterologous proteins in this methylotroph. These are now available for testing by the LANL collaborators in labeling reactors to obtain labeled proteins of interest.« less

Key gene regulating cell wall biosynthesis and recalcitrance in Populus, gene Y

DOEpatents

Chen, Jay; Engle, Nancy; Gunter, Lee E.; Jawdy, Sara; Tschaplinski, Timothy J.; Tuskan, Gerald A.

2015-12-08

This disclosure provides methods and transgenic plants for improved production of renewable biofuels and other plant-derived biomaterials by altering the expression and/or activity of Gene Y, an O-acetyltransferase. This disclosure also provides expression vectors containing a nucleic acid (Gene Y) which encodes the polypeptide of SEQ ID NO: 1 and is operably linked to a heterologous promoter.

Efficient expression of green fluorescent protein (GFP) mediated by a chimeric promoter in Chlamydomonas reinhardtii

NASA Astrophysics Data System (ADS)

Wu, Jinxia; Hu, Zhangli; Wang, Chaogang; Li, Shuangfei; Lei, Anping

2008-08-01

To improve the expression efficiency of exogenous genes in Chlamydomonas reinhardtii, a high efficient expression vector was constructed. Green fluorescent protein (GFP) was expressed in C. reinhardtii under the control of promoters: RBCS2 and HSP70A-RBCS2. Efficiency of transformation and expression were compared between two transgenic algae: RBCS2 mediated strain Tran-I and HSP70A-RBCS2 mediated strain Tran-II. Results show that HSP70A-RBCS2 could improve greatly the transformation efficiency by approximately eightfold of RBCS2, and the expression efficiency of GFP in Tran-II was at least double of that in Tran-I. In addition, a threefold increase of GFP in Tran-II was induced by heat shock at 40°C. All of the results demonstrated that HSP70A-RBCS2 was more efficient than RBCS2 in expressing exogenous gene in C. reinhardtii.

Biocontrol of the Sugarcane Borer Eldana saccharina by Expression of the Bacillus thuringiensis cry1Ac7 and Serratia marcescens chiA Genes in Sugarcane-Associated Bacteria

PubMed Central

Downing, Katrina J.; Leslie, Graeme; Thomson, Jennifer A.

2000-01-01

The cry1Ac7 gene of Bacillus thuringiensis strain 234, showing activity against the sugarcane borer Eldana saccharina, was cloned under the control of the tac promoter. The fusion was introduced into the broad-host-range plasmid pKT240 and the integration vector pJFF350 and without the tac promoter into the broad-host-range plasmids pML122 and pKmM0. These plasmids were introduced into a Pseudomonas fluorescens strain isolated from the phylloplane of sugarcane and the endophytic bacterium Herbaspirillum seropedicae found in sugarcane. The ptac-cry1Ac7 construct was introduced into the chromosome of P. fluorescens using the integration vector pJFF350 carrying the artificial interposon Omegon-Km. Western blot analysis showed that the expression levels of the integrated cry1Ac7 gene were much higher under the control of the tac promoter than under the control of its endogenous promoter. It was also determined that multicopy expression in P. fluorescens and H. seropedicae of ptac-cry1Ac7 carried on pKT240 caused plasmid instability with no detectable protein expression. In H. seropedicae, more Cry1Ac7 toxin was produced when the gene was cloned under the control of the Nmr promoter on pML122 than in the opposite orientation and bioassays showed that the former resulted in higher mortality of E. saccharina larvae than the latter. P. fluorescens 14::ptac-tox resulted in higher mortality of larvae than did P. fluorescens 14::tox. An increased toxic effect was observed when P. fluorescens 14::ptac-tox was combined with P. fluorescens carrying the Serratia marcescens chitinase gene chiA, under the control of the tac promoter, integrated into the chromosome. PMID:10877771

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE PAGES

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...

2018-02-01

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

Generation of Envelope-Modified Baculoviruses for Gene Delivery into Mammalian Cells.

PubMed

Hofmann, Christian

2016-01-01

Genetically modified baculoviruses can efficiently deliver and express genes in mammalian cells. The major prerequisite for the expression of a gene transferred by baculovirus is its control by a promoter that is active in mammalian cells. This chapter describes methods for producing second generation baculovirus vectors through modification of their envelope. Envelope modified baculoviruses offer additional new applications of the system, such as their use in in vivo gene delivery, targeting, and vaccination. Methods of generating a recombinant baculovirus vector with a modified envelope and its amplification and purification, including technical scale production, are discussed. A variety of notes give clues regarding specific technical procedures. Finally, methods to analyze the virus and transduction procedures are presented.

Gene inactivation in the plant pathogen Glomerella cingulata: three strategies for the disruption of the pectin lyase gene pnlA.

PubMed

Bowen, J K; Templeton, M D; Sharrock, K R; Crowhurst, R N; Rikkerink, E H

1995-01-20

The feasibility of performing routine transformation-mediated mutagenesis in Glomerella cingulata was analysed by adopting three one-step gene disruption strategies targeted at the pectin lyase gene pnlA. The efficiencies of disruption following transformation with gene replacement- or gene truncation-disruption vectors were compared. To effect replacement-disruption, G. cingulata was transformed with a vector carrying DNA from the pnlA locus in which the majority of the coding sequence had been replaced by the gene for hygromycin B resistance. Two of the five transformants investigated contained an inactivated pnlA gene (pnlA-); both also contained ectopically integrated vector sequences. The efficacy of gene disruption by transformation with two gene truncation-disruption vectors was also assessed. Both vectors carried at 5' and 3' truncated copy of the pnlA coding sequence, adjacent to the gene for hygromycin B resistance. The promoter sequences controlling the selectable marker differed in the two vectors. In one vector the homologous G. cingulata gpdA promoter controlled hygromycin B phosphotransferase expression (homologous truncation vector), whereas in the second vector promoter elements were from the Aspergillus nidulans gpdA gene (heterologous truncation vector). Following transformation with the homologous truncation vector, nine transformants were analysed by Southern hybridisation; no transformants contained a disrupted pnlA gene. Of nineteen heterologous truncation vector transformants, three contained a disrupted pnlA gene; Southern analysis revealed single integrations of vector sequence at pnlA in two of these transformants. pnlA mRNA was not detected by Northern hybridisation in pnlA- transformants. pnlA- transformants failed to produce a PNLA protein with a pI identical to one normally detected in wild-type isolates by silver and activity staining of isoelectric focussing gels. Pathogenesis on Capsicum and apple was unaffected by disruption of the pnlA gene, indicating that the corresponding gene product, PNLA, is not essential for pathogenicity. Gene disruption is a feasible method for selectively mutating defined loci in G. cingulata for functional analysis of the corresponding gene products.

Overexpression of SASH1 related to the decreased invasion ability of human glioma U251 cells.

PubMed

Yang, Liu; Liu, Mei; Gu, Zhikai; Chen, Jianguo; Yan, Yaohua; Li, Jian

2012-12-01

The purpose of this study was to investigate the impact of SAM- and SH3-domain containing 1 (SASH1) on the biological behavior of glioma cells, including its effects on cellular growth, proliferation, apoptosis, invasion, and metastasis, and thereby to provide an experimental basis for future therapeutic treatments. A pcDNA3.1-SASH1 eukaryotic expression vector was constructed and transfected into the U251 human glioma cell line. Using the tetrazolium-based colorimetric (MTT) assay, flow cytometry analyses, transwell invasion chamber experiments, and other methods, we examined the impact of SASH1 on the biological behaviors of U251 cells, including effects on viability, cell cycle, apoptosis, and invasion. Furthermore, the effect of SASH1 on the expression of cyclin D1, caspase-3, matrix metalloproteinase (MMP)-2, MMP-9, and other proteins was observed. Compared to the empty vector and blank control groups, the pcDNA3.1-SASH1 group of U251 cells exhibited significantly reduced cell viability, proliferation, and invasion (p < 0.05), although there was no difference between the empty vector and blank control groups. The pcDNA3.1-SASH1 group demonstrated a significantly higher apoptotic index than did the empty vector and blank control groups (p < 0.05), and the percentage of apoptotic cells was similar between the empty vector and blank control groups. In addition, the pcDNA3.1-SASH1 group expressed significantly lower protein levels of cyclin D1 and MMP-2/9 compared to the control and empty vector groups (p < 0.05) and significantly higher protein levels of caspase-3 than the other two groups (p < 0.05). Cyclin D1, caspase-3, and MMP-2/9 expression was unchanged between the empty vector and blank control groups. SASH1 gene expression might be related to the inhibition of the growth, proliferation, and invasion of U251 cells and the promotion of U251 cells apoptosis.

[Functional analysis of Oct4 promoter in Xuhuai goat].

PubMed

Wei, Guanghui; Li, Dong; Zuo, Qisheng; Zhang, Yani; Zhu, Rui; Zhang, Lei; Liu, Zhiyong; Qiu, Fenglong; Li, Bichun

2014-08-01

The aim of this study was to determine the activity region of Oct4 (octamer-binding transcription factor 4) promoter in Xuhuai goat, and to investigate the effect of TSA (trichostatin A) and VPA(valproicacid) on Oct4 promoter activity. Specific PCR primers of Oct4 promoter including different lengths of fragments were designed by Primer 5.0, then were amplified and cloned into PGL3-Bacic luciferase reporter vector. All the reconstruction vectors were transfected into gEF, P19 and COS7 cells, respectively. After TSA and VPA treatment, the activity of dual-luciferase reporter gene in these three transfected cells was detected. In addition, the CMV promoter of pEGFP-N1 was replaced by the -1516─+30 bp fragment of Oct4 promoter, GFP fluorescence was used to detect the activity of Oct4 promoter. The results indicated that different fragments of Oct4 promoter showed different degrees of activity in gEF, P19 and COS7 cells, and the maximal activity region of Oct4 promoter was -1516─+30 bp, the basal activity region was -238─+30 bp. Positive regulatory domains existed in the region of -1516─-946 bp and -615─-96 bp, while negative regulatory domains existed in the region of -1936─-1516 bp and -946─-615 bp. The optimum induction concentration to enhance the activity of Oct4 promoter was 1 μmol/L of TSA and 4 mmol/L of VPA. The GFP expression can be started by the fragment of -1516─+30 bp. This study provides an experimental basis for revealing the mechanism of expression and regulation of Oct4 in goat.

Genetic engineering of human embryonic stem cells with lentiviral vectors.

PubMed

Xiong, Chen; Tang, Dong-Qi; Xie, Chang-Qing; Zhang, Li; Xu, Ke-Feng; Thompson, Winston E; Chou, Wayne; Gibbons, Gary H; Chang, Lung-Ji; Yang, Li-Jun; Chen, Yuqing E

2005-08-01

Human embryonic stem (hES) cells present a valuable source of cells with a vast therapeutic potential. However, the low efficiency of directed differentiation of hES cells remains a major obstacle in their uses for regenerative medicine. While differentiation may be controlled by the genetic manipulation, effective and efficient gene transfer into hES cells has been an elusive goal. Here, we show stable and efficient genetic manipulations of hES cells using lentiviral vectors. This method resulted in the establishment of stable gene expression without loss of pluripotency in hES cells. In addition, lentiviral vectors were effective in conveying the expression of an U6 promoter-driven small interfering RNA (siRNA), which was effective in silencing its specific target. Taken together, our results suggest that lentiviral gene delivery holds great promise for hES cell research and application.

Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodyer, P.R.; Torban, E.; Dehbi, M.

1994-09-01

The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less

An efficient deletion mutant packaging system for defective herpes simplex virus vectors: Potential applications to human gene therapy and neuronal physiology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geller, A.I.; Keyomarsi, K.; Bryan, J.

1990-11-01

The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli {beta}-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; tsmore » mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses {beta}-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system.« less

Autophagy pathway induced by a plant virus facilitates viral spread and transmission by its insect vector.

PubMed

Chen, Yong; Chen, Qian; Li, Manman; Mao, Qianzhuo; Chen, Hongyan; Wu, Wei; Jia, Dongsheng; Wei, Taiyun

2017-11-01

Many viral pathogens are persistently transmitted by insect vectors and cause agricultural or health problems. Generally, an insect vector can use autophagy as an intrinsic antiviral defense mechanism against viral infection. Whether viruses can evolve to exploit autophagy to promote their transmission by insect vectors is still unknown. Here, we show that the autophagic process is triggered by the persistent replication of a plant reovirus, rice gall dwarf virus (RGDV) in cultured leafhopper vector cells and in intact insects, as demonstrated by the appearance of obvious virus-containing double-membrane autophagosomes, conversion of ATG8-I to ATG8-II and increased level of autophagic flux. Such virus-containing autophagosomes seem able to mediate nonlytic viral release from cultured cells or facilitate viral spread in the leafhopper intestine. Applying the autophagy inhibitor 3-methyladenine or silencing the expression of Atg5 significantly decrease viral spread in vitro and in vivo, whereas applying the autophagy inducer rapamycin or silencing the expression of Torc1 facilitate such viral spread. Furthermore, we find that activation of autophagy facilitates efficient viral transmission, whereas inhibiting autophagy blocks viral transmission by its insect vector. Together, these results indicate a plant virus can induce the formation of autophagosomes for carrying virions, thus facilitating viral spread and transmission by its insect vector. We believe that such a role for virus-induced autophagy is common for vector-borne persistent viruses during their transmission by insect vectors.

Autophagy pathway induced by a plant virus facilitates viral spread and transmission by its insect vector

PubMed Central

Mao, Qianzhuo; Chen, Hongyan; Wu, Wei

2017-01-01

Many viral pathogens are persistently transmitted by insect vectors and cause agricultural or health problems. Generally, an insect vector can use autophagy as an intrinsic antiviral defense mechanism against viral infection. Whether viruses can evolve to exploit autophagy to promote their transmission by insect vectors is still unknown. Here, we show that the autophagic process is triggered by the persistent replication of a plant reovirus, rice gall dwarf virus (RGDV) in cultured leafhopper vector cells and in intact insects, as demonstrated by the appearance of obvious virus-containing double-membrane autophagosomes, conversion of ATG8-I to ATG8-II and increased level of autophagic flux. Such virus-containing autophagosomes seem able to mediate nonlytic viral release from cultured cells or facilitate viral spread in the leafhopper intestine. Applying the autophagy inhibitor 3-methyladenine or silencing the expression of Atg5 significantly decrease viral spread in vitro and in vivo, whereas applying the autophagy inducer rapamycin or silencing the expression of Torc1 facilitate such viral spread. Furthermore, we find that activation of autophagy facilitates efficient viral transmission, whereas inhibiting autophagy blocks viral transmission by its insect vector. Together, these results indicate a plant virus can induce the formation of autophagosomes for carrying virions, thus facilitating viral spread and transmission by its insect vector. We believe that such a role for virus-induced autophagy is common for vector-borne persistent viruses during their transmission by insect vectors. PMID:29125860

Systemic administration of a PEGylated adenovirus vector with a cancer-specific promoter is effective in a mouse model of metastasis.

PubMed

Yao, X; Yoshioka, Y; Morishige, T; Eto, Y; Watanabe, H; Okada, Y; Mizuguchi, H; Mukai, Y; Okada, N; Nakagawa, S

2009-12-01

Cancer gene therapy by adenovirus vectors (Advs) for metastatic cancer is limited because systemic administration of Adv produces low therapeutic effect and severe side effects. In this study, we generated a dual cancer-specific targeting vector system by using PEGylation and the telomere reverse transcriptase (TERT) promoter and attempted to treat experimental metastases through systemic administration of the vectors. We first optimized the molecular size of PEG and modification ratios used to create PEG-Ads. Systemic administration of PEG-Ad with 20-kDa PEG at a 45% modification ratio (PEG[20K/45%]-Ad) resulted in higher tumor-selective transgene expression than unmodified Adv. Next, we examined the effectiveness against metastases and side effects of a TERT promoter-driven PEG[20K/45%]-Ad containing the herpes simplex virus thymidine kinase (HSVtk) gene (PEG-Ad-TERT/HSVtk). Systemic administration of PEG-Ad-TERT/HSVtk showed superior antitumor effects against metastases with negligible side effects. A cytomegalovirus (CMV) promoter-driven PEG[20K/45%]-Ad also produced antimetastatic effects, but these were accompanied by side effects. Combining PEG-Ad-TERT/HSVtk with etoposide or 5-fluorouracil enhanced the therapeutic effects with negligible side effects. These results suggest that modification with 20-kDa PEG at a 45% modification ratio is the optimal condition for PEGylation of Adv, and PEG-Ad-TERT/HSVtk is a prototype Adv for systemic cancer gene therapy against metastases.

Microorganisms having enhanced resistance to acetate and methods of use

DOEpatents

Brown, Steven D; Yang, Shihui

2014-10-21

The present invention provides isolated or genetically modified strains of microorganisms that display enhanced resistance to acetate as a result of increased expression of a sodium proton antiporter. The present invention also provides methods for producing such microbial strains, as well as related promoter sequences and expression vectors. Further, the present invention provides methods of producing alcohol from biomass materials by using microorganisms with enhanced resistance to acetate.

Versatile approach for functional analysis of human proteins and efficient stable cell line generation using FLP-mediated recombination system

PubMed Central

Szczesny, Roman J.; Kowalska, Katarzyna; Klosowska-Kosicka, Kamila; Chlebowski, Aleksander; Owczarek, Ewelina P.; Warkocki, Zbigniew; Kulinski, Tomasz M.; Adamska, Dorota; Affek, Kamila; Jedroszkowiak, Agata; Kotrys, Anna V.; Tomecki, Rafal; Krawczyk, Pawel S.; Borowski, Lukasz S.; Dziembowski, Andrzej

2018-01-01

Deciphering a function of a given protein requires investigating various biological aspects. Usually, the protein of interest is expressed with a fusion tag that aids or allows subsequent analyses. Additionally, downregulation or inactivation of the studied gene enables functional studies. Development of the CRISPR/Cas9 methodology opened many possibilities but in many cases it is restricted to non-essential genes. Recombinase-dependent gene integration methods, like the Flp-In system, are very good alternatives. The system is widely used in different research areas, which calls for the existence of compatible vectors and efficient protocols that ensure straightforward DNA cloning and generation of stable cell lines. We have created and validated a robust series of 52 vectors for streamlined generation of stable mammalian cell lines using the FLP recombinase-based methodology. Using the sequence-independent DNA cloning method all constructs for a given coding-sequence can be made with just three universal PCR primers. Our collection allows tetracycline-inducible expression of proteins with various tags suitable for protein localization, FRET, bimolecular fluorescence complementation (BiFC), protein dynamics studies (FRAP), co-immunoprecipitation, the RNA tethering assay and cell sorting. Some of the vectors contain a bidirectional promoter for concomitant expression of miRNA and mRNA, so that a gene can be silenced and its product replaced by a mutated miRNA-insensitive version. Our toolkit and protocols have allowed us to create more than 500 constructs with ease. We demonstrate the efficacy of our vectors by creating stable cell lines with various tagged proteins (numatrin, fibrillarin, coilin, centrin, THOC5, PCNA). We have analysed transgene expression over time to provide a guideline for future experiments and compared the effectiveness of commonly used inducers for tetracycline-responsive promoters. As proof of concept we examined the role of the exoribonuclease XRN2 in transcription termination by RNAseq. PMID:29590189

Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease.

PubMed

Trapani, Ivana; Toriello, Elisabetta; de Simone, Sonia; Colella, Pasqualina; Iodice, Carolina; Polishchuk, Elena V; Sommella, Andrea; Colecchi, Linda; Rossi, Settimio; Simonelli, Francesca; Giunti, Massimo; Bacci, Maria L; Polishchuk, Roman S; Auricchio, Alberto

2015-12-01

Stargardt disease (STGD1) due to mutations in the large ABCA4 gene is the most common inherited macular degeneration in humans. We have shown that dual adeno-associated viral (AAV) vectors effectively transfer ABCA4 to the retina of Abca4-/- mice. However, they express both lower levels of transgene compared with a single AAV and truncated proteins. To increase productive dual AAV concatemerization, which would overcome these limitations, we have explored the use of either various regions of homology or heterologous inverted terminal repeats (ITR). In addition, we tested the ability of various degradation signals to decrease the expression of truncated proteins. We found the highest levels of transgene expression using regions of homology based on either alkaline phosphatase or the F1 phage (AK). The use of heterologous ITR does not decrease the levels of truncated proteins relative to full-length ABCA4 and impairs AAV vector production. Conversely, the inclusion of the CL1 degradation signal results in the selective degradation of truncated proteins from the 5'-half without affecting full-length protein production. Therefore, we developed dual AAV hybrid ABCA4 vectors including homologous ITR2, the photoreceptor-specific G protein-coupled receptor kinase 1 promoter, the AK region of homology and the CL1 degradation signal. We show that upon subretinal administration these vectors are both safe in pigs and effective in Abca4-/- mice. Our data support the use of improved dual AAV vectors for gene therapy of STGD1. © The Author 2015. Published by Oxford University Press.

Foamy Virus Vector-mediated Gene Correction of a Mouse Model of Wiskott–Aldrich Syndrome

PubMed Central

Uchiyama, Toru; Adriani, Marsilio; Jagadeesh, G Jayashree; Paine, Adam; Candotti, Fabio

2012-01-01

The Wiskott–Aldrich syndrome (WAS) is an X-linked disorder characterized by eczema, thrombocytopenia and immunodeficiency. Hematopoietic cell transplantation can cure the disease and gene therapy is being tested as an alternative treatment option. In this study, we assessed the use of foamy virus (FV) vectors as a gene transfer system for WAS, using a Was knockout (KO) mouse model. Preliminary experiments using FV vectors expressing the green fluorescent protein under the transcriptional control of the endogenous WAS promoter or a ubiquitously acting chromatin opening element allowed us to define transduction conditions resulting in high (>40%) and long-term in-vivo marking of blood cells after transplantation. In following experiments, Was KO mice were treated with FV vectors containing the human WAS complementary DNA (cDNA). Transplanted animals expressed the WAS protein (WASp) in T and B lymphocytes, as well as platelets and showed restoration of both T-cell receptor-mediated responses and B-cell migration. We also observed recovery of platelet adhesion and podosome formation in dendritic cells (DCs) of treated mice. These data demonstrate that FV vectors can be effective for hematopoietic stem cell (HSC)-directed gene correction of WAS. PMID:22215016

High-level recombinant protein expression in transgenic plants by using a double-inducible viral vector

PubMed Central

Werner, Stefan; Breus, Oksana; Symonenko, Yuri; Marillonnet, Sylvestre; Gleba, Yuri

2011-01-01

We describe here a unique ethanol-inducible process for expression of recombinant proteins in transgenic plants. The process is based on inducible release of viral RNA replicons from stably integrated DNA proreplicons. A simple treatment with ethanol releases the replicon leading to RNA amplification and high-level protein production. To achieve tight control of replicon activation and spread in the uninduced state, the viral vector has been deconstructed, and its two components, the replicon and the cell-to-cell movement protein, have each been placed separately under the control of an inducible promoter. Transgenic Nicotiana benthamiana plants incorporating this double-inducible system demonstrate negligible background expression, high (over 0.5 × 104-fold) induction multiples, and high absolute levels of protein expression upon induction (up to 4.3 mg/g fresh biomass). The process can be easily scaled up, supports expression of practically important recombinant proteins, and thus can be directly used for industrial manufacturing. PMID:21825158

Lentiviral Gene Therapy Using Cellular Promoters Cures Type 1 Gaucher Disease in Mice

PubMed Central

Dahl, Maria; Doyle, Alexander; Olsson, Karin; Månsson, Jan-Eric; Marques, André R A; Mirzaian, Mina; Aerts, Johannes M; Ehinger, Mats; Rothe, Michael; Modlich, Ute; Schambach, Axel; Karlsson, Stefan

2015-01-01

Gaucher disease is caused by an inherited deficiency of the enzyme glucosylceramidase. Due to the lack of a fully functional enzyme, there is progressive build-up of the lipid component glucosylceramide. Insufficient glucosylceramidase activity results in hepatosplenomegaly, cytopenias, and bone disease in patients. Gene therapy represents a future therapeutic option for patients unresponsive to enzyme replacement therapy and lacking a suitable bone marrow donor. By proof-of-principle experiments, we have previously demonstrated a reversal of symptoms in a murine disease model of type 1 Gaucher disease, using gammaretroviral vectors harboring strong viral promoters to drive glucosidase β-acid (GBA) gene expression. To investigate whether safer vectors can correct the enzyme deficiency, we utilized self-inactivating lentiviral vectors (SIN LVs) with the GBA gene under the control of human phosphoglycerate kinase (PGK) and CD68 promoter, respectively. Here, we report prevention of, as well as reversal of, manifest disease symptoms after lentiviral gene transfer. Glucosylceramidase activity above levels required for clearance of glucosylceramide from tissues resulted in reversal of splenomegaly, reduced Gaucher cell infiltration and a restoration of hematological parameters. These findings support the use of SIN-LVs with cellular promoters in future clinical gene therapy protocols for type 1 Gaucher disease. PMID:25655314

Gene encoding plant asparagine synthetase

DOEpatents

Coruzzi, Gloria M.; Tsai, Fong-Ying

1993-10-26

The identification and cloning of the gene(s) for plant asparagine synthetase (AS), an important enzyme involved in the formation of asparagine, a major nitrogen transport compound of higher plants is described. Expression vectors constructed with the AS coding sequence may be utilized to produce plant AS; to engineer herbicide resistant plants, salt/drought tolerant plants or pathogen resistant plants; as a dominant selectable marker; or to select for novel herbicides or compounds useful as agents that synchronize plant cells in culture. The promoter for plant AS, which directs high levels of gene expression and is induced in an organ specific manner and by darkness, is also described. The AS promoter may be used to direct the expression of heterologous coding sequences in appropriate hosts.

Expression of human argininosuccinate synthetase after retroviral-mediated gene transfer.

PubMed

Wood, P A; Partridge, C A; O'Brien, W E; Beaudet, A L

1986-09-01

The cDNA sequence for human argininosuccinate synthetase (AS) was introduced into plasmid expression vectors with an SV40 promoter or Rous sarcoma virus promoter to construct pSV2-AS and pRSV-AS, respectively, and human enzyme was synthesized after gene transfer into Chinese hamster cells. The functional cDNA was inserted into the retroviral vectors pZIP-NeoSV(X) and pZIP-NeoSV(B). Ecotropic AS retrovirus was produced after calcium-phosphate-mediated gene transfer of these constructions into the packaging cell line psi-2, and viral titers up to 10(5) CFU/ml were obtained. Recombinant AS retrovirus was evaluated by detecting G-418-resistant colonies after infection of the rodent cells, XC, NRK, and 3T3. Colonies were also obtained when infected XC cells were selected in citrulline medium for expression of AS activity. Southern blot analysis of infected cells demonstrated that the recombinant retroviral genome was not altered grossly after infecting some rodent cells, while other cells showed evidence of rearrangement. A rapid assay for detecting AS retrovirus was developed based on the incorporation of [14C]citrulline into protein by intact 3T3 cells or XC cells.

Stable zymomonas mobilis xylose and arabinose fermenting strains

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

2008-04-08

The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome.

PubMed

Ren, He-Lin; Hu, Yuan; Guo, Ya-Jun; Li, Lu-Lin

2016-06-01

Within Baculoviridae, little is known about the molecular mechanisms of replication in betabaculoviruses, despite extensive studies in alphabaculoviruses. In this study, the promoters of nine late genes of the betabaculovirus Plutella xylostella granulovirus (PlxyGV) were cloned into a transient expression vector and the alphabaculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) genome, and compared with homologous late gene promoters of AcMNPV in Sf9 cells. In transient expression assays, all PlxyGV late promoters were activated in cells transfected with the individual reporter plasmids together with an AcMNPV bacmid. In infected cells, reporter gene expression levels with the promoters of PlxyGV e18 and AcMNPV vp39 and gp41 were significantly higher than those of the corresponding AcMNPV or PlxyGV promoters, which had fewer late promoter motifs. Observed expression levels were lower for the PlxyGV p6.9, pk1, gran, p10a, and p10b promoters than for the corresponding AcMNPV promoters, despite equal numbers of late promoter motifs, indicating that species-specific elements contained in some late promoters were favored by the native viral RNA polymerases for optimal transcription. The 8-nt sequence TAAATAAG encompassing the ATAAG motif was conserved in the AcMNPV polh, p10, and pk1 promoters. The 5-nt sequence CAATT located 4 or 5 nt upstream of the T/ATAAG motif was conserved in the promoters of PlxyGV gran, p10c, and pk1. The results of this study demonstrated that PlxyGV late gene promoters could be effectively activated by the RNA polymerase from AcMNPV, implying that late gene expression systems are regulated by similar mechanisms in alphabaculoviruses and betabaculoviruses.

Gene Transfer to Chicks Using Lentiviral Vectors Administered via the Embryonic Chorioallantoic Membrane

PubMed Central

Hen, Gideon; Yosefi, Sara; Shinder, Dmitry; Or, Adi; Mygdal, Sivan; Condiotti, Reba; Galun, Eithan; Bor, Amir; Sela-Donenfeld, Dalit; Friedman-Einat, Miriam

2012-01-01

The lack of affordable techniques for gene transfer in birds has inhibited the advancement of molecular studies in avian species. Here we demonstrate a new approach for introducing genes into chicken somatic tissues by administration of a lentiviral vector, derived from the feline immunodeficiency virus (FIV), into the chorioallantoic membrane (CAM) of chick embryos on embryonic day 11. The FIV-derived vectors carried yellow fluorescent protein (YFP) or recombinant alpha-melanocyte-stimulating hormone (α-MSH) genes, driven by the cytomegalovirus (CMV) promoter. Transgene expression, detected in chicks 2 days after hatch by quantitative real-time PCR, was mostly observed in the liver and spleen. Lower expression levels were also detected in the brain, kidney, heart and breast muscle. Immunofluorescence and flow cytometry analyses confirmed transgene expression in chick tissues at the protein level, demonstrating a transduction efficiency of ∼0.46% of liver cells. Integration of the viral vector into the chicken genome was demonstrated using genomic repetitive (CR1)-PCR amplification. Viability and stability of the transduced cells was confirmed using terminal deoxynucleotidyl transferase (dUTP) nick end labeling (TUNEL) assay, immunostaining with anti-proliferating cell nuclear antigen (anti-PCNA), and detection of transgene expression 51 days post transduction. Our approach led to only 9% drop in hatching efficiency compared to non-injected embryos, and all of the hatched chicks expressed the transgenes. We suggest that the transduction efficiency of FIV vectors combined with the accessibility of the CAM vasculature as a delivery route comprise a new powerful and practical approach for gene delivery into somatic tissues of chickens. Most relevant is the efficient transduction of the liver, which specializes in the production and secretion of proteins, thereby providing an optimal target for prolonged study of secreted hormones and peptides. PMID:22606269

An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation

PubMed Central

Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.

2008-01-01

Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809

Characterization of a lactose-responsive promoter of ATP-binding cassette (ABC) transporter gene from Lactobacillus acidophilus 05-172.

PubMed

Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu

2017-09-01

A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Identification, characterization and use of two tick promoters for construction of a dual luciferase reporter vector

USDA-ARS?s Scientific Manuscript database

Dual luciferase reporter systems are valuable tools for functional genomic studies, but have not previously been developed for use in tick cell culture. We evaluated expression of available luciferase constructs in tick cell cultures derived from Rhipicephalus (Boophilus) microplus, an important vec...

Adenovirus vector covalently conjugated to polyethylene glycol with a cancer-specific promoter suppresses the tumor growth through systemic administration.

PubMed

Yao, Xinglei; Yoshioka, Yasuo; Morishige, Tomohiro; Eto, Yusuke; Narimatsu, Shogo; Mizuguchi, Hiroyuki; Mukai, Yohei; Okada, Naoki; Nakagawa, Shinsaku

2010-01-01

Cancer gene therapy with adenovirus vectors (Adv) is limited to local administration because systemic administration of Adv produces a weak therapeutic effect and severe side effects. Previously, we generated a dual cancer-specific Adv system by using Adv covalently conjugated to polyethylene glycol (PEG) for transductional targeting and the telomere reverse transcriptase (TERT) promoter as a cancer-specific promoter for transcriptional targeting (PEG-Ad-TERT). We demonstrated that systemic administration of PEG-Ad-TERT showed superior antitumor effects against lung metastatic cancer with negligible side effects. Here, we investigated the therapeutic efficacy of systemic administration of PEG-Ad-TERT for the treatment of primary tumors. We first evaluated the transgene expression of PEG-Ad-TERT containing the luciferase gene (PEG-Ad-TERT/Luc) in primary tumors. Systemic administration of PEG-Ad-TERT/Luc resulted high transgene expression, similar to that observed in tumors for the conventional cytomegalovirus (CMV) promoter-driven Adv containing the luciferase gene (Ad-CMV/Luc). By comparison, transgene expression was 2500-fold lower than that of Ad-CMV/Luc in liver. We then examined the therapeutic effect of systemic administration of PEG-Ad-TERT containing the herpes simplex virus thymidine kinase (HSVtk) gene (PEG-Ad-TERT/HSVtk) for the treatment of primary tumors. We showed that PEG-Ad-TERT/HSVtk produced a notable antitumor effect against primary tumors with negligible side effects. These results demonstrated that PEG-Ad-TERT can be regarded as a prototype Adv with suitable efficacy and safety for systemic cancer gene therapy against both metastatic and primary tumors.

Regulation of Id2 expression in EL4 T lymphoma cells overexpressing growth hormone.

PubMed

Weigent, Douglas A

2009-01-01

In previous studies, we have shown that overexpression of growth hormone (GH) in cells of the immune system upregulates proteins involved in cell growth and protects from apoptosis. Here, we report that overexpression of GH in EL4 T lymphoma cells (GHo) also significantly increased levels of the inhibitor of differentiation-2 (Id2). The increase in Id2 was suggested in both Id2 promoter luciferase assays and by Western analysis for Id2 protein. To identify the regulatory elements that mediate transcriptional activation by GH in the Id2 promoter, promoter deletion analysis was performed. Deletion analysis revealed that transactivation involved a 301-132bp region upstream to the Id2 transcriptional start site. The pattern in the human GHo Jurkat T lymphoma cell line paralleled that found in the mouse GHo EL4 T lymphoma cell line. Significantly less Id2 was detected in the nucleus of GHo EL4 T lymphoma cells compared to vector alone controls. Although serum increased the levels of Id2 in control vector alone cells, no difference was found in the total levels of Id2 in GHo EL4 T lymphoma cells treated with or without serum. The increase in Id2 expression in GHo EL4 T lymphoma cells measured by Id2 promoter luciferase expression and Western blot analysis was blocked by the overexpression of a dominant-negative mutant of STAT5. The results suggest that in EL4 T lymphoma cells overexpressing GH, there is an upregulation of Id2 protein that appears to involve STAT protein activity.

An E8 promoter-HSP terminator cassette promotes the high-level accumulation of recombinant protein predominantly in transgenic tomato fruits: a case study of miraculin.

PubMed

Kurokawa, Natsuko; Hirai, Tadayoshi; Takayama, Mariko; Hiwasa-Tanase, Kyoko; Ezura, Hiroshi

2013-04-01

The E8 promoter-HSP terminator expression cassette is a powerful tool for increasing the accumulation of recombinant protein in a ripening tomato fruit. Strong, tissue-specific transgene expression is a desirable feature in transgenic plants to allow the production of variable recombinant proteins. The expression vector is a key tool to control the expression level and site of transgene and recombinant protein expression in transgenic plants. The combination of the E8 promoter, a fruit-ripening specific promoter, and a heat shock protein (HSP) terminator, derived from heat shock protein 18.2 of Arabidopsis thaliana, produces the strong and fruit-specific accumulation of recombinant miraculin in transgenic tomato. Miraculin gene expression was driven by an E8 promoter and HSP terminator cassette (E8-MIR-HSP) in transgenic tomato plants, and the miraculin concentration was the highest in the ripening fruits, representing 30-630 μg miraculin of the gram fresh weight. The highest level of miraculin concentration among the transgenic tomato plant lines containing the E8-MIR-HSP cassette was approximately four times higher than those observed in a previous study using a constitutive 35S promoter and NOS terminator cassette (Hiwasa-Tanase et al. in Plant Cell Rep 30:113-124, 2011). These results demonstrate that the combination of the E8 promoter and HSP terminator cassette is a useful tool to increase markedly the accumulation of recombinant proteins in a ripening fruit-specific manner.

Gateway Vectors for Efficient Artificial Gene Assembly In Vitro and Expression in Yeast Saccharomyces cerevisiae

PubMed Central

Giuraniuc, Claudiu V.; MacPherson, Murray; Saka, Yasushi

2013-01-01

Construction of synthetic genetic networks requires the assembly of DNA fragments encoding functional biological parts in a defined order. Yet this may become a time-consuming procedure. To address this technical bottleneck, we have created a series of Gateway shuttle vectors and an integration vector, which facilitate the assembly of artificial genes and their expression in the budding yeast Saccharomyces cerevisiae. Our method enables the rapid construction of an artificial gene from a promoter and an open reading frame (ORF) cassette by one-step recombination reaction in vitro. Furthermore, the plasmid thus created can readily be introduced into yeast cells to test the assembled gene’s functionality. As flexible regulatory components of a synthetic genetic network, we also created new versions of the tetracycline-regulated transactivators tTA and rtTA by fusing them to the auxin-inducible degron (AID). Using our gene assembly approach, we made yeast expression vectors of these engineered transactivators, AIDtTA and AIDrtTA and then tested their functions in yeast. We showed that these factors can be regulated by doxycycline and degraded rapidly after addition of auxin to the medium. Taken together, the method for combinatorial gene assembly described here is versatile and would be a valuable tool for yeast synthetic biology. PMID:23675537

Expression of a heat-stable NADPH-dependent alcohol dehydrogenase from Thermoanaerobacter pseudethanolicus 39E in Clostridium thermocellum 1313 results in increased hydroxymethylfurfural resistance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Sun -Ki; Groom, Joseph; Chung, Daehwan

Resistance to deconstruction is a major limitation to the use of lignocellulosic biomass as a substrate for the production of fuels and chemicals. Consolidated bioprocessing (CBP), the use of microbes for the simultaneous hydrolysis of lignocellulose into soluble sugars and fermentation of the resulting sugars to products of interest, is a potential solution to this obstacle. The pretreatment of plant biomass, however, releases compounds that are inhibitory to the growth of microbes used for CBP. Heterologous expression of the Thermoanaerobacter pseudethanolicus 39E bdhA gene, that encodes an alcohol dehydrogenase, in Clostridium thermocellum significantly increased resistance to furan derivatives at concentrationsmore » found in acid-pretreated biomass. The mechanism of detoxification of hydroxymethylfurfural was shown to be primarily reduction using NADPH as the cofactor. In addition, we report the construction of new expression vectors for homologous and heterologous expression in C. thermocellum. These vectors use regulatory signals from both C. bescii (the S-layer promoter) and C. thermocellum (the enolase promoter) shown to efficiently drive expression of the BdhA enzyme. Toxic compounds present in lignocellulose hydrolysates that inhibit cell growth and product formation are obstacles to the commercialization of fuels and chemicals from biomass. Lastly, expression of genes that reduce the effect of these inhibitors, such as furan derivatives, will serve to enable commercial processes using plant biomass for the production of fuels and chemicals.« less

Validation of the use of an artificial mitochondrial reporter DNA vector containing a Cytomegalovirus promoter for mitochondrial transgene expression.

PubMed

Yamada, Yuma; Ishikawa, Takuya; Harashima, Hideyoshi

2017-08-01

Mitochondria have their own gene expression system that is independent of the nuclear system, and control cellular functions in cooperation with the nucleus. While a number of useful technologies for achieving nuclear transgene expression have been reported, only a few have focused on mitochondria. In this study, we validated the utility of an artificial mitochondrial DNA vector with a virus promoter on mitochondrial transgene expression. We designed and constructed pCMV-mtLuc (CGG) that contains a CMV promotor derived from Cytomegalovirus and an artificial mitochondrial genome with a NanoLuc (Nluc) luciferase gene that records adjustments to the mitochondrial codon system. Nluc luciferase activity measurements showed that the pCMV-mtLuc (CGG) efficiently produced the Nluc luciferase protein in human HeLa cells. Moreover, we optimized the mitochondrial transfection of pCMV-mtLuc (CGG) using a MITO-Porter system, a liposome-based carrier for mitochondrial delivery via membrane fusion. As a result, we found that transfection of pCMV-mtLuc (CGG) by MITO-Porter modified with the KALA peptide (cationic amphipathic cell-penetrating peptide) showed a high mitochondrial transgene expression. The developed mitochondrial transgene expression system represents a potentially useful tool for the fields of nanoscience and nanotechnology for controlling the intracellular microenvironment via the regulation of mitochondrial function and promises to open additional innovative research fields of study. Copyright © 2017 Elsevier Ltd. All rights reserved.

Expression of a heat-stable NADPH-dependent alcohol dehydrogenase from Thermoanaerobacter pseudethanolicus 39E in Clostridium thermocellum 1313 results in increased hydroxymethylfurfural resistance

DOE PAGES

Kim, Sun -Ki; Groom, Joseph; Chung, Daehwan; ...

2017-03-15

Resistance to deconstruction is a major limitation to the use of lignocellulosic biomass as a substrate for the production of fuels and chemicals. Consolidated bioprocessing (CBP), the use of microbes for the simultaneous hydrolysis of lignocellulose into soluble sugars and fermentation of the resulting sugars to products of interest, is a potential solution to this obstacle. The pretreatment of plant biomass, however, releases compounds that are inhibitory to the growth of microbes used for CBP. Heterologous expression of the Thermoanaerobacter pseudethanolicus 39E bdhA gene, that encodes an alcohol dehydrogenase, in Clostridium thermocellum significantly increased resistance to furan derivatives at concentrationsmore » found in acid-pretreated biomass. The mechanism of detoxification of hydroxymethylfurfural was shown to be primarily reduction using NADPH as the cofactor. In addition, we report the construction of new expression vectors for homologous and heterologous expression in C. thermocellum. These vectors use regulatory signals from both C. bescii (the S-layer promoter) and C. thermocellum (the enolase promoter) shown to efficiently drive expression of the BdhA enzyme. Toxic compounds present in lignocellulose hydrolysates that inhibit cell growth and product formation are obstacles to the commercialization of fuels and chemicals from biomass. Lastly, expression of genes that reduce the effect of these inhibitors, such as furan derivatives, will serve to enable commercial processes using plant biomass for the production of fuels and chemicals.« less

Both retinoic-acid-receptor- and retinoid-X-receptor-dependent signalling pathways mediate the induction of the brown-adipose-tissue-uncoupling-protein-1 gene by retinoids.

PubMed Central

Alvarez, R; Checa, M; Brun, S; Viñas, O; Mampel, T; Iglesias, R; Giralt, M; Villarroya, F

2000-01-01

The intracellular pathways and receptors mediating the effects of retinoic acid (RA) on the brown-fat-uncoupling-protein-1 gene (ucp-1) have been analysed. RA activates transcription of ucp-1 and the RA receptor (RAR) is known to be involved in this effect. However, co-transfection of an expression vector for retinoid-X receptor (RXR) increases the action of 9-cis RA but not the effects of all-trans RA on the ucp-1 promoter in brown adipocytes. Either RAR-specific ¿p-[(E)-2-(5,6,7,8,-tetrahydro-5,5,8, 8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid¿ or RXR-specific [isopropyl-(E,E)-(R,S)-11-methoxy-3,7, 11-trimethyldodeca-2,4-dienoate, or methoprene] synthetic compounds increase the expression of UCP-1 mRNA and the activity of chloramphenicol acetyltransferase expression vectors driven by the ucp-1 promoter. The RXR-mediated action of 9-cis RA requires the upstream enhancer region at -2469/-2318 in ucp-1. During brown-adipocyte differentiation RXRalpha and RXRgamma mRNA expression is induced in parallel with UCP-1 mRNA, whereas the mRNA for the three RAR subtypes, alpha, beta and gamma, decreases. Co-transfection of murine expression vectors for the different RAR and RXR subtypes indicates that RARalpha and RARbeta as well as RXRalpha are the major retinoid-receptor subtypes capable of mediating the responsiveness of ucp-1 to retinoids. It is concluded that the effects of retinoids on ucp-1 transcription involve both RAR- and RXR-dependent signalling pathways. The responsiveness of brown adipose tissue to retinoids in vivo relies on a complex combination of the capacity of RAR and RXR subtypes to mediate ucp-1 induction and their distinct expression in the differentiated brown adipocyte. PMID:10600643

Lentivirus-mediated bifunctional cell labeling for in vivo melanoma study

PubMed Central

Day, Chi-Ping; Carter, John; Bonomi, Carrie; Esposito, Dominic; Crise, Bruce; Ortiz-Conde, Betty; Hollingshead, Melinda; Merlino, Glenn

2009-01-01

SUMMARY Lentiviral vectors (LVs) are capable of labeling a broad spectrum of cell types, achieving stable expression of transgenes. However, for in vivo studies, the duration of marker gene expression has been highly variable. We have developed a series of LVs harboring different promoters for expressing reporter gene in mouse cells. Long-term culture and colony formation of several LV-labeled mouse melanoma cells showed that promoters derived from mammalian house-keeping genes, especially those encoding RNA polymerase II (Pol2) and ferritin (FerH), provided the highest consistency for reporter expression. For in vivo studies, primary B16BL6 mouse melanoma were infected with LVs whose luciferase-GFP fusion gene (Luc/GFP) was driven by either Pol2 or FerH promoters. When transplanted into syngeneic C57BL/6 mice, Luc/GFP-labeled B16BL6 mouse melanoma cells can be monitored by bioluminescence imaging in vivo, and GFP-positive cells can be isolated from the tumors by FACS. Pol2-Luc/GFP labeling, while lower in activity, was more sustainable than FerH-Luc/GFP labeling in B16BL6 over consecutive passages into mice. We conclude that Pol-2-Luc/GFP labeling allows long-term in vivo monitoring and tumor cell isolation in immunocompetent mouse melanoma models. SIGNIFICANCE In this study we have developed and identified lentiviral vectors that allow labeled mouse melanoma cells to maintain long-term and consistent expression of a bifunctional luciferase-GFP marker gene, even in syngeneic mice with an intact immune function. This cell-labeling system can be used to build immunocompetent mouse melanoma models that permit both tumor monitoring and FACS-based tumor cell isolation from tissues, greatly facilitating the in vivo study of melanoma. PMID:19175523

A Preliminary Study on a Specifically Expressed Arabidopsis Promotor in Vascular Bundle

NASA Astrophysics Data System (ADS)

Yun-hong, Gu; Chuan-xiao, Xie; Li-fang, Wu; Zeng-liang, Yu; Guang-yong, Qin; Yu-ping, Huo

2003-04-01

From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonatrated through transformation.

On the efficient bio-incorporation of 5-hydroxy-tryptophan in recombinant proteins expressed in Escherichia coli with T7 RNA polymerase-based vectors.

PubMed

Oliveira-Souza, Wellington P; Bronze, Fellipe; Broos, Jaap; Marcondes, Marcelo F M; Oliveira, Vitor

2017-10-21

Biosynthetic incorporation of non-canonic amino acids is an attractive strategy to introduce new properties in recombinant proteins. Trp analogs can be incorporated in recombinant proteins replacing regular Trp during protein translation into a Trp-auxotrophic cell host. This straightforward method however, is limited to few analogs recognized and accepted by the cellular protein production machinery. 5-hydroxy-tryptophan (5OH-Trp) can be bio-incorporated using E. coli as expression host however; we have experienced very low incorporation yields - amount of protein containing regular Trp/amount of protein containing the Trp analog - during expressions of 5OH-Trp labeled proteins. Furthermore, this low incorporation yield were verified especially when the widely-used vectors based on the T7 RNA polymerase were used. Testing different 5OH-Trp incorporation protocols we verified that in these T7-based systems, the production of the T7 RNA polymerase is driven by the same elements - lac promoter/IPTG - as the target protein. Consequently, the bio-incorporation of the 5OH-Trp residues also occurs in this crucial enzyme, but, the produced T7 RNA polymerase labeled with 5OH-Trp is inactive or much less active. In the present work, we describe an efficient method to overcome this mentioned problem and bio-incorporate 5OH-Trp in proteins expressed in E. coli., using vectors based on the T7 RNA polymerase-T7 promoter. The two-step induction protocol here described showed incorporation efficiencies of 5OH-Trp higher than 90%. Copyright © 2017 Elsevier Inc. All rights reserved.

Recombination-activating gene 1 (Rag1)-deficient mice with severe combined immunodeficiency treated with lentiviral gene therapy demonstrate autoimmune Omenn-like syndrome.

PubMed

van Til, Niek P; Sarwari, Roya; Visser, Trudi P; Hauer, Julia; Lagresle-Peyrou, Chantal; van der Velden, Guus; Malshetty, Vidyasagar; Cortes, Patricia; Jollet, Arnaud; Danos, Olivier; Cassani, Barbara; Zhang, Fang; Thrasher, Adrian J; Fontana, Elena; Poliani, Pietro L; Cavazzana, Marina; Verstegen, Monique M A; Villa, Anna; Wagemaker, Gerard

2014-04-01

Recombination-activating gene 1 (RAG1) deficiency results in severe combined immunodeficiency (SCID) caused by a complete lack of T and B lymphocytes. If untreated, patients succumb to recurrent infections. We sought to develop lentiviral gene therapy for RAG1-induced SCID and to test its safety. Constructs containing the viral spleen-focus-forming virus (SF), ubiquitous promoters, or cell type-restricted promoters driving sequence-optimized RAG1 were compared for efficacy and safety in sublethally preconditioned Rag1(-/-) mice undergoing transplantation with transduced bone marrow progenitors. Peripheral blood CD3(+) T-cell reconstitution was achieved with SF, ubiquitous promoters, and cell type-restricted promoters but 3- to 18-fold lower than that seen in wild-type mice, and with a compromised CD4(+)/CD8(+) ratio. Mitogen-mediated T-cell responses and T cell-dependent and T cell-independent B-cell responses were not restored, and T-cell receptor patterns were skewed. Reconstitution of mature peripheral blood B cells was approximately 20-fold less for the SF vector than in wild-type mice and often not detectable with the other promoters, and plasma immunoglobulin levels were abnormal. Two months after transplantation, gene therapy-treated mice had rashes with cellular tissue infiltrates, activated peripheral blood CD44(+)CD69(+) T cells, high plasma IgE levels, antibodies against double-stranded DNA, and increased B cell-activating factor levels. Only rather high SF vector copy numbers could boost T- and B-cell reconstitution, but mRNA expression levels during T- and B-cell progenitor stages consistently remained less than wild-type levels. These results underline that further development is required for improved expression to successfully treat patients with RAG1-induced SCID while maintaining low vector copy numbers and minimizing potential risks, including autoimmune reactions resembling Omenn syndrome. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

HDM2 promotes WIP1-mediated medulloblastoma growth

PubMed Central

Buss, Meghan C.; Read, Tracy-Ann; Schniederjan, Matthew J.; Gandhi, Khanjan; Castellino, Robert C.

2012-01-01

Medulloblastoma is the most common malignant childhood brain tumor. The protein phosphatase and oncogene WIP1 is over-expressed or amplified in a significant number of primary human medulloblastomas and cell lines. In the present study, we examine an important mechanism by which WIP1 promotes medulloblastoma growth using in vitro and in vivo models. Human cell lines and intracerebellar xenografted animal models were used to study the role of WIP1 and the major TP53 regulator, HDM2, in medulloblastoma growth. Stable expression of WIP1 enhances growth of TP53 wild-type medulloblastoma cells, compared with cells with stable expression of an empty-vector or mutant WIP1. In an animal model, WIP1 enhances proliferation and reduces the survival of immunodeficient mice bearing intracerebellar xenografted human medulloblastoma cells. Cells with increased WIP1 expression also exhibit increased expression of HDM2. HDM2 knockdown or treatment with the HDM2 inhibitor Nutlin-3a, the active enantomer of Nutlin-3, specifically inhibits the growth of medulloblastoma cells with increased WIP1 expression. Nutlin-3a does not affect growth of medulloblastoma cells with stable expression of an empty vector or of mutant WIP1. Knockdown of WIP1 or treatment with the WIP1 inhibitor CCT007093 results in increased phosphorylation of known WIP1 targets, reduced HDM2 expression, and reduced growth specifically in WIP1 wild-type and high-expressing medulloblastoma cells. Combined WIP1 and HDM2 inhibition is more effective than WIP1 inhibition alone in blocking growth of WIP1 high-expressing medulloblastoma cells. Our preclinical study supports a role for therapies that target WIP1 and HDM2 in the treatment of medulloblastoma. PMID:22379189

In vitro and ex vivo analysis of CHRNA3 and CHRNA5 haplotype expression.

PubMed

Doyle, Glenn A; Wang, Min-Jung; Chou, Andrew D; Oleynick, John U; Arnold, Steven E; Buono, Russell J; Ferraro, Thomas N; Berrettini, Wade H

2011-01-01

Genome-wide association studies implicate variations in CHRNA5 and CHRNA3 as being associated with nicotine addiction (NA). Multiple common haplotypes ("risk", "mixed" and "protective") exist in Europeans; however, high linkage disequilibrium between variations in CHRNA5 and CHRNA3 makes assigning causative allele(s) for NA difficult through genotyping experiments alone. We investigated whether CHRNA5 or CHRNA3 promoter haplotypes, associated previously with NA, might influence allelic expression levels. For in vitro analyses, promoter haplotypes were sub-cloned into a luciferase reporter vector. When assessed in BE(2)-C cells, luciferase expression was equivalent among CHRNA3 haplotypes, but the combination of deletion at rs3841324 and variation at rs503464 decreased CHRNA5 promoter-derived luciferase activity, possibly due to loss of an SP-1 and other site(s). Variation within the CHRNA5 5'UTR at rs55853698 and rs55781567 also altered luciferase expression in BE(2)-C cells. Allelic expression imbalance (AEI) from the "risk" or "protective" haplotypes was assessed in post-mortem brain tissue from individuals heterozygous at coding polymorphisms in CHRNA3 (rs1051730) or CHRNA5 (rs16969968). In most cases, equivalent allelic expression was observed; however, one individual showed CHRNA5 AEI that favored the "protective" allele and that was concordant with heterozygosity at polymorphisms ∼13.5 kb upstream of the CHRNA5 transcription start site. Putative enhancer activity from these distal promoter elements was assessed using heterologous promoter constructs. We observed no differences in promoter activity from the two distal promoter haplotypes examined, but found that the distal promoter region strongly repressed transcription. We conclude that CHRNA5 promoter variants may affect relative risk for NA in some heterozygous individuals.

Selection of transduced CD34+ progenitors and enzymatic correction of cells from Gaucher patients, with bicistronic vectors.

PubMed Central

Migita, M; Medin, J A; Pawliuk, R; Jacobson, S; Nagle, J W; Anderson, S; Amiri, M; Humphries, R K; Karlsson, S

1995-01-01

The gene transfer efficiency of human hematopoietic stem cells is still inadequate for efficient gene therapy of most disorders. To overcome this problem, a selectable retroviral vector system for gene therapy has been developed for gene therapy of Gaucher disease. We constructed a bicistronic retroviral vector containing the human glucocerebrosidase (GC) cDNA and the human small cell surface antigen CD24 (243 bp). Expression of both cDNAs was controlled by the long terminal repeat enhancer/promoter of the Molony murine leukemia virus. The CD24 selectable marker was placed downstream of the GC cDNA and its translation was enhanced by inclusion of the long 5' untranslated region of encephalomyocarditis virus internal ribosomal entry site. Virus-producing GP+envAM12 cells were created by multiple supernatant transductions to create vector producer cells. The vector LGEC has a high titer and can drive expression of GC and the cell surface antigen CD24 simultaneously in transduced NIH 3T3 cells and Gaucher skin fibroblasts. These transduced cells have been successfully separated from untransduced cells by fluorescence-activated cell sorting, based on cell surface expression of CD24. Transduced and sorted NIH 3T3 cells showed higher GC enzyme activity than the unsorted population, demonstrating coordinated expression of both genes. Fibroblasts from Gaucher patients were transduced and sorted for CD24 expression, and GC enzyme activity was measured. The transduced sorted Gaucher fibroblasts had a marked increase in enzyme activity (149%) compared with virgin Gaucher fibroblasts (17% of normal GC enzyme activity). Efficient transduction of CD34+ hematopoietic progenitors (20-40%) was accomplished and fluorescence-activated cell sorted CD24(+)-expressing progenitors generated colonies, all of which (100%) were vector positive. The sorted, CD24-expressing progenitors generated erythroid burst-forming units, colony-forming units (CFU)-granulocyte, CFU-macrophage, CFU-granulocyte/macrophage, and CFU-mix hematopoietic colonies, demonstrating their ability to differentiate into these myeloid lineages in vitro. The transduced, sorted progenitors raised the GC enzyme levels in their progeny cells manyfold compared with untransduced CD34+ progenitors. Collectively, this demonstrates the development of high titer, selectable bicistronic vectors that allow isolation of transduced hematopoietic progenitors and cells that have been metabolically corrected. Images Fig. 2 Fig. 3 PMID:8618847

An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

2006-11-03

In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

Membrane-bound SIV envelope trimers are immunogenic in ferrets after intranasal vaccination with a replication-competent canine distemper virus vector.

PubMed

Zhang, Xinsheng; Wallace, Olivia; Wright, Kevin J; Backer, Martin; Coleman, John W; Koehnke, Rebecca; Frenk, Esther; Domi, Arban; Chiuchiolo, Maria J; DeStefano, Joanne; Narpala, Sandeep; Powell, Rebecca; Morrow, Gavin; Boggiano, Cesar; Zamb, Timothy J; Richter King, C; Parks, Christopher L

2013-11-01

We are investigating canine distemper virus (CDV) as a vaccine vector for the delivery of HIV envelope (Env) that closely resembles the native trimeric spike. We selected CDV because it will promote vaccine delivery to lymphoid tissues, and because human exposure is infrequent, reducing potential effects of pre-existing immunity. Using SIV Env as a model, we tested a number of vector and gene insert designs. Vectors containing a gene inserted between the CDV H and L genes, which encoded Env lacking most of its cytoplasmic tail, propagated efficiently in Vero cells, expressed the immunogen on the cell surface, and incorporated the SIV glycoprotein into progeny virus particles. When ferrets were vaccinated intranasally, there were no signs of distress, vector replication was observed in the gut-associated lymphoid tissues, and the animals produced anti-SIV Env antibodies. These data show that live CDV-SIV Env vectors can safely induce anti-Env immune responses following intranasal vaccination. © 2013 Elsevier Inc. All rights reserved.

Detection of neuroendocrine tumors using promoter-specific secreted Gaussia luciferase.

PubMed

Tseng, Alan Wei-Shun; Akerstrom, Victoria; Chen, Chiachen; Breslin, Mary B; Lan, Michael S

2016-01-01

Accurate detection of neuroendocrine (NE) tumors is critically important for better prognosis and treatment outcomes in patients. To demonstrate the efficacy of using an adenoviral vector for the detection of NE tumors, we have constructed a pair of adenoviral vectors which, in combination, can conditionally replicate and release Gaussia luciferase into the circulation after infecting the NE tumors. The expression of these two vectors is regulated upstream by an INSM1-promoter (insulinoma-associated-1) that is specifically active in NE tumors and developing NE tissues, but silenced in normal adult tissues. In order to retain the tumor-specificity of the INSM1 promoter, we have modified the promoter using the core insulator sequence from the chicken β-globin HS4 insulator and the neuronal restrictive silencing element (NRSE). This modified INSM1-promoter can retain NE tumor specificity in an adenoviral construct while driving a mutated adenovirus E1A gene (∆24E1A), the Metridia, or Gaussia luciferase gene. The in vitro cell line and mouse xenograft human tumor studies revealed the NE specificity of the INSM1-promoter in NE lung cancer, neuroblastoma, medulloblastoma, retinoblastoma, and insulinoma. When we combined the INSM1-promoter driven Gaussia luciferase with ∆24E1A, the co-infected NE tumor secreted higher levels of Gaussia luciferase as compared to the INSM1p-Gaussia virus alone. In a mouse subcutaneous xenograft tumor model, the combination viruses secreted detectable level of Gaussia luciferase after infecting an INSM1-positive NE lung tumor for ≥12 days. Therefore, the INSM1-promoter specific conditional replicating adenovirus represents a sensitive diagnostic tool to aid clinicians in the detection of NE tumors.

Gene expression systems in corynebacteria.

PubMed

Srivastava, Preeti; Deb, J K

2005-04-01

Corynebacterium belongs to a group of gram-positive bacteria having moderate to high G+C content, the other members being Mycobacterium, Nocardia, and Rhodococcus. Considerable information is now available on the plasmids, gene regulatory elements, and gene expression in corynebacteria, especially in soil corynebacteria such as Corynebacterium glutamicum. These bacteria are non-pathogenic and, unlike Bacillus and Streptomyces, are low in proteolytic activity and thus have the potential of becoming attractive systems for expression of heterologous proteins. This review discusses recent advances in our understanding of the organization of various regulatory elements, such as promoters, transcription terminators, and development of vectors for cloning and gene expression.

Aquaporin 5 Plays a Role in Estrogen-Induced Ectopic Implantation of Endometrial Stromal Cells in Endometriosis

PubMed Central

Jiang, Xiu Xiu; Fei, Xiang Wei; Zhao, Li; Ye, Xiao Lei; Xin, Liao Bin; Qu, Yang; Xu, Kai Hong; Wu, Rui Jin; Lin, Jun

2015-01-01

Aquaporin 5 (AQP5) participates in the migration of endometrial cells. Elucidation of the molecular mechanisms associated with AQP5-mediated, migration of endometrial cells may contribute to a better understanding of endometriosis. Our objectives included identifying the estrogen-response element (ERE) in the promoter region of the AQP5 gene, and, investigating the effects of AQP5 on ectopic implantation of endometrial cells. Luciferase reporter assays and electrophoretic mobility shift assay (EMSA) identified the ERE-like motif in the promoter region of the AQP5 gene. After blocking and up-regulating estradiol (E2) levels, we analysed the expression of AQP5 in endometrial stromal (ES) cells. After blocking E2 /or phosphatidylinositol 3 kinase(PI3K), we analysed the role of AQP5 in signaling pathways. We constructed an AQP5, shRNA, lentiviral vector to knock out the AQP5 gene in ES cells. After knock-out of the AQP5 gene, we studied the role of AQP5 in cell invasion, proliferation, and the formation of ectopic endometrial implants in female mice. We identified an estrogen-response element in the promoter region of the AQP5 gene. Estradiol (E2) increased AQP5 expression in a dose-dependent fashion, that was blocked by ICI182,780(an estrogen receptor inhibitor). E2 activated PI3K /protein kinase B(AKT) pathway (PI3K/AKT), that, in turn, increased AQP5 expression. LY294002(PI3K inhibitor) attenuated estrogen-enhanced, AQP5 expression. Knock-out of the AQP5 gene with AQP5 shRNA lentiviral vector significantly inhibited E2-enhanced invasion, proliferation of ES cells and formation of ectopic implants. Estrogen induces AQP5 expression by activating ERE in the promoter region of the AQP5gene, activates the PI3K/AKT pathway, and, promotes endometrial cell invasion and proliferation. These results provide new insights into some of the mechanisms that may underpin the development of deposits of ectopic endometrium. PMID:26679484

The Agrobacterium-mediated transformation of common wheat (Triticum aestivum L.) and triticale (x Triticosecale Wittmack): role of the binary vector system and selection cassettes.

PubMed

Bińka, Agnieszka; Orczyk, Wacław; Nadolska-Orczyk, Anna

2012-02-01

The influence of two binary vector systems, pGreen and pCAMBIA, on the Agrobacterium-mediated transformation ability of wheat and triticale was studied. Both vectors carried selection cassettes with bar or nptII driven by different promoters. Two cultivars of wheat, Kontesa and Torka, and one cultivar of triticale, Wanad, were tested. The transformation rates for the wheat cultivars ranged from 0.00 to 3.58% and from 0.00 to 6.79% for triticale. The best values for wheat were 3.58% for Kontesa and 3.14% for Torka, and these were obtained after transformation with the pGreen vector carrying the nptII selection gene under the control of 35S promoter. In the case of the bar selection system, the best transformation rates were, respectively, 1.46 and 1.79%. Such rates were obtained when the 35S::bar cassette was carried by the pCAMBIA vector; they were significantly lower with the pGreen vector. The triticale cultivar Wanad had its highest transformation rate after transformation with nptII driven by 35S in pCAMBIA. The bar selection system for the same triticale cultivar was better when the gene was driven by nos and the selection cassette was carried by pGreen. The integration of the transgenes was confirmed with at least three pairs of specific starters amplifying the fragments of nptII, bar, or gus. The expression of selection genes, measured by reverse transcriptase polymerase chain reaction (RT-PCR) in relation to the actin gene, was low, ranging from 0.00 to 0.63 for nptII and from 0.00 to 0.33 for bar. The highest relative transcript accumulation was observed for nptII driven by 35S and expressed in Kontesa that had been transformed with pGreen.

[GPER silence inhibits the stimulation of growth and inhibition of apoptosis induced by tamoxifen in breast cancer-associated fibroblasts].

PubMed

Yan, Yuzhao; Yu, Tenghua; Tu, Gang; Liu, Manran; Yuan, Jie; Yang, Guanglun

2015-09-01

To construct a lentiviral vector (Lenti-GPER-shRNA) targeting G-protein coupled estrogen receptor (GPER) and explore the role of GPER in the effect of tamoxifen on cell proliferation and apoptosis in breast cancer associated fibroblasts (BCAFs). The target sequence of GPER gene and negative control were cloned into lentiviral vectors. The recombinant lentivirus and control were extracted after HEK293T cells were transfected with the recombinant vector and helper vectors. After infection of BCAFs with the GPER lentiviral vector under the best interfering condition, GPER expression was detected by real-time quantitative PCR and Western blotting. BCAFs were divided into negative control group, GPER-RNAi group, negative control combined with tamoxifen (10(-8) mmol/L) group and GPER-RNAi combined with tamoxifen (10(-8) mmol/L) group. CCK-8 assay was used to detect the proliferation and annexin V-fluorescein isothiocyanate/propidium iodide (annexin V-FITC/PI) combined with flow cytometry was used to detect the apoptosis of BCAFs after the treatment of tamoxifen. Lenti-GPER-shRNA significantly interfered the expression of GPER in BCAFs. Tamoxifen promoted the growth of BCAFs, which could be attenuated by knockdown of GPER. Moreover, the apoptosis of BCAFs was reduced by tamoxifen, which was also reversed by knockdown of GPER. Lenti-GPER-shRNA could effectively silence the GPER expression in BCAFs. The ability of tamoxifen to accelerate cell proliferation and decrease cell apoptosis could be weakened by knockdown of GPER.

Dextran and protamine-based solid lipid nanoparticles as potential vectors for the treatment of X-linked juvenile retinoschisis.

PubMed

Delgado, Diego; del Pozo-Rodríguez, Ana; Solinís, Maria Ángeles; Avilés-Triqueros, Marcelino; Weber, Bernhard H F; Fernández, Eduardo; Gascón, Alicia R

2012-04-01

The goal of the present study was to analyze the potential application of nonviral vectors based on solid lipid nanoparticles (SLN) for the treatment of ocular diseases by gene therapy, specifically X-linked juvenile retinoschisis (XLRS). Vectors were prepared with SLN, dextran, protamine, and a plasmid (pCMS-EGFP or pCEP4-RS1). Formulations were characterized and the in vitro transfection capacity as well as the cellular uptake and the intracellular trafficking were studied in ARPE-19 cells. Formulations were also tested in vivo in Wistar rat eyes, and the efficacy was studied by monitoring the expression of enhanced green fluorescent protein (EGFP) after intravitreal, subretinal, and topical administration. The presence of dextran and protamine in the SLN improved greatly the expression of retinoschisin and EGFP in ARPE-19 cells. The nuclear localization signals of protamine, its ability to protect the DNA, and a shift in the entry mechanism from caveola-mediated to clathrin-mediated endocytosis promoted by the dextran, justify the increase in transfection. After ocular administration of the dextran-protamine-DNA-SLN complex to rat eyes, we detected the expression of EGFP in various types of cells depending on the administration route. Our vectors were also able to transfect corneal cells after topical application. We have demonstrated the potential usefulness of our nonviral vectors loaded with XLRS1 plasmid and provided evidence for their potential application for the management or treatment of degenerative retinal disorders as well as ocular surface diseases.

Inhibition of the binding of MSG-intermolt-specific complex, MIC, to the sericin-1 gene promoter and sericin-1 gene expression by POU-M1/SGF-3.

PubMed

Kimoto, Mai; Kitagawa, Tsuyuki; Kobayashi, Isao; Nakata, Tomohiro; Kuroiwa, Asato; Takiya, Shigeharu

2012-11-01

The sericin-1 gene encoding a glue protein is expressed in the middle silk gland (MSG) of the silkworm, Bombyx mori. A member of the class III POU domain transcription factors, POU-M1, was cloned as the factor bound to the SC site of the sericin-1 promoter and has been proposed to be a positive transcription factor. In this study, we analyzed the expression pattern of the POU-M1 gene in fourth and fifth instars in comparison with the pattern of the sericin-1 gene. The POU-M1 gene was expressed strongly in the region anterior to the sericin-1-expressing portion of the silk gland at both feeding stages. As the sericin-1-expressing region expands from the posterior to middle portions of the MSG in the fifth instar, the POU-M1-expressing region retreated from the middle to anterior portion. Introduction of the expression vector of POU-M1 into the silk glands by gene gun technology repressed promoter activity of the sericin-1 gene, suggesting that POU-M1 regulates the sericin-1 gene negatively. An in vitro binding assay showed that POU-M1 bound not only to the SC site but also to other promoter elements newly detected in vivo. Another spatiotemporal specific factor MIC binds to these elements, and POU-M1 competed with MIC to bind at the -70 site essential for promoter activity. These results suggest that POU-M1 is involved in restricting the anterior boundary of the sericin-1-expressing region in the silk gland by inhibiting the binding of the transcriptional activator to the promoter elements.

Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells.

PubMed

Tay, Felix Chang; Lim, Jia Kai; Zhu, Haibao; Hin, Lau Cia; Wang, Shu

2015-01-01

Widely observed dysregulation of microRNAs (miRNAs) in human cancer has led to substantial speculation regarding possible functions of these short, non-coding RNAs in cancer development and manipulation of miRNA expression to treat cancer. To achieve miRNA loss-of-function, miRNA sponge technology has been developed to use plasmid or viral vectors for intracellular expression of tandemly arrayed, bulged miRNA binding sites complementary to a miRNA target to saturate its ability to regulate natural mRNAs. A strong viral promoter can be used in miRNA sponge vectors to generate high-level expression of the competitive inhibitor transcripts for either transient or long-term inhibition of miRNA function. Taking the advantage of sharing a common seed sequence by members of a miRNA family, this technology is especially useful in knocking down the expression of a family of miRNAs, providing a powerful means for simultaneous inhibition of multiple miRNAs of interest with a single inhibitor. Knockdown of overexpressed oncogenic miRNAs with the technology can be a rational therapeutic strategy for cancer, whereas inhibition of tumor-suppressive miRNAs by the sponges will be useful in deciphering functions of miRNAs in oncogenesis. Herein, we discuss the design of miRNA sponge expression vectors and the use of the vectors to gain better understanding of miRNA's roles in cancer biology and as an alternative tool for anticancer gene therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

ACTIVE EFFLUX OF ORGANIC SOLVENTS BY PSEUDOMONAS PUTIDA S12 IS INDUCED BY SOLVENTS

EPA Science Inventory

Induction of the membrane-associated organic solvent efflux system SrpABC of Pseudomonas putida S12 was examined by cloning a 312-bp DNA fragment, containing the srp promoter, in the broad-host-range reporter vector pKRZ-1. Compounds that are capable of inducing expression of the...

Recent tissue engineering-based advances for effective rAAV-mediated gene transfer in the musculoskeletal system.

PubMed

Rey-Rico, Ana; Cucchiarini, Magali

2016-04-01

Musculoskeletal tissues are diverse and significantly different in their ability to repair upon injury. Current treatments often fail to reproduce the natural functions of the native tissue, leading to an imperfect healing. Gene therapy might improve the repair of tissues by providing a temporarily and spatially defined expression of the therapeutic gene(s) at the site of the injury. Several gene transfer vehicles have been developed to modify various human cells and tissues from musculoskeletal system among which the non-pathogenic, effective, and relatively safe recombinant adeno-associated viral (rAAV) vectors that have emerged as the preferred gene delivery system to treat human disorders. Adapting tissue engineering platforms to gene transfer approaches mediated by rAAV vectors is an attractive tool to circumvent both the limitations of the current therapeutic options to promote an effective healing of the tissue and the natural obstacles from these clinically adapted vectors to achieve an efficient and durable gene expression of the therapeutic sequences within the lesions.

HSV-mediated gene transfer of vascular endothelial growth factor to dorsal root ganglia prevents diabetic neuropathy

PubMed Central

Chattopadhyay, M; Krisky, D; Wolfe, D; Glorioso, JC; Mata, M; Fink, DJ

2005-01-01

We examined the utility of herpes simplex virus (HSV) vector-mediated gene transfer of vascular endothelial growth factor (VEGF) in a mouse model of diabetic neuropathy. A replication-incompetent HSV vector with VEGF under the control of the HSV ICP0 promoter (vector T0VEGF) was constructed. T0VEGF expressed and released VEGF from primary dorsal root ganglion (DRG) neurons in vitro, and following subcutaneous inoculation in the foot, expressed VEGF in DRG and nerve in vivo. At 2 weeks after induction of diabetes, subcutaneous inoculation of T0VEGF prevented the reduction in sensory nerve amplitude characteristic of diabetic neuropathy measured 4 weeks later, preserved autonomic function measured by pilocarpine-induced sweating, and prevented the loss of nerve fibers in the skin and reduction of neuropeptide calcitonin gene-related peptide and substance P in DRG neurons of the diabetic mice. HSV-mediated transfer of VEGF to DRG may prove useful in treatment of diabetic neuropathy. PMID:15843809

Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

PubMed Central

Hoffmann, Jana; Altenbuchner, Josef

2015-01-01

A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

Alphavirus vector-based replicon particles expressing multivalent cross-protective Lassa virus glycoproteins

PubMed Central

Wang, Min; Jokinen, Jenny; Tretyakova, Irina; Pushko, Peter; Lukashevich, Igor S.

2018-01-01

Lassa virus (LASV) is the most prevalent rodent-borne arenavirus circulated in West Africa. With population at risk from Senegal to Nigeria, LASV causes Lassa fever and is responsible for thousands of deaths annually. High genetic diversity of LASV is one of the challenges for vaccine R&D. We developed multivalent virus-like particle vectors (VLPVs) derived from the human Venezuelan equine encephalitis TC-83 IND vaccine (VEEV) as the next generation of alphavirus-based bicistronic RNA replicon particles. The genes encoding VEEV structural proteins were replaced with LASV glycoproteins (GPC) from distantly related clades I and IV with individual 26S promoters. Bicistronic RNA replicons encoding wild-type LASV GPC (GPCwt) and C-terminally deleted, non-cleavable modified glycoprotein (ΔGPfib), were encapsidated into VLPV particles using VEEV capsid and glycoproteins provided in trans. In transduced cells, VLPVs induced simultaneous expression of LASV GPCwt and ΔGPfib from 26S alphavirus promoters. LASV ΔGPfib was predominantly expressed as trimers, accumulated in the endoplasmic reticulum, induced ER stress and apoptosis promoting antigen cross-priming. VLPV vaccines were immunogenic and protective in mice and upregulated CD11c+/CD8+ dendritic cells playing the major role in cross-presentation. Notably, VLPV vaccination resulted in induction of cross-reactive multifunctional T cell responses after stimulation of immune splenocytes with peptide cocktails derived from LASV from clades I-IV. Multivalent RNA replicon-based LASV vaccines can be applicable for first responders, international travelers visiting endemic areas, military and lab personnel. PMID:29287681

The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression

PubMed Central

Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie

2004-01-01

Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene expression in the mice livers, which did not produce the therapeutic effects on alteration the lipid levels or the inhibition of atherosclerosis development. In contrast, the ribozyme RB15 RNA mediated by scAAV2-TTR-RB15 vector was expressed immediately at day-1 after transduction in HepG2 cells. The apoB mRNA levels were decreased 47% (p = 0.001), compared to the control vector scAAV2-TTR-RB15-mutant. Conclusion This study provided evidence that the rAAV2 single-strand vector mediated a prolonged but not efficient transduction in mouse liver. However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells. This strategy using scAAV2 vectors represents a better approach to express small molecules such as ribozyme. PMID:15193153

A piggyBac-based reporter system for scalable in vitro and in vivo analysis of 3′ untranslated region-mediated gene regulation

PubMed Central

Chaudhury, Arindam; Kongchan, Natee; Gengler, Jon P.; Mohanty, Vakul; Christiansen, Audrey E.; Fachini, Joseph M.; Martin, James F.; Neilson, Joel R.

2014-01-01

Regulation of messenger ribonucleic acid (mRNA) subcellular localization, stability and translation is a central aspect of gene expression. Much of this control is mediated via recognition of mRNA 3′ untranslated regions (UTRs) by microRNAs (miRNAs) and RNA-binding proteins. The gold standard approach to assess the regulation imparted by a transcript's 3′ UTR is to fuse the UTR to a reporter coding sequence and assess the relative expression of this reporter as compared to a control. Yet, transient transfection approaches or the use of highly active viral promoter elements may overwhelm a cell's post-transcriptional regulatory machinery in this context. To circumvent this issue, we have developed and validated a novel, scalable piggyBac-based vector for analysis of 3′ UTR-mediated regulation in vitro and in vivo. The vector delivers three independent transcription units to the target genome—a selection cassette, a turboGFP control reporter and an experimental reporter expressed under the control of a 3′ UTR of interest. The pBUTR (piggyBac-based 3′ UnTranslated Region reporter) vector performs robustly as a siRNA/miRNA sensor, in established in vitro models of post-transcriptional regulation, and in both arrayed and pooled screening approaches. The vector is robustly expressed as a transgene during murine embryogenesis, highlighting its potential usefulness for revealing post-transcriptional regulation in an in vivo setting. PMID:24753411

Overexpression of IL-10 in C2D macrophages promotes a macrophage phenotypic switch in adipose tissue environments.

PubMed

Xie, Linglin; Fu, Qiang; Ortega, Teresa M; Zhou, Lun; Rasmussen, Dane; O'Keefe, Jacy; Zhang, Ke K; Chapes, Stephen K

2014-01-01

Adipose tissue macrophages are a heterogeneous collection of classically activated (M1) and alternatively activated (M2) macrophages. Interleukin 10 (IL-10) is an anti-inflammatory cytokine, secreted by a variety of cell types including M2 macrophages. We generated a macrophage cell line stably overexpressing IL-10 (C2D-IL10) and analyzed the C2D-IL10 cells for several macrophage markers after exposure to adipocytes compared to C2D cells transfected with an empty vector (C2D-vector). C2D-IL10 macrophage cells expressed more CD206 when co-cultured with adipocytes than C2D-vector cells; while the co-cultured cell mixture also expressed higher levels of Il4, Il10, Il1β and Tnf. Since regular C2D cells traffic to adipose tissue after adoptive transfer, we explored the impact of constitutive IL-10 expression on C2D-IL10 macrophages in adipose tissue in vivo. Adipose tissue-isolated C2D-IL10 cells increased the percentage of CD206(+), CD301(+), CD11c(-)CD206(+) (M2) and CD11c(+)CD206(+) (M1b) on their cell surface, compared to isolated C2D-vector cells. These data suggest that the expression of IL-10 remains stable, alters the C2D-IL10 macrophage cell surface phenotype and may play a role in regulating macrophage interactions with the adipose tissue.

Fluorescent protein vectors for pancreatic islet cell identification in live-cell imaging.

PubMed

Shuai, Hongyan; Xu, Yunjian; Yu, Qian; Gylfe, Erik; Tengholm, Anders

2016-10-01

The islets of Langerhans contain different types of endocrine cells, which are crucial for glucose homeostasis. β- and α-cells that release insulin and glucagon, respectively, are most abundant, whereas somatostatin-producing δ-cells and particularly pancreatic polypeptide-releasing PP-cells are more scarce. Studies of islet cell function are hampered by difficulties to identify the different cell types, especially in live-cell imaging experiments when immunostaining is unsuitable. The aim of the present study was to create a set of vectors for fluorescent protein expression with cell-type-specific promoters and evaluate their applicability in functional islet imaging. We constructed six adenoviral vectors for expression of red and green fluorescent proteins controlled by the insulin, preproglucagon, somatostatin, or pancreatic polypeptide promoters. After transduction of mouse and human islets or dispersed islet cells, a majority of the fluorescent cells also immunostained for the appropriate hormone. Recordings of the sub-plasma membrane Ca(2+) and cAMP concentrations with a fluorescent indicator and a protein biosensor, respectively, showed that labeled cells respond to glucose and other modulators of secretion and revealed a striking variability in Ca(2+) signaling among α-cells. The measurements allowed comparison of the phase relationship of Ca(2+) oscillations between different types of cells within intact islets. We conclude that the fluorescent protein vectors allow easy identification of specific islet cell types and can be used in live-cell imaging together with organic dyes and genetically encoded biosensors. This approach will facilitate studies of normal islet physiology and help to clarify molecular defects and disturbed cell interactions in diabetic islets.

Efficient and sustained IGF-1 expression in the adipose tissue-derived stem cells mediated via a lentiviral vector.

PubMed

Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao

2015-02-01

The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.

Balancing Cell Migration with Matrix Degradation Enhances Gene Delivery to Cells Cultured Three-Dimensionally Within Hydrogels

PubMed Central

Shepard, Jaclyn A.; Huang, Alyssa; Shikanova, Ariella; Shea, Lonnie D.

2010-01-01

In regenerative medicine, hydrogels are employed to fill defects and support the infiltration of cells that can ultimately regenerate tissue. Gene delivery within hydrogels targeting infiltrating cells has the potential to promote tissue formation, but the delivery efficiency of nonviral vectors within hydrogels is low hindering their applicability in tissue regeneration. To improve their functionality, we have conducted a mechanistic study to investigate the contribution of cell migration and matrix degradation on gene delivery. In this report, lipoplexes were entrapped within hydrogels based on poly(ethylene glycol) (PEG) crosslinked with peptides containing matrix metalloproteinase degradable sequences. The mesh size of these hydrogels is substantially less than the size of the entrapped lipoplexes, which can function to retain vectors. Cell migration and transfection were simultaneously measured within hydrogels with varying density of cell adhesion sites (Arg-Gly-Asp peptides) and solids content. Increasing RGD density increased expression levels up to 100-fold, while greater solids content sustained expression levels for 16 days. Increasing RGD density and decreasing solids content increased cell migration, which indicates expression levels increase with increased cell migration. Initially exposing cells to vector resulted in transient expression that declined after 2 days, verifying the requirement of migration to sustain expression. Transfected cells were predominantly located within the population of migrating cells for hydrogels that supported cell migration. Although the small mesh size retained at least 70% of the lipoplexes in the absence of cells after 32 days, the presence of cells decreased retention to 10% after 16 days. These results indicate that vectors retained within hydrogels contact migrating cells, and that persistent cell migration can maintain elevated expression levels. Thus matrix degradation and cell migration are fundamental design parameters for maximizing gene delivery from hydrogels. PMID:20450944

Placenta Growth Factor in Diabetic Wound Healing

PubMed Central

Cianfarani, Francesca; Zambruno, Giovanna; Brogelli, Laura; Sera, Francesco; Lacal, Pedro Miguel; Pesce, Maurizio; Capogrossi, Maurizio C.; Failla, Cristina Maria; Napolitano, Monica; Odorisio, Teresa

2006-01-01

Reduced microcirculation and diminished expression of growth factors contribute to wound healing impairment in diabetes. Placenta growth factor (PlGF), an angiogenic mediator promoting pathophysiological neovascularization, is expressed during cutaneous wound healing and improves wound closure by enhancing angiogenesis. By using streptozotocin-induced diabetic mice, we here demonstrate that PlGF induction is strongly reduced in diabetic wounds. Diabetic transgenic mice overexpressing PlGF in the skin displayed accelerated wound closure compared with diabetic wild-type littermates. Moreover, diabetic wound treatment with an adenovirus vector expressing the human PlGF gene (AdCMV.PlGF) significantly accelerated the healing process compared with wounds treated with a control vector. The analysis of treated wounds showed that PlGF gene transfer improved granulation tissue formation, maturation, and vascularization, as well as monocytes/macrophages local recruitment. Platelet-derived growth factor, fibroblast growth factor-2, and vascular endothelial growth factor mRNA levels were increased in AdCMV.PlGF-treated wounds, possibly enhancing PlGF-mediated effects. Finally, PlGF treatment stimulated cultured dermal fibroblast migration, pointing to a direct role of PlGF in accelerating granulation tissue maturation. In conclusion, our data indicate that reduced PlGF expression contributes to impaired wound healing in diabetes and that PlGF gene transfer to diabetic wounds exerts therapeutic activity by promoting different aspects of the repair process. PMID:17003476

Integration of adeno-associated virus vectors in CD34+ human hematopoietic progenitor cells after transduction.

PubMed

Fisher-Adams, G; Wong, K K; Podsakoff, G; Forman, S J; Chatterjee, S

1996-07-15

Gene transfer vectors based on adeno-associated virus (AAV) appear promising because of their high transduction frequencies regardless of cell cycle status and ability to integrate into chromosomal DNA. We tested AAV-mediated gene transfer into a panel of human bone marrow or umbilical cord-derived CD34+ hematopoietic progenitor cells, using vectors encoding several transgenes under the control of viral and cellular promoters. Gene transfer was evaluated by (1) chromosomal integration of vector sequences and (2) analysis of transgene expression. Southern hybridization and fluorescence in situ hybridization analysis of transduced CD34 genomic DNA showed the presence of integrated vector sequences in chromosomal DNA in a portion of transduced cells and showed that integrated vector sequences were replicated along with cellular DNA during mitosis. Transgene expression in transduced CD34 cells in suspension cultures and in myeloid colonies differentiating in vitro from transduced CD34 cells approximated that predicted by the multiplicity of transduction. This was true in CD34 cells from different donors, regardless of the transgene or selective pressure. Comparisons of CD34 cell transduction either before or after cytokine stimulation showed similar gene transfer frequencies. Our findings suggest that AAV transduction of CD34+ hematopoietic progenitor cells is efficient, can lead to stable integration in a population of transduced cells, and may therefore provide the basis for safe and efficient ex vivo gene therapy of the hematopoietic system.

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

Persistence of RSV promotes proliferation and epithelial-mesenchymal transition of bronchial epithelial cells through Nodal signaling.

PubMed

Xiang, Zhao; Liang, Zhang; Yanfeng, Huang; Leitao, Kang

2017-10-01

Nodal may play an important role in the development of cancers. The present study was designed to determine the effects of Nodal induced by respiratory syncytial virus (RSV) infection on the occurrence and development of lung cancer and the underlying mechanisms. After verification of RSV infection by observation of cytopathic effect and indirect immunofluorescence, real-time PCR, Western blot and methylation assays were used to verify the influence of RSV on Nodal expression. Then, a Nodal overexpressed vector was constructed and the effects of Nodal on the proliferation and apoptosis of bronchial epithelial cells (BECs) and epithelial-mesenchymal transition (EMT) were assayed by flow cytometry and Western blot, respectively. Moreover, Lefty and pSmad2/3 were assayed by Western blot and Cyclin D1, CDK4, c-myc and Bcl-2 induced by Nodal overepression or RSV infection were also assayed by real-time PCR. The results showed that Nodal over expression and demethylation of the promoter were observed in BECs after RSV infection. Activation of Nodal promoted proliferation, colony formation and EMT and inhibited apoptosis of BECs. Nodal also promoted malignant change by promoting expression of cyclin D1 and related-dependent kinase and inhibiting apoptosis. Besides, RSV infection inhibited Lefty expression and promoted the activation of pSmad2/3. RSV also promoted Cyclin D1, CDK4, c-myc and Bcl-2 expression through the activation of pSmad2/3. Our data showed that persistence of RSV promoted the proliferation, epithelial-mesenchymal transition and expression of oncogenes through Nodal signaling, which may be associated with the occurrence and development of lung cancers.

Lentiviral gene ontology (LeGO) vectors equipped with novel drug-selectable fluorescent proteins: new building blocks for cell marking and multi-gene analysis.

PubMed

Weber, K; Mock, U; Petrowitz, B; Bartsch, U; Fehse, B

2010-04-01

Vector-encoded fluorescent proteins (FPs) facilitate unambiguous identification or sorting of gene-modified cells by fluorescence-activated cell sorting (FACS). Exploiting this feature, we have recently developed lentiviral gene ontology (LeGO) vectors (www.LentiGO-Vectors.de) for multi-gene analysis in different target cells. In this study, we extend the LeGO principle by introducing 10 different drug-selectable FPs created by fusing one of the five selection marker (protecting against blasticidin, hygromycin, neomycin, puromycin and zeocin) and one of the five FP genes (Cerulean, eGFP, Venus, dTomato and mCherry). All tested fusion proteins allowed both fluorescence-mediated detection and drug-mediated selection of LeGO-transduced cells. Newly generated codon-optimized hygromycin- and neomycin-resistance genes showed improved expression as compared with their ancestors. New LeGO constructs were produced at titers >10(6) per ml (for non-concentrated supernatants). We show efficient combinatorial marking and selection of various cells, including mesenchymal stem cells, simultaneously transduced with different LeGO constructs. Inclusion of the cytomegalovirus early enhancer/chicken beta-actin promoter into LeGO vectors facilitated robust transgene expression in and selection of neural stem cells and their differentiated progeny. We suppose that the new drug-selectable markers combining advantages of FACS and drug selection are well suited for numerous applications and vector systems. Their inclusion into LeGO vectors opens new possibilities for (stem) cell tracking and functional multi-gene analysis.

Induction of neural differentiation by electrically stimulated gene expression of NeuroD2.

PubMed

Mie, Masayasu; Endoh, Tamaki; Yanagida, Yasuko; Kobatake, Eiry; Aizawa, Masuo

2003-02-13

Regulation of cell differentiation is an important assignment for cellular engineering. One of the techniques for regulation is gene transfection into undifferentiated cells. Transient expression of NeuroD2, one of neural bHLH transcription factors, converted mouse N1E-115 neuroblastoma cells into differentiated neurons. The regulation of neural bHLH expression should be a novel strategy for cell differentiation. In this study, we tried to regulate neural differentiation by NeuroD2 gene inserted under the control of heat shock protein-70 (HSP) promoter, which can be activated by electrical stimulation. Mouse neuroblastoma cell line, N1E-115, was stably transfected with expression vector containing mouse NeuroD2 cDNA under HSP promoter. Transfected cells were cultured on the electrode surface and applied electrical stimulation. After stimulation, NeuroD2 expression was induced, and transfected cells adopt a neuronal morphology at 3 days after stimulation. These results suggest that neural differentiation can be induced by electrically stimulated gene expression of NeuroD2.

Immune responses in pigs induced by recombinant canine adenovirus 2 expressing the glycoprotein 5 of porcine reproductive and respiratory syndrome virus.

PubMed

Zhou, J-X; Xue, J-D; Yu, T; Zhang, J-B; Liu, Y; Jiang, N; Li, Y-L; Hu, R-L

2010-04-01

To develop a new type vaccine for porcine reproductive and respiratory syndrome (PRRS) prevention by using canine adenovirus 2(CAV-2) as vector, the Glycoprotein 5(GP5) gene from PRRSV strain JL was amplified by RT-PCR, and the expression cassette of GP5 was constructed using the human cytomegalovirus (HCMV) promoter and the simian virus 40 (SV40) early mRNA polyadenylation signal. The expression cassette of Glycoprotein 5 was cloned into the CAV-2 genome in which E3 region had been partly deleted, and the recombinant virus (CAV-2-GP5) was obtained by transfecting the recombinant CAV-2-GP5 genome into MDCK cells together with Lipofectamine 2000. Immunization trial in pigs with the recombinant virus CAV-2-GP5 showed that CAV-2-GP5 could stimulate a specific immune response to PRRSV. Immune response to the GP5 and PRRSV was confirmed by ELISA, neutralization test and lymphocyte proliferative responses, and western blotting confirmed expression of GP5 by the vector in cells. These results indicated that CAV-2 may serve as a vector for development of PRRSV vaccine in pigs, and the CAV-2-GP5 might be a candidate vaccine to be tested for preventing PRRSV infection.

Promotion of spinosad biosynthesis by chromosomal integration of the Vitreoscilla hemoglobin gene in Saccharopolyspora spinosa.

PubMed

Luo, Yushuang; Kou, Xiaoxiao; Ding, Xuezhi; Hu, Shengbiao; Tang, Ying; Li, Wenping; Huang, Fan; Yang, Qi; Chen, Hanna; Xia, Liqiu

2012-02-01

To promote spinosad biosynthesis by improving the limited oxygen supply during high-density fermentation of Saccharopolyspora spinosa, the open reading frame of the Vitreoscilla hemoglobin gene was placed under the control of the promoter for the erythromycin resistance gene by splicing using overlapping extension PCR. This was cloned into the integrating vector pSET152, yielding the Vitreoscilla hemoglobin gene expression plasmid pSET152EVHB. This was then introduced into S. spinosa SP06081 by conjugal transfer, and integrated into the chromosome by site-specific recombination at the integration site ΦC31 on pSET152EVHB. The resultant conjugant, S. spinosa S078-1101, was genetically stable. The integration was further confirmed by PCR and Southern blotting analysis. A carbon monoxide differential spectrum assay showed that active Vitreoscilla hemoglobin was successfully expressed in S. spinosa S078-1101. Fermentation results revealed that expression of the Vitreoscilla hemoglobin gene significantly promoted spinosad biosynthesis under normal oxygen and moderately oxygen-limiting conditions (P<0.01). These findings demonstrate that integrating expression of the Vitreoscilla hemoglobin gene improves oxygen uptake and is an effective means for the genetic improvement of S. spinosa fermentation.

Inhibition of Choroidal Neovascularization by Intravenous Injection of Adenoviral Vectors Expressing Secretable Endostatin

PubMed Central

Mori, Keisuke; Ando, Akira; Gehlbach, Peter; Nesbitt, David; Takahashi, Kyoichi; Goldsteen, Donna; Penn, Michael; Chen, Cheauyan T.; Mori, Keiko; Melia, Michele; Phipps, Sandrina; Moffat, Diana; Brazzell, Kim; Liau, Gene; Dixon, Katharine H.; Campochiaro, Peter A.

2001-01-01

Endostatin is a cleavage product of collagen XVIII that inhibits tumor angiogenesis and growth. Interferon α2a blocks tumor angiogenesis and causes regression of hemangiomas, but has no effect on choroidal neovascularization (CNV). Therefore, inhibitors of tumor angiogenesis do not necessarily inhibit ocular neovascularization. In this study, we used an intravenous injection of adenoviral vectors containing a sig-mEndo transgene consisting of murine immunoglobulin κ-chain leader sequence coupled to sequence coding for murine endostatin to investigate the effect of high serum levels of endostatin on CNV in mice. Mice injected with a construct in which sig-mEndo expression was driven by the Rous sarcoma virus promoter had moderately high serum levels of endostatin and significantly smaller CNV lesions at sites of laser-induced rupture of Bruch’s membrane than mice injected with null vector. Mice injected with a construct in which sig-mEndo was driven by the simian cytomegalovirus promoter had ∼10-fold higher endostatin serum levels and had nearly complete prevention of CNV. There was a strong inverse correlation between endostatin serum level and area of CNV. This study provides proof of principle that gene therapy to increase levels of endostatin can prevent the development of CNV and may provide a new treatment for the leading cause of severe loss of vision in patients with age-related macular degeneration. PMID:11438478

Viability of long-term gene therapy in the cochlea.

PubMed

Atkinson, Patrick J; Wise, Andrew K; Flynn, Brianna O; Nayagam, Bryony A; Richardson, Rachael T

2014-04-22

Gene therapy has been investigated as a way to introduce a variety of genes to treat neurological disorders. An important clinical consideration is its long-term effectiveness. This research aims to study the long-term expression and effectiveness of gene therapy in promoting spiral ganglion neuron survival after deafness. Adenoviral vectors modified to express brain derived neurotrophic factor or neurotrophin-3 were unilaterally injected into the guinea pig cochlea one week post ototoxic deafening. After six months, persistence of gene expression and significantly greater neuronal survival in neurotrophin-treated cochleae compared to the contralateral cochleae were observed. The long-term gene expression observed indicates that gene therapy is potentially viable; however the degeneration of the transduced cells as a result of the original ototoxic insult may limit clinical effectiveness. With further research aimed at transducing stable cochlear cells, gene therapy may be an efficacious way to introduce neurotrophins to promote neuronal survival after hearing loss.

Use of in vivo Expression Technology for the Identification of Putative Host Adaptation Factors of the Lyme Disease Spirochete.

PubMed

Casselli, Timothy; Bankhead, Troy

2015-01-01

The causative agent of Lyme disease, Borrelia burgdorferi, is an obligate parasite that requires either a tick vector or a mammalian host for survival. Identification of the bacterial genes that are specifically expressed during infection of the mammalian host could provide targets for novel therapeutics and vaccines. In vivo expression technology (IVET) is a reporter-based promoter trap system that utilizes selectable markers to identify promoters of bacterial host-specific genes. Using previously characterized genes for in vivo and in vitro selection, this study utilized an IVET system that allows for selection of B. burgdorferi sequences that act as active promoters only during murine infection. This promoter trap system was able to successfully distinguish active promoter sequences both in vivo and in vitro from control sequences and a library of cloned B. burgdorferi genomic fragments. However, a bottleneck effect during the experimental mouse infection limited the utility for genome-wide promoter screening. Overall, IVET was demonstrated as a tool for the identification of in vivo-induced promoter elements of B. burgdorferi, and the observed infection bottleneck apparent using a polyclonal infection pool provides insight into the dynamics of experimental infection with B. burgdorferi. © 2015 S. Karger AG, Basel.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu Hui; Wu Jihong; Li Huiming

The interaction of vascular endothelial growth factor (VEGF) and its receptors (Flt-1, Flk-1/KDR) is correlated with neovascularization in the eyes. Therefore, blocking the binding of VEGF and the corresponding receptor has become critical for inhibiting corneal neovascularization. In this study, we have expressed the cDNA for sFlk-1 under the control of cytomegalovirus immediate-early promoter (CMV) from an E1/partial E3 deleted replication defective recombinant adenovirus, and Ad.sflk-1 expression was determined by Western blotting. We have shown that conditioned media from Ad.sflk-1-infected ARPE-19 cells significantly reduced VEGF-induced human umbilical vein endothelial cells (HUVEC) and murine endothelial cells (SVEC) proliferation in vitro comparedmore » with the control vector. In vivo, adenoviral vectors expressing green fluorescent protein alone (Ad.GFP) were utilized to monitor gene transfer to the cornea. Moreover, in the models of corneal neovascularization, the injection of Ad.sflk-1 (10{sup 8} PFU) into the anterior chamber could significantly inhibit angiogenic changes compared with Ad.null-injected and vehicle-injected models. Immunohistochemical analysis showed that corneal endothelial cells and corneal stroma of cauterized rat eyes were efficiently transduced and expressed sFlk-1. These results not only support that adenoviral vectors are capable of high-level transgene expression but also demonstrate that Ad.sflk-1 gene therapy might be a feasible approach for inhibiting the development of corneal neovascularization.« less

Simultaneous neuron- and astrocyte-specific fluorescent marking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schulze, Wiebke; Hayata-Takano, Atsuko; Kamo, Toshihiko

2015-03-27

Systematic and simultaneous analysis of multiple cell types in the brain is becoming important, but such tools have not yet been adequately developed. Here, we aimed to generate a method for the specific fluorescent labeling of neurons and astrocytes, two major cell types in the brain, and we have developed lentiviral vectors to express the red fluorescent protein tdTomato in neurons and the enhanced green fluorescent protein (EGFP) in astrocytes. Importantly, both fluorescent proteins are fused to histone 2B protein (H2B) to confer nuclear localization to distinguish between single cells. We also constructed several expression constructs, including a tandem alignmentmore » of the neuron- and astrocyte-expression cassettes for simultaneous labeling. Introducing these vectors and constructs in vitro and in vivo resulted in cell type-specific and nuclear-localized fluorescence signals enabling easy detection and distinguishability of neurons and astrocytes. This tool is expected to be utilized for the simultaneous analysis of changes in neurons and astrocytes in healthy and diseased brains. - Highlights: • We develop a method for the specific fluorescent labeling of neurons and astrocytes. • Neuron-specific labeling is achieved using Scg10 and synapsin promoters. • Astrocyte-specific labeling is generated using the minimal GFAP promoter. • Nuclear localization of fluorescent proteins is achieved with histone 2B protein.« less

Enhancement of expression of survivin promoter-driven CD/TK double suicide genes by the nuclear matrix attachment region in transgenic gastric cancer cells.

PubMed

Niu, Ying; Li, Jian-Sheng; Luo, Xian-Run

2014-01-25

This work aimed to study a novel transgenic expression system of the CD/TK double suicide genes enhanced by the nuclear matrix attachment region (MAR) for gene therapy. The recombinant vector pMS-CD/TK containing the MAR-survivin promoter-CD/TK cassette was developed and transfected into human gastric cancer SGC-7901 cells. Expression of the CD/TK genes was detected by quantitative real-time PCR (qPCR) and Western blot. Cell viability and apoptosis were measured using the methyl thiazolyl tetrazolium (MTT) assay and flow cytometry. When the MAR fragment was inserted into the upstream of the survivin promoter, the qPCR result showed that the expression of the CD/TK genes significantly increased 7.7-fold in the transgenic SGC-7901 cells with plasmid pMS-CD/TK compared with that without MAR. MTT and flow cytometry analyses indicated that treatment with the prodrugs (5-FC+GCV) significantly decreased the cellular survival rate and enhanced the cellular apoptosis in the SGC-7901 cells. The expression of the CD/TK double suicide genes driven by the survivin promoter can be enhanced by the MAR fragment in human gastric cancer cells. Copyright © 2013 Elsevier B.V. All rights reserved.

Using viral vectors as gene transfer tools (Cell Biology and Toxicology Special Issue: ETCS-UK 1 day meeting on genetic manipulation of cells).

PubMed

Howarth, Joanna L; Lee, Youn Bok; Uney, James B

2010-02-01

In recent years, the development of powerful viral gene transfer techniques has greatly facilitated the study of gene function. This review summarises some of the viral delivery systems routinely used to mediate gene transfer into cell lines, primary cell cultures and in whole animal models. The systems described were originally discussed at a 1-day European Tissue Culture Society (ETCS-UK) workshop that was held at University College London on 1st April 2009. Recombinant-deficient viral vectors (viruses that are no longer able to replicate) are used to transduce dividing and post-mitotic cells, and they have been optimised to mediate regulatable, powerful, long-term and cell-specific expression. Hence, viral systems have become very widely used, especially in the field of neurobiology. This review introduces the main categories of viral vectors, focusing on their initial development and highlighting modifications and improvements made since their introduction. In particular, the use of specific promoters to restrict expression, translational enhancers and regulatory elements to boost expression from a single virion and the development of regulatable systems is described.

Analysis of the promoters involved in enterocin AS-48 expression.

PubMed

Cebrián, Rubén; Rodríguez-Ruano, Sonia; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes; Montalbán-López, Manuel

2014-01-01

The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene) and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2) and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2) promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2) promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.

Mesenchymal stem cells are efficiently transduced with adenoviruses bearing type 35-derived fibers and the transduced cells with the IL-28A gene produces cytotoxicity to lung carcinoma cells co-cultured.

PubMed

Suzuki, Takeo; Kawamura, Kiyoko; Li, Quanhai; Okamoto, Shinya; Tada, Yuji; Tatsumi, Koichiro; Shimada, Hideaki; Hiroshima, Kenzo; Yamaguchi, Naoto; Tagawa, Masatoshi

2014-09-25

Transduction of human mesenchymal stem cells (MSCs) with type 5 adenoviruses (Ad5) is limited in the efficacy because of the poor expression level of the coxsackie adenovirus receptor (CAR) molecules. We examined a possible improvement of Ad-mediated gene transfer in MSCs by substituting the fiber region of type 5 Ad with that of type 35 Ad. Expression levels of CAR and CD46 molecules, which are the major receptors for type 5 and type 35 Ad, respectively, were assayed with flow cytometry. We constructed vectors expressing the green fluorescent protein gene with Ad5 or modified Ad5 bearing the type 35 fiber region (AdF35), and examined the infectivity to MSCs with flow cytometry. We investigated anti-tumor effects of MSCs transduced with interleukin (IL)-28A gene on human lung carcinoma cells with a colorimetric assay. Expression of IL-28A receptors was tested with the polymerase chain reaction. A promoter activity of transcriptional regulatory regions in MSCs was determined with a luciferase assay and a tumor growth-promoting ability of MSCs was tested with co-injection of human tumor cells in nude mice. MSCs expressed CD46 but scarcely CAR molecules, and subsequently were transduced with AdF35 but not with Ad5. Growth of MSCs transduced with the IL-28A gene remained the same as that of untransduced cells since MSCs were negative for the IL-28A receptors. The IL-28A-transduced MSCs however suppressed growth of lung carcinoma cells co-cultured, whereas MSCs transduced with AdF35 expressing the β-galactosidase gene did not. A regulatory region of the cyclooygenase-2 gene possessed transcriptional activities greater than other tumor promoters but less than the cytomegalovirus promoter, and MSCs themselves did not support tumor growth in vivo. AdF35 is a suitable vector to transduce MSCs that are resistant to Ad5-mediated gene transfer. MSCs infected with AdF35 that activate an exogenous gene by the cytomegalovirus promoter can be a vehicle to deliver the gene product to targeted cells.

Expression of sunflower cytoplasmic male sterility-associated open reading frame, orfH522 induces male sterility in transgenic tobacco plants.

PubMed

Nizampatnam, Narasimha Rao; Doodhi, Harinath; Kalinati Narasimhan, Yamini; Mulpuri, Sujatha; Viswanathaswamy, Dinesh Kumar

2009-03-01

Sterility in the universally exploited PET1-CMS system of sunflower is associated with the expression of orfH522, a novel mitochondrial gene. Definitive evidence that ORFH522 is directly responsible for male sterility is lacking. To test the hypothesis that ORFH522 is sufficient to induce male sterility, a set of chimeric constructs were developed. The cDNA of orfH522 was cloned in-frame with yeast coxIV pre-sequence, and was expressed under tapetum-specific promoter TA29 (construct designated as TCON). For developing control vectors, orfH522 was cloned without the transit peptide under TA29 promoter (TON) or orfH522 was cloned with or without transit peptide under the constitutive CaMV35S promoter (SCOP and SOP). Among several independent transformants obtained with each of the gene cassettes, one third of the transgenics (6/17) with TCON were completely male sterile while more than 10 independent transformants obtained with each of the control vectors were fertile. The male sterile plants were morphologically similar to fertile plants, but had anthers that remained below the stigmatic surface at anthesis. RT-PCR analysis of the sterile plants confirmed the anther-specific expression of orfH522 and bright-field microscopy demonstrated ablation of the tapetal cell layer. Premature DNA fragmentation and programmed cell death was observed at meiosis stage in the anthers of sterile plants. Stable transmission of induced male sterility trait was confirmed in test cross progeny. This constitutes the first report at demonstrating the induction of male sterility by introducing orfH522 gene that could be useful for genetic engineering of male sterility.

Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.

PubMed

Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika

2013-01-01

Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.

Insulated piggyBac vectors for insect transgenesis

PubMed Central

Sarkar, Abhimanyu; Atapattu, Asela; Belikoff, Esther J; Heinrich, Jörg C; Li, Xuelei; Horn, Carsten; Wimmer, Ernst A; Scott, Maxwell J

2006-01-01

Background Germ-line transformation of insects is now a widely used method for analyzing gene function and for the development of genetically modified strains suitable for pest control programs. The most widely used transposable element for the germ-line transformation of insects is piggyBac. The site of integration of the transgene can influence gene expression due to the effects of nearby transcription enhancers or silent heterochromatic regions. Position effects can be minimized by flanking a transgene with insulator elements. The scs/scs' and gypsy insulators from Drosophila melanogaster as well as the chicken β-globin HS4 insulator function in both Drosophila and mammalian cells. Results To minimize position effects we have created a set of piggyBac transformation vectors that contain either the scs/scs', gypsy or chicken β-globin HS4 insulators. The vectors contain either fluorescent protein or eye color marker genes and have been successfully used for germ-line transformation of Drosophila melanogaster. A set of the scs/scs' vectors contains the coral reef fluorescent protein marker genes AmCyan, ZsGreen and DsRed that have not been optimized for translation in human cells. These marker genes are controlled by a combined GMR-3xP3 enhancer/promoter that gives particularly strong expression in the eyes. This is also the first report of the use of the ZsGreen and AmCyan reef fluorescent proteins as transformation markers in insects. Conclusion The insulated piggyBac vectors should protect transgenes against position effects and thus facilitate fine control of gene expression in a wide spectrum of insect species. These vectors may also be used for transgenesis in other invertebrate species. PMID:16776846

Efficient production of antibody Fab fragment by transient gene expression in insect cells.

PubMed

Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

2017-08-01

Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Plasmids for increased efficiency of vector construction and genetic engineering in filamentous fungi.

PubMed

Schoberle, Taylor J; Nguyen-Coleman, C Kim; May, Gregory S

2013-01-01

Fungal species are continuously being studied to not only understand disease in humans and plants but also to identify novel antibiotics and other metabolites of industrial importance. Genetic manipulations, such as gene deletion, gene complementation, and gene over-expression, are common techniques to investigate fungal gene functions. Although advances in transformation efficiency and promoter usage have improved genetic studies, some basic steps in vector construction are still laborious and time-consuming. Gateway cloning technology solves this problem by increasing the efficiency of vector construction through the use of λ phage integrase proteins and att recombination sites. We developed a series of Gateway-compatible vectors for use in genetic studies in a range of fungal species. They contain nutritional and drug-resistance markers and can be utilized to manipulate different filamentous fungal genomes. Copyright © 2013 Elsevier Inc. All rights reserved.

Prolonged recovery of retinal structure/function after gene therapy in an Rs1h-deficient mouse model of x-linked juvenile retinoschisis.

PubMed

Min, Seok H; Molday, Laurie L; Seeliger, Mathias W; Dinculescu, Astra; Timmers, Adrian M; Janssen, Andreas; Tonagel, Felix; Tanimoto, Naoyuki; Weber, Bernhard H F; Molday, Robert S; Hauswirth, William W

2005-10-01

X-linked juvenile retinoschisis (RS) is a common cause of juvenile macular degeneration in males. RS is characterized by cystic spoke-wheel-like maculopathy, peripheral schisis, and a negative (b-wave more reduced than a-wave) electroretinogram (ERG). These symptoms are due to mutations in the RS1 gene in Xp22.2 leading to loss of functional protein. No medical treatment is currently available. We show here that in an Rs1h-deficient mouse model of human RS, delivery of the human RS1 cDNA with an AAV vector restored expression of retinoschisin to both photoreceptors and the inner retina essentially identical to that seen in wild-type mice. More importantly, unlike an earlier study with a different AAV vector and promoter, this work shows for the first time that therapeutic gene delivery using a highly specific AAV5-opsin promoter vector leads to progressive and significant improvement in both retinal function (ERG) and morphology, with preservation of photoreceptor cells that, without treatment, progressively degenerate.

Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate

PubMed Central

Liang, Bo; Ngwuta, Joan O.; Surman, Sonja; Kabatova, Barbora; Liu, Xiang; Lingemann, Matthias; Liu, Xueqiao; Yang, Lijuan; Herbert, Richard; Swerczek, Joanna; Chen, Man; Moin, Syed M.; Kumar, Azad; McLellan, Jason S.; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

2017-01-01

ABSTRACT Respiratory syncytial virus (RSV) is the most important viral agent of severe pediatric respiratory tract disease worldwide, but it lacks a licensed vaccine or suitable antiviral drug. A live attenuated chimeric bovine/human parainfluenza virus type 3 (rB/HPIV3) was developed previously as a vector expressing RSV fusion (F) protein to confer bivalent protection against RSV and HPIV3. In a previous clinical trial in virus-naive children, rB/HPIV3 was well tolerated but the immunogenicity of wild-type RSV F was unsatisfactory. We previously modified RSV F with a designed disulfide bond (DS) to increase stability in the prefusion (pre-F) conformation and to be efficiently packaged in the vector virion. Here, we further stabilized pre-F by adding both disulfide and cavity-filling mutations (DS-Cav1), and we also modified RSV F codon usage to have a lower CpG content and a higher level of expression. This RSV F open reading frame was evaluated in rB/HPIV3 in three forms: (i) pre-F without vector-packaging signal, (ii) pre-F with vector-packaging signal, and (iii) secreted pre-F ectodomain trimer. Despite being efficiently expressed, the secreted pre-F was poorly immunogenic. DS-Cav1 stabilized pre-F, with or without packaging, induced higher titers of pre-F specific antibodies in hamsters, and improved the quality of RSV-neutralizing serum antibodies. Codon-optimized RSV F containing fewer CpG dinucleotides had higher F expression, replicated more efficiently in vivo, and was more immunogenic. The combination of DS-Cav1 pre-F stabilization, optimized codon usage, reduced CpG content, and vector packaging significantly improved vector immunogenicity and protective efficacy against RSV. This provides an improved vectored RSV vaccine candidate suitable for pediatric clinical evaluation. IMPORTANCE RSV and HPIV3 are the first and second leading viral causes of severe pediatric respiratory disease worldwide. Licensed vaccines or suitable antiviral drugs are not available. We are developing a chimeric rB/HPIV3 vector expressing RSV F as a bivalent RSV/HPIV3 vaccine and have been evaluating means to increase RSV F immunogenicity. In this study, we evaluated the effects of improved stabilization of F in the pre-F conformation and of codon optimization resulting in reduced CpG content and greater pre-F expression. Reduced CpG content dampened the interferon response to infection, promoting higher replication and increased F expression. We demonstrate that improved pre-F stabilization and strategic manipulation of codon usage, together with efficient pre-F packaging into vector virions, significantly increased F immunogenicity in the bivalent RSV/HPIV3 vaccine. The improved immunogenicity included induction of increased titers of high-quality complement-independent antibodies with greater pre-F site Ø binding and greater protection against RSV challenge. PMID:28539444

Development of recombinant Yarrowia lipolytica producing virus-like particles of a fish nervous necrosis virus.

PubMed

Luu, Van-Trinh; Moon, Hye Yun; Hwang, Jee Youn; Kang, Bo-Kyu; Kang, Hyun Ah

2017-08-01

Nervous necrosis virus (NNV) causes viral encephalopathy and retinopathy, a devastating disease of many species of cultured marine fish worldwide. In this study, we used the dimorphic non-pathogenic yeast Yarrowia lipolytica as a host to express the capsid protein of red-spotted grouper nervous necrosis virus (RGNNV-CP) and evaluated its potential as a platform for vaccine production. An initial attempt was made to express the codon-optimized synthetic genes encoding intact and N-terminal truncated forms of RGNNV-CP under the strong constitutive TEF1 promoter using autonomously replicating sequence (ARS)-based vectors. The full-length recombinant capsid proteins expressed in Y. lipolytica were detected not only as monomers and but also as trimers, which is a basic unit for formation of NNV virus-like particles (VLPs). Oral immunization of mice with whole recombinant Y. lipolytica harboring the ARS-based plasmids was shown to efficiently induce the formation of IgG against RGNNV-CP. To increase the number of integrated copies of the RGNNV-CP expression cassette, a set of 26S ribosomal DNA-based multiple integrative vectors was constructed in combination with a series of defective Ylura3 with truncated promoters as selection markers, resulting in integrants harboring up to eight copies of the RGNNV-CP cassette. Sucrose gradient centrifugation and transmission electron microscopy of this high-copy integrant were carried out to confirm the expression of RGNNV-CPs as VLPs. This is the first report on efficient expression of viral capsid proteins as VLPs in Y. lipolytica, demonstrating high potential for the Y. lipolytica expression system as a platform for recombinant vaccine production based on VLPs.

Construction of PR39 recombinant AAV under control of the HRE promoter and the effect of recombinant AAV on gene therapy of ischemic heart disease

PubMed Central

SUN, LIJUN; HAO, YUEWEN; NIE, XIAOWEI; ZHANG, XUEXIN; YANG, GUANGXIAO; WANG, QUANYING

2012-01-01

The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the immunohistochemical method and results showed that the expression was positive in the experimental group. Myocardium perfusion MRI displayed that the infracted area significantly decreased under the action of pSS-HRE-CMV-NT4-PR39-PolyA-AAV. The artificial minimal HRE in CRL-1730 cells effectively and rapidly regulates the expression of the downstream gene NT4-TAT-His-PR39 of the CMV promoter. Recombinant pSS-HRE-CMV-NT4-PR39-Poly-AAAV promotes neoangiogenesis in the ischemic area, reduces the area of infarction and improves heart function. PMID:23226731

Construction of PR39 recombinant AAV under control of the HRE promoter and the effect of recombinant AAV on gene therapy of ischemic heart disease.

PubMed

Sun, Lijun; Hao, Yuewen; Nie, Xiaowei; Zhang, Xuexin; Yang, Guangxiao; Wang, Quanying

2012-11-01

The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the immunohistochemical method and results showed that the expression was positive in the experimental group. Myocardium perfusion MRI displayed that the infracted area significantly decreased under the action of pSS-HRE-CMV-NT4-PR39-PolyA-AAV. The artificial minimal HRE in CRL-1730 cells effectively and rapidly regulates the expression of the downstream gene NT4-TAT-His-PR39 of the CMV promoter. Recombinant pSS-HRE-CMV-NT4-PR39-Poly-AAAV promotes neoangiogenesis in the ischemic area, reduces the area of infarction and improves heart function.

Development of an optimized tetracycline-inducible expression system to increase the accumulation of interleukin-10 in tobacco BY-2 suspension cells.

PubMed

Bortesi, Luisa; Rademacher, Thomas; Schiermeyer, Andreas; Schuster, Flora; Pezzotti, Mario; Schillberg, Stefan

2012-07-11

Plant cell suspension cultures can be used for the production of valuable pharmaceutical and industrial proteins. When the recombinant protein is secreted into the culture medium, restricting expression to a defined growth phase can improve both the quality and quantity of the recovered product by minimizing proteolytic activity. Temporal restriction is also useful for recombinant proteins whose constitutive expression affects cell growth and viability, such as viral interleukin-10 (vIL-10). We have developed a novel, tetracycline-inducible system suitable for tobacco BY-2 suspension cells which increases the yields of vIL-10. The new system is based on a binary vector that is easier to handle than conventional vectors, contains an enhanced inducible promoter and 5'-UTR to improve yields, and incorporates a constitutively-expressed visible marker gene to allow the rapid and straightforward selection of the most promising transformed clones. Stable transformation of BY-2 cells with this vector, without extensive optimization of the induction conditions, led to a 3.5 fold increase in vIL-10 levels compared to constitutive expression in the same host. We have developed an effective and straightforward molecular farming platform technology that improves both the quality and the quantity of recombinant proteins produced in plant cells, particularly those whose constitutive expression has a negative impact on plant growth and development. Although we tested the platform using vIL-10 produced in BY-2 cells, it can be applied to other host/product combinations and is also useful for basic research requiring strictly controlled transgene expression.

Single-Construct Polycistronic Doxycycline-Inducible Vectors Improve Direct Cardiac Reprogramming and Can Be Used to Identify the Critical Timing of Transgene Expression.

PubMed

Umei, Tomohiko C; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

2017-08-19

Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming.

Single-Construct Polycistronic Doxycycline-Inducible Vectors Improve Direct Cardiac Reprogramming and Can Be Used to Identify the Critical Timing of Transgene Expression

PubMed Central

Umei, Tomohiko C.; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

2017-01-01

Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming. PMID:28825623

Regulation of human heme oxygenase in endothelial cells by using sense and antisense retroviral constructs

PubMed Central

Quan, Shuo; Yang, Liming; Abraham, Nader G.; Kappas, Attallah

2001-01-01

Our objective was to determine whether overexpression and underexpression of human heme oxygenase (HHO)-1 could be controlled on a long-term basis by introduction of the HO-1 gene in sense (S) and antisense (AS) orientation with an appropriate vector into endothelial cells. Retroviral vector (LXSN) containing viral long terminal repeat promoter-driven human HO-1 S (LSN-HHO-1) and LXSN vectors containing HHO-1 promoter (HOP)-controlled HHO-1 S and AS (LSN-HOP-HHO-1 and LSN-HOP-HHO-1-AS) sequences were constructed and used to transfect rat lung microvessel endothelial cells (RLMV cells) and human dermal microvessel endothelial cells (HMEC-1 cells). RLMV cells transduced with HHO-1 S expressed human HO-1 mRNA and HO-1 protein associated with elevation in total HO activity compared with nontransduced cells. Vector-mediated expression of HHO-1 S or AS under control of HOP resulted in effective production of HO-1 or blocked induction of endogenous human HO-1 in HMEC-1 cells, respectively. Overexpression of HO-1 AS was associated with a long-term decrease (45%) of endogenous HO-1 protein and an increase (167%) in unmetabolized exogenous heme in HMEC-1 cells. Carbon monoxide (CO) production in HO-1 S- or AS-transduced HMEC-1 cells after heme treatment was increased (159%) or decreased (50%), respectively, compared with nontransduced cells. HO-2 protein levels did not change. These findings demonstrate that HHO-1 S and AS retroviral constructs are functional in enhancing and reducing HO activity, respectively, and thus can be used to regulate cellular heme levels, the activity of heme-dependent enzymes, and the rate of heme catabolism to CO and bilirubin. PMID:11593038

Regulation of human heme oxygenase in endothelial cells by using sense and antisense retroviral constructs.

PubMed

Quan, S; Yang, L; Abraham, N G; Kappas, A

2001-10-09

Our objective was to determine whether overexpression and underexpression of human heme oxygenase (HHO)-1 could be controlled on a long-term basis by introduction of the HO-1 gene in sense (S) and antisense (AS) orientation with an appropriate vector into endothelial cells. Retroviral vector (LXSN) containing viral long terminal repeat promoter-driven human HO-1 S (LSN-HHO-1) and LXSN vectors containing HHO-1 promoter (HOP)-controlled HHO-1 S and AS (LSN-HOP-HHO-1 and LSN-HOP-HHO-1-AS) sequences were constructed and used to transfect rat lung microvessel endothelial cells (RLMV cells) and human dermal microvessel endothelial cells (HMEC-1 cells). RLMV cells transduced with HHO-1 S expressed human HO-1 mRNA and HO-1 protein associated with elevation in total HO activity compared with nontransduced cells. Vector-mediated expression of HHO-1 S or AS under control of HOP resulted in effective production of HO-1 or blocked induction of endogenous human HO-1 in HMEC-1 cells, respectively. Overexpression of HO-1 AS was associated with a long-term decrease (45%) of endogenous HO-1 protein and an increase (167%) in unmetabolized exogenous heme in HMEC-1 cells. Carbon monoxide (CO) production in HO-1 S- or AS-transduced HMEC-1 cells after heme treatment was increased (159%) or decreased (50%), respectively, compared with nontransduced cells. HO-2 protein levels did not change. These findings demonstrate that HHO-1 S and AS retroviral constructs are functional in enhancing and reducing HO activity, respectively, and thus can be used to regulate cellular heme levels, the activity of heme-dependent enzymes, and the rate of heme catabolism to CO and bilirubin.

Heat-shock-mediated elimination of the nptII marker gene in transgenic apple (Malus×domestica Borkh.).

PubMed

Herzog, Katja; Flachowsky, Henryk; Deising, Holger B; Hanke, Magda-Viola

2012-04-25

Production of marker-free genetically modified (GM) plants is one of the major challenges of molecular fruit breeding. Employing clean vector technologies, allowing the removal of undesired DNA sequences from GM plants, this goal can be achieved. The present study describes the establishment of a clean vector system in apple Malus×domestica Borkh., which is based on the use of the neomycin phosphotransferase II gene (nptII) as selectable marker gene and kanamycin/paramomycin as selective agent. The nptII gene can be removed after selection of GM shoots via site-specific excision mediated by heat-shock-inducible expression of the budding yeast FLP recombinase driven by the soybean Gmhsp17.5-E promoter. We created a monitoring vector containing the nptII and the flp gene as a box flanked by two direct repeats of the flp recognition target (FRT) sites. The FRT-flanked box separates the gusA reporter gene from the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter. Consequently, GUS expression does only occur after elimination of the FRT-flanked box. Transformation experiments using the monitoring vector resulted in a total of nine transgenic lines. These lines were investigated for transgenicity by PCR, RT-PCR and Southern hybridization. Among different temperature regimes tested, exposure to 42 °C for 3.5 to 4h led to efficient induction of FLP-mediated recombination and removal of the nptII marker gene. A second round of shoot regeneration from leaf explants led to GM apple plants completely free of the nptII gene. Copyright © 2012 Elsevier B.V. All rights reserved.

Anti-tumor function of double-promoter regulated adenovirus carrying SEA gene, in the treatment of bladder cancer.

PubMed

Hu, Jianpeng; Xuan, Xujun; Han, Conghui; Hao, Lin; Zhang, Peiying; Chen, Meng; He, Houguang; Fan, Tao; Dong, Binzheng

2012-03-01

To construct an adenovirus carrying SEA gene and regulated by telomerase reverse transcriptase (hTERT) and hypoxia-inducible factor (HIF) promoters and investigate its anti-tumor function in vitro, as well as its role in lymphocyte production. hTERT and HIF genes were cloned into adenovirus E1A and E1B shuttle plasmids. The control vector for SEA gene expression is under the regulation of CMV and SV40 promoters. Double regulation was obtained through homologous recombination. The positive clones of replicable adenovirus H2-SEA-Ad were selected by plaque assay. The adenovirus was purified, titrated, and DNA was verified by PCR. The obtained virus was used to infect EJ bladder tumor cells and the SEA Mrna, and protein expression was measured by RT-PCR, western blot, and immunofluorescence microscopy, respectively. Co-culture of lymphocytes and tumor cells was observed dynamically under microscope. The construction of shuttle plasmid p315-CSS-SEA was confirmed by PCR and DNA sequencing. Insertion of superantigen SEA gene in adenovirus (H2-SEA-Ad.SEA) was obtained by homologous recombination. In lymphocytes and tumor cell co-culture, the number of viable tumor cells in test groups was significantly lower than that in control group after 12, 24, and 48 h of treatment. Production of interleukin-2, interleukin-4, and tumor necrosis factor were higher in test groups than in control group. Expression of SEA gene in bladder tumor cells by adenoviral vector caused reduced tumor cell proliferation, as well as stimulation of inflammatory cytokine productions in co-cultures with lymphocytes.

Seed specific expression and analysis of recombinant human adenosine deaminase (hADA) in three host plant species.

PubMed

Doshi, Ketan M; Loukanina, Natalia N; Polowick, Patricia L; Holbrook, Larry A

2016-10-01

The plant seed is a leading platform amongst plant-based storage systems for the production of recombinant proteins. In this study, we compared the activity of human adenosine deaminase (hADA) expressed in transgenic seeds of three different plant species: pea (Pisum sativum L.), Nicotiana benthamiana L. and tarwi (Lupinus mutabilis Sweet). All three species were transformed with the same expression vector containing the hADA gene driven by the seed-specific promoter LegA2 with an apoplast targeting pinII signal peptide. During the study, several independent transgenic lines were generated and screened from each plant species and only lines with a single copy of the gene of interest were used for hADA expression analysis. A stable transgenic canola line expressing the ADA protein, under the control of 35S constitutive promoter was used as both as a positive control and for comparative study with the seed specific promoter. Significant differences were detected in the expression of hADA. The highest activity of the hADA enzyme (Units/g seed) was reported in tarwi (4.26 U/g) followed by pea (3.23 U/g) and Nicotiana benthamiana (1.69 U/g). The expression of mouse ADA in canola was very low in both seed and leaf tissue compared to other host plants, confirming higher activity of seed specific promoter. Altogether, these results suggest that tarwi could be an excellent candidate for the production of valuable recombinant proteins.

Establishment of conditional vectors for hairpin siRNA knockdowns

PubMed Central

Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

2003-01-01

Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

Persistence of hAQP1 expression in human salivary gland cells following AdhAQP1 transduction is associated with a lack of methylation of hCMV promoter

PubMed Central

Zheng, C; Baum, BJ; Liu, X; Goldsmith, CM; Perez, P; Jang, S-I; Cotrim, AP; McCullagh, L; Ambudkar, IS; Alevizos, I

2017-01-01

In 2012, we reported that 5 out of 11 subjects in a clinical trial (NCT00372320) administering AdhAQP1 to radiation-damaged parotid glands showed increased saliva flow rates and decreased symptoms over the initial 42 days. AdhAQP1 is a first-generation, E1-deleted, replication-defective, serotype 5 adenoviral vector encoding human aquaporin-1 (hAQP1). This vector uses the human cytomegalovirus enhancer/promoter (hCMVp). As subject peak responses were at times much longer (7–42 days) than expected, we hypothesized that the hCMVp may not be methylated in human salivary gland cells to the extent previously observed in rodent salivary gland cells. This hypothesis was supported in human salivary gland primary cultures and human salivary gland cell lines after transduction with AdhAQP1. Importantly, hAQP1 maintained its function in those cells. Conversely, when we transduced mouse and rat cell lines in vitro and submandibular glands in vivo with AdhAQP1, the hCMVp was gradually methylated over time and associated with decreased hAQP1 expression and function in vitro and decreased hAQP1 expression in vivo. These data suggest that the hCMVp in AdhAQP1was probably not methylated in transduced human salivary gland cells of responding subjects, resulting in an unexpectedly longer functional expression of hAQP1. PMID:26177970

[Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

PubMed

Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

2008-10-01

To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

Partial complementation of the UV sensitivity of E. coli and yeast excision repair mutants by the cloned denV gene of bacteriophage T4.

PubMed

Chenevert, J M; Naumovski, L; Schultz, R A; Friedberg, E C

1986-04-01

The denV gene of bacteriophage T4 was reconstituted from two overlapping DNA fragments cloned in M13 vectors. The coding region of the intact gene was tailored into a series of plasmid vectors containing different promoters suitable for expression of the gene in E. coli and in yeast. Induction of the TAC promoter with IPTG resulted in overexpression of the gene, which was lethal to E. coli. Expression of the TACdenV gene in the absence of IPTG, or the use of the yeast GAL1 or ADH promoters resulted in partial complementation of the UV sensitivity of uvrA, uvrB, uvrC and recA mutants of E. coli and rad1, rad2, rad3, rad4 and rad10 mutants of S. cerevisiae. The extent of denV-mediated reactivation of excision-defective mutants was approximately equal to that of photoreactivation of such strains. Excision proficient E. coli cells transformed with a plasmid containing the denV gene were slightly more resistant to ultraviolet (UV) radiation than control cells without the denV gene. On the other hand, excision proficient yeast cells were slightly more sensitive to killing by UV radiation following transformation with a plasmid containing the denV gene. This effect was more pronounced in yeast mutants of the RAD52 epistasis group.

Generation of β-glucuronidase reporter-tagged strain to monitor Ustilaginoidea virens infection in rice.

PubMed

Andargie, Mebeaselassie; Yang, Chao; Li, Jianxiong

2016-12-01

An Agrobacterium-mediated genetic transformation system for the rice false smut fungus Ustilaginoidea virens was developed using conidia as recipients. A binary vector, pCAMBIA1301-P gpdA -GUS-T trpC , was constructed. The gpdA promoter (P gpdA ) from Aspergillus nidulans was used to drive the expression of the β-glucuronidase (GUS) gene which enabled GUS activity visualization. The conidia transformation efficiency reached approximately 110 to 250 transformants per 1×10 5 conidia. Based on the analysis made on five successive generations of subcultures and PCR, the pCAMBIA1301-GUS cassette had integrated into the genomes of all transformants and clearly showed mitotic stability. The novel reporter vector constructed will promote the functional characterization of genes and the construction of genetically engineered strains of this important fungus. Copyright © 2016 Elsevier B.V. All rights reserved.

Method of increasing conversion of a fatty acid to its corresponding dicarboxylic acid

DOEpatents

Craft, David L.; Wilson, C. Ron; Eirich, Dudley; Zhang, Yeyan

2004-09-14

A nucleic acid sequence including a CYP promoter operably linked to nucleic acid encoding a heterologous protein is provided to increase transcription of the nucleic acid. Expression vectors and host cells containing the nucleic acid sequence are also provided. The methods and compositions described herein are especially useful in the production of polycarboxylic acids by yeast cells.

A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants[OPEN

PubMed Central

Gil-Humanes, Javier; Čegan, Radim; Kono, Thomas J.Y.; Konečná, Eva; Belanto, Joseph J.; Starker, Colby G.

2017-01-01

We report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A Web-based tool streamlines vector selection and construction. One advantage of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 (Csy4) and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing 12 gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare). PMID:28522548

A multi-purpose toolkit to enable advanced genome engineering in plants

DOE PAGES

Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier; ...

2017-05-18

Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

A multi-purpose toolkit to enable advanced genome engineering in plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier

Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

Down-regulation of CD19 expression inhibits proliferation, adhesion, migration and invasion and promotes apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells.

PubMed

Wu, Junqing; Liang, Bin; Qian, Yan; Tang, Liyuan; Xing, Chongyun; Zhuang, Qiang; Shen, Zhijian; Jiang, Songfu; Yu, Kang; Feng, Jianhua

2018-05-29

The survival rate of childhood acute lymphoblastic leukemia (ALL) has increased while that of Philadelphia-positive (Ph+) ALL remains low. CD19 is a B-cell specific molecule related to the survival and proliferation of normal B cells. However, there is little information available on the effects of CD19 on the biological behavior of Ph+ ALL cells. In this study, we explored a lentiviral vector-mediated short hairpin RNA (shRNA) expression vector to stably reduce CD19 expression in Ph+ ALL cell line SUP-B15 cells and investigated the effects of CD19 downregulation on cell proliferation, apoptosis, drug sensitivity, cell adhesion, cell migration and cell invasion in vitro. CD19 mRNA and protein expression levels were inhibited significantly by CD19 shRNA. Down-regulation of CD19 could inhibit cell proliferation, adhesion, migration and invasion, and increase cell apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells. Moreover, we found that down-regulation of CD19 expression inhibits cell proliferation and induces apoptosis in SUP-B15 cells in a p53-dependent manner. Taken together, our results suggest that lentiviral vector-mediated RNA interference of CD19 gene may be a promising strategy in the treatment of Ph+ ALL. This article is protected by copyright. All rights reserved.

Optimization of Acidothermus Celluloyticus Endoglucanase (E1) Production in Transgenic Tobacco Plants by Transcriptional, Post-transcription and Post-Translational Modification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dai, Ziyu; Hooker, Brian S.; Quesenberry, Ryan D.

2005-10-01

Biochemical characteristics of Acidothermus cellulolyticus endoglucanase (E1) and its physiological effects in transgenic tobacco (Nicotiana tabacum) has been studied previously. In an attempt to obtain a high level of production of intact E1 in transgenic plants, the E1 gene was expressed under the control of strong Mac promoter (a hybrid promoter of manopine synthase promoter and cauliflower mosaic virus 35S promoter enhancer region) or tomato Rubisco small subunit (RbcS-3C) promoter with different 5’ untranslated leader (UTL) sequence and targeted to different subcellular comartmentations with various transit peptides. The expression of E1 protein in transgenic tobacco plants was determined via E1more » activity, protein immunobloting, and RNA gel-blotting analyses. Effects of different transit peptides on E1 protein production and its stability were examined in transgenic tobacco plants carrying one of six transgene expression vectors with the same (Mac) promoter and transcription terminator (Tmas). Transgenic tobacco plants with apoplast transit peptide (Mm-apo) had the highest average E1 activity and protein accumulation , while E1 protein was more stable in transgenic plants with no transit peptide (Mm) than others. The E1 expression under tomato RbcS-3C promoter was higher than that under Mac promoter based on the average E1 activity, E1 protein accumulation, and RNA gel-blotting. The E1 expression was increased more than two fold when the 5’-UTL of alfalfa mosaic virus RNA4 gene replaced the UTL of RbcS-3C promoter, while the UTL of alfalfa mosaic virus RNA4 gene was less effective than the UTL of Mac promoter. The optimal combination of promoter, 5’-UTL, and subcellular compartmentation (transit peptide) for E1 protein production in transgenic tobacco plants are discussed.« less

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana

PubMed Central

2017-01-01

The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. PMID:27856772

Correlation between luminescence intensity and cytotoxicity in cell-based cytotoxicity assay using luciferase.

PubMed

Wakuri, S; Yamakage, K; Kazuki, Y; Kazuki, K; Oshimura, M; Aburatani, S; Yasunaga, M; Nakajima, Y

2017-04-01

The luciferase reporter assay has become one of the conventional methods for cytotoxicity evaluation. Typically, the decrease of luminescence expressed by a constitutive promoter is used as an index of cytotoxicity. However, to our knowledge, there have been no reports of the correlation between cytotoxicity and luminescence intensity. In this study, to accurately verify the correlation between them, beetle luciferase was stably expressed in human hepatoma HepG2 cells harboring the multi-integrase mouse artificial chromosome vector. We showed that the cytotoxicity assay using luciferase does not depend on the stability of luciferase protein and the kind of constitutive promoter. Next, HepG2 cells in which green-emitting beetle luciferase was expressed under the control of CAG promoter were exposed to 58 compounds. The luminescence intensity and cytotoxicity curves of cells exposed to 48 compounds showed similar tendencies, whereas those of cells exposed to 10 compounds did not do so, although the curves gradually approached each other with increasing exposure time. Finally, we demonstrated that luciferase expressed under the control of a constitutive promoter can be utilized both as an internal control reporter for normalizing a test reporter and for monitoring cytotoxicity when two kinds of luciferases are simultaneously used in the cytotoxicity assay. Copyright © 2017 Elsevier Inc. All rights reserved.

Integration Site and Clonal Expansion in Human Chronic Retroviral Infection and Gene Therapy

PubMed Central

Niederer, Heather A.; Bangham, Charles R. M.

2014-01-01

Retroviral vectors have been successfully used therapeutically to restore expression of genes in a range of single-gene diseases, including several primary immunodeficiency disorders. Although clinical trials have shown remarkable results, there have also been a number of severe adverse events involving malignant outgrowth of a transformed clonal population. This clonal expansion is influenced by the integration site profile of the viral integrase, the transgene expressed, and the effect of the viral promoters on the neighbouring host genome. Infection with the pathogenic human retrovirus HTLV-1 also causes clonal expansion of cells containing an integrated HTLV-1 provirus. Although the majority of HTLV-1-infected people remain asymptomatic, up to 5% develop an aggressive T cell malignancy. In this review we discuss recent findings on the role of the genomic integration site in determining the clonality and the potential for malignant transformation of cells carrying integrated HTLV-1 or gene therapy vectors, and how these results have contributed to the understanding of HTLV-1 pathogenesis and to improvements in gene therapy vector safety. PMID:25365582

Co-expression of hepatitis C virus polytope-HBsAg and p19-silencing suppressor protein in tobacco leaves.

PubMed

Mohammadzadeh, Sara; Roohvand, Farzin; Memarnejadian, Arash; Jafari, Anis; Ajdary, Soheila; Salmanian, Ali-Hatef; Ehsani, Parastoo

2016-01-01

Plants transformed by virus-based vectors have emerged as promising tools to rapidly express large amounts and inexpensive antigens in transient condition. We studied the possibility of transient-expression of an HBsAg-fused polytopic construct (HCVpc) [containing H-2d and HLA-A2-restricted CD8+CTL-epitopic peptides of C (Core; aa 132-142), E6 (Envelope2; aa 614-622), N (NS3; aa 1406-1415), and E4 (Envelope2; aa 405-414) in tandem of CE6NE4] in tobacco (Nicotiana tabacum) leaves for the development of a plant-based HCV vaccine. A codon-optimized gene encoding the Kozak sequence, hexahistidine (6×His)-tag peptide, and HCVpc in tandem was designed, chemically synthesized, fused to HBsAg gene, and inserted into Potato virus X (PVX-GW) vector under the control of duplicated PVX coat protein promoter (CPP). The resulted recombinant plasmids (after confirmation by restriction and sequencing analyses) were transferred into Agrobacterium tumefaciens strain GV3101 and vacuum infiltrated into tobacco leaves. The effect of gene-silencing suppressor, p19 protein from tomato bushy stunt virus, on the expression yield of HCVpc-HBsAg was also evaluated by co-infiltration of a p19 expression vector. Codon-optimized gene increased adaptation index (CAI) value (from 0.61 to 0.92) in tobacco. The expression of the HCVpc-HBsAg was confirmed by western blot and HBsAg-based detection ELISA on total extractable proteins of tobacco leaves. The expression level of the fusion protein was significantly higher in p19 co-agroinfiltrated plants. The results indicated the possibility of expression of HCVpc-HBsAg constructs with proper protein conformations in tobacco for final application as a plant-derived HCV vaccine.

Enhanced protection against Ebola virus mediated by an improved adenovirus-based vaccine.

PubMed

Richardson, Jason S; Yao, Michel K; Tran, Kaylie N; Croyle, Maria A; Strong, James E; Feldmann, Heinz; Kobinger, Gary P

2009-01-01

The Ebola virus is transmitted by direct contact with bodily fluids of infected individuals, eliciting death rates as high as 90% among infected humans. Currently, replication defective adenovirus-based Ebola vaccine is being studied in a phase I clinical trial. Another Ebola vaccine, based on an attenuated vesicular stomatitis virus has shown efficacy in post-exposure treatment of nonhuman primates to Ebola infection. In this report, we modified the common recombinant adenovirus serotype 5-based Ebola vaccine expressing the wild-type ZEBOV glycoprotein sequence from a CMV promoter (Ad-CMVZGP). The immune response elicited by this improved expression cassette vector (Ad-CAGoptZGP) and its ability to afford protection against lethal ZEBOV challenge in mice was compared to the standard Ad-CMVZGP vector. Ad-CMVZGP was previously shown to protect mice, guinea pigs and nonhuman primates from an otherwise lethal challenge of Zaire ebolavirus. The antigenic expression cassette of this vector was improved through codon optimization, inclusion of a consensus Kozak sequence and reconfiguration of a CAG promoter (Ad-CAGoptZGP). Expression of GP from Ad-CAGoptZGP was substantially higher than from Ad-CMVZGP. Ad-CAGoptZGP significantly improved T and B cell responses at doses 10 to 100-fold lower than that needed with Ad-CMVZGP. Additionally, Ad-CAGoptZGP afforded full protections in mice against lethal challenge at a dose 100 times lower than the dose required for Ad-CMVZGP. Finally, Ad-CAGoptZGP induced full protection to mice when given 30 minutes post-challenge. We describe an improved adenovirus-based Ebola vaccine capable of affording post-exposure protection against lethal challenge in mice. The molecular modifications of the new improved vaccine also translated in the induction of significantly enhanced immune responses and complete protection at a dose 100 times lower than with the previous generation adenovirus-based Ebola vaccine. Understanding and improving the molecular components of adenovirus-based vaccines can produce potent, optimized product, useful for vaccination and post-exposure therapy.

Pituitary transcription factor Prop-1 stimulates porcine pituitary glycoprotein hormone alpha subunit gene expression.

PubMed

Sato, Takanobu; Kitahara, Kousuke; Susa, Takao; Kato, Takako; Kato, Yukio

2006-10-01

Recently, we have reported that a Prophet of Pit-1 homeodomain factor, Prop-1, is a novel transcription factor for the porcine follicle-stimulating hormone beta subunit (FSHbeta) gene. This study subsequently aimed to examine the role of Prop-1 in the gene expression of two other porcine gonadotropin subunits, pituitary glycoprotein hormone alpha subunit (alphaGSU), and luteinizing hormone beta subunit (LHbeta). A series of deletion mutants of the porcine alphaGSU (up to -1059 bp) and LHbeta (up to -1277 bp) promoters were constructed in the reporter vector, fused with the secreted alkaline phosphatase gene (pSEAP2-Basic). Transient transfection studies using GH3 cells were carried out to estimate the activation of the porcine alphaGSU and LHbeta promoters by Prop-1, which was found to activate the alphaGSU promoter of -1059/+12 bp up to 11.7-fold but not the LHbeta promoter. Electrophoretic mobility shift assay and DNase I footprinting analysis revealed that Prop-1 binds to six positions, -1038/-1026, -942/-928, -495/-479, -338/-326, -153/-146, and -131/-124 bp, that comprise the A/T cluster. Oligonucleotides of six Prop-1 binding sites were directly connected to the minimum promoter of alphaGSU, fused in the pSEAP2-Basic vector, followed by transfecting GH3 cells to determine the cis-acting activity. Finally, we concluded that at least five Prop-1 binding sites are the cis-acting elements for alphaGSU gene expression. The present results revealed a notable feature of the proximal region, where three Prop-1-binding sites are close to and/or overlap the pituitary glycoprotein hormone basal element, GATA-binding element, and junctional regulatory element. To our knowledge, this is the first demonstration of the role of Prop-1 in the regulation of alphaGSU gene expression. These results, taken together with our previous finding that Prop-1 is a transcription factor for FSHbeta gene, confirm that Prop-1 modulates the synthesis of FSH at the transcriptional level. On the other hand, the defects of Prop-1 are known to cause dwarfism and combined pituitary hormone deficiency accompanying hypogonadism. Accordingly, the present observations provide a novel view to understand the hypogonadism caused by Prop-1 defects at the molecular level through the regulatory mechanism of alphaGSU and FSHbeta gene expressions.

Local over-expression of VEGF-DΔNΔC in the uterine arteries of pregnant sheep results in long-term changes in uterine artery contractility and angiogenesis.

PubMed

Mehta, Vedanta; Abi-Nader, Khalil N; Shangaris, Panicos; Shaw, S W Steven; Filippi, Elisa; Benjamin, Elizabeth; Boyd, Michael; Peebles, Donald M; Martin, John; Zachary, Ian; David, Anna L

2014-01-01

The normal development of the uteroplacental circulation in pregnancy depends on angiogenic and vasodilatory factors such as vascular endothelial growth factor (VEGF). Reduced uterine artery blood flow (UABF) is a common cause of fetal growth restriction; abnormalities in angiogenic factors are implicated. Previously we showed that adenovirus (Ad)-mediated VEGF-A165 expression in the pregnant sheep uterine artery (UtA) increased nitric oxide synthase (NOS) expression, altered vascular reactivity and increased UABF. VEGF-D is a VEGF family member that promotes angiogenesis and vasodilatation but, in contrast to VEGF-A, does not increase vascular permeability. Here we examined the effect of Ad.VEGF-DΔNΔC vector encoding a fully processed form of VEGF-D, on the uteroplacental circulation. UtA transit-time flow probes and carotid artery catheters were implanted in mid-gestation pregnant sheep (n = 5) to measure baseline UABF and maternal haemodynamics respectively. 7-14 days later, after injection of Ad.VEGF-DΔNΔC vector (5×10(11) particles) into one UtA and an Ad vector encoding β-galactosidase (Ad.LacZ) contralaterally, UABF was measured daily until scheduled post-mortem examination at term. UtAs were assessed for vascular reactivity, NOS expression and endothelial cell proliferation; NOS expression was studied in ex vivo transduced UtA endothelial cells (UAECs). At 4 weeks post-injection, Ad.VEGF-DΔNΔC treated UtAs showed significantly lesser vasoconstriction (Emax144.0 v/s 184.2, p = 0.002). There was a tendency to higher UABF in Ad.VEGF-DΔNΔC compared to Ad.LacZ transduced UtAs (50.58% v/s 26.94%, p = 0.152). There was no significant effect on maternal haemodynamics. An increased number of proliferating endothelial cells and adventitial blood vessels were observed in immunohistochemistry. Ad.VEGF-DΔNΔC expression in cultured UAECs upregulated eNOS and iNOS expression. Local over-expression of VEGF-DΔNΔC in the UtAs of pregnant mid-gestation sheep reduced vasoconstriction, promoted endothelial cell proliferation and showed a trend towards increased UABF. Studies in cultured UAECs indicate that VEGF-DΔNΔC may act in part through upregulation of eNOS and iNOS.

Exploiting Multisite Gateway and pENFRUIT plasmid collection for fruit genetic engineering.

PubMed

Estornell, Leandro H; Granell, Antonio; Orzaez, Diego

2012-01-01

MultiSite Gateway cloning techniques based on homologous recombination facilitate the combinatorial assembly of basic genetic pieces (i.e., promoters, CDS, and terminators) into gene expression or gene silencing cassettes. pENFRUIT is a collection of MultiSite Triple Gateway Entry vectors dedicated to genetic engineering in fruits. It comprises a number of fruit-operating promoters as well as C-terminal tags adapted to the Gateway standard. In this way, flanking regulatory/labeling sequences can be easily Gateway-assembled with a given gene of interest for its ectopic expression or silencing in fruits. The resulting gene constructs can be analyzed in stable transgenic plants or in transient expression assays, the latter allowing fast testing of the increasing number of combinations arising from MultiSite methodology. A detailed description of the use of MultiSite cloning methodology for the assembly of pENFRUIT elements is presented.

High level activity of the mouse CCAAT/enhancer binding protein (C/EBP alpha) gene promoter involves autoregulation and several ubiquitous transcription factors.

PubMed Central

Legraverend, C; Antonson, P; Flodby, P; Xanthopoulos, K G

1993-01-01

The promoter region of the mouse CCAAT-Enhancer Binding Protein (C/EBP alpha) gene is capable of directing high levels of expression of reporter constructs in various cell lines, albeit even in cells that do not express their endogenous C/EBP alpha gene. To understand the molecular mechanisms underlying this ubiquitous expression, we have characterized the promoter region of the mouse C/EBP alpha gene by a variety of in vitro and in vivo methods. We show that three sites related in sequence to USF, BTE and C/EBP binding sites and present in promoter region -350/+3, are recognized by proteins from rat liver nuclear extracts. The sequence of the C/EBP alpha promoter that includes the USF binding site is also capable of forming stable complexes with purified Myc+Max heterodimers and mutation of this site drastically reduces transcription of C/EBP alpha promoter luciferase constructs both in liver and non liver cell lines. In addition, we identify three novel protein-binding sites two of which display similarity to NF-1 and a NF kappa B binding sites. The region located between nucleotides -197 and -178 forms several heat-stable complexes with liver nuclear proteins in vitro which are recognized mainly by antibodies specific for C/EBP alpha. Furthermore, transient expression of C/EBP alpha and to a lesser extent C/EBP beta expression vectors, results in transactivation of a cotransfected C/EBP alpha promoter-luciferase reporter construct. These experiments support the notion that the C/EBP alpha gene is regulated by C/EBP alpha but other C/EBP-related proteins may also be involved. Images PMID:8493090

Dual AAV therapy ameliorates exercise-induced muscle injury and functional ischemia in murine models of Duchenne muscular dystrophy.

PubMed

Zhang, Yadong; Yue, Yongping; Li, Liang; Hakim, Chady H; Zhang, Keqing; Thomas, Gail D; Duan, Dongsheng

2013-09-15

Neuronal nitric oxide synthase (nNOS) membrane delocalization contributes to the pathogenesis of Duchenne muscular dystrophy (DMD) by promoting functional muscle ischemia and exacerbating muscle injury during exercise. We have previously shown that supra-physiological expression of nNOS-binding mini-dystrophin restores normal blood flow regulation and prevents functional ischemia in transgenic mdx mice, a DMD model. A critical next issue is whether systemic dual adeno-associated virus (AAV) gene therapy can restore nNOS-binding mini-dystrophin expression and mitigate muscle activity-related functional ischemia and injury. Here, we performed systemic gene transfer in mdx and mdx4cv mice using a pair of dual AAV vectors that expressed a 6 kb nNOS-binding mini-dystrophin gene. Vectors were packaged in tyrosine mutant AAV-9 and co-injected (5 × 10(12) viral genome particles/vector/mouse) via the tail vein to 1-month-old dystrophin-null mice. Four months later, we observed 30-50% mini-dystrophin positive myofibers in limb muscles. Treatment ameliorated histopathology, increased muscle force and protected against eccentric contraction-induced injury. Importantly, dual AAV therapy successfully prevented chronic exercise-induced muscle force drop. Doppler hemodynamic assay further showed that therapy attenuated adrenergic vasoconstriction in contracting muscle. Our results suggest that partial transduction can still ameliorate nNOS delocalization-associated functional deficiency. Further evaluation of nNOS binding mini-dystrophin dual AAV vectors is warranted in dystrophic dogs and eventually in human patients.

Novel adeno-associated viral vector delivering the utrophin gene regulator jazz counteracts dystrophic pathology in mdx mice.

PubMed

Strimpakos, Georgios; Corbi, Nicoletta; Pisani, Cinzia; Di Certo, Maria Grazia; Onori, Annalisa; Luvisetto, Siro; Severini, Cinzia; Gabanella, Francesca; Monaco, Lucia; Mattei, Elisabetta; Passananti, Claudio

2014-09-01

Over-expression of the dystrophin-related gene utrophin represents a promising therapeutic strategy for Duchenne muscular dystrophy (DMD). The strategy is based on the ability of utrophin to functionally replace defective dystrophin. We developed the artificial zinc finger transcription factor "Jazz" that up-regulates both the human and mouse utrophin promoter. We observed a significant recovery of muscle strength in dystrophic Jazz-transgenic mdx mice. Here we demonstrate the efficacy of an experimental gene therapy based on the systemic delivery of Jazz gene in mdx mice by adeno-associated virus (AAV). AAV serotype 8 was chosen on the basis of its high affinity for skeletal muscle. Muscle-specific expression of the therapeutic Jazz gene was enhanced by adding the muscle α-actin promoter to the AAV vector (mAAV). Injection of mAAV8-Jazz viral preparations into mdx mice resulted in muscle-specific Jazz expression coupled with up-regulation of the utrophin gene. We show a significant recovery from the dystrophic phenotype in mAAV8-Jazz-treated mdx mice. Histological and physiological analysis revealed a reduction of fiber necrosis and inflammatory cell infiltration associated with functional recovery in muscle contractile force. The combination of ZF-ATF technology with the AAV delivery can open a new avenue to obtain a therapeutic strategy for treatment of DMD. © 2014 Wiley Periodicals, Inc.

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

Enhancement or inhibition of PLCγ2 expression in rat hepatocytes by recombinant adenoviral vectors that contain full-length gene or siRNA.

PubMed

Chen, X G; Liu, Y M; Lv, Q X; Ma, J

2017-01-01

We investigated the effects of recombinant adenovirus vectors that overexpress or silence PLCγ2 on the expression of this gene during hepatocyte proliferation. Hepatocytes were isolated, identified by immunofluorescent cytochemical staining and infected by previously constructed Ad-PLCγ2 and Ad-PLCγ2 siRNA1, siRNA2 and siRNA3. Green fluorescent protein (GFP) expression was observed by fluorescence microscopy. Infection percentage was calculated by flow cytometry. mRNA and protein levels of PLCγ2 were detected by quantitative reverse transcription-PCR (qRT-PCR) and western blotting, respectively. The viability of the infected hepatocytes was measured by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. We found that nearly 97% of cells were positive for the hepatocyte marker, CK18. After infection of Ad-PLCγ2 and Ad-PLCγ2 siRNA, more than 99% of hepatocytes expressed GFP significantly, and mRNA and protein expression of PLCγ2 was up-regulated significantly in Ad-PLCγ2 infected hepatocytes, but down-regulated in Ad-PLCγ2 siRNA2 infected cells. The cell proliferation rate decreased in PLCγ2-overexpressing cells, while the rate increased in PLCγ2-silencing cells. We verified that recombinant Ad-PLCγ2 and Ad-PLCγ2 siRNA2 were constructed successfully. These two recombinant vectors promoted or decreased the expression of PLCγ2 in rat hepatocytes and affected the cell proliferation rate, which provides a useful tool for further investigation of the role of PLCγ2 in hepatocyte apoptosis.

Hox proteins activate the IGFBP-1 promoter and suppress the function of hPR in human endometrial cells.

PubMed

Gao, Jiaguo; Mazella, James; Tseng, Linda

2002-11-01

Previous studies have shown that progestin activates the transcription of IGFBP-1 (insulin-like growth factor binding protein-1). Four regions in the IGFBP-1 promotor have been identified to enhance the transcription. Two of the regions, located at -73 to -65 bp and -319 to -311 bp formed identical DNA-protein complexes with the nuclear extracts of endometrial stromal/decidual cells. To identify the binding protein(s) in endometrial cells that interact with these two regions, we have used the TGTCAATTA repeats (-319 to -11 bp of the IGFBP-1 promoter) to screen the human decidual cDNA library by yeast one-hybrid system. We found that Hox A10, HoxA11, HoxB2, HoxB4, and HoxD11 interacted with the TGTCAATTA repeats in yeast cells. Among these hox genes, the full-length coding region of HoxA10, HoxA11, and HoxB4 were used for functional analysis in three types of endometrial cells, undifferentiated endometrial stromal cells, decidual cells (differentiated stromal cells) and endometrial adenocarcinoma cell line (HEC1-B). All these endometrial cells produce IGFBP-1. Transient transfection assay showed that HoxA10 expression vector increased the promoter activity (the IGFBP-1 proximal promoter containing TGC/TCAATTA and two functional PRE sites) in endometrial stromal cells and in HEC-1B cells, but not in decidual cells. HoxB4 enhanced the promoter activity only in decidual cells, while HoxA11 had no apparent effect in all three types of cells. To evaluate whether Hox proteins would interact with progesterone receptor (hPR), cells were transfected with the promoter construct, Hox and hPR expression vectors. hPR alone activated the IGFBP-1 promoter activity, but expression of Hox gene suppressed the activation. Hox proteins also suppressed the hPR enhanced promoter activities of MMTV (containing consensus-PRE sites) and glycodelin (GdA, containing Sp1 site which mediates the hPR function). These data showed that Hox genes selectively activate the transcription of the IGFBP-1 and GdA genes in different types of endometrial cells. Hox genes, however, suppress the hPR enhanced activities. In addition, we found that HoxB4 expression was induced by estrogen and progestin. Other investigators have shown that HoxA10 and 11 were stimulated by progestin. These findings show that Hox proteins are molecular mediators of the steroid hormones during endometrial cell development.

Molecular cloning and expression in Saccharomyces cerevisiae and Neurospora crassa of the invertase gene from Neurospora crassa.

PubMed

Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A

1989-10-01

A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.

Development of A Flexible System for the Simultaneous Conversion of Biomass to Industrial Chemicals and the Production of Industrial Biocatalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Johnway; Hooker, Brian S.; Skeen, R S.

2002-01-01

A flexible system was developed for the simultaneous conversion of biomass to industrial chemicals and the production of industrial biocatalysts. In particular, the expression of a bacterial enzyme, beta-glucuronidase (GUS), was investigated using a genetically modified starch-degrading Saccharomyces strain in suspension cultures in starch media. Different sources of starch including corn and waste potato starch were used for yeast biomass accumulation and GUS expression studies under controls of inducible and constitutive promoters. A thermostable bacterial cellulase, Acidothermus cellulolyticus E1 endoglucanase gene was also cloned into an episomal plasmid expression vector and expressed in the starch-degrading Saccharomyces strain.

Human papillomavirus type 16 E7 oncoprotein mediates CCNA1 promoter methylation.

PubMed

Chalertpet, Kanwalat; Pakdeechaidan, Watcharapong; Patel, Vyomesh; Mutirangura, Apiwat; Yanatatsaneejit, Pattamawadee

2015-10-01

Human papillomavirus (HPV) oncoproteins drive distinctive promoter methylation patterns in cancer. However, the underlying mechanism remains to be elucidated. Cyclin A1 (CCNA1) promoter methylation is strongly associated with HPV-associated cancer. CCNA1 methylation is found in HPV-associated cervical cancers, as well as in head and neck squamous cell cancer. Numerous pieces of evidence suggest that E7 may drive CCNA1 methylation. First, the CCNA1 promoter is methylated in HPV-positive epithelial lesions after transformation. Second, the CCNA1 promoter is methylated at a high level when HPV is integrated into the human genome. Finally, E7 has been shown to interact with DNA methyltransferase 1 (Dnmt1). Here, we sought to determine the mechanism by which E7 increases methylation in cervical cancer by using CCNA1 as a gene model. We investigated whether E7 induces CCNA1 promoter methylation, resulting in the loss of expression. Using both E7 knockdown and overexpression approaches in SiHa and C33a cells, our data showed that CCNA1 promoter methylation decreases with a corresponding increase in expression in E7 siRNA-transfected cells. By contrast, CCNA1 promoter methylation was augmented with a corresponding reduction in expression in E7-overexpressing cells. To confirm whether the binding of the E7-Dnmt1 complex to the CCNA1 promoter induced methylation and loss of expression, ChIP assays were carried out in E7-, del CR3-E7 and vector control-overexpressing C33a cells. The data showed that E7 induced CCNA1 methylation by forming a complex with Dnmt1 at the CCNA1 promoter, resulting in the subsequent reduction of expression in cancers. It is interesting to further explore the genome-wide mechanism of E7 oncoprotein-mediated DNA methylation. © 2015 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

A study on the influence of different promoter and 5'UTR (URM) cassettes from Arabidopsis thaliana on the expression level of the reporter gene β glucuronidase in tobacco and cotton.

PubMed

Agarwal, Parul; Garg, Varsha; Gautam, Taru; Pillai, Beena; Kanoria, Shaveta; Burma, Pradeep Kumar

2014-04-01

Several reports of promoters from plants, viral and artificial origin that confer high constitutive expression are known. Among these the CaMV 35S promoter is used extensively for transgene expression in plants. We identified candidate promoters from Arabidopsis based on their transcript levels (meta-analysis of available microarray control datasets) to test their activity in comparison to the CaMV 35S promoter. A set of 11 candidate genes were identified which showed high transcript levels in the aerial tissue (i.e. leaf, shoot, flower and stem). In the initial part of the study binary vectors were developed wherein the promoter and 5'UTR region of these candidate genes (Upstream Regulatory Module, URM) were cloned upstream to the reporter gene β glucuronidase (gus). The promoter strengths were tested in transformed callus of Nicotiana tabacum and Gossypium hirsutum. On the basis of the results obtained from the callus, the influence of the URM cassettes on transgene expression was tested in transgenic tobacco. The URM regions of the genes encoding a subunit of photosystem I (PHOTO) and geranyl geranyl reductase (GGR) in A. thaliana genome showed significantly high levels of GUS activity in comparison to the CaMV 35S promoter. Further, when the 5'UTRs of both the genes were placed downstream to the CaMV 35S promoter it led to a substantial increase in GUS activity in transgenic tobacco lines and cotton callus. The enhancement observed was even higher to that observed with the viral leader sequences like Ω and AMV, known translational enhancers. Our results indicate that the two URM cassettes or the 5'UTR regions of PHOTO and GGR when placed downstream to the CaMV 35S promoter can be used to drive high levels of transgene expression in dicotyledons.

KIT Signaling Promotes Growth of Colon Xenograft Tumors in Mice and Is Up-Regulated in a Subset of Human Colon Cancers.

PubMed

Chen, Evan C; Karl, Taylor A; Kalisky, Tomer; Gupta, Santosh K; O'Brien, Catherine A; Longacre, Teri A; van de Rijn, Matt; Quake, Stephen R; Clarke, Michael F; Rothenberg, Michael E

2015-09-01

Receptor tyrosine kinase (RTK) inhibitors have advanced colon cancer treatment. We investigated the role of the RTK KIT in development of human colon cancer. An array of 137 patient-derived colon tumors and their associated xenografts were analyzed by immunohistochemistry to measure levels of KIT and its ligand KITLG. KIT and/or KITLG was stably knocked down by expression of small hairpin RNAs from lentiviral vectors in DLD1, HT29, LS174T, and COLO320 DM colon cancer cell lines, and in UM-COLON#8 and POP77 xenografts; cells transduced with only vector were used as controls. Cells were analyzed by real-time quantitative reverse transcription polymerase chain reaction, single-cell gene expression analysis, flow cytometry, and immunohistochemical, immunoblot, and functional assays. Xenograft tumors were grown from control and KIT-knockdown DLD1 and UM-COLON#8 cells in immunocompromised mice and compared. Some mice were given the RTK inhibitor imatinib after injection of cancer cells; tumor growth was measured based on bioluminescence. We assessed tumorigenicity using limiting dilution analysis. KIT and KITLG were expressed heterogeneously by a subset of human colon tumors. Knockdown of KIT decreased proliferation of colon cancer cell lines and growth of xenograft tumors in mice compared with control cells. KIT knockdown cells had increased expression of enterocyte markers, decreased expression of cycling genes, and, unexpectedly, increased expression of LGR5 associated genes. No activating mutations in KIT were detected in DLD1, POP77, or UM-COLON#8 cells. However, KITLG-knockdown DLD1 cells formed smaller xenograft tumors than control cells. Gene expression analysis of single CD44(+) cells indicated that KIT can promote growth via KITLG autocrine and/or paracrine signaling. Imatinib inhibited growth of KIT(+) colon cancer organoids in culture and growth of xenograft tumors in mice. Cancer cells with endogenous KIT expression were more tumorigenic in mice. KIT and KITLG are expressed by a subset of human colon tumors. KIT signaling promotes growth of colon cancer cells and organoids in culture and xenograft tumors in mice via its ligand, KITLG, in an autocrine or paracrine manner. Patients with KIT-expressing colon tumors can benefit from KIT RTK inhibitors. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

KIT Signaling Promotes Growth of Colon Xenograft Tumors in Mice and is Upregulated in a Subset of Human Colon Cancers

PubMed Central

Chen, Evan C.; Karl, Taylor A.; Kalisky, Tomer; Gupta, Santosh K.; O’Brien, Catherine A.; Longacre, Teri A.; van de Rijn, Matt; Quake, Stephen R.; Clarke, Michael F.; Rothenberg, Michael E.

2015-01-01

Background & Aims Receptor tyrosine kinase (RTK) inhibitors have advanced colon cancer treatment. We investigated the role of the RTK KIT in development of human colon cancer. Methods An array of 137 patient-derived colon tumors and their associated xenografts were analyzed by immunohistochemistry to measure levels of KIT and its ligand KITLG. KIT and/or KITLG was stably knocked down by expression of small hairpin RNAs from lentiviral vectors in DLD1, HT29, LS174T, and COLO320 colon cancer cell lines, and in UM-COLON#8 and POP77 xenografts; cells transduced with only vector were used as controls. Cells were analyzed by real-time quantitative reverse transcription PCR, single-cell gene expression analysis, flow cytometry, and immunohistochemical, immunoblot, and functional assays. Xenograft tumors were grown from control and KIT-knockdown DLD1 and UM-COLON#8 cells in immunocompromised mice and compared. Some mice were given the RTK inhibitor imatinib following injection of cancer cells; tumor growth was measured based on bioluminescence. We assessed tumorigenicity using limiting dilution analysis. Results KIT and KITLG were expressed heterogeneously by a subset of human colon tumors. Knockdown of KIT decreased proliferation of colon cancer cell lines and growth of xenograft tumors in mice, compared with control cells. KIT knockdown cells had increased expression of enterocyte markers, decreased expression of cycling genes, and, unexpectedly, increased expression of LGR5-associated genes. No activating mutations in KIT were detected in DLD1, POP77, or UM-COLON#8 cell lines. However, KITLG-knockdown DLD1 cells formed smaller xenograft tumors than control cells. Gene expression analysis of single CD44+ cells indicated that KIT may promote growth via KITLG autocrine and/or paracrine signaling. Imatinib inhibited growth of KIT+ colon cancer organoids in culture and growth of xenograft tumors in mice. Cancer cells with endogenous KIT expression were more tumorigenic in mice. Conclusions KIT and KITLG are expressed by a subset of human colon tumors. KIT signaling promotes growth of colon cancer cells and organoids in culture and xenograft tumors in mice via its ligand, KITLG, in an autocrine or paracrine manner. Patients with KIT-expressing colon tumors may benefit from KIT RTK inhibitors. PMID:26026391

Enhancement of extracellular expression of Bacillus naganoensis pullulanase from recombinant Bacillus subtilis: Effects of promoter and host.

PubMed

Song, Wan; Nie, Yao; Mu, Xiao Qing; Xu, Yan

2016-08-01

Pullulanase plays an important role in industrial applications of starch processing. However, extracellular production of pullulanase from recombinant Bacillus subtilis is yet limited due to the issues on regulatory elements of B. subtilis expression system. In this study, the gene encoding B. naganoensis pullulanase (PUL) was expressed in B. subtilis WB800 under the promoter PHpaII in the shuttle vector pMA0911. The extracellular activity of expressed pullulanase was 3.9 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-PHpaII-pul. To further enhance the yield of PUL, the promoter PHpaII in pMA0911 was replaced by a stronger constitutive promoter P43. Then the activity was increased to 8.7 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-P43-pul. Effect of host on pullulanase expression was further investigated by comparison between B. subtilis WB600 and B. subtilis WB800. In addition to the available B. subtilis WB800 recombinants, the constructed plasmids pMA0911-PHpaII-pul and pMA0911-P43-pul were transformed into B. subtilis WB600, respectively. Consequently, the extracellular production of PUL was significantly enhanced by B. subtilis WB600/pMA0911-P43-pul, resulting in the extracellular pullulanase activity of 24.5 U ml(-1). Therefore, promoter and host had an impact on pullulanase expression and their optimization would be useful to improve heterologous protein expression in B. subtilis. Copyright © 2016 Elsevier Inc. All rights reserved.

Superoxide radical-generating compounds activate a predicted promoter site for paraquat-inducible genes of the Chromobacterium violaceum bacterium in a dose-dependent manner.

PubMed

Gabriel, J E; Guerra-Slompo, E P; de Souza, E M; de Carvalho, F A L; Madeira, H M F; de Vasconcelos, A T R

2015-08-21

The purpose of the present study was to functionally evaluate the influence of superoxide radical-generating compounds on the heterologous induction of a predicted promoter region of open reading frames for paraquat-inducible genes (pqi genes) revealed during genome annotation analyses of the Chromobacterium violaceum bacterium. A 388-bp fragment corresponding to a pqi gene promoter of C. violaceum was amplified using specific primers and cloned into a conjugative vector containing the Escherichia coli lacZ gene without a promoter. Assessments of the expression of the β-galactosidase enzyme were performed in the presence of menadione (MEN) and phenazine methosulfate (PMS) compounds at different final concentrations to evaluate the heterologous activation of the predicted promoter region of interest in C. violaceum induced by these substrates. Under these experimental conditions, the MEN reagent promoted highly significant increases in the expression of the β-galactosidase enzyme modulated by activating the promoter region of the pqi genes at all concentrations tested. On the other hand, significantly higher levels in the expression of the β-galactosidase enzyme were detected exclusively in the presence of the PMS reagent at a final concentration of 50 μg/mL. The findings described in the present study demonstrate that superoxide radical-generating compounds can activate a predicted promoter DNA motif for pqi genes of the C. violaceum bacterium in a dose-dependent manner.

Androgen receptor mediated epigenetic regulation of CRISP3 promoter in prostate cancer cells.

PubMed

Pathak, Bhakti R; Breed, Ananya A; Deshmukh, Priyanka; Mahale, Smita D

2018-07-01

Cysteine-rich secretory protein 3 (CRISP3) is one of the most upregulated genes in prostate cancer. Androgen receptor (AR) plays an important role not only in initial stages of prostate cancer development but also in the advanced stage of castration-resistant prostate cancer (CRPC). Role of AR in regulation of CRISP3 expression is not yet known. In order to understand the regulation of CRISP3 expression, various overlapping fragments of CRISP3 promoter were cloned in pGL3 luciferase reporter vector. All constructs were transiently and stably transfected in PC3 (CRISP3 negative) and LNCaP (CRISP3 positive) cell lines and promoter activity was measured by luciferase assay. Promoter activity of LNCaP stable clones was significantly higher than PC3 stable clones. Further in CRISP3 negative PC3 and RWPE-1 cells, CRISP3 promoter was shown to be silenced by histone deacetylation. Treatment of LNCaP cells with DHT resulted in increase in levels of CRISP3 transcript and protein. AR dependency of CRISP3 promoter was also evaluated in LNCaP stable clones by luciferase assay. To provide molecular evidence of epigenetic regulation of CRISP3 promoter and its response to DHT, ChIP PCR was performed in PC3 and LNCaP cells. Our results demonstrate that CRISP3 expression in prostate cancer cells is androgen dependent and in AR positive cells, CRISP3 promoter is epigenetically regulated by AR. Copyright © 2018 Elsevier Ltd. All rights reserved.

Discovery, adaptation and transcriptional activity of two tick promoters: Construction of a dual luciferase reporter system for optimization of RNA interference in rhipicephalus (boophilus) microplus cell lines.

PubMed

Tuckow, A P; Temeyer, K B

2015-08-01

Dual luciferase reporter systems are valuable tools for functional genomic studies, but have not previously been developed for use in tick cell culture. We evaluated expression of available luciferase constructs in tick cell cultures derived from Rhipicephalus (Boophilus) microplus, an important vector of bovine babesiosis and anaplasmosis. Commercial promoters were evaluated for transcriptional activity driving luciferase expression in the tick cell lines. The human phosphoglycerate kinase (PGK) promoter resulted in detectable firefly luciferase activity within 2 days post-transfection of the R. microplus cell line BME26, with maximal activity at 5 days post-transfection. Several other promoters were weaker or inactive in the tick cells, prompting identification and assessment of transcriptional activity of the homologous ribosomal protein L4 (rpL4, GenBank accession no.: KM516205) and elongation factor 1α (EF-1α, GenBank accession no.: KM516204) promoters cloned from R. microplus. Evaluation of luciferase expression driven by various promoters in tick cell culture resulted in selection of the R. microplus rpL4 promoter and the human PGK promoter driving transcription of sequences encoding modified firefly and NanoLuc® luciferases for construction of a dual luciferase reporter system for use in tick cell culture. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

PubMed

Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

2015-12-01

Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

PubMed Central

Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

2016-01-01

ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

Strategies to optimize capsid protein expression and single-stranded DNA formation of adeno-associated virus in Saccharomyces cerevisiae.

PubMed

Galli, A; Della Latta, V; Bologna, C; Pucciarelli, D; Cipriani, F; Backovic, A; Cervelli, T

2017-08-01

Adeno-associated virus type 2 (AAV) is a nonpathogenic parvovirus that is a promising tool for gene therapy. We aimed to construct plasmids for optimal expression and assembly of capsid proteins and evaluate adenovirus (Ad) protein effect on AAV single-stranded DNA (ssDNA) formation in Saccharomyces cerevisiae. Yeast expression plasmids have been developed in which the transcription of AAV capsid proteins (VP1,2,3) is driven by the constitutive ADH1 promoter or galactose-inducible promoters. Optimal VP1,2,3 expression was obtained from GAL1/10 bidirectional promoter. Moreover, we demonstrated that AAP is expressed in yeast and virus-like particles (VLPs) assembled inside the cell. Finally, the expression of two Ad proteins, E4orf6 and E1b55k, had no effect on AAV ssDNA formation. This study confirms that yeast is able to form AAV VLPs; however, capsid assembly and ssDNA formation are less efficient in yeast than in human cells. Moreover, the expression of Ad proteins did not affect AAV ssDNA formation. New manufacturing strategies for AAV-based gene therapy vectors (rAAV) are needed to reduce costs and time of production. Our study explores the feasibility of yeast as alternative system for rAAV production. © 2017 The Society for Applied Microbiology.

Cloning and characterization of an adenoviral vector for highly efficient and doxycycline – suppressible expression of bioactive human single – chain interleukin 12 in colon cancer

PubMed Central

Wulff, Holger; Krieger, Thorsten; Krüger, Karen; Stahmer, Ingrid; Thaiss, Friedrich; Schäfer, Hansjörg; Block, Andreas

2007-01-01

Background Interleukin-12 (IL-12) is well characterized to induce cellular antitumoral immunity by activation of NK-cells and T-lymphocytes. However, systemic administration of recombinant human IL-12 resulted in severe toxicity without perceptible therapeutic benefit. Even though intratumoral expression of IL-12 leads to tumor regression and long-term survival in a variety of animal models, clinical trials have not yet shown a significant therapeutic benefit. One major obstacle in the treatment with IL-12 is to overcome the relatively low expression of the therapeutic gene without compromising the safety of such an approach. Our objective was to generate an adenoviral vector system enabling the regulated expression of very high levels of bioactive, human IL-12. Results High gene expression was obtained utilizing the VP16 herpes simplex transactivator. Strong regulation of gene expression was realized by fusion of the VP16 to a tetracycline repressor with binding of the fusion protein to a flanking tetracycline operator and further enhanced by auto-regulated expression of its fusion gene within a bicistronic promoter construct. Infection of human colon cancer cells (HT29) at a multiplicity of infection (m.o.i.) of 10 resulted in the production of up to 8000 ng/106 cells in 48 h, thus exceeding any published vector system so far. Doxycycline concentrations as low as 30 ng/ml resulted in up to 5000-fold suppression, enabling significant reduction of gene expression in a possible clinical setting. Bioactivity of the human single-chain IL-12 was similar to purified human heterodimeric IL-12. Frozen sections of human colon cancer showed high expression of the coxsackie adenovirus receptor with significant production of human single chain IL-12 in colon cancer biopsies after infection with 3*107 p.f.u. Ad.3r-scIL12. Doxycycline mediated suppression of gene expression was up to 9000-fold in the infected colon cancer tissue. Conclusion VP16 transactivator-mediated and doxycycline-regulated expression of the human interleukin-12 gene enables highly efficient and tightly controlled cytokine expression in human cancer. These data illustrate the potential of the described adenoviral vector system for the safe and superior expression of therapeutic genes in the treatment of colorectal cancer and other malignancies. PMID:17594499

Development of an optimized tetracycline-inducible expression system to increase the accumulation of interleukin-10 in tobacco BY-2 suspension cells

PubMed Central

2012-01-01

Background Plant cell suspension cultures can be used for the production of valuable pharmaceutical and industrial proteins. When the recombinant protein is secreted into the culture medium, restricting expression to a defined growth phase can improve both the quality and quantity of the recovered product by minimizing proteolytic activity. Temporal restriction is also useful for recombinant proteins whose constitutive expression affects cell growth and viability, such as viral interleukin-10 (vIL-10). Results We have developed a novel, tetracycline-inducible system suitable for tobacco BY-2 suspension cells which increases the yields of vIL-10. The new system is based on a binary vector that is easier to handle than conventional vectors, contains an enhanced inducible promoter and 5′-UTR to improve yields, and incorporates a constitutively-expressed visible marker gene to allow the rapid and straightforward selection of the most promising transformed clones. Stable transformation of BY-2 cells with this vector, without extensive optimization of the induction conditions, led to a 3.5 fold increase in vIL-10 levels compared to constitutive expression in the same host. Conclusions We have developed an effective and straightforward molecular farming platform technology that improves both the quality and the quantity of recombinant proteins produced in plant cells, particularly those whose constitutive expression has a negative impact on plant growth and development. Although we tested the platform using vIL-10 produced in BY-2 cells, it can be applied to other host/product combinations and is also useful for basic research requiring strictly controlled transgene expression. PMID:22784336

New Advances in Molecular Therapy for Muscle Repair After Diseases and Injuries

DTIC Science & Technology

2010-04-01

in grey matter indicated small neuron and axon communication . Project # 5 Final Report** Inhibiting cell death and promoting muscle growth for...the treatment of other genetic and acquired causes of muscle wasting. We produced multiple AAV8 vectors with expression cassettes designed to... communication between the various investigators and institutions. The Administrative Core holds weekly/biweekly seminar series for SCRC

PCR-mediated site-directed mutagenesis.

PubMed

Carey, Michael F; Peterson, Craig L; Smale, Stephen T

2013-08-01

Unlike traditional site-directed mutagenesis, this protocol requires only a single PCR step using full plasmid amplification to generate point mutants. The method can introduce small mutations into promoter sites and is even better suited for introducing single or double mutations into proteins. It is elegant in its simplicity and can be applied quite easily in any laboratory using standard protein expression vectors and commercially available reagents.

'Green mice' display limitations in enhanced green fluorescent protein expression in retina and optic nerve cells.

PubMed

Caminos, Elena; Vaquero, Cecilia F; García-Olmo, Dolores C

2014-12-01

Characterization of retinal cells, cell transplants and gene therapies may be helped by pre-labeled retinal cells, such as those transfected with vectors for green fluorescent protein expression. The aim of this study was to analyze retinal cells and optic nerve components from transgenic green mice (GM) with the 'enhanced' green fluorescent protein (EGFP) gene under the control of the CAG promoter (a chicken β-actin promoter and a cytomegalovirus enhancer). The structural analysis and electroretinography recordings showed a normal, healthy retina. Surprisingly, EGFP expression was not ubiquitously located in the retina and optic nerve. Epithelial cells, photoreceptors and bipolar cells presented high green fluorescence levels. In contrast, horizontal cells, specific amacrine cells and ganglion cells exhibited a null EGFP expression level. The synaptic terminals of rod bipolar cells displayed a high green fluorescence level when animals were kept in the dark. Immature retinas exhibited different EGFP expression patterns to those noted in adults. Axons and glial cells in the optic nerve revealed a specific regional EGFP expression pattern, which correlated with the presence of myelin. These results suggest that EGFP expression might be related to the activity of both the CAG promoter and β-actin in mature retinal neurons and oligodendrocytes. Moreover, EGFP expression might be regulated by light in both immature and adult animals. Since GM are used in numerous retina bioassays, it is essential to know the differential EGFP expression in order to select cells of interest for each study.

Engineering of a green-light inducible gene expression system in Synechocystis sp. PCC6803.

PubMed

Abe, Koichi; Miyake, Kotone; Nakamura, Mayumi; Kojima, Katsuhiro; Ferri, Stefano; Ikebukuro, Kazunori; Sode, Koji

2014-03-01

In order to construct a green-light-regulated gene expression system for cyanobacteria, we characterized a green-light sensing system derived from Synechocystis sp. PCC6803, consisting of the green-light sensing histidine kinase CcaS, the cognate response regulator CcaR, and the promoter of cpcG2 (PcpcG 2 ). CcaS and CcaR act as a genetic controller and activate gene expression from PcpcG 2 with green-light illumination. The green-light induction level of the native PcpcG 2 was investigated using GFPuv as a reporter gene inserted in a broad-host-range vector. A clear induction of protein expression from native PcpcG 2 under green-light illumination was observed; however, the expression level was very low compared with Ptrc , which was reported to act as a constitutive promoter in cyanobacteria. Therefore, a Shine-Dalgarno-like sequence derived from the cpcB gene was inserted in the 5' untranslated region of the cpcG2 gene, and the expression level of CcaR was increased. Thus, constructed engineered green-light sensing system resulted in about 40-fold higher protein expression than with the wild-type promoter with a high ON/OFF ratio under green-light illumination. The engineered green-light gene expression system would be a useful genetic tool for controlling gene expression in the emergent cyanobacterial bioprocesses. © 2013 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

[Prediction of Promoter Motifs in Virophages].

PubMed

Gong, Chaowen; Zhou, Xuewen; Pan, Yingjie; Wang, Yongjie

2015-07-01

Virophages have crucial roles in ecosystems and are the transport vectors of genetic materials. To shed light on regulation and control mechanisms in virophage--host systems as well as evolution between virophages and their hosts, the promoter motifs of virophages were predicted on the upstream regions of start codons using an analytical tool for prediction of promoter motifs: Multiple EM for Motif Elicitation. Seventeen potential promoter motifs were identified based on the E-value, location, number and length of promoters in genomes. Sputnik and zamilon motif 2 with AT-rich regions were distributed widely on genomes, suggesting that these motifs may be associated with regulation of the expression of various genes. Motifs containing the TCTA box were predicted to be late promoter motif in mavirus; motifs containing the ATCT box were the potential late promoter motif in the Ace Lake mavirus . AT-rich regions were identified on motif 2 in the Organic Lake virophage, motif 3 in Yellowstone Lake virophage (YSLV)1 and 2, motif 1 in YSLV3, and motif 1 and 2 in YSLV4, respectively. AT-rich regions were distributed widely on the genomes of virophages. All of these motifs may be promoter motifs of virophages. Our results provide insights into further exploration of temporal expression of genes in virophages as well as associations between virophages and giant viruses.

Chicken ovalbumin upstream promoter-transcription factor II regulates nuclear receptor, myogenic, and metabolic gene expression in skeletal muscle cells.

PubMed

Crowther, Lisa M; Wang, Shu-Ching Mary; Eriksson, Natalie A; Myers, Stephen A; Murray, Lauren A; Muscat, George E O

2011-02-24

We demonstrate that chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) mRNA is more abundantly expressed (than COUP-TFI mRNA) in skeletal muscle C2C12 cells and in (type I and II) skeletal muscle tissue from C57BL/10 mice. Consequently, we have utilized the ABI TaqMan Low Density Array (TLDA) platform to analyze gene expression changes specifically attributable to ectopic COUP-TFII (relative to vector only) expression in muscle cells. Utilizing a TLDA-based platform and 5 internal controls, we analyze the entire NR superfamily, 96 critical metabolic genes, and 48 important myogenic regulatory genes on the TLDA platform utilizing 5 internal controls. The low density arrays were analyzed by rigorous statistical analysis (with Genorm normalization, Bioconductor R, and the Empirical Bayes statistic) using the (integromics) statminer software. In addition, we validated the differentially expressed patho-physiologically relevant gene (identified on the TLDA platform) glucose transporter type 4 (Glut4). We demonstrated that COUP-TFII expression increased the steady state levels of Glut4 mRNA and protein, while ectopic expression of truncated COUP-TFII lacking helix 12 (COUP-TFΔH12) reduced Glut4 mRNA expression in C2C12 cells. Moreover, COUP-TFII expression trans-activated the Glut4 promoter (-997/+3), and ChIP analysis identified selective recruitment of COUP-TFII to a region encompassing a highly conserved SP1 binding site (in mouse, rat, and human) at nt positions -131/-118. Mutation of the SpI site ablated COUP-TFII mediated trans-activation of the Glut4 promoter. In conclusion, this study demonstrates that in skeletal muscle cells, COUP-TFII regulates several nuclear hormone receptors, and critical metabolic and muscle specific genes.

EWS Knockdown and Taxifolin Treatment Induced Differentiation and Removed DNA Methylation from p53 Promoter to Promote Expression of Puma and Noxa for Apoptosis in Ewing’s Sarcoma

PubMed Central

Hossain, Mohammad Motarab; Ray, Swapan Kumar

2016-01-01

Ewing’s sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing’s sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing’s sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing’s sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing’s sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing’s sarcoma in cell culture and animal models. PMID:27547487

EWS Knockdown and Taxifolin Treatment Induced Differentiation and Removed DNA Methylation from p53 Promoter to Promote Expression of Puma and Noxa for Apoptosis in Ewing's Sarcoma.

PubMed

Hossain, Mohammad Motarab; Ray, Swapan Kumar

2014-10-01

Ewing's sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing's sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing's sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing's sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing's sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing's sarcoma in cell culture and animal models.

Construction of a novel shuttle vector for use in Gluconobacter oxydans.

PubMed

Zhang, Lin; Lin, Jinping; Ma, Yushu; Wei, Dongzhi; Sun, Ming

2010-11-01

A shuttle vector pZL1 which can replicate both in Gluconobacter oxydans and Escherichia coli was constructed based on G. oxydans DSM2003 cryptic plasmid pGOX3, a homology of G. oxydans 621H pGOX3, and E. coli cloning vector pUC18. It was found to be stably maintained in G. oxydans during the serial subcultures in the absence of antibiotic pressure for 144 h. With pGOX3 as the reference sample, the relative copy number of pZL1 in G. oxydans is 13 determined by real-time fluorescence quantitative PCR (qPCR). The copy number of pZL1 is much higher than pBBR1MCS5 in E. coli. The vector pZL1 contains six commonly used restriction endonuclease sites, HindIII, SalI, XbaI, BamHI, SmaI, KpnI, and SacI, and is easy to manipulate in molecular biology experiments. The shuttle vector was used to express a reporter protein wasabi successfully in G. oxydans DSM2003 under the control of the tufB promoter.

RANK ligand signaling modulates the matrix metalloproteinase-9 gene expression during osteoclast differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sundaram, Kumaran; Nishimura, Riko; Senn, Joseph

2007-01-01

Osteoclast differentiation is tightly regulated by receptor activator of NF-{kappa}B ligand (RANKL) signaling. Matrix metalloproteinase-9 (MMP-9), a type IV collagenase is highly expressed in osteoclast cells and plays an important role in degradation of extracellular matrix; however, the molecular mechanisms that regulate MMP-9 gene expression are unknown. In this study, we demonstrate that RANKL signaling induces MMP-9 gene expression in osteoclast precursor cells. We further show that RANKL regulates MMP-9 gene expression through TRAF6 but not TRAF2. Interestingly, blockade of p38 MAPK activity by pharmacological inhibitor, SB203580 increases MMP-9 activity whereas ERK1/2 inhibitor, PD98059 decreases RANKL induced MMP-9 activity inmore » RAW264.7 cells. These data suggest that RANKL differentially regulates MMP-9 expression through p38 and ERK signaling pathways during osteoclast differentiation. Transient expression of MMP-9 gene (+ 1 to - 1174 bp relative to ATG start codon) promoter-luciferase reporter plasmids in RAW264.7 cells and RANKL stimulation showed significant increase (20-fold) of MMP-9 gene promoter activity; however, there is no significant change with respect to + 1 bp to - 446 bp promoter region and empty vector transfected cells. These results indicated that MMP-9 promoter sequence from - 446 bp to - 1174 bp relative to start codon is responsive to RANKL stimulation. Sequence analysis of the mouse MMP-9 gene promoter region further identified the presence of binding motif (- 1123 bp to - 1153 bp) for the nuclear factor of activated T cells 1 (NFATc1) transcription factor. Inhibition of NFATc1 using siRNA and VIVIT peptide inhibitor significantly decreased RANKL stimulation of MMP-9 activity. We further confirm by oligonucleotide pull-down assay that RANKL stimuli enhanced NFATc1 binding to MMP-9 gene promoter element. In addition, over-expression of constitutively active NFAT in RAW264.7 cells markedly increased (5-fold) MMP-9 gene promoter activity in the absence of RANKL. Taken together, our results suggest that RANKL signals through TRAF6 and that NFATc1 is a downstream effector of RANKL signaling to modulate MMP-9 gene expression during osteoclast differentiation.« less

Production of recombinant protein by a novel oxygen-induced system in Escherichia coli.

PubMed

Baez, Antonino; Majdalani, Nadim; Shiloach, Joseph

2014-04-07

The SoxRS regulon of E. coli is activated in response to elevated dissolved oxygen concentration likely to protect the bacteria from possible oxygen damage. The soxS expression can be increased up to 16 fold, making it a possible candidate for recombinant protein expression. Compared with the existing induction approaches, oxygen induction is advantageous because it does not involve addition or depletion of growth factors or nutrients, addition of chemical inducers or temperature changes that can affect growth and metabolism of the producing bacteria. It also does not affect the composition of the growth medium simplifying the recovery and purification processes. The soxS promoter was cloned into the commercial pGFPmut3.1 plasmid creating pAB49, an expression vector that can be induced by increasing oxygen concentration. The efficiency and the regulatory properties of the soxS promoter were characterized by measuring the GFP expression when the culture dissolved oxygen concentration was increased from 30% to 300% air saturation. The expression level of recombinant GFP was proportional to the oxygen concentration, demonstrating that pAB49 is a controllable expression vector. A possible harmful effect of elevated oxygen concentration on the recombinant product was found to be negligible by determining the protein-carbonyl content and its specific fluorescence. By performing high density growth in modified LB medium, the cells were induced by increasing the oxygen concentration. After 3 hours at 300% air saturation, GFP fluorescence reached 109000 FU (494 mg of GFP/L), representing 3.4% of total protein, and the cell concentration reached 29.1 g/L (DW). Induction of recombinant protein expression by increasing the dissolved oxygen concentration was found to be a simple and efficient alternative expression strategy that excludes the use of chemical, nutrient or thermal inducers that have a potential negative effect on cell growth or the product recovery.

Optimization of a nonviral transfection system to evaluate Cox-2 controlled interleukin-4 expression for osteoarthritis gene therapy in vitro.

PubMed

Lang, Annemarie; Neuhaus, Johannes; Pfeiffenberger, Moritz; Schröder, Erik; Ponomarev, Igor; Weber, Yvonne; Gaber, Timo; Schmidt, Michael F G

2014-01-01

Gene therapy appears to have the potential for achieving a long-term remedy for osteoarthritis (OA). However, there is a risk of adverse reactions, especially when using cytomegalovirus-controlled expression. To provide a safe application, we focused on the expression of therapeutic cytokines [e.g. interleukin (IL)-4] in a disease-responsive manner by use of the previously cloned Cox-2 promoter as 'genetic switch'. In the present study, we report the functionality of a controlled gene therapeutic system in an equine osteoarthritic cell model. Different nonviral transfection reagents were tested for their efficiency on equine chondrocytes stimulated with equine IL-1β or lipopolysaccharide to create an inflammatory environment. To optimize the transfection, we successfully redesigned the vector by excluding the internal ribosomal entry site (IRES). The functionality of our Cox-2 promoter construct with respect to expressing IL-4 was proven at the mRNA and protein levels and the anti-inflammatory potential of IL-4 was confirmed by analyzing the expression of IL-1β, IL-6, IL-8, matrix metalloproteinase (MMP)-1, MMP-3 and tumor necrosis factor (TNF)-α using a quantitative polymerase chain reaction. Nonviral transfection reagents yielded transfection rates from 21% to 44% with control vectors with and without IRES, respectively. Stimulation of equine chondrocytes resulted in a 20-fold increase of mRNA expression of IL-1β. Such exogenous stimulation of chondrocytes transfected with pNCox2-IL4 led to an increase of IL-4 mRNA expression, whereas expression of inflammatory mediators decreased. The timely link between these events confirms the anti-inflammatory potential of synthesized IL-4. We consider that this approach has significant potential for translation into a useful anti-inflammation therapy. Molecular tools such as the described therapeutic plasmid pave the way for a local-controlled, self-limiting gene therapy. Copyright © 2014 John Wiley & Sons, Ltd.

Generating an Open Reading Frame (ORF) Entry Clone and Destination Clone.

PubMed

Reece-Hoyes, John S; Walhout, Albertha J M

2018-01-02

This protocol describes using the Gateway recombinatorial cloning system to create an Entry clone carrying an open reading frame (ORF) and then to transfer the ORF into a Destination vector. In this example, BP recombination is used to clone an ORF from a cDNA source into the Donor vector pDONR 221. The ORF from the resulting Entry clone is then transferred into the Destination vector pDEST-15; the product (the Destination clone) will express the ORF as an amino-terminal GST-fusion. The technique can be used as a guide for cloning any other DNA fragment of interest-a promoter sequence or 3' untranslated region (UTR), for example-with substitutions of different genetic material such as genomic DNA, att sites, and vectors as required. The series of constructions and transformations requires 9-15 d, not including time that may be required for sequence confirmation, if desired/necessary. © 2018 Cold Spring Harbor Laboratory Press.

The Pacific White Shrimp β-actin Promoter: Functional Properties and the Potential Application for Transduction System Using Recombinant Baculovirus.

PubMed

Shi, Yingli; Xiang, Jianhai; Zhou, Guangzhou; Ron, Tetsuzan Benny; Tong, Hsin-I; Kang, Wen; Sun, Si; Lu, Yuanan

2016-06-01

A newly isolated Pacific white shrimp (Litopenaeus vannamei) beta-actin promoter SbaP and its derivative compact construct SbaP (ENX) have recently been demonstrated to promote ectopic gene expression in vitro and in vivo. To further explore the potential transduction application, this newly isolated shrimp promoter SbaP was comparatively tested with cytomegalovirus (CMV), simian virus 40 (SV40), polyhedrin (Polh), and white spot syndrome virus immediate early gene 1 (WSSV ie1) four constitutive promoters and a beta-actin promoter (TbaP) from tilapia fish to characterize its promoting function in eight different cell lines. Luciferase quantitation assays revealed that SbaP can drive luciferase gene expression in all eight cell lines including sf21 (insect), PAC2 (zebrafish), EPC (carp), CHSE-214 (chinook salmon), GSTEF (green sea turtle), MS-1 (monk seal), 293T (human), and HeLa (human), but at different levels. Comparative analysis revealed that the promoting activity of SbaP was lower (≤10-fold) than CMV but higher (2-20 folds) than Polh in most of these cell lines tested. Whereas, SbaP mediated luciferase expression in sf21 cells was over 20-fold higher than CMV, SV40, Polh, and TbaP promoter. Compared to the SbaP, SbaP (ENX), which was constructed on the basis of SbaP by deletion of two "negative" regulatory elements, exhibited no significant change of promoting activity in EPC and PAC2 cells, but a 5 and 16 % lower promoting effect in 293T and HeLa cells, respectively. Additionally, a recombinant baculovirus was constructed under the control of SbaP (ENX), and efficient promoter activity of newly generated baculoviral vector was detected both in vitro of infected sf21 cells and in vivo of injected indicator shrimp. These results warrant the potential application of SbaP, particularly SbaP (ENX) in ectopic gene expression in future.

Linear Lepidopteran ambidensovirus 1 sequences drive random integration of a reporter gene in transfected Spodoptera frugiperda cells.

PubMed

Rizk, Francine; Laverdure, Sylvain; d'Alençon, Emmanuelle; Bossin, Hervé; Dupressoir, Thierry

2018-01-01

The Lepidopteran ambidensovirus 1 isolated from Junonia coenia (hereafter JcDV) is an invertebrate parvovirus considered as a viral transduction vector as well as a potential tool for the biological control of insect pests. Previous works showed that JcDV-based circular plasmids experimentally integrate into insect cells genomic DNA. In order to approach the natural conditions of infection and possible integration, we generated linear JcDV- gfp based molecules which were transfected into non permissive Spodoptera frugiperda ( Sf9 ) cultured cells. Cells were monitored for the expression of green fluorescent protein (GFP) and DNA was analyzed for integration of transduced viral sequences. Non-structural protein modulation of the VP-gene cassette promoter activity was additionally assayed. We show that linear JcDV-derived molecules are capable of long term genomic integration and sustained transgene expression in Sf9 cells. As expected, only the deletion of both inverted terminal repeats (ITR) or the polyadenylation signals of NS and VP genes dramatically impairs the global transduction/expression efficiency. However, all the integrated viral sequences we characterized appear "scrambled" whatever the viral content of the transfected vector. Despite a strong GFP expression, we were unable to recover any full sequence of the original constructs and found rearranged viral and non-viral sequences as well. Cellular flanking sequences were identified as non-coding ones. On the other hand, the kinetics of GFP expression over time led us to investigate the apparent down-regulation by non-structural proteins of the VP-gene cassette promoter. Altogether, our results show that JcDV-derived sequences included in linear DNA molecules are able to drive efficiently the integration and expression of a foreign gene into the genome of insect cells, whatever their composition, provided that at least one ITR is present. However, the transfected sequences were extensively rearranged with cellular DNA during or after random integration in the host cell genome. Lastly, the non-structural proteins seem to participate in the regulation of p9 promoter activity rather than to the integration of viral sequences.

Metabolic biotinylation of lentiviral pseudotypes for scalable paramagnetic microparticle-dependent manipulation.

PubMed

Nesbeth, Darren; Williams, Sharon L; Chan, Lucas; Brain, Tony; Slater, Nigel K H; Farzaneh, Farzin; Darling, David

2006-04-01

Nonviral, host-derived proteins on lentiviral vector surfaces can have a profound effect on the vector's biology as they can both promote infection and provide resistance to complement inactivation. We have exploited this to engineer a specific posttranslational modification of a "nonenvelope," virally associated protein. The bacterial biotin ligase (BirA) and a modified human DeltaLNGFR have been introduced into HEK293T cells and their protein products directed to the lumen of the endoplasmic reticulum. The BirA then couples biotin to an acceptor peptide that has been fused to the DeltaLNGFR. This results in the covalent linkage of biotin to the extracellular domain of the DeltaLNGFR expressed on the cell surface. Lentiviral vectors from these cells are metabolically labeled with biotin in the presence of free biotin. These biotinylated lentiviral vectors have a high affinity for streptavidin paramagnetic particles and, once captured, are easily manipulated in vitro. This is illustrated by the concentration of lentiviral vectors pseudotyped with either the VSV-G or an amphotropic envelope in excess of 4500-fold. This new cell line has the potential for widespread application to envelope pseudotypes compatible with lentiviral vector production.

Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

PubMed

Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

2013-03-05

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest. Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome(13,14) and apoptosis signaling(15,16). In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Flexible tools for gene expression and silencing in tomato.

PubMed

Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

2009-12-01

As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

Expressing Transgenes That Exceed the Packaging Capacity of Adeno-Associated Virus Capsids

PubMed Central

Chamberlain, Kyle; Riyad, Jalish Mahmud; Weber, Thomas

2016-01-01

Recombinant adeno-associated virus vectors (rAAV) are being explored as gene delivery vehicles for the treatment of various inherited and acquired disorders. rAAVs are attractive vectors for several reasons: wild-type AAVs are nonpathogenic, and rAAVs can trigger long-term transgene expression even in the absence of genome integration—at least in postmitotic tissues. Moreover, rAAVs have a low immunogenic profile, and the various AAV serotypes and variants display broad but distinct tropisms. One limitation of rAAVs is that their genome-packaging capacity is only ∼5 kb. For most applications this is not of major concern because the median human protein size is 375 amino acids. Excluding the ITRs, for a protein of typical length, this allows the incorporation of ∼3.5 kb of DNA for the promoter, polyadenylation sequence, and other regulatory elements into a single AAV vector. Nonetheless, for certain diseases the packaging limit of AAV does not allow the delivery of a full-length therapeutic protein by a single AAV vector. Hence, approaches to overcome this limitation have become an important area of research for AAV gene therapy. Among the most promising approaches to overcome the limitation imposed by the packaging capacity of AAV is the use of dual-vector approaches, whereby a transgene is split across two separate AAV vectors. Coinfection of a cell with these two rAAVs will then—through a variety of mechanisms—result in the transcription of an assembled mRNA that could not be encoded by a single AAV vector because of the DNA packaging limits of AAV. The main purpose of this review is to assess the current literature with respect to dual-AAV-vector design, to highlight the effectiveness of the different methodologies and to briefly discuss future areas of research to improve the efficiency of dual-AAV-vector transduction. PMID:26757051

Embedding siRNA sequences targeting Apolipoprotein B100 in shRNA and miRNA scaffolds results in differential processing and in vivo efficacy

PubMed Central

Maczuga, Piotr; Lubelski, Jacek; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Fakkert, Erwin; Costessi, Adalberto; Butler, Derek; van Deventer, Sander; Petry, Harald; Koornneef, Annemart; Konstantinova, Pavlina

2013-01-01

Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5′ and 3′ cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 1011 genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics. PMID:23089734

Plasmid Vectors for Proteomic Analyses in Giardia: Purification of Virulence Factors and Analysis of the Proteasome

PubMed Central

Stadelmann, Britta; Birkestedt, Sandra; Hellman, Ulf; Svärd, Staffan G.

2012-01-01

In recent years, proteomics has come of age with the development of efficient tools for purification, identification, and characterization of gene products predicted by genome projects. The intestinal protozoan Giardia intestinalis can be transfected, but there is only a limited set of vectors available, and most of them are not user friendly. This work delineates the construction of a suite of cassette-based expression vectors for use in Giardia. Expression is provided by the strong constitutive ornithine carbamoyltransferase (OCT) promoter, and tagging is possible in both N- and C-terminal configurations. Taken together, the vectors are capable of providing protein localization and production of recombinant proteins, followed by efficient purification by a novel affinity tag combination, streptavidin binding peptide–glutathione S-transferase (SBP-GST). The option of removing the tags from purified proteins was provided by the inclusion of a PreScission protease site. The efficiency and feasibility of producing and purifying endogenous recombinant Giardia proteins with the developed vectors was demonstrated by the purification of active recombinant arginine deiminase (ADI) and OCT from stably transfected trophozoites. Moreover, we describe the tagging, purification by StrepTactin affinity chromatography, and compositional analysis by mass spectrometry of the G. intestinalis 26S proteasome by employing the Strep II-FLAG–tandem affinity purification (SF-TAP) tag. This is the first report of efficient production and purification of recombinant proteins in and from Giardia, which will allow the study of specific parasite proteins and protein complexes. PMID:22611020

Sustained ELABELA Gene Therapy in High-salt Diet-induced Hypertensive Rats.

PubMed

Schreiber, Claire A; Holditch, Sara J; Generous, Alex; Ikeda, Yasuhiro

2017-01-01

Elabela (ELA) is a recently identified apelin receptor agonist essential for cardiac development, but its biology and therapeutic potential are unclear. In humans, ELA transcripts are detected in embryonic stem cells, induced pluripotent stem cells, kidney, heart and blood vessels. ELA through the apelin (APJ) receptor promotes angiogenesis in vitro, relaxes murine aortic blood vessels and attenuates high blood pressure in vivo. The APJ receptor when bound to its original ligand, apelin, exerts peripheral vasodilatory and positive inotropic effects, conferring cardioprotection in vivo. This study initially assessed endogenous ELA expression in normal and diseased rats and then characterized the effects of long-term ELA gene delivery by adeno-associated virus serotype 9 (AAV9) vectors on cardiorenal function in Dahl salt-sensitive rats (DS) on a high-salt diet over 3 months. Endogenous ELA was predominantly expressed in the kidneys, especially in the renal collecting duct cells and was not affected by disease. Rat ELA was overexpressed in the heart via AAV9 vector by a single intravenous injection. ELA-treated animals showed delayed onset of blood pressure elevation. Prior to high-salt diet, a reduction in the fractional sodium and chloride excretion was observed in rats given the AAV9-ELA vector. After three months on a high-salt diet, ELA preserved glomerular architecture, decreased renal fibrosis and suppressed expression of fibrosis-associated genes in the kidneys. ELA is constitutively expressed in renal collecting ducts in rats. Sustained AAV-ELA expression may offer a potential long-term therapy for hypertension and renal remodeling. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Enhanced expression of EGFP gene in CHSE-214 cells by an ARS element from mud loach (Misgurnus mizolepis).

PubMed

Kim, Moo-Sang; Lim, Hak-Seob; Ahn, Sang Jung; Jeong, Yong-Kee; Kim, Chul Geun; Lee, Hyung Ho

2007-11-01

The origins of replication are associated with nuclear matrices or are found in close proximity to matrix attachment regions (MARs). In this report, fish MARs were cloned into an autonomously replicating sequence (ARS) cloning vector and were screened for ARS elements in Saccharomyces cerevisiae. Sixteen clones were isolated that were able to grow on the selective plates. In particular, an ARS905 that shows high efficiency among them was selected for this study. Southern hybridization indicated the autonomous replication of the transformation vector containing the ARS905 element. DNA sequences analysis showed that the ARS905 contained two ARS consensus sequences as well as MAR motifs, such as AT tracts, ORI patterns, and ATC tracts. In vitro matrix binding analysis, major matrix binding activity and ARS function coincided in a subfragment of the ARS905. To analyze the effects of ARS905 on expression of a reporter gene, an ARS905(E1158) with ARS activity was inserted into pBaEGFP(+) containing mud loach beta-actin promoter, EGFP as a reporter gene, and SV40 poly(A) signal. The pBaEGFP(+)-ARS905(E1158) was transfected into a fish cell line, CHSE-214. The intensity of EGFP transfected cells was a 7-fold of the control at 11days post-transfection. These results indicate that ARS905 enhances the expression of the EGFP gene and that it should be as a component of expression vectors in further fish biotechnological studies.

The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

PubMed Central

Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

2013-01-01

IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

Stability of Lentiviral Vector-Mediated Transgene Expression in the Brain in the Presence of Systemic Antivector Immune Responses

PubMed Central

ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.

2009-01-01

Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune responses against lentiviral vectors was effective in causing a decrease in transgene expression only if the immune response was directed against the transgene. A systemic immune response against vector components alone did not cause brain inflammation, possibly because vector-derived epitopes were not being presented in the CNS. PMID:15960605

A Novel Dual Expression Platform for High Throughput Functional Screening of Phage Libraries in Product like Format.

PubMed

Xiao, Xiaodong; Chen, Yan; Mugabe, Sheila; Gao, Changshou; Tkaczyk, Christine; Mazor, Yariv; Pavlik, Peter; Wu, Herren; Dall'Acqua, William; Chowdhury, Partha Sarathi

2015-01-01

High throughput screenings of single chain Fv (scFv) antibody phage display libraries are currently done as soluble scFvs produced in E.coli. Due to endotoxin contaminations from bacterial cells these preparations cannot be reliably used in mammalian cell based assays. The monovalent nature and lack of Fc in soluble scFvs prevent functional assays that are dependent on target cross linking and/or Fc functions. A convenient approach is to convert scFvs into scFv.Fc fusion proteins and express them in mammalian cell lines for screening. This approach is low throughput and is only taken after primary screening of monovalent scFvs that are expressed in bacteria. There is no platform at present that combines the benefits of both bacterial and mammalian expression system for screening phage library output. We have, therefore, developed a novel dual expression vector, called pSplice, which can be used to express scFv.Fc fusion proteins both in E.coli and mammalian cell lines. The hallmark of the vector is an engineered intron which houses the bacterial promoter and signal peptide for expression and secretion of scFv.Fc in E.coli. When the vector is transfected into a mammalian cell line, the intron is efficiently spliced out resulting in a functional operon for expression and secretion of the scFv.Fc fusion protein into the culture medium. By applying basic knowledge of mammalian introns and splisosome, we designed this vector to enable screening of phage libraries in a product like format. Like IgG, the scFv.Fc fusion protein is bi-valent for the antigen and possesses Fc effector functions. Expression in E.coli maintains the speed of the bacterial expression platform and is used to triage clones based on binding and other assays that are not sensitive to endotoxin. Triaged clones are then expressed in a mammalian cell line without the need for any additional cloning steps. Conditioned media from the mammalian cell line containing the fusion proteins are then used for different types of cell based assays. Thus this system retains the speed of the current screening system for phage libraries and adds additional functionality to it.

pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana.

PubMed

Tsutsui, Hiroki; Higashiyama, Tetsuya

2017-01-01

The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

Set regulation in asexual and sexual Plasmodium parasites reveals a novel mechanism of stage-specific expression.

PubMed

Pace, Tomasino; Olivieri, Anna; Sanchez, Massimo; Albanesi, Veronica; Picci, Leonardo; Siden Kiamos, Inga; Janse, Chris J; Waters, Andrew P; Pizzi, Elisabetta; Ponzi, Marta

2006-05-01

Transmission of the malaria parasite depends on specialized gamete precursors (gametocytes) that develop in the bloodstream of a vertebrate host. Gametocyte/gamete differentiation requires controlled patterns of gene expression and regulation not only of stage and gender-specific genes but also of genes associated with DNA replication and mitosis. Once taken up by mosquito, male gametocytes undergo three mitotic cycles within few minutes to produce eight motile gametes. Here we analysed, in two Plasmodium species, the expression of SET, a conserved nuclear protein involved in chromatin dynamics. SET is expressed in both asexual and sexual blood stages but strongly accumulates in male gametocytes. We demonstrated functionally the presence of two distinct promoters upstream of the set open reading frame, the one active in all blood stage parasites while the other active only in gametocytes and in a fraction of schizonts possibly committed to sexual differentiation. In ookinetes both promoters exhibit a basal activity, while in the oocysts the gametocyte-specific promoter is silent and the reporter gene is only transcribed from the constitutive promoter. This transcriptional control, described for the first time in Plasmodium, provides a mechanism by which single-copy genes can be differently modulated during parasite development. In male gametocytes an overexpression of SET might contribute to a prompt entry and execution of S/M phases within mosquito vector.

Replication-Competent Controlled Herpes Simplex Virus

PubMed Central

Bloom, David C.; Feller, Joyce; McAnany, Peterjon; Vilaboa, Nuria

2015-01-01

ABSTRACT We present the development and characterization of a replication-competent controlled herpes simplex virus 1 (HSV-1). Replication-essential ICP4 and ICP8 genes of HSV-1 wild-type strain 17syn+ were brought under the control of a dually responsive gene switch. The gene switch comprises (i) a transactivator that is activated by a narrow class of antiprogestins, including mifepristone and ulipristal, and whose expression is mediated by a promoter cassette that comprises an HSP70B promoter and a transactivator-responsive promoter and (ii) transactivator-responsive promoters that drive the ICP4 and ICP8 genes. Single-step growth experiments in different cell lines demonstrated that replication of the recombinant virus, HSV-GS3, is strictly dependent on an activating treatment consisting of administration of a supraphysiological heat dose in the presence of an antiprogestin. The replication-competent controlled virus replicates with an efficiency approaching that of the wild-type virus from which it was derived. Essentially no replication occurs in the absence of activating treatment or if HSV-GS3-infected cells are exposed only to heat or antiprogestin. These findings were corroborated by measurements of amounts of viral DNA and transcripts of the regulated ICP4 gene and the glycoprotein C (gC) late gene, which was not regulated. Similar findings were made in experiments with a mouse footpad infection model. IMPORTANCE The alphaherpesviruses have long been considered vectors for recombinant vaccines and oncolytic therapies. The traditional approach uses vector backbones containing attenuating mutations that restrict replication to ensure safety. The shortcoming of this approach is that the attenuating mutations tend to limit both the immune presentation and oncolytic properties of these vectors. HSV-GS3 represents a novel type of vector that, when activated, replicates with the efficiency of a nonattenuated virus and whose safety is derived from deliberate, stringent regulation of multiple replication-essential genes. By directing activating heat to the region of virus administration, replication is strictly confined to infected cells within this region. The requirement for antiprogestin provides an additional level of safety, ensuring that virus replication cannot be triggered inadvertently. Replication-competent controlled vectors such as HSV-GS3 may have the potential to be superior to conventional attenuated HSV vaccine and oncolytic vectors without sacrificing safety. PMID:26269179

Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae.

PubMed

Gritz, L; Davies, J

1983-11-01

The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.

Administration of helper-dependent adenoviral vectors and sequential delivery of different vector serotype for long-term liver-directed gene transfer in baboons

PubMed Central

Morral, Núria; O’Neal, Wanda; Rice, Karen; Leland, Michele; Kaplan, Johanne; Piedra, Pedro A.; Zhou, Heshan; Parks, Robin J.; Velji, Rizwan; Aguilar-Córdova, Estuardo; Wadsworth, Samuel; Graham, Frank L.; Kochanek, Stefan; Carey, K. Dee; Beaudet, Arthur L.

1999-01-01

The efficiency of first-generation adenoviral vectors as gene delivery tools is often limited by the short duration of transgene expression, which can be related to immune responses and to toxic effects of viral proteins. In addition, readministration is usually ineffective unless the animals are immunocompromised or a different adenovirus serotype is used. Recently, adenoviral vectors devoid of all viral coding sequences (helper-dependent or gutless vectors) have been developed to avoid expression of viral proteins. In mice, liver-directed gene transfer with AdSTK109, a helper-dependent adenoviral (Ad) vector containing the human α1-antitrypsin (hAAT) gene, resulted in sustained expression for longer than 10 months with negligible toxicity to the liver. In the present report, we have examined the duration of expression of AdSTK109 in the liver of baboons and compared it to first-generation vectors expressing hAAT. Transgene expression was limited to approximately 3–5 months with the first-generation vectors. In contrast, administration of AdSTK109 resulted in transgene expression for longer than a year in two of three baboons. We have also investigated the feasibility of circumventing the humoral response to the virus by sequential administration of vectors of different serotypes. We found that the ineffectiveness of readministration due to the humoral response to an Ad5 first-generation vector was overcome by use of an Ad2-based vector expressing hAAT. These data suggest that long-term expression of transgenes should be possible by combining the reduced immunogenicity and toxicity of helper-dependent vectors with sequential delivery of vectors of different serotypes. PMID:10536005

Molecular breeding of transgenic rice plants expressing a bacterial chlorocatechol dioxygenase gene.

PubMed

Shimizu, Masami; Kimura, Tetsuya; Koyama, Takayoshi; Suzuki, Katsuhisa; Ogawa, Naoto; Miyashita, Kiyotaka; Sakka, Kazuo; Ohmiya, Kunio

2002-08-01

The cbnA gene encoding the chlorocatechol dioxygenase gene from Ralstonia eutropha NH9 was introduced into rice plants. The cbnA gene was expressed in transgenic rice plants under the control of a modified cauliflower mosaic virus 35S promoter. Western blot analysis using anti-CbnA protein indicated that the cbnA gene was expressed in leaf tissue, roots, culms, and seeds. Transgenic rice calluses expressing the cbnA gene converted 3-chlorocatechol to 2-chloromucote efficiently. Growth and morphology of the transgenic rice plants expressing the cbnA gene were not distinguished from those of control rice plants harboring only a Ti binary vector. It is thus possible to breed transgenic plants that degrade chloroaromatic compounds in soil and surface water.

Pleiotrophin over-expression provides trophic support to dopaminergic neurons in parkinsonian rats.

PubMed

Taravini, Irene Re; Chertoff, Mariela; Cafferata, Eduardo G; Courty, José; Murer, Mario G; Pitossi, Fernando J; Gershanik, Oscar S

2011-06-07

Pleiotrophin is known to promote the survival and differentiation of dopaminergic neurons in vitro and is up-regulated in the substantia nigra of Parkinson's disease patients. To establish whether pleiotrophin has a trophic effect on nigrostriatal dopaminergic neurons in vivo, we injected a recombinant adenovirus expressing pleiotrophin in the substantia nigra of 6-hydroxydopamine lesioned rats. The viral vector induced pleiotrophin over-expression by astrocytes in the substantia nigra pars compacta, without modifying endogenous neuronal expression. The percentage of tyrosine hydroxylase-immunoreactive cells as well as the area of their projections in the lesioned striatum was higher in pleiotrophin-treated animals than in controls. These results indicate that pleiotrophin over-expression partially rescues tyrosine hydroxylase-immunoreactive cell bodies and terminals of dopaminergic neurons undergoing 6-hydroxydopamine-induced degeneration.

Avirulent Marek’s Disease Virus Type 1 Strain 814 Vectored Vaccine Expressing Avian Influenza (AI) Virus H5 Haemagglutinin Induced Better Protection Than Turkey Herpesvirus Vectored AI Vaccine

PubMed Central

Cui, Xianlan; Zhao, Yan; Shi, Xingming; Li, Qiaoling; Yan, Shuai; Gao, Ming; Wang, Mei; Liu, Changjun; Wang, Yunfeng

2013-01-01

Background Herpesvirus of turkey (HVT) as a vector to express the haemagglutinin (HA) of avian influenza virus (AIV) H5 was developed and its protection against lethal Marek’s disease virus (MDV) and highly pathogenic AIV (HPAIV) challenges was evaluated previously. It is well-known that avirulemt MDV type 1 vaccines are more effective than HVT in prevention of lethal MDV infection. To further increase protective efficacy against HPAIV and lethal MDV, a recombinant MDV type 1 strain 814 was developed to express HA gene of HPAIV H5N1. Methodology/Principal Findings A recombinant MDV-1 strain 814 expressing HA gene of HPAIV H5N1 virus A/goose/Guangdong/3/96 at the US2 site (rMDV-HA) was developed under the control of a human CMV immediate-early promoter. The HA expression in the rMDV-HA was tested by immunofluorescence and Western blot analyses, and in vitro and in vivo growth properties of rMDV-HA were also analyzed. Furthermore, we evaluated and compared the protective immunity of rMDV-HA and previously constructed rHVT-HA against HPAIV and lethal MDV. Vaccination of chickens with rMDV-HA induced 80% protection against HPAIV, which was better than the protection rate by rHVT-HA (66.7%). In the animal study with MDV challenge, chickens immunized with rMDV-HA were completely protected against virulent MDV strain J-1 whereas rHVT-HA only induced 80% protection with the same challenge dose. Conclusions/Significance The rMDV-HA vaccine was more effective than rHVT-HA vaccine for protection against lethal MDV and HPAIV challenges. Therefore, avirulent MDV type 1 vaccine is a better vector than HVT for development of a recombinant live virus vaccine against virulent MDV and HPAIV in poultry. PMID:23301062

Adeno-associated virus type 8 vector–mediated expression of siRNA targeting vascular endothelial growth factor efficiently inhibits neovascularization in a murine choroidal neovascularization model

PubMed Central

Igarashi, Tsutomu; Miyake, Noriko; Fujimoto, Chiaki; Yaguchi, Chiemi; Iijima, Osamu; Shimada, Takashi; Takahashi, Hiroshi

2014-01-01

Purpose To assess the feasibility of a gene therapeutic approach to treating choroidal neovascularization (CNV), we generated an adeno-associated virus type 8 vector (AAV2/8) encoding an siRNA targeting vascular endothelial growth factor (VEGF), and determined the AAV2/8 vector’s ability to inhibit angiogenesis. Methods We initially transfected 3T3 cells expressing VEGF with the AAV2/8 plasmid vector psiRNA-VEGF using the H1 promoter and found that VEGF expression was significantly diminished in the transfectants. We next injected 1 μl (3 × 1014 vg/ml) of AAV2/8 vector encoding siRNA targeting VEGF (AAV2/8/SmVEGF-2; n = 12) or control vector encoding green fluorescent protein (GFP) (AAV2/8/GFP; n = 14) into the subretinal space in C57BL/6 mice. One week later, CNV was induced by using a diode laser to make four separate choroidal burns around the optic nerve in each eye. After an additional 2 weeks, the eyes were removed for flat mount analysis of the CNV surface area. Results Subretinal delivery of AAV2/8/SmVEGF-2 significantly diminished CNV at the laser lesions, compared to AAV8/GFP (1597.3±2077.2 versus 5039.5±4055.9 µm2; p<0.05). Using an enzyme-linked immunosorbent assay, we found that VEGF levels were reduced by approximately half in the AAV2/8/SmVEGF-2 treated eyes. Conclusions These results suggest that siRNA-VEGF can be expressed across the retina and that long-term suppression of CNV is possible through the use of stable AAV2/8-mediated siRNA-VEGF expression. In vivo gene therapy may thus be a feasible approach to the clinical management of CNV in conditions such as age-related macular degeneration. PMID:24744609

α-Synuclein induced toxicity in brain stem serotonin neurons mediated by an AAV vector driven by the tryptophan hydroxylase promoter.

PubMed

Wan, Oi Wan; Shin, Eunju; Mattsson, Bengt; Caudal, Dorian; Svenningsson, Per; Björklund, Anders

2016-05-23

We studied the impact of α-synuclein overexpression in brainstem serotonin neurons using a novel vector construct where the expression of human wildtype α-synuclein is driven by the tryptophan hydroxylase promoter, allowing expression of α-synuclein at elevated levels, and with high selectivity, in serotonergic neurons. α-Synuclein induced degenerative changes in axons and dendrites, displaying a distorted appearance, suggesting accumulation and aggregation of α-synuclein as a result of impaired axonal transport, accompanied by a 40% loss of terminals, as assessed in the hippocampus. Tissue levels of serotonin and its major metabolite 5-HIAA remained largely unaltered, and the performance of the α-synuclein overexpressing rats in tests of spatial learning (water maze), anxiety related behavior (elevated plus maze) and depressive-like behavior (forced swim test) was not different from control, suggesting that the impact of the developing axonal pathology on serotonin neurotransmission was relatively mild. Overexpression of α-synuclein in the raphe nuclei, combined with overexpression in basal forebrain cholinergic neurons, resulted in more pronounced axonal pathology and significant impairment in the elevated plus maze. We conclude that α-synuclein pathology in serotonergic or cholinergic neurons alone is not sufficient to impair non-motor behaviors, but that it is their simultaneous involvement that determines severity of such symptoms.

Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector

PubMed Central

Kabadi, Ami M.; Ousterout, David G.; Hilton, Isaac B.; Gersbach, Charles A.

2014-01-01

Engineered DNA-binding proteins that manipulate the human genome and transcriptome have enabled rapid advances in biomedical research. In particular, the RNA-guided CRISPR/Cas9 system has recently been engineered to create site-specific double-strand breaks for genome editing or to direct targeted transcriptional regulation. A unique capability of the CRISPR/Cas9 system is multiplex genome engineering by delivering a single Cas9 enzyme and two or more single guide RNAs (sgRNAs) targeted to distinct genomic sites. This approach can be used to simultaneously create multiple DNA breaks or to target multiple transcriptional activators to a single promoter for synergistic enhancement of gene induction. To address the need for uniform and sustained delivery of multiplex CRISPR/Cas9-based genome engineering tools, we developed a single lentiviral system to express a Cas9 variant, a reporter gene and up to four sgRNAs from independent RNA polymerase III promoters that are incorporated into the vector by a convenient Golden Gate cloning method. Each sgRNA is efficiently expressed and can mediate multiplex gene editing and sustained transcriptional activation in immortalized and primary human cells. This delivery system will be significant to enabling the potential of CRISPR/Cas9-based multiplex genome engineering in diverse cell types. PMID:25122746

Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.

PubMed

Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C

2010-05-01

Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.

Impact of age and vector construct on striatal and nigral transgene expression

PubMed Central

Polinski, Nicole K; Manfredsson, Fredric P; Benskey, Matthew J; Fischer, D Luke; Kemp, Christopher J; Steece-Collier, Kathy; Sandoval, Ivette M; Paumier, Katrina L; Sortwell, Caryl E

2016-01-01

Therapeutic protein delivery using viral vectors has shown promise in preclinical models of Parkinson’s disease (PD) but clinical trial success remains elusive. This may partially be due to a failure to include advanced age as a covariate despite aging being the primary risk factor for PD. We investigated transgene expression following intracerebral injections of recombinant adeno-associated virus pseudotypes 2/2 (rAAV2/2), 2/5 (rAAV2/5), 2/9 (rAAV2/9), and lentivirus (LV) expressing green fluorescent protein (GFP) in aged versus young adult rats. Both rAAV2/2 and rAAV2/5 yielded lower GFP expression following injection to either the aged substantia nigra or striatum. rAAV2/9-mediated GFP expression was deficient in the aged striatonigral system but displayed identical transgene expression between ages in the nigrostriatal system. Young and aged rats displayed equivalent GFP levels following LV injection to the striatonigral system but LV-delivered GFP was deficient in delivering GFP to the aged nigrostriatal system. Notably, age-related transgene expression deficiencies revealed by protein quantitation were poorly predicted by GFP-immunoreactive cell counts. Further, in situ hybridization for the viral CβA promoter revealed surprisingly limited tropism for astrocytes compared to neurons. Our results demonstrate that aging is a critical covariate to consider when designing gene therapy approaches for PD. PMID:27933309

Safe and Efficient Gene Therapy for Pyruvate Kinase Deficiency.

PubMed

Garcia-Gomez, Maria; Calabria, Andrea; Garcia-Bravo, Maria; Benedicenti, Fabrizio; Kosinski, Penelope; López-Manzaneda, Sergio; Hill, Collin; Del Mar Mañu-Pereira, María; Martín, Miguel A; Orman, Israel; Vives-Corrons, Joan-LLuis; Kung, Charles; Schambach, Axel; Jin, Shengfang; Bueren, Juan A; Montini, Eugenio; Navarro, Susana; Segovia, Jose C

2016-08-01

Pyruvate kinase deficiency (PKD) is a monogenic metabolic disease caused by mutations in the PKLR gene that leads to hemolytic anemia of variable symptomatology and that can be fatal during the neonatal period. PKD recessive inheritance trait and its curative treatment by allogeneic bone marrow transplantation provide an ideal scenario for developing gene therapy approaches. Here, we provide a preclinical gene therapy for PKD based on a lentiviral vector harboring the hPGK eukaryotic promoter that drives the expression of the PKLR cDNA. This therapeutic vector was used to transduce mouse PKD hematopoietic stem cells (HSCs) that were subsequently transplanted into myeloablated PKD mice. Ectopic RPK expression normalized the erythroid compartment correcting the hematological phenotype and reverting organ pathology. Metabolomic studies demonstrated functional correction of the glycolytic pathway in RBCs derived from genetically corrected PKD HSCs, with no metabolic disturbances in leukocytes. The analysis of the lentiviral insertion sites in the genome of transplanted hematopoietic cells demonstrated no evidence of genotoxicity in any of the transplanted animals. Overall, our results underscore the therapeutic potential of the hPGK-coRPK lentiviral vector and provide high expectations toward the gene therapy of PKD and other erythroid metabolic genetic disorders.

Novel Adeno-Associated Viral Vector Delivering the Utrophin Gene Regulator Jazz Counteracts Dystrophic Pathology in mdx Mice

PubMed Central

Strimpakos, Georgios; Corbi, Nicoletta; Pisani, Cinzia; Di Certo, Maria Grazia; Onori, Annalisa; Luvisetto, Siro; Severini, Cinzia; Gabanella, Francesca; Monaco, Lucia; Mattei, Elisabetta; Passananti, Claudio

2014-01-01

Over-expression of the dystrophin-related gene utrophin represents a promising therapeutic strategy for Duchenne muscular dystrophy (DMD). The strategy is based on the ability of utrophin to functionally replace defective dystrophin. We developed the artificial zinc finger transcription factor “Jazz” that up-regulates both the human and mouse utrophin promoter. We observed a significant recovery of muscle strength in dystrophic Jazz-transgenic mdx mice. Here we demonstrate the efficacy of an experimental gene therapy based on the systemic delivery of Jazz gene in mdx mice by adeno-associated virus (AAV). AAV serotype 8 was chosen on the basis of its high affinity for skeletal muscle. Muscle-specific expression of the therapeutic Jazz gene was enhanced by adding the muscle α-actin promoter to the AAV vector (mAAV). Injection of mAAV8-Jazz viral preparations into mdx mice resulted in muscle-specific Jazz expression coupled with up-regulation of the utrophin gene. We show a significant recovery from the dystrophic phenotype in mAAV8-Jazz-treated mdx mice. Histological and physiological analysis revealed a reduction of fiber necrosis and inflammatory cell infiltration associated with functional recovery in muscle contractile force. The combination of ZF-ATF technology with the AAV delivery can open a new avenue to obtain a therapeutic strategy for treatment of DMD. J. Cell. Physiol. 229: 1283–1291, 2014. © 2014 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc. PMID:24469912

Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

PubMed

Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

2013-01-01

In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.

Adeno-Associated Virus Type 6 (AAV6) Vectors Mediate Efficient Transduction of Airway Epithelial Cells in Mouse Lungs Compared to That of AAV2 Vectors

PubMed Central

Halbert, Christine L.; Allen, James M.; Miller, A. Dusty

2001-01-01

Although vectors derived from adeno-associated virus type 2 (AAV2) promote gene transfer and expression in many somatic tissues, studies with animal models and cultured cells show that the apical surface of airway epithelia is resistant to transduction by AAV2 vectors. Approaches to increase transduction rates include increasing the amount of vector and perturbing the integrity of the epithelia. In this study, we explored the use of vectors based on AAV6 to increase transduction rates in airways. AAV vectors were made using combinations of rep, cap, and packaged genomes from AAV2 or AAV6. The packaged genomes encoded human placental alkaline phosphatase and contained terminal repeat sequences from AAV2 or AAV6. We found that transduction efficiency was primarily dependent on the source of Cap protein, defined here as the vector pseudotype. The AAV6 and AAV2 pseudotype vectors exhibited different tropisms in tissue-cultured cells, and cell transduction by AAV6 vectors was not inhibited by heparin, nor did they compete for entry in a transduction assay, indicating that AAV6 and AAV2 capsid bind different receptors. In vivo analysis of vectors showed that AAV2 pseudotype vectors gave high transduction rates in alveolar cells but much lower rates in the airway epithelium. In contrast, the AAV6 pseudotype vectors exhibited much more efficient transduction of epithelial cells in large and small airways, showing up to 80% transduction in some airways. These results, combined with our previous results showing lower immunogenicity of AAV6 than of AAV2 vectors, indicate that AAV6 vectors may provide significant advantages over AAV2 for gene therapy of lung diseases like cystic fibrosis. PMID:11413329

Robust production of virus-like particles and monoclonal antibodies with geminiviral replicon vectors in lettuce

PubMed Central

Lai, Huafang; He, Junyun; Engle, Michael; Diamond, Michael S.; Chen, Qiang

2011-01-01

Summary Pharmaceutical protein production in plants has been greatly promoted by the development of viral-based vectors and transient expression systems. Tobacco and related Nicotiana species are currently the most common host plants for generation of plant-made pharmaceutical proteins (PMPs). Downstream processing of target PMPs from these plants, however, is hindered by potential technical and regulatory difficulties due to the presence of high levels of phenolics and toxic alkaloids. Here, we explored the use of lettuce, which grows quickly yet produces low levels of secondary metabolites, and viral vector-based transient expression systems to develop a robust PMP production platform. Our results showed that a geminiviral replicon system based on the bean yellow dwarf virus permits high-level expression in lettuce of virus-like particles (VLP) derived from the Norwalk virus capsid protein and therapeutic monoclonal antibodies (mAbs) against Ebola and West Nile viruses. These vaccine and therapeutic candidates can be readily purified from lettuce leaves with scalable processing methods while fully retaining functional activity. Furthermore, this study also demonstrated the feasibility of using commercially produced lettuce for high-level PMP production. This allows our production system to have access to unlimited quantities of inexpensive plant material for large-scale production. These results establish a new production platform for biological pharmaceutical agents that is effective, safe, low-cost, and amenable to large-scale manufacturing. PMID:21883868

Engineering species-like barriers to sexual reproduction.

PubMed

Maselko, Maciej; Heinsch, Stephen C; Chacón, Jeremy M; Harcombe, William R; Smanski, Michael J

2017-10-12

Controlling the exchange of genetic information between sexually reproducing populations has applications in agriculture, eradication of disease vectors, control of invasive species, and the safe study of emerging biotechnology applications. Here we introduce an approach to engineer a genetic barrier to sexual reproduction between otherwise compatible populations. Programmable transcription factors drive lethal gene expression in hybrid offspring following undesired mating events. As a proof of concept, we target the ACT1 promoter of the model organism Saccharomyces cerevisiae using a dCas9-based transcriptional activator. Lethal overexpression of actin results from mating this engineered strain with a strain containing the wild-type ACT1 promoter.Genetic isolation of a genetically modified organism represents a useful strategy for biocontainment. Here the authors use dCas9-VP64-driven gene expression to construct a 'species-like' barrier to reproduction between two otherwise compatible populations.

Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

PubMed Central

Podsakoff, G; Wong, K K; Chatterjee, S

1994-01-01

Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells. Images PMID:8057446

Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

PubMed

Podsakoff, G; Wong, K K; Chatterjee, S

1994-09-01

Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells.

Let-7b promotes alpaca hair growth via transcriptional repression of TGFβR I.

PubMed

Yan, Shen; Yu, Zhang; Ning, Liu; Hai-Dong, Wang; Jian-Shan, Xie; Shu-Yuan, Gao; Jia-Qi, Cheng; Xiu-Ju, Yu; Ting, Wang; Chang-Sheng, Dong; Xiao-Yan, He

2016-02-10

The young male alpaca ear and the back skins were used to investigate the effect of transforming growth factor receptor-β I (TGFβR I) on alpaca hair follicles and hair growth. The expression level and location of TGFβR I in alpaca ear and dorsal skin were detected through real-time quantitative PCR (RT-PCR) and paraffin section immunohistochemical technique (ICC-P). The results shown TGFβR I was lower expression in back skin compared to ear skin and the mean density of the positive reaction in ear skin was significantly higher than back skin. The targeted relationship with let-7b was detected using the dual-luciferase reporter vector of TGFβR I, which showed a significant target relationship between let-7b and TGFβR I. After transfection with let-7b eukaryotic expression vector, the relative mRNA expression of TGFβR I in alpaca skin fibroblasts did not differ, while the relative protein level was significantly decreased. In summary, a higher TGFβR I expression level in the ear skin suggests that TGFβR I may inhibit coat hair elongation. Further studies showed TGFβR I protein was downregulated by let-7b through transcriptional repression. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.

PubMed

Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo

2016-09-01

Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.

Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

Using adenovirus armed short hairpin RNA targeting transforming growth factor β1 inhibits melanoma growth and metastasis in an ex vivo animal model.

PubMed

Tai, Kuo-Feng; Wang, Chien-Hsing

2013-12-01

The transforming growth factor β (TGF-β) is the key molecule implicated in impaired immune function in human patients with malignant melanoma. TGF-β can promote tumor growth, invasion, and metastasis in advanced stages of melanoma. Blocking these tumor-promoting effects of TGF-β provides a potentially important therapeutic strategy for the treatment of melanoma. In this study, we used an adenovirus-based shRNA expression system and successfully constructed Ad/TGF-β1-RNA interference (RNAi) which mediated the RNAi for TGF-β1 gene silencing. We examined the effects of TGF-β1 protein knockdown by RNAi on the growth and metastasis of melanoma in C57BL/6 mice induced by the B16F0 cell line. The TGF-β1 hairpin oligonucleotide was cloned into adenoviral vector. The resulting recombinant adenoviruses infected murine melanoma cell line, B16F0, and designated as B16F0/TGF-β1-RNAi cells. The blank adenoviral vector also infected B16F0 cells and designed as B16F0/vector-control cells served as a control. TGF-β1 expression was reduced in B16F0/TGF-β1-RNAi cells compared with B16F0 cells and B16F0/vector-control cells. Three million wild-type B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells were injected subcutaneously into the right flanks of adult female syngeneic mice C57BL/6. The tumor sizes were 756.09 (65.35), 798.48 (78.77), and 203.55 (24.56) mm at the 14th day in the mice receiving B16F0 cells, B16F0/vector-control cells, and B16F0/TGFβ1-RNAi cells, respectively. The P value was less than 0.01 by 1-way analysis of variance. TGF-β1 knockdown in B16F0 cells enhanced the infiltration of CD4 and CD8 T cells in the tumor regions. C57BL/6 mice were evaluated for pulmonary metastasis after tail vein injection of 2 million B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells. The pulmonary metastasis also reduced significantly on days 14 day and 21 in mice injected with B16F0/TGF-β1-RNAi tumors. The blood vessel density of the tumors markedly reduced in B16F0/TGF-β1-RNAi tumors. Our results showed that Ad/TGF-β1-RNAi could induce silencing of the TGF-β1 gene effectively. Silencing of TGF-β1 expression in B16F0 cells by RNAi technology can inhibit the growth and metastasis of this tumor after being transplanted to C57BL/6 mice. This kind of adenoviral vector based on RNAi might be a promising vector for cancer therapy.

Construction of a recombinant duck enteritis virus (DEV) expressing hemagglutinin of H5N1 avian influenza virus based on an infectious clone of DEV vaccine strain and evaluation of its efficacy in ducks and chickens.

PubMed

Wang, Jichun; Ge, Aimin; Xu, Mengwei; Wang, Zhisheng; Qiao, Yongfeng; Gu, Yiqi; Liu, Chang; Liu, Yamei; Hou, Jibo

2015-08-13

Highly pathogenic avian influenza virus (AIV) subtype H5N1 remains a threat to poultry. Duck enteritis virus (DEV)-vectored vaccines expressing AIV H5N1 hemagglutinin (HA) may be viable AIV and DEV vaccine candidates. To facilitate the generation and further improvement of DEV-vectored HA(H5) vaccines, we first constructed an infectious clone of DEV Chinese vaccine strain C-KCE (DEV(C-KCE)). Then, we generated a DEV-vectored HA(H5) vaccine (DEV-H5(UL55)) based on the bacterial artificial chromosome (BAC) by inserting a synthesized HA(H5) expression cassette with a pMCMV IE promoter and a consensus HA sequence into the noncoding area between UL55 and LORF11. The immunogenicity and protective efficacy of the resulting recombinant vaccine against DEV and AIV H5N1 were evaluated in both ducks and chickens. The successful construction of DEV BAC and DEV-H5(UL55) was verified by restriction fragment length polymorphism analysis. Recovered virus from the BAC or mutants showed similar growth kinetics to their parental viruses. The robust expression of HA in chicken embryo fibroblasts infected with the DEV-vectored vaccine was confirmed by indirect immunofluorescence and western blotting analyses. A single dose of 10(6) TCID50 DEV-vectored vaccine provided 100 % protection against duck viral enteritis in ducks, and the hemagglutination inhibition (HI) antibody titer of AIV H5N1 with a peak of 8.2 log2 was detected in 3-week-old layer chickens. In contrast, only very weak HI titers were observed in ducks immunized with 10(7) TCID50 DEV-vectored vaccine. A mortality rate of 60 % (6/10) was observed in 1-week-old specific pathogen free chickens inoculated with 10(6) TCID50 DEV-vectored vaccine. We demonstrate the following in this study. (i) The constructed BAC is a whole genome clone of DEV(C-KCE). (ii) The insertion of an HA expression cassette sequence into the noncoding area between UL55 and LORF11 of DEV(C-KCE) affects neither the growth kinetics of the virus nor its protection against DEV. (iii) DEV-H5(UL55) can generate a strong humoral immune response in 3-week-old chickens, despite the virulence of this virus observed in 1-week-old chickens. (iv) DEV-H5(UL55) induces a weak HI titer in ducks. An increase in the HI titers induced by DEV-vectored HA(H5) will be required prior to its wide application.

Generation of transgenic mice expressing EGFP protein fused to NP68 MHC class I epitope using lentivirus vectors.

PubMed

Tomkowiak, Martine; Ghittoni, Raffaella; Teixeira, Marie; Blanquier, Bariza; Szécsi, Judit; Nègre, Didier; Aubert, Denise; Coupet, Charles-Antoine; Brunner, Molly; Verhoeyen, Els; Thoumas, Jean-Louis; Cosset, François-Loïc; Leverrier, Yann; Marvel, Jacqueline

2013-03-01

Immune tolerance to self-antigens is a complex process that utilizes multiple mechanisms working in concert to maintain homeostasis and prevent autoimmunity. Considerable progress in deciphering the mechanisms controlling the activation or deletion of T cells has been made by using T cell receptor (TCR) transgenic mice. One such model is the F5 model in which CD8 T cells express a TCR specific for an epitope derived from the influenza NP68 protein. Our aim was to create transgenic mouse models expressing constitutively the NP68 epitope fused to enhanced green fluorescent protein (EGFP) in order to assess unambiguously the relative levels of NP68 epitope expressed by single cells. We used a lentiviral-based approach to generate two independent transgenic mouse strains expressing the fusion protein EGFP-NP68 under the control of CAG (CMV immediate early enhancer and the chicken β-actin promoter) or spleen focus-forming virus (SFFV) promoters. Analysis of the pattern of EGFP expression in the hematopoietic compartment showed that CAG and SFFV promoters are differentially regulated during T cell development. However, both promoters drove high EGFP-NP68 expression in dendritic cells (pDCs, CD8α(+) cDCs, and CD8α(-) cDCs) from spleen or generated in vitro following differentiation from bone-marrow progenitors. NP68 epitope was properly processed and successfully presented by dendritic cells (DCs) by direct presentation and cross-presentation to F5 CD8 T cells. The models presented here are valuable tools to investigate the priming of F5 CD8 T cells by different subsets of DCs. Copyright © 2013 Wiley Periodicals, Inc.

Expression of six peptidases from Lactobacillus helveticus in Lactococcus lactis.

PubMed

Luoma, S; Peltoniemi, K; Joutsjoki, V; Rantanen, T; Tamminen, M; Heikkinen, I; Palva, A

2001-03-01

For development of novel starter strains with improved proteolytic properties, the ability of Lactococcus lactis to produce Lactobacillus helveticus aminopeptidase N (PepN), aminopeptidase C (PepC), X-prolyl dipeptidyl aminopeptidase (PepX), proline iminopeptidase (PepI), prolinase (PepR), and dipeptidase (PepD) was studied by introducing the genes encoding these enzymes into L. lactis MG1363 and its derivatives. According to Northern analyses and enzyme activity measurements, the L. helveticus aminopeptidase genes pepN, pepC, and pepX are expressed under the control of their own promoters in L. lactis. The highest expression level, using a low-copy-number vector, was obtained with the L. helveticus pepN gene, which resulted in a 25-fold increase in PepN activity compared to that of wild-type L. lactis. The L. helveticus pepI gene, residing as a third gene in an operon in its host, was expressed in L. lactis under the control of the L. helveticus pepX promoter. The genetic background of the L. lactis derivatives tested did not affect the expression level of any of the L. helveticus peptidases studied. However, the growth medium used affected both the recombinant peptidase profiles in transformant strains and the resident peptidase activities. The levels of expression of the L. helveticus pepD and pepR clones under the control of their own promoters were below the detection limit in L. lactis. However, substantial amounts of recombinant pepD and PepR activities were obtained in L. lactis when pepD and pepR were expressed under the control of the inducible lactococcal nisA promoter at an optimized nisin concentration.

Expression of Six Peptidases from Lactobacillus helveticus in Lactococcus lactis

PubMed Central

Luoma, Susanna; Peltoniemi, Kirsi; Joutsjoki, Vesa; Rantanen, Terhi; Tamminen, Marja; Heikkinen, Inka; Palva, Airi

2001-01-01

For development of novel starter strains with improved proteolytic properties, the ability of Lactococcus lactis to produce Lactobacillus helveticus aminopeptidase N (PepN), aminopeptidase C (PepC), X-prolyl dipeptidyl aminopeptidase (PepX), proline iminopeptidase (PepI), prolinase (PepR), and dipeptidase (PepD) was studied by introducing the genes encoding these enzymes into L. lactis MG1363 and its derivatives. According to Northern analyses and enzyme activity measurements, the L. helveticus aminopeptidase genes pepN, pepC, and pepX are expressed under the control of their own promoters in L. lactis. The highest expression level, using a low-copy-number vector, was obtained with the L. helveticus pepN gene, which resulted in a 25-fold increase in PepN activity compared to that of wild-type L. lactis. The L. helveticus pepI gene, residing as a third gene in an operon in its host, was expressed in L. lactis under the control of the L. helveticus pepX promoter. The genetic background of the L. lactis derivatives tested did not affect the expression level of any of the L. helveticus peptidases studied. However, the growth medium used affected both the recombinant peptidase profiles in transformant strains and the resident peptidase activities. The levels of expression of the L. helveticus pepD and pepR clones under the control of their own promoters were below the detection limit in L. lactis. However, substantial amounts of recombinant pepD and PepR activities were obtained in L. lactis when pepD and pepR were expressed under the control of the inducible lactococcal nisA promoter at an optimized nisin concentration. PMID:11229915

Hepatitis B core protein promotes liver cancer metastasis through miR-382-5p/DLC-1 axis.

PubMed

Du, Juan; Bai, Fuxiang; Zhao, Peiqing; Li, Xiaoyan; Li, Xueen; Gao, Lifen; Ma, Chunhong; Liang, Xiaohong

2018-01-01

The hepatitis B virus core protein (HBc), also named core antigen, is well-known for its key role in viral capsid formation and virus replication. Recently, studies showed that HBc has the potential to control cell biology activity by regulating host gene expression. Here, we utilized miRNA microarray to identify 24 upregulated miRNAs and 21 downregulated miRNAs in HBc-expressed HCC cells, which were involved in multiple biological processes, including cell motility. Consistently, the in vitro transwell assay and the in vivo tail-vein injection model showed HBc promotion on HCC metastasis. Further, the miRNA-target gene network analysis displayed that the deleted in liver cancer (DLC-1) gene, an important negative regulator for cell motility, was potentially targeted by several differentially expressed miRNAs in HBc-introduced cells. Introduction of miRNAs mimics or inhibitors and 3'UTR luciferase activity assay proved that miR-382-5p efficiently suppressed DLC-1 expression and its 3'-UTR luciferase reporter activity. Importantly, cotransfection of miR-382-5p mimics/inhibitors and the DLC-1 expression vector almost abrogated HBc promotion on cell motility, indicating that the miR-382-5p/DLC-1 axis is important for mediating HBc-enhanced HCC motility. Clinical HCC samples also showed a negative correlation between miR-382-5p and DLC-1 expression level. Furthermore, HBc-positive HCC tissues showed high miR-382-5p level and reduced DLC-1 expression. In conclusion, our findings revealed that HBc promoted HCC motility by regulating the miR-382-5p/DLC-1 axis, which might provide a novel target for clinical diagnosis and treatment. Copyright © 2017 Elsevier B.V. All rights reserved.

Phytoplasma protein effector SAP11 enhances insect vector reproduction by manipulating plant development and defense hormone biosynthesis.

PubMed

Sugio, Akiko; Kingdom, Heather N; MacLean, Allyson M; Grieve, Victoria M; Hogenhout, Saskia A

2011-11-29

Phytoplasmas are insect-transmitted phytopathogenic bacteria that can alter plant morphology and the longevity and reproduction rates and behavior of their insect vectors. There are various examples of animal and plant parasites that alter the host phenotype to attract insect vectors, but it is unclear how these parasites accomplish this. We hypothesized that phytoplasmas produce effectors that modulate specific targets in their hosts leading to the changes in plant development and insect performance. Previously, we sequenced and mined the genome of Aster Yellows phytoplasma strain Witches' Broom (AY-WB) and identified 56 candidate effectors. Here, we report that the secreted AY-WB protein 11 (SAP11) effector modulates plant defense responses to the advantage of the AY-WB insect vector Macrosteles quadrilineatus. SAP11 binds and destabilizes Arabidopsis CINCINNATA (CIN)-related TEOSINTE BRANCHED1, CYCLOIDEA, PROLIFERATING CELL FACTORS 1 and 2 (TCP) transcription factors, which control plant development and promote the expression of lipoxygenase (LOX) genes involved in jasmonate (JA) synthesis. Both the Arabidopsis SAP11 lines and AY-WB-infected plants produce less JA on wounding. Furthermore, the AY-WB insect vector produces more offspring on AY-WB-infected plants, SAP11 transgenic lines, and plants impaired in CIN-TCP and JA synthesis. Thus, SAP11-mediated destabilization of CIN-TCPs leads to the down-regulation of LOX2 expression and JA synthesis and an increase in M. quadrilineatus progeny. Phytoplasmas are obligate inhabitants of their plant host and insect vectors, in which the latter transmits AY-WB to a diverse range of plant species. This finding demonstrates that pathogen effectors can reach beyond the pathogen-host interface to modulate a third organism in the biological interaction.

Structural recovery of the retina in a retinoschisin-deficient mouse after gene replacement therapy by solid lipid nanoparticles.

PubMed

Apaolaza, P S; Del Pozo-Rodríguez, A; Solinís, M A; Rodríguez, J M; Friedrich, U; Torrecilla, J; Weber, B H F; Rodríguez-Gascón, A

2016-06-01

X-linked juvenile retinoschisis (XLRS) is a retinal degenerative disorder caused by mutations in the RS1 gene encoding a protein termed retinoschisin. The disease is an excellent candidate for gene replacement therapy as the majority of mutations have been shown to lead to a complete deficiency of the secreted protein in the retinal structures. In this work, we have studied the ability of non-viral vectors based on solid lipid nanoparticles (SLN) to induce the expression of retinoschisin in photoreceptors (PR) after intravitreal administration to Rs1h-deficient mice. We designed two vectors prepared with SLN, protamine, and dextran (DX) or hyaluronic acid (HA), bearing a plasmid containing the human RS1 gene under the control of the murin opsin promoter (mOPS). In vitro, the nanocarriers were able to induce the expression of retinoschisin in a PR cell line. After injection into the murine vitreous, the formulation prepared with HA induced a higher transfection level in PR than the formulation prepared with DX. Moreover, the level of retinoschisin in the inner nuclear layer (INL), where bipolar cells are located, was also higher. Two weeks after vitreal administration into Rs1h-deficient mice, both formulations showed significant improvement of the retinal structure by inducing a decrease of cavities and PR loss, and an increase of retinal and outer nuclear layer (ONL) thickness. HA-SLN resulted in a significant higher increase in the thickness of both retina and ONL, which can be explained by the higher transfection level of PR. In conclusion, we have shown the structural improvement of the retina of Rs1h-deficient mice with PR specific expression of the RS1 gene driven by the specific promoter mOPS, after successful delivery via SLN-based non-viral vectors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Role for chondroitin sulfate glycosaminoglycan in NEDD9-mediated breast cancer cell growth.

PubMed

Iida, Joji; Dorchak, Jesse; Clancy, Rebecca; Slavik, Juliana; Ellsworth, Rachel; Katagiri, Yasuhiro; Pugacheva, Elena N; van Kuppevelt, Toin H; Mural, Richard J; Cutler, Mary Lou; Shriver, Craig D

2015-01-15

There are lines of evidence demonstrating that NEDD9 (Cas-L, HEF-1) plays a key role in the development, progression, and metastasis of breast cancer cells. We previously reported that NEDD9 plays a critical role for promoting migration and growth of MDA-MB-231. In order to further characterize the mechanisms of NEDD9-mediated cancer migration and growth, stable cells overexpressing NEDD9 were generated using HCC38 as a parental cell line which expresses low level of endogenous NEDD9. Microarray studies demonstrated that core proteins of CD44 and Serglycin were markedly upregulated in HCC38(NEDD9) cells compared to HCC38(Vector) cells, while those of Syndecan-1, Syndecan-2, and Versican were downregulated in HCC38(NEDD9). Importantly, enzymes generating chondroitin sulfate glycosaminoglycans (CS) such as CHST11, CHST15, and CSGALNACT1 were upregulated in HCC38(NEDD9) compared to HCC38(Vector). Immunofluorescence studies using specific antibody, GD3G7, confirmed the enhanced expression of CS-E subunit in HCC38(NEDD9). Immunoprecipitation and western blotting analysis demonstrated that CS-E was attached to CD44 core protein. We demonstrated that removing CS by chondroitinase ABC significantly inhibited anchorage-independent colony formation of HCC38(NEDD9) in methylcellulose. Importantly, the fact that GD3G7 significantly inhibited colony formation of HCC38(NEDD9) cells suggests that CS-E subunit plays a key role in this process. Furthermore, treatment of HCC38(NEDD9) cells with chondroitinase ABC or GD3G7 significantly inhibited mammosphere formation. Exogenous addition of CS-E enhanced colony formation and mammosphere formation of HCC38 parental and HCC38(Vector) cells. These results suggest that NEDD9 regulates the synthesis and expression of tumor associated glycocalyx structures including CS-E, which plays a key role in promoting and regulating breast cancer progression and metastasis and possibly stem cell phenotypes. Copyright © 2014 Elsevier Inc. All rights reserved.

A Noninvasive In Vitro Monitoring System Reporting Skeletal Muscle Differentiation.

PubMed

Öztürk-Kaloglu, Deniz; Hercher, David; Heher, Philipp; Posa-Markaryan, Katja; Sperger, Simon; Zimmermann, Alice; Wolbank, Susanne; Redl, Heinz; Hacobian, Ara

2017-01-01

Monitoring of cell differentiation is a crucial aspect of cell-based therapeutic strategies depending on tissue maturation. In this study, we have developed a noninvasive reporter system to trace murine skeletal muscle differentiation. Either a secreted bioluminescent reporter (Metridia luciferase) or a fluorescent reporter (green fluorescent protein [GFP]) was placed under the control of the truncated muscle creatine kinase (MCK) basal promoter enhanced by variable numbers of upstream MCK E-boxes. The engineered pE3MCK vector, coding a triple tandem of E-Boxes and the truncated MCK promoter, showed twentyfold higher levels of luciferase activation compared with a Cytomegalovirus (CMV) promoter. This newly developed reporter system allowed noninvasive monitoring of myogenic differentiation in a straining bioreactor. Additionally, binding sequences of endogenous microRNAs (miRNAs; seed sequences) that are known to be downregulated in myogenesis were ligated as complementary seed sequences into the reporter vector to reduce nonspecific signal background. The insertion of seed sequences improved the signal-to-noise ratio up to 25% compared with pE3MCK. Due to the highly specific, fast, and convenient expression analysis for cells undergoing myogenic differentiation, this reporter system provides a powerful tool for application in skeletal muscle tissue engineering.

Translational repression by an RNA-binding protein promotes differentiation to infective forms in Trypanosoma cruzi.

PubMed

Romaniuk, Maria Albertina; Frasch, Alberto Carlos; Cassola, Alejandro

2018-06-01

Trypanosomes, protozoan parasites of medical importance, essentially rely on post-transcriptional mechanisms to regulate gene expression in insect vectors and vertebrate hosts. RNA binding proteins (RBPs) that associate to the 3'-UTR of mature mRNAs are thought to orchestrate master developmental programs for these processes to happen. Yet, the molecular mechanisms by which differentiation occurs remain largely unexplored in these human pathogens. Here, we show that ectopic inducible expression of the RBP TcUBP1 promotes the beginning of the differentiation process from non-infective epimastigotes to infective metacyclic trypomastigotes in Trypanosoma cruzi. In early-log epimastigotes TcUBP1 promoted a drop-like phenotype, which is characterized by the presence of metacyclogenesis hallmarks, namely repositioning of the kinetoplast, the expression of an infective-stage virulence factor such as trans-sialidase, increased resistance to lysis by human complement and growth arrest. Furthermore, TcUBP1-ectopic expression in non-infective late-log epimastigotes promoted full development into metacyclic trypomastigotes. TcUBP1-derived metacyclic trypomastigotes were infective in cultured cells, and developed normally into amastigotes in the cytoplasm. By artificial in vivo tethering of TcUBP1 to the 3' untranslated region of a reporter mRNA we were able to determine that translation of the reporter was reduced by 8-fold, while its mRNA abundance was not significantly compromised. Inducible ectopic expression of TcUBP1 confirmed its role as a translational repressor, revealing significant reduction in the translation rate of multiple proteins, a reduction of polysomes, and promoting the formation of mRNA granules. Expression of TcUBP1 truncated forms revealed the requirement of both N and C-terminal glutamine-rich low complexity sequences for the development of the drop-like phenotype in early-log epimastigotes. We propose that a rise in TcUBP1 levels, in synchrony with nutritional deficiency, can promote the differentiation of T. cruzi epimastigotes into infective metacyclic trypomastigotes.

Enhanced immune response to a dual-promoter anti-caries DNA vaccine orally delivered by attenuated Salmonella typhimurium.

PubMed

Jiang, Hao; Hu, Yijun; Yang, Mei; Liu, Hao; Jiang, Guangshui

2017-05-01

The strength of immune responses induced by DNA vaccine is closely associated with the expression level of cloned antigens available to the antigen presenting cells (APCs). To acquire a larger and more persistent amount of antigen, a dual-promoter, which could double the target antigen output through its expression both in prokaryotic and eukaryotic cells, was employed in the constructed anti-caries DNA vaccine with attenuated Salmonella as mucosal delivery vector in this study. Here, both CMV and nirB promoters were included in the plasmid that harbors the genes encoding the functional epitopes of two virulence factors of S. mutans, i.e. the saliva-binding region (SBR) of PAc and the glucan-binding region (GBR) of glucosyltransferase-I (GTF-I). Delivered by attenuated Salmonella Typhimurium strain SL3261, the anti-caries vaccine was administered intragastrointestinally to BALB/c mice for evaluation of the effectiveness of this immune regime. Specific anti-SBR and anti-GBR antibodies were detected in the serum and saliva of experimental animals by week 3 after immunization. These immune responses were further enhanced after a booster vaccination at week 16. However, in mice receiving Salmonella expressing SBR and GBR under the control of nirB alone these antibody responses were significantly (P<0.01) lower. The serum IgG subclass profiles suggested a Th1/Th2-mixed but Th2 biased immune response to the cloned antigens, which was further confirmed by a significant increase in the Th1 (IFN-γ, IL-2) and Th2 (IL-4, IL-10) cytokines in splenocytes of immunized mice upon stimulation with SBR or GBR. To further determine the protective efficacy of these responses, a challenge test with S. mutans strain UA159 was performed in mice after the second immunization. Following challenge, mice immunized with Salmonella expressing SBR and GBR under the control of the CMV-nirB promoter showed a significant (P<0.01) reduction in the number of S. mutans in the dental plaque compared to the empty vector-immunized or unimmunized mice, and the reduction was also significant at weeks 3-8 (P<0.05) post-challenge when compared with those receiving Salmonella clones with nirB promoter alone. These results provide evidence for the effectiveness of a dual-promoter strategy in the anti-caries DNA vaccine when employing attenuated Salmonella as delivering vehicle for mucosal immunization. Copyright © 2017 Elsevier GmbH. All rights reserved.

An inducible expression system for high-level expression of recombinant proteins in slow growing mycobacteria.

PubMed

Leotta, Lisa; Spratt, Joanne M; Kong, Carlyn U; Triccas, James A

2015-09-01

A novel protein expression vector utilising the inducible hspX promoter of Mycobacterium tuberculosis was constructed and evaluated in this study. High-level induction of three mycobacterial antigens, comprising up to 9% of bacterial sonicate, was demonstrated in recombinant Mycobacterium bovis BCG when grown under low-oxygen tension, which serves to enhance hspX promoter activity. Recombinant proteins were efficiently purified from bacterial lysates in a soluble form by virtue of a C-terminal 6-histidine tag. Purification of the immunodominant M. tuberculosis Ag85B antigen using this system resulted in a recombinant protein that stimulated significant IFN-γ release from Ag85B-reactive T cells generated after vaccination of mice with an Ag85B-expressing vaccine. Further, the M. tuberculosis L-alanine dehydrogenase (Ald) protein purified from recombinant BCG displayed strong enzymatic activity in recombinant form. This study demonstrated that high levels of native-like recombinant mycobacterial proteins can be produced in mycobacterial hosts, and this may aid the analysis of mycobacterial protein function and the development of new treatments. Copyright © 2015 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

Genic insights from integrated human proteomics in GeneCards.

PubMed

Fishilevich, Simon; Zimmerman, Shahar; Kohn, Asher; Iny Stein, Tsippi; Olender, Tsviya; Kolker, Eugene; Safran, Marilyn; Lancet, Doron

2016-01-01

GeneCards is a one-stop shop for searchable human gene annotations (http://www.genecards.org/). Data are automatically mined from ∼120 sources and presented in an integrated web card for every human gene. We report the application of recent advances in proteomics to enhance gene annotation and classification in GeneCards. First, we constructed the Human Integrated Protein Expression Database (HIPED), a unified database of protein abundance in human tissues, based on the publically available mass spectrometry (MS)-based proteomics sources ProteomicsDB, Multi-Omics Profiling Expression Database, Protein Abundance Across Organisms and The MaxQuant DataBase. The integrated database, residing within GeneCards, compares favourably with its individual sources, covering nearly 90% of human protein-coding genes. For gene annotation and comparisons, we first defined a protein expression vector for each gene, based on normalized abundances in 69 normal human tissues. This vector is portrayed in the GeneCards expression section as a bar graph, allowing visual inspection and comparison. These data are juxtaposed with transcriptome bar graphs. Using the protein expression vectors, we further defined a pairwise metric that helps assess expression-based pairwise proximity. This new metric for finding functional partners complements eight others, including sharing of pathways, gene ontology (GO) terms and domains, implemented in the GeneCards Suite. In parallel, we calculated proteome-based differential expression, highlighting a subset of tissues that overexpress a gene and subserving gene classification. This textual annotation allows users of VarElect, the suite's next-generation phenotyper, to more effectively discover causative disease variants. Finally, we define the protein-RNA expression ratio and correlation as yet another attribute of every gene in each tissue, adding further annotative information. The results constitute a significant enhancement of several GeneCards sections and help promote and organize the genome-wide structural and functional knowledge of the human proteome. Database URL:http://www.genecards.org/. © The Author(s) 2016. Published by Oxford University Press.

Conditional immortalization of Gunn rat hepatocytes: an ex vivo model for evaluating methods for bilirubin-UDP-glucuronosyltransferase gene transfer.

PubMed

Fox, I J; Chowdhury, N R; Gupta, S; Kondapalli, R; Schilsky, M L; Stockert, R J; Chowdhury, J R

1995-03-01

Viral vectors and protein carriers utilizing asialoglycoprotein receptor (ASGR)-mediated endocytosis are being developed to transfer genes for the correction of bilirubin-UDP-glucuronosyltransferase (bilirubin-UGT) deficiency. Ex vivo evaluation of these gene transfer vectors would be facilitated by a cell system that lacks bilirubin-UGT, but expresses differentiated liver functions, including ASGR. We immortalized primary Gunn rat hepatocytes by transduction with a recombinant Moloney murine leukemia virus expressing a thermolabile mutant SV40 large T antigen (tsA58). At 33 degrees C, the immortalized hepatocyte clones expressed SV40 large T antigen, synthesized DNA, and doubled in number every 2 to 3 days. At this temperature, differentiated hepatocyte markers, e.g., albumin, ASGR, and androsterone-UGT, were expressed at 5% to 10% of the levels found in primary hepatocytes maintained in culture for 24 hours. Glutathione-S-transferase Yp (GST-Yp), an oncofetal protein, was expressed in these cells at 33 degrees C, but was undetectable in primary hepatocytes. In contrast, when the cells were cultured at 39 degrees C or 37 degrees C, the large T antigen was degraded, DNA synthesis and cell growth stopped, and morphologic characteristics of differentiated hepatocytes were observed. The expression of albumin, ASGR, and androsterone-UGT, and their corresponding mRNAs, increased to 25% to 40% of the level in primary hepatocytes, whereas GST-Yp expression decreased. Functionality of ASGR was demonstrated by internalization of Texas red-labeled asialoorosomucoid, and binding and degradation of 125I-asialoorosomucoid. After liposome-mediated transfer of a plasmid containing the coding region of human bilirubin-UGT1, driven by the SV40 large T promoter, active human bilirubin-UGT1 was expressed in these cells. The immortalized cells were not tumorigenic after transplantation into severe combined immunodeficiency mice. These conditionally immortalized cells will be useful for ex vivo evaluation of bilirubin-UGT gene transfer vectors.

Transfection and heat-inducible expression of molluscan promoter-luciferase reporter gene constructs in the Biomphalaria glabrata embryonic snail cell line.

PubMed

Yoshino, T P; Wu, X J; Liu, H D

1998-09-01

Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable integration and expression of snail genes of interest into the Bge cell line.

Systemic injection of AAV9 carrying a periostin promoter targets gene expression to a myofibroblast-like lineage in mouse hearts after reperfused myocardial infarction.

PubMed

Piras, B A; Tian, Y; Xu, Y; Thomas, N A; O'Connor, D M; French, B A

2016-05-01

Adeno-associated virus (AAV) has been used to direct gene transfer to a variety of tissues, including heart, liver, skeletal muscle, brain, kidney and lung, but it has not previously been shown to effectively target fibroblasts in vivo, including cardiac fibroblasts. We constructed expression cassettes using a modified periostin promoter to drive gene expression in a cardiac myofibroblast-like lineage, with only occasional spillover into cardiomyocyte-like cells. We compared AAV serotypes 6 and 9 and found robust gene expression when the vectors were delivered by systemic injection after myocardial infarction (MI), with little expression in healthy, non-infarcted mice. AAV9 provided expression in a greater number of cells than AAV6, with reporter gene expression visible in the cardiac infarct and border zones from 5 to 62 days post MI, as assessed by luciferase and Cre-activated green fluorescent protein expression. Although common myofibroblast markers were expressed in low abundance, most of the targeted cells expressed myosin IIb, an embryonic form of smooth muscle myosin heavy chain that has previously been associated with myofibroblasts after reperfused MI. This study is the first to demonstrate AAV-mediated expression in a potentially novel myofibroblast-like lineage in mouse hearts post MI and may open new avenues of gene therapy to treat patients surviving MI.

Dual systemic tumor targeting with ligand-directed phage and Grp78 promoter induces tumor regression.

PubMed

Kia, Azadeh; Przystal, Justyna M; Nianiaris, Nastasia; Mazarakis, Nicholas D; Mintz, Paul J; Hajitou, Amin

2012-12-01

The tumor-specific Grp78 promoter is overexpressed in aggressive tumors. Cancer patients would benefit greatly from application of this promoter in gene therapy and molecular imaging; however, clinical benefit is limited by lack of strategies to target the systemic delivery of Grp78-driven transgenes to tumors. This study aims to assess the systemic efficacy of Grp78-guided expression of therapeutic and imaging transgenes relative to the standard cytomegalovirus (CMV) promoter. Combination of ligand and Grp78 transcriptional targeting into a single vector would facilitate systemic applications of the Grp78 promoter. We generated a dual tumor-targeted phage containing the arginine-glycine-aspartic acid tumor homing ligand and Grp78 promoter. Next, we combined flow cytometry, Western blot analysis, bioluminescence imaging of luciferase, and HSVtk/ganciclovir gene therapy and compared efficacy to conventional phage carrying the CMV promoter in vitro and in vivo in subcutaneous models of rat and human glioblastoma. We show that double-targeted phage provides persistent transgene expression in vitro and in tumors in vivo after systemic administration compared with conventional phage. Next, we showed significant tumor killing in vivo using the HSVtk/ganciclovir gene therapy and found a systemic antitumor effect of Grp78-driven HSVtk against therapy-resistant tumors. Finally, we uncovered a novel mechanism of Grp78 promoter activation whereby HSVtk/ganciclovir therapy upregulates Grp78 and transgene expression via the conserved unfolded protein response signaling cascade. These data validate the potential of Grp78 promoter in systemic cancer gene therapy and report the efficacy of a dual tumor targeting phage that may prove useful for translation into gene therapy and molecular imaging applications.

Human granulocyte colony-stimulating factor (hG-CSF) expression in plastids of Lactuca sativa.

PubMed

Sharifi Tabar, Mehdi; Habashi, Ali Akbar; Rajabi Memari, Hamid

2013-01-01

Human granulocyte colony-stimulating factor (hG-CSF) can serve as valuable biopharmaceutical for research and treatment of the human blood cancer. Transplastomic plants have been emerged as a new and high potential candidate for production of recombinant biopharmaceutical proteins in comparison with transgenic plants due to extremely high level expression, biosafety and many other advantages. hG-CSF gene was cloned into pCL vector between prrn16S promoter and TpsbA terminator. The recombinant vector was coated on nanogold particles and transformed to lettuce chloroplasts through biolistic method. Callogenesis and regeneration of cotyledonary explants were obtained by Murashige and Skoog media containing 6-benzylaminopurine and 1-naphthaleneacetic acid hormones. The presence of hG-CSF gene in plastome was studied with four specific PCR primers and expression by Western immunoblotting. hG-CSF gene cloning was confirmed by digestion and sequencing. Transplastomic lettuce lines were regenerated and subjected to molecular analysis. The presence of hG-CSF in plastome was confirmed by PCR using specific primers designed from the plastid genome. Western immunoblotting of extracted protein from transplastomic plants showed a 20-kDa band, which verified the expression of recombinant protein in lettuce chloroplasts. This study is the first report that successfully express hG-CSF gene in lettuce chloroplast. The lettuce plastome can provide a cheap and safe expression platform for producing valuable biopharmaceuticals for research and treatment.

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

PubMed

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

Yak IGF2 Promotes Fibroblast Proliferation Via Suppression of IGF1R and PI3KCG Expression

PubMed Central

Wang, Qi; Gong, Jishang; Du, Jiaxing; Zhang, Yong; Zhao, Xingxu

2018-01-01

Insulin-like growth factor 2 (IGF2) recapitulates many of the activities of insulin and promotes differentiation of myoblasts and osteoblasts, which likely contribute to genetic variations of growth potential. However, little is known about the functions and signaling properties of IGF2 variants in yaks. The over-expression vector and knockdown sequence of yak IGF2 were transfected into yak fibroblasts, and the effects were detected by a series of assays. IGF2 expression in yak muscle tissues was significantly lower than that of other tissues. In yak fibroblasts, the up-regulated expression of IGF2 inhibits expression of IGF1 and insulin-like growth factor 2 receptor (IGF2R) and significantly up-regulates expression of IGF1R. Inhibition of IGF2 expression caused the up-regulates expression of IGF1, IGF1R and IGF2R. Both over-expression and knockdown of IGF2 resulted in up-regulation of threonine protein kinase 1 (Akt1) expression and down-regulation of phosphatidylinositol 3-kinase, catalytic subunit gamma (PIK3CG). Cell cycle and cell proliferation assays revealed that over-expression of IGF2 enhanced the DNA synthesis phase and promoted yak fibroblasts proliferation. Conversely, knockdown of IGF2 decreased DNA synthesis and inhibited proliferation. These results suggested that IGF2 was negatively correlated with IGF1R and PIK3CG and demonstrated an association with the IGFs-PI3K-Akt (IGFs-phosphatidylinositol 3-kinase- threonine protein kinase) pathway in cell proliferation and provided evidence supporting the functional role of IGF2 for use in improving the production performance of yaks. PMID:29558395

Flp and Cre expressed from Flp–2A–Cre and Flp–IRES–Cre transcription units mediate the highest level of dual recombinase-mediated cassette exchange

PubMed Central

Anderson, Rachelle P.; Voziyanova, Eugenia; Voziyanov, Yuri

2012-01-01

Recombinase-mediated cassette exchange (RMCE) is a powerful tool for unidirectional integration of DNA fragments of interest into a pre-determined genome locale. In this report, we examined how the efficiency of dual RMCE catalyzed by Flp and Cre depends on the nature of transcription units that express the recombinases. The following recombinase transcription units were analyzed: (i) Flp and Cre genes expressed as individual transcription units located on different vectors, (ii) Flp and Cre genes expressed as individual transcription units located on the same vector, (iii) Flp and Cre genes expressed from a single promoter and separated by internal ribosome entry sequence and (iv) Flp and Cre coding sequences separated by the 2A peptide and expressed as a single gene. We found that the highest level of dual RMCE (35–45% of the transfected cells) can be achieved when Flp and Cre recombinases are expressed as Flp–2A–Cre and Flp–IRES–Cre transcription units. In contrast, the lowest level of dual RMCE (∼1% of the transfected cells) is achieved when Flp and Cre are expressed as individual transcription units. The analysis shows that it is the relative Flp–to–Cre ratio that critically affects the efficiency of dual RMCE. Our results will be helpful for maximizing the efficiency of dual RMCE aimed to engineer and re-engineer genomes. PMID:22270085

In Vivo Imaging of MDR1A Gene Expression

DTIC Science & Technology

2004-12-01

Engineer PGK-neo and Renilla luciferase cassettes, already available, with appropriate loxP sites, into mdrla locus. Repeat for HSV-tk reporter. The...of the gene-targeting vector. under the control of the PGK promoter. Luc: Renilla luciferase fused in- frame with the translated sequences of exon 2...between the two loxP sites, upstream of the Neo cassette. A cloning strategy was then devised to fuse Renilla luciferase in-frame with the translated

Effect of TCEA3 on the differentiation of bovine skeletal muscle satellite cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Yue; Tong, Hui-Li; Li, Shu-Feng

Bovine muscle-derived satellite cells (MDSCs) are important for animal growth. In this study, the effect of transcription elongation factor A3 (TCEA3) on bovine MDSC differentiation was investigated. Western blotting, immunofluorescence assays, and cytoplasmic and nuclear protein isolation and purification techniques were used to determine the expression pattern and protein localization of TCEA3 in bovine MDSCs during in vitro differentiation. TCEA3 expression was upregulated using the CRISPR/Cas9 technique to study its effects on MDSC differentiation in vitro. TCEA3 expression gradually increased during the in vitro differentiation of bovine MDSCs and peaked on the 5th day of differentiation. TCEA3 was mainly localized in the cytoplasmmore » of bovine MDSCs, and its expression was not detected in the nucleus. The level of TCEA3 was relatively higher in myotubes at a higher degree of differentiation than during early differentiation. After transfection with a TCEA3-activating plasmid vector (TCEA3 overexpression) for 24 h, the myotube fusion rate, number of myotubes, and expression levels of the muscle differentiation-related loci myogenin (MYOG) and myosin heavy chain 3 (MYH3) increased significantly during the in vitro differentiation of bovine MDSCs. After transfection with a TCEA3-inhibiting plasmid vector for 24 h, the myotube fusion rate, number of myotubes, and expression levels of MYOG and MYH3 decreased significantly. Our results indicated, for the first time, that TCEA3 promotes the differentiation of bovine MDSCs and have implications for meat production and animal rearing. - Highlights: • Muscle-derived satellite cell differentiation is promoted by TCEA3. • TCEA3 protein was localized in the cytoplasm, but not nuclei of bovine MDSCs. • TCEA3 levels increased as myotube differentiation increased. • TCEA3 affected myotube fusion, myotube counts, and MYOG and MYH3 levels.« less

Adenoviral Gene Delivery to Primary Human Cutaneous Cells and Burn Wounds

PubMed Central

Hirsch, Tobias; von Peter, Sebastian; Dubin, Grzegorz; Mittler, Dominik; Jacobsen, Frank; Lehnhardt, Markus; Eriksson, Elof; Steinau, Hans-Ulrich; Steinstraesser, Lars

2006-01-01

The adenoviral transfer of therapeutic genes into epidermal and dermal cells is an interesting approach to treat skin diseases and to promote wound healing. The aim of this study was to assess the in vitro and in vivo transfection efficacy in skin and burn wounds after adenoviral gene delivery. Primary keratinocytes (HKC), fibroblasts (HFB), and HaCaT cells were transfected using different concentrations of an adenoviral construct (eGFP). Transfection efficiency and cytotoxicity was determined up to 30 days. Expression was quantified by FACS analysis and fluorimeter. Cytotoxicity was measured using the trypan blue exclusion method. 45 male Sprague Dawley rats received 2 × 108 pfu of Ad5-CMV-LacZ or carrier control intradermally into either superficial partial thickness scald burn or unburned skin. Animals were euthanized after 48 h, 7 or 14 days posttreatment. Transgene expression was assessed using immunohistochemistry and bioluminescent assays. The highest transfection rate was observed 48 h posttransfection: 79% for HKC, 70% for HFB, and 48% for HaCaT. The eGFP expression was detectable in all groups over 30 days (P > 0.05). Cytotoxic effects of the adenoviral vector were observed for HFB after 10 days and HaCaT after 30 days. Reporter gene expression in vivo was significantly higher in burned skin compared with unburned skin (P = 0,004). Gene expression decreases from 2 to 7 days with no significant expression after 14 days. This study demonstrates that effective adenoviral-mediated gene transfer of epidermal primary cells and cell-lines is feasible. Ex vivo gene transfer in epithelial cells might have promise for the use in severely burned patients who receive autologous keratinocyte sheets. Transient cutaneous gene delivery in burn wounds using adenoviral vectors causes significant concentrations in the wound tissue for at least 1 week. Based on these findings, we hypothesize that transient cutaneous adenoviral gene delivery of wound healing promoting factors has potential for clinical application. PMID:17225867

Adenoviral gene delivery to primary human cutaneous cells and burn wounds.

PubMed

Hirsch, Tobias; von Peter, Sebastian; Dubin, Grzegorz; Mittler, Dominik; Jacobsen, Frank; Lehnhardt, Markus; Eriksson, Elof; Steinau, Hans-Ulrich; Steinstraesser, Lars

2006-01-01

The adenoviral transfer of therapeutic genes into epidermal and dermal cells is an interesting approach to treat skin diseases and to promote wound healing. The aim of this study was to assess the in vitro and in vivo transfection efficacy in skin and burn wounds after adenoviral gene delivery. Primary keratinocytes (HKC), fibroblasts (HFB), and HaCaT cells were transfected using different concentrations of an adenoviral construct (eGFP). Transfection efficiency and cytotoxicity was determined up to 30 days. Expression was quantified by FACS analysis and fluorimeter. Cytotoxicity was measured using the trypan blue exclusion method. 45 male Sprague Dawley rats received 2x10(8) pfu of Ad5-CMV-LacZ or carrier control intradermally into either superficial partial thickness scald burn or unburned skin. Animals were euthanized after 48 h, 7 or 14 days posttreatment. Transgene expression was assessed using immunohistochemistry and bioluminescent assays. The highest transfection rate was observed 48 h posttransfection: 79% for HKC, 70% for HFB, and 48% for HaCaT. The eGFP expression was detectable in all groups over 30 days (P>0.05). Cytotoxic effects of the adenoviral vector were observed for HFB after 10 days and HaCaT after 30 days. Reporter gene expression in vivo was significantly higher in burned skin compared with unburned skin (P=0,004). Gene expression decreases from 2 to 7 days with no significant expression after 14 days. This study demonstrates that effective adenoviral-mediated gene transfer of epidermal primary cells and cell-lines is feasible. Ex vivo gene transfer in epithelial cells might have promise for the use in severely burned patients who receive autologous keratinocyte sheets. Transient cutaneous gene delivery in burn wounds using adenoviral vectors causes significant concentrations in the wound tissue for at least 1 week. Based on these findings, we hypothesize that transient cutaneous adenoviral gene delivery of wound healing promoting factors has potential for clinical application.

Coronin 3 promotes gastric cancer metastasis via the up-regulation of MMP-9 and cathepsin K.

PubMed

Ren, Gui; Tian, Qifei; An, Yanxin; Feng, Bin; Lu, Yuanyuan; Liang, Jie; Li, Kai; Shang, Yulong; Nie, Yongzhan; Wang, Xin; Fan, Daiming

2012-09-14

Coronins are a family of highly evolutionary conserved proteins reportedly involved in the regulation of actin cytoskeletal dynamics, although only coronin 3 has been shown to be related to cancer cell migration. In glioblastoma cells, the knockdown of coronin 3 inhibits cell proliferation and invasion. Coronin 3 is also associated with the aggression and metastasis of hepatocellular carcinoma. In this paper, we analyze the migration, invasion and metastasis abilities of gastric cancer cells after up- or down-regulation of coronin 3, and explore the mechanism of coronin 3 in the process of gastric cancer metastasis. The expression of coronin 3 was higher in the highly metastatic sub-cell line MKN28-M, which we established in our laboratory. We also demonstrated that the expression of coronin 3 was remarkably higher in lymph lode metastases than in primary gastric cancer tissues, and over-expression of coronin 3 was correlated with the increased clinical stage and lymph lode metastasis. Recombinant lentiviral vectors encoding shRNAs were designed to down-regulate coronin 3 expression in gastric cancer cell lines. Stable knockdown of coronin 3 by this lentiviral vector could efficiently inhibit the migration and invasion of MKN45 gastric cancer cells. In contrast, up-regulation of coronin 3 significantly enhanced migration and invasion of MKN28-NM cells. In addition, knockdown of coronin 3 significantly reduced liver metastasis in mice after tail vein injection of gastric cancer cells. The Human Tumor Metastasis PCR Array was used to screen the metastasis-associated genes identified by the down-regulation of coronin 3, and the results suggested that, following the knockdown of coronin 3, the tumor cell migration and invasion were inhibited by the reduced expression of MMP-9 and cathepsin K. Coronin 3 is highly expressed in gastric cancer metastases and can promote the metastatic behaviors of gastric cancer cells, including their migration and invasion.

Adenovirus small interfering RNA targeting ezrin induces apoptosis and inhibits metastasis of human osteosarcoma MG-63 cells.

PubMed

Tao, Zhi-Wei; Zou, Ping-An

2018-06-13

Osteosarcoma is a disease prone to recurrence and metastasis, and adenovirus expression vector is frequently studied as a therapeutic target of osteosarcoma in recent year. This study attempts to explore the effect of adenovirus-mediated small interfering RNA (siRNA) targeting ezrin on the proliferation, migration, invasion and apoptosis of human osteosarcoma MG-63 cells. Human osteosarcoma MG-63 cell line was selected for construction of recombinant adenovirus vector. The mRNA and protein levels of ezrin, Bcl2-associated X protein (Bax), B cell lymphoma-2 (Bcl-2), p21, p53, Caspase-3, matrix metalloproteinase 2 (MMP-2) and MMP-9, Cyclin D1, and cyclin-dependent kinase 4a (CDK4a) were determined. Through ELISA, the levels of Caspase-3, MMP-2 and MMP-9 were examined. Finally, human osteosarcoma MG-63 cell viability, growth, invasion, migration, and apoptosis were detected. Initially, adenovirus expression vector of ezrin was constructed by ezrin 2 siRNA sequence. Adenovirus-mediated siRNA targeting ezrin reduced expression of ezrin in MG-63 cells. The results revealed that adenovirus-mediated siRNA targeting ezrin elevated expression levels of Bax, P21, P53, and Caspase-3, Cyclin D1, and CDK4a and reduced expression levels of Bcl-2, MMP-2, and MMP-9. Furthermore, adenovirus-mediated siRNA targeting ezrin inhibited human osteosarcoma MG-63 cell viability, growth, invasion, and migration, and promoted apoptosis. Our study demonstrates that adenovirus-mediated siRNA targeting ezrin can induce apoptosis and inhibit the proliferation, migration and invasion of human osteosarcoma MG-63 cells. ©2018 The Author(s).

Polymorphism in the PER3 promoter associates with diurnal preference and delayed sleep phase disorder.

PubMed

Archer, Simon N; Carpen, Jayshan D; Gibson, Mark; Lim, Gim Hui; Johnston, Jonathan D; Skene, Debra J; von Schantz, Malcolm

2010-05-01

To screen the PER3 promoter for polymorphisms and investigate the phenotypic associations of these polymorphisms with diurnal preference, delayed sleep phase disorder/syndrome (DSPD/DSPS), and their effects on reporter gene expression. Interspecific comparison was used to define the approximate extent of the PER3 promoter as the region between the transcriptional start site and nucleotide position -874. This region was screened in DNA pools using PCR and direct sequencing, which was also used to screen DNA from individual participants. The different promoter alleles were cloned into a luciferase expression vector and a deletion library created. Promoter activation was measured by chemiluminescence. N/A. DNA samples were obtained from volunteers with defined diurnal preference (3 x 80, selected from a pool of 1,590), and DSPD patients (n=23). N/A. We verified three single nucleotide polymorphisms (G -320T, C -319A, G -294A), and found a novel variable number tandem repeat (VNTR) polymorphism (-318 1/2 VNTR). The -320T and -319A alleles occurred more frequently in DSPD compared to morning (P = 0.042 for each) or evening types (P = 0.006 and 0.033). The allele combination TA2G was more prevalent in DSPD compared to morning (P 0.033) or evening types (P = 0.002). Luciferase expression driven by the TA2G combination was greater than for the more common GC2A (P < 0.05) and the rarer TA1G (P < 0.001) combinations. Deletion reporter constructs identified two enhancer regions (-703 to -605, and -283 to -80). Polymorphisms in the PER3 promoter could affect its expression, leading to potential differences in the observed functions of PER3.

AAV-CRISPR/Cas9-Mediated Depletion of VEGFR2 Blocks Angiogenesis In Vitro.

PubMed

Wu, Wenyi; Duan, Yajian; Ma, Gaoen; Zhou, Guohong; Park-Windhol, Cindy; D'Amore, Patricia A; Lei, Hetian

2017-12-01

Pathologic angiogenesis is a component of many diseases, including neovascular age-related macular degeneration, proliferation diabetic retinopathy, as well as tumor growth and metastasis. The purpose of this project was to examine whether the system of adeno-associated viral (AAV)-mediated CRISPR (clustered regularly interspaced short palindromic repeats)-associated endonuclease (Cas)9 can be used to deplete expression of VEGF receptor 2 (VEGFR2) in human vascular endothelial cells in vitro and thus suppress its downstream signaling events. The dual AAV system of CRISPR/Cas9 from Streptococcus pyogenes (AAV-SpGuide and -SpCas9) was adapted to edit genomic VEGFR2 in primary human retinal microvascular endothelial cells (HRECs). In this system, the endothelial-specific promoter for intercellular adhesion molecule 2 (ICAM2) was cloned into the dual AAV vectors of SpGuide and SpCas9 for driving expression of green fluorescence protein (GFP) and SpCas9, respectively. These two AAV vectors were applied to production of recombinant AAV serotype 5 (rAAV5), which were used to infect HRECs for depletion of VEGFR2. Protein expression was determined by Western blot; and cell proliferation, migration, as well as tube formation were examined. AAV5 effectively infected vascular endothelial cells (ECs) and retinal pigment epithelial (RPE) cells; the ICAM2 promoter drove expression of GFP and SpCas9 in HRECs, but not in RPE cells. The results showed that the rAAV5-CRISPR/Cas9 depleted VEGFR2 by 80% and completely blocked VEGF-induced activation of Akt, and proliferation, migration as well as tube formation of HRECs. AAV-CRISRP/Cas9-mediated depletion of VEGFR2 is a potential therapeutic strategy for pathologic angiogenesis.

In Vivo Selection of CD4+ T Cells Transduced with a Gamma-Retroviral Vector Expressing a Single-Chain Intrabody Targeting HIV-1 Tat

PubMed Central

Braun, Stephen E.; Taube, Ran; Zhu, Quan; Wong, Fay Eng; Murakami, Akikazu; Kamau, Erick; Dwyer, Markryan; Qiu, Gang; Daigle, Janet; Carville, Angela; Johnson, R. Paul

2012-01-01

Abstract We evaluated the potential of an anti–human immunodeficiency virus (HIV) Tat intrabody (intracellular antibody) to promote the survival of CD4+ cells after chimeric simian immunodeficiency virus (SIV)/HIV (SHIV) infection in rhesus macaques. Following optimization of stimulation and transduction conditions, purified CD4+ T cells were transduced with GaLV-pseudotyped retroviral vectors expressing either an anti-HIV-1 Tat or a control single-chain intrabody. Ex vivo intrabody-gene marking was highly efficient, averaging four copies per CD4+ cell. Upon reinfusion of engineered autologous CD4+ cells into two macaques, high levels of gene marking (peak of 0.6% and 6.8% of peripheral blood mononuclear cells (PBMCs) and 0.3% or 2.2% of the lymph node cells) were detected in vivo. One week post cell infusion, animals were challenged with SHIV 89.6p and the ability of the anti-HIV Tat intrabody to promote cell survival was evaluated. The frequency of genetically modified CD4+ T cells progressively decreased, concurrent with loss of CD4+ cells and elevated viral loads in both animals. However, CD4+ T cells expressing the therapeutic anti-Tat intrabody exhibited a relative survival advantage over an 8- and 21-week period compared with CD4+ cells expressing a control intrabody. In one animal, this survival benefit of anti-Tat transduced cells was associated with a reduction in viral load. Overall, these results indicate that a retrovirus-mediated anti-Tat intrabody provided significant levels of gene marking in PBMCs and peripheral tissues and increased relative survival of transduced cells in vivo. PMID:22734618

A Chimeric HS4-SAR Insulator (IS2) That Prevents Silencing and Enhances Expression of Lentiviral Vectors in Pluripotent Stem Cells

PubMed Central

Gutierrez-Guerrero, Alejandra; Cobo, Marién; Muñoz, Pilar

2014-01-01

Chromatin insulators, such as the chicken β-globin locus control region hypersensitive site 4 (HS4), and scaffold/matrix attachment regions (SARs/MARs) have been incorporated separately or in combination into retroviral vectors (RVs) in order to increase transgene expression levels, avoid silencing and reduce expression variability. However, their incorporation into RVs either produces a reduction on titer and/or expression levels or do not have sufficient effect on stem cells. In order to develop an improved insulator we decided to combine SAR elements with HS4 insulators. We designed several synthetic shorter SAR elements containing 4 or 5 MAR/SARs recognition signatures (MRS) and studied their effects on a lentiviral vector (LV) expressing eGFP through the SFFV promoter (SE). A 388 bp SAR element containing 5 MRS, named SAR2, was as efficient or superior to the other SARs analyzed. SAR2 enhanced transgene expression and reduced silencing and variability on human embryonic stem cells (hESCs). We next compared the effect of different HS4-based insulators, the HS4-Core (250 bp), the HS4-Ext (400 bp) and the HS4-650 (650 bp). All HS4 elements reduced silencing and expression variability but they also had a negative effect on transgene expression levels and titer. In general, the HS4-650 element had a better overall effect. Based on these data we developed a chimeric insulator, IS2, combining the SAR2 and the HS4-650. When incorporated into the 3′ LTR of the SE LV, the IS2 element was able to enhance expression, avoid silencing and reduce variability of expression on hESCs. Importantly, these effects were maintained after differentiation of the transduced hESCs toward the hematopoietic linage. Neither the HS4-650 nor the SAR2 elements had these effects. The IS2 element is therefore a novel insulator that confers expression stability and enhances expression of LVs on stem cells. PMID:24400083