Model-based reconstruction of synthetic promoter library in Corynebacterium glutamicum.
Zhang, Shuanghong; Liu, Dingyu; Mao, Zhitao; Mao, Yufeng; Ma, Hongwu; Chen, Tao; Zhao, Xueming; Wang, Zhiwen
2018-05-01
To develop an efficient synthetic promoter library for fine-tuned expression of target genes in Corynebacterium glutamicum. A synthetic promoter library for C. glutamicum was developed based on conserved sequences of the - 10 and - 35 regions. The synthetic promoter library covered a wide range of strengths, ranging from 1 to 193% of the tac promoter. 68 promoters were selected and sequenced for correlation analysis between promoter sequence and strength with a statistical model. A new promoter library was further reconstructed with improved promoter strength and coverage based on the results of correlation analysis. Tandem promoter P70 was finally constructed with increased strength by 121% over the tac promoter. The promoter library developed in this study showed a great potential for applications in metabolic engineering and synthetic biology for the optimization of metabolic networks. To the best of our knowledge, this is the first reconstruction of synthetic promoter library based on statistical analysis of C. glutamicum.
Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R
2005-09-01
We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.
Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B
1995-01-01
Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.
Promoter classifier: software package for promoter database analysis.
Gershenzon, Naum I; Ioshikhes, Ilya P
2005-01-01
Promoter Classifier is a package of seven stand-alone Windows-based C++ programs allowing the following basic manipulations with a set of promoter sequences: (i) calculation of positional distributions of nucleotides averaged over all promoters of the dataset; (ii) calculation of the averaged occurrence frequencies of the transcription factor binding sites and their combinations; (iii) division of the dataset into subsets of sequences containing or lacking certain promoter elements or combinations; (iv) extraction of the promoter subsets containing or lacking CpG islands around the transcription start site; and (v) calculation of spatial distributions of the promoter DNA stacking energy and bending stiffness. All programs have a user-friendly interface and provide the results in a convenient graphical form. The Promoter Classifier package is an effective tool for various basic manipulations with eukaryotic promoter sequences that usually are necessary for analysis of large promoter datasets. The program Promoter Divider is described in more detail as a representative component of the package.
de Souza, C R; Aragão, F J; Moreira, E C O; Costa, C N M; Nascimento, S B; Carvalho, L J
2009-03-24
Cassava is one of the most important tropical food crops for more than 600 million people worldwide. Transgenic technologies can be useful for increasing its nutritional value and its resistance to viral diseases and insect pests. However, tissue-specific promoters that guarantee correct expression of transgenes would be necessary. We used inverse polymerase chain reaction to isolate a promoter sequence of the Mec1 gene coding for Pt2L4, a glutamic acid-rich protein differentially expressed in cassava storage roots. In silico analysis revealed putative cis-acting regulatory elements within this promoter sequence, including root-specific elements that may be required for its expression in vascular tissues. Transient expression experiments showed that the Mec1 promoter is functional, since this sequence was able to drive GUS expression in bean embryonic axes. Results from our computational analysis can serve as a guide for functional experiments to identify regions with tissue-specific Mec1 promoter activity. The DNA sequence that we identified is a new promoter that could be a candidate for genetic engineering of cassava roots.
Detecting cooperative sequences in the binding of RNA Polymerase-II
NASA Astrophysics Data System (ADS)
Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles
2008-03-01
Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.
Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong
2017-03-01
To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.
Ni, Xiangyang; Westpheling, Janet
1997-01-01
The chi63 promoter directs glucose-sensitive, chitin-dependent transcription of a gene involved in the utilization of chitin as carbon source. Analysis of 5′ and 3′ deletions of the promoter region revealed that a 350-bp segment is sufficient for wild-type levels of expression and regulation. The analysis of single base changes throughout the promoter region, introduced by random and site-directed mutagenesis, identified several sequences to be important for activity and regulation. Single base changes at −10, −12, −32, −33, −35, and −37 upstream of the transcription start site resulted in loss of activity from the promoter, suggesting that bases in these positions are important for RNA polymerase interaction. The sequences centered around −10 (TATTCT) and −35 (TTGACC) in this promoter are, in fact, prototypical of eubacterial promoters. Overlapping the RNA polymerase binding site is a perfect 12-bp direct repeat sequence. Some base changes within this direct repeat resulted in constitutive expression, suggesting that this sequence is an operator for negative regulation. Other base changes resulted in loss of glucose repression while retaining the requirement for chitin induction, suggesting that this sequence is also involved in glucose repression. The fact that cis-acting mutations resulted in glucose resistance but not inducer independence rules out the possibility that glucose repression acts exclusively by inducer exclusion. The fact that mutations that affect glucose repression and chitin induction fall within the same direct repeat sequence module suggests that the direct repeat sequence facilitates both chitin induction and glucose repression. PMID:9371809
Yamaguchi, Kiyoshi; Nagayama, Satoshi; Shimizu, Eigo; Komura, Mitsuhiro; Yamaguchi, Rui; Shibuya, Tetsuo; Arai, Masami; Hatakeyama, Seira; Ikenoue, Tsuneo; Ueno, Masashi; Miyano, Satoru; Imoto, Seiya; Furukawa, Yoichi
2016-05-24
Germline mutations in the tumor suppressor gene APC are associated with familial adenomatous polyposis (FAP). Here we applied whole-genome sequencing (WGS) to the DNA of a sporadic FAP patient in which we did not find any pathological APC mutations by direct sequencing. WGS identified a promoter deletion of approximately 10 kb encompassing promoter 1B and exon1B of APC. Additional allele-specific expression analysis by deep cDNA sequencing revealed that the deletion reduced the expression of the mutated APC allele to as low as 11.2% in the total APC transcripts, suggesting that the residual mutant transcripts were driven by other promoter(s). Furthermore, cap analysis of gene expression (CAGE) demonstrated that the deleted promoter 1B region is responsible for the great majority of APC transcription in many tissues except the brain. The deletion decreased the transcripts of APC-1B to 39-45% in the patient compared to the healthy controls, but it did not decrease those of APC-1A. Different deletions including promoter 1B have been reported in FAP patients. Taken together, our results strengthen the evidence that analysis of structural variations in promoter 1B should be considered for the FAP patients whose pathological mutations are not identified by conventional direct sequencing.
Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T
1993-12-22
The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.
2014-01-01
Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182
Analysis of an osmotically regulated pathogenesis-related osmotin gene promoter.
Raghothama, K G; Liu, D; Nelson, D E; Hasegawa, P M; Bressan, R A
1993-12-01
Osmotin is a small (24 kDa), basic, pathogenesis-related protein, that accumulates during adaptation of tobacco (Nicotiana tabacum) cells to osmotic stress. There are more than 10 inducers that activate the osmotin gene in various plant tissues. The osmotin promoter contains several sequences bearing a high degree of similarity to ABRE, as-1 and E-8 cis element sequences. Gel retardation studies indicated the presence of at least two regions in the osmotin promoter that show specific interactions with nuclear factors isolated from cultured cells or leaves. The abundance of these binding factors increased in response to salt, ABA and ethylene. Nuclear factors protected a 35 bp sequence of the promoter from DNase I digestion. Different 5' deletions of the osmotin promoter cloned into a promoter-less GUSNOS plasmid (pBI 201) were used in transient expression studies with a Biolistic gun. The transient expression studies revealed the presence of three distinct regions in the osmotin promoter. The promoter sequence from -108 to -248 bp is absolutely required for reporter gene activity, followed by a long stretch (up to -1052) of enhancer-like sequence and then a sequence upstream of -1052, which appears to contain negative elements. The responses to ABA, ethylene, salt, desiccation and wounding appear to be associated with the -248 bp sequence of the promoter. This region also contains a putative ABRE (CACTGTG) core element. Activation of the osmotin gene by various inducers is discussed in view of antifungal activity of the osmotin protein.
First Pass Annotation of Promoters on Human Chromosome 22
Scherf, Matthias; Klingenhoff, Andreas; Frech, Kornelie; Quandt, Kerstin; Schneider, Ralf; Grote, Korbinian; Frisch, Matthias; Gailus-Durner, Valérie; Seidel, Alexander; Brack-Werner, Ruth; Werner, Thomas
2001-01-01
The publication of the first almost complete sequence of a human chromosome (chromosome 22) is a major milestone in human genomics. Together with the sequence, an excellent annotation of genes was published which certainly will serve as an information resource for numerous future projects. We noted that the annotation did not cover regulatory regions; in particular, no promoter annotation has been provided. Here we present an analysis of the complete published chromosome 22 sequence for promoters. A recent breakthrough in specific in silico prediction of promoter regions enabled us to attempt large-scale prediction of promoter regions on chromosome 22. Scanning of sequence databases revealed only 20 experimentally verified promoters, of which 10 were correctly predicted by our approach. Nearly 40% of our 465 predicted promoter regions are supported by the currently available gene annotation. Promoter finding also provides a biologically meaningful method for “chromosomal scaffolding”, by which long genomic sequences can be divided into segments starting with a gene. As one example, the combination of promoter region prediction with exon/intron structure predictions greatly enhances the specificity of de novo gene finding. The present study demonstrates that it is possible to identify promoters in silico on the chromosomal level with sufficient reliability for experimental planning and indicates that a wealth of information about regulatory regions can be extracted from current large-scale (megabase) sequencing projects. Results are available on-line at http://genomatix.gsf.de/chr22/. PMID:11230158
O'Sullivan, D J; O'Gara, F
1991-08-01
An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.
Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard
2012-01-01
A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985
Murthy, S C; Bhat, G P; Thimmappaya, B
1985-01-01
A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577
Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.
Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning
2016-08-01
miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.
Effective Feature Selection for Classification of Promoter Sequences.
K, Kouser; P G, Lavanya; Rangarajan, Lalitha; K, Acharya Kshitish
2016-01-01
Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM) features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine), KNN (K Nearest Neighbor) and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method) but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.
He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y
2013-09-04
To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
Inferring gene expression from ribosomal promoter sequences, a crowdsourcing approach
Meyer, Pablo; Siwo, Geoffrey; Zeevi, Danny; Sharon, Eilon; Norel, Raquel; Segal, Eran; Stolovitzky, Gustavo; Siwo, Geoffrey; Rider, Andrew K.; Tan, Asako; Pinapati, Richard S.; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael T.; Tung, Yi-An; Chen, Yong-Syuan; Chen, Mei-Ju May; Chen, Chien-Yu; Knight, Jason M.; Sahraeian, Sayed Mohammad Ebrahim; Esfahani, Mohammad Shahrokh; Dreos, Rene; Bucher, Philipp; Maier, Ezekiel; Saeys, Yvan; Szczurek, Ewa; Myšičková, Alena; Vingron, Martin; Klein, Holger; Kiełbasa, Szymon M.; Knisley, Jeff; Bonnell, Jeff; Knisley, Debra; Kursa, Miron B.; Rudnicki, Witold R.; Bhattacharjee, Madhuchhanda; Sillanpää, Mikko J.; Yeung, James; Meysman, Pieter; Rodríguez, Aminael Sánchez; Engelen, Kristof; Marchal, Kathleen; Huang, Yezhou; Mordelet, Fantine; Hartemink, Alexander; Pinello, Luca; Yuan, Guo-Cheng
2013-01-01
The Gene Promoter Expression Prediction challenge consisted of predicting gene expression from promoter sequences in a previously unknown experimentally generated data set. The challenge was presented to the community in the framework of the sixth Dialogue for Reverse Engineering Assessments and Methods (DREAM6), a community effort to evaluate the status of systems biology modeling methodologies. Nucleotide-specific promoter activity was obtained by measuring fluorescence from promoter sequences fused upstream of a gene for yellow fluorescence protein and inserted in the same genomic site of yeast Saccharomyces cerevisiae. Twenty-one teams submitted results predicting the expression levels of 53 different promoters from yeast ribosomal protein genes. Analysis of participant predictions shows that accurate values for low-expressed and mutated promoters were difficult to obtain, although in the latter case, only when the mutation induced a large change in promoter activity compared to the wild-type sequence. As in previous DREAM challenges, we found that aggregation of participant predictions provided robust results, but did not fare better than the three best algorithms. Finally, this study not only provides a benchmark for the assessment of methods predicting activity of a specific set of promoters from their sequence, but it also shows that the top performing algorithm, which used machine-learning approaches, can be improved by the addition of biological features such as transcription factor binding sites. PMID:23950146
Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P
1984-01-01
We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950
Nadjar-Boger, Elisabeth; Maccatrozzo, Lisa; Radaelli, Giuseppe; Funkenstein, Bruria
2013-02-01
Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily, known as a negative regulator of skeletal muscle development and growth in mammals. In contrast to mammals, fish possess at least two paralogs of MSTN: MSTN-1 and MSTN-2. Here we describe the cloning and sequence analysis of spliced and precursor (unspliced) transcripts as well as the 5' flanking region of MSTN-2 from the marine fish Umbrina cirrosa (ucMSTN-2). In silico analysis revealed numerous putative cis regulatory elements including several E-boxes known as binding sites to myogenic transcription factors. Transient transfection experiments using non-muscle and muscle cell lines showed high transcriptional activity in muscle cells and in differentiated neural cells, in accordance with our previous findings in MSTN-2 promoter from Sparus aurata. Comparative informatics analysis of MSTN-2 from several fish species revealed high conservation of the predicted amino acid sequence as well as the gene structure (exon length) although intron length varied between species. The proximal promoter of MSTN-2 gene was found to be conserved among Perciforms. In conclusion, this study reinforces our conclusion that MSTN-2 promoter is a very strong promoter, especially in muscle cells. In addition, we show that the MSTN-2 gene structure is highly conserved among fishes as is the predicted amino acid sequence of the peptide. Copyright © 2012 Elsevier Inc. All rights reserved.
Defrance, Matthieu; Janky, Rekin's; Sand, Olivier; van Helden, Jacques
2008-01-01
This protocol explains how to discover functional signals in genomic sequences by detecting over- or under-represented oligonucleotides (words) or spaced pairs thereof (dyads) with the Regulatory Sequence Analysis Tools (http://rsat.ulb.ac.be/rsat/). Two typical applications are presented: (i) predicting transcription factor-binding motifs in promoters of coregulated genes and (ii) discovering phylogenetic footprints in promoters of orthologous genes. The steps of this protocol include purging genomic sequences to discard redundant fragments, discovering over-represented patterns and assembling them to obtain degenerate motifs, scanning sequences and drawing feature maps. The main strength of the method is its statistical ground: the binomial significance provides an efficient control on the rate of false positives. In contrast with optimization-based pattern discovery algorithms, the method supports the detection of under- as well as over-represented motifs. Computation times vary from seconds (gene clusters) to minutes (whole genomes). The execution of the whole protocol should take approximately 1 h.
CapZyme-Seq Comprehensively Defines Promoter-Sequence Determinants for RNA 5' Capping with NAD.
Vvedenskaya, Irina O; Bird, Jeremy G; Zhang, Yuanchao; Zhang, Yu; Jiao, Xinfu; Barvík, Ivan; Krásný, Libor; Kiledjian, Megerditch; Taylor, Deanne M; Ebright, Richard H; Nickels, Bryce E
2018-05-03
Nucleoside-containing metabolites such as NAD + can be incorporated as 5' caps on RNA by serving as non-canonical initiating nucleotides (NCINs) for transcription initiation by RNA polymerase (RNAP). Here, we report CapZyme-seq, a high-throughput-sequencing method that employs NCIN-decapping enzymes NudC and Rai1 to detect and quantify NCIN-capped RNA. By combining CapZyme-seq with multiplexed transcriptomics, we determine efficiencies of NAD + capping by Escherichia coli RNAP for ∼16,000 promoter sequences. The results define preferred transcription start site (TSS) positions for NAD + capping and define a consensus promoter sequence for NAD + capping: HRRASWW (TSS underlined). By applying CapZyme-seq to E. coli total cellular RNA, we establish that sequence determinants for NCIN capping in vivo match the NAD + -capping consensus defined in vitro, and we identify and quantify NCIN-capped small RNAs (sRNAs). Our findings define the promoter-sequence determinants for NCIN capping with NAD + and provide a general method for analysis of NCIN capping in vitro and in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.
Nadjar-Boger, Elisabeth; Funkenstein, Bruria
2011-02-01
Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.
Sebestyén, Endre; Nagy, Tibor; Suhai, Sándor; Barta, Endre
2009-01-01
Background The comparative genomic analysis of a large number of orthologous promoter regions of the chordate and plant genes from the DoOP databases shows thousands of conserved motifs. Most of these motifs differ from any known transcription factor binding site (TFBS). To identify common conserved motifs, we need a specific tool to be able to search amongst them. Since conserved motifs from the DoOP databases are linked to genes, the result of such a search can give a list of genes that are potentially regulated by the same transcription factor(s). Results We have developed a new tool called DoOPSearch for the analysis of the conserved motifs in the promoter regions of chordate or plant genes. We used the orthologous promoters of the DoOP database to extract thousands of conserved motifs from different taxonomic groups. The advantage of this approach is that different sets of conserved motifs might be found depending on how broad the taxonomic coverage of the underlying orthologous promoter sequence collection is (consider e.g. primates vs. mammals or Brassicaceae vs. Viridiplantae). The DoOPSearch tool allows the users to search these motif collections or the promoter regions of DoOP with user supplied query sequences or any of the conserved motifs from the DoOP database. To find overrepresented gene ontologies, the gene lists obtained can be analysed further using a modified version of the GeneMerge program. Conclusion We present here a comparative genomics based promoter analysis tool. Our system is based on a unique collection of conserved promoter motifs characteristic of different taxonomic groups. We offer both a command line and a web-based tool for searching in these motif collections using user specified queries. These can be either short promoter sequences or consensus sequences of known transcription factor binding sites. The GeneMerge analysis of the search results allows the user to identify statistically overrepresented Gene Ontology terms that might provide a clue on the function of the motifs and genes. PMID:19534755
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Rombel, I T; McMorran, B J; Lamont, I L
1995-02-20
Many bacteria respond to a lack of iron in the environment by synthesizing siderophores, which act as iron-scavenging compounds. Fluorescent pseudomonads synthesize strain-specific but chemically related siderophores called pyoverdines or pseudobactins. We have investigated the mechanisms by which iron controls expression of genes involved in pyoverdine metabolism in Pseudomonas aeruginosa. Transcription of these genes is repressed by the presence of iron in the growth medium. Three promoters from these genes were cloned and the activities of the promoters were dependent on the amounts of iron in the growth media. Two of the promoters were sequenced and the transcriptional start site were identified by S1 nuclease analysis. Sequences similar to the consensus binding site for the Fur repressor protein, which controls expression of iron-repressible genes in several gram-negative species, were not present in the promoters, suggesting that they are unlikely to have a high affinity for Fur. However, comparison of the promoter sequences with those of iron-regulated genes from other Pseudomonas species and also the iron-regulated exotoxin gene of P. aeruginosa allowed identification of a shared sequence element, with the consensus sequence (G/C)CTAAAT-CCC, which is likely to act as a binding site for a transcriptional activator protein. Mutations in this sequence greatly reduced the activities of the promoters characterized here as well as those of other iron-regulated promoters. The requirement for this motif in the promoters of iron-regulated genes of different Pseudomonas species indicates that similar mechanisms are likely to be involved in controlling expression of a range of iron-regulated genes in pseudomonads.
ERIC Educational Resources Information Center
Wu, Yann-Shya
The purpose of this paper is to provide guidance for instructional sequencing in emotional literacy curricula. First, the concepts of instructional sequence and the problems involved with instructional sequence in the affective domain of learning are addressed. Then, through the analysis of the emotional literacy curriculum, Promoting Alternative…
Li, Yunhai; Lee, Kee Khoon; Walsh, Sean; Smith, Caroline; Hadingham, Sophie; Sorefan, Karim; Cawley, Gavin; Bevan, Michael W
2006-03-01
Establishing transcriptional regulatory networks by analysis of gene expression data and promoter sequences shows great promise. We developed a novel promoter classification method using a Relevance Vector Machine (RVM) and Bayesian statistical principles to identify discriminatory features in the promoter sequences of genes that can correctly classify transcriptional responses. The method was applied to microarray data obtained from Arabidopsis seedlings treated with glucose or abscisic acid (ABA). Of those genes showing >2.5-fold changes in expression level, approximately 70% were correctly predicted as being up- or down-regulated (under 10-fold cross-validation), based on the presence or absence of a small set of discriminative promoter motifs. Many of these motifs have known regulatory functions in sugar- and ABA-mediated gene expression. One promoter motif that was not known to be involved in glucose-responsive gene expression was identified as the strongest classifier of glucose-up-regulated gene expression. We show it confers glucose-responsive gene expression in conjunction with another promoter motif, thus validating the classification method. We were able to establish a detailed model of glucose and ABA transcriptional regulatory networks and their interactions, which will help us to understand the mechanisms linking metabolism with growth in Arabidopsis. This study shows that machine learning strategies coupled to Bayesian statistical methods hold significant promise for identifying functionally significant promoter sequences.
Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.
Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R
1987-01-01
The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Daniels, C.J.
1993-06-01
We have established that a 100 bp DNA fragment from the Haloferax volcanii tRNALys gene directs transcription in vivo. This element served as the starting point for a detailed analysis of the requirements for in vivo transcription. Among several gene tentatively identified as reporter elements, we selected a eukaryotic intron-containing tRNAPro gene for when it is driven by the H. volcanii tRNALys promoter fragment, produces a single small transcript. Transcript analysis, by Sl mapping and primer extension, showed that this RNA initiated at the expected tRNALys BoxB sequence and terminated in the tRNAPro RNA Pol III termination element present onmore » the DNA fragment. In initial studies we determined that the 3 inches proximal region of this tRNALys promoter element was sufficient for transcription initiation in vivo. This 40 bp region contains only the BoxA and BoxB regions and short purine rich regions 5 inches to the BoxA and BoxB sequence. Using the tRNAPro gene as the reporter and this minimal promoter, we performed a comprehensive analysis of the BoxA region. Each position of the BoxA region was converted to an four possible nucleotides and the transcription of 36 mutants was quantitated. Among the sites analyzed, only five of the positions showed high levels of discrimination; the preferred BoxA element was 5 inches-TT({sub T}/A)({sup A}/T) ANNNN-3 inches. Mutational analysis demonstrated that a transition from T-rich to A-rich sequences in the BoxA element is essential and that there is some flexibility in the location of the ``TA`` sequence. Additionally the TA sequence appears to determine the location of the transcription start site. The BoxA element defined in this study is similar to those observed for Sulfolobus and the methanogen promoters, and supports the hypothesis that a similar core promoter element is used by all archaeal RNA polymerases.« less
USDA-ARS?s Scientific Manuscript database
Advances in long-read, single molecule real-time sequencing technology and analysis software over the last two years has enabled the efficient production of closed bacterial genome sequences. However, consistent annotation of these genomes has lagged behind the ability to create them, while the avai...
Transcription Factor Map Alignment of Promoter Regions
Blanco, Enrique; Messeguer, Xavier; Smith, Temple F; Guigó, Roderic
2006-01-01
We address the problem of comparing and characterizing the promoter regions of genes with similar expression patterns. This remains a challenging problem in sequence analysis, because often the promoter regions of co-expressed genes do not show discernible sequence conservation. In our approach, thus, we have not directly compared the nucleotide sequence of promoters. Instead, we have obtained predictions of transcription factor binding sites, annotated the predicted sites with the labels of the corresponding binding factors, and aligned the resulting sequences of labels—to which we refer here as transcription factor maps (TF-maps). To obtain the global pairwise alignment of two TF-maps, we have adapted an algorithm initially developed to align restriction enzyme maps. We have optimized the parameters of the algorithm in a small, but well-curated, collection of human–mouse orthologous gene pairs. Results in this dataset, as well as in an independent much larger dataset from the CISRED database, indicate that TF-map alignments are able to uncover conserved regulatory elements, which cannot be detected by the typical sequence alignments. PMID:16733547
Human Promoters Are Intrinsically Directional
Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe
2015-01-01
Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469
SivaRaman, L; Subramanian, S; Thimmappaya, B
1986-01-01
Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943
Zhou, Xiao-hong; Chen, Xiao-guang; Zhang, Xiao-dong; Wang, Ya-nan; Li, Lin; Xi, Jia-fei; Hu, Jian-jun
2003-01-01
To obtain the gene encoding tomato fruit-specific E8 promoter therefore to prepare for exogenous gene transcription and expression in transgenic tomato fruit. The cotyledons of tomato Lycopersicon esculentum (Zhongshu No.5) were collected for extracting the genomic DNA of this plant. The fruit-specific E81.1 and E82.2 promoter DNA were then amplified by PCR, the product of which was subcloned into pGEM-T vector. After identification by restriction enzymes, the recombinant T-vectors were subjected to sequence analysis. The fragments of the promoter as amplified by PCR were of predicted length. Digestion with Xba I and Hind III /BamH I proved correct insertion of the target fragments with expected length into the recombinant T vectors. As indicated by homology analysis, the resultant tomato fruit-specific E8 promoter was highly conservative, and E82.2 promoter of Zhongshu No.5, with GenBank submission number of AF515784, proved to share 99% homology with E82.2 promoter of Zhongshu No.5 Cherry as reported by Deikman J. Tomato fruit-specific E8 promoter of Zhongshu No.5 has been successfully cloned, thus making possible the subsequent research in oral vaccine of transgenic tomato.
Chang, D D; Clayton, D A
1986-01-01
Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226
Yang, Zhirong; Patra, Barunava; Li, Runzhi; Pattanaik, Sitakanta; Yuan, Ling
2013-12-01
WRKY transcription factors (TFs) are emerging as an important group of regulators of plant secondary metabolism. However, the cis-regulatory elements associated with their regulation have not been well characterized. We have previously demonstrated that CrWRKY1, a member of subgroup III of the WRKY TF family, regulates biosynthesis of terpenoid indole alkaloids in the ornamental and medicinal plant, Catharanthus roseus. Here, we report the isolation and functional characterization of the CrWRKY1 promoter. In silico analysis of the promoter sequence reveals the presence of several potential TF binding motifs, indicating the involvement of additional TFs in the regulation of the TIA pathway. The CrWRKY1 promoter can drive the expression of a β-glucuronidase (GUS) reporter gene in native (C. roseus protoplasts and transgenic hairy roots) and heterologous (transgenic tobacco seedlings) systems. Analysis of 5'- or 3'-end deletions indicates that the sequence located between positions -140 to -93 bp and -3 to +113 bp, relative to the transcription start site, is critical for promoter activity. Mutation analysis shows that two overlapping as-1 elements and a CT-rich motif contribute significantly to promoter activity. The CrWRKY1 promoter is induced in response to methyl jasmonate (MJ) treatment and the promoter region between -230 and -93 bp contains a putative MJ-responsive element. The CrWRKY1 promoter can potentially be used as a tool to isolate novel TFs involved in the regulation of the TIA pathway.
Palzkill, T G; Oliver, S G; Newlon, C S
1986-01-01
Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036
Sequencing and functional analysis of the nifENXorf1orf2 gene cluster of Herbaspirillum seropedicae.
Klassen, G; Pedrosa, F O; Souza, E M; Yates, M G; Rigo, L U
1999-12-01
A 5.1-kb DNA fragment from the nifHDK region of H. seropedicae was isolated and sequenced. Sequence analysis showed the presence of nifENXorf1orf2 but nifTY were not present. No nif or consensus promoter was identified. Furthermore, orf1 expression occurred only under nitrogen-fixing conditions and no promoter activity was detected between nifK and nifE, suggesting that these genes are expressed from the upstream nifH promoter and are parts of a unique nif operon. Mutagenesis studies indicate that nifN was essential for nitrogenase activity whereas nifXorf1orf2 were not. High homology between the C-terminal region of the NifX and NifB proteins from H. seropedicae was observed. Since the NifX and NifY proteins are important for FeMo cofactor (FeMoco) synthesis, we propose that alternative proteins with similar activities exist in H. seropedicae.
The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.
Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R
2003-02-01
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.
Functional analysis of Drosophila HSP70 promoter with different HSE numbers in human cells.
Kust, Nadezda; Rybalkina, Ekaterina; Mertsalov, Ilya; Savchenko, Ekaterina; Revishchin, Alexander; Pavlova, Gali
2014-01-01
The activation of genetic constructs including the Drosophila hsp70 promoter with four and eight HSE sequences in the regulatory region has been described in human cells. The promoter was shown to be induced at lower temperatures compared to the human hsp70 promoter. The promoter activity increased after a 60-min heat shock already at 38 °C in human cells. The promoter activation was observed 24 h after heat shock for the constructs with eight HSEs, while those with four HSEs required 48 h. After transplantation of in vitro heat-shocked transfected cells, the promoter activity could be maintained for 3 days with a gradual decline. The promoter activation was confirmed in vivo without preliminary heat shock in mouse ischemic brain foci. Controlled expression of the Gdnf gene under a Drosophila hsp70 promoter was demonstrated. This promoter with four and eight HSE sequences in the regulatory region can be proposed as a regulated promoter in genetic therapeutic systems.
2012-01-01
Background The cuticle is an important adaptive structure whose origin played a crucial role in the transition of plants from aqueous to terrestrial conditions. HvABCG31/Eibi1 is an ABCG transporter gene, involved in cuticle formation that was recently identified in wild barley (Hordeum vulgare ssp. spontaneum). To study the genetic variation of HvABCG31 in different habitats, its 2 kb promoter region was sequenced from 112 wild barley accessions collected from five natural populations from southern and northern Israel. The sites included three mesic and two xeric habitats, and differed in annual rainfall, soil type, and soil water capacity. Results Phylogenetic analysis of the aligned HvABCG31 promoter sequences clustered the majority of accessions (69 out of 71) from the three northern mesic populations into one cluster, while all 21 accessions from the Dead Sea area, a xeric southern population, and two isolated accessions (one from a xeric population at Mitzpe Ramon and one from the xeric ‘African Slope’ of “Evolution Canyon”) formed the second cluster. The southern arid populations included six haplotypes, but they differed from the consensus sequence at a large number of positions, while the northern mesic populations included 15 haplotypes that were, on average, more similar to the consensus sequence. Most of the haplotypes (20 of 22) were unique to a population. Interestingly, higher genetic variation occurred within populations (54.2%) than among populations (45.8%). Analysis of the promoter region detected a large number of transcription factor binding sites: 121–128 and 121–134 sites in the two southern arid populations, and 123–128,125–128, and 123–125 sites in the three northern mesic populations. Three types of TFBSs were significantly enriched: those related to GA (gibberellin), Dof (DNA binding with one finger), and light. Conclusions Drought stress and adaptive natural selection may have been important determinants in the observed sequence variation of HvABCG31 promoter. Abiotic stresses may be involved in the HvABCG31 gene transcription regulations, generating more protective cuticles in plants under stresses. PMID:23006777
Gaji, Rajshekhar Y; Howe, Daniel K
2009-07-01
The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.
Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard
2016-01-01
Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a potential effect on fiber cell development, mediated by TGA-element containing sequences, via the auxin-signaling pathway. PMID:27597995
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a potential effect on fiber cell development, mediated by TGA-element containing sequences, via the auxin-signaling pathway.
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji
2015-12-01
Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.
Erpen, L; Tavano, E C R; Harakava, R; Dutt, M; Grosser, J W; Piedade, S M S; Mendes, B M J; Mourão Filho, F A A
2018-05-23
Regulatory sequences from the citrus constitutive genes cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1) were isolated, fused to the uidA gene, and qualitatively and quantitatively evaluated in transgenic sweet orange plants. The 5' upstream region of a gene (the promoter) is the most important component for the initiation and regulation of gene transcription of both native genes and transgenes in plants. The isolation and characterization of gene regulatory sequences are essential to the development of intragenic or cisgenic genetic manipulation strategies, which imply the use of genetic material from the same species or from closely related species. We describe herein the isolation and evaluation of the promoter sequence from three constitutively expressed citrus genes: cyclophilin (CsCYP), glyceraldehyde-3-phosphate dehydrogenase C2 (CsGAPC2), and elongation factor 1-alpha (CsEF1). The functionality of the promoters was confirmed by a histochemical GUS assay in leaves, stems, and roots of stably transformed citrus plants expressing the promoter-uidA construct. Lower uidA mRNA levels were detected when the transgene was under the control of citrus promoters as compared to the expression under the control of the CaMV35S promoter. The association of the uidA gene with the citrus-derived promoters resulted in mRNA levels of up to 60-41.8% of the value obtained with the construct containing CaMV35S driving the uidA gene. Moreover, a lower inter-individual variability in transgene expression was observed amongst the different transgenic lines, where gene constructs containing citrus-derived promoters were used. In silico analysis of the citrus-derived promoter sequences revealed that their activity may be controlled by several putative cis-regulatory elements. These citrus promoters will expand the availability of regulatory sequences for driving gene expression in citrus gene-modification programs.
Cloning and functional analysis of the promoter region of the human Disc large gene.
Cavatorta, Ana Laura; Giri, Adriana A; Banks, Lawrence; Gardiol, Daniela
2008-11-15
A number of studies have demonstrated the involvement of human Disc large (DLG1) in the control of both cell polarity and maintenance of tissue architecture. However, the mechanisms controlling DLG1 transcription are not fully understood. This is relevant since DLG1 is lost in many tumours during the later stages of malignant progression. Therefore, we performed the cloning and functional analysis of a genomic 5' flanking region of the DLG1 open reading frame with promoter activity. We analyzed the activity of a series of 5' deletion constructs of the DLG1 promoter and determined the minimal essential sequences that are required for promoter activity as well as cis-elements that regulate transcription. We found, within the DLG1 promoter sequences, consensus-binding sites for the Snail family of transcription factors that repress the expression of epithelial markers and are up-regulated in a variety of tumours. Snail transcription factors repress the transcriptional activity of the DLG1 promoter and, ectopically expressed Snail proteins bind to the native DLG1 promoter. These data suggest a role for Snail transcription factors in the control of DLG1 expression and provide a basis for understanding the transcriptional regulation of DLG1.
SD-MSAEs: Promoter recognition in human genome based on deep feature extraction.
Xu, Wenxuan; Zhang, Li; Lu, Yaping
2016-06-01
The prediction and recognition of promoter in human genome play an important role in DNA sequence analysis. Entropy, in Shannon sense, of information theory is a multiple utility in bioinformatic details analysis. The relative entropy estimator methods based on statistical divergence (SD) are used to extract meaningful features to distinguish different regions of DNA sequences. In this paper, we choose context feature and use a set of methods of SD to select the most effective n-mers distinguishing promoter regions from other DNA regions in human genome. Extracted from the total possible combinations of n-mers, we can get four sparse distributions based on promoter and non-promoters training samples. The informative n-mers are selected by optimizing the differentiating extents of these distributions. Specially, we combine the advantage of statistical divergence and multiple sparse auto-encoders (MSAEs) in deep learning to extract deep feature for promoter recognition. And then we apply multiple SVMs and a decision model to construct a human promoter recognition method called SD-MSAEs. Framework is flexible that it can integrate new feature extraction or new classification models freely. Experimental results show that our method has high sensitivity and specificity. Copyright © 2016 Elsevier Inc. All rights reserved.
Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J.; Tooney, Paul A.; Scott, Rodney J.; Carr, Vaughan J.; Cairns, Murray J.
2012-01-01
Background While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. Methodology/Principal Findings The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05). Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1) gene. Conclusions This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia. PMID:22558445
Li, Yongsheng; Camarillo, Cynthia; Xu, Juan; Arana, Tania Bedard; Xiao, Yun; Zhao, Zheng; Chen, Hong; Ramirez, Mercedes; Zavala, Juan; Escamilla, Michael A.; Armas, Regina; Mendoza, Ricardo; Ontiveros, Alfonso; Nicolini, Humberto; Jerez Magaña, Alvaro Antonio; Rubin, Lewis P.; Li, Xia; Xu, Chun
2015-01-01
Schizophrenia (SZ) and bipolar disorder (BP) are complex genetic disorders. Their appearance is also likely informed by as yet only partially described epigenetic contributions. Using a sequencing-based method for genome-wide analysis, we quantitatively compared the blood DNA methylation landscapes in SZ and BP subjects to control, both in an understudied population, Hispanics along the US-Mexico border. Remarkably, we identified thousands of differentially methylated regions for SZ and BP preferentially located in promoters 3′-UTRs and 5′-UTRs of genes. Distinct patterns of aberrant methylation of promoter sequences were located surrounding transcription start sites. In these instances, aberrant methylation occurred in CpG islands (CGIs) as well as in flanking regions as well as in CGI sparse promoters. Pathway analysis of genes displaying these distinct aberrant promoter methylation patterns showed enhancement of epigenetic changes in numerous genes previously related to psychiatric disorders and neurodevelopment. Integration of gene expression data further suggests that in SZ aberrant promoter methylation is significantly associated with altered gene transcription. In particular, we found significant associations between (1) promoter CGIs hypermethylation with gene repression and (2) CGI 3′-shore hypomethylation with increased gene expression. Finally, we constructed a specific methylation analysis platform that facilitates viewing and comparing aberrant genome methylation in human neuropsychiatric disorders. PMID:25734057
Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung
2016-05-10
Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. Copyright © 2016 Elsevier B.V. All rights reserved.
Tavares, D; Tully, K; Dobner, P R
1999-10-15
The promoter region of the mouse high affinity neurotensin receptor (Ntr-1) gene was characterized, and sequences required for expression in neuroblastoma cell lines that express high affinity NT-binding sites were characterized. Me(2)SO-induced neuronal differentiation of N1E-115 neuroblastoma cells increased both the expression of the endogenous Ntr-1 gene and reporter genes driven by NTR-1 promoter sequences by 3-4-fold. Deletion analysis revealed that an 83-base pair promoter region containing the transcriptional start site is required for Me(2)SO activation. Detailed mutational analysis of this region revealed that a CACCC box and the central region of a large GC-rich palindrome are the crucial cis-regulatory elements required for Me(2)SO induction. The CACCC box is bound by at least one factor that is induced upon Me(2)SO treatment of N1E-115 cells. The Me(2)SO effect was found to be both selective and cell type-restricted. Basal expression in the neuroblastoma cell lines required a distinct set of sequences, including an Sp1-like sequence, and a sequence resembling an NGFI-A-binding site; however, a more distal 5' sequence was found to repress basal activity in N1E-115 cells. These results provide evidence that Ntr-1 gene regulation involves both positive and negative regulatory elements located in the 5'-flanking region and that Ntr-1 gene activation involves the coordinate activation or induction of several factors, including a CACCC box binding complex.
Fuentes-Pananá, Ezequiel M.; Swaminathan, Sankar; Ling, Paul D.
1999-01-01
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (−1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates. PMID:9847397
Fuentes-Pananá, E M; Swaminathan, S; Ling, P D
1999-01-01
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.
Spatial and temporal activity of the foxtail millet (Setaria italica) seed-specific promoter pF128.
Pan, Yanlin; Ma, Xin; Liang, Hanwen; Zhao, Qian; Zhu, Dengyun; Yu, Jingjuan
2015-01-01
pF128 drives GUS specifically expressed in transgenic seeds of foxtail millet and Zea mays with higher activity than the constitutive CaMV35S promoter and the maize seed-specific 19Z promoter. Foxtail millet (Setaria italica), a member of the Poaceae family, is an important food and fodder crop in arid regions. Foxtail millet is an excellent C4 crop model owing to its small genome (~490 Mb), self-pollination and availability of a complete genome sequence. F128 was isolated from a cDNA library of foxtail millet immature seeds. Real-time PCR analysis revealed that F128 mRNA was specifically expressed in immature and mature seeds. The highest F128 mRNA level was observed 5 days after pollination and gradually decreased as the seed matured. Sequence analysis suggested that the protein encoded by F128 is likely a protease inhibitor/seed storage protein/lipid-transfer protein. The 1,053 bp 5' flanking sequence of F128 (pF128) was isolated and fused to the GUS reporter gene. The corresponding vector was then transformed into Arabidopsis thaliana, foxtail millet and Zea mays. GUS analysis revealed that pF128 drove GUS expression efficiently and specifically in the seeds of transgenic Arabidopsis, foxtail millet and Zea mays. GUS activity was also detected in Arabidopsis cotyledons. Activity of pF128 was higher than that observed for the constitutive CaMV35S promoter and the maize seed-specific 19 Zein (19Z) promoter. These results indicate that pF128 is a seed-specific promoter. Its application is expected to be of considerable value in plant genetic engineering.
NASA Astrophysics Data System (ADS)
Harada, M.; Furukawa, R.; Yokobori, S. I.; Tajika, E.; Yamagishi, A.
2016-12-01
A significant rise in atmospheric O2 levels during the GOE (Great Oxidation Event), ca. 2.45-2.0 Ga, must have caused a great stress to biosphere, enforcing life to adapt to oxic conditions. Cyanobacteria, oxygenic photosynthetic bacteria that had been responsible for the GOE, are at the same time one of the organisms that would have been greatly affected by the rise of O2 level in the surface environments. Knowledge on the evolution of cyanobacteria is not only important to elucidate the cause of the GOE, but also helps us to better understand the adaptive evolution of life in response to the GOE. Here we performed phylogenetic analysis of an anti-oxidant enzyme Fe-SOD (iron superoxide dismutase) of cyanobacteria, to assess the adaptive evolution of life under the GOE. The rise of O2 level must have increased the level of toxic reactive oxygen species in cyanobacterial cells, thus forced them to change activities or the gene expression levels of Fe-SOD. In the present study, we focus on the change in the gene expression levels of the enzyme, which can be estimated from the promoter sequences of the gene. Promoters are DNA sequences found upstream of protein encoding regions, where RNA polymerase binds and initiates transcription. "Strong" promoters that efficiently interact with RNA polymerase induce high rates of transcription, leading to high levels of gene expression. Thus, from the temporal changes in the promoter sequences, we can estimate the variations in the gene expression levels during the geological time. Promoter sequences of Fe-SOD at each ancestral node of cyanobacteria were predicted from phylogenetic analysis, and the ancestral promoter sequences were compared to the promoters of known highly expressed genes. The similarity was low at the time of the emergence of cyanobacteria; however, increased at the branching nodes diverged 2.4 billon years ago. This roughly coincided with the onset of the GOE, implying that the transition from low to high gene expression levels of Fe-SOD occurred in response to the GOE. We propose that this is the first direct evidence of the evolution of cyanobacteria related to the rise of O2, and that the methodologies of ancestral promoter analysis used in this study can be a novel tools to reveal the biological adaptation to such a significant geologic event.
Corynebacterium glutamicum promoters: a practical approach
Pátek, Miroslav; Holátko, Jiří; Busche, Tobias; Kalinowski, Jörn; Nešvera, Jan
2013-01-01
Summary Transcription initiation is the key step in gene expression in bacteria, and it is therefore studied for both theoretical and practical reasons. Promoters, the traffic lights of transcription initiation, are used as construction elements in biotechnological efforts to coordinate ‘green waves’ in the metabolic pathways leading to the desired metabolites. Detailed analyses of Corynebacterium glutamicum promoters have already provided large amounts of data on their structures, regulatory mechanisms and practical capabilities in metabolic engineering. In this minireview the main aspects of promoter studies, the methods developed for their analysis and their practical use in C. glutamicum are discussed. These include definitions of the consensus sequences of the distinct promoter classes, promoter localization and characterization, activity measurements, the functions of transcriptional regulators and examples of practical uses of constitutive, inducible and modified promoters in biotechnology. The implications of the introduction of novel techniques, such as in vitro transcription and RNA sequencing, to C. glutamicum promoter studies are outlined. PMID:23305350
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
An integrated expression atlas of miRNAs and their promoters in human and mouse
de Rie, Derek; Abugessaisa, Imad; Alam, Tanvir; Arner, Erik; Arner, Peter; Ashoor, Haitham; Åström, Gaby; Babina, Magda; Bertin, Nicolas; Burroughs, A. Maxwell; Carlisle, Ailsa J.; Daub, Carsten O.; Detmar, Michael; Deviatiiarov, Ruslan; Fort, Alexandre; Gebhard, Claudia; Goldowitz, Daniel; Guhl, Sven; Ha, Thomas J.; Harshbarger, Jayson; Hasegawa, Akira; Hashimoto, Kosuke; Herlyn, Meenhard; Heutink, Peter; Hitchens, Kelly J.; Hon, Chung Chau; Huang, Edward; Ishizu, Yuri; Kai, Chieko; Kasukawa, Takeya; Klinken, Peter; Lassmann, Timo; Lecellier, Charles-Henri; Lee, Weonju; Lizio, Marina; Makeev, Vsevolod; Mathelier, Anthony; Medvedeva, Yulia A.; Mejhert, Niklas; Mungall, Christopher J.; Noma, Shohei; Ohshima, Mitsuhiro; Okada-Hatakeyama, Mariko; Persson, Helena; Rizzu, Patrizia; Roudnicky, Filip; Sætrom, Pål; Sato, Hiroki; Severin, Jessica; Shin, Jay W.; Swoboda, Rolf K.; Tarui, Hiroshi; Toyoda, Hiroo; Vitting-Seerup, Kristoffer; Winteringham, Louise; Yamaguchi, Yoko; Yasuzawa, Kayoko; Yoneda, Misako; Yumoto, Noriko; Zabierowski, Susan; Zhang, Peter G.; Wells, Christine A.; Summers, Kim M.; Kawaji, Hideya; Sandelin, Albin; Rehli, Michael; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R. R.; de Hoon, Michiel J. L.
2018-01-01
MicroRNAs (miRNAs) are short non-coding RNAs with key roles in cellular regulation. As part of the fifth edition of the Functional Annotation of Mammalian Genome (FANTOM5) project, we created an integrated expression atlas of miRNAs and their promoters by deep-sequencing 492 short RNA (sRNA) libraries, with matching Cap Analysis Gene Expression (CAGE) data, from 396 human and 47 mouse RNA samples. Promoters were identified for 1,357 human and 804 mouse miRNAs and showed strong sequence conservation between species. We also found that primary and mature miRNA expression levels were correlated, allowing us to use the primary miRNA measurements as a proxy for mature miRNA levels in a total of 1,829 human and 1,029 mouse CAGE libraries. We thus provide a broad atlas of miRNA expression and promoters in primary mammalian cells, establishing a foundation for detailed analysis of miRNA expression patterns and transcriptional control regions. PMID:28829439
Wang, Y L; Beach, M J; Rodwell, V W
1989-01-01
We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360
Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr
2007-01-01
Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842
2013-01-01
Background APOAI, a member of the APOAI/CIII/IV/V gene cluster on chromosome 11q23-24, encodes a major protein component of HDL that has been associated with serum lipid levels. The aim of this study was to determine the genetic association of polymorphisms in the APOAI promoter region with plasma lipid levels in a cohort of healthy Kuwaiti volunteers. Methods A 435 bp region of the APOAI promoter was analyzed by re-sequencing in 549 Kuwaiti samples. DNA was extracted from blood taken from 549 healthy Kuwaiti volunteers who had fasted for the previous 12 h. Univariate and multivariate analysis was used to determine allele association with serum lipid levels. Results The target sequence included a partial segment of the promoter region, 5’UTR and exon 1 located between nucleotides −141 to +294 upstream of the APOAI gene on chromosome 11. No novel single nucleotide polymorphisms (SNPs) were observed. The sequences obtained were deposited with the NCBI GenBank with accession number [GenBank: JX438706]. The allelic frequencies for the three SNPs were as follows: APOAI rs670G = 0.807; rs5069C = 0.964; rs1799837G = 0.997 and found to be in HWE. A significant association (p < 0.05) was observed for the APOAI rs670 polymorphism with increased serum LDL-C. Multivariate analysis showed that APOAI rs670 was an independent predictive factor when controlling for age, sex and BMI for both LDL-C (OR: 1.66, p = 0.014) and TC (OR: 1.77, p = 0.006) levels. Conclusion This study is the first to report sequence analysis of the APOAI promoter in an Arab population. The unexpected positive association found between the APOAI rs670 polymorphism and increased levels of LDL-C and TC may be due to linkage disequilibrium with other polymorphisms in candidate and neighboring genes known to be associated with lipid metabolism and transport. PMID:24028463
Al-Bustan, Suzanne A; Al-Serri, Ahmad E; Annice, Babitha G; Alnaqeeb, Majed A; Ebrahim, Ghada A
2013-09-12
APOAI, a member of the APOAI/CIII/IV/V gene cluster on chromosome 11q23-24, encodes a major protein component of HDL that has been associated with serum lipid levels. The aim of this study was to determine the genetic association of polymorphisms in the APOAI promoter region with plasma lipid levels in a cohort of healthy Kuwaiti volunteers. A 435 bp region of the APOAI promoter was analyzed by re-sequencing in 549 Kuwaiti samples. DNA was extracted from blood taken from 549 healthy Kuwaiti volunteers who had fasted for the previous 12 h. Univariate and multivariate analysis was used to determine allele association with serum lipid levels. The target sequence included a partial segment of the promoter region, 5'UTR and exon 1 located between nucleotides -141 to +294 upstream of the APOAI gene on chromosome 11. No novel single nucleotide polymorphisms (SNPs) were observed. The sequences obtained were deposited with the NCBI GenBank with accession number [GenBank: JX438706]. The allelic frequencies for the three SNPs were as follows: APOAI rs670G = 0.807; rs5069C = 0.964; rs1799837G = 0.997 and found to be in HWE. A significant association (p < 0.05) was observed for the APOAI rs670 polymorphism with increased serum LDL-C. Multivariate analysis showed that APOAI rs670 was an independent predictive factor when controlling for age, sex and BMI for both LDL-C (OR: 1.66, p = 0.014) and TC (OR: 1.77, p = 0.006) levels. This study is the first to report sequence analysis of the APOAI promoter in an Arab population. The unexpected positive association found between the APOAI rs670 polymorphism and increased levels of LDL-C and TC may be due to linkage disequilibrium with other polymorphisms in candidate and neighboring genes known to be associated with lipid metabolism and transport.
Characterization of the Structural Gene Promoter of Aedes aegypti Densovirus
Ward, Todd W.; Kimmick, Michael W.; Afanasiev, Boris N.; Carlson, Jonathan O.
2001-01-01
Aedes aegypti densonucleosis virus (AeDNV) has two promoters that have been shown to be active by reporter gene expression analysis (B. N. Afanasiev, Y. V. Koslov, J. O. Carlson, and B. J. Beaty, Exp. Parasitol. 79:322–339, 1994). Northern blot analysis of cells infected with AeDNV revealed two transcripts 1,200 and 3,500 nucleotides in length that are assumed to express the structural protein (VP) gene and nonstructural protein genes, respectively. Primer extension was used to map the transcriptional start site of the structural protein gene. Surprisingly, the structural protein gene transcript began at an initiator consensus sequence, CAGT, 60 nucleotides upstream from the map unit 61 TATAA sequence previously thought to define the promoter. Constructs with the β-galactosidase gene fused to the structural protein gene were used to determine elements necessary for promoter function. Deletion or mutation of the initiator sequence, CAGT, reduced protein expression by 93%, whereas mutation of the TATAA sequence at map unit 61 had little effect. An additional open reading frame was observed upstream of the structural protein gene that can express β-galactosidase at a low level (20% of that of VP fusions). Expression of the AeDNV structural protein gene was shown to be stimulated by the major nonstructural protein NS1 (Afanasiev et al., Exp. parasitol., 1994). To determine the sequences required for transactivation, expression of structural protein gene–β-galactosidase gene fusion constructs differing in AeDNV genome content was measured with and without NS1. The presence of NS1 led to an 8- to 10-fold increase in expression when either genomic end was present, compared to a 2-fold increase with a construct lacking the genomic ends. An even higher (37-fold) increase in expression occurred with both genomic ends present; however, this was in part due to template replication as shown by Southern blot analysis. These data indicate the location and importance of various elements necessary for efficient protein expression and transactivation from the structural protein gene promoter of AeDNV. PMID:11152505
Genome-wide analysis of promoter architecture in Drosophila melanogaster
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.
2010-10-20
Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysismore » indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.« less
Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T
2005-06-03
We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.
Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, W.M.; Sylvester, J.E.
1994-09-01
In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less
Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E
1985-01-01
The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916
Sand, Olivier; Thomas-Chollier, Morgane; Vervisch, Eric; van Helden, Jacques
2008-01-01
This protocol shows how to access the Regulatory Sequence Analysis Tools (RSAT) via a programmatic interface in order to automate the analysis of multiple data sets. We describe the steps for writing a Perl client that connects to the RSAT Web services and implements a workflow to discover putative cis-acting elements in promoters of gene clusters. In the presented example, we apply this workflow to lists of transcription factor target genes resulting from ChIP-chip experiments. For each factor, the protocol predicts the binding motifs by detecting significantly overrepresented hexanucleotides in the target promoters and generates a feature map that displays the positions of putative binding sites along the promoter sequences. This protocol is addressed to bioinformaticians and biologists with programming skills (notions of Perl). Running time is approximately 6 min on the example data set.
Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.
Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A
2016-03-18
Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.
Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi
2016-01-04
Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Fauteux, François; Strömvik, Martina V
2009-01-01
Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs. The majority of discovered motifs match experimentally characterized cis-regulatory elements. These results provide a good starting point for further experimental analysis of plant seed-specific promoters and our methodology can be used to unravel more transcriptional regulatory mechanisms in plants and other eukaryotes. PMID:19843335
Prediction of enhancer-promoter interactions via natural language processing.
Zeng, Wanwen; Wu, Mengmeng; Jiang, Rui
2018-05-09
Precise identification of three-dimensional genome organization, especially enhancer-promoter interactions (EPIs), is important to deciphering gene regulation, cell differentiation and disease mechanisms. Currently, it is a challenging task to distinguish true interactions from other nearby non-interacting ones since the power of traditional experimental methods is limited due to low resolution or low throughput. We propose a novel computational framework EP2vec to assay three-dimensional genomic interactions. We first extract sequence embedding features, defined as fixed-length vector representations learned from variable-length sequences using an unsupervised deep learning method in natural language processing. Then, we train a classifier to predict EPIs using the learned representations in supervised way. Experimental results demonstrate that EP2vec obtains F1 scores ranging from 0.841~ 0.933 on different datasets, which outperforms existing methods. We prove the robustness of sequence embedding features by carrying out sensitivity analysis. Besides, we identify motifs that represent cell line-specific information through analysis of the learned sequence embedding features by adopting attention mechanism. Last, we show that even superior performance with F1 scores 0.889~ 0.940 can be achieved by combining sequence embedding features and experimental features. EP2vec sheds light on feature extraction for DNA sequences of arbitrary lengths and provides a powerful approach for EPIs identification.
Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters.
Gagniuc, Paul; Ionescu-Tirgoviste, Constantin
2012-09-28
The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on comprehensive data from three different databases and a new computer model whose core is using Kappa index of coincidence. To fully understand the connections between gene promoters and gene expression, we analyzed thousands of promoter sequences using our Kappa Index of Coincidence method and a specialized Optical Character Recognition (OCR) neural network. Under our criteria, 10 classes of promoters were detected. In addition, the existence of "transitional" promoters suggests that there is an evolutionary weighted continuum between classes, depending perhaps upon changes in their gene products.
Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W
1989-01-01
We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481
Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y
1995-08-01
We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.
Promoter Motifs in NCLDVs: An Evolutionary Perspective
Oliveira, Graziele Pereira; Andrade, Ana Cláudia dos Santos Pereira; Rodrigues, Rodrigo Araújo Lima; Arantes, Thalita Souza; Boratto, Paulo Victor Miranda; Silva, Ludmila Karen dos Santos; Dornas, Fábio Pio; Trindade, Giliane de Souza; Drumond, Betânia Paiva; La Scola, Bernard; Kroon, Erna Geessien; Abrahão, Jônatas Santos
2017-01-01
For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV), raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’) that could be evolved gradually by nucleotides’ gain and loss and point mutations. PMID:28117683
Small Bodies, Big Concepts: Bringing Visual Analysis into the Middle School Classroom
NASA Astrophysics Data System (ADS)
Cobb, W. H.; Lebofsky, L. A.; Ristvey, J. D.; Buxner, S.; Weeks, S.; Zolensky, M. E.
2012-03-01
Multi-disciplinary PD model digs into high-end planetary science backed by a pedagogical framework, Designing Effective Science Instruction. NASA activities are sequenced to promote visual analysis of emerging data from Discovery Program missions.
Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J
1992-03-01
The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary.
Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J
1992-01-01
The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788
Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou
2014-08-01
30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.
Qin, Yu-Xiang; Qin, Fangyuan
2016-02-01
Dehydrins confer abiotic stress tolerance in seedlings, but few dehydrins have been studied by transgenic analysis under their own promoters in relation to abiotic stress tolerance. Also the inducible promoters for transgenic engineering are limited. In this study, we isolated from wheat three salt-induced YSK2 dehydrin genes and their promoters. The cDNA sequences were 711, 785, and 932 bp in length, encoding proteins containing 133, 166 and 231 amino acids, respectively, and were named TaDHN1, TaDHN2, and TaDHN3. TaDHN2 doesn't contain introns, while the other two genes each contain one. Semi-quantitative reverse transcription PCR analysis revealed all three dehydrin genes are substantially induced by ABA and NaCl, but only TaDHN2 is induced in seedlings by PEG and by cold (4 °C). Regulatory sequences upstream of the first translation codon (775, 1615 and 889 bp) of the three dehydrin genes were also cloned. Cis-element prediction indicated the presence of ABRE and other abiotic-stress-related elements. Histochemical analysis using GUS expression demonstrated that all three promoters were induced by ABA, cold or NaCl. Ectopic over-expression of TaDHN1 or TaDHN3 in Arabidopsis under their own inducible promoters enhanced NaCl- and drought-stress tolerance without growth retardation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
NASA Astrophysics Data System (ADS)
Omar, Aimi Farehah; Ismail, Ismanizan
2016-11-01
Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.
Ventura, Marco; Jankovic, Ivana; Walker, D. Carey; Pridmore, R. David; Zink, Ralf
2002-01-01
We have identified and sequenced the genes encoding the aggregation-promoting factor (APF) protein from six different strains of Lactobacillus johnsonii and Lactobacillus gasseri. Both species harbor two apf genes, apf1 and apf2, which are in the same orientation and encode proteins of 257 to 326 amino acids. Multiple alignments of the deduced amino acid sequences of these apf genes demonstrate a very strong sequence conservation of all of the genes with the exception of their central regions. Northern blot analysis showed that both genes are transcribed, reaching their maximum expression during the exponential phase. Primer extension analysis revealed that apf1 and apf2 harbor a putative promoter sequence that is conserved in all of the genes. Western blot analysis of the LiCl cell extracts showed that APF proteins are located on the cell surface. Intact cells of L. johnsonii revealed the typical cell wall architecture of S-layer-carrying gram-positive eubacteria, which could be selectively removed with LiCl treatment. In addition, the amino acid composition, physical properties, and genetic organization were found to be quite similar to those of S-layer proteins. These results suggest that APF is a novel surface protein of the Lactobacillus acidophilus B-homology group which might belong to an S-layer-like family. PMID:12450842
Lin, Min; Dan, Hanhong; Li, Yijing
2004-02-01
Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.
Kolpakova, E; Frengen, E; Stokke, T; Olsnes, S
2000-01-01
Acidic fibroblast growth factor (aFGF) intracellular binding protein (FIBP) is a protein found mainly in the nucleus that might be involved in the intracellular function of aFGF. Here we present a comparative analysis of the deduced amino acid sequences of human, murine and Drosophila FIBP analogues and demonstrate that FIBP is an evolutionarily conserved protein. The human gene spans more than 5 kb, comprising ten exons and nine introns, and maps to chromosome 11q13.1. Two slightly different splice variants found in different tissues were isolated and characterized. Sequence analysis of the region surrounding the translation start revealed a CpG island, a classical feature of widely expressed genes. Functional studies of the promoter region with a luciferase reporter system suggested a strong transcriptional activity residing within 600 bp of the 5' flanking region. PMID:11104667
Wawrzyńska, Anna; Lewandowska, Małgorzata; Sirko, Agnieszka
2010-03-01
Sulphur deficiency severely affects plant growth and their agricultural productivity leading to diverse changes in development and metabolisms. Molecular mechanisms regulating gene expression under low sulphur conditions remain largely unknown. AtSLIM1, a member of the EIN3-like (EIL) family was reported to be a central transcriptional regulator of the plant sulphur response, however, no direct interaction of this protein with any sulphur-responsive promoters was demonstrated. The focus of this study was on the analysis of a promoter region of UP9C, a tobacco gene strongly induced by sulphur limitation. Cloning and subsequent examination of this promoter resulted in the identification of a 20-nt sequence (UPE-box), also present in the promoters of several Arabidopsis genes, including three out of four homologues of UP9C. The UPE-box, consisting of two parallel tebs sequences (TEIL binding site), proved to be necessary to bind the transcription factors belonging to the EIL family and of a 5-nt conserved sequence at the 3'-end. The yeast one-hybrid analysis resulted in the identification of one transcription factor (NtEIL2) capable of binding to the UPE-box. The interactions of NtEIL2, and its homologue from Arabidopsis, AtSLIM1, with DNA were affected by mutations within the UPE-box. Transient expression assays in Nicotiana benthamiana have further shown that both factors, NtEIL2 and AtSLIM1, activate the UP9C promoter. Interestingly, activation by NtEIL2, but not by AtSLIM1, was dependent on the sulphur-deficiency of the plants.
RhoA Regulation of Cardiomyocyte Differentiation
Kaarbø, Mari; Crane, Denis I.; Murrell, Wayne G.
2013-01-01
Earlier findings from our laboratory implicated RhoA in heart developmental processes. To investigate factors that potentially regulate RhoA expression, RhoA gene organisation and promoter activity were analysed. Comparative analysis indicated strict conservation of both gene organisation and coding sequence of the chick, mouse, and human RhoA genes. Bioinformatics analysis of the derived promoter region of mouse RhoA identified putative consensus sequence binding sites for several transcription factors involved in heart formation and organogenesis generally. Using luciferase reporter assays, RhoA promoter activity was shown to increase in mouse-derived P19CL6 cells that were induced to differentiate into cardiomyocytes. Overexpression of a dominant negative mutant of mouse RhoA (mRhoAN19) blocked this cardiomyocyte differentiation of P19CL6 cells and led to the accumulation of the cardiac transcription factors SRF and GATA4 and the early cardiac marker cardiac α-actin. Taken together, these findings indicate a fundamental role for RhoA in the differentiation of cardiomyocytes. PMID:23935420
The rpoE operon regulates heat stress response in Burkholderia pseudomallei.
Vanaporn, Muthita; Vattanaviboon, Paiboon; Thongboonkerd, Visith; Korbsrisate, Sunee
2008-07-01
Burkholderia pseudomallei is a gram-negative bacterium and the causative agent of melioidosis, one of the important lethal diseases in tropical regions. In this article, we demonstrate the crucial role of the B. pseudomallei rpoE locus in the response to heat stress. The rpoE operon knockout mutant exhibited growth retardation and reduced survival when exposed to a high temperature. Expression analysis using rpoH promoter-lacZ fusion revealed that heat stress induction of rpoH, which encodes heat shock sigma factor (sigma(H)), was abolished in the B. pseudomallei rpoE mutant. Analysis of the rpoH promoter region revealed sequences sharing high homology to the consensus sequence of sigma(E)-dependent promoters. Moreover, the putative heat-induced sigma(H)-regulated heat shock proteins (i.e. GroEL and HtpG) were also absent in the rpoE operon mutant. Altogether, our data suggest that the rpoE operon regulates B. pseudomallei heat stress response through the function of rpoH.
Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar
1998-01-01
The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.
Xie, Jianbo; Shi, Haowen; Du, Zhenglin; Wang, Tianshu; Liu, Xiaomeng; Chen, Sanfeng
2016-01-01
Paenibacillus polymyxa has widely been studied as a model of plant-growth promoting rhizobacteria (PGPR). Here, the genome sequences of 9 P. polymyxa strains, together with 26 other sequenced Paenibacillus spp., were comparatively studied. Phylogenetic analysis of the concatenated 244 single-copy core genes suggests that the 9 P. polymyxa strains and 5 other Paenibacillus spp., isolated from diverse geographic regions and ecological niches, formed a closely related clade (here it is called Poly-clade). Analysis of single nucleotide polymorphisms (SNPs) reveals local diversification of the 14 Poly-clade genomes. SNPs were not evenly distributed throughout the 14 genomes and the regions with high SNP density contain the genes related to secondary metabolism, including genes coding for polyketide. Recombination played an important role in the genetic diversity of this clade, although the rate of recombination was clearly lower than mutation. Some genes relevant to plant-growth promoting traits, i.e. phosphate solubilization and IAA production, are well conserved, while some genes relevant to nitrogen fixation and antibiotics synthesis are evolved with diversity in this Poly-clade. This study reveals that both P. polymyxa and its closely related species have plant growth promoting traits and they have great potential uses in agriculture and horticulture as PGPR. PMID:26856413
Recurrent and functional regulatory mutations in breast cancer.
Rheinbay, Esther; Parasuraman, Prasanna; Grimsby, Jonna; Tiao, Grace; Engreitz, Jesse M; Kim, Jaegil; Lawrence, Michael S; Taylor-Weiner, Amaro; Rodriguez-Cuevas, Sergio; Rosenberg, Mara; Hess, Julian; Stewart, Chip; Maruvka, Yosef E; Stojanov, Petar; Cortes, Maria L; Seepo, Sara; Cibulskis, Carrie; Tracy, Adam; Pugh, Trevor J; Lee, Jesse; Zheng, Zongli; Ellisen, Leif W; Iafrate, A John; Boehm, Jesse S; Gabriel, Stacey B; Meyerson, Matthew; Golub, Todd R; Baselga, Jose; Hidalgo-Miranda, Alfredo; Shioda, Toshi; Bernards, Andre; Lander, Eric S; Getz, Gad
2017-07-06
Genomic analysis of tumours has led to the identification of hundreds of cancer genes on the basis of the presence of mutations in protein-coding regions. By contrast, much less is known about cancer-causing mutations in non-coding regions. Here we perform deep sequencing in 360 primary breast cancers and develop computational methods to identify significantly mutated promoters. Clear signals are found in the promoters of three genes. FOXA1, a known driver of hormone-receptor positive breast cancer, harbours a mutational hotspot in its promoter leading to overexpression through increased E2F binding. RMRP and NEAT1, two non-coding RNA genes, carry mutations that affect protein binding to their promoters and alter expression levels. Our study shows that promoter regions harbour recurrent mutations in cancer with functional consequences and that the mutations occur at similar frequencies as in coding regions. Power analyses indicate that more such regions remain to be discovered through deep sequencing of adequately sized cohorts of patients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lagrimini, L.M.
Since this manuscript was submitted we have conducted a more thorough physiological analysis of water relations in wild-type and peroxidase overproducing plants. These experiments include pressure bomb, plasmolysis, and membrane integrity analysis. We are also in the process of analyzing other phenotypes in peroxidase overproducer plants such as excessive browning of tissue, the rapid death of tissue in culture, and poor germination of seed. Transformed plants of Nicotiana tabacum and Nicotiana sylvestris were obtained which have peroxidase activity 3--7 fold lower than wild-type plants. This was done by introducing a chimeric gene composed of the CaMV 35S promoter and themore » 5' half of the tobacco anionic peroxidase cDNA in the antisense RNA configuration. A manuscript which describes this work is being written, and will be submitted for publication in January 1990. The anionic peroxidase gene has been cloned by hybridization to the cloned cDNA. The entire gene is contained on an 8.7kb fragment within a lambda phage clone. Several smaller DNA fragments have been subcloned, and some have been sequenced. One exon within the coding sequence has been sequenced, along with the partial sequence of two introns. Further sequencing is being carried-out to identify the promoter, which will be later joined to a reporter gene. 6 figs.« less
Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taghavi, S.; van der Lelie, D.; Hoffman, A.
2010-05-13
Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa x deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plantmore » roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT-PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to improve establishment and sustainable production of poplar as an energy feedstock on marginal, non-agricultural soils using endophytic bacteria as growth promoting agents. Poplar is considered as the model tree species for the production of lignocellulosic biomass destined for biofuel production. The plant growth promoting endophytic bacterium Enterobacter sp. 638 can improve the growth of poplar on marginal soils by as much as 40%. This prompted us to sequence the genome of this strain and, via comparative genomics, identify functions essential for the successful colonization and endophytic association with its poplar host. Analysis of the genome sequence, combined with metabolite analysis and quantitative PCR, pointed to a remarkable interaction between Enterobacter sp. 638 and its poplar host with the endophyte responsible for the production of a phytohormone, and a precursor for another that poplar is unable to synthesize, and where the production of the plant growth promoting compounds depended on the presence of plant synthesized compounds, such as sucrose, in the growth medium. Our results provide the basis to better understanding the synergistic interactions between poplar and Enterobacter sp. 638. This information can be further exploited to improve establishment and sustainable production of poplar on marginal, non-agricultural soils using endophytic bacteria such as Enterobacter sp. 638 as growth promoting agents.« less
Hattori, T; Terada, T; Hamasuna, S
1995-06-01
Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1991-08-30
Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).
Continuous in vitro evolution of bacteriophage RNA polymerase promoters
NASA Technical Reports Server (NTRS)
Breaker, R. R.; Banerji, A.; Joyce, G. F.
1994-01-01
Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.
Transcriptome analysis by strand-specific sequencing of complementary DNA
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-01-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212
Transcriptome analysis by strand-specific sequencing of complementary DNA.
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-10-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.
Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps
Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz
2015-01-01
In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450
A Noninvasive In Vitro Monitoring System Reporting Skeletal Muscle Differentiation.
Öztürk-Kaloglu, Deniz; Hercher, David; Heher, Philipp; Posa-Markaryan, Katja; Sperger, Simon; Zimmermann, Alice; Wolbank, Susanne; Redl, Heinz; Hacobian, Ara
2017-01-01
Monitoring of cell differentiation is a crucial aspect of cell-based therapeutic strategies depending on tissue maturation. In this study, we have developed a noninvasive reporter system to trace murine skeletal muscle differentiation. Either a secreted bioluminescent reporter (Metridia luciferase) or a fluorescent reporter (green fluorescent protein [GFP]) was placed under the control of the truncated muscle creatine kinase (MCK) basal promoter enhanced by variable numbers of upstream MCK E-boxes. The engineered pE3MCK vector, coding a triple tandem of E-Boxes and the truncated MCK promoter, showed twentyfold higher levels of luciferase activation compared with a Cytomegalovirus (CMV) promoter. This newly developed reporter system allowed noninvasive monitoring of myogenic differentiation in a straining bioreactor. Additionally, binding sequences of endogenous microRNAs (miRNAs; seed sequences) that are known to be downregulated in myogenesis were ligated as complementary seed sequences into the reporter vector to reduce nonspecific signal background. The insertion of seed sequences improved the signal-to-noise ratio up to 25% compared with pE3MCK. Due to the highly specific, fast, and convenient expression analysis for cells undergoing myogenic differentiation, this reporter system provides a powerful tool for application in skeletal muscle tissue engineering.
Huang, Wei; Zhang, Jianshe; Liao, Zhi; Lv, Zhenming; Wu, Huifei; Zhu, Aiyi; Wu, Changwen
2016-01-15
Gonadotropin-releasing hormone III (GnRH3) is considered to be a key neurohormone in fish reproduction control. In the present study, the cDNA and genomic sequences of GnRH3 were cloned and characterized from large yellow croaker Larimichthys crocea. The cDNA encoded a protein of 99 amino acids with four functional motifs. The full-length genome sequence was composed of 3797 nucleotides, including four exons and three introns. Higher identities of amino acid sequences and conserved exon-intron organizations were found between LcGnRH3 and other GnRH3 genes. In addition, some special features of the sequences were detected in partial species. For example, two specific residues (V and A) were found in the family Sciaenidae, and the unique 75-72 bp type of the open reading frame 2 and 3 existed in the family Cyprinidae. Analysis of the 2576 bp promoter fragment of LcGnRH3 showed a number of transcription factor binding sites, such as AP1, CREB, GATA-1, HSF, FOXA2, and FOXL1. Promoter functional analysis using an EGFP reporter fusion in zebrafish larvae presented positive signals in the brain, including the olfactory region, the terminal nerve ganglion, the telencephalon, and the hypothalamus. The expression pattern was generally consistent with the endogenous GnRH3 GFP-expressing transgenic zebrafish lines, but the details were different. These results indicate that the structure and function of LcGnRH3 are generally similar to the other teleost GnRH3 genes, but there exist some distinctions among them. Copyright © 2015 Elsevier B.V. All rights reserved.
Linking disease-associated genes to regulatory networks via promoter organization
Döhr, S.; Klingenhoff, A.; Maier, H.; de Angelis, M. Hrabé; Werner, T.; Schneider, R.
2005-01-01
Pathway- or disease-associated genes may participate in more than one transcriptional co-regulation network. Such gene groups can be readily obtained by literature analysis or by high-throughput techniques such as microarrays or protein-interaction mapping. We developed a strategy that defines regulatory networks by in silico promoter analysis, finding potentially co-regulated subgroups without a priori knowledge. Pairs of transcription factor binding sites conserved in orthologous genes (vertically) as well as in promoter sequences of co-regulated genes (horizontally) were used as seeds for the development of promoter models representing potential co-regulation. This approach was applied to a Maturity Onset Diabetes of the Young (MODY)-associated gene list, which yielded two models connecting functionally interacting genes within MODY-related insulin/glucose signaling pathways. Additional genes functionally connected to our initial gene list were identified by database searches with these promoter models. Thus, data-driven in silico promoter analysis allowed integrating molecular mechanisms with biological functions of the cell. PMID:15701758
The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.
Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D
2004-11-15
Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.
ERIC Educational Resources Information Center
Giani, Matthew; Fox, Heather Lee
2017-01-01
Career pathways, comprised of stackable credentials and a coherently aligned sequence of programmes of study, are being hailed as an effective means for promoting postsecondary attainment and upward mobility, particularly for low-income and low-skilled adult workers. However, concerns have been raised regarding whether this strategy accomplishes…
Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S
2000-06-01
17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.
Gomes, S L; Gober, J W; Shapiro, L
1990-01-01
Caulobacter crescentus has a single dnaK gene that is highly homologous to the hsp70 family of heat shock genes. Analysis of the cloned and sequenced dnaK gene has shown that the deduced amino acid sequence could encode a protein of 67.6 kilodaltons that is 68% identical to the DnaK protein of Escherichia coli and 49% identical to the Drosophila and human hsp70 protein family. A partial open reading frame 165 base pairs 3' to the end of dnaK encodes a peptide of 190 amino acids that is 59% identical to DnaJ of E. coli. Northern blot analysis revealed a single 4.0-kilobase mRNA homologous to the cloned fragment. Since the dnaK coding region is 1.89 kilobases, dnaK and dnaJ may be transcribed as a polycistronic message. S1 mapping and primer extension experiments showed that transcription initiated at two sites 5' to the dnaK coding sequence. A single start site of transcription was identified during heat shock at 42 degrees C, and the predicted promoter sequence conformed to the consensus heat shock promoters of E. coli. At normal growth temperature (30 degrees C), a different start site was identified 3' to the heat shock start site that conformed to the E. coli sigma 70 promoter consensus sequence. S1 protection assays and analysis of expression of the dnaK gene fused to the lux transcription reporter gene showed that expression of dnaK is temporally controlled under normal physiological conditions and that transcription occurs just before the initiation of DNA replication. Thus, in both human cells (I. K. L. Milarski and R. I. Morimoto, Proc. Natl. Acad. Sci. USA 83:9517-9521, 1986) and in a simple bacterium, the transcription of a hsp70 gene is temporally controlled as a function of the cell cycle under normal growth conditions. Images PMID:2345134
Mismer, D.; Rubin, G. M.
1989-01-01
We have analyzed the cis-acting regulatory sequences of the Rh1 (ninaE) gene in Drosophila melanogaster by P-element-mediated germline transformation of indicator genes transcribed from mutant ninaE promoter sequences. We have previously shown that a 200-bp region extending from -120 to +67 relative to the transcription start site is sufficient to obtain eye-specific expression from the ninaE promoter. In the present study, 22 different 4-13-bp sequences in the -120/+67 promoter region were altered by oligonucleotide-directed mutagenesis. Several of these sequences were found to be required for proper promoter function; two of these are conserved in the promoter of the homologous gene isolated from the related species Drosophila virilis. Alteration of a conserved 9-bp sequence results in aberrant, low level expression in the body. Alteration of a separate 11-bp sequence, found in the promoter regions of several photoreceptor-specific genes of Drosophila, results in an approximately 15-fold reduction in promoter efficiency but without apparent alteration of tissue-specificity. A protein factor capable of interacting with this 11-bp sequence has been detected by DNaseI footprinting in embryonic nuclear extracts. Finally, we have further characterized two separable enhancer sequences previously shown to be required for normal levels of expression from this promoter. PMID:2521839
Recognising promoter sequences using an artificial immune system
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cooke, D.E.; Hunt, J.E.
1995-12-31
We have developed an artificial immune system (AIS) which is based on the human immune system. The AIS possesses an adaptive learning mechanism which enables antibodies to emerge which can be used for classification tasks. In this paper, we describe how the AIS has been used to evolve antibodies which can classify promoter containing and promoter negative DNA sequences. The DNA sequences used for teaching were 57 nucleotides in length and contained procaryotic promoters. The system classified previously unseen DNA sequences with an accuracy of approximately 90%.
Watanabe, Keijirou; Hida, Mariko; Sasaki, Takako; Yano, Hiroyuki; Kawano, Kenji; Yoshioka, Hidekatsu; Matsuo, Noritaka
2016-02-01
Type XI collagen is a cartilage-specific extracellular matrix, and is important for collagen fibril formation and skeletal morphogenesis. We have previously reported that NF-Y regulated the proximal promoter activity of the mouse collagen α1(XI) gene (Col11a1) in chondrocytes (Hida et. al. In Vitro Cell. Dev. Biol. Anim. 2014). However, the mechanism of the Col11a1 gene regulation in chondrocytes has not been fully elucidated. In this study, we further characterized the proximal promoter activity of the mouse Col11a1 gene in chondrocytes. Cell transfection experiments with deletion and mutation constructs indicated that the downstream region of the NF-Y binding site (-116 to +1) is also necessary to regulate the proximal promoter activity of the mouse Col11a1 gene. This minimal promoter region has no TATA box and GC-rich sequence; we therefore examined whether the GC-rich sequence (-96 to -67) is necessary for the transcription regulation of the Col11a1 gene. Luciferase assays using a series of mutation constructs exhibited that the GC-rich sequence is a critical element of Col11a1 promoter activity in chondrocytes. Moreover, in silico analysis of this region suggested that one of the most effective candidates was transcription factor Sp1. Consistent with the prediction, overexpression of Sp1 significantly increased the promoter activity. Furthermore, knockdown of Sp1 expression by siRNA transfection suppressed the proximal promoter activity and the expression of endogenous transcript of the mouse Col11a1 gene. Taken together, these results indicate that the transcription factor Sp1 upregulates the proximal promoter activity of the mouse Col11a1 gene in chondrocytes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grigoriev, Igor
The JGI Fungal Genomics Program aims to scale up sequencing and analysis of fungal genomes to explore the diversity of fungi important for energy and the environment, and to promote functional studies on a system level. Combining new sequencing technologies and comparative genomics tools, JGI is now leading the world in fungal genome sequencing and analysis. Over 120 sequenced fungal genomes with analytical tools are available via MycoCosm (www.jgi.doe.gov/fungi), a web-portal for fungal biologists. Our model of interacting with user communities, unique among other sequencing centers, helps organize these communities, improves genome annotation and analysis work, and facilitates new larger-scalemore » genomic projects. This resulted in 20 high-profile papers published in 2011 alone and contributing to the Genomics Encyclopedia of Fungi, which targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts). Our next grand challenges include larger scale exploration of fungal diversity (1000 fungal genomes), developing molecular tools for DOE-relevant model organisms, and analysis of complex systems and metagenomes.« less
Comeau, André M; Arbiol, Christine; Krisch, Henry M
2014-06-19
The diverse T4-like phages (Tquatrovirinae) infect a wide array of gram-negative bacterial hosts. The genome architecture of these phages is generally well conserved, most of the phylogenetically variable genes being grouped together in a series hyperplastic regions (HPRs) that are interspersed among large blocks of conserved core genes. Recent evidence from a pair of closely related T4-like phages has suggested that small, composite terminator/promoter sequences (promoterearly stem loop [PeSLs]) were implicated in mediating the high levels of genetic plasticity by indels occurring within the HPRs. Here, we present the genome sequence analysis of two T4-like phages, PST (168 kb, 272 open reading frames [ORFs]) and nt-1 (248 kb, 405 ORFs). These two phages were chosen for comparative sequence analysis because, although they are closely related to phages that have been previously sequenced (T4 and KVP40, respectively), they have different host ranges. In each case, one member of the pair infects a bacterial strain that is a human pathogen, whereas the other phage's host is a nonpathogen. Despite belonging to phylogenetically distant branches of the T4-likes, these pairs of phage have diverged from each other in part by a mechanism apparently involving PeSL-mediated recombination. This analysis confirms a role of PeSL sequences in the generation of genomic diversity by serving as a point of genetic exchange between otherwise unrelated sequences within the HPRs. Finally, the palette of divergent genes swapped by PeSL-mediated homologous recombination is discussed in the context of the PeSLs' potentially important role in facilitating phage adaption to new hosts and environments. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Prevalence of transcription promoters within archaeal operons and coding sequences
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of ∼64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein–DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3′ ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes—events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements. PMID:19536208
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
Dennison, Sarah Rachel; Harris, Frederick; Brandenburg, Klaus; Phoenix, David Andrew
2007-11-01
The barley yellow dwarf virus movement protein (BYDV-MP) requires its N-terminal sequence to promote the transport of viral RNA into the nuclear compartment of host plant cells. Here, graphical analysis predicts that this sequence would form a membrane interactive amphiphilic alpha-helix. Confirming this prediction, NT1, a peptide homologue of the BYDV-MP N-terminal sequence, was found to be alpha-helical (65%) in the presence of vesicles mimics of the nuclear membrane. The peptide increased the fluidity of these nuclear membrane mimics (rise in wavenumber of circa 0.5-1.0 cm(-1)) and induced surface pressure changes of 2 mN m(-1) in lipid monolayers with corresponding compositions. Taken with isotherm analysis these results suggest that BYDV-MP forms an N-terminal amphiphilic alpha-helix, which partitions into the nuclear membrane primarily through thermodynamically stable associations with the membrane lipid headgroup region. We speculate that these associations may play a role in targeting of the nuclear membrane by BYDM-MP.
Hayden, Eric J
2016-08-15
RNA molecules provide a realistic but tractable model of a genotype to phenotype relationship. This relationship has been extensively investigated computationally using secondary structure prediction algorithms. Enzymatic RNA molecules, or ribozymes, offer access to genotypic and phenotypic information in the laboratory. Advancements in high-throughput sequencing technologies have enabled the analysis of sequences in the lab that now rivals what can be accomplished computationally. This has motivated a resurgence of in vitro selection experiments and opened new doors for the analysis of the distribution of RNA functions in genotype space. A body of computational experiments has investigated the persistence of specific RNA structures despite changes in the primary sequence, and how this mutational robustness can promote adaptations. This article summarizes recent approaches that were designed to investigate the role of mutational robustness during the evolution of RNA molecules in the laboratory, and presents theoretical motivations, experimental methods and approaches to data analysis. Copyright © 2016 Elsevier Inc. All rights reserved.
Methods and compositions for regulating gene expression in plant cells
NASA Technical Reports Server (NTRS)
Dai, Shunhong (Inventor); Beachy, Roger N. (Inventor); Luis, Maria Isabel Ordiz (Inventor)
2010-01-01
Novel chimeric plant promoter sequences are provided, together with plant gene expression cassettes comprising such sequences. In certain preferred embodiments, the chimeric plant promoters comprise the BoxII cis element and/or derivatives thereof. In addition, novel transcription factors are provided, together with nucleic acid sequences encoding such transcription factors and plant gene expression cassettes comprising such nucleic acid sequences. In certain preferred embodiments, the novel transcription factors comprise the acidic domain, or fragments thereof, of the RF2a transcription factor. Methods for using the chimeric plant promoter sequences and novel transcription factors in regulating the expression of at least one gene of interest are provided, together with transgenic plants comprising such chimeric plant promoter sequences and novel transcription factors.
Promoter Sequences Prediction Using Relational Association Rule Mining
Czibula, Gabriela; Bocicor, Maria-Iuliana; Czibula, Istvan Gergely
2012-01-01
In this paper we are approaching, from a computational perspective, the problem of promoter sequences prediction, an important problem within the field of bioinformatics. As the conditions for a DNA sequence to function as a promoter are not known, machine learning based classification models are still developed to approach the problem of promoter identification in the DNA. We are proposing a classification model based on relational association rules mining. Relational association rules are a particular type of association rules and describe numerical orderings between attributes that commonly occur over a data set. Our classifier is based on the discovery of relational association rules for predicting if a DNA sequence contains or not a promoter region. An experimental evaluation of the proposed model and comparison with similar existing approaches is provided. The obtained results show that our classifier overperforms the existing techniques for identifying promoter sequences, confirming the potential of our proposal. PMID:22563233
Bing, Tiejun; Zhang, Suzhen; Liu, Xiaojuan; Liang, Zhibin; Shao, Peng; Zhang, Song; Qiao, Wentao; Tan, Juan
2016-06-30
Bovine foamy virus (BFV) encodes the transactivator BTas, which enhances viral gene transcription by binding to the long terminal repeat promoter and the internal promoter. In this study, we investigated the different replication capacities of two similar BFV full-length DNA clones, pBS-BFV-Y and pBS-BFV-B. Here, functional analysis of several chimeric clones revealed a major role for the C-terminal region of the viral genome in causing this difference. Furthermore, BTas-B, which is located in this C-terminal region, exhibited a 20-fold higher transactivation activity than BTas-Y. Sequence alignment showed that these two sequences differ only at amino acid 108, with BTas-B containing N108 and BTas-Y containing D108 at this position. Results of mutagenesis studies demonstrated that residue N108 is important for BTas binding to viral promoters. In addition, the N108D mutation in pBS-BFV-B reduced the viral replication capacity by about 1.5-fold. Our results suggest that residue N108 is important for BTas binding to BFV promoters and has a major role in BFV replication. These findings not only advances our understanding of the transactivation mechanism of BTas, but they also highlight the importance of certain sequence polymorphisms in modulating the replication capacity of isolated BFV clones.
E1A promoter of bovine adenovirus type 3.
Xing, Li; Tikoo, Suresh Kumar
2006-12-01
Conserved motifs of eukaryotic gene promoters, such as TATA box and CAAT box sequences, of E1A of human adenoviruses (e.g human adenovirus 5) lie between the left inverted terminal repeat (ITR) and the ATG of E1A. However, analysis of the left end of the bovine adenovirus 3 (BAdV-3) genome revealed that the conserved sequences of the E1A promoter are present only in the ITR. As such, the promoter activity of ITR was tested in the context of a BAdV-3 vector or a plasmid-based system. Different regions of the left end of the BAdV-3 genome initiated transcription of the red fluorescent protein gene in a plasmid-based system. Moreover, BAdV-3 mutants in which the open reading frame of E1A was placed immediately downstream of the ITR produced E1A transcript and could be propagated in non-E1A-complementing Madin-Darby bovine kidney cells. These results suggest that the left ITR contains the sole BAdV-3 E1A promoter.
Umarov, Ramzan Kh; Solovyev, Victor V
2017-01-01
Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize Convolutional Neural Networks (CNN) to analyze sequence characteristics of prokaryotic and eukaryotic promoters and build their predictive models. We trained a similar CNN architecture on promoters of five distant organisms: human, mouse, plant (Arabidopsis), and two bacteria (Escherichia coli and Bacillus subtilis). We found that CNN trained on sigma70 subclass of Escherichia coli promoter gives an excellent classification of promoters and non-promoter sequences (Sn = 0.90, Sp = 0.96, CC = 0.84). The Bacillus subtilis promoters identification CNN model achieves Sn = 0.91, Sp = 0.95, and CC = 0.86. For human, mouse and Arabidopsis promoters we employed CNNs for identification of two well-known promoter classes (TATA and non-TATA promoters). CNN models nicely recognize these complex functional regions. For human promoters Sn/Sp/CC accuracy of prediction reached 0.95/0.98/0,90 on TATA and 0.90/0.98/0.89 for non-TATA promoter sequences, respectively. For Arabidopsis we observed Sn/Sp/CC 0.95/0.97/0.91 (TATA) and 0.94/0.94/0.86 (non-TATA) promoters. Thus, the developed CNN models, implemented in CNNProm program, demonstrated the ability of deep learning approach to grasp complex promoter sequence characteristics and achieve significantly higher accuracy compared to the previously developed promoter prediction programs. We also propose random substitution procedure to discover positionally conserved promoter functional elements. As the suggested approach does not require knowledge of any specific promoter features, it can be easily extended to identify promoters and other complex functional regions in sequences of many other and especially newly sequenced genomes. The CNNProm program is available to run at web server http://www.softberry.com.
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
Łochowska, Anna; Iwanicka-Nowicka, Roksana; Zielak, Agata; Modelewska, Anna; Thomas, Mark S.; Hryniewicz, Monika M.
2011-01-01
The genome of Burkholderia cenocepacia contains two genes encoding closely related LysR-type transcriptional regulators, CysB and SsuR, involved in control of sulfur assimilation processes. In this study we show that the function of SsuR is essential for the utilization of a number of organic sulfur sources of either environmental or human origin. Among the genes upregulated by SsuR identified here are the tauABC operon encoding a predicted taurine transporter, three tauD-type genes encoding putative taurine dioxygenases, and atsA encoding a putative arylsulfatase. The role of SsuR in expression of these genes/operons was characterized through (i) construction of transcriptional reporter fusions to candidate promoter regions and analysis of their expression in the presence/absence of SsuR and (ii) testing the ability of SsuR to bind SsuR-responsive promoter regions. We also demonstrate that expression of SsuR-activated genes is not repressed in the presence of inorganic sulfate. A more detailed analysis of four SsuR-responsive promoter regions indicated that ∼44 bp of the DNA sequence preceding and/or overlapping the predicted −35 element of such promoters is sufficient for SsuR binding. The DNA sequence homology among SsuR “recognition motifs” at different responsive promoters appears to be limited. PMID:21317335
Lee, Jae Hoon; Sundin, George W; Zhao, Youfu
2016-06-01
The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.
Vadigepalli, Rajanikanth; Chakravarthula, Praveen; Zak, Daniel E; Schwaber, James S; Gonye, Gregory E
2003-01-01
We have developed a bioinformatics tool named PAINT that automates the promoter analysis of a given set of genes for the presence of transcription factor binding sites. Based on coincidence of regulatory sites, this tool produces an interaction matrix that represents a candidate transcriptional regulatory network. This tool currently consists of (1) a database of promoter sequences of known or predicted genes in the Ensembl annotated mouse genome database, (2) various modules that can retrieve and process the promoter sequences for binding sites of known transcription factors, and (3) modules for visualization and analysis of the resulting set of candidate network connections. This information provides a substantially pruned list of genes and transcription factors that can be examined in detail in further experimental studies on gene regulation. Also, the candidate network can be incorporated into network identification methods in the form of constraints on feasible structures in order to render the algorithms tractable for large-scale systems. The tool can also produce output in various formats suitable for use in external visualization and analysis software. In this manuscript, PAINT is demonstrated in two case studies involving analysis of differentially regulated genes chosen from two microarray data sets. The first set is from a neuroblastoma N1E-115 cell differentiation experiment, and the second set is from neuroblastoma N1E-115 cells at different time intervals following exposure to neuropeptide angiotensin II. PAINT is available for use as an agent in BioSPICE simulation and analysis framework (www.biospice.org), and can also be accessed via a WWW interface at www.dbi.tju.edu/dbi/tools/paint/.
Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László
2005-01-01
DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291
Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László
2005-01-01
DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.
Chen, Liang
2017-06-10
Bacillus velezensis LM2303 is a biocontrol strain with a broad inhibitory spectrum against plant pathogens, isolated from the dung of wild yak inhabited Qinghai-Tibet plateau, China. Here we present its complete genome sequence, which consists of a single, circular chromosome of 3,989,393bp with a 46.68% G+C content. Genome analysis revealed genes encoding specialized functions for the biosynthesis of antifungal metabolites and antibacterial metabolites, the promotion of plant growth, the alleviation of oxidative stress and nutrient utilization. And the biosynthesis of antimicrobial metabolites in strain LM2303 was confirmed by biochemical analysis, while its plant growth promoting traits were confirmed by inoculation tests. Our results will establish a better foundation for further studies and biocontrol application of B. velezensis LM2303. Copyright © 2017 Elsevier B.V. All rights reserved.
The evolution of transcriptional regulation in eukaryotes
NASA Technical Reports Server (NTRS)
Wray, Gregory A.; Hahn, Matthew W.; Abouheif, Ehab; Balhoff, James P.; Pizer, Margaret; Rockman, Matthew V.; Romano, Laura A.
2003-01-01
Gene expression is central to the genotype-phenotype relationship in all organisms, and it is an important component of the genetic basis for evolutionary change in diverse aspects of phenotype. However, the evolution of transcriptional regulation remains understudied and poorly understood. Here we review the evolutionary dynamics of promoter, or cis-regulatory, sequences and the evolutionary mechanisms that shape them. Existing evidence indicates that populations harbor extensive genetic variation in promoter sequences, that a substantial fraction of this variation has consequences for both biochemical and organismal phenotype, and that some of this functional variation is sorted by selection. As with protein-coding sequences, rates and patterns of promoter sequence evolution differ considerably among loci and among clades for reasons that are not well understood. Studying the evolution of transcriptional regulation poses empirical and conceptual challenges beyond those typically encountered in analyses of coding sequence evolution: promoter organization is much less regular than that of coding sequences, and sequences required for the transcription of each locus reside at multiple other loci in the genome. Because of the strong context-dependence of transcriptional regulation, sequence inspection alone provides limited information about promoter function. Understanding the functional consequences of sequence differences among promoters generally requires biochemical and in vivo functional assays. Despite these challenges, important insights have already been gained into the evolution of transcriptional regulation, and the pace of discovery is accelerating.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Depto, A.S.; Stenberg, R.M.
1989-03-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection ofmore » the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.« less
The complete sequence and promoter activity of the human A-raf-1 gene (ARAF1)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, J.E.; Beck, T.W.; Brennscheidt, U.
1994-03-01
The raf proto-oncogenes encode cytoplasmic protein serine/threonine kinases, which play a critical role in cell growth and development. One of these, A-raf-1 (human gene symbol, ARAF1), which is predominantly expressed in mouse urogenital tissues, has been mapped to an evolutionarily conserved linkage group composed of ARAF1, SYN1, TIMP, and properdin located at human chromosome Xp11.2. The authors have isolated human genomic DNA clones containing the expressed gene (ARAF1) on the X chromosome and a pseudogene (ARAF2) on chromosome 7p12-q11.21. Analysis of the nucleotide sequence from the ARAF1 genomic clones demonstrated that it consists of 16 exons encoded by minimally 10,776more » nucleotides. The major transcriptional start site (+1) was determined by RNase protection and primer extension assays. Promoter activity was confirmed by functional assays using DNA fragments fused to a CAT reporter gene. The ARAF1 minimal promoter, located between nucleotides -59 and +93, has a low G + C content and lacks consensus TATA and Inr sequences but shows sequence similarity at position -1 to the E box that is known to interact with USF and TFII-I transcription factors. 65 refs., 7 figs., 1 tab.« less
Ding, Zhihu; Gillespie, Laura L; Mercer, F Corinne; Paterno, Gary D
2004-07-02
To gain insight into the regulation of hmi-er1 expression, we cloned a human genomic DNA fragment containing one of the two hmi-er1 promoters and consisting of 1460 bp upstream of the translation initiation codon of hMI-ER1. Computer-assisted sequence analysis revealed that the hmi-er1 promoter region contains a CpG island but lacks an identifiable TATA element, initiator sequence and downstream promoter element. This genomic DNA was able to direct transcription of a luciferase reporter gene in a variety of human cell lines, and the minimal promoter was shown to be located within-68/+144 bp. Several putative Sp1 binding sites were identified, and we show that Sp1 can bind to the hmi-er1 minimal promoter and increase transcription, suggesting that the level of hmi-er1 expression may depend on the availability of Sp1 protein. Functional analysis revealed that hMI-ER1 represses Sp1-activated transcription from the minimal promoter by a histone deacetylase-independent mechanism. Chromatin immunoprecipitation analysis demonstrated that both Sp1 and hMI-ER1 are associated with the chromatin of the hmi-er1 promoter and that overexpression of hMI-ER1 in cell lines that allow Tet-On-inducible expression resulted in loss of detectable Sp1 from the endogenous hmi-er1 promoter. The mechanism by which this occurs does not involve binding of hMI-ER1 to cis-acting elements. Instead, we show that hMI-ER1 physically associates with Sp1 and that endogenous complexes containing the two proteins could be detected in vivo. Furthermore, hMI-ER1 specifically interferes with binding of Sp1 to the hmi-er1 minimal promoter as well as to an Sp1 consensus oligonucleotide. Deletion analysis revealed that this interaction occurs through a region containing the SANT domain of hMI-ER1. Together, these data reveal a functional role for the SANT domain in the action of co-repressor regulatory factors and suggest that the association of hMI-ER1 with Sp1 represents a novel mechanism for the negative regulation of Sp1 target promoters.
Litwin, Christine M.; Byrne, Burke L.
1998-01-01
Vibrio vulnificus is a halophilic, marine pathogen that has been associated with septicemia and serious wound infections in patients with iron overload and preexisting liver disease. For V. vulnificus, the ability to acquire iron from the host has been shown to correlate with virulence. V. vulnificus is able to use host iron sources such as hemoglobin and heme. We previously constructed a fur mutant of V. vulnificus which constitutively expresses at least two iron-regulated outer membrane proteins, of 72 and 77 kDa. The N-terminal amino acid sequence of the 77-kDa protein purified from the V. vulnificus fur mutant had 67% homology with the first 15 amino acids of the mature protein of the Vibrio cholerae heme receptor, HutA. In this report, we describe the cloning, DNA sequence, mutagenesis, and analysis of transcriptional regulation of the structural gene for HupA, the heme receptor of V. vulnificus. DNA sequencing of hupA demonstrated a single open reading frame of 712 amino acids that was 50% identical and 66% similar to the sequence of V. cholerae HutA and similar to those of other TonB-dependent outer membrane receptors. Primer extension analysis localized one promoter for the V. vulnificus hupA gene. Analysis of the promoter region of V. vulnificus hupA showed a sequence homologous to the consensus Fur box. Northern blot analysis showed that the transcript was strongly regulated by iron. An internal deletion in the V. vulnificus hupA gene, done by using marker exchange, resulted in the loss of expression of the 77-kDa protein and the loss of the ability to use hemin or hemoglobin as a source of iron. The hupA deletion mutant of V. vulnificus will be helpful in future studies of the role of heme iron in V. vulnificus pathogenesis. PMID:9632577
Anish, Ramakrishnan; Hossain, Mohammad B.; Jacobson, Raymond H.; Takada, Shinako
2009-01-01
Background More than 80% of mammalian protein-coding genes are driven by TATA-less promoters which often show multiple transcriptional start sites (TSSs). However, little is known about the core promoter DNA sequences or mechanisms of transcriptional initiation for this class of promoters. Methodology/Principal Findings Here we identify a new core promoter element XCPE2 (X core promoter element 2) (consensus sequence: A/C/G-C-C/T-C-G/A-T-T-G/A-C-C/A+1-C/T) that can direct specific transcription from the second TSS of hepatitis B virus X gene mRNA. XCPE2 sequences can also be found in human promoter regions and typically appear to drive one of the start sites within multiple TSS-containing TATA-less promoters. To gain insight into mechanisms of transcriptional initiation from this class of promoters, we examined requirements of several general transcription factors by in vitro transcription experiments using immunodepleted nuclear extracts and purified factors. Our results show that XCPE2-driven transcription uses at least TFIIB, either TFIID or free TBP, RNA polymerase II (RNA pol II) and the MED26-containing mediator complex but not Gcn5. Therefore, XCPE2-driven transcription can be carried out by a mechanism which differs from previously described TAF-dependent mechanisms for initiator (Inr)- or downstream promoter element (DPE)-containing promoters, the TBP- and SAGA (Spt-Ada-Gcn5-acetyltransferase)-dependent mechanism for yeast TATA-containing promoters, or the TFTC (TBP-free-TAF-containing complex)-dependent mechanism for certain Inr-containing TATA-less promoters. EMSA assays using XCPE2 promoter and purified factors further suggest that XCPE2 promoter recognition requires a set of factors different from those for TATA box, Inr, or DPE promoter recognition. Conclusions/Significance We identified a new core promoter element XCPE2 that are found in multiple TSS-containing TATA-less promoters. Mechanisms of promoter recognition and transcriptional initiation for XCPE2-driven promoters appear different from previously shown mechanisms for classical promoters that show single “focused” TSSs. Our studies provide insight into novel mechanisms of RNA Pol II transcription from multiple TSS-containing TATA-less promoters. PMID:19337366
DNA methylation analysis of phenotype specific stratified Indian population.
Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu
2015-05-08
DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.
Shariati J, Vahid; Malboobi, Mohammad Ali; Tabrizi, Zeinab; Tavakol, Elahe; Owilia, Parviz; Safari, Maryam
2017-11-15
In this study, we provide a comparative genomic analysis of Pantoea agglomerans strain P5 and 10 closely related strains based on phylogenetic analyses. A next-generation shotgun strategy was implemented using the Illumina HiSeq 2500 technology followed by core- and pan-genome analysis. The genome of P. agglomerans strain P5 contains an assembly size of 5082485 bp with 55.4% G + C content. P. agglomerans consists of 2981 core and 3159 accessory genes for Coding DNA Sequences (CDSs) based on the pan-genome analysis. Strain P5 can be grouped closely with strains PG734 and 299 R using pan and core genes, respectively. All the predicted and annotated gene sequences were allocated to KEGG pathways. Accordingly, genes involved in plant growth-promoting (PGP) ability, including phosphate solubilization, IAA and siderophore production, acetoin and 2,3-butanediol synthesis and bacterial secretion, were assigned. This study provides an in-depth view of the PGP characteristics of strain P5, highlighting its potential use in agriculture as a biofertilizer.
ERIC Educational Resources Information Center
Finn, Jerry; Dillon, Caroline
2007-01-01
This paper describes methods for teaching content analysis as part of the Research sequence in social work education. Teaching content analysis is used to develop research skills as well as to promote students' knowledge and critical thinking and about new information technology resources that are being increasingly used by the general public. The…
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less
Disappearance of nucleosome positioning in mitotic chromatin in vivo.
Komura, Jun-ichiro; Ono, Tetsuya
2005-04-15
During mitosis, transcription is silenced and most transcription factors are displaced from their recognition sequences. By in vivo footprinting analysis, we have confirmed and extended previous studies showing loss of transcription factors from an RNA polymerase II promoter (c-FOS) and, for the first time, an RNA polymerase III promoter (U6) in HeLa cells. Because little was known about nucleosomal organization in mitotic chromosomes, we performed footprinting analysis for nucleosomes on these promoters in interphase and mitotic cells. During interphase, each of the promoters had a positioned nucleosome in the region intervening between proximal promoter elements and distal enhancer elements, but the strong nucleosome positioning disappeared during mitosis. Thus, the nucleosomal organization that appears to facilitate transcription in interphase cells may be lost in mitotic cells, and nucleosome positioning during mitosis does not seem to be a major component of the epigenetic mechanisms to mark genes for rapid reactivation after this phase.
Perkins, J B; Bower, S; Howitt, C L; Yocum, R R; Pero, J
1996-01-01
Northern (RNA) blot analysis of the Bacillus subtilis biotin operon, bioWAFDBIorf2, detected at least two steady-state polycistronic transcripts initiated from a putative vegetative (Pbio) promoter that precedes the operon, i.e., a full-length 7.2-kb transcript covering the entire operon and a more abundant 5.1-kb transcript covering just the first five genes of the operon. Biotin and the B. subtilis birA gene product regulated synthesis of the transcripts. Moreover, replacing the putative Pbio promoter and regulatory sequence with a constitutive SP01 phage promoter resulted in higher-level constitutive synthesis. Removal of a rho-independent terminator-like sequence located between the fifth (bioB) and sixth (bioI) genes prevented accumulation of the 5.1-kb transcript, suggesting that the putative terminator functions to limit expression of bioI, which is thought to be involved in an early step in biotin synthesis. PMID:8892842
Perkins, J B; Bower, S; Howitt, C L; Yocum, R R; Pero, J
1996-11-01
Northern (RNA) blot analysis of the Bacillus subtilis biotin operon, bioWAFDBIorf2, detected at least two steady-state polycistronic transcripts initiated from a putative vegetative (Pbio) promoter that precedes the operon, i.e., a full-length 7.2-kb transcript covering the entire operon and a more abundant 5.1-kb transcript covering just the first five genes of the operon. Biotin and the B. subtilis birA gene product regulated synthesis of the transcripts. Moreover, replacing the putative Pbio promoter and regulatory sequence with a constitutive SP01 phage promoter resulted in higher-level constitutive synthesis. Removal of a rho-independent terminator-like sequence located between the fifth (bioB) and sixth (bioI) genes prevented accumulation of the 5.1-kb transcript, suggesting that the putative terminator functions to limit expression of bioI, which is thought to be involved in an early step in biotin synthesis.
Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea
Didi, Jennifer; Ergani, Ayla; Lima, Sandra
2016-01-01
ABSTRACT Whole-genome sequencing of Serratia rubidaea CIP 103234T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5′ rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. PMID:27956418
Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea.
Bonnin, Rémy A; Didi, Jennifer; Ergani, Ayla; Lima, Sandra; Naas, Thierry
2017-02-01
Whole-genome sequencing of Serratia rubidaea CIP 103234 T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5' rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ 70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. Copyright © 2017 American Society for Microbiology.
Zhang, Wenxiang; Fan, Shuli; Pang, Chaoyou; Wei, Hengling; Ma, Jianhui; Song, Meizhen; Yu, Shuxun
2013-07-01
The MADS-box genes encode a large family of transcription factors having diverse roles in plant development. The SQUAMOSA (SQUA)/APETALA1 (AP1)/FRUITFULL (FUL) subfamily genes are essential regulators of floral transition and floral organ identity. Here we cloned two MADS-box genes, GhMADS22 and GhMADS23, belonging to the SQUA/AP1/FUL subgroup from Gossypium hirsutum L. Phylogenetic analysis and sequence alignment showed that GhMADS22 and GhMADS23 belonged to the euFUL and euAP1 subclades, respectively. The two genes both had eight exons and seven introns from the start codon to the stop codon according to the alignment between the obtained cDNA sequence and the Gossypium raimondii L. genome sequence. Expression profile analysis showed that GhMADS22 and GhMADS23 were highly expressed in developing shoot apices, bracts, and sepals. Gibberellic acid promoted GhMADS22 and GhMADS23 expression in the shoot apex. Transgenic Arabidopsis lines overexpressing 35S::GhMADS22 had abnormal flowers and bolted earlier than wild type under long-day conditions (16 h light/8 h dark). Moreover, GhMADS22 overexpression delayed floral organ senescence and abscission and it could also respond to abscisic acid. In summary, GhMADS22 may have functions in promoting flowering, improving resistance and delaying senescence for cotton and thus it may be a candidate target for promoting early-maturation in cotton breeding. © 2013 Institute of Botany, Chinese Academy of Sciences.
Identification of the promoter of the myelomonocytic leukocyte integrin CD11b.
Hickstein, D D; Baker, D M; Gollahon, K A; Back, A L
1992-01-01
The CD11b (or macrophage-1 antigen; MAC-1) subunit of the leukocyte integrin family forms a noncovalently associated heterodimeric structure with the CD18 (beta) subunit on the surface of human granulocytes and monocyte/macrophages, where it enables these myeloid cells to participate in a variety of adherence-related activities. Expression of the CD11b subunit is restricted to cells of the myelomonocytic lineage and depends upon the stage of differentiation with the most mature myeloid cells expressing the highest levels of CD11b. To study the regulation of CD11b expression, a genomic clone corresponding to the 5' region of the CD11b gene was isolated from a human chromosome 16 library. Primer extension and RNase protection assays identified two major transcriptional start sites, located 90 base pairs and 54 base pairs upstream from the initiation methionine. DNA sequence analysis of 1.7 kilobases of the 5' flanking sequence of the CD11b gene indicated the absence of a "CAAT" or "TATA" box; however, potential binding sites for the transcription activators Sp1, PU.1, ets, and AP-2 are present, as well as retinoic acid response elements. The 1.7-kilobase CD11b promoter sequence displayed functional activity in transient transfection assays in the monocytic cell line THP-1 and the myeloid cell line HL-60. In contrast, this 1.7-kilobase promoter sequence did not display functional activity in the Jurkat T-lymphoid cell line. Detailed characterization of the CD11b promoter sequence should provide insight into the molecular events regulating the tissue-specific and developmental stage-specific expression of the CD11b molecule in myelomonocytic cells. Images PMID:1347945
Unconventional P-35S sequence identified in genetically modified maize
Al-Hmoud, Nisreen; Al-Husseini, Nawar; Ibrahim-Alobaide, Mohammed A; Kübler, Eric; Farfoura, Mahmoud; Alobydi, Hytham; Al-Rousan, Hiyam
2014-01-01
The Cauliflower Mosaic Virus 35S promoter sequence, CaMV P-35S, is one of several commonly used genetic targets to detect genetically modified maize and is found in most GMOs. In this research we report the finding of an alternative P-35S sequence and its incidence in GM maize marketed in Jordan. The primer pair normally used to amplify a 123 bp DNA fragment of the CaMV P-35S promoter in GMOs also amplified a previously undetected alternative sequence of CaMV P-35S in GM maize samples which we term V3. The amplified V3 sequence comprises 386 base pairs and was not found in the standard wild-type maize, MON810 and MON 863 GM maize. The identified GM maize samples carrying the V3 sequence were found free of CaMV when compared with CaMV infected brown mustard sample. The data of sequence alignment analysis of the V3 genetic element showed 90% similarity with the matching P-35S sequence of the cauliflower mosaic virus isolate CabbB-JI and 99% similarity with matching P-35S sequences found in several binary plant vectors, of which the binary vector locus JQ693018 is one example. The current study showed an increase of 44% in the incidence of the identified 386 bp sequence in GM maize sold in Jordan’s markets during the period 2009 and 2012. PMID:24495911
Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.
2014-01-01
The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924
Computational Approaches to Identify Promoters and cis-Regulatory Elements in Plant Genomes1
Rombauts, Stephane; Florquin, Kobe; Lescot, Magali; Marchal, Kathleen; Rouzé, Pierre; Van de Peer, Yves
2003-01-01
The identification of promoters and their regulatory elements is one of the major challenges in bioinformatics and integrates comparative, structural, and functional genomics. Many different approaches have been developed to detect conserved motifs in a set of genes that are either coregulated or orthologous. However, although recent approaches seem promising, in general, unambiguous identification of regulatory elements is not straightforward. The delineation of promoters is even harder, due to its complex nature, and in silico promoter prediction is still in its infancy. Here, we review the different approaches that have been developed for identifying promoters and their regulatory elements. We discuss the detection of cis-acting regulatory elements using word-counting or probabilistic methods (so-called “search by signal” methods) and the delineation of promoters by considering both sequence content and structural features (“search by content” methods). As an example of search by content, we explored in greater detail the association of promoters with CpG islands. However, due to differences in sequence content, the parameters used to detect CpG islands in humans and other vertebrates cannot be used for plants. Therefore, a preliminary attempt was made to define parameters that could possibly define CpG and CpNpG islands in Arabidopsis, by exploring the compositional landscape around the transcriptional start site. To this end, a data set of more than 5,000 gene sequences was built, including the promoter region, the 5′-untranslated region, and the first introns and coding exons. Preliminary analysis shows that promoter location based on the detection of potential CpG/CpNpG islands in the Arabidopsis genome is not straightforward. Nevertheless, because the landscape of CpG/CpNpG islands differs considerably between promoters and introns on the one side and exons (whether coding or not) on the other, more sophisticated approaches can probably be developed for the successful detection of “putative” CpG and CpNpG islands in plants. PMID:12857799
Genome-wide mapping of autonomous promoter activity in human cells
van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas
2017-01-01
Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or the consensus ERE was blunted by the antiestrogen tamoxifen. Based on these studies, we believe the 3'-fos ERE sequence we have identified may be a major cis-acting element involved in the physiological regulation of the gene by estrogens in vivo.
Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2012-01-01
The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637
Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.
Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M
2011-07-01
Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value < 2 × 10(-16)). We found distinct patterns of promoter methylation around transcription start sites, where methylation occurred not only on the CGIs, but also on flanking regions and CGI sparse promoters. Among the 6691 methylated promoters in prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.
Hall, R L; Moyer, R W
1991-01-01
Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245
Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.
Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni
2015-12-21
Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.
Genomes OnLine Database (GOLD) v.6: data updates and feature enhancements
Mukherjee, Supratim; Stamatis, Dimitri; Bertsch, Jon; Ovchinnikova, Galina; Verezemska, Olena; Isbandi, Michelle; Thomas, Alex D.; Ali, Rida; Sharma, Kaushal; Kyrpides, Nikos C.; Reddy, T. B. K.
2017-01-01
The Genomes Online Database (GOLD) (https://gold.jgi.doe.gov) is a manually curated data management system that catalogs sequencing projects with associated metadata from around the world. In the current version of GOLD (v.6), all projects are organized based on a four level classification system in the form of a Study, Organism (for isolates) or Biosample (for environmental samples), Sequencing Project and Analysis Project. Currently, GOLD provides information for 26 117 Studies, 239 100 Organisms, 15 887 Biosamples, 97 212 Sequencing Projects and 78 579 Analysis Projects. These are integrated with over 312 metadata fields from which 58 are controlled vocabularies with 2067 terms. The web interface facilitates submission of a diverse range of Sequencing Projects (such as isolate genome, single-cell genome, metagenome, metatranscriptome) and complex Analysis Projects (such as genome from metagenome, or combined assembly from multiple Sequencing Projects). GOLD provides a seamless interface with the Integrated Microbial Genomes (IMG) system and supports and promotes the Genomic Standards Consortium (GSC) Minimum Information standards. This paper describes the data updates and additional features added during the last two years. PMID:27794040
Current state-of-art of STR sequencing in forensic genetics.
Alonso, Antonio; Barrio, Pedro A; Müller, Petra; Köcher, Steffi; Berger, Burkhard; Martin, Pablo; Bodner, Martin; Willuweit, Sascha; Parson, Walther; Roewer, Lutz; Budowle, Bruce
2018-05-11
The current state of validation and implementation strategies of MPS technology for the analysis of STR markers for forensic genetics use is described, covering the topics of the current catalogue of commercial MPS-STR panels, leading MPS-platforms, and MPS-STR data analysis tools. In addition, the developmental and internal validation studies carried out to date to evaluate reliability, sensitivity, mixture analysis, concordance, and the ability to analyze challenged samples are summarized. The results of various MPS-STR population studies that showed a large number of new STR sequence variants that increase the power of discrimination in several forensically-relevant loci are also presented. Finally, various initiatives developed by several international projects and standardization (or guidelines) groups to facilitate application of MPS technology for STR marker analyses are discussed in regard to promoting a standard STR sequence nomenclature, performing population studies to detect sequence variants, and developing a universal system to translate sequence variants into a simple STR nomenclature (numbers and letters) compatible with national STR databases. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria
Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen
2001-01-01
The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607
Sequences 5' to translation start regulate expression of petunia rbcS genes.
Dean, C; Favreau, M; Bedbrook, J; Dunsmuir, P
1989-01-01
The promoter sequences that contribute to quantitative differences in expression of the petunia genes (rbcS) encoding the small subunit of ribulose bisphosphate carboxylase have been characterized. The promoter regions of the two most abundantly expressed petunia rbcS genes, SSU301 and SSU611, show sequence similarity not present in other rbcS genes. We investigated the significance of these and other sequences by adding specific regions from the SSU301 promoter (the most strongly expressed gene) to equivalent regions in the SSU911 promoter (the least strongly expressed gene) and assaying the expression of the fusions in transgenic tobacco plants. In this way, we characterized an SSU301 promoter region (either from -285 to -178 or -291 to -204) which, when added to SSU911, in either orientation, increased SSU911 expression 25-fold. This increase was equivalent to that caused by addition of the entire SSU301 5'-flanking region. Replacement of SSU911 promoter sequences between -198 and the start codon with sequences from the equivalent region of SSU301 did not increase SSU911 expression significantly. The -291 to -204 SSU301 promoter fragment contributes significantly to quantitative differences in expression between the petunia rbcS genes. PMID:2535543
Bes, M T; Hernández, J A; Peleato, M L; Fillat, M F
2001-01-15
A gene coding for a Fur (ferric uptake regulation) protein from the cyanobacterium Anabaena PCC 7119 has been cloned and overexpressed in Escherichia coli. DNA sequence analysis confirmed the presence of a 151-amino-acid open reading frame that showed homology with the Fur proteins reported for the unicellular cyanobacteria Synechococcus 7942 and Synechocystis PCC 6803. Two putative Fur-binding sites were detected in the promoter regions of the fur gene from Anabaena. Partially purified recombinant Fur binds to the flavodoxin promoter as well as its own promoter. This suggests that the Fur gene is autoregulated in Anabaena.
Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.
Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling
2015-06-19
Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.
DNA hypomethylation of individual sequences in aborted cloned bovine fetuses.
Chen, Tao; Jiang, Yan; Zhang, Yan-Ling; Liu, Jing-He; Hou, Yi; Schatten, Heide; Chen, Da-Yuan; Sun, Qing-Yuan
2005-09-01
Cloned bovines have a much higher abortion rate than those derived in vivo. Available evidence indicates that inappropriate epigenetic reprogramming of donor nuclei is the primary cause of cloning failure. To gain a better understanding of the DNA methylation changes associated with the high abortion rate of cloned bovines, we examined the DNA methylation status of a repeated sequence (satellite I) and the promoter regions of two single-copy genes (interleukin 3/cytokeratin) in aborted cloned fetuses, aborted fetuses derived from artificial insemination (AI), cloned adults and AI adults by bisulfite sequencing and restriction enzyme analysis. Two of four aborted cloned fetuses show very low methylation levels in the two single-copy gene promoter regions. One of the two fetuses also showed undermethylated status in the satellite I sequence. The other two aborted cloned fetuses have similar methylation levels to those of aborted AI fetuses. However, no difference in methylation was observed between cloned adults and AI adults. Our results demonstrate for the first time the undermethylated status of individual sequences in aborted cloned fetuses. These findings suggest that aberrant DNA methylation may contribute to the developmental failure of cloned bovine fetuses.
Li, Zheng; Wang, Shu; Gui, Xiao-Ling; Chang, Xiao-Bei; Gong, Zhen-Hui
2013-01-01
Mature pepper (Capsicum sp.) fruits come in a variety of colors, including red, orange, yellow, brown, and white. To better understand the genetic and regulatory relationships between the yellow fruit phenotype and the capsanthin-capsorubin synthase gene (Ccs), we examined 156 Capsicum varieties, most of which were collected from Northwest Chinese landraces. A new ccs variant was identified in the yellow fruit cultivar CK7. Cluster analysis revealed that CK7, which belongs to the C. annuum species, has low genetic similarity to other yellow C. annuum varieties. In the coding sequence of this ccs allele, we detected a premature stop codon derived from a C to G change, as well as a downstream frame-shift caused by a 1-bp nucleotide deletion. In addition, the expression of the gene was detected in mature CK7 fruit. Furthermore, the promoter sequences of Ccs from some pepper varieties were examined, and we detected a 176-bp tandem repeat sequence in the promoter region. In all C. annuum varieties examined in this study, the repeat number was three, compared with four in two C. chinense accessions. The sequence similarity ranged from 84.8% to 97.7% among the four types of repeats, and some putative cis-elements were also found in every repeat. This suggests that the transcriptional regulation of Ccs expression is complex. Based on the analysis of the novel C. annuum mutation reported here, along with the studies of three mutation types in yellow C. annuum and C. chinense accessions, we suggest that the mechanism leading to the production of yellow color fruit may be not as complex as that leading to orange fruit production.
Gui, Xiao-Ling; Chang, Xiao-Bei; Gong, Zhen-Hui
2013-01-01
Mature pepper (Capsicum sp.) fruits come in a variety of colors, including red, orange, yellow, brown, and white. To better understand the genetic and regulatory relationships between the yellow fruit phenotype and the capsanthin-capsorubin synthase gene (Ccs), we examined 156 Capsicum varieties, most of which were collected from Northwest Chinese landraces. A new ccs variant was identified in the yellow fruit cultivar CK7. Cluster analysis revealed that CK7, which belongs to the C. annuum species, has low genetic similarity to other yellow C. annuum varieties. In the coding sequence of this ccs allele, we detected a premature stop codon derived from a C to G change, as well as a downstream frame-shift caused by a 1-bp nucleotide deletion. In addition, the expression of the gene was detected in mature CK7 fruit. Furthermore, the promoter sequences of Ccs from some pepper varieties were examined, and we detected a 176-bp tandem repeat sequence in the promoter region. In all C. annuum varieties examined in this study, the repeat number was three, compared with four in two C. chinense accessions. The sequence similarity ranged from 84.8% to 97.7% among the four types of repeats, and some putative cis-elements were also found in every repeat. This suggests that the transcriptional regulation of Ccs expression is complex. Based on the analysis of the novel C. annuum mutation reported here, along with the studies of three mutation types in yellow C. annuum and C. chinense accessions, we suggest that the mechanism leading to the production of yellow color fruit may be not as complex as that leading to orange fruit production. PMID:23637942
A Predictive Model of the Oxygen and Heme Regulatory Network in Yeast
Kundaje, Anshul; Xin, Xiantong; Lan, Changgui; Lianoglou, Steve; Zhou, Mei; Zhang, Li; Leslie, Christina
2008-01-01
Deciphering gene regulatory mechanisms through the analysis of high-throughput expression data is a challenging computational problem. Previous computational studies have used large expression datasets in order to resolve fine patterns of coexpression, producing clusters or modules of potentially coregulated genes. These methods typically examine promoter sequence information, such as DNA motifs or transcription factor occupancy data, in a separate step after clustering. We needed an alternative and more integrative approach to study the oxygen regulatory network in Saccharomyces cerevisiae using a small dataset of perturbation experiments. Mechanisms of oxygen sensing and regulation underlie many physiological and pathological processes, and only a handful of oxygen regulators have been identified in previous studies. We used a new machine learning algorithm called MEDUSA to uncover detailed information about the oxygen regulatory network using genome-wide expression changes in response to perturbations in the levels of oxygen, heme, Hap1, and Co2+. MEDUSA integrates mRNA expression, promoter sequence, and ChIP-chip occupancy data to learn a model that accurately predicts the differential expression of target genes in held-out data. We used a novel margin-based score to extract significant condition-specific regulators and assemble a global map of the oxygen sensing and regulatory network. This network includes both known oxygen and heme regulators, such as Hap1, Mga2, Hap4, and Upc2, as well as many new candidate regulators. MEDUSA also identified many DNA motifs that are consistent with previous experimentally identified transcription factor binding sites. Because MEDUSA's regulatory program associates regulators to target genes through their promoter sequences, we directly tested the predicted regulators for OLE1, a gene specifically induced under hypoxia, by experimental analysis of the activity of its promoter. In each case, deletion of the candidate regulator resulted in the predicted effect on promoter activity, confirming that several novel regulators identified by MEDUSA are indeed involved in oxygen regulation. MEDUSA can reveal important information from a small dataset and generate testable hypotheses for further experimental analysis. Supplemental data are included. PMID:19008939
Li, S J; Cronan, J E
1993-01-01
Acetyl coenzyme A (CoA) carboxylase catalyzes the synthesis of malonyl-CoA, the first intermediate of fatty acid synthesis. The Escherichia coli enzyme is encoded by four subunits located at three different positions on the E. coli chromosome. The accBC genes lie in a small operon at min 72, whereas accA and accD are located at min 4.3 and 50, respectively. We examined the expression of the genes that encode the E. coli acetyl-CoA carboxylase subunits (accA, accBC, and accD) under a variety of growth conditions by quantitative Northern (RNA) blot analysis. We found a direct correlation between the levels of transcription of the acc genes and the rate of cellular growth. Consistent results were also obtained upon nutritional upshift and downshift experiments and upon dilution of stationary-phase cultures into fresh media. We also determined the 5' end of the accA and accD mRNAs by primer extension and did transcriptional fusion analysis of the previously reported accBC promoter. Several interesting features were found in the promoter regions of these genes, including a bent DNA sequence and an open reading frame within the unusually long leader mRNA of the accBC operon, potential stem-loop structures in the accA and accD mRNA leader regions, and a stretch of GC-rich sequences followed by AT-rich sequences common to all three promoters. In addition, both accA and accD are located in complex gene clusters. For example, the accA promoter was localized within the upstream polC gene (which encodes the DNA polymerase III catalytic subunit), suggesting that additional regulatory mechanisms exist. Images PMID:7678242
Seif, Elias; Niu, Meijuan; Kleiman, Lawrence
2013-01-01
The 5′ untranslated region (5′ UTR) of HIV-1 genomic RNA (gRNA) includes structural elements that regulate reverse transcription, transcription, translation, tRNALys3 annealing to the gRNA, and gRNA dimerization and packaging into viruses. It has been reported that gRNA dimerization and packaging are regulated by changes in the conformation of the 5′-UTR RNA. In this study, we show that annealing of tRNALys3 or a DNA oligomer complementary to sequences within the primer binding site (PBS) loop of the 5′ UTR enhances its dimerization in vitro. Structural analysis of the 5′-UTR RNA using selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) shows that the annealing promotes a conformational change of the 5′ UTR that has been previously reported to favor gRNA dimerization and packaging into virus. The model predicted by SHAPE analysis is supported by antisense experiments designed to test which annealed sequences will promote or inhibit gRNA dimerization. Based on reports showing that the gRNA dimerization favors its incorporation into viruses, we tested the ability of a mutant gRNA unable to anneal to tRNALys3 to be incorporated into virions. We found a ∼60% decrease in mutant gRNA packaging compared with wild-type gRNA. Together, these data further support a model for viral assembly in which the initial annealing of tRNALys3 to gRNA is cytoplasmic, which in turn aids in the promotion of gRNA dimerization and its incorporation into virions. PMID:23960173
DMINDA: an integrated web server for DNA motif identification and analyses
Ma, Qin; Zhang, Hanyuan; Mao, Xizeng; Zhou, Chuan; Liu, Bingqiang; Chen, Xin; Xu, Ying
2014-01-01
DMINDA (DNA motif identification and analyses) is an integrated web server for DNA motif identification and analyses, which is accessible at http://csbl.bmb.uga.edu/DMINDA/. This web site is freely available to all users and there is no login requirement. This server provides a suite of cis-regulatory motif analysis functions on DNA sequences, which are important to elucidation of the mechanisms of transcriptional regulation: (i) de novo motif finding for a given set of promoter sequences along with statistical scores for the predicted motifs derived based on information extracted from a control set, (ii) scanning motif instances of a query motif in provided genomic sequences, (iii) motif comparison and clustering of identified motifs, and (iv) co-occurrence analyses of query motifs in given promoter sequences. The server is powered by a backend computer cluster with over 150 computing nodes, and is particularly useful for motif prediction and analyses in prokaryotic genomes. We believe that DMINDA, as a new and comprehensive web server for cis-regulatory motif finding and analyses, will benefit the genomic research community in general and prokaryotic genome researchers in particular. PMID:24753419
2017-01-01
Tight and tunable control of gene expression is a highly desirable goal in synthetic biology for constructing predictable gene circuits and achieving preferred phenotypes. Elucidating the sequence–function relationship of promoters is crucial for manipulating gene expression at the transcriptional level, particularly for inducible systems dependent on transcriptional regulators. Sort-seq methods employing fluorescence-activated cell sorting (FACS) and high-throughput sequencing allow for the quantitative analysis of sequence–function relationships in a robust and rapid way. Here we utilized a massively parallel sort-seq approach to analyze the formaldehyde-inducible Escherichia coli promoter (Pfrm) with single-nucleotide resolution. A library of mutated formaldehyde-inducible promoters was cloned upstream of gfp on a plasmid. The library was partitioned into bins via FACS on the basis of green fluorescent protein (GFP) expression level, and mutated promoters falling into each expression bin were identified with high-throughput sequencing. The resulting analysis identified two 19 base pair repressor binding sites, one upstream of the −35 RNA polymerase (RNAP) binding site and one overlapping with the −10 site, and assessed the relative importance of each position and base therein. Key mutations were identified for tuning expression levels and were used to engineer formaldehyde-inducible promoters with predictable activities. Engineered variants demonstrated up to 14-fold lower basal expression, 13-fold higher induced expression, and a 3.6-fold stronger response as indicated by relative dynamic range. Finally, an engineered formaldehyde-inducible promoter was employed to drive the expression of heterologous methanol assimilation genes and achieved increased biomass levels on methanol, a non-native substrate of E. coli. PMID:28463494
Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.
Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E
2001-06-01
Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.
Gbadegesin, M A; Beeching, J R
2011-06-07
Cassava can be cultivated on impoverished soils with minimum inputs, and its storage roots are a staple food for millions in Africa. However, these roots are low in bioavailable nutrients and in protein content, contain cyanogenic glycosides, and suffer from a very short post-harvest shelf-life, and the plant is susceptible to viral and bacterial diseases prevalent in Africa. The demand for improvement of cassava with respect to these traits comes from both farmers and national agricultural institutions. Genetic improvement of cassava cultivars by molecular biology techniques requires the availability of appropriate genes, a system to introduce these genes into cassava, and the use of suitable gene promoters. Cassava root-specific promoter for auxin-repressed protein was isolated using the gene walking approach, starting with a cDNA sequence. In silico analysis of promoter sequences revealed putative cis-acting regulatory elements, including root-specific elements, which may be required for gene expression in vascular tissues. Research on the activities of this promoter is continuing, with the development of plant expression cassettes for transformation into major African elite lines and farmers' preferred cassava cultivars to enable testing of tissue-specific expression patterns in the field.
Liang, C L; Tsai, C N; Chung, P J; Chen, J L; Sun, C M; Chen, R H; Hong, J H; Chang, Y S
2000-11-10
In Epstein-Barr virus (EBV)-infected BL cells, the oncogenic EBV-encoded nuclear antigen 1 (EBNA 1) gene is directed from the latent promoter Qp. Yeast one-hybrid screen analysis using the -50 to -37 sequence of Qp as the bait was carried out to identify transcriptional factors that may control Qp activity. Results showed that Smad4 binds the -50 to -37 sequence of Qp, indicating that this promoter is potentially regulated by TGF-beta. The association of Smad4 with Qp was further confirmed by supershift of EMSA complexes using Smad4-specific antibody. The transfection of a Qp reporter construct in two EBV(+) BL cell lines, Rael and WW2, showed that Qp activity is repressed in response to the TGF-beta treatment. This repression involves the interaction of a Smad3/Smad4 complex and the transcriptional repressor TGIF, as determined by cotransfection assay and coimmunoprecipitation analysis. Results suggest that TGF-beta may transcriptionally repress Qp through the Smad4-binding site in human BL cells. Copyright 2000 Academic Press.
René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y
2000-01-04
In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.
Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice.
Wang, Rui; Zhu, Menglin; Ye, Rongjian; Liu, Zuoxiong; Zhou, Fei; Chen, Hao; Lin, Yongjun
2015-12-11
As an important part of synthetic biology, synthetic promoter has gradually become a hotspot in current biology. The purposes of the present study were to synthesize green tissue-specific promoters and to discover green tissue-specific cis-elements. We first assembled several regulatory sequences related to tissue-specific expression in different combinations, aiming to obtain novel green tissue-specific synthetic promoters. GUS assays of the transgenic plants indicated 5 synthetic promoters showed green tissue-specific expression patterns and different expression efficiencies in various tissues. Subsequently, we scanned and counted the cis-elements in different tissue-specific promoters based on the plant cis-elements database PLACE and the rice cDNA microarray database CREP for green tissue-specific cis-element discovery, resulting in 10 potential cis-elements. The flanking sequence of one potential core element (GEAT) was predicted by bioinformatics. Then, the combination of GEAT and its flanking sequence was functionally identified with synthetic promoter. GUS assays of the transgenic plants proved its green tissue-specificity. Furthermore, the function of GEAT flanking sequence was analyzed in detail with site-directed mutagenesis. Our study provides an example for the synthesis of rice tissue-specific promoters and develops a feasible method for screening and functional identification of tissue-specific cis-elements with their flanking sequences at the genome-wide level in rice.
Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J
1996-01-01
The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664
Genome Sequence of the Plant Growth Promoting Endophytic Bacterium Enterobacter sp. 638
Taghavi, Safiyh; van der Lelie, Daniel; Hoffman, Adam; Zhang, Yian-Biao; Walla, Michael D.; Vangronsveld, Jaco; Newman, Lee; Monchy, Sébastien
2010-01-01
Enterobacter sp. 638 is an endophytic plant growth promoting gamma-proteobacterium that was isolated from the stem of poplar (Populus trichocarpa×deltoides cv. H11-11), a potentially important biofuel feed stock plant. The Enterobacter sp. 638 genome sequence reveals the presence of a 4,518,712 bp chromosome and a 157,749 bp plasmid (pENT638-1). Genome annotation and comparative genomics allowed the identification of an extended set of genes specific to the plant niche adaptation of this bacterium. This includes genes that code for putative proteins involved in survival in the rhizosphere (to cope with oxidative stress or uptake of nutrients released by plant roots), root adhesion (pili, adhesion, hemagglutinin, cellulose biosynthesis), colonization/establishment inside the plant (chemiotaxis, flagella, cellobiose phosphorylase), plant protection against fungal and bacterial infections (siderophore production and synthesis of the antimicrobial compounds 4-hydroxybenzoate and 2-phenylethanol), and improved poplar growth and development through the production of the phytohormones indole acetic acid, acetoin, and 2,3-butanediol. Metabolite analysis confirmed by quantitative RT–PCR showed that, the production of acetoin and 2,3-butanediol is induced by the presence of sucrose in the growth medium. Interestingly, both the genetic determinants required for sucrose metabolism and the synthesis of acetoin and 2,3-butanediol are clustered on a genomic island. These findings point to a close interaction between Enterobacter sp. 638 and its poplar host, where the availability of sucrose, a major plant sugar, affects the synthesis of plant growth promoting phytohormones by the endophytic bacterium. The availability of the genome sequence, combined with metabolome and transcriptome analysis, will provide a better understanding of the synergistic interactions between poplar and its growth promoting endophyte Enterobacter sp. 638. This information can be further exploited to improve establishment and sustainable production of poplar as an energy feedstock on marginal, non-agricultural soils using endophytic bacteria as growth promoting agents. PMID:20485560
NASA Astrophysics Data System (ADS)
Liu, Wuxing; Wang, Qingling; Hou, Jinyu; Tu, Chen; Luo, Yongming; Christie, Peter
2016-05-01
This research undertook the systematic analysis of the Klebsiella sp. D5A genome and identification of genes that contribute to plant growth-promoting (PGP) traits, especially genes related to salt tolerance and wide pH adaptability. The genome sequence of isolate D5A was obtained using an Illumina HiSeq 2000 sequencing system with average coverages of 174.7× and 200.1× using the paired-end and mate-pair sequencing, respectively. Predicted and annotated gene sequences were analyzed for similarity with the Kyoto Encyclopedia of Genes and Genomes (KEGG) enzyme database followed by assignment of each gene into the KEGG pathway charts. The results show that the Klebsiella sp. D5A genome has a total of 5,540,009 bp with 57.15% G + C content. PGP conferring genes such as indole-3-acetic acid (IAA) biosynthesis, phosphate solubilization, siderophore production, acetoin and 2,3-butanediol synthesis, and N2 fixation were determined. Moreover, genes putatively responsible for resistance to high salinity including glycine-betaine synthesis, trehalose synthesis and a number of osmoregulation receptors and transport systems were also observed in the D5A genome together with numerous genes that contribute to pH homeostasis. These genes reveal the genetic adaptation of D5A to versatile environmental conditions and the effectiveness of the isolate to serve as a plant growth stimulator.
Mochida, Keiichi; Uehara-Yamaguchi, Yukiko; Takahashi, Fuminori; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo
2013-01-01
A comprehensive collection of full-length cDNAs is essential for correct structural gene annotation and functional analyses of genes. We constructed a mixed full-length cDNA library from 21 different tissues of Brachypodium distachyon Bd21, and obtained 78,163 high quality expressed sequence tags (ESTs) from both ends of ca. 40,000 clones (including 16,079 contigs). We updated gene structure annotations of Brachypodium genes based on full-length cDNA sequences in comparison with the latest publicly available annotations. About 10,000 non-redundant gene models were supported by full-length cDNAs; ca. 6,000 showed some transcription unit modifications. We also found ca. 580 novel gene models, including 362 newly identified in Bd21. Using the updated transcription start sites, we searched a total of 580 plant cis-motifs in the −3 kb promoter regions and determined a genome-wide Brachypodium promoter architecture. Furthermore, we integrated the Brachypodium full-length cDNAs and updated gene structures with available sequence resources in wheat and barley in a web-accessible database, the RIKEN Brachypodium FL cDNA database. The database represents a “one-stop” information resource for all genomic information in the Pooideae, facilitating functional analysis of genes in this model grass plant and seamless knowledge transfer to the Triticeae crops. PMID:24130698
CDinFusion – Submission-Ready, On-Line Integration of Sequence and Contextual Data
Hankeln, Wolfgang; Wendel, Norma Johanna; Gerken, Jan; Waldmann, Jost; Buttigieg, Pier Luigi; Kostadinov, Ivaylo; Kottmann, Renzo; Yilmaz, Pelin; Glöckner, Frank Oliver
2011-01-01
State of the art (DNA) sequencing methods applied in “Omics” studies grant insight into the ‘blueprints’ of organisms from all domains of life. Sequencing is carried out around the globe and the data is submitted to the public repositories of the International Nucleotide Sequence Database Collaboration. However, the context in which these studies are conducted often gets lost, because experimental data, as well as information about the environment are rarely submitted along with the sequence data. If these contextual or metadata are missing, key opportunities of comparison and analysis across studies and habitats are hampered or even impossible. To address this problem, the Genomic Standards Consortium (GSC) promotes checklists and standards to better describe our sequence data collection and to promote the capturing, exchange and integration of sequence data with contextual data. In a recent community effort the GSC has developed a series of recommendations for contextual data that should be submitted along with sequence data. To support the scientific community to significantly enhance the quality and quantity of contextual data in the public sequence data repositories, specialized software tools are needed. In this work we present CDinFusion, a web-based tool to integrate contextual and sequence data in (Multi)FASTA format prior to submission. The tool is open source and available under the Lesser GNU Public License 3. A public installation is hosted and maintained at the Max Planck Institute for Marine Microbiology at http://www.megx.net/cdinfusion. The tool may also be installed locally using the open source code available at http://code.google.com/p/cdinfusion. PMID:21935468
Zaide, Galia; Grosfeld, Haim; Ehrlich, Sharon; Zvi, Anat; Cohen, Ofer; Shafferman, Avigdor
2011-03-01
Two alternative promoter trap libraries, based on the green fluorescence protein (gfp) reporter and on the chloramphenicol acetyltransferase (cat) cassette, were constructed for isolation of potent Francisella tularensis promoters. Of the 26,000 F. tularensis strain LVS gfp library clones, only 3 exhibited visible fluorescence following UV illumination and all appeared to carry the bacterioferritin promoter (Pbfr). Out of a total of 2,000 chloramphenicol-resistant LVS clones isolated from the cat promoter library, we arbitrarily selected 40 for further analysis. Over 80% of these clones carry unique F. tularensis DNA sequences which appear to drive a wide range of protein expression, as determined by specific chloramphenicol acetyltransferase (CAT) Western dot blot and enzymatic assays. The DNA sequence information for the 33 unique and novel F. tularensis promoters reported here, along with the results of in silico and primer extension analyses, suggest that F. tularensis possesses classical Escherichia coli σ(70)-related promoter motifs. These motifs include the -10 (TATAAT) and -35 [TTGA(C/T)A] domains and an AT-rich region upstream from -35, reminiscent of but distinct from the E. coli upstream region that is termed the UP element. The most efficient promoter identified (Pbfr) appears to be about 10 times more potent than the F. tularensis groEL promoter and is probably among the strongest promoters in F. tularensis. The battery of promoters identified in this work will be useful, among other things, for genetic manipulation in the background of F. tularensis intended to gain better understanding of the mechanisms involved in pathogenesis and virulence, as well as for vaccine development studies.
Walker, Joseph F; Zanis, Michael J; Emery, Nancy C
2014-04-01
Complete chloroplast genome studies can help resolve relationships among large, complex plant lineages such as Asteraceae. We present the first whole plastome from the Madieae tribe and compare its sequence variation to other chloroplast genomes in Asteraceae. We used high throughput sequencing to obtain the Lasthenia burkei chloroplast genome. We compared sequence structure and rates of molecular evolution in the small single copy (SSC), large single copy (LSC), and inverted repeat (IR) regions to those for eight Asteraceae accessions and one Solanaceae accession. The chloroplast sequence of L. burkei is 150 746 bp and contains 81 unique protein coding genes and 4 coding ribosomal RNA sequences. We identified three major inversions in the L. burkei chloroplast, all of which have been found in other Asteraceae lineages, and a previously unreported inversion in Lactuca sativa. Regions flanking inversions contained tRNA sequences, but did not have particularly high G + C content. Substitution rates varied among the SSC, LSC, and IR regions, and rates of evolution within each region varied among species. Some observed differences in rates of molecular evolution may be explained by the relative proportion of coding to noncoding sequence within regions. Rates of molecular evolution vary substantially within and among chloroplast genomes, and major inversion events may be promoted by the presence of tRNAs. Collectively, these results provide insight into different mechanisms that may promote intramolecular recombination and the inversion of large genomic regions in the plastome.
See-Too, Wah Seng; Lim, Yan-Lue; Ee, Robson; Convey, Peter; Pearce, David A; Yin, Wai-Fong; Chan, Kok Gan
2016-03-20
Pseudomonas sp. strain L10.10 (=DSM 101070) is a psychrotolerant bacterium which was isolated from Lagoon Island, Antarctica. Analysis of its complete genome sequence indicates its possible role as a plant-growth promoting bacterium, including nitrogen-fixing ability and indole acetic acid (IAA)-producing trait, with additional suggestion of plant disease prevention attributes via hydrogen cyanide production. Copyright © 2016 Elsevier B.V. All rights reserved.
Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun
2016-09-21
With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our findings will be relevant in furthering the understanding of HIV-1 recombination mechanisms.
Bottacini, Francesca; Zomer, Aldert; Milani, Christian; Ferrario, Chiara; Lugli, Gabriele Andrea; Egan, Muireann; Ventura, Marco; van Sinderen, Douwe
2017-12-28
Bifidobacterium breve represents a common member of the infant gut microbiota and its presence in the gut has been associated with host well being. For this reason it is relevant to investigate and understand the molecular mechanisms underlying the establishment, persistence and activities of this gut commensal in the host environment. The assessment of vegetative promoters in the bifidobacterial prototype Bifidobacterium breve UCC2003 was performed employing a combination of RNA tiling array analysis and cDNA sequencing. Canonical -10 (TATAAT) and -35 (TTGACA) sequences were identified upstream of transcribed genes or operons, where deviations from this consensus correspond to transcription level variations. A Random Forest analysis assigned the -10 region of B. breve promoters as the element most impacting on the level of transcription, followed by the spacer length and the 5'-UTR length of transcripts. Furthermore, our transcriptome study also identified rho-independent termination as the most common and effective termination signal of highly and moderately transcribed operons in B. breve. The present study allowed us to identify genes and operons that are actively transcribed in this organism during logarithmic growth, and link promoter elements with levels of transcription of essential genes in this organism. As homologs of many of our identified genes are present across the whole genus Bifidobacterium, our dataset constitutes a transcriptomic reference to be used for future investigations of gene expression in members of this genus.
Khan, Abdur Rahim; Park, Gun-Seok; Asaf, Sajjad; Hong, Sung-Jun; Jung, Byung Kwon
2017-01-01
Serratia marcescens RSC-14 is a Gram-negative bacterium that was previously isolated from the surface-sterilized roots of the Cd-hyperaccumulator Solanum nigrum. The strain stimulates plant growth and alleviates Cd stress in host plants. To investigate the genetic basis for these traits, the complete genome of RSC-14 was obtained by single-molecule real-time sequencing. The genome of S. marcescens RSC-14 comprised a 5.12-Mbp-long circular chromosome containing 4,593 predicted protein-coding genes, 22 rRNA genes, 88 tRNA genes, and 41 pseudogenes. It contained genes with potential functions in plant growth promotion, including genes involved in indole-3-acetic acid (IAA) biosynthesis, acetoin synthesis, and phosphate solubilization. Moreover, annotation using NCBI and Rapid Annotation using Subsystem Technology identified several genes that encode antioxidant enzymes as well as genes involved in antioxidant production, supporting the observed resistance towards heavy metals, such as Cd. The presence of IAA pathway-related genes and oxidative stress-responsive enzyme genes may explain the plant growth-promoting potential and Cd tolerance, respectively. This is the first report of a complete genome sequence of Cd-tolerant S. marcescens and its plant growth promotion pathway. The whole-genome analysis of this strain clarified the genetic basis underlying its phenotypic and biochemical characteristics, underpinning the beneficial interactions between RSC-14 and plants. PMID:28187139
Metagenomics workflow analysis of endophytic bacteria from oil palm fruits
NASA Astrophysics Data System (ADS)
Tanjung, Z. A.; Aditama, R.; Sudania, W. M.; Utomo, C.; Liwang, T.
2017-05-01
Next-Generation Sequencing (NGS) has become a powerful sequencing tool for microbial study especially to lead the establishment of the field area of metagenomics. This study described a workflow to analyze metagenomics data of a Sequence Read Archive (SRA) file under accession ERP004286 deposited by University of Sao Paulo. It was a direct sequencing data generated by 454 pyrosequencing platform originated from oil palm fruits endophytic bacteria which were cultured using oil-palm enriched medium. This workflow used SortMeRNA to split ribosomal reads sequence, Newbler (GS Assembler and GS Mapper) to assemble and map reads into genome reference, BLAST package to identify and annotate contigs sequence, and QualiMap for statistical analysis. Eight bacterial species were identified in this study. Enterobacter cloacae was the most abundant species followed by Citrobacter koseri, Seratia marcescens, Latococcus lactis subsp. lactis, Klebsiella pneumoniae, Citrobacter amalonaticus, Achromobacter xylosoxidans, and Pseudomonas sp. respectively. All of these species have been reported as endophyte bacteria in various plant species and each has potential as plant growth promoting bacteria or another application in agricultural industries.
Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R
1988-01-01
We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343
Chen, Yawen; Shen, Xuemei; Peng, Huasong; Hu, Hongbo; Wang, Wei; Zhang, Xuehong
2015-01-01
Pseudomonas chlororaphis HT66, a plant growth-promoting rhizobacterium that produces phenazine-1-carboxamide with high yield, was compared with three genomic sequenced P. chlororaphis strains, GP72, 30–84 and O6. The genome sizes of four strains vary from 6.66 to 7.30 Mb. Comparisons of predicted coding sequences indicated 4833 conserved genes in 5869–6455 protein-encoding genes. Phylogenetic analysis showed that the four strains are closely related to each other. Its competitive colonization indicates that P. chlororaphis can adapt well to its environment. No virulence or virulence-related factor was found in P. chlororaphis. All of the four strains could synthesize antimicrobial metabolites including different phenazines and insecticidal protein FitD. Some genes related to the regulation of phenazine biosynthesis were detected among the four strains. It was shown that P. chlororaphis is a safe PGPR in agricultural application and could also be used to produce some phenazine antibiotics with high-yield. PMID:26484173
Analysis of MSH3 in endometrial cancers with defective DNA mismatch repair.
Swisher, E M; Mutch, D G; Herzog, T J; Rader, J S; Kowalski, L D; Elbendary, A; Goodfellow, P J
1998-01-01
To clarify the origin of defective mismatch repair (MMR) in sporadic endometrial cancers with microsatellite instability (MSI), a thorough mutation analysis was performed on the human mismatch repair gene MSH3. Twenty-eight MSI-positive endometrial cancers were investigated for mutations in the human mismatch repair gene MSH3 using single-strand conformation variant (SSCV) analysis of all 24 exons. All variants were sequenced. Loss of heterozygosity was investigated at all MSH3 polymorphisms discovered. A subset of tumors were investigated for methylation of the 5' promoter region of MSH3 using Southern blot hybridization. An identical single-base deletion (delta A) predicted to result in a truncated proteins was discovered in six tumors (21.4%). This deletion occurs in a string of eight consecutive adenosine residues (A8). Because simple repeat sequences are unstable in cells with defective MMR, the observed mutation may be an effect, rather than a cause, of MSI. Evidence of inactivation of the second MSH3 allele in tumors with the delta A mutation would strongly support a causal role for these MSH3 mutations. However, there was no evidence of a second mutation, loss of sequences, or methylation of the promoter region in any of the tumors with the delta A mutation. Although the delta A mutation is a frequent event in sporadic MSI-positive endometrial cancers, it may not be causally associated with defective DNA MMR.
Caboche, Ségolène; Audebert, Christophe; Hot, David
2014-01-01
The recent progresses of high-throughput sequencing (HTS) technologies enable easy and cost-reduced access to whole genome sequencing (WGS) or re-sequencing. HTS associated with adapted, automatic and fast bioinformatics solutions for sequencing applications promises an accurate and timely identification and characterization of pathogenic agents. Many studies have demonstrated that data obtained from HTS analysis have allowed genome-based diagnosis, which has been consistent with phenotypic observations. These proofs of concept are probably the first steps toward the future of clinical microbiology. From concept to routine use, many parameters need to be considered to promote HTS as a powerful tool to help physicians and clinicians in microbiological investigations. This review highlights the milestones to be completed toward this purpose. PMID:25437800
de Vries, G E; Arfman, N; Terpstra, P; Dijkhuizen, L
1992-01-01
The gene (mdh) coding for methanol dehydrogenase (MDH) of thermotolerant, methylotroph Bacillus methanolicus C1 has been cloned and sequenced. The deduced amino acid sequence of the mdh gene exhibited similarity to those of five other alcohol dehydrogenase (type III) enzymes, which are distinct from the long-chain zinc-containing (type I) or short-chain zinc-lacking (type II) enzymes. Highly efficient expression of the mdh gene in Escherichia coli was probably driven from its own promoter sequence. After purification of MDH from E. coli, the kinetic and biochemical properties of the enzyme were investigated. The physiological effect of MDH synthesis in E. coli and the role of conserved sequence patterns in type III alcohol dehydrogenases have been analyzed and are discussed. Images PMID:1644761
Borisenko, A S; Kotus, E V; Kaloshin, A A
2008-01-01
Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.
Ding, Xiang; Zhu, Hongqing; Hou, Yiling; Hou, Wanru; Zhang, Nan; Fu, Lei
2017-01-01
The mechanism of the immunoregulatory activities of polysaccharide is still not clear. Here, we performed the B-cell, T-cell, and macrophage cell proliferation, the cell cycle analysis of macrophage cells, sequenced the transcriptomes of control group macrophages, and Boletus speciosus Frost polysaccharide (BSF-1) group macrophages using Illumina sequencing technology to identify differentially expressed genes (DEGs) to determine the molecular mechanisms of immunomodulatory activity of BSF-1 in macrophages. These results suggested that BSF-1 could promote the proliferation of B-cell, T-cell, and macrophages, promote the proliferation of macrophage cells by abolishing cell cycle arrests in the G0/G1 phases, and promote cell cycle progression in S-phase and G2/M phase, which might induce cell division. A total of 12,498,414 and 11,840,624 bp paired-end reads were obtained for the control group and BSF-1 group, respectively, and they corresponded to a total size of 12.5 G bp and 11.8 G bp, respectively, after the low-quality reads and adapter sequences were removed. Approximately 81.83% of the total number of genes (8,257) were expressed reads per kilobase per million mapped reads (RPKM ≥1) and more than 1366 genes were highly expressed (RPKM >60) in the BSF-1 group. A gene ontology-enrichment analysis generated 13,042 assignments to cellular components, 13,094 assignments to biological processes, and 13,135 assignments to molecular functions. A Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that the mitogen-activated protein kinase (MAPK) signaling pathways are significantly enriched for DEGs between the two cell groups. An analysis of transcriptome resources enabled us to examine gene expression profiles, verify differential gene expression, and select candidate signaling pathways as the mechanisms of the immunomodulatory activity of BSF-1. Based on the experimental data, we believe that the significant antitumor activities of BSF-1 in vivo mainly involve the MAPK signaling pathways. Boletus speciosus Frost-1 (BSF-1) could promote the proliferation of B-cell, T-cell, and macrophages, promote the proliferation of macrophage cells by abolishing cell cycle arrests in the G0/G1 phases, and promote cell cycle progression in S-phase and G2/M phase, which might induce cell divisionApproximately 81.83% of the total number of genes (8257) were expressed (reads per kilobase per million mapped reads [RPKM] =1) and more than 1366 genes were highly expressed (RPKM >60) in the BSF-1 groupA gene ontology-enrichment analysis generated 13,042 assignments to cellular components, 13,094 assignments to biological processes, and 13,135 assignments to molecular functionsA Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that the mitogen-activated protein kinase signaling pathways are significantly enriched for DEGs between the two cell groups. Abbreviations used: BSF-1: Boletus speciosus Frost polysaccharide.
Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.
2012-01-01
IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919
Reading biological processes from nucleotide sequences
NASA Astrophysics Data System (ADS)
Murugan, Anand
Cellular processes have traditionally been investigated by techniques of imaging and biochemical analysis of the molecules involved. The recent rapid progress in our ability to manipulate and read nucleic acid sequences gives us direct access to the genetic information that directs and constrains biological processes. While sequence data is being used widely to investigate genotype-phenotype relationships and population structure, here we use sequencing to understand biophysical mechanisms. We present work on two different systems. First, in chapter 2, we characterize the stochastic genetic editing mechanism that produces diverse T-cell receptors in the human immune system. We do this by inferring statistical distributions of the underlying biochemical events that generate T-cell receptor coding sequences from the statistics of the observed sequences. This inferred model quantitatively describes the potential repertoire of T-cell receptors that can be produced by an individual, providing insight into its potential diversity and the probability of generation of any specific T-cell receptor. Then in chapter 3, we present work on understanding the functioning of regulatory DNA sequences in both prokaryotes and eukaryotes. Here we use experiments that measure the transcriptional activity of large libraries of mutagenized promoters and enhancers and infer models of the sequence-function relationship from this data. For the bacterial promoter, we infer a physically motivated 'thermodynamic' model of the interaction of DNA-binding proteins and RNA polymerase determining the transcription rate of the downstream gene. For the eukaryotic enhancers, we infer heuristic models of the sequence-function relationship and use these models to find synthetic enhancer sequences that optimize inducibility of expression. Both projects demonstrate the utility of sequence information in conjunction with sophisticated statistical inference techniques for dissecting underlying biophysical mechanisms.
MicroRNA-21 promotes proliferation of rat hepatocyte BRL-3A by targeting FASLG.
Li, J J; Chan, W H; Leung, W Y; Wang, Y; Xu, C S
2015-04-27
Rat liver regeneration (RLR) induced by partial hepatectomy involves cell proliferation regulated by numerous factors, including microRNAs (miRNAs). miRNA high-throughput sequencing has been established and used to analyze miRNA expression profiles. This study showed that 39 miRNAs were related to RLR through the analysis of miRNA high-throughput sequencing. Their role toward rat normal hepatocyte line BRL-3A was studied by gain- and loss-of-function analyses, and one of them, microRNA-21 (miR-21), obviously upregulated and promoted BRL-3A cell proliferation. Using bioinformatics to search for miR-21 targets revealed that Fas ligand (FASLG) is one of miR-21's target genes. A dual-luciferase report assay and Western blot assay showed that miR-21 directly targeted the 3'-untranslated region of FASLG and inhibited the expression of FASLG, which suggests that miR-21 promoted BRL-3A cell proliferation by reducing FASLG expression.
The Ars insulator facilitates I-SceI meganuclease-mediated transgenesis in the sea urchin embryo.
Ochiai, Hiroshi; Sakamoto, Naoaki; Suzuki, Kenichi; Akasaka, Koji; Yamamoto, Takashi
2008-09-01
For the efficient generation of transgenic sea urchins, we have adopted an I-SceI meganuclease-mediated transgenesis method. Several types of promoter-GFP gene constructs flanked by two I-SceI recognition sequences were co-injected with I-SceI into sea urchin fertilized eggs. Using cell-lineage-specific promoter constructs, the frequency of transgene expression was elevated, and their level of mozaicism was reduced. The addition of the Ars insulator sequence, which is known to block the enhancer activity and protect transgenes from position effects, led to a reduction in ectopic transgene expression and an elevation of transgene expression frequency in this I-SceI-mediated system. However, the magnitude of the effects of the Ars insulator was dependent upon the promoter constructs. QPCR analysis also showed that the Ars insulator increases the transgene copy number. These results suggest that the I-SceI-mediated method using the Ars insulator is advantageous for transgenesis in the sea urchin embryo.
Ancient DNA sequence revealed by error-correcting codes.
Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo
2015-07-10
A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.
Ancient DNA sequence revealed by error-correcting codes
Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo
2015-01-01
A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228
Kohno, K; Yasuzawa, K; Hirose, M; Kano, Y; Goshima, N; Tanaka, H; Imamoto, F
1994-06-01
The molecular mechanism of autoregulation of expression of the hupA gene in Escherichia coli was examined. The promoter of the gene contains a palindromic sequence with the potential to form a cruciform DNA structure in which the -35 sequence lies at the base of the stem and the -10 sequence forms a single-stranded loop. An artificial promoter lacking the palindrome, which was constructed by replacing a 10 nucleotide repeat for the predicted cruciform arm by a sequence in the opposite orientation, was not subject to HU-repression. DNA relaxation induced by deleting HU proteins and/or inhibiting DNA gyrase in cells results in increased expression from the hupA promoter. We propose that initiation of transcription of the hupA gene is negatively regulated by steric hindrance of the functional promoter domains for formation of the cruciform configuration, which is facilitated at least in part by negative supercoiling of the hupA promoter DNA region. The promoter region of the hupB gene also contains a palindromic sequence that can assume a cruciform configuration. Negative regulation of this gene by HU proteins may occur by a mechanism similar to that operating for the hupA gene.
Guimond, Julie; Devost, Dominic; Brodeur, Helene; Mader, Sylvie; Bhat, Pangala V
2002-12-12
Retinal dehydrogenase type 1 (RALDH1) catalyzes the oxidation of retinal to retinoic acid (RA), a metabolite of vitamin A important for embryogenesis and tissue differentiation. Rat RALDH1 is expressed to high levels in developing kidney, and in stomach, intestine epithelia. To understand the mechanisms of the transcriptional regulation of rat RALDH1, we cloned a 1360-base pair (bp) 5'-flanking region of RALDH1 gene. Using luciferase reporter constructs transfected into HEK 293 and LLCPK (kidney-derived) cells, basal promoter activity was associated with sequences between -80 and +43. In this minimal promoter region, TATA and CCAAT cis-acting elements as well as SP1, AP1 and octamer (Oct)-binding sites were present. The CCAAT box and Oct-binding site, located between positions -72 and -68 and -56 and -49, respectively, were shown by deletion analysis and site-directed mutation to be critical for promoter activity. Nuclear extracts from kidney cells contain proteins specifically binding the Oct and CCAAT sequences, resulting in the formation of six complexes, while different patterns of complexes were observed with non-kidney cell extracts. Gel shift assays using either single or double mutations of the Oct and CCAAT sequences as well as super shift assays demonstrated single and double occupancy of these two sites by Oct-1 and CBF-A. In addition, unidentified proteins also bound the Oct motif specifically in the absence of CBF-A binding. These results demonstrate specific involvement of Oct and CCAAT-binding proteins in the regulation of RALDH1 gene.
Analysis of CHRNA7 rare variants in autism spectrum disorder susceptibility.
Bacchelli, Elena; Battaglia, Agatino; Cameli, Cinzia; Lomartire, Silvia; Tancredi, Raffaella; Thomson, Susanne; Sutcliffe, James S; Maestrini, Elena
2015-04-01
Chromosome 15q13.3 recurrent microdeletions are causally associated with a wide range of phenotypes, including autism spectrum disorder (ASD), seizures, intellectual disability, and other psychiatric conditions. Whether the reciprocal microduplication is pathogenic is less certain. CHRNA7, encoding for the alpha7 subunit of the neuronal nicotinic acetylcholine receptor, is considered the likely culprit gene in mediating neurological phenotypes in 15q13.3 deletion cases. To assess if CHRNA7 rare variants confer risk to ASD, we performed copy number variant analysis and Sanger sequencing of the CHRNA7 coding sequence in a sample of 135 ASD cases. Sequence variation in this gene remains largely unexplored, given the existence of a fusion gene, CHRFAM7A, which includes a nearly identical partial duplication of CHRNA7. Hence, attempts to sequence coding exons must distinguish between CHRNA7 and CHRFAM7A, making next-generation sequencing approaches unreliable for this purpose. A CHRNA7 microduplication was detected in a patient with autism and moderate cognitive impairment; while no rare damaging variants were identified in the coding region, we detected rare variants in the promoter region, previously described to functionally reduce transcription. This study represents the first sequence variant analysis of CHRNA7 in a sample of idiopathic autism. © 2015 Wiley Periodicals, Inc.
Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C
1996-03-01
Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.
Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L
2015-11-01
Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. Copyright © 2015 by the Genetics Society of America.
Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R.; McQueen, Philip G.; Yang, Andrew X.; Mizuguchi, Takeshi; Grewal, Shiv I. S.; Levin, Henry L.
2015-01-01
Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and −9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. PMID:26358720
Enhancer activity of Helitron in sericin-1 gene promoter from Bombyx mori.
Huang, Ke; Li, Chun-Feng; Wu, Jie; Wei, Jun-Hong; Zou, Yong; Han, Min-Jin; Zhou, Ze-Yang
2016-06-01
Sericin is a kind of water-soluble protein expressed specifically in the middle silk gland of Bombyx mori. When the sericin-1 gene promoter was cloned and a transgenic vector was constructed to express a foreign protein, a specific Helitron, Bmhel-8, was identified in the sericin-1 gene promoter sequence in some genotypes of Bombyx mori and Bombyx mandarina. Given that the Bmhel-8 Helitron transposon was present only in some genotypes, it could be the source of allelic variation in the sericin-1 promoter. The length of the sericin-1 promoter sequence is approximately 1063 or 643 bp. The larger size of the sequence or allele is ascribed to the presence of Bmhel-8. Silkworm genotypes can be homozygous for either the shorter or larger promoter sequence or heterozygous, containing both alleles. Bmhel-8 in the sericin-1 promoter exhibits enhancer activity, as demonstrated by a dual-luciferase reporter system in BmE cell lines. Furthermore, Bmhel-8 displays enhancer activity in a sericin-1 promoter-driven gene expression system but does not regulate the tissue-specific expression of sericin-1. © 2016 Institute of Zoology, Chinese Academy of Sciences.
A promoter recognition mechanism common to yeast mitochondrial and phage t7 RNA polymerases.
Nayak, Dhananjaya; Guo, Qing; Sousa, Rui
2009-05-15
Yeast mitochondrial (YMt) and phage T7 RNA polymerases (RNAPs) are two divergent representatives of a large family of single subunit RNAPs that are also found in the mitochondria and chloroplasts of higher eukaryotes, mammalian nuclei, and many other bacteriophage. YMt and phage T7 promoters differ greatly in sequence and length, and the YMt RNAP uses an accessory factor for initiation, whereas T7 RNAP does not. We obtain evidence here that, despite these apparent differences, both the YMt and T7 RNAPs utilize a similar promoter recognition loop to bind their respective promoters. Mutations in this element in YMt RNAP specifically disrupt mitochondrial promoter utilization, and experiments with site-specifically tethered chemical nucleases indicate that this element binds the mitochondrial promoter almost identically to how the promoter recognition loop from the phage RNAP binds its promoter. Sequence comparisons reveal that the other members of the single subunit RNAP family display loops of variable sequence and size at a position corresponding to the YMt and T7 RNAP promoter recognition loops. We speculate that these elements may be involved in promoter recognition in most or all of these enzymes and that this element's structure allows it to accommodate significant sequence and length variation to provide a mechanism for rapid evolution of new promoter specificities in this RNAP family.
White, Eleanor; Kamieniarz-Gdula, Kinga; Dye, Michael J.; Proudfoot, Nick J.
2013-01-01
RNA Polymerase II (Pol II) termination is dependent on RNA processing signals as well as specific terminator elements located downstream of the poly(A) site. One of the two major terminator classes described so far is the Co-Transcriptional Cleavage (CoTC) element. We show that homopolymer A/T tracts within the human β-globin CoTC-mediated terminator element play a critical role in Pol II termination. These short A/T tracts, dispersed within seemingly random sequences, are strong terminator elements, and bioinformatics analysis confirms the presence of such sequences in 70% of the putative terminator regions (PTRs) genome-wide. PMID:23258704
Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.
Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R
1984-01-11
We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.
Varicella Zoster Virus Promoter Sequences
1994-01-01
Fragments from each of the recombinant plasmids were excised to determine the optimal sequences used for promoter function. The ExonucleaseIII/ Mung ...activation o f these two herpesvirus l ate promoters by vzv is str i kingly similar . 4 . Definition of the functional promo ter for the early/late ILl
Fukuzawa, M; Williams, J G
2000-06-01
The cudA gene encodes a nuclear protein that is essential for normal multicellular development. At the slug stage cudA is expressed in the prespore cells and in a sub-region of the prestalk zone. We show that cap site distal promoter sequences direct cudA expression in prespore cells, while proximal sequences direct expression in the prestalk sub-region. The promoter domain that directs prespore-specific transcription consists of a positively acting region, that has the potential to direct expression in all cells within the slug, and a negatively acting region that prevents expression in the prestalk cells. Dd-STATa is the STAT protein that regulates commitment to stalk cell gene expression, where it is known to function as a transcriptional repressor. We show that Dd-STATa binds in vitro to the positively acting part of the prespore domain of the cudA promoter. However, Dd-STATa cannot be utilised for this purpose in vivo, because analysis of a Dd-STATa null mutant strain shows that Dd-STATa is not necessary for cudA transcription in prespore cells. In contrast, the part of the cudA promoter that directs prestalk-specific expression contains a binding site for Dd-STATa that is essential for its biological activity. Dd-STATa appears therefore to serve as a direct activator of cudA transcription in prestalk cells, while a protein with a DNA binding specificity highly related to that of Dd-STATa is utilised to activate cudA transcription in prespore cells.
Man, Michal; Epel, Bernard L
2004-06-01
A replicon based on Tobacco mosaic virus that was engineered to express the open reading frame (ORF) of the green fluorescent protein (GFP) gene in place of the native coat protein (CP) gene from a minimal CP subgenomic (sg) RNA promoter was found to accumulate very low levels of GFP. Regulatory regions within the CP ORF were identified that, when presented as untranslated regions flanking the GFP ORF, enhanced or inhibited sg transcription and GFP expression. Full GFP expression from the CP sgRNA promoter required more than the first 20 nt of the CP ORF but not beyond the first 56 nt. Further analysis indicated the presence of an enhancer element between nt +25 and +55 with respect to the CP translation start site. The inclusion of this enhancer sequence upstream of the GFP ORF led to elevated sg transcription and to a 50-fold increase in GFP accumulation in comparison with a minimal CP promoter in which the entire CP ORF was displaced by the GFP ORF. Inclusion of the 3'-terminal 22 nt had a minor positive effect on GFP accumulation, but the addition of extended untranslated sequences from the 3' terminus of the CP ORF downstream of the GFP ORF was basically found to inhibit sg transcription. Secondary structure analysis programs predicted the CP sgRNA promoter to reside within two stable stem-loop structures, which are followed by an enhancer region.
Tn5401, a new class II transposable element from Bacillus thuringiensis.
Baum, J A
1994-01-01
A new class II (Tn3-like) transposable element, designated Tn5401, was recovered from a sporulation-deficient variant of Bacillus thuringiensis subsp. morrisoni EG2158 following its insertion into a recombinant plasmid. Sequence analysis of the insert revealed a 4,837-bp transposon with two large open reading frames, in the same orientation, encoding proteins of 36 kDa (306 residues) and 116 kDa (1,005 residues) and 53-bp terminal inverted repeats. The deduced amino acid sequence for the 36-kDa protein shows 24% sequence identity with the TnpI recombinase of the B. thuringiensis transposon Tn4430, a member of the phage integrase family of site-specific recombinases. The deduced amino acid sequence for the 116-kDa protein shows 42% sequence identity with the transposase of Tn3 but only 28% identity with the TnpA transposase of Tn4430. Two small open reading frames of unknown function, designated orf1 (85 residues) and orf2 (74 residues), were also identified. Southern blot analysis indicated that Tn5401, in contrast to Tn4430, is not commonly found among different subspecies of B. thuringiensis and is not typically associated with known insecticidal crystal protein genes. Transposition was studied with B. thuringiensis by using plasmid pEG922, a temperature-sensitive shuttle vector containing Tn5401. Tn5401 transposed to both chromosomal and plasmid target sites but displayed an apparent preference for plasmid sites. Transposition was replicative and resulted in the generation of a 5-bp duplication at the target site. Transcriptional start sites within Tn5401 were mapped by primer extension analysis. Two promoters, designated PL and PR, direct the transcription of orf1-orf2 and tnpI-tnpA, respectively, and are negatively regulated by TnpI. Sequence comparison of the promoter regions of Tn5401 and Tn4430 suggests that the conserved sequence element ATGTCCRCTAAY mediates TnpI binding and cointegrate resolution. The same element is contained within the 53-bp terminal inverted repeats, thus accounting for their unusual lengths and suggesting an additional role for TnpI in regulating Tn5401 transposition. Images PMID:7514590
Nguyen, Thong T; Suryamohan, Kushal; Kuriakose, Boney; Janakiraman, Vasantharajan; Reichelt, Mike; Chaudhuri, Subhra; Guillory, Joseph; Divakaran, Neethu; Rabins, P E; Goel, Ridhi; Deka, Bhabesh; Sarkar, Suman; Ekka, Preety; Tsai, Yu-Chih; Vargas, Derek; Santhosh, Sam; Mohan, Sangeetha; Chin, Chen-Shan; Korlach, Jonas; Thomas, George; Babu, Azariah; Seshagiri, Somasekar
2018-06-12
We sequenced the Hyposidra talaca NPV (HytaNPV) double stranded circular DNA genome using PacBio single molecule sequencing technology. We found that the HytaNPV genome is 139,089 bp long with a GC content of 39.6%. It encodes 141 open reading frames (ORFs) including the 37 baculovirus core genes, 25 genes conserved among lepidopteran baculoviruses, 72 genes known in baculovirus, and 7 genes unique to the HytaNPV genome. It is a group II alphabaculovirus that codes for the F protein and lacks the gp64 gene found in group I alphabaculovirus viruses. Using RNA-seq, we confirmed the expression of the ORFs identified in the HytaNPV genome. Phylogenetic analysis showed HytaNPV to be closest to BusuNPV, SujuNPV and EcobNPV that infect other tea pests, Buzura suppressaria, Sucra jujuba, and Ectropis oblique, respectively. We identified repeat elements and a conserved non-coding baculovirus element in the genome. Analysis of the putative promoter sequences identified motif consistent with the temporal expression of the genes observed in the RNA-seq data.
Qin, Jin-Hong; Zhang, Qing; Zhang, Zhi-Ming; Zhong, Yi; Yang, Yang; Hu, Bao-Yu; Zhao, Guo-Ping; Guo, Xiao-Kui
2008-06-01
DNA microarray analysis was used to compare the differential gene expression profiles between Leptospira interrogans serovar Lai type strain 56601 and its corresponding attenuated strain IPAV. A 22-kb genomic island covering a cluster of 34 genes (i.e., genes LA0186 to LA0219) was actively expressed in both strains but concomitantly upregulated in strain 56601 in contrast to that of IPAV. Reverse transcription-PCR assays proved that the gene cluster comprised five transcripts. Gene annotation of this cluster revealed characteristics of a putative prophage-like remnant with at least 8 of 34 sequences encoding prophage-like proteins, of which the LA0195 protein is probably a putative prophage CI-like regulator. The transcription initiation activities of putative promoter-regulatory sequences of transcripts I, II, and III, all proximal to the LA0195 gene, were further analyzed in the Escherichia coli promoter probe vector pKK232-8 by assaying the reporter chloramphenicol acetyltransferase (CAT) activities. The strong promoter activities of both transcripts I and II indicated by the E. coli CAT assay were well correlated with the in vitro sequence-specific binding of the recombinant LA0195 protein to the corresponding promoter probes detected by the electrophoresis mobility shift assay. On the other hand, the promoter activity of transcript III was very low in E. coli and failed to show active binding to the LA0195 protein in vitro. These results suggested that the LA0195 protein is likely involved in the transcription of transcripts I and II. However, the identical complete DNA sequences of this prophage remnant from these two strains strongly suggests that possible regulatory factors or signal transduction systems residing outside of this region within the genome may be responsible for the differential expression profiling in these two strains.
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
Chan, Yvonne H.; Venev, Sergey V.; Zeldovich, Konstantin B.; Matthews, C. Robert
2017-01-01
Sequence divergence of orthologous proteins enables adaptation to environmental stresses and promotes evolution of novel functions. Limits on evolution imposed by constraints on sequence and structure were explored using a model TIM barrel protein, indole-3-glycerol phosphate synthase (IGPS). Fitness effects of point mutations in three phylogenetically divergent IGPS proteins during adaptation to temperature stress were probed by auxotrophic complementation of yeast with prokaryotic, thermophilic IGPS. Analysis of beneficial mutations pointed to an unexpected, long-range allosteric pathway towards the active site of the protein. Significant correlations between the fitness landscapes of distant orthologues implicate both sequence and structure as primary forces in defining the TIM barrel fitness landscape and suggest that fitness landscapes can be translocated in sequence space. Exploration of fitness landscapes in the context of a protein fold provides a strategy for elucidating the sequence-structure-fitness relationships in other common motifs. PMID:28262665
Variable responses of two VlMYBA gene promoters to ABA and ACC in Kyoho grape berries.
Zhai, Xiawan; Zhang, Yushu; Kai, Wenbin; Liang, Bin; Jiang, Li; Du, Yangwei; Wang, Juan; Sun, Yufei; Leng, Ping
2017-04-01
The VlMYBA subfamily of transcription factors has been known to be the functional regulators in anthocyanin biosynthesis in red grapes. In this study, the expressions of the VlMYBA1-2 and VlMYBA 2 genes, and the responses of the VlMYBA1-2/2 promoters to ABA and ACC treatments in Kyoho grape berries are examined through quantitative real-time PCR analysis and the transient expression assay. The results show that the expressions of VlMYBA1-2/2 increase dramatically after véraison and reach their highest levels when the berries are nearly fully ripe. Exogenous ABA promotes the expressions of VlMYBA1-2/2, whereas the ACC treatment increases the expression of VlMYBA2, however, it has no effect on VlMYBA1-2. The ABA treatment has a faster and stronger effect on berry pigmentation than ACC does. The VlMYBA1-2 promoter sequence contains two ABA response elements (ABRE) but no ethylene response element (ERE), whereas the VlMYBA2 promoter sequence contains two ABRE and one ERE in the upstream region of the start codon. The VlMYBA2 promoter can be activated by both ABA (more effective) and ACC, whereas the VlMYBA1-2 promoter can be activated by ABA only. In sum, ABA can promote the coloring of Kyoho grape by the promotion of VlMYBA1-2/2 transcriptions via activating the response of their promoters to ABA, whereas ethylene only regulates VlMYBA2 through the response activation of its promoter to ACC which partially enhances the coloring. Copyright © 2017 Elsevier GmbH. All rights reserved.
Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R
1994-05-01
Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.
Lam, Kathy N; Charles, Trevor C
2015-01-01
Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.
Isolation and characterization of an Arabidopsis biotin carboxylase gene and its promoter.
Bao, X; Shorrosh, B S; Ohlrogge, J B
1997-11-01
In the plastids of most plants, acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) is a multisubunit complex consisting of biotin carboxylase (BC), biotin-carboxyl carrier protien (BCCP), and carboxytransferase (alpha-CT, beta-CT) subunits. To better understand the regulation of this enzyme, we have isolated and sequenced a BC genomic clone from Arabidopsis and partially characterized its promoter. Fifteen introns were identified. The deduced amino acid sequence of the mature BC protein is highly conserved between Arabidopsis and tobacco (92.6% identity). BC expression was evaluated using northern blots and BC/GUS fusion constructs in transgenic Arabidopsis. GUS activity in the BC/GUS transgenics as well as transcript level of the native gene were both found to be higher in silique and flower than in root and leaf. Analysis of tobacco suspension cells transformed with truncated BC promoter/GUS gene fusions indicated the region from -140 to +147 contained necessary promoter elements which supported basal gene expression. A positive regulatory region was found to be located between -2100 and -140, whereas a negative element was possibly located in the first intron. In addition, several conserved regulatory elements were identified in the BC promoter. Surprisingly, although BC is a low-abundance protein, the expression of BC/GUS fusion constructs was similar to 35S/GUS constructs.
Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.
Lo, W Y; Ting, L P
1994-01-01
Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237
Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A
2002-01-01
κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628
Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica
Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.
2006-01-01
The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115
DMINDA: an integrated web server for DNA motif identification and analyses.
Ma, Qin; Zhang, Hanyuan; Mao, Xizeng; Zhou, Chuan; Liu, Bingqiang; Chen, Xin; Xu, Ying
2014-07-01
DMINDA (DNA motif identification and analyses) is an integrated web server for DNA motif identification and analyses, which is accessible at http://csbl.bmb.uga.edu/DMINDA/. This web site is freely available to all users and there is no login requirement. This server provides a suite of cis-regulatory motif analysis functions on DNA sequences, which are important to elucidation of the mechanisms of transcriptional regulation: (i) de novo motif finding for a given set of promoter sequences along with statistical scores for the predicted motifs derived based on information extracted from a control set, (ii) scanning motif instances of a query motif in provided genomic sequences, (iii) motif comparison and clustering of identified motifs, and (iv) co-occurrence analyses of query motifs in given promoter sequences. The server is powered by a backend computer cluster with over 150 computing nodes, and is particularly useful for motif prediction and analyses in prokaryotic genomes. We believe that DMINDA, as a new and comprehensive web server for cis-regulatory motif finding and analyses, will benefit the genomic research community in general and prokaryotic genome researchers in particular. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gruber, Andreas R
2014-07-10
RNA Polymerase III is a highly specialized enzyme complex responsible for the transcription of a very distinct set of housekeeping noncoding RNAs including tRNAs, 7SK snRNA, Y RNAs, U6 snRNA, and the RNA components of RNaseP and RNaseMRP. In this work we have utilized the conserved promoter structure of known RNA Polymerase III transcripts consisting of characteristic sequence elements termed proximal sequence elements (PSE) A and B and a TATA-box to uncover a novel RNA Polymerase III-transcribed, noncoding RNA family found to be conserved in Caenorhabditis as well as other clade V nematode species. Homology search in combination with detailed sequence and secondary structure analysis revealed that members of this novel ncRNA family evolve rapidly, and only maintain a potentially functional small stem structure that links the 5' end to the very 3' end of the transcript and a small hairpin structure at the 3' end. This is most likely required for efficient transcription termination. In addition, our study revealed evidence that canonical C/D box snoRNAs are also transcribed from a PSE A-PSE B-TATA-box promoter in Caenorhabditis elegans. Copyright © 2014 Elsevier B.V. All rights reserved.
Rangannan, Vetriselvi; Bansal, Manju
2009-12-01
The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool PromPredict. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.
Effects of the HN gene c-terminal extensions on the Newcastle disease virus virulence
USDA-ARS?s Scientific Manuscript database
The hemagglutinin-neuraminidase (HN) of Newcastle disease virus (NDV) is a multifunctional protein that has receptor recognition, neuraminidase and fusion promotion activities. Sequence analysis revealed that the HN gene of many extremely low virulence NDV strains encodes a larger open reading frame...
Identification of the likely translational start of Mycobacterium tuberculosis GyrB.
Karkare, Shantanu; Brown, Amanda C; Parish, Tanya; Maxwell, Anthony
2013-07-15
Bacterial DNA gyrase is a validated target for antibacterial chemotherapy. It consists of two subunits, GyrA and GyrB, which form an A₂B₂ complex in the active enzyme. Sequence alignment of Mycobacterium tuberculosis GyrB with other bacterial GyrBs predicts the presence of 40 potential additional amino acids at the GyrB N-terminus. There are discrepancies between the M. tuberculosis GyrB sequences retrieved from different databases, including sequences annotated with or without the additional 40 amino acids. This has resulted in differences in the GyrB sequence numbering that has led to the reporting of previously known fluoroquinolone-resistance mutations as novel mutations. We have expressed M. tuberculosis GyrB with and without the extra 40 amino acids in Escherichia coli and shown that both can be produced as soluble, active proteins. Supercoiling and other assays of the two proteins show no differences, suggesting that the additional 40 amino acids have no effect on the enzyme in vitro. RT-PCR analysis of M. tuberculosis mRNA shows that transcripts that could yield both the longer and shorter protein are present. However, promoter analysis showed that only the promoter elements leading to the shorter GyrB (lacking the additional 40 amino acids) had significant activity. We conclude that the most probable translational start codon for M. tuberculosis GyrB is GTG (Val) which results in translation of a protein of 674 amino acids (74 kDa).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bell-Lelong, D.A.; Cusumano, J.C.; Meyer, K.
1997-03-01
Cinnamate-r-hydroxylase (C4H) is the first Cyt P450-dependent monooxygenase of the phenylpropanoid pathway. To study the expression of this gene in Arabidopsis thaliana, a C4H cDNA clone from the Arabidopsis expressed sequence tag database was identified and used to isolate its corresponding genomic clone. The entire C4H coding sequence plus 2.9 kb of its promoter were isolated on a 5.4-kb HindIII fragment of this cosmid. Inspection of the promoter sequence revealed the presence of a number of putative regulatory motifs previously identified in the promoters of other phenylpropanoid pathway genes. The expression of C4H was analyzed by RNA blot hybridization analysismore » and in transgenic Arabidopsis carrying a C4H-{beta}-glucuronidase transcriptional fusion. C4H message accumulation was light-dependent, but was detectable even in dark-grown seedlings. Consistent with these data, C4H mRNA was accumulated to light-grown levels in etiolated det1-1 mutant seedlings. C4H is widely expressed in various Arabidopsis tissues, particularly in roots and cells undergoing lignification. The C4H-driven {beta}-glucuronidase expression accurately reflected the tissue-specificity and wound-inducibility of the C4H promoter indicated by RNA blot hybridization analysis. A modest increase in C4H expression was observed in the tt8 mutant of Arabidopsis. 77 refs., 5 figs.« less
Casimiro, Ana C; Vinga, Susana; Freitas, Ana T; Oliveira, Arlindo L
2008-02-07
Motif finding algorithms have developed in their ability to use computationally efficient methods to detect patterns in biological sequences. However the posterior classification of the output still suffers from some limitations, which makes it difficult to assess the biological significance of the motifs found. Previous work has highlighted the existence of positional bias of motifs in the DNA sequences, which might indicate not only that the pattern is important, but also provide hints of the positions where these patterns occur preferentially. We propose to integrate position uniformity tests and over-representation tests to improve the accuracy of the classification of motifs. Using artificial data, we have compared three different statistical tests (Chi-Square, Kolmogorov-Smirnov and a Chi-Square bootstrap) to assess whether a given motif occurs uniformly in the promoter region of a gene. Using the test that performed better in this dataset, we proceeded to study the positional distribution of several well known cis-regulatory elements, in the promoter sequences of different organisms (S. cerevisiae, H. sapiens, D. melanogaster, E. coli and several Dicotyledons plants). The results show that position conservation is relevant for the transcriptional machinery. We conclude that many biologically relevant motifs appear heterogeneously distributed in the promoter region of genes, and therefore, that non-uniformity is a good indicator of biological relevance and can be used to complement over-representation tests commonly used. In this article we present the results obtained for the S. cerevisiae data sets.
Lin, Hao; Deng, En-Ze; Ding, Hui; Chen, Wei; Chou, Kuo-Chen
2014-01-01
The σ54 promoters are unique in prokaryotic genome and responsible for transcripting carbon and nitrogen-related genes. With the avalanche of genome sequences generated in the postgenomic age, it is highly desired to develop automated methods for rapidly and effectively identifying the σ54 promoters. Here, a predictor called ‘iPro54-PseKNC’ was developed. In the predictor, the samples of DNA sequences were formulated by a novel feature vector called ‘pseudo k-tuple nucleotide composition’, which was further optimized by the incremental feature selection procedure. The performance of iPro54-PseKNC was examined by the rigorous jackknife cross-validation tests on a stringent benchmark data set. As a user-friendly web-server, iPro54-PseKNC is freely accessible at http://lin.uestc.edu.cn/server/iPro54-PseKNC. For the convenience of the vast majority of experimental scientists, a step-by-step protocol guide was provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics that were presented in this paper just for its integrity. Meanwhile, we also discovered through an in-depth statistical analysis that the distribution of distances between the transcription start sites and the translation initiation sites were governed by the gamma distribution, which may provide a fundamental physical principle for studying the σ54 promoters. PMID:25361964
Wiśniewska, A; Dąbrowska-Bronk, J; Szafrański, K; Fudali, S; Święcicka, M; Czarny, M; Wilkowska, A; Morgiewicz, K; Matusiak, J; Sobczak, M; Filipecki, M
2013-06-01
The potato cyst nematode (Globodera rostochiensis) induces feeding sites (syncytia) in tomato and potato roots. In a previous study, 135 tomato genes up-regulated during G. rostochiensis migration and syncytium development were identified. Five genes (CYP97A29, DFR, FLS, NIK and PMEI) were chosen for further study to examine their roles in plant-nematode interactions. The promoters of these genes were isolated and potential cis regulatory elements in their sequences were characterized using bioinformatics tools. Promoter fusions with the β-glucuronidase gene were constructed and introduced into tomato and potato genomes via transformation with Agrobacterium rhizogenes to produce hairy roots. The analysed promoters displayed different activity patterns in nematode-infected and uninfected transgenic hairy roots.
Identification of distal silencing elements in the murine interferon-A11 gene promoter.
Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G
1996-08-01
The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.
Vílchez, Juan Ignacio; Tang, Qiming; Kaushal, Richa; Wang, Wei; Lv, Suhui; He, Danxia; Chu, Zhaoqing; Zhang, Heng; Liu, Renyi; Zhang, Huiming
2018-06-21
Here, we report the complete genome sequence for Bacillus megaterium strain YC4-R4, a highly salt-tolerant rhizobacterium that promotes growth in plants. The sequencing process was performed by combining pyrosequencing and single-molecule sequencing techniques. The complete genome is estimated to be approximately 5.44 Mb, containing a total of 5,673 predicted protein-coding DNA sequences (CDSs). Copyright © 2018 Vílchez et al.
Chen, Huan; Je, Jihyun; Song, Chieun; Hwang, Jung Eun; Lim, Chae Oh
2012-09-01
The dehydration-responsive element-binding factor 2C (DREB2C) is a member of the CBF/DREB subfamily of proteins, which contains a single APETALA2/Ethylene responsive element-binding factor (AP2/ERF) domain. To identify the expression pattern of the DREB2C gene, which contains multiple transcription cis-regulatory elements in its promoter, an approximately 1.4 kb upstream DREB2C sequence was fused to the β-glucuronidase reporter gene (GUS) and the recombinant p1244 construct was transformed into Arabidopsis thaliana (L.) Heynh. The promoter of the gene directed prominent GUS activity in the vasculature in diverse young dividing tissues. Upon applying heat stress (HS), GUS staining was also enhanced in the vasculature of the growing tissues. Analysis of a series of 5'-deletions of the DREB2C promoter revealed that a proximal upstream sequence sufficient for the tissue-specific spatial and temporal induction of GUS expression by HS is localized in the promoter region between -204 and -34 bps relative to the transcriptional start site. Furthermore, electrophoretic mobility shift assay (EMSA) demonstrated that nuclear protein binding activities specific to a -120 to -32 bp promoter fragment increased after HS. These results indicate that the TATA-proximal region and some latent trans-acting factors may cooperate in HS-induced activation of the Arabidopsis DREB2C promoter. © 2012 Institute of Botany, Chinese Academy of Sciences.
Liao, Ai-Jun; Su, Qi; Wang, Xun; Zeng, Bin; Shi, Wei
2008-01-01
AIM: To isolate and analyze the DNA sequences which are methylated differentially between gastric cancer and normal gastric mucosa. METHODS: The differentially methylated DNA sequences between gastric cancer and normal gastric mucosa were isolated by methylation-sensitive representational difference analysis (MS-RDA). Similarities between the separated fragments and the human genomic DNA were analyzed with Basic Local Alignment Search Tool (BLAST). RESULTS: Three differentially methylated DNA sequences were obtained, two of which have been accepted by GenBank. The accession numbers are AY887106 and AY887107. AY887107 was highly similar to the 11th exon of LOC440683 (98%), 3’ end of LOC440887 (99%), and promoter and exon regions of DRD5 (94%). AY887106 was consistent (98%) with a CpG island in ribosomal RNA isolated from colorectal cancer by Minoru Toyota in 1999. CONCLUSION: The methylation degree is different between gastric cancer and normal gastric mucosa. The differentially methylated DNA sequences can be isolated effectively by MS-RDA. PMID:18322944
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.
Uniform, optimal signal processing of mapped deep-sequencing data.
Kumar, Vibhor; Muratani, Masafumi; Rayan, Nirmala Arul; Kraus, Petra; Lufkin, Thomas; Ng, Huck Hui; Prabhakar, Shyam
2013-07-01
Despite their apparent diversity, many problems in the analysis of high-throughput sequencing data are merely special cases of two general problems, signal detection and signal estimation. Here we adapt formally optimal solutions from signal processing theory to analyze signals of DNA sequence reads mapped to a genome. We describe DFilter, a detection algorithm that identifies regulatory features in ChIP-seq, DNase-seq and FAIRE-seq data more accurately than assay-specific algorithms. We also describe EFilter, an estimation algorithm that accurately predicts mRNA levels from as few as 1-2 histone profiles (R ∼0.9). Notably, the presence of regulatory motifs in promoters correlates more with histone modifications than with mRNA levels, suggesting that histone profiles are more predictive of cis-regulatory mechanisms. We show by applying DFilter and EFilter to embryonic forebrain ChIP-seq data that regulatory protein identification and functional annotation are feasible despite tissue heterogeneity. The mathematical formalism underlying our tools facilitates integrative analysis of data from virtually any sequencing-based functional profile.
Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M
2015-12-01
Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.
NASA Astrophysics Data System (ADS)
Kikuchi, Shoshi
2009-02-01
Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.
Quaglino, Fabio; Kube, Michael; Jawhari, Maan; Abou-Jawdah, Yusuf; Siewert, Christin; Choueiri, Elia; Sobh, Hana; Casati, Paola; Tedeschi, Rosemarie; Lova, Marina Molino; Alma, Alberto; Bianco, Piero Attilio
2015-07-30
Almond witches'-broom (AlmWB), a devastating disease of almond, peach and nectarine in Lebanon, is associated with 'Candidatus Phytoplasma phoenicium'. In the present study, we generated a draft genome sequence of 'Ca. P. phoenicium' strain SA213, representative of phytoplasma strain populations from different host plants, and determined the genetic diversity among phytoplasma strain populations by phylogenetic analyses of 16S rRNA, groEL, tufB and inmp gene sequences. Sequence-based typing and phylogenetic analysis of the gene inmp, coding an integral membrane protein, distinguished AlmWB-associated phytoplasma strains originating from diverse host plants, whereas their 16S rRNA, tufB and groEL genes shared 100 % sequence identity. Moreover, dN/dS analysis indicated positive selection acting on inmp gene. Additionally, the analysis of 'Ca. P. phoenicium' draft genome revealed the presence of integral membrane proteins and effector-like proteins and potential candidates for interaction with hosts. One of the integral membrane proteins was predicted as BI-1, an inhibitor of apoptosis-promoting Bax factor. Bioinformatics analyses revealed the presence of putative BI-1 in draft and complete genomes of other 'Ca. Phytoplasma' species. The genetic diversity within 'Ca. P. phoenicium' strain populations in Lebanon suggested that AlmWB disease could be associated with phytoplasma strains derived from the adaptation of an original strain to diverse hosts. Moreover, the identification of a putative inhibitor of apoptosis-promoting Bax factor (BI-1) in 'Ca. P. phoenicium' draft genome and within genomes of other 'Ca. Phytoplasma' species suggested its potential role as a phytoplasma fitness-increasing factor by modification of the host-defense response.
Tenebrio molitor antifreeze protein gene identification and regulation.
Qin, Wensheng; Walker, Virginia K
2006-02-15
The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.
Molecular cloning and characterization of the promoter region of the porcine apolipoprotein E gene.
Xia, Jihan; Hu, Bingjun; Mu, Yulian; Xin, Leilei; Yang, Shulin; Li, Kui
2014-05-01
Apolipoprotein E (APOE), a component of lipoproteins plays an important role in the transport and metabolism of cholesterol, and is associated with hyperlipoproteinemia and Alzheimer's disease. In order to further understand the characterization of APOE gene, the promoter of APOE gene of Landrace pigs was analyzed in the present study. The genomic structure and amino acid sequence in pigs were analyzed and found to share high similarity in those of human but low similarity in promoter region. Real-time PCR revealed the APOE gene expression pattern of pigs in diverse tissues. The highest expression level was observed in liver, relatively low expression in other tissues, especially in stomach and muscle. Furthermore, the promoter expressing in Hepa 1-6 was significantly better at driving luciferase expression compared with C2C12 cell. After analysis of porcine APOE gene promoter regions, potential transcription factor binding sites were predicted and two GC signals, a TATA box were indicated. Results of promoter activity analysis indicated that one of potential regulatory elements was located in the region -669 to -259, which was essential for a high expression of the APOE gene. Promoter mutation and deletion analysis further suggested that the C/EBPA binding site within the APOE promoter was responsible for the regulation of APOE transcription. Electrophoretic mobility shift assays also showed the binding site of the transcription factor C/EBPA. This study advances our knowledge of the promoter of the porcine APOE gene.
Santos, Efrén; Remy, Serge; Thiry, Els; Windelinckx, Saskia; Swennen, Rony; Sági, László
2009-06-24
Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+) gene and low temperature-responsive luciferase activation was monitored in real time. Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26 degrees C followed by a gradual decrease to 8 degrees C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate promoters even in a multicopy T-DNA line. Qualitative and quantitative GUS expression analyses of one tagged promoter in a commercial cultivar demonstrated a reproducible promoter activity pattern during in vitro culture. Thus, this promoter could be used during in vitro selection and generation of commercial transgenic plants.
Monteiro, Rose A; Souza, Emanuel M; Geoffrey Yates, M; Steffens, M Berenice R; Pedrosa, Fábio O; Chubatsu, Leda S
2003-02-01
The Herbaspirillum seropedicae NifA protein is responsible for nif gene expression. The C-terminal domain of the H. seropedicae NifA protein, fused to a His-Tag sequence (His-Tag-C-terminal), was over-expressed and purified by metal-affinity chromatography to yield a highly purified and active protein. Band-shift assays showed that the NifA His-Tag-C-terminal bound specifically to the H. seropedicae nifB promoter region in vitro. In vivo analysis showed that this protein inhibited the Central + C-terminal domains of NifA protein from activating the nifH promoter of K. pneumoniae in Escherichia coli, indicating that the protein must be bound to the NifA-binding site (UAS site) at the nifH promoter region to activate transcription. Copyright 2002 Elsevier Science (USA)
ElemeNT: a computational tool for detecting core promoter elements.
Sloutskin, Anna; Danino, Yehuda M; Orenstein, Yaron; Zehavi, Yonathan; Doniger, Tirza; Shamir, Ron; Juven-Gershon, Tamar
2015-01-01
Core promoter elements play a pivotal role in the transcriptional output, yet they are often detected manually within sequences of interest. Here, we present 2 contributions to the detection and curation of core promoter elements within given sequences. First, the Elements Navigation Tool (ElemeNT) is a user-friendly web-based, interactive tool for prediction and display of putative core promoter elements and their biologically-relevant combinations. Second, the CORE database summarizes ElemeNT-predicted core promoter elements near CAGE and RNA-seq-defined Drosophila melanogaster transcription start sites (TSSs). ElemeNT's predictions are based on biologically-functional core promoter elements, and can be used to infer core promoter compositions. ElemeNT does not assume prior knowledge of the actual TSS position, and can therefore assist in annotation of any given sequence. These resources, freely accessible at http://lifefaculty.biu.ac.il/gershon-tamar/index.php/resources, facilitate the identification of core promoter elements as active contributors to gene expression.
Altet, Laura; Francino, Olga; Solano-Gallego, Laia; Renier, Corinne; Sánchez, Armand
2002-01-01
The NRAMP1 gene (Slc11a1) encodes an ion transporter protein involved in the control of intraphagosomal replication of parasites and in macrophage activation. It has been described in mice as the determinant of natural resistance or susceptibility to infection with antigenically unrelated pathogens, including Leishmania. Our aims were to sequence and map the canine Slc11a1 gene and to identify mutations that may be associated with resistance or susceptibility to Leishmania infection. The canine Slc11a1 gene has been mapped to dog chromosome CFA37 and covers 9 kb, including a 700-bp promoter region, 15 exons, and a polymorphic microsatellite in intron 1. It encodes a 547-amino-acid protein that has over 87% identity with the Slc11a1 proteins of different mammalian species. A case-control study with 33 resistant and 84 susceptible dogs showed an association between allele 145 of the microsatellite and susceptible dogs. Sequence variant analysis was performed by direct sequencing of the cDNA and the promoter region of four unrelated beagles experimentally infected with Leishmania infantum to search for possible functional mutations. Two of the dogs were classified as susceptible and the other two were classified as resistant based on their immune responses. Two important mutations were found in susceptible dogs: a G-rich region in the promoter that was common to both animals and a complete deletion of exon 11, which encodes the consensus transport motif of the protein, in the unique susceptible dog that needed an additional and prolonged treatment to avoid continuous relapses. A study with a larger dog population would be required to prove the association of these sequence variants with disease susceptibility. PMID:12010961
Status of duckweed genomics and transcriptomics.
Wang, W; Messing, J
2015-01-01
Duckweeds belong to the smallest flowering plants that undergo fast vegetative growth in an aquatic environment. They are commonly used in wastewater treatment and animal feed. Whereas duckweeds have been studied at the biochemical level, their reduced morphology and wide environmental adaption had not been subjected to molecular analysis until recently. Here, we review the progress that has been made in using a DNA barcode system and the sequences of chloroplast and mitochondrial genomes to identify duckweed species at the species or population level. We also review analysis of the nuclear genome sequence of Spirodela that provides new insights into fundamental biological questions. Indeed, reduced gene families and missing genes are consistent with its compact morphogenesis, aquatic floating and suppression of juvenile-to-adult transition. Furthermore, deep RNA sequencing of Spirodela at the onset of dormancy and Landoltia in exposure of nutrient deficiency illustrate the molecular network for environmental adaption and stress response, constituting major progress towards a post-genome sequencing phase, where further functional genomic details can be explored. Rapid advances in sequencing technologies could continue to promote a proliferation of genome sequences for additional ecotypes as well as for other duckweed species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
Single-Cell Sequencing for Precise Cancer Research: Progress and Prospects.
Zhang, Xiaoyan; Marjani, Sadie L; Hu, Zhaoyang; Weissman, Sherman M; Pan, Xinghua; Wu, Shixiu
2016-03-15
Advances in genomic technology have enabled the faithful detection and measurement of mutations and the gene expression profile of cancer cells at the single-cell level. Recently, several single-cell sequencing methods have been developed that permit the comprehensive and precise analysis of the cancer-cell genome, transcriptome, and epigenome. The use of these methods to analyze cancer cells has led to a series of unanticipated discoveries, such as the high heterogeneity and stochastic changes in cancer-cell populations, the new driver mutations and the complicated clonal evolution mechanisms, and the novel identification of biomarkers of variant tumors. These methods and the knowledge gained from their utilization could potentially improve the early detection and monitoring of rare cancer cells, such as circulating tumor cells and disseminated tumor cells, and promote the development of personalized and highly precise cancer therapy. Here, we discuss the current methods for single cancer-cell sequencing, with a strong focus on those practically used or potentially valuable in cancer research, including single-cell isolation, whole genome and transcriptome amplification, epigenome profiling, multi-dimensional sequencing, and next-generation sequencing and analysis. We also examine the current applications, challenges, and prospects of single cancer-cell sequencing. ©2016 American Association for Cancer Research.
Malachowa, Natalia; Kohler, Petra L; Schlievert, Patrick M; Chuang, Olivia N; Dunny, Gary M; Kobayashi, Scott D; Miedzobrodzki, Jacek; Bohach, Gregory A; Seo, Keun Seok
2011-01-01
Staphylococcus aureus is a prominent human pathogen and a leading cause of community- and hospital-acquired bacterial infections worldwide. Herein, we describe the identification and characterization of the S. aureus 67.6-kDa hypothetical protein, named for the surface factor promoting resistance to oxidative killing (SOK) in this study. Sequence analysis showed that the SOK gene is conserved in all sequenced S. aureus strains and homologous to the myosin cross-reactive antigen of Streptococcus pyogenes. Immunoblotting and immunofluorescence analysis showed that SOK was copurified with membrane fractions and was exposed on the surface of S. aureus Newman and RN4220. Comparative analysis of wild-type S. aureus and an isogenic deletion strain indicated that SOK contributes to both resistance to killing by human neutrophils and to oxidative stress. In addition, the S. aureus sok deletion strain showed dramatically reduced aortic valve vegetation and bacterial cell number in a rabbit endocarditis model. These results, plus the suspected role of the streptococcal homologue in certain diseases such as acute rheumatic fever, suggest that SOK plays an important role in cardiovascular and other staphylococcal infections.
Cloning and functional analysis of 5'-upstream region of the Pokemon gene.
Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang
2008-04-01
Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.
Kathiravan, P; Goyal, S; Kataria, R S; Mishra, B P; Jayakumar, S; Joshi, B K
2011-01-01
The present study was undertaken to characterize the structure of S100A8 gene and its promoter in water buffalo and yak. Sequence data of 2.067 kb, 2.071 kb, and 2.052 kb with respect to complete S100A8 gene including 5' flanking region was generated in river buffalo, swamp buffalo, and yak, respectively. BLAST analysis of coding DNA sequences (CDS) of S100A8 gene revealed 95% homology of buffalo sequence with cattle, 85% with pig and horse, 83% with dog, 72-73% with murines, and around 79% with primates and humans. Phylogenetic analysis of predicted CDS revealed distinct clustering of murines, primates, and domestic animals with bovines and bubalines forming a subcluster among farm animals. In silico translation of predicted CDS revealed a sequence of 89 amino acids with 7 amino acid changes between cattle and buffalo and 2 changes between cattle and yak. The search for Pfam family revealed the N-terminal calcium binding domain and the noncanonical EF hand domain in the carboxy terminus, with more variations being observed in the N-terminal domain among different species. Two amino acid changes observed in carboxy terminal EF hand domain resulted in altered secondary structure of yak S100A8 protein. Analysis of S100A8 gene promoter revealed 14 putative motifs for transcriptional factor binding sites. Two putative motifs viz. C/EBP and v-Myb were found to be absent in swamp buffalo as compared to river buffalo and cattle. Differences in the structure of S100A8 protein and the transcriptional factor binding sites identified in the present study need to be analyzed further for their functional significance in yak and swamp buffalo respectively. Copyright © Taylor & Francis Group, LLC
Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.
de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J
2002-09-01
The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.
Sakuma, Keiichiro; Sasaki, Eiichi; Kimura, Kenya; Komori, Koji; Shimizu, Yasuhiro; Yatabe, Yasushi; Aoki, Masahiro
2018-06-05
HNRNPLL (heterogeneous nuclear ribonucleoprotein L-like), an RNA-binding protein that regulates alternative splicing of pre-mRNAs, has been shown to regulate differentiation of lymphocytes, as well as metastasis of colorectal cancer cells. Here we show that HNRNPLL promotes cell cycle progression and hence proliferation of colorectal cancer cells. Functional annotation analysis of those genes whose expression levels were changed by three-fold or more in RNA sequencing analysis between SW480 cells overexpressing HNRNPLL and those knocked down for HNRNPLL revealed enrichment of DNA replication-related genes by HNRNPLL overexpression. Among 13 genes detected in the DNA replication pathway, PCNA, RFC3, and FEN1 showed reproducible upregulation by HNRNPLL overexpression both at mRNA and protein levels in SW480 and HT29 cells. Importantly, knockdown of any of these genes alone suppressed the proliferation promoting effect induced by HNRNPLL overexpression. RNA-immunoprecipitation assay presented a binding of FLAG-tagged HNRNPLL to mRNA of these genes, and HNRNPLL overexpression significantly suppressed the downregulation of these genes during 12 hours of actinomycin D treatment, suggesting a role of HNRNPLL in mRNA stability. Finally, analysis of a public RNA sequencing dataset of clinical samples suggested a link between overexpression of HNRNPLL and that of PCNA, RFC3, and FEN1. This link was further supported by immunohistochemistry of colorectal cancer clinical samples, whereas expression of CDKN1A, which is known to inhibit the cooperative function of PCNA, RFC3, and FEN1, was negatively associated with HNRNPLL expression. These results indicate that HNRNPLL stabilizes mRNAs encoding regulators of DNA replication and promotes colorectal cancer cell proliferation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Shrestha, Ankita; Khan, Ahamed; Mishra, Dipti Ranjan; Bhuyan, Kashyap; Sahoo, Bhabani; Maiti, Indu B; Dey, Nrisingha
2018-02-01
Caulimoviral promoters have become excellent tools for efficient transgene expression in plants. However, the transcriptional framework controlling their systematic regulation is poorly understood. To understand this regulatory mechanism, we extensively studied a novel caulimoviral promoter, PV8 (-163 to +138, 301 bp), isolated from Petunia vein-clearing virus (PVCV). PVCV was found to be Salicylic acid (SA)-inducible and 2.5-3.0 times stronger than the widely used CaMV35S promoter. In silico analysis of the PV8 sequence revealed a unique clustering of two stress-responsive cis-elements, namely, as-1 1 and W-box 1-2 , located within a span of 31 bp (-74 to -47) that bound to the TGA1a and WRKY71 plant transcription factors (TFs), respectively. We found that as-1 (TTACG) and W-box (TGAC) elements occupied both TGA1a and WRKY71 on the PV8 backbone. Mutational studies demonstrated that the combinatorial influence of as-1 (-57) and W-box 1-2 (-74 and -47) on the PV8 promoter sequence largely modulated its activity. TGA1a and WRKY71 physically interacted and cooperatively enhanced the transcriptional activity of the PV8 promoter. Biotic stress stimuli induced PV8 promoter activity by ~1.5 times. We also established the possible pathogen-elicitor function of AtWRKY71 and NtabWRKY71 TFs. Altogether, this study elucidates the interplay between TFs, biotic stress and caulimoviral promoter function. Copyright © 2018 Elsevier B.V. All rights reserved.
DNA-Demethylase Regulated Genes Show Methylation-Independent Spatiotemporal Expression Patterns
Schumann, Ulrike; Lee, Joanne; Kazan, Kemal; Ayliffe, Michael; Wang, Ming-Bo
2017-01-01
Recent research has indicated that a subset of defense-related genes is downregulated in the Arabidopsis DNA demethylase triple mutant rdd (ros1 dml2 dml3) resulting in increased susceptibility to the fungal pathogen Fusarium oxysporum. In rdd plants these downregulated genes contain hypermethylated transposable element sequences (TE) in their promoters, suggesting that this methylation represses gene expression in the mutant and that these sequences are actively demethylated in wild-type plants to maintain gene expression. In this study, the tissue-specific and pathogen-inducible expression patterns of rdd-downregulated genes were investigated and the individual role of ROS1, DML2, and DML3 demethylases in these spatiotemporal regulation patterns was determined. Large differences in defense gene expression were observed between pathogen-infected and uninfected tissues and between root and shoot tissues in both WT and rdd plants, however, only subtle changes in promoter TE methylation patterns occurred. Therefore, while TE hypermethylation caused decreased gene expression in rdd plants it did not dramatically effect spatiotemporal gene regulation, suggesting that this latter regulation is largely methylation independent. Analysis of ros1-3, dml2-1, and dml3-1 single gene mutant lines showed that promoter TE hypermethylation and defense-related gene repression was predominantly, but not exclusively, due to loss of ROS1 activity. These data demonstrate that DNA demethylation of TE sequences, largely by ROS1, promotes defense-related gene expression but does not control spatiotemporal expression in Arabidopsis. Summary: Ros1-mediated DNA demethylation of promoter transposable elements is essential for activation of defense-related gene expression in response to fungal infection in Arabidopsis thaliana. PMID:28894455
Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.
Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian
2018-03-12
ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.
Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter
Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian
2018-01-01
ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529
Bowen, J K; Templeton, M D; Sharrock, K R; Crowhurst, R N; Rikkerink, E H
1995-01-20
The feasibility of performing routine transformation-mediated mutagenesis in Glomerella cingulata was analysed by adopting three one-step gene disruption strategies targeted at the pectin lyase gene pnlA. The efficiencies of disruption following transformation with gene replacement- or gene truncation-disruption vectors were compared. To effect replacement-disruption, G. cingulata was transformed with a vector carrying DNA from the pnlA locus in which the majority of the coding sequence had been replaced by the gene for hygromycin B resistance. Two of the five transformants investigated contained an inactivated pnlA gene (pnlA-); both also contained ectopically integrated vector sequences. The efficacy of gene disruption by transformation with two gene truncation-disruption vectors was also assessed. Both vectors carried at 5' and 3' truncated copy of the pnlA coding sequence, adjacent to the gene for hygromycin B resistance. The promoter sequences controlling the selectable marker differed in the two vectors. In one vector the homologous G. cingulata gpdA promoter controlled hygromycin B phosphotransferase expression (homologous truncation vector), whereas in the second vector promoter elements were from the Aspergillus nidulans gpdA gene (heterologous truncation vector). Following transformation with the homologous truncation vector, nine transformants were analysed by Southern hybridisation; no transformants contained a disrupted pnlA gene. Of nineteen heterologous truncation vector transformants, three contained a disrupted pnlA gene; Southern analysis revealed single integrations of vector sequence at pnlA in two of these transformants. pnlA mRNA was not detected by Northern hybridisation in pnlA- transformants. pnlA- transformants failed to produce a PNLA protein with a pI identical to one normally detected in wild-type isolates by silver and activity staining of isoelectric focussing gels. Pathogenesis on Capsicum and apple was unaffected by disruption of the pnlA gene, indicating that the corresponding gene product, PNLA, is not essential for pathogenicity. Gene disruption is a feasible method for selectively mutating defined loci in G. cingulata for functional analysis of the corresponding gene products.
Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R
1994-10-01
We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.
Hypoxia induces mucin expression and secretion in human bronchial epithelial cells.
Zhou, Xiangdong; Tu, Jing; Li, Qi; Kolosov, Victor P; Perelman, Juliy M
2012-12-01
The study objective was to investigate the role of hypoxia-inducible factor 1 (HIF-1) in the transcriptional activation of MUC5AC in human bronchial epithelial (HBE) 16 cells under hypoxia conditions and the effect of hypoxia on expression and secretion of MUC5AC. Cells were incubated in hypoxia medium. Serial deletions or mutations of the MUC5AC promoter were cloned in the reporter pGL3-basic plasmid (Promega Biotech Co, Ltd, Beijing, China). These reporter plasmids were cotransfected with HIF-1α small interfering RNA. Hypoxia markedly increased the level of MUC5AC secretion and the transcriptional activity of MUC5AC promoters. Western blot analysis showed that HIF-1α and MUC5AC proteins were strongly increased after HBE16 cells were exposed to hypoxic conditions. Treatment of HBE16 cells with HIF-1α inhibitor (YC-1) or HIF-1α small interfering RNA significantly inhibited the expression of HIF-1α and MUC5AC, and the secretion of MUC5AC. Depletion of the promoter sequence did not reduce the MUC5AC promoter activity to hypoxia. Luciferase assay indicated that HRE in the MUC5AC promoter was in the region from -120 to +54. Promoter sequence analysis showed that 1 HRE site at -65 plays an important role in hypoxia activation of the MUC5AC. The inactivation of the HRE site using site-directed mutagenesis led to the complete loss of induction by hypoxia, which further confirmed the key role of the HRE site. MUC5AC expression and secretion are upregulated in response to hypoxia. The HRE site at -65 in the MUC5AC promoter and the HIF-1α are the major regulators for the cellular response against hypoxia in human bronchial epithelial cells. Copyright © 2012 Mosby, Inc. All rights reserved.
Shen, Xuemei; Hu, Hongbo; Peng, Huasong; Wang, Wei; Zhang, Xuehong
2013-04-22
Some Pseudomonas strains function as predominant plant growth-promoting rhizobacteria (PGPR). Within this group, Pseudomonas chlororaphis and Pseudomonas fluorescens are non-pathogenic biocontrol agents, and some Pseudomonas aeruginosa and Pseudomonas stutzeri strains are PGPR. P. chlororaphis GP72 is a plant growth-promoting rhizobacterium with a fully sequenced genome. We conducted a genomic analysis comparing GP72 with three other pseudomonad PGPR: P. fluorescens Pf-5, P. aeruginosa M18, and the nitrogen-fixing strain P. stutzeri A1501. Our aim was to identify the similarities and differences among these strains using a comparative genomic approach to clarify the mechanisms of plant growth-promoting activity. The genome sizes of GP72, Pf-5, M18, and A1501 ranged from 4.6 to 7.1 M, and the number of protein-coding genes varied among the four species. Clusters of Orthologous Groups (COGs) analysis assigned functions to predicted proteins. The COGs distributions were similar among the four species. However, the percentage of genes encoding transposases and their inactivated derivatives (COG L) was 1.33% of the total genes with COGs classifications in A1501, 0.21% in GP72, 0.02% in Pf-5, and 0.11% in M18. A phylogenetic analysis indicated that GP72 and Pf-5 were the most closely related strains, consistent with the genome alignment results. Comparisons of predicted coding sequences (CDSs) between GP72 and Pf-5 revealed 3544 conserved genes. There were fewer conserved genes when GP72 CDSs were compared with those of A1501 and M18. Comparisons among the four Pseudomonas species revealed 603 conserved genes in GP72, illustrating common plant growth-promoting traits shared among these PGPR. Conserved genes were related to catabolism, transport of plant-derived compounds, stress resistance, and rhizosphere colonization. Some strain-specific CDSs were related to different kinds of biocontrol activities or plant growth promotion. The GP72 genome contained the cus operon (related to heavy metal resistance) and a gene cluster involved in type IV pilus biosynthesis, which confers adhesion ability. Comparative genomic analysis of four representative PGPR revealed some conserved regions, indicating common characteristics (metabolism of plant-derived compounds, heavy metal resistance, and rhizosphere colonization) among these pseudomonad PGPR. Genomic regions specific to each strain provide clues to its lifestyle, ecological adaptation, and physiological role in the rhizosphere.
Pardo, Carolina E; Carr, Ian M; Hoffman, Christopher J; Darst, Russell P; Markham, Alexander F; Bonthron, David T; Kladde, Michael P
2011-01-01
Bisulfite sequencing is a widely-used technique for examining cytosine DNA methylation at nucleotide resolution along single DNA strands. Probing with cytosine DNA methyltransferases followed by bisulfite sequencing (MAPit) is an effective technique for mapping protein-DNA interactions. Here, MAPit methylation footprinting with M.CviPI, a GC methyltransferase we previously cloned and characterized, was used to probe hMLH1 chromatin in HCT116 and RKO colorectal cancer cells. Because M.CviPI-probed samples contain both CG and GC methylation, we developed a versatile, visually-intuitive program, called MethylViewer, for evaluating the bisulfite sequencing results. Uniquely, MethylViewer can simultaneously query cytosine methylation status in bisulfite-converted sequences at as many as four different user-defined motifs, e.g. CG, GC, etc., including motifs with degenerate bases. Data can also be exported for statistical analysis and as publication-quality images. Analysis of hMLH1 MAPit data with MethylViewer showed that endogenous CG methylation and accessible GC sites were both mapped on single molecules at high resolution. Disruption of positioned nucleosomes on single molecules of the PHO5 promoter was detected in budding yeast using M.CviPII, increasing the number of enzymes available for probing protein-DNA interactions. MethylViewer provides an integrated solution for primer design and rapid, accurate and detailed analysis of bisulfite sequencing or MAPit datasets from virtually any biological or biochemical system.
Sequences Associated with Centromere Competency in the Human Genome
Hayden, Karen E.; Strome, Erin D.; Merrett, Stephanie L.; Lee, Hye-Ran; Rudd, M. Katharine
2013-01-01
Centromeres, the sites of spindle attachment during mitosis and meiosis, are located in specific positions in the human genome, normally coincident with diverse subsets of alpha satellite DNA. While there is strong evidence supporting the association of some subfamilies of alpha satellite with centromere function, the basis for establishing whether a given alpha satellite sequence is or is not designated a functional centromere is unknown, and attempts to understand the role of particular sequence features in establishing centromere identity have been limited by the near identity and repetitive nature of satellite sequences. Utilizing a broadly applicable experimental approach to test sequence competency for centromere specification, we have carried out a genomic and epigenetic functional analysis of endogenous human centromere sequences available in the current human genome assembly. The data support a model in which functionally competent sequences confer an opportunity for centromere specification, integrating genomic and epigenetic signals and promoting the concept of context-dependent centromere inheritance. PMID:23230266
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
Isolation and characterization of a novel pollen-specific promoter in maize (Zea mays L.).
Wang, He; Fan, Mingxia; Wang, Guohong; Zhang, Chunyu; Shi, Lei; Wei, Zhengyi; Ma, Wenjuan; Chang, Jing; Huang, Senxin; Lin, Feng
2017-06-01
ZmSTK2_USP, located on the long arm of chromosome 4, belongs to the serine/threonine kinase gene in maize. The sequence analysis of 2100 bp upstream from the start codon ATG has shown that it contains cis-element motifs and two types of anther/pollen-specific promoter elements (GTGA and AGAAA), suggesting that it is the pollen-specific promoter. To investigate the function of ZmSTK2_USP promoter, the GUS gene fusion system was employed. In proZmSTK2_USP-GUS genetically modified plants, GUS activity was detected in mature pollen grains and pollen tubes but not found in other floral and vegetative tissues. These results show that proZmSTK2_USP is the pollen-specific promoter and drives pollen-specific activity during the middle stage of pollen development until pollen maturation.
[Novel Approaches in DNA Methylation Studies - MS-HRM Analysis and Electrochemistry].
Bartošík, M; Ondroušková, E
Cytosine methylation in DNA is an epigenetic mechanism regulating gene expression and plays a vital role in cell differentiation or proliferation. Tumor cells often exhibit aberrant DNA methylation, e.g. hypermethylation of tumor suppressor gene promoters. New methods, capable of determining methylation status of specific DNA sequences, are thus being developed. Among them, MS-HRM (methylation-specific high resolution melting) and electrochemistry offer relatively inexpensive instrumentation, fast assay times and possibility of screening multiple samples/DNA regions simultaneously. MS-HRM is due to its sensitivity and simplicity an interesting alternative to already established techniques, including methylation-specific PCR or bisulfite sequencing. Electrochemistry, when combined with suitable electroactive labels and electrode surfaces, has been applied in several unique strategies for discrimination of cytosines and methylcytosines. Both techniques were successfully tested in analysis of DNA methylation within promoters of important tumor suppressor genes and could thus help in achieving more precise diagnostics and prognostics of cancer. Aberrant methylation of promoters has already been described in hundreds of genes associated with tumorigenesis and could serve as important biomarker if new methods applicable into clinical practice are sufficiently advanced.Key words: DNA methylation - 5-methylcytosine - HRM analysis - melting temperature - DNA duplex - electrochemistry - nucleic acid hybridizationThis work was supported by MEYS - NPS I - LO1413.The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study.The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 6. 5. 2016Accepted: 16. 5. 2016.
Ding, Xiang; Zhu, Hongqing; Hou, Yiling; Hou, Wanru; Zhang, Nan; Fu, Lei
2017-01-01
Background: The mechanism of the immunoregulatory activities of polysaccharide is still not clear. Materials and Methods: Here, we performed the B-cell, T-cell, and macrophage cell proliferation, the cell cycle analysis of macrophage cells, sequenced the transcriptomes of control group macrophages, and Boletus speciosus Frost polysaccharide (BSF-1) group macrophages using Illumina sequencing technology to identify differentially expressed genes (DEGs) to determine the molecular mechanisms of immunomodulatory activity of BSF-1 in macrophages. Results: These results suggested that BSF-1 could promote the proliferation of B-cell, T-cell, and macrophages, promote the proliferation of macrophage cells by abolishing cell cycle arrests in the G0/G1 phases, and promote cell cycle progression in S-phase and G2/M phase, which might induce cell division. A total of 12,498,414 and 11,840,624 bp paired-end reads were obtained for the control group and BSF-1 group, respectively, and they corresponded to a total size of 12.5 G bp and 11.8 G bp, respectively, after the low-quality reads and adapter sequences were removed. Approximately 81.83% of the total number of genes (8,257) were expressed reads per kilobase per million mapped reads (RPKM ≥1) and more than 1366 genes were highly expressed (RPKM >60) in the BSF-1 group. A gene ontology-enrichment analysis generated 13,042 assignments to cellular components, 13,094 assignments to biological processes, and 13,135 assignments to molecular functions. A Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that the mitogen-activated protein kinase (MAPK) signaling pathways are significantly enriched for DEGs between the two cell groups. Conclusion: An analysis of transcriptome resources enabled us to examine gene expression profiles, verify differential gene expression, and select candidate signaling pathways as the mechanisms of the immunomodulatory activity of BSF-1. Based on the experimental data, we believe that the significant antitumor activities of BSF-1 in vivo mainly involve the MAPK signaling pathways. SUMMARY Boletus speciosus Frost-1 (BSF-1) could promote the proliferation of B-cell, T-cell, and macrophages, promote the proliferation of macrophage cells by abolishing cell cycle arrests in the G0/G1 phases, and promote cell cycle progression in S-phase and G2/M phase, which might induce cell divisionApproximately 81.83% of the total number of genes (8257) were expressed (reads per kilobase per million mapped reads [RPKM] =1) and more than 1366 genes were highly expressed (RPKM >60) in the BSF-1 groupA gene ontology-enrichment analysis generated 13,042 assignments to cellular components, 13,094 assignments to biological processes, and 13,135 assignments to molecular functionsA Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that the mitogen-activated protein kinase signaling pathways are significantly enriched for DEGs between the two cell groups. Abbreviations used: BSF-1: Boletus speciosus Frost polysaccharide. PMID:28839373
Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H
1999-10-28
We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kalchman, M.; Lin, B.; Nasir, J.
1994-09-01
The mouse homologue of the Huntington disease gene (Hdh) has recently been cloned and mapped to a region of synteny with the human, on mouse chromosome 5. The two genes share a high degree of both coding (90% amino acid) and nucleotide (86.2%) identity. We have subsequently performed a detailed comparison of the genomic organization of the 5{prime} region of the two genes encompassing the promoter region and first five exons of both the human and mouse genes. The comparative sequence analysis of the promoter region between HD and Hdh reveals two highly conserved regions. One region (-56 to -118)more » (+1 is the ATG start codon), shared 84% nucleotide identity and another region (-130 to -206) had 81% nucleotide identity. Nine putative Sp1 sites appear in the human promoter region contrasted with only 3 in a similar region in the mouse. Furthermore, 17 and 20 base pair direct repeats present in the HD 5{prime} region are absent in the similar Hdh region. Although both the mouse and human intron/exon boundaries conform to the GT/AG rule, the intron sizes between HD and Hdh are markedly different. The first four introns in Hdh are 15, 7, 5 and 0.5 kb compared to sizes of 10, 15, 7 and 0.5 kb, respectively. Comparison between the mouse and human intronic sequences immediately adjacent to the first five exons (excluding exon 1) reveals only about 46 to 50% identity within the first 60 bp of intronic sequence. Furthermore, we have identified novel polymorphic di-, tri- and tetra-nucleotide repeats in Hdh introns of various mouse strains that are not present in the human. For example, polymorphic CT repeats are present in introns 2 and 4 of Hdh and a novel mouse 56 AAG trinucleotide repeat (interrupted by an AAGG) is also located within intron 2. This information concerning the promoter and genomic organization of both HD and Hdh is critical for designing appropriate gene targetting vectors for studying the normal function of the HD and Hdh genes in model systems.« less
Sequence information gain based motif analysis.
Maynou, Joan; Pairó, Erola; Marco, Santiago; Perera, Alexandre
2015-11-09
The detection of regulatory regions in candidate sequences is essential for the understanding of the regulation of a particular gene and the mechanisms involved. This paper proposes a novel methodology based on information theoretic metrics for finding regulatory sequences in promoter regions. This methodology (SIGMA) has been tested on genomic sequence data for Homo sapiens and Mus musculus. SIGMA has been compared with different publicly available alternatives for motif detection, such as MEME/MAST, Biostrings (Bioconductor package), MotifRegressor, and previous work such Qresiduals projections or information theoretic based detectors. Comparative results, in the form of Receiver Operating Characteristic curves, show how, in 70% of the studied Transcription Factor Binding Sites, the SIGMA detector has a better performance and behaves more robustly than the methods compared, while having a similar computational time. The performance of SIGMA can be explained by its parametric simplicity in the modelling of the non-linear co-variability in the binding motif positions. Sequence Information Gain based Motif Analysis is a generalisation of a non-linear model of the cis-regulatory sequences detection based on Information Theory. This generalisation allows us to detect transcription factor binding sites with maximum performance disregarding the covariability observed in the positions of the training set of sequences. SIGMA is freely available to the public at http://b2slab.upc.edu.
Shi, Feng; Luan, Mingyue; Li, Yongfu
2018-04-18
Glutamate decarboxylase (GAD) converts L-glutamate (Glu) into γ-aminobutyric acid (GABA). Corynebacterium glutamicum that expresses exogenous GAD gene, gadB2 or gadB1, can synthesize GABA from its own produced Glu. To enhance GABA production in C. glutamicum, ribosomal binding site (RBS) sequence and promoter were searched and optimized for increasing the expression efficiency of gadB2. R4 exhibited the highest strength among RBS sequences tested, with 6 nt the optimal aligned spacing (AS) between RBS and start codon. This combination of RBS sequence and AS contributed to gadB2 expression, increased GAD activity by 156% and GABA production by 82% compared to normal strong RBS and AS combination. Then, a series of native promoters were selected for transcribing gadB2 under optimal RBS and AS combination. P dnaK , P dtsR , P odhI and P clgR expressed gadB2 and produced GABA as effectively as widely applied P tuf and P cspB promoters and more effectively than P sod promoter. However, each native promoter did not work as well as the synthetic strong promoter P tacM , which produced 20.2 ± 0.3 g/L GABA. Even with prolonged length and bicistronic architecture, the strength of P dnaK did not enhance. Finally, gadB2 and mutant gadB1 were co-expressed under the optimal promoter and RBS combination, thus converted Glu into GABA completely and improved GABA production to more than 25 g/L. This study provides useful promoters and RBS sequences for gene expression in C. glutamicum.
Zhao, Si-Si; Zhao, Guo-Dong; Di, Tian-Yuan; Ding, Hua; Wan, Xiao-Ling; Li, Bing; Chen, Yu-Hua; Xu, Ya-Xiang; Shen, Wei-De; Wei, Zheng-Guo
2013-02-01
Cytochrome P450s (CYPs) are widespread proteins that interact with exogenous chemicals from the diet or the environment. CYP9A subfamily genes are important in the silkworm Bombyx mori. We previously reported transcriptional levels of two CYP9A genes in different tissues and their responses to sodium fluoride (NaF). In this study, promoter truncation analysis using a dual-luciferase reporter assay in B. mori ovary cells (BmN) showed that the regions -1,496 to -1,102 bp for CYP9A19, and -1,630 to -1,210 bp for CYP9A22 were essential for basal transcriptional activity. Sequence analysis of these regions revealed several transcriptional regulatory elements but no typical promoter elements. Promoter activities were regulated after NaF induction and with an obvious dose effect. Although the dual-luciferase assay has been widely used to determine the activity of a given promoter in cell lines, problems with it still exist. Our results indicate that both plasmid size and construct protocols affect the experimental results.
Computational and experimental analysis of DNA shuffling
Maheshri, Narendra; Schaffer, David V.
2003-01-01
We describe a computational model of DNA shuffling based on the thermodynamics and kinetics of this process. The model independently tracks a representative ensemble of DNA molecules and records their states at every stage of a shuffling reaction. These data can subsequently be analyzed to yield information on any relevant metric, including reassembly efficiency, crossover number, type and distribution, and DNA sequence length distributions. The predictive ability of the model was validated by comparison to three independent sets of experimental data, and analysis of the simulation results led to several unique insights into the DNA shuffling process. We examine a tradeoff between crossover frequency and reassembly efficiency and illustrate the effects of experimental parameters on this relationship. Furthermore, we discuss conditions that promote the formation of useless “junk” DNA sequences or multimeric sequences containing multiple copies of the reassembled product. This model will therefore aid in the design of optimal shuffling reaction conditions. PMID:12626764
Madi, Asaf; Poran, Asaf; Shifrut, Eric; Reich-Zeliger, Shlomit; Greenstein, Erez; Zaretsky, Irena; Arnon, Tomer; Laethem, Francois Van; Singer, Alfred; Lu, Jinghua; Sun, Peter D; Cohen, Irun R; Friedman, Nir
2017-01-01
Diversity of T cell receptor (TCR) repertoires, generated by somatic DNA rearrangements, is central to immune system function. However, the level of sequence similarity of TCR repertoires within and between species has not been characterized. Using network analysis of high-throughput TCR sequencing data, we found that abundant CDR3-TCRβ sequences were clustered within networks generated by sequence similarity. We discovered a substantial number of public CDR3-TCRβ segments that were identical in mice and humans. These conserved public sequences were central within TCR sequence-similarity networks. Annotated TCR sequences, previously associated with self-specificities such as autoimmunity and cancer, were linked to network clusters. Mechanistically, CDR3 networks were promoted by MHC-mediated selection, and were reduced following immunization, immune checkpoint blockade or aging. Our findings provide a new view of T cell repertoire organization and physiology, and suggest that the immune system distributes its TCR sequences unevenly, attending to specific foci of reactivity. DOI: http://dx.doi.org/10.7554/eLife.22057.001 PMID:28731407
Kon, Tatsuya; Yoshikawa, Nobuyuki
2014-01-01
Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109
Kavamura, Vanessa Nessner; Santos, Suikinai Nobre; Taketani, Rodrigo Gouvêa; Vasconcellos, Rafael Leandro Figueiredo; Melo, Itamar Soares
2017-02-02
The strain of Bacillus sp. CMAA 1363 was isolated from the Brazilian Caatinga biome and showed plant growth-promoting traits and ability to promote maize growth under drought stress. Sequencing revealed genes involved in stress response and plant growth promotion. These genomic features might aid in the protection of plants against the negative effects imposed by drought. Copyright © 2017 Kavamura et al.
Santos, Suikinai Nobre; Taketani, Rodrigo Gouvêa; Vasconcellos, Rafael Leandro Figueiredo; Melo, Itamar Soares
2017-01-01
ABSTRACT The strain of Bacillus sp. CMAA 1363 was isolated from the Brazilian Caatinga biome and showed plant growth-promoting traits and ability to promote maize growth under drought stress. Sequencing revealed genes involved in stress response and plant growth promotion. These genomic features might aid in the protection of plants against the negative effects imposed by drought. PMID:28153893
ERIC Educational Resources Information Center
Pontrello, Jason K.
2016-01-01
Introductory organic laboratory courses frequently begin with a set of activities built around developing basic experimental skills and techniques, often with guided-inquiry components. A sequence of skill-based activities is described to promote reflection, analysis of, and interpersonal communication around science. A multistage process was used…
ERIC Educational Resources Information Center
Truckenmiller, James L.
The former HEW (Health, Education, and Welfare) National Strategy for Youth Development Model proposed a community-based program to promote positive youth development and to prevent delinquency through a sequence of youth needs assessments, needs-targeted programs, and program impact evaluation. HEW Community Program Impact Scales data obtained…
FSH is an important regulator of mammalian gametogenesis and the female reproductive cycle. Although little is known about the transcriptional regulation of the beta-subunit (the rate-limiting subunit of FSH synthesis), sequence analysis of the ovine FSHbeta promoter has revealed...
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.
Boyer, S K; Mullet, J E
1988-07-01
The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.
CaMV-35S promoter sequence-specific DNA methylation in lettuce.
Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro
2016-01-01
We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette
2012-10-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.
Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard
2012-01-01
Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level. PMID:22896612
Santa-Cruz, Diego; Pacienza, Natalia; Zilli, Carla; Pagano, Eduardo; Balestrasse, Karina; Yannarelli, Gustavo
2017-08-01
Heme oxygenase-1 (HO-1) plays a protective role against oxidative stress in plants. The mechanisms regulating its expression, however, remain unclear. Here we studied the methylation state of a GC rich HO-1 promoter region and the expression of several stress-related transcription factors (TFs) in soybean plants subjected to ultraviolet-B (UV-B) radiation. Genomic DNA and total RNA were isolated from leaves of plants irradiated with 7.5 and 15kJm-2 UV-B. A 304bp HO-1 promoter region was amplified by PCR from sodium bisulfite-treated DNA, cloned into pGEMT plasmid vector and evaluated by DNA sequencing. Bisulfite sequencing analysis showed similar HO-1 promoter methylation levels in control and UV-B-treated plants (C: 3.4±1.3%; 7.5: 2.6±0.5%; 15: 3.1±1.1%). Interestingly, HO-1 promoter was strongly unmethylated in control plants. Quantitative RT-PCR analysis of TFs showed that GmMYB177, GmMYBJ6, GmWRKY21, GmNAC11, GmNAC20 and GmGT2A but not GmWRK13 and GmDREB were induced by UV-B radiation. The expression of several TFs was also enhanced by hemin, a potent and specific HO inducer, inferring that they may mediate HO-1 up-regulation. These results suggest that soybean HO-1 gene expression is not epigenetically regulated. Moreover, the low level of HO-1 promoter methylation suggests that this antioxidant enzyme can rapidly respond to environmental stress. Finally, this study has identified some stress-related TFs involved in HO-1 up-regulation under UV-B radiation. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sollome, James; Martin, Elizabeth
MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database,more » genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression.« less
Itzhaki, H; Maxson, J M; Woodson, W R
1994-09-13
The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.
TERT promoter mutation status as an independent prognostic factor in cutaneous melanoma.
Griewank, Klaus G; Murali, Rajmohan; Puig-Butille, Joan Anton; Schilling, Bastian; Livingstone, Elisabeth; Potrony, Miriam; Carrera, Cristina; Schimming, Tobias; Möller, Inga; Schwamborn, Marion; Sucker, Antje; Hillen, Uwe; Badenas, Celia; Malvehy, Josep; Zimmer, Lisa; Scherag, André; Puig, Susana; Schadendorf, Dirk
2014-09-01
Recently, TERT promoter mutations were identified at high frequencies in cutaneous melanoma tumor samples and cell lines. The mutations were found to have a UV-signature and to lead to increased TERT gene expression. We analyzed a large cohort of melanoma patients for the presence and distribution of TERT promoter mutations and their association with clinico-pathological characteristics. 410 melanoma tumor samples were analyzed by Sanger sequencing for the presence of TERT promoter mutations. An analysis of associations between mutation status and various clinical and pathologic variables was performed. TERT promoter mutations were identified in 154 (43%) of 362 successfully sequenced melanomas. Mutation frequencies varied between melanoma subtype, being most frequent in melanomas arising in nonacral skin (48%) and melanomas with occult primary (50%), and less frequent in mucosal (23%), and acral (19%) melanomas. Mutations carried a UV signature (C>T or CC>TT). The presence of TERT promoter mutations was associated with factors such as BRAF or NRAS mutation (P < .001), histologic type (P = .002), and Breslow thickness (P < .001). TERT promoter mutation was independently associated with poorer overall survival in patients with nonacral cutaneous melanomas (median survival 80 months vs 291 months for wild-type; hazard ratio corrected for other covariates 2.47; 95% confidence interval [CI] = 1.29 to 4.74; P = .006). UV-induced TERT promoter mutations are one of the most frequent genetic alterations in melanoma, with frequencies varying depending on melanoma subtype. In nonacral cutaneous melanomas, presence of TERT promoter mutations is independently associated with poor prognosis. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Sorkina, Alina; Bardosh, Gabriel; Liu, Yong-Zhong; Fridman, Ifat; Schlizerman, Ludmila; Zur, Naftali; Or, Etti; Goldschmidt, Eliezer E; Blumwald, Eduardo; Sadka, Avi
2011-09-01
While searching for genes expressed in acid lemon but not in acidless lime pulp, we isolated clone Cl111 which showed the following expression phenotypes: (1) while it was expressed in the ovaries in both varieties, its mRNA was detected only in the pulp of the acid fruit, (2) no or very low expression of the gene was detected in vegetative organs. These expression patterns suggested that Cl111 is an ovary- and pulp-specific gene. The ability of ~2-kb fragments upstream of the transcription start site of the lemon and lime genes to confer reporter-gene activity was investigated by transient expression in isolated juice vesicles of both varieties. Whereas Cl111 promoter from lemon showed faint activity in lemon and lime juice vesicles, no activity was evident with the lime promoter. The activities of the 2-kb fragments and their delimited fragments were further investigated in tomato. The results indicated that the promoters were active in a manner similar to that in acid lemon and acidless lime: the lemon promoter generated activity in the fruit endocarp, analogous to citrus fruit pulp. The delimitation analyses identified an expression-conferring region which, in the lemon promoter, contained a sequence homologous to a fruit-specific element of the melon cucumisin gene. Another region, which reduced promoter activity, contained an I-Box-like sequence, identified as a fruit-specific negative element. Taken together, Cl111 promoter was confirmed to be pulp- and flower-specific. Differences in the expression of Cl111 between the two varieties could be attributable to changes in the gene promoter region.
Augustin, Regina; Lichtenthaler, Stefan F.; Greeff, Michael; Hansen, Jens; Wurst, Wolfgang; Trümbach, Dietrich
2011-01-01
The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD) pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases. PMID:21559189
Koehorst-van Putten, Herma J J; Wolters, Anne-Marie A; Pereira-Bertram, Isolde M; van den Berg, Hans H J; van der Krol, Alexander R; Visser, Richard G F
2012-12-01
In order to obtain a tuberous root-specific promoter to be used in the transformation of cassava, a 1,728 bp sequence containing the cassava granule-bound starch synthase (GBSSI) promoter was isolated. The sequence proved to contain light- and sugar-responsive cis elements. Part of this sequence (1,167 bp) was cloned into binary vectors to drive expression of the firefly luciferase gene. Cassava cultivar Adira 4 was transformed with this construct or a control construct in which the luciferase gene was cloned behind the 35S promoter. Luciferase activity was measured in leaves, stems, roots and tuberous roots. As expected, the 35S promoter induced luciferase activity in all organs at similar levels, whereas the GBSSI promoter showed very low expression in leaves, stems and roots, but very high expression in tuberous roots. These results show that the cassava GBSSI promoter is an excellent candidate to achieve tuberous root-specific expression in cassava.
De Nicola, Beatrice; Lech, Christopher J.; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N.; Phan, Anh Tuân
2016-01-01
The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. PMID:27298260
Harada, S; Okubo, T; Tsutsumi, M; Takase, S; Muramatsu, T
1998-05-01
Neuropeptide cholecystokinin (CCK) and the CCK receptors in the central nervous system mediate actions on increasing firings, anxiety, and nociceptions. Furthermore, CCK modulates the release of dopamine and dopamine-related behaviors in the mesolimbic pathway. In our study, genetic variation in the promoter and coding regions of the prepro-CCK gene were analyzed among 66 Japanese, 66 American Whites, 54 Chinese, and 41 Colombian natives. Two nucleotide sequence variants were found: a frequent mutation at nucleotide position -45 C to T involved in core sequence of Sp1 binding cis-element of the promoter region, and a C to T substitution at the 1662 position in intron 2. Analysis for the segregation study in 10 families of twins confirmed codominant heredity of two alleles. Distribution of genotypes and gene frequencies of 66 controls and 108 alcoholics in Japan presented that allelic variant T type in alcoholics was found in higher frequencies than that of controls, and distribution of these genotypes was significantly different between the both groups.
Mutational Analysis of a C-Dependent Late Promoter of Bacteriophage Mu
Chiang, L. W.; Howe, M. M.
1993-01-01
Late transcription of bacteriophage Mu initiates at four promoters, P(lys), P(I), P(P) and P(mom), and requires the Mu C protein and the host RNA polymerase. Promoter-containing DNA fragments extending ~200 bp upstream and downstream of the 5' starts of the lys, I and P transcripts were cloned into a multicopy lacZ-expression plasmid. Promoter activity, assayed by β-galactosidase expression, was determined under two different conditions: (1) with C provided from a compatible plasmid in the absence of other Mu factors and (2) with C provided from an induced Mu prophage. β-galactosidase activities were greatest for P(lys), intermediate for P(I), and lowest for P(P). Similar analysis of plasmids containing nested sets of deletions removing 5' or 3' sequences of P(lys) demonstrated that a 68-bp region was sufficient for full activity. Point mutations were generated within the 68-bp region by mutagenic oligonucleotide-directed PCR (Mod-PCR). Properties of the lys promoter mutants indicated that, in addition to the -10 region, a 19-bp region from -52 to -34 containing the C footprint is required for C-dependent promoter activity. PMID:8293968
Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP.
Li, Yan; Sun, Yan; Yang, Qingchuan; Kang, Junmei; Zhang, Tiejun; Gruber, Margaret Yvonne; Fang, Feng
2012-08-01
A 1272 bp upstream sequence of MsZFN gene was cloned from alfalfa, which was designed as MsZPP (Genbank accession number: FJ 161979.2) using an adaptor-mediated genome walking method. A sole transcription start site was located 69 bp upstream of the translation start site. Its pattern of expression included roots, stem vascular tissues, floral reproductive organs, and leaves, but the promoter did not express in seeds, petals or sepals. Transcription levels can be stimulated by dark, MeJA, and IAA. However, GUS fusion activities had no change by treatments of GA, ABA, drought and high salt for 3 days. Deletion analysis revealed that all sections of the promoter can drive gus gene expression in the root, stem, leaves and floral reproductive organs; however, only fragments longer than the -460 bp promoter can stimulate strong gus gene expression in these organs. In addition, the -460 bp promoter fragment can drive gus expression not only in the vascular tissue, but also in leaf guard cells. The results suggest that the promoter MsZPP plays roles in the regulation of transgene expression, particularly due to its darkness, MeJA, and IAA responsiveness.
Evidence That Up-Regulation of MicroRNA-29 Contributes to Postnatal Body Growth Deceleration
Kamran, Fariha; Andrade, Anenisia C.; Nella, Aikaterini A.; Clokie, Samuel J.; Rezvani, Geoffrey; Nilsson, Ola; Baron, Jeffrey
2015-01-01
Body growth is rapid in infancy but subsequently slows and eventually ceases due to a progressive decline in cell proliferation that occurs simultaneously in multiple organs. We previously showed that this decline in proliferation is driven in part by postnatal down-regulation of a large set of growth-promoting genes in multiple organs. We hypothesized that this growth-limiting genetic program is orchestrated by microRNAs (miRNAs). Bioinformatic analysis identified target sequences of the miR-29 family of miRNAs to be overrepresented in age–down-regulated genes. Concomitantly, expression microarray analysis in mouse kidney and lung showed that all members of the miR-29 family, miR-29a, -b, and -c, were strongly up-regulated from 1 to 6 weeks of age. Real-time PCR confirmed that miR-29a, -b, and -c were up-regulated with age in liver, kidney, lung, and heart, and their expression levels were higher in hepatocytes isolated from 5-week-old mice than in hepatocytes from embryonic mouse liver at embryonic day 16.5. We next focused on 3 predicted miR-29 target genes (Igf1, Imp1, and Mest), all of which are growth-promoting. A 3′-untranslated region containing the predicted target sequences from each gene was placed individually in a luciferase reporter construct. Transfection of miR-29 mimics suppressed luciferase gene activity for all 3 genes, and this suppression was diminished by mutating the target sequences, suggesting that these genes are indeed regulated by miR-29. Taken together, the findings suggest that up-regulation of miR-29 during juvenile life drives the down-regulation of multiple growth-promoting genes, thus contributing to physiological slowing and eventual cessation of body growth. PMID:25866874
Galamb, Orsolya; Kalmár, Alexandra; Péterfia, Bálint; Csabai, István; Bodor, András; Ribli, Dezső; Krenács, Tibor; Patai, Árpád V; Wichmann, Barnabás; Barták, Barbara Kinga; Tóth, Kinga; Valcz, Gábor; Spisák, Sándor; Tulassay, Zsolt; Molnár, Béla
2016-08-02
The WNT signaling pathway has an essential role in colorectal carcinogenesis and progression, which involves a cascade of genetic and epigenetic changes. We aimed to analyze DNA methylation affecting the WNT pathway genes in colorectal carcinogenesis in promoter and gene body regions using whole methylome analysis in 9 colorectal cancer, 15 adenoma, and 6 normal tumor adjacent tissue (NAT) samples by methyl capture sequencing. Functional methylation was confirmed on 5-aza-2'-deoxycytidine-treated colorectal cancer cell line datasets. In parallel with the DNA methylation analysis, mutations of WNT pathway genes (APC, β-catenin/CTNNB1) were analyzed by 454 sequencing on GS Junior platform. Most differentially methylated CpG sites were localized in gene body regions (95% of WNT pathway genes). In the promoter regions, 33 of the 160 analyzed WNT pathway genes were differentially methylated in colorectal cancer vs. normal, including hypermethylated AXIN2, CHP1, PRICKLE1, SFRP1, SFRP2, SOX17, and hypomethylated CACYBP, CTNNB1, MYC; 44 genes in adenoma vs. NAT; and 41 genes in colorectal cancer vs. adenoma comparisons. Hypermethylation of AXIN2, DKK1, VANGL1, and WNT5A gene promoters was higher, while those of SOX17, PRICKLE1, DAAM2, and MYC was lower in colon carcinoma compared to adenoma. Inverse correlation between expression and methylation was confirmed in 23 genes, including APC, CHP1, PRICKLE1, PSEN1, and SFRP1. Differential methylation affected both canonical and noncanonical WNT pathway genes in colorectal normal-adenoma-carcinoma sequence. Aberrant DNA methylation appears already in adenomas as an early event of colorectal carcinogenesis.
Evidence That Up-Regulation of MicroRNA-29 Contributes to Postnatal Body Growth Deceleration.
Kamran, Fariha; Andrade, Anenisia C; Nella, Aikaterini A; Clokie, Samuel J; Rezvani, Geoffrey; Nilsson, Ola; Baron, Jeffrey; Lui, Julian C
2015-06-01
Body growth is rapid in infancy but subsequently slows and eventually ceases due to a progressive decline in cell proliferation that occurs simultaneously in multiple organs. We previously showed that this decline in proliferation is driven in part by postnatal down-regulation of a large set of growth-promoting genes in multiple organs. We hypothesized that this growth-limiting genetic program is orchestrated by microRNAs (miRNAs). Bioinformatic analysis identified target sequences of the miR-29 family of miRNAs to be overrepresented in age-down-regulated genes. Concomitantly, expression microarray analysis in mouse kidney and lung showed that all members of the miR-29 family, miR-29a, -b, and -c, were strongly up-regulated from 1 to 6 weeks of age. Real-time PCR confirmed that miR-29a, -b, and -c were up-regulated with age in liver, kidney, lung, and heart, and their expression levels were higher in hepatocytes isolated from 5-week-old mice than in hepatocytes from embryonic mouse liver at embryonic day 16.5. We next focused on 3 predicted miR-29 target genes (Igf1, Imp1, and Mest), all of which are growth-promoting. A 3'-untranslated region containing the predicted target sequences from each gene was placed individually in a luciferase reporter construct. Transfection of miR-29 mimics suppressed luciferase gene activity for all 3 genes, and this suppression was diminished by mutating the target sequences, suggesting that these genes are indeed regulated by miR-29. Taken together, the findings suggest that up-regulation of miR-29 during juvenile life drives the down-regulation of multiple growth-promoting genes, thus contributing to physiological slowing and eventual cessation of body growth.
Griewank, Klaus G; Wiesner, Thomas; Murali, Rajmohan; Pischler, Carina; Müller, Hansgeorg; Koelsche, Christian; Möller, Inga; Franklin, Cindy; Cosgarea, Ioana; Sucker, Antje; Schadendorf, Dirk; Schaller, Jörg; Horn, Susanne; Brenn, Thomas; Mentzel, Thomas
2018-03-01
Atypical fibroxanthomas and pleomorphic dermal sarcomas are tumors arising in sun-damaged skin of elderly patients. They have differing prognoses and are currently distinguished using histological criteria, such as invasion of deeper tissue structures, necrosis and lymphovascular or perineural invasion. To investigate the as-yet poorly understood genetics of these tumors, 41 atypical fibroxanthomas and 40 pleomorphic dermal sarcomas were subjected to targeted next-generation sequencing approaches as well as DNA copy number analysis by comparative genomic hybridization. In an analysis of the entire coding region of 341 oncogenes and tumor suppressor genes in 13 atypical fibroxanthomas using an established hybridization-based next-generation sequencing approach, we found that these tumors harbor a large number of mutations. Gene alterations were identified in more than half of the analyzed samples in FAT1, NOTCH1/2, CDKN2A, TP53, and the TERT promoter. The presence of these alterations was verified in 26 atypical fibroxanthoma and 35 pleomorphic dermal sarcoma samples by targeted amplicon-based next-generation sequencing. Similar mutation profiles in FAT1, NOTCH1/2, CDKN2A, TP53, and the TERT promoter were identified in both atypical fibroxanthoma and pleomorphic dermal sarcoma. Activating RAS mutations (G12 and G13) identified in 3 pleomorphic dermal sarcoma were not found in atypical fibroxanthoma. Comprehensive DNA copy number analysis demonstrated a wide array of different copy number gains and losses, with similar profiles in atypical fibroxanthoma and pleomorphic dermal sarcoma. In summary, atypical fibroxanthoma and pleomorphic dermal sarcoma are highly mutated tumors with recurrent mutations in FAT1, NOTCH1/2, CDKN2A, TP53, and the TERT promoter, and a range of DNA copy number alterations. These findings suggest that atypical fibroxanthomas and pleomorphic dermal sarcomas are genetically related, potentially representing two ends of a common tumor spectrum and distinguishing these entities is at present still best performed using histological criteria.
Lavysh, Daria; Sokolova, Maria; Slashcheva, Marina; Förstner, Konrad U; Severinov, Konstantin
2017-02-14
Bacteriophage AR9 is a recently sequenced jumbo phage that encodes two multisubunit RNA polymerases. Here we investigated the AR9 transcription strategy and the effect of AR9 infection on the transcription of its host, Bacillus subtilis Analysis of whole-genome transcription revealed early, late, and continuously expressed AR9 genes. Alignment of sequences upstream of the 5' ends of AR9 transcripts revealed consensus sequences that define early and late phage promoters. Continuously expressed AR9 genes have both early and late promoters in front of them. Early AR9 transcription is independent of protein synthesis and must be determined by virion RNA polymerase injected together with viral DNA. During infection, the overall amount of host mRNAs is significantly decreased. Analysis of relative amounts of host transcripts revealed notable differences in the levels of some mRNAs. The physiological significance of up- or downregulation of host genes for AR9 phage infection remains to be established. AR9 infection is significantly affected by rifampin, an inhibitor of host RNA polymerase transcription. The effect is likely caused by the antibiotic-induced killing of host cells, while phage genome transcription is solely performed by viral RNA polymerases. IMPORTANCE Phages regulate the timing of the expression of their own genes to coordinate processes in the infected cell and maximize the release of viral progeny. Phages also alter the levels of host transcripts. Here we present the results of a temporal analysis of the host and viral transcriptomes of Bacillus subtilis infected with a giant phage, AR9. We identify viral promoters recognized by two virus-encoded RNA polymerases that are a unique feature of the phiKZ-related group of phages to which AR9 belongs. Our results set the stage for future analyses of highly unusual RNA polymerases encoded by AR9 and other phiKZ-related phages. Copyright © 2017 Lavysh et al.
Szymanski, P; Stenlund, A
1991-01-01
Expression of bovine papillomavirus (BPV) early gene products is required for viral DNA replication and establishment of the transformed phenotype. By the use of a highly efficient electroporation system, we have examined for the first time the transcriptional activity of BPV promoters in their natural genomic context in a replication-permissive cell line. We have determined that a qualitatively distinct stage of transcription is not detectable prior to DNA replication in transiently transfected cells. This suggests that the transcriptional activity of the BPV genome in stably transformed cells represents the early stage of BPV gene expression. Quantitative differences in promoter activity between transiently transfected and stably transformed cells suggest that subtle changes in gene expression may control progression of the viral life cycle. Deletion analysis demonstrated that the E2 transactivator protein stimulates all of the early promoters through sequences located in the upstream regulatory region. This E2-dependent enhancer was found to be highly redundant, and particular E2 binding sites did not display a preference for particular promoters. Despite this dependence on a common cis-acting sequence, the various promoters displayed different sensitivities to the E2 transactivator. The findings that E2 regulates all promoters and, with the exception of the E2 repressors, that no other known viral gene product appears to affect transcription indicate that the E2 system functions as the master regulator of BPV early gene expression. Images PMID:1656065
Pastukh, Viktor; Roberts, Justin T.; Clark, David W.; Bardwell, Gina C.; Patel, Mita; Al-Mehdi, Abu-Bakr; Borchert, Glen M.
2015-01-01
In hypoxia, mitochondria-generated reactive oxygen species not only stimulate accumulation of the transcriptional regulator of hypoxic gene expression, hypoxia inducible factor-1 (Hif-1), but also cause oxidative base modifications in hypoxic response elements (HREs) of hypoxia-inducible genes. When the hypoxia-induced base modifications are suppressed, Hif-1 fails to associate with the HRE of the VEGF promoter, and VEGF mRNA accumulation is blunted. The mechanism linking base modifications to transcription is unknown. Here we determined whether recruitment of base excision DNA repair (BER) enzymes in response to hypoxia-induced promoter modifications was required for transcription complex assembly and VEGF mRNA expression. Using chromatin immunoprecipitation analyses in pulmonary artery endothelial cells, we found that hypoxia-mediated formation of the base oxidation product 8-oxoguanine (8-oxoG) in VEGF HREs was temporally associated with binding of Hif-1α and the BER enzymes 8-oxoguanine glycosylase 1 (Ogg1) and redox effector factor-1 (Ref-1)/apurinic/apyrimidinic endonuclease 1 (Ape1) and introduction of DNA strand breaks. Hif-1α colocalized with HRE sequences harboring Ref-1/Ape1, but not Ogg1. Inhibition of BER by small interfering RNA-mediated reduction in Ogg1 augmented hypoxia-induced 8-oxoG accumulation and attenuated Hif-1α and Ref-1/Ape1 binding to VEGF HRE sequences and blunted VEGF mRNA expression. Chromatin immunoprecipitation-sequence analysis of 8-oxoG distribution in hypoxic pulmonary artery endothelial cells showed that most of the oxidized base was localized to promoters with virtually no overlap between normoxic and hypoxic data sets. Transcription of genes whose promoters lost 8-oxoG during hypoxia was reduced, while those gaining 8-oxoG was elevated. Collectively, these findings suggest that the BER pathway links hypoxia-induced introduction of oxidative DNA modifications in promoters of hypoxia-inducible genes to transcriptional activation. PMID:26432868
A Novel Collection of snRNA-Like Promoters with Tissue-Specific Transcription Properties
Garritano, Sonia; Gigoni, Arianna; Costa, Delfina; Malatesta, Paolo; Florio, Tullio; Cancedda, Ranieri; Pagano, Aldo
2012-01-01
We recently identified a novel dataset of snRNA-like trascriptional units in the human genome. The investigation of a subset of these elements showed that they play relevant roles in physiology and/or pathology. In this work we expand our collection of small RNAs taking advantage of a newly developed algorithm able to identify genome sequence stretches with RNA polymerase (pol) III type 3 promoter features thus constituting putative pol III binding sites. The bioinformatic analysis of a subset of these elements that map in introns of protein-coding genes in antisense configuration suggest their association with alternative splicing, similarly to other recently characterized small RNAs. Interestingly, the analysis of the transcriptional activity of these novel promoters shows that they are active in a cell-type specific manner, in accordance with the emerging body of evidence of a tissue/cell-specific activity of pol III. PMID:23109855
A novel collection of snRNA-like promoters with tissue-specific transcription properties.
Garritano, Sonia; Gigoni, Arianna; Costa, Delfina; Malatesta, Paolo; Florio, Tullio; Cancedda, Ranieri; Pagano, Aldo
2012-01-01
We recently identified a novel dataset of snRNA-like trascriptional units in the human genome. The investigation of a subset of these elements showed that they play relevant roles in physiology and/or pathology. In this work we expand our collection of small RNAs taking advantage of a newly developed algorithm able to identify genome sequence stretches with RNA polymerase (pol) III type 3 promoter features thus constituting putative pol III binding sites. The bioinformatic analysis of a subset of these elements that map in introns of protein-coding genes in antisense configuration suggest their association with alternative splicing, similarly to other recently characterized small RNAs. Interestingly, the analysis of the transcriptional activity of these novel promoters shows that they are active in a cell-type specific manner, in accordance with the emerging body of evidence of a tissue/cell-specific activity of pol III.
Hosoyama, Akira; Yamazoe, Atsushi; Morikawa, Masaaki
2015-01-01
Acinetobacter calcoaceticus strain P23 is a plant growth-promoting bacterium, which was isolated from the surface of duckweed. We report here the draft genome sequence of strain P23. The genome data will serve as a valuable reference for understanding the molecular mechanism of plant growth promotion in aquatic plants. PMID:25720680
Definition of RNA Polymerase II CoTC Terminator Elements in the Human Genome
Nojima, Takayuki; Dienstbier, Martin; Murphy, Shona; Proudfoot, Nicholas J.; Dye, Michael J.
2013-01-01
Summary Mammalian RNA polymerase II (Pol II) transcription termination is an essential step in protein-coding gene expression that is mediated by pre-mRNA processing activities and DNA-encoded terminator elements. Although much is known about the role of pre-mRNA processing in termination, our understanding of the characteristics and generality of terminator elements is limited. Whereas promoter databases list up to 40,000 known and potential Pol II promoter sequences, fewer than ten Pol II terminator sequences have been described. Using our knowledge of the human β-globin terminator mechanism, we have developed a selection strategy for mapping mammalian Pol II terminator elements. We report the identification of 78 cotranscriptional cleavage (CoTC)-type terminator elements at endogenous gene loci. The results of this analysis pave the way for the full understanding of Pol II termination pathways and their roles in gene expression. PMID:23562152
Okeke, Iruka N.; Borneman, Jade A.; Shin, Sooan; Mellies, Jay L.; Quinn, Laura E.; Kaper, James B.
2001-01-01
Enteropathogenic Escherichia coli (EPEC) strains that carry the EPEC adherence factor (EAF) plasmid were screened for the presence of different EAF sequences, including those of the plasmid-encoded regulator (per). Considerable variation in gene content of EAF plasmids from different strains was seen. However, bfpA, the gene encoding the structural subunit for the bundle-forming pilus, bundlin, and per genes were found in 96.8% of strains. Sequence analysis of the per operon and its promoter region from 15 representative strains revealed that it is highly conserved. Most of the variation occurs in the 5′ two-thirds of the perA gene. In contrast, the C-terminal portion of the predicted PerA protein that contains the DNA-binding helix-turn-helix motif is 100% conserved in all strains that possess a full-length gene. In a minority of strains including the O119:H2 and canine isolates and in a subset of O128:H2 and O142:H6 strains, frameshift mutations in perA leading to premature truncation and consequent inactivation of the gene were identified. Cloned perA, -B, and -C genes from these strains, unlike those from strains with a functional operon, failed to activate the LEE1 operon and bfpA transcriptional fusions or to complement a per mutant in reference strain E2348/69. Furthermore, O119, O128, and canine strains that carry inactive per operons were deficient in virulence protein expression. The context in which the perABC operon occurs on the EAF plasmid varies. The sequence upstream of the per promoter region in EPEC reference strains E2348/69 and B171-8 was present in strains belonging to most serogroups. In a subset of O119:H2, O128:H2, and O142:H6 strains and in the canine isolate, this sequence was replaced by an IS1294-homologous sequence. PMID:11500429
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal
Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable themore » differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i.e. cerebellum versus heart for differential variation at the gene, isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the “electron transport chain” and neuronal differentiation, emphasizing that “tissue important” genes are regulated at several levels. Furthermore, our analysis shows that the “across tissue approach” has a promising potential when screening for possible explanations for variations, such as those observed at the gene expression levels.« less
Frank, Till D.; Carmody, Aimée M.; Kholodenko, Boris N.
2012-01-01
We derive a statistical model of transcriptional activation using equilibrium thermodynamics of chemical reactions. We examine to what extent this statistical model predicts synergy effects of cooperative activation of gene expression. We determine parameter domains in which greater-than-additive and less-than-additive effects are predicted for cooperative regulation by two activators. We show that the statistical approach can be used to identify different causes of synergistic greater-than-additive effects: nonlinearities of the thermostatistical transcriptional machinery and three-body interactions between RNA polymerase and two activators. In particular, our model-based analysis suggests that at low transcription factor concentrations cooperative activation cannot yield synergistic greater-than-additive effects, i.e., DNA transcription can only exhibit less-than-additive effects. Accordingly, transcriptional activity turns from synergistic greater-than-additive responses at relatively high transcription factor concentrations into less-than-additive responses at relatively low concentrations. In addition, two types of re-entrant phenomena are predicted. First, our analysis predicts that under particular circumstances transcriptional activity will feature a sequence of less-than-additive, greater-than-additive, and eventually less-than-additive effects when for fixed activator concentrations the regulatory impact of activators on the binding of RNA polymerase to the promoter increases from weak, to moderate, to strong. Second, for appropriate promoter conditions when activator concentrations are increased then the aforementioned re-entrant sequence of less-than-additive, greater-than-additive, and less-than-additive effects is predicted as well. Finally, our model-based analysis suggests that even for weak activators that individually induce only negligible increases in promoter activity, promoter activity can exhibit greater-than-additive responses when transcription factors and RNA polymerase interact by means of three-body interactions. Overall, we show that versatility of transcriptional activation is brought about by nonlinearities of transcriptional response functions and interactions between transcription factors, RNA polymerase and DNA. PMID:22506020
GenePublisher: Automated analysis of DNA microarray data.
Knudsen, Steen; Workman, Christopher; Sicheritz-Ponten, Thomas; Friis, Carsten
2003-07-01
GenePublisher, a system for automatic analysis of data from DNA microarray experiments, has been implemented with a web interface at http://www.cbs.dtu.dk/services/GenePublisher. Raw data are uploaded to the server together with a specification of the data. The server performs normalization, statistical analysis and visualization of the data. The results are run against databases of signal transduction pathways, metabolic pathways and promoter sequences in order to extract more information. The results of the entire analysis are summarized in report form and returned to the user.
Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi
2009-02-01
Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.
Genome-wide uniformity of human ‘open’ pre-initiation complexes
Lai, William K.M.; Pugh, B. Franklin
2017-01-01
Transcription of protein-coding and noncoding DNA occurs pervasively throughout the mammalian genome. Their sites of initiation are generally inferred from transcript 5′ ends and are thought to be either locally dispersed or focused. How these two modes of initiation relate is unclear. Here, we apply permanganate treatment and chromatin immunoprecipitation (PIP-seq) of initiation factors to identify the precise location of melted DNA separately associated with the preinitiation complex (PIC) and the adjacent paused complex (PC). This approach revealed the two known modes of transcription initiation. However, in contrast to prevailing views, they co-occurred within the same promoter region: initiation originating from a focused PIC, and broad nucleosome-linked initiation. PIP-seq allowed transcriptional orientation of Pol II to be determined, which may be useful near promoters where sufficient sense/anti-sense transcript mapping information is lacking. PIP-seq detected divergently oriented Pol II at both coding and noncoding promoters, as well as at enhancers. Their occupancy levels were not necessarily coupled in the two orientations. DNA sequence and shape analysis of initiation complex sites suggest that both sequence and shape contribute to specificity, but in a context-restricted manner. That is, initiation sites have the locally “best” initiator (INR) sequence and/or shape. These findings reveal a common core to pervasive Pol II initiation throughout the human genome. PMID:27927716
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Arko, B; Prezelj, J; Komel, R; Kocijancic, A; Hudler, P; Marc, J
2002-09-01
Osteoprotegerin (OPG) is a recently discovered member of the TNF receptor superfamily that acts as an important paracrine regulator of bone remodeling. OPG knockout mice develop severe osteoporosis, whereas administration of OPG can prevent ovariectomy-induced bone loss. These findings implicate a role for OPG in the development of osteoporosis. In the present study, we screened the OPG gene promoter for sequence variations and examined their association with bone mineral density (BMD) in 103 osteoporotic postmenopausal women. Single-strand conformation polymorphism analysis followed by DNA sequencing revealed a presence of four nucleotide substitutions: 209 G-->A, 245 T-->G, 889 C-->T, and 950 T-->C. The frequencies of genotypes were as follows: GG (89.3%), GA (10.7%) for 209 G-->A polymorphism; TT (89.3%), TG (10.7%) for 245 T-->G polymorphism; and TT (25.2%), TC (53.4%), CC (21.4%) for 950 T-->C polymorphism. Substitution 889 C-->T was found in only two patients. Statistically significant association of genotypes with BMD at the lumbar spine (P = 0.005) was observed for 209 G-->A and 245 T-->G polymorphisms. Haplotype GATG was associated with lower BMD as compared with GGTT haplotype. Our results suggest that 209 G-->A and 245 T-->G polymorphisms in the OPG gene promoter may contribute to the genetic regulation of BMD.
Li, Mingzhuo; Li, Yanzhi; Guo, Lili; Gong, Niandi; Pang, Yongzheng; Jiang, Wenbo; Liu, Yajun; Jiang, Xiaolan; Zhao, Lei; Wang, Yunsheng; Xie, De-Yu; Gao, Liping; Xia, Tao
2017-01-01
Green tea (Camellia sinensis, Cs) abundantly produces a diverse array of phenylpropanoid compounds benefiting human health. To date, the regulation of the phenylpropanoid biosynthesis in tea remains to be investigated. Here, we report a cDNA isolated from leaf tissues, which encodes a R2R3-MYB transcription factor. Amino acid sequence alignment and phylogenetic analysis indicate that it is a member of the MYB4-subgroup and named as CsMYB4a. Transcriptional and metabolic analyses show that the expression profile of CsMYB4a is negatively correlated to the accumulation of six flavan-3-ols and other phenolic acids. GFP fusion analysis shows CsMYB4a’s localization in the nucleus. Promoters of five tea phenylpropanoid pathway genes are isolated and characterized to contain four types of AC-elements, which are targets of MYB4 members. Interaction of CsMYB4a and five promoters shows that CsMYB4a decreases all five promoters’ activity. To further characterize its function, CsMYB4a is overexpressed in tobacco plants. The resulting transgenic plants show dwarf, shrinking and yellowish leaf, and early senescence phenotypes. A further genome-wide transcriptomic analysis reveals that the expression levels of 20 tobacco genes involved in the shikimate and the phenylpropanoid pathways are significantly downregulated in transgenic tobacco plants. UPLC-MS and HPLC based metabolic profiling reveals significant reduction of total lignin content, rutin, chlorogenic acid, and phenylalanine in CsMYB4a transgenic tobacco plants. Promoter sequence analysis of the 20 tobacco genes characterizes four types of AC-elements. Further CsMYB4a-AC element and CsMYB4a-promoter interaction analyses indicate that the negative regulation of CsMYB4a on the shikimate and phenylpropanoid pathways in tobacco is via reducing promoter activity. Taken together, all data indicate that CsMYB4a negatively regulates the phenylpropanoid and shikimate pathways. Highlight: A tea (Camellia sinensis) MYB4a is characterized to encode a R2R3-MYB transcription factor. It is shown to repressively control the phenylpropanoid and shikimate pathway. PMID:28659938
Ran, Kun; Yang, Hongqiang; Sun, Xiaoli; Li, Qiang; Jiang, Qianqian; Zhang, Weiwei; Shen, Wei
2014-05-01
Vacuolar processing enzymes (VPEs) have received considerable attention recently, as they exhibit caspase-1-like cleavage activity and regulate the process of PCD. However, knowledge about their detailed characteristics and structures is relatively limited. In this study, a gamma vacuolar processing enzyme gene, MhVPEγ, has been isolated from the leaves of Malus hupehensis (Ramp) Rehd. var pinyiensis Jiang. MhVPEγ coded-translated protein sequence comprised of 494 amino acids with a signal peptide and a transmembrane helix structure at N-terminal, peptidase_C13 domain, and vacuolar sorting signal at C-terminal. Consequently, genomic walking approach was performed for the isolation of its upstream sequence. Computational analysis demonstrated several motifs of the promoter exhibiting hypothetic MeJA, ABA, and light-induced characteristics, as well as some typical domains universally discovered in promoter, such as TATA-box and CAAT-box. MhVPEγ transcript level was enhanced during wounding treatment, and WUN-motif, as one of the cis-acting regulatory elements existing in the upstream sequence perhaps regulates its expression. In silico-constructed 3D models revealed that MhCPYL successively interacts with MhVPEγ like that of "Induced Fit-Lock and Key" model, providing molecular conformation evidence that CPY is a direct substrate of VPEγ. This study is the first stride to understand the molecular mechanism of VPEγ and CPYL interactions.
Zamuner, Annj; Brun, Paola; Scorzeto, Michele; Sica, Giuseppe; Castagliuolo, Ignazio; Dettin, Monica
2017-09-01
Engineered scaffolds for bone tissue regeneration are designed to promote cell adhesion, growth, proliferation and differentiation. Recently, covalent and selective functionalization of glass and titanium surfaces with an adhesive peptide (HVP) mapped on [351-359] sequence of human Vitronectin allowed to selectively increase osteoblast attachment and adhesion strength in in vitro assays, and to promote osseointegration in in vivo studies. For the first time to our knowledge, in this study we investigated the resistance of adhesion sequences to proteolytic digestion: HVP was completely cleaved after 5 h. In order to overcome the enzymatic degradation of the native peptide under physiological conditions we synthetized three analogues of HVP sequence. A retro-inverted peptide D-2HVP, composed of D amino acids, was completely stable in serum-containing medium. In addition, glass surfaces functionalized with D-2HVP increased human osteoblast adhesion as compared to the native peptide and maintained deposition of calcium. Interestingly, D-2HVP increased expression of IBSP, VTN and SPP1 genes as compared to HVP functionalized surfaces. Total internal reflection fluorescence microscope analysis showed cells with numerous filopodia spread on D-2HVP-functionalized surfaces. Therefore, the D-2HVP sequence is proposed as new osteoblast adhesive peptide with increased bioactivity and high proteolytic resistance.
Switchgrass ubiquitin promoter (PVUBI2) and uses thereof
Stewart, C. Neal; Mann, David George James
2013-12-10
The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.
2013-01-01
Background The binding of transcription factors to DNA plays an essential role in the regulation of gene expression. Numerous experiments elucidated binding sequences which subsequently have been used to derive statistical models for predicting potential transcription factor binding sites (TFBS). The rapidly increasing number of genome sequence data requires sophisticated computational approaches to manage and query experimental and predicted TFBS data in the context of other epigenetic factors and across different organisms. Results We have developed D-Light, a novel client-server software package to store and query large amounts of TFBS data for any number of genomes. Users can add small-scale data to the server database and query them in a large scale, genome-wide promoter context. The client is implemented in Java and provides simple graphical user interfaces and data visualization. Here we also performed a statistical analysis showing what a user can expect for certain parameter settings and we illustrate the usage of D-Light with the help of a microarray data set. Conclusions D-Light is an easy to use software tool to integrate, store and query annotation data for promoters. A public D-Light server, the client and server software for local installation and the source code under GNU GPL license are available at http://biwww.che.sbg.ac.at/dlight. PMID:23617301
[Structural organization of 5S ribosomal DNA of Rosa rugosa].
Tynkevych, Iu O; Volkov, R A
2014-01-01
In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.
The punctilious RNA polymerase II core promoter
Vo ngoc, Long; Wang, Yuan-Liang; Kassavetis, George A.; Kadonaga, James T.
2017-01-01
The signals that direct the initiation of transcription ultimately converge at the core promoter, which is the gateway to transcription. Here we provide an overview of the RNA polymerase II core promoter in bilateria (bilaterally symmetric animals). The core promoter is diverse in terms of its composition and function yet is also punctilious, as it acts with strict rules and precision. We additionally describe an expanded view of the core promoter that comprises the classical DNA sequence motifs, sequence-specific DNA-binding transcription factors, chromatin signals, and DNA structure. This model may eventually lead to a more unified conceptual understanding of the core promoter. PMID:28808065
NASA Technical Reports Server (NTRS)
Romano, Laura A.; Wray, Gregory A.
2003-01-01
Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.
Kiermer, V; Van Lint, C; Briclet, D; Vanhulle, C; Kettmann, R; Verdin, E; Burny, A; Droogmans, L
1998-07-01
Bovine leukemia virus (BLV) replication is controlled by both cis- and trans-acting elements. The virus-encoded transactivator, Tax, is necessary for efficient transcription from the BLV promoter, although it is not present during the early stages of infection. Therefore, sequences that control Tax-independent transcription must play an important role in the initiation of viral gene expression. This study demonstrates that the R-U5 sequence of BLV stimulates Tax-independent reporter gene expression directed by the BLV promoter. R-U5 was also stimulatory when inserted immediately downstream from the transcription initiation site of a heterologous promoter. Progressive deletion analysis of this region revealed that a 46-bp element corresponding to the 5' half of U5 is principally responsible for the stimulation. This element exhibited enhancer activity when inserted upstream or downstream from the herpes simplex virus thymidine kinase promoter. This enhancer contains a binding site for the interferon regulatory factors IRF-1 and IRF-2. A 3-bp mutation that destroys the IRF recognition site caused a twofold decrease in Tax-independent BLV long terminal repeat-driven gene expression. These observations suggest that the IRF binding site in the U5 region of BLV plays a role in the initiation of virus replication.
Gutiérrez, Gabriel; Millán-Zambrano, Gonzalo; Medina, Daniel A; Jordán-Pla, Antonio; Pérez-Ortín, José E; Peñate, Xenia; Chávez, Sebastián
2017-12-07
TFIIS stimulates RNA cleavage by RNA polymerase II and promotes the resolution of backtracking events. TFIIS acts in the chromatin context, but its contribution to the chromatin landscape has not yet been investigated. Co-transcriptional chromatin alterations include subtle changes in nucleosome positioning, like those expected to be elicited by TFIIS, which are elusive to detect. The most popular method to map nucleosomes involves intensive chromatin digestion by micrococcal nuclease (MNase). Maps based on these exhaustively digested samples miss any MNase-sensitive nucleosomes caused by transcription. In contrast, partial digestion approaches preserve such nucleosomes, but introduce noise due to MNase sequence preferences. A systematic way of correcting this bias for massively parallel sequencing experiments is still missing. To investigate the contribution of TFIIS to the chromatin landscape, we developed a refined nucleosome-mapping method in Saccharomyces cerevisiae. Based on partial MNase digestion and a sequence-bias correction derived from naked DNA cleavage, the refined method efficiently mapped nucleosomes in promoter regions rich in MNase-sensitive structures. The naked DNA correction was also important for mapping gene body nucleosomes, particularly in those genes whose core promoters contain a canonical TATA element. With this improved method, we analyzed the global nucleosomal changes caused by lack of TFIIS. We detected a general increase in nucleosomal fuzziness and more restricted changes in nucleosome occupancy, which concentrated in some gene categories. The TATA-containing genes were preferentially associated with decreased occupancy in gene bodies, whereas the TATA-like genes did so with increased fuzziness. The detected chromatin alterations correlated with functional defects in nascent transcription, as revealed by genomic run-on experiments. The combination of partial MNase digestion and naked DNA correction of the sequence bias is a precise nucleosomal mapping method that does not exclude MNase-sensitive nucleosomes. This method is useful for detecting subtle alterations in nucleosome positioning produced by lack of TFIIS. Their analysis revealed that TFIIS generally contributed to nucleosome positioning in both gene promoters and bodies. The independent effect of lack of TFIIS on nucleosome occupancy and fuzziness supports the existence of alternative chromatin dynamics during transcription elongation.
Han, C; Dai, S F; Liu, D C; Pu, Z J; Wei, Y M; Zheng, Y L; Wen, D J; Zhao, L; Yan, Z H
2013-11-18
Previous genetic studies on wheat from various sources have indicated that aluminum (Al) tolerance may have originated independently in USA, Brazil, and China. Here, TaALMT1 promoter sequences of 92 landraces and cultivars from Sichuan, China, were sequenced. Five promoter types (I', II, III, IV, and V) were observed in 39 cultivars, and only three promoter types (I, II, and III) were observed in 53 landraces. Among the wheat collections worldwide, only the Chinese Spring (CS) landrace native to Sichuan, China, carried the TaALMT1 promoter type III. Besides CS, two other Sichuan-bred landraces and six cultivars with TaALMT1 promoter type III were identified in this study. In the phylogenetic tree constructed based on the TaALMT1 promoter sequences, type III formed a separate branch, which was supported by a high bootstrap value. It is likely that TaALMT1 promoter type III originated from Sichuan-bred wheat landraces of China. In addition, the landraces with promoter type I showed the lowest Al tolerance among all landraces and cultivars. Furthermore, the cultivars with promoter type IV showed better Al tolerance than landraces with promoter type II. A comparison of acid tolerance and Al tolerance between cultivars and landraces showed that the landraces had better acid tolerance than the cultivars, whereas the cultivars showed better Al tolerance than the landraces. Moreover, significant difference in Al tolerance was also observed between the cultivars raised by the National Ministry of Agriculture and by Sichuan Province. Among the landraces from different regions, those from the East showed better acid tolerance and Al tolerance than those from the South and West of Sichuan. Additional Al-tolerant and acid-tolerant wheat lines were also identified.
Effect of regulatory peptides on gene transcription.
Khavinson, V Kh; Shataeva, L K; Chernova, A A
2003-09-01
Experimental studies of geroprotective activity of synthetic oligopeptides and conformational analysis of the tetrapeptide Epithalon allowed us to hypothesize that regulatory oligopeptides directly initiate transcription of genes for vitally important proteins. Sequences of nucleotide pairs that can serve as binding sites for tetrapeptide Epithalon were identified in the promoter regions of retinal genes F379, telomerase, and RNA polymerase II.
Manipulation of lignin composition in plants using a tissue-specific promoter
Chapple, Clinton C. S.
2003-08-26
The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.
Satheesh, Viswanathan; Jagannadham, P Tej Kumar; Chidambaranathan, Parameswaran; Jain, P K; Srinivasan, R
2014-12-01
The NAC (NAM, ATAF and CUC) proteins are plant-specific transcription factors implicated in development and stress responses. In the present study 88 pigeonpea NAC genes were identified from the recently published draft genome of pigeonpea by using homology based and de novo prediction programmes. These sequences were further subjected to phylogenetic, motif and promoter analyses. In motif analysis, highly conserved motifs were identified in the NAC domain and also in the C-terminal region of the NAC proteins. A phylogenetic reconstruction using pigeonpea, Arabidopsis and soybean NAC genes revealed 33 putative stress-responsive pigeonpea NAC genes. Several stress-responsive cis-elements were identified through in silico analysis of the promoters of these putative stress-responsive genes. This analysis is the first report of NAC gene family in pigeonpea and will be useful for the identification and selection of candidate genes associated with stress tolerance.
Eastman, Alexander W; Heinrichs, David E; Yuan, Ze-Chun
2014-10-03
Members of the genus Paenibacillus are important plant growth-promoting rhizobacteria that can serve as bio-reactors. Paenibacillus polymyxa promotes the growth of a variety of economically important crops. Our lab recently completed the genome sequence of Paenibacillus polymyxa CR1. As of January 2014, four P. polymyxa genomes have been completely sequenced but no comparative genomic analyses have been reported. Here we report the comparative and genetic analyses of four sequenced P. polymyxa genomes, which revealed a significantly conserved core genome. Complex metabolic pathways and regulatory networks were highly conserved and allow P. polymyxa to rapidly respond to dynamic environmental cues. Genes responsible for phytohormone synthesis, phosphate solubilization, iron acquisition, transcriptional regulation, σ-factors, stress responses, transporters and biomass degradation were well conserved, indicating an intimate association with plant hosts and the rhizosphere niche. In addition, genes responsible for antimicrobial resistance and non-ribosomal peptide/polyketide synthesis are present in both the core and accessory genome of each strain. Comparative analyses also reveal variations in the accessory genome, including large plasmids present in strains M1 and SC2. Furthermore, a considerable number of strain-specific genes and genomic islands are irregularly distributed throughout each genome. Although a variety of plant-growth promoting traits are encoded by all strains, only P. polymyxa CR1 encodes the unique nitrogen fixation cluster found in other Paenibacillus sp. Our study revealed that genomic loci relevant to host interaction and ecological fitness are highly conserved within the P. polymyxa genomes analysed, despite variations in the accessory genome. This work suggets that plant-growth promotion by P. polymyxa is mediated largely through phytohormone production, increased nutrient availability and bio-control mechanisms. This study provides an in-depth understanding of the genome architecture of this species, thus facilitating future genetic engineering and applications in agriculture, industry and medicine. Furthermore, this study highlights the current gap in our understanding of complex plant biomass metabolism in Gram-positive bacteria.
Organization and transient expression of the gene for human U11 snRNA
Clemens, Suter-Crazzolara; Walter, Keller
1991-01-01
The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214
Kumar, Deepak; Sahoo, Dipak K.; Maiti, Indu B.; Dey, Nrisingha
2011-01-01
Background Designing functionally efficient recombinant promoters having reduced sequence homology and enhanced promoter activity will be an important step toward successful stacking or pyramiding of genes in a plant cell for developing transgenic plants expressing desired traits(s). Also basic knowledge regarding plant cell specific expression of a transgene under control of a promoter is crucial to assess the promoter's efficacy. Methodology/Principal Findings We have constructed a set of 10 recombinant promoters incorporating different up-stream activation sequences (UAS) of Mirabilis mosaic virus sub-genomic transcript (MS8, -306 to +27) and TATA containing core domains of Figwort mosaic virus sub-genomic transcript promoter (FS3, −271 to +31). Efficacies of recombinant promoters coupled to GUS and GFP reporter genes were tested in tobacco protoplasts. Among these, a 369-bp long hybrid sub-genomic transcript promoter (MSgt-FSgt) showed the highest activity in both transient and transgenic systems. In a transient system, MSgt-FSgt was 10.31, 2.86 and 2.18 times more active compared to the CaMV35S, MS8 and FS3 promoters, respectively. In transgenic tobacco (Nicotiana tabaccum, var. Samsun NN) and Arabidopsis plants, the MSgt-FSgt hybrid promoter showed 14.22 and 7.16 times stronger activity compared to CaMV35S promoter respectively. The correlation between GUS activity and uidA-mRNA levels in transgenic tobacco plants were identified by qRT-PCR. Both CaMV35S and MSgt-FSgt promoters caused gene silencing but the degree of silencing are less in the case of the MSgt-FSgt promoter compared to CaMV35S. Quantification of GUS activity in individual plant cells driven by the MSgt-FSgt and the CaMV35S promoter were estimated using confocal laser scanning microscopy and compared. Conclusion and Significance We propose strong recombinant promoter MSgt-FSgt, developed in this study, could be very useful for high-level constitutive expression of transgenes in a wide variety of plant cells. PMID:21931783
[Isolation and function of genes regulating aphB expression in Vibrio cholerae].
Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao
2012-02-04
We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.
Blount, Benjamin A.; Weenink, Tim; Vasylechko, Serge; Ellis, Tom
2012-01-01
Yeast is an ideal organism for the development and application of synthetic biology, yet there remain relatively few well-characterised biological parts suitable for precise engineering of this chassis. In order to address this current need, we present here a strategy that takes a single biological part, a promoter, and re-engineers it to produce a fine-graded output range promoter library and new regulated promoters desirable for orthogonal synthetic biology applications. A highly constitutive Saccharomyces cerevisiae promoter, PFY1p, was identified by bioinformatic approaches, characterised in vivo and diversified at its core sequence to create a 36-member promoter library. TetR regulation was introduced into PFY1p to create a synthetic inducible promoter (iPFY1p) that functions in an inverter device. Orthogonal and scalable regulation of synthetic promoters was then demonstrated for the first time using customisable Transcription Activator-Like Effectors (TALEs) modified and designed to act as orthogonal repressors for specific PFY1-based promoters. The ability to diversify a promoter at its core sequences and then independently target Transcription Activator-Like Orthogonal Repressors (TALORs) to virtually any of these sequences shows great promise toward the design and construction of future synthetic gene networks that encode complex “multi-wire” logic functions. PMID:22442681
Blount, Benjamin A; Weenink, Tim; Vasylechko, Serge; Ellis, Tom
2012-01-01
Yeast is an ideal organism for the development and application of synthetic biology, yet there remain relatively few well-characterised biological parts suitable for precise engineering of this chassis. In order to address this current need, we present here a strategy that takes a single biological part, a promoter, and re-engineers it to produce a fine-graded output range promoter library and new regulated promoters desirable for orthogonal synthetic biology applications. A highly constitutive Saccharomyces cerevisiae promoter, PFY1p, was identified by bioinformatic approaches, characterised in vivo and diversified at its core sequence to create a 36-member promoter library. TetR regulation was introduced into PFY1p to create a synthetic inducible promoter (iPFY1p) that functions in an inverter device. Orthogonal and scalable regulation of synthetic promoters was then demonstrated for the first time using customisable Transcription Activator-Like Effectors (TALEs) modified and designed to act as orthogonal repressors for specific PFY1-based promoters. The ability to diversify a promoter at its core sequences and then independently target Transcription Activator-Like Orthogonal Repressors (TALORs) to virtually any of these sequences shows great promise toward the design and construction of future synthetic gene networks that encode complex "multi-wire" logic functions.
Casco-Robles, Martin Miguel; Miura, Tomoya; Chiba, Chikafumi
2015-06-01
The adult newt has the ability to regenerate the neural retina following injury, a process achieved primarily by the retinal pigment epithelium (RPE). To deliver exogenous genes to the RPE for genetic manipulation of regenerative events, we isolated the newt RPE65 promoter region by genome walking. First, we cloned the 2.8 kb RPE65 promoter from the newt, Cynops pyrrhogaster. Sequence analysis revealed several conserved regulatory elements described previously in mouse and human RPE65 promoters. Second, having previously established an I-SceI-mediated transgenic protocol for the newt, we used it here to examine the -657 bp proximal promoter of RPE65. The promoter assay used with F0 transgenic newts confirmed transgene expression of mCherry fluorescent protein in the RPE. Using bioinformatic tools and the TRANSFAC database, we identified a 340 bp CpG island located between -635 and -296 bp in the promoter; this region contains response elements for the microphthalmia-associated transcription factor known as MITF (CACGTG, CATGTG), and E-boxes (CANNTG). Sex-determining region box 9 (or SOX9) response element previously reported in the regulation of RPE genes (including RPE65) was also identified in the newt RPE65 promoter. Third, we identified DNA motif boxes in the newt RPE65 promoter that are conserved among other vertebrates. The newt RPE65 promoter is an invaluable tool for site-specific delivery of exogenous genes or genetic manipulation systems for the study of retinal regeneration in this animal.
Roux-Rouquie, M; Marilley, M
2000-09-15
We have modeled local DNA sequence parameters to search for DNA architectural motifs involved in transcription regulation and promotion within the Xenopus laevis ribosomal gene promoter and the intergenic spacer (IGS) sequences. The IGS was found to be shaped into distinct topological domains. First, intrinsic bends split the IGS into domains of common but different helical features. Local parameters at inter-domain junctions exhibit a high variability with respect to intrinsic curvature, bendability and thermal stability. Secondly, the repeated sequence blocks of the IGS exhibit right-handed supercoiled structures which could be related to their enhancer properties. Thirdly, the gene promoter presents both inherent curvature and minor groove narrowing which may be viewed as motifs of a structural code for protein recognition and binding. Such pre-existing deformations could simply be remodeled during the binding of the transcription complex. Alternatively, these deformations could pre-shape the promoter in such a way that further remodeling is facilitated. Mutations shown to abolish promoter curvature as well as intrinsic minor groove narrowing, in a variant which maintained full transcriptional activity, bring circumstantial evidence for structurally-preorganized motifs in relation to transcription regulation and promotion. Using well documented X. laevis rDNA regulatory sequences we showed that computer modeling may be of invaluable assistance in assessing encrypted architectural motifs. The evidence of these DNA topological motifs with respect to the concept of structural code is discussed.
Donald, R G; Schindler, U; Batschauer, A; Cashmore, A R
1990-01-01
G box and I box sequences of the Arabidopsis thaliana ribulose-bisphosphate-1,5-carboxylase small subunit (RBCS) promoter are required for expression mediated by the Arabidopsis rbcS-1A promoter in transgenic tobacco plants and are bound in vitro by factors from plant nuclear extracts termed GBF and GA-1, respectively. We show here that a -390 to -60 rbcS-1A promoter fragment containing the G box and two I boxes activates transcription from a truncated iso-1-cytochrome c (CYC1) gene promoter in Saccharomyces cerevisiae. Mutagenesis of either the rbcS-1A G box or both I box sequences eliminated the expression mediated by this fragment. When polymerized, I box oligonucleotides were also capable of enhancing expression from the truncated CYC1 promoter. Single-copy G box sequences from the Arabidopsis rbcS-1A, Arabidopsis Adh and tomato rbcS-3A promoters were more potent activators and were used in mobility shift assays to identify a DNA binding activity in yeast functionally similar to GBF. In methylation interference experiments, the binding specificity of the yeast protein was indistinguishable from that obtained with plant nuclear extracts. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2161333
Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters
Wozniak, Christopher E.; Hughes, Kelly T.
2008-01-01
Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950
Leblanc, B; Read, C; Moss, T
1993-02-01
The interaction of the ribosomal transcription factor xUBF with the RNA polymerase I core promoter of Xenopus laevis has been studied both at the DNA and protein levels. It is shown that a single xUBF-DNA complex forms over the 40S initiation site (+1) and involves at least the DNA sequences between -20 and +60 bp. DNA sequences upstream of +10 and downstream of +18 are each sufficient to direct complex formation independently. HMG box 1 of xUBF independently recognizes the sequences -20 to -1 and +1 to +22 and the addition of the N-terminal dimerization domain to HMG box 1 stabilizes its interaction with these sequences approximately 10-fold. HMG boxes 2/3 interact with the DNA downstream of +22 and can independently position xUBF across the initiation site. The C-terminal segment of xUBF, HMG boxes 4, 5 or the acidic domain, directly or indirectly interact with HMG box 1, making the core promoter sequences between -11 and -15 hypersensitive to DNase. This interaction also requires the DNA sequences between +17 and +32, i.e. the HMG box 2/3 binding site. The data suggest extensive folding of the core promoter within the xUBF complex.
Meinel, Dominik M; Heinzinger, Susanne; Eberle, Ute; Ackermann, Nikolaus; Schönberger, Katharina; Sing, Andreas
2018-02-01
Influenza with its annual epidemic waves is a major cause of morbidity and mortality worldwide. However, only little whole genome data are available regarding the molecular epidemiology promoting our understanding of viral spread in human populations. We implemented a RT-PCR strategy starting from patient material to generate influenza A whole genome sequences for molecular epidemiological surveillance. Samples were obtained within the Bavarian Influenza Sentinel. The complete influenza virus genome was amplified by a one-tube multiplex RT-PCR and sequenced on an Illumina MiSeq. We report whole genomic sequences for 50 influenza A H3N2 viruses, which was the predominating virus in the season 2014/15, directly from patient specimens. The dataset included random samples from Bavaria (Germany) throughout the influenza season and samples from three suspected transmission clusters. We identified the outbreak samples based on sequence identity. Whole genome sequencing (WGS) was superior in resolution compared to analysis of single segments or partial segment analysis. Additionally, we detected manifestation of substantial amounts of viral quasispecies in several patients, carrying mutations varying from the dominant virus in each patient. Our rapid whole genome sequencing approach for influenza A virus shows that WGS can effectively be used to detect and understand outbreaks in large communities. Additionally, the genomic data provide in-depth details about the circulating virus within one season.
RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.
Brule, C E; Dean, K M; Grayhack, E J
2016-01-01
The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.
Nur, I; Pascale, E; Furano, A V
1988-01-01
Here we report that the 600 bp promoter-like region at the left end of a newly isolated and characterized rat L1 DNA element can activate the prokaryotic chloramphenicol acyltransferase gene in a rat cell line. Activation only occurs when the promoter region is oriented to the transferase gene as it is to the L1 protein encoding sequences and is 75% inhibited by methylation of just 5 of the 22 CpGs present in the promoter. The G + C rich promoter contains enough CpGs to qualify it as a CpG island, but in contrast to other CpG islands, genomic L1 promoters are fully methylated in both somatic cell and sperm DNA as judged by restriction enzyme analysis. Partial demethylation of the genomic promoters by treatment with 5-azacytidine failed to produce discrete L1 transcripts. The relationship of methylation to the evolutionary history and fate of the rat L1 promoter is discussed. Images PMID:2459662
Retrotransposon Tf1 is targeted to pol II promoters by transcription activators
Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.
2008-01-01
SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330
Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.
Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L
2008-04-11
The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.
Evaluation of the arrestin gene in patients with retinitis pigmentosa or an allied disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeStefano, D.J.; Berson, E.L.; Dryja, T.P.
1994-09-01
Arrestin, also called 48K protein or S-antigen, plays a role in deactivating rhodopsin, the photosensitive, seven-helix, G-protein receptor found in rod photoreceptors. In Drosophila, null mutations in arrestin genes cause a light-dependent photoreceptor degeneration. It is possible that a comparable photoreceptor degeneration in humans is caused by defects in the rod arrestin gene. In order to evaluate this possibility, we are characterizing the human arrestin locus on chromosome 2q. We screened a genomic library (5 million plaques) using an arrestin cDNA clone. Sixty-eight hybridizing clones were identified; portions of 7 clones were sequenced to determine the intron sequence flanking themore » exons. We are using SSCP analysis and direct genomic sequencing to screen the entire coding region, splice donor and acceptor sites, and the promoter region of the arrestin gene in 188 patients with autosomal dominant and 104 patients with autosomal recessive retinitis pigmentosa. We have already obtained flanking intron sequences necessary for SSCP analysis for 13 of 16 exons. So far, we have identified 4 silent base changes at codons 67 (TGC-to-TGT), 107 (CTG-to-CTC), 163 (GCC-to-GCT), and 288 (CTG-to-TGT), all with allele frequencies at 1% or less. Several other variant bands detected by SSCP analysis are currently being sequenced.« less
Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela
2008-01-01
Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163
Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E
2015-03-20
Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.
Chowdhury, M; Taylor, J P; Chang, C F; Rappaport, J; Khalili, K
1992-01-01
A specific RNA sequence located in the leader of all human immunodeficiency virus type 1 (HIV-1) mRNAs termed the transactivation response element, or TAR, is a primary target for induction of HIV-1 long terminal repeat activity by the HIV-1-derived trans-regulatory protein, Tat. Human neurotropic virus, JC virus (JCV), a causative agent of the degenerative demyelinating disease progressive multifocal leukoencephalopathy, contains sequences in the 5' end of the late RNA species with an extensive homology to HIV-1 TAR. In this study, we examined the possible role of the JCV-derived TAR-homologous sequence in Tat-mediated activation of the JCV late promoter (Tada et al., Proc. Natl. Acad. Sci. USA 87:3479-3483, 1990). Results from site-directed mutagenesis revealed that critical G residues required for the function of HIV-1 TAR that are conserved in the JCV TAR homolog play an important role in Tat activation of the JCV promoter. In addition, in vivo competition studies suggest that shared regulatory components mediate Tat activation of the JCV late and HIV-1 long terminal repeat promoters. Furthermore, we showed that the JCV-derived TAR sequence behaves in the same way as HIV-1 TAR in response to two distinct Tat mutants, one of which that has no ability to bind to HIV-1 TAR and another that lacks transcriptional activity on a responsive promoter. These results suggest that the TAR homolog of the JCV late promoter is responsive to HIV-1 Tat induction and thus may participate in the overall activation of the JCV late promoter mediated by this transactivation. Images PMID:1331525
Bruce, A. Gregory; Ryan, Jonathan T.; Thomas, Mathew J.; Peng, Xinxia; Grundhoff, Adam; Tsai, Che-Chung
2013-01-01
The complete sequence of retroperitoneal fibromatosis-associated herpesvirus Macaca nemestrina (RFHVMn), the pig-tailed macaque homolog of Kaposi's sarcoma-associated herpesvirus (KSHV), was determined by next-generation sequence analysis of a Kaposi's sarcoma (KS)-like macaque tumor. Colinearity of genes was observed with the KSHV genome, and the core herpesvirus genes had strong sequence homology to the corresponding KSHV genes. RFHVMn lacked homologs of open reading frame 11 (ORF11) and KSHV ORFs K5 and K6, which appear to have been generated by duplication of ORFs K3 and K4 after the divergence of KSHV and RFHV. RFHVMn contained positional homologs of all other unique KSHV genes, although some showed limited sequence similarity. RFHVMn contained a number of candidate microRNA genes. Although there was little sequence similarity with KSHV microRNAs, one candidate contained the same seed sequence as the positional homolog, kshv-miR-K12-10a, suggesting functional overlap. RNA transcript splicing was highly conserved between RFHVMn and KSHV, and strong sequence conservation was noted in specific promoters and putative origins of replication, predicting important functional similarities. Sequence comparisons indicated that RFHVMn and KSHV developed in long-term synchrony with the evolution of their hosts, and both viruses phylogenetically group within the RV1 lineage of Old World primate rhadinoviruses. RFHVMn is the closest homolog of KSHV to be completely sequenced and the first sequenced RV1 rhadinovirus homolog of KSHV from a nonhuman Old World primate. The strong genetic and sequence similarity between RFHVMn and KSHV, coupled with similarities in biology and pathology, demonstrate that RFHVMn infection in macaques offers an important and relevant model for the study of KSHV in humans. PMID:24109218
Morak, Monika; Ibisler, Ayseguel; Keller, Gisela; Jessen, Ellen; Laner, Andreas; Gonzales-Fassrainer, Daniela; Locher, Melanie; Massdorf, Trisari; Nissen, Anke M; Benet-Pagès, Anna; Holinski-Feder, Elke
2018-04-01
Germline defects in MLH1 , MSH2 , MSH6 and PMS2 predisposing for Lynch syndrome (LS) are mainly based on sequence changes, whereas a constitutional epimutation of MLH1 (CEM) is exceptionally rare. This abnormal MLH1 promoter methylation is not hereditary when arising de novo, whereas a stably heritable and variant-induced CEM was described for one single allele. We searched for MLH1 promoter variants causing a germline or somatic methylation induction or transcriptional repression. We analysed the MLH1 promoter sequence in five different patient groups with colorectal cancer (CRC) (n=480) composed of patients with i) CEM (n=16), ii) unsolved loss of MLH1 expression in CRC (n=37), iii) CpG-island methylator-phenotype CRC (n=102), iv) patients with LS (n=83) and v) MLH1-proficient CRC (n=242) as controls. 1150 patients with non-LS tumours also served as controls to correctly judge the results. We detected 10 rare MLH1 promoter variants. One novel, complex MLH1 variant c.-63_-58delins18 is present in a patient with CRC with CEM and his sister, both showing a complete allele-specific promoter methylation and transcriptional silencing. The other nine promoter variants detected in 17 individuals were not associated with methylation. For four of these, a normal, biallelic MLH1 expression was found in the patients' cDNA. We report the second promoter variant stably inducing a hereditary CEM. Concerning the classification of promoter variants, we discuss contradictory results from the literature for two variants, describe classification discrepancies between existing rules for five variants, suggest the (re-)classification of five promoter variants to (likely) benign and regard four variants as functionally unclear. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Usefulness of heterologous promoters in the Pseudozyma flocculosa gene expression system.
Avis, Tyler J; Anguenot, Raphaël; Neveu, Bertrand; Bolduc, Sébastien; Zhao, Yingyi; Cheng, Yali; Labbé, Caroline; Belzile, François; Bélanger, Richard R
2008-02-01
The basidiomycetous fungus Pseudozyma flocculosa represents a promising new host for the expression of complex recombinant proteins. Two novel heterologous promoter sequences, the Ustilago maydis glyceraldehyde-3-phosphate dehydrogenase (GPD) and Pseudozyma tsukubaensis alpha-glucosidase promoters, were tested for their ability to provide expression in P. flocculosa. In liquid medium, these two promoters produced lower levels of intracellular green fluorescent protein (GFP) as compared to the U. maydis hsp70 promoter. However, GPD and alpha-glucosidase sequences behaved as constitutive promoters whereas the hsp70 promoter appeared to be morphology-dependent. When using the hsp70 promoter, the expression of GFP increased proportionally to the concentration of hygromycin in the culture medium, indicating possible induction of the promoter by the antibiotic. Optimal solid-state culture conditions were designed for high throughput screening of hygromycin-resistant transformants with the hsp70 promoter in P. flocculosa.
Cross-Specificities between cII-like Proteins and pRE-like Promoters of Lambdoid Bacteriophages
Wulff, Daniel L.; Mahoney, Michael E.
1987-01-01
We have investigated the activation of transcription from the pRE promoters of phages λ, 21 and P22 by the λ and 21 cII proteins and the P22 c1 (cII-like) protein, using an in vivo system in which cII protein from a derepressed prophage activates transcription from a pRE DNA fragment on a multicopy plasmid. We find that each protein is highly specific for its own cognate pRE promoter, although measureable cross-reactions are observed. The primary recognition sequence for cII protein on λ pRE is a pair of TTGC repeat sequences in the sequence 5'-TTGCN 6TTGC-3' at the -35 region of the promoter. This same sequence is found in 21 pRE, while P22 pRE has the sequence 5'-TTGCN6TTGT-3', which is the same as that of λctr1, a pRE+ variant of λ. λctr1 pRE is half as active as λ + pRE when assayed with either the λ cII or the P22 c1 proteins. Therefore, the single base change in the P22 repeat sequence cannot explain why the P22 c1 protein is much more active with P22 pRE than λ p RE. The dya5 mutation, a G→A change at position -43 of pRE, makes pRE a stronger promoter when assayed with either the λ or 21 cII proteins or the P22 c1 protein. We conclude that efficient activation of a cII-dependent promoter by a cII protein requires sequence information in addition to the TTGC repeat sequences. We do not know the characteristics of the proteins which are responsible for the specificity of each protein for its own cognate promoter. However, λdya8, which has a Glu27→Lys alteration in the λ cII protein and a cII+ phenotype, results in a mutant cII protein that is much more highly specific than wild-type cII protein for its own cognate λ p RE promoter. This is especially remarkable because the dya8 amino acid alteration makes the helix-2 region (the region of the protein predicted to make contact with the phosphodiester backbone of the DNA) of λ cII protein conform exactly with the helix-2 region of the P22 c1 protein in both charge and charge distribution. PMID:2953649
Promoter regions of potato vacuolar invertase gene in response to sugars and hormones.
Ou, Yongbin; Song, Botao; Liu, Xun; Xie, Conghua; Li, Meng; Lin, Yuan; Zhang, Huiling; Liu, Jun
2013-08-01
Potato vacuolar acid invertase (StvacINV1) (β-fructofuranosidase; EC 3.2.1.26) has been confirmed to play an important role in cold-induced sweetening of potato tubers. However, the transcriptional regulation mechanisms of StvacINV1 are largely unknown. In this study, the 5'-flanking sequence of StvacINV1 was cloned and the cis-acting elements were predicted. Histochemical assay showed that the StvacINV1 promoter governed β-glucuronidase (GUS) expression in potato leaves, stems, roots and tubers. Quantitative analysis of GUS expression suggested that the activity of StvacINV1 promoter was suppressed by sucrose, glucose, fructose, and cold, while enhanced by indole-3-acetic acid (IAA), and gibberellic acid (GA3). Further deletion analysis clarified that the promoter regions from -118 to -551, -551 to -1021, and -1021 to -1521 were required for responding to sucrose/glucose, GA3, and IAA, respectively. These findings provide essential information regarding transcriptional regulation mechanisms of StvacINV1. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Melters, Daniël P; Bradnam, Keith R; Young, Hugh A; Telis, Natalie; May, Michael R; Ruby, J Graham; Sebra, Robert; Peluso, Paul; Eid, John; Rank, David; Garcia, José Fernando; DeRisi, Joseph L; Smith, Timothy; Tobias, Christian; Ross-Ibarra, Jeffrey; Korf, Ian; Chan, Simon W L
2013-01-30
Centromeres are essential for chromosome segregation, yet their DNA sequences evolve rapidly. In most animals and plants that have been studied, centromeres contain megabase-scale arrays of tandem repeats. Despite their importance, very little is known about the degree to which centromere tandem repeats share common properties between different species across different phyla. We used bioinformatic methods to identify high-copy tandem repeats from 282 species using publicly available genomic sequence and our own data. Our methods are compatible with all current sequencing technologies. Long Pacific Biosciences sequence reads allowed us to find tandem repeat monomers up to 1,419 bp. We assumed that the most abundant tandem repeat is the centromere DNA, which was true for most species whose centromeres have been previously characterized, suggesting this is a general property of genomes. High-copy centromere tandem repeats were found in almost all animal and plant genomes, but repeat monomers were highly variable in sequence composition and length. Furthermore, phylogenetic analysis of sequence homology showed little evidence of sequence conservation beyond approximately 50 million years of divergence. We find that despite an overall lack of sequence conservation, centromere tandem repeats from diverse species showed similar modes of evolution. While centromere position in most eukaryotes is epigenetically determined, our results indicate that tandem repeats are highly prevalent at centromeres of both animal and plant genomes. This suggests a functional role for such repeats, perhaps in promoting concerted evolution of centromere DNA across chromosomes.
2013-01-01
Background Centromeres are essential for chromosome segregation, yet their DNA sequences evolve rapidly. In most animals and plants that have been studied, centromeres contain megabase-scale arrays of tandem repeats. Despite their importance, very little is known about the degree to which centromere tandem repeats share common properties between different species across different phyla. We used bioinformatic methods to identify high-copy tandem repeats from 282 species using publicly available genomic sequence and our own data. Results Our methods are compatible with all current sequencing technologies. Long Pacific Biosciences sequence reads allowed us to find tandem repeat monomers up to 1,419 bp. We assumed that the most abundant tandem repeat is the centromere DNA, which was true for most species whose centromeres have been previously characterized, suggesting this is a general property of genomes. High-copy centromere tandem repeats were found in almost all animal and plant genomes, but repeat monomers were highly variable in sequence composition and length. Furthermore, phylogenetic analysis of sequence homology showed little evidence of sequence conservation beyond approximately 50 million years of divergence. We find that despite an overall lack of sequence conservation, centromere tandem repeats from diverse species showed similar modes of evolution. Conclusions While centromere position in most eukaryotes is epigenetically determined, our results indicate that tandem repeats are highly prevalent at centromeres of both animal and plant genomes. This suggests a functional role for such repeats, perhaps in promoting concerted evolution of centromere DNA across chromosomes. PMID:23363705
Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching
2015-01-01
Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517
2013-01-01
Background Cotton (Gossypium spp.) is widely cultivated due to the important economic value of its fiber. However, extreme environmental degradation impedes cotton growth and production. Receptor-like kinase (RLK) proteins play important roles in signal transduction and participate in a diverse range of processes in response to plant hormones and environmental cues. Here, we introduced an RLK gene (GbRLK) from cotton into Arabidopsis and investigated its role in imparting abiotic stress tolerance. Results GbRLK transcription was induced by exogenously supplied abscisic acid (ABA), salicylic acid, methyl jasmonate, mock drought conditions and high salinity. We cloned the promoter sequence of this gene via self-formed adaptor PCR. Sequence analysis revealed that the promoter region contains many cis-acting stress-responsive elements such as ABRE, W-Box, MYB-core, W-Box core, TCA-element and others. We constructed a vector containing a 1,890-bp sequence in the 5′ region upstream of the initiation codon of this promoter and transformed it into Arabidopsis thaliana. GUS histochemical staining analysis showed that GbRLK was expressed mainly in leaf veins, petioles and roots of transgenic Arabidopsis, but not in the cotyledons or root hairs. GbRLK promoter activity was induced by ABA, PEG, NaCl and Verticillium dahliae. Transgenic Arabidopsis with constitutive overexpression of GbRLK exhibited a reduced rate of water loss in leaves in vitro, along with improved salinity and drought tolerance and increased sensitivity to ABA compared with non-transgenic Col-0 Arabidopsis. Expression analysis of stress-responsive genes in GbRLK Arabidopsis revealed that there was increased expression of genes involved in the ABA-dependent signaling pathway (AtRD20, AtRD22 and AtRD26) and antioxidant genes (AtCAT1, AtCCS, AtCSD2 and AtCSD1) but not ion transporter genes (AtNHX1, AtSOS1). Conclusions GbRLK is involved in the drought and high salinity stresses pathway by activating or participating in the ABA signaling pathway. Overexpression of GbRLK may improve stress tolerance by regulating stress-responsive genes to reduce water loss. GbRLK may be employed in the genetic engineering of novel cotton cultivars in the future. Further studying of GbRLK will help elucidate abiotic stress signaling pathways. PMID:23915077
Zhao, Jun; Gao, Yulong; Zhang, Zhiyuan; Chen, Tianzi; Guo, Wangzhen; Zhang, Tianzhen
2013-08-06
Cotton (Gossypium spp.) is widely cultivated due to the important economic value of its fiber. However, extreme environmental degradation impedes cotton growth and production. Receptor-like kinase (RLK) proteins play important roles in signal transduction and participate in a diverse range of processes in response to plant hormones and environmental cues. Here, we introduced an RLK gene (GbRLK) from cotton into Arabidopsis and investigated its role in imparting abiotic stress tolerance. GbRLK transcription was induced by exogenously supplied abscisic acid (ABA), salicylic acid, methyl jasmonate, mock drought conditions and high salinity. We cloned the promoter sequence of this gene via self-formed adaptor PCR. Sequence analysis revealed that the promoter region contains many cis-acting stress-responsive elements such as ABRE, W-Box, MYB-core, W-Box core, TCA-element and others. We constructed a vector containing a 1,890-bp sequence in the 5' region upstream of the initiation codon of this promoter and transformed it into Arabidopsis thaliana. GUS histochemical staining analysis showed that GbRLK was expressed mainly in leaf veins, petioles and roots of transgenic Arabidopsis, but not in the cotyledons or root hairs. GbRLK promoter activity was induced by ABA, PEG, NaCl and Verticillium dahliae. Transgenic Arabidopsis with constitutive overexpression of GbRLK exhibited a reduced rate of water loss in leaves in vitro, along with improved salinity and drought tolerance and increased sensitivity to ABA compared with non-transgenic Col-0 Arabidopsis. Expression analysis of stress-responsive genes in GbRLK Arabidopsis revealed that there was increased expression of genes involved in the ABA-dependent signaling pathway (AtRD20, AtRD22 and AtRD26) and antioxidant genes (AtCAT1, AtCCS, AtCSD2 and AtCSD1) but not ion transporter genes (AtNHX1, AtSOS1). GbRLK is involved in the drought and high salinity stresses pathway by activating or participating in the ABA signaling pathway. Overexpression of GbRLK may improve stress tolerance by regulating stress-responsive genes to reduce water loss. GbRLK may be employed in the genetic engineering of novel cotton cultivars in the future. Further studying of GbRLK will help elucidate abiotic stress signaling pathways.
On the presence and role of human gene-body DNA methylation
Jjingo, Daudi; Conley, Andrew B.; Yi, Soojin V.; Lunyak, Victoria V.; Jordan, I. King
2012-01-01
DNA methylation of promoter sequences is a repressive epigenetic mark that down-regulates gene expression. However, DNA methylation is more prevalent within gene-bodies than seen for promoters, and gene-body methylation has been observed to be positively correlated with gene expression levels. This paradox remains unexplained, and accordingly the role of DNA methylation in gene-bodies is poorly understood. We addressed the presence and role of human gene-body DNA methylation using a meta-analysis of human genome-wide methylation, expression and chromatin data sets. Methylation is associated with transcribed regions as genic sequences have higher levels of methylation than intergenic or promoter sequences. We also find that the relationship between gene-body DNA methylation and expression levels is non-monotonic and bell-shaped. Mid-level expressed genes have the highest levels of gene-body methylation, whereas the most lowly and highly expressed sets of genes both have low levels of methylation. While gene-body methylation can be seen to efficiently repress the initiation of intragenic transcription, the vast majority of methylated sites within genes are not associated with intragenic promoters. In fact, highly expressed genes initiate the most intragenic transcription, which is inconsistent with the previously held notion that gene-body methylation serves to repress spurious intragenic transcription to allow for efficient transcriptional elongation. These observations lead us to propose a model to explain the presence of human gene-body methylation. This model holds that the repression of intragenic transcription by gene-body methylation is largely epiphenomenal, and suggests that gene-body methylation levels are predominantly shaped via the accessibility of the DNA to methylating enzyme complexes. PMID:22577155
Deppdb--DNA electrostatic potential properties database: electrostatic properties of genome DNA.
Osypov, Alexander A; Krutinin, Gleb G; Kamzolova, Svetlana G
2010-06-01
The electrostatic properties of genome DNA influence its interactions with different proteins, in particular, the regulation of transcription by RNA-polymerases. DEPPDB--DNA Electrostatic Potential Properties Database--was developed to hold and provide all available information on the electrostatic properties of genome DNA combined with its sequence and annotation of biological and structural properties of genome elements and whole genomes. Genomes in DEPPDB are organized on a taxonomical basis. Currently, the database contains all the completely sequenced bacterial and viral genomes according to NCBI RefSeq. General properties of the genome DNA electrostatic potential profile and principles of its formation are revealed. This potential correlates with the GC content but does not correspond to it exactly and strongly depends on both the sequence arrangement and its context (flanking regions). Analysis of the promoter regions for bacterial and viral RNA polymerases revealed a correspondence between the scale of these proteins' physical properties and electrostatic profile patterns. We also discovered a direct correlation between the potential value and the binding frequency of RNA polymerase to DNA, supporting the idea of the role of electrostatics in these interactions. This matches a pronounced tendency of the promoter regions to possess higher values of the electrostatic potential.
Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert
2014-11-11
The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.
Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert
2014-01-01
The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations. PMID:25393897
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kogure, Takahisa; Faculty of Applied Life Sciences, Niigata University of Pharmacy and Applied Life Sciences, Higashijima 265-1, Niitsu, Niigata 956-8603; Takagi, Masamichi
2005-04-01
The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated thatmore » three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism.« less
The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis
Kessler, Peter S.; Blank, Carrine; Leigh, John A.
1998-01-01
Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920
Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J.
2008-01-01
Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTSGut). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIBGat domain) and a mannitol/fructose-specific EIIA-like domain (EIIAMtl domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBCGut negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710
Kourennaia, Olga V; Tsujikawa, Laura; Dehaseth, Pieter L
2005-10-01
Upon the exposure of Escherichia coli to high temperature (heat shock), cellular levels of the transcription factor sigma32 rise greatly, resulting in the increased formation of the sigma32 holoenzyme, which is capable of transcription initiation at heat shock promoters. Higher levels of heat shock proteins render the cell better able to cope with the effects of higher temperatures. To conduct structure-function studies on sigma32 in vivo, we have carried out site-directed mutagenesis and employed a previously developed system involving sigma32 expression from one plasmid and a beta-galactosidase reporter gene driven by the sigma32-dependent groE promoter on another in order to monitor the effects of single amino acid substitutions on sigma32 activity. It was found that the recognition of the -35 region involves similar amino acid residues in regions 4.2 of E. coli sigma32 and sigma70. Three conserved amino acids in region 2.3 of sigma32 were found to be only marginally important in determining activity in vivo. Differences between sigma32 and sigma70 in the effects of mutation in region 2.4 on the activities of the two sigma factors are consistent with the pronounced differences between both the amino acid sequences in this region and the recognized promoter DNA sequences.
Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.
Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping
2018-04-01
Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.
Song, Qinxin; Wei, Guijiang; Zhou, Guohua
2014-07-01
A portable bioluminescence analyser for detecting the DNA sequence of genetically modified organisms (GMOs) was developed by using a photodiode (PD) array. Pyrosequencing on eight genes (zSSIIb, Bt11 and Bt176 gene of genetically modified maize; Lectin, 35S-CTP4, CP4EPSPS, CaMV35S promoter and NOS terminator of the genetically modified Roundup ready soya) was successfully detected with this instrument. The corresponding limit of detection (LOD) was 0.01% with 35 PCR cycles. The maize and soya available from three different provenances in China were detected. The results indicate that pyrosequencing using the small size of the detector is a simple, inexpensive, and reliable way in a farm/field test of GMO analysis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Regulatory sequence of cupin family gene
Hood, Elizabeth; Teoh, Thomas
2017-07-25
This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.
NASA Astrophysics Data System (ADS)
Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.
2018-05-01
Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.
Research Resource: Aorta- and Liver-Specific ERα-Binding Patterns and Gene Regulation by Estrogen
Gordon, Francesca K.; Vallaster, Caroline S.; Westerling, Thomas; Iyer, Lakshmanan K.; Brown, Myles
2014-01-01
Estrogen has vascular protective effects in premenopausal women and in women younger than 60 years who are receiving hormone replacement therapy. However, estrogen also increases the risks of breast and uterine cancers and of venous thromboses linked to up-regulation of coagulation factors in the liver. In mouse models, the vasculoprotective effects of estrogen are mediated by the estrogen receptor α (ERα) transcription factor. Here, through next-generation sequencing approaches, we show that almost all of the genes regulated by 17β-estradiol (E2) differ between mouse aorta and mouse liver, ex vivo, and that this difference is associated with a distinct genomewide distribution of ERα on chromatin. Bioinformatic analysis of E2-regulated promoters and ERα binding site sequences identify several transcription factors that may determine the tissue specificity of ERα binding and E2-regulated genes, including the enrichment of NF-κB, AML1, and AP1 sites in the promoters of E2 down-regulated inflammatory genes in aorta but not liver. The possible vascular-specific functions of these factors suggest ways in which the protective effects of estrogen could be promoted in the vasculature without incurring negative effects in other tissues. PMID:24992180
NASA Astrophysics Data System (ADS)
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Yang, Jilong; Annala, Matti; Ji, Ping; Wang, Guowen; Zheng, Hong; Codgell, David; Du, Xiaoling; Fang, Zhiwei; Sun, Baocun; Nykter, Matti; Chen, Kexin; Zhang, Wei
2014-10-10
The identification of fusion genes such as SYT-SSX1/SSX2, PAX3-FOXO1, TPM3/TPM4-ALK and EWS-FLI1 in human sarcomas has provided important insight into the diagnosis and targeted therapy of sarcomas. No recurrent fusion has been reported in human osteosarcoma. Transcriptome sequencing was used to characterize the gene fusions and mutations in 11 human osteosarcomas. Nine of 11 samples were found to harbor genetic inactivating alterations in the TP53 pathway. Two recurrent fusion genes associated with the 12q locus, LRP1-SNRNP25 and KCNMB4-CCND3, were identified and validated by RT-PCR, Sanger sequencing and fluorescence in situ hybridization, and were found to be osteosarcoma specific in a validation cohort of 240 other sarcomas. Expression of LRP1-SNRNP25 fusion gene promoted SAOS-2 osteosarcoma cell migration and invasion. Expression of KCNMB4-CCND3 fusion gene promoted SAOS-2 cell migration. Our study represents the first whole transcriptome analysis of untreated human osteosarcoma. Our discovery of two osteosarcoma specific fusion genes associated with osteosarcoma cellular motility highlights the heterogeneity of osteosarcoma and provides opportunities for new treatment modalities.
De Nicola, Beatrice; Lech, Christopher J; Heddi, Brahim; Regmi, Sagar; Frasson, Ilaria; Perrone, Rosalba; Richter, Sara N; Phan, Anh Tuân
2016-07-27
The long terminal repeat (LTR) of the proviral human immunodeficiency virus (HIV)-1 genome is integral to virus transcription and host cell infection. The guanine-rich U3 region within the LTR promoter, previously shown to form G-quadruplex structures, represents an attractive target to inhibit HIV transcription and replication. In this work, we report the structure of a biologically relevant G-quadruplex within the LTR promoter region of HIV-1. The guanine-rich sequence designated LTR-IV forms a well-defined structure in physiological cationic solution. The nuclear magnetic resonance (NMR) structure of this sequence reveals a parallel-stranded G-quadruplex containing a single-nucleotide thymine bulge, which participates in a conserved stacking interaction with a neighboring single-nucleotide adenine loop. Transcription analysis in a HIV-1 replication competent cell indicates that the LTR-IV region may act as a modulator of G-quadruplex formation in the LTR promoter. Consequently, the LTR-IV G-quadruplex structure presented within this work could represent a valuable target for the design of HIV therapeutics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad
2014-01-01
In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.
Functional sequencing read annotation for high precision microbiome analysis
Zhu, Chengsheng; Miller, Maximilian; Marpaka, Srinayani; Vaysberg, Pavel; Rühlemann, Malte C; Wu, Guojun; Heinsen, Femke-Anouska; Tempel, Marie; Zhao, Liping; Lieb, Wolfgang; Franke, Andre; Bromberg, Yana
2018-01-01
Abstract The vast majority of microorganisms on Earth reside in often-inseparable environment-specific communities—microbiomes. Meta-genomic/-transcriptomic sequencing could reveal the otherwise inaccessible functionality of microbiomes. However, existing analytical approaches focus on attributing sequencing reads to known genes/genomes, often failing to make maximal use of available data. We created faser (functional annotation of sequencing reads), an algorithm that is optimized to map reads to molecular functions encoded by the read-correspondent genes. The mi-faser microbiome analysis pipeline, combining faser with our manually curated reference database of protein functions, accurately annotates microbiome molecular functionality. mi-faser’s minutes-per-microbiome processing speed is significantly faster than that of other methods, allowing for large scale comparisons. Microbiome function vectors can be compared between different conditions to highlight environment-specific and/or time-dependent changes in functionality. Here, we identified previously unseen oil degradation-specific functions in BP oil-spill data, as well as functional signatures of individual-specific gut microbiome responses to a dietary intervention in children with Prader–Willi syndrome. Our method also revealed variability in Crohn's Disease patient microbiomes and clearly distinguished them from those of related healthy individuals. Our analysis highlighted the microbiome role in CD pathogenicity, demonstrating enrichment of patient microbiomes in functions that promote inflammation and that help bacteria survive it. PMID:29194524
Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad
2014-01-01
In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935
Yoshino, T P; Wu, X J; Liu, H D
1998-09-01
Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable integration and expression of snail genes of interest into the Bge cell line.
Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu
2007-03-01
Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.
Bertalan, Marcelo; Albano, Rodolpho; de Pádua, Vânia; Rouws, Luc; Rojas, Cristian; Hemerly, Adriana; Teixeira, Kátia; Schwab, Stefan; Araujo, Jean; Oliveira, André; França, Leonardo; Magalhães, Viviane; Alquéres, Sylvia; Cardoso, Alexander; Almeida, Wellington; Loureiro, Marcio Martins; Nogueira, Eduardo; Cidade, Daniela; Oliveira, Denise; Simão, Tatiana; Macedo, Jacyara; Valadão, Ana; Dreschsel, Marcela; Freitas, Flávia; Vidal, Marcia; Guedes, Helma; Rodrigues, Elisete; Meneses, Carlos; Brioso, Paulo; Pozzer, Luciana; Figueiredo, Daniel; Montano, Helena; Junior, Jadier; de Souza Filho, Gonçalo; Martin Quintana Flores, Victor; Ferreira, Beatriz; Branco, Alan; Gonzalez, Paula; Guillobel, Heloisa; Lemos, Melissa; Seibel, Luiz; Macedo, José; Alves-Ferreira, Marcio; Sachetto-Martins, Gilberto; Coelho, Ana; Santos, Eidy; Amaral, Gilda; Neves, Anna; Pacheco, Ana Beatriz; Carvalho, Daniela; Lery, Letícia; Bisch, Paulo; Rössle, Shaila C; Ürményi, Turán; Rael Pereira, Alessandra; Silva, Rosane; Rondinelli, Edson; von Krüger, Wanda; Martins, Orlando; Baldani, José Ivo; Ferreira, Paulo CG
2009-01-01
Background Gluconacetobacter diazotrophicus Pal5 is an endophytic diazotrophic bacterium that lives in association with sugarcane plants. It has important biotechnological features such as nitrogen fixation, plant growth promotion, sugar metabolism pathways, secretion of organic acids, synthesis of auxin and the occurrence of bacteriocins. Results Gluconacetobacter diazotrophicus Pal5 is the third diazotrophic endophytic bacterium to be completely sequenced. Its genome is composed of a 3.9 Mb chromosome and 2 plasmids of 16.6 and 38.8 kb, respectively. We annotated 3,938 coding sequences which reveal several characteristics related to the endophytic lifestyle such as nitrogen fixation, plant growth promotion, sugar metabolism, transport systems, synthesis of auxin and the occurrence of bacteriocins. Genomic analysis identified a core component of 894 genes shared with phylogenetically related bacteria. Gene clusters for gum-like polysaccharide biosynthesis, tad pilus, quorum sensing, for modulation of plant growth by indole acetic acid and mechanisms involved in tolerance to acidic conditions were identified and may be related to the sugarcane endophytic and plant-growth promoting traits of G. diazotrophicus. An accessory component of at least 851 genes distributed in genome islands was identified, and was most likely acquired by horizontal gene transfer. This portion of the genome has likely contributed to adaptation to the plant habitat. Conclusion The genome data offer an important resource of information that can be used to manipulate plant/bacterium interactions with the aim of improving sugarcane crop production and other biotechnological applications. PMID:19775431
Zhang, X; Wang, C; Zhang, Y; Ju, Z; Qi, C; Wang, X; Huang, J; Zhang, S; Li, J; Zhong, J; Shi, F
2014-10-01
Katanin p60 subunit A-like 1 (KATNAL1) is an ATPase that regulates Sertoli cell microtubule dynamics and sperm retention. We evaluated one novel splice variant and characterized the promoter and a functional single nucleotide polymorphism (SNP) of the bovine KATNAL1 gene to explore its expression pattern, possible regulatory mechanism and relationship with semen traits in Chinese Holstein bulls. A novel splice variant, KATNAL1 transcript variant 2 (KATNAL1-TV2) of the retained 68 bp in intron 2, was identified by RT-PCR and compared with KATNAL1 transcript variant 1 (KATNAL1-TV1, NM 001192918.1) in various tissues. Bioinformatics analyses predicted that KATNAL1 transcription was regulated by two promoters: P1 in KATNAL1-TV1 and P2 in KATNAL1-TV2. Results of qRT-PCR revealed that KATNAL1-TV1 had higher expression than did KATNAL1-TV2 in testes of adult bulls (P < 0.05). Promoter luciferase activity analysis suggested that the core sequences of P1 and P2 were mapped to the region of c.-575˜c.-180 and c.163-40˜c.333+59 respectively. One novel SNP (c.163-210T>C, ss836312085) located in intron 1 was found using sequence alignment. The SNP in P2 resulted in the presence of the DeltaE binding site, improving its basal promoter activity (P < 0.05); and we observed a greater sperm deformity rate in bulls with the genotype CC than in those with the genotype TT (P < 0.05), which indicated that different genotypes were associated with the bovine semen traits. Bioinformatics analysis of the KATNAL1 protein sequence predicted that the loss of the MIT domain in the KATNAL1-TV2 transcript resulted in protein dysfunction. These findings help us to understand that a functional SNP in P2 and subsequent triggering of expression diversity of KATNAL1 transcripts are likely to play an important role with regard to semen traits in bull breeding programs. © 2014 Stichting International Foundation for Animal Genetics.
Liu, Bingqiang; Zhang, Hanyuan; Zhou, Chuan; Li, Guojun; Fennell, Anne; Wang, Guanghui; Kang, Yu; Liu, Qi; Ma, Qin
2016-08-09
Phylogenetic footprinting is an important computational technique for identifying cis-regulatory motifs in orthologous regulatory regions from multiple genomes, as motifs tend to evolve slower than their surrounding non-functional sequences. Its application, however, has several difficulties for optimizing the selection of orthologous data and reducing the false positives in motif prediction. Here we present an integrative phylogenetic footprinting framework for accurate motif predictions in prokaryotic genomes (MP(3)). The framework includes a new orthologous data preparation procedure, an additional promoter scoring and pruning method and an integration of six existing motif finding algorithms as basic motif search engines. Specifically, we collected orthologous genes from available prokaryotic genomes and built the orthologous regulatory regions based on sequence similarity of promoter regions. This procedure made full use of the large-scale genomic data and taxonomy information and filtered out the promoters with limited contribution to produce a high quality orthologous promoter set. The promoter scoring and pruning is implemented through motif voting by a set of complementary predicting tools that mine as many motif candidates as possible and simultaneously eliminate the effect of random noise. We have applied the framework to Escherichia coli k12 genome and evaluated the prediction performance through comparison with seven existing programs. This evaluation was systematically carried out at the nucleotide and binding site level, and the results showed that MP(3) consistently outperformed other popular motif finding tools. We have integrated MP(3) into our motif identification and analysis server DMINDA, allowing users to efficiently identify and analyze motifs in 2,072 completely sequenced prokaryotic genomes. The performance evaluation indicated that MP(3) is effective for predicting regulatory motifs in prokaryotic genomes. Its application may enhance progress in elucidating transcription regulation mechanism, thus provide benefit to the genomic research community and prokaryotic genome researchers in particular.
Daspute, Abhijit Arun; Kobayashi, Yuriko; Panda, Sanjib Kumar; Fakrudin, Bashasab; Kobayashi, Yasufumi; Tokizawa, Mutsutomo; Iuchi, Satoshi; Choudhary, Arbind Kumar; Yamamoto, Yoshiharu Y; Koyama, Hiroyuki
2018-01-01
Al-responsive citrate-transporting CcMATE1 function and its regulation by CcSTOP1 were analyzed using NtSTOP1 -KD tobacco- and pigeonpea hairy roots, respectively, CcSTOP1 binding sequence of CcMATE1 showed similarity with AtALMT1 promoter. The molecular mechanisms of Aluminum (Al) tolerance in pigeonpea (Cajanus cajan) were characterized to provide information for molecular breeding. Al-inducible citrate excretion was associated with the expression of MULTIDRUGS AND TOXIC COMPOUNDS EXCLUSION (CcMATE1), which encodes a citrate transporter. Ectopic expression of CcMATE1-conferred Al tolerance to hairy roots of transgenic tobacco with the STOP1 regulation system knocked down. This gain-of-function approach clearly showed CcMATE1 was involved in Al detoxification. The expression of CcMATE1 and another Al-tolerance gene, ALUMINUM SENSITIVE 3 (CcALS3), was regulated by SENSITIVE TO PROTON RHIZOTOXICITY1 (CcSTOP1) according to loss-of-function analysis of pigeonpea hairy roots in which CcSTOP1 was suppressed. An in vitro binding assay showed that the Al-responsive CcMATE1 promoter contained the GGNVS consensus bound by CcSTOP1. Mutation of GGNVS inactivated the Al-inducible expression of CcMATE1 in pigeonpea hairy roots. This indicated that CcSTOP1 binding to the promoter is critical for CcMATE1 expression. The STOP1 binding sites of both the CcMATE1 and AtALMT1 promoters contained GGNVS and a flanking 3' sequence. The GGNVS region was identical in both CcMATE1 and AtALMT1. By contrast, the 3' flanking sequence with binding affinity to STOP1 did not show similarity. Putative STOP1 binding sites with similar structures were also found in Al-inducible MATE and ALMT1 promoters in other plant species. The characterized Al-responsive CcSTOP1 and CcMATE1 genes will help in pigeonpea breeding in acid soil tolerance.
Thomas, Vincent; Mazard, Blandine; Garcia, Caroline; Lacan, Philippe; Gagnieu, Marie-Claude; Joly, Philippe
2013-09-23
Minucci et al. have proposed in 2010 a rapid, simple and cost-effective HRM method on the LightCycler 480® apparatus (Roche) for the determination of the 6/6, 6/7 and 7/7 genotypes of the (TA)n UGT1A1 promoter polymorphism. However, they have not studied the n=5 and n=8 alleles which can be quite frequent in sickle-cell disease patients. The aim of our study was to test this HRM protocol to all the 10 possible (TA)n UGT1A1 genotypes (i.e. 5/5, 5/6, 5/7, 5/8, 6/6, 6/7, 6/8, 7/7, 7/8 and 8/8) by using our SCD cohort of patients. All genotypes could be unambiguously identified except 6/7 and 6/8 which give a similar HRM profile. For those two genotypes, the differentiation necessitates either a direct Sanger sequencing or a second PCR protocol followed by a 3% agarose gel migration. For the (TA)n UGT1A1 promoter genotyping of African patients, each lab has to wonder what is the best way between (i) direct Sanger sequencing of all patients and (ii) HRM protocol for all patients followed by a complementary analysis to differentiate the 6/7 and 6/8 genotypes. © 2013. Published by Elsevier B.V. All rights reserved.
The identification of cis-regulatory elements: A review from a machine learning perspective.
Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W
2015-12-01
The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field. Crown Copyright © 2015. Published by Elsevier Ireland Ltd. All rights reserved.
Roux-Rouquie, Magali; Marilley, Monique
2000-01-01
We have modeled local DNA sequence parameters to search for DNA architectural motifs involved in transcription regulation and promotion within the Xenopus laevis ribosomal gene promoter and the intergenic spacer (IGS) sequences. The IGS was found to be shaped into distinct topological domains. First, intrinsic bends split the IGS into domains of common but different helical features. Local parameters at inter-domain junctions exhibit a high variability with respect to intrinsic curvature, bendability and thermal stability. Secondly, the repeated sequence blocks of the IGS exhibit right-handed supercoiled structures which could be related to their enhancer properties. Thirdly, the gene promoter presents both inherent curvature and minor groove narrowing which may be viewed as motifs of a structural code for protein recognition and binding. Such pre-existing deformations could simply be remodeled during the binding of the transcription complex. Alternatively, these deformations could pre-shape the promoter in such a way that further remodeling is facilitated. Mutations shown to abolish promoter curvature as well as intrinsic minor groove narrowing, in a variant which maintained full transcriptional activity, bring circumstantial evidence for structurally-preorganized motifs in relation to transcription regulation and promotion. Using well documented X.laevis rDNA regulatory sequences we showed that computer modeling may be of invaluable assistance in assessing encrypted architectural motifs. The evidence of these DNA topological motifs with respect to the concept of structural code is discussed. PMID:10982860
Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg
2011-01-07
O⁶-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR = 5.23, 95% CI [2.089-13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR = 3.076, 95% CI [1.301-7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting.
Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg
2011-01-01
O6-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR = 5.23, 95% CI [2.089–13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR = 3.076, 95% CI [1.301–7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting. PMID:21249131
Promoter mutation is a common variant in GJC2-associated Pelizaeus-Merzbacher-like disease.
Meyer, E; Kurian, M A; Morgan, N V; McNeill, A; Pasha, S; Tee, L; Younis, R; Norman, A; van der Knaap, M S; Wassmer, E; Trembath, R C; Brueton, L; Maher, E R
2011-12-01
Pelizaeus-Merzbacher-like disease (PMLD) is a clinically and genetically heterogeneous neurological disorder of cerebral hypomyelination. It is clinically characterised by early onset (usually infantile) nystagmus, impaired motor development, ataxia, choreoathetoid movements, dysarthria and progressive limb spasticity. We undertook autozygosity mapping studies in a large consanguineous family of Pakistani origin in which affected children had progressive lower limb spasticity and features of cerebral hypomyelination on MR brain imaging. SNP microarray and microsatellite marker analysis demonstrated linkage to chromosome 1q42.13-1q42.2. Direct sequencing of the gap junction protein gamma-2 gene, GJC2, identified a promoter region mutation (c.-167A>G) in the non-coding exon 1. The c.-167A>G promoter mutation was identified in a further 4 individuals from two families (who were also of Pakistani origin) with clinical and radiological features of PMLD in whom previous routine diagnostic screening of GJC2 had been reported as negative. A common haplotype was identified at the GJC2 locus in the three mutation-positive families, consistent with a common origin for the mutation and likely founder effect. This promoter mutation has only recently been reported in GJC2-PMLD but it has been postulated to affect the binding of the transcription factor SOX10 and appears to be a prevalent mutation, accounting for ~29% of reported patients with GJC2-PMLD. We propose that diagnostic screening of GJC2 should include sequence analysis of the non-coding exon 1, as well as the coding regions to avoid misdiagnosis or diagnostic delay in suspected PMLD. Copyright © 2011 Elsevier Inc. All rights reserved.
R1, a novel repressor of the human monoamine oxidase A.
Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C
2005-03-25
Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
Biedler, James K; Tu, Zhijian
2010-07-08
The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1) in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a 1 kb fragment upstream of the AaKLC2.1 start codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.
Antonini, S R; N'Diaye, N; Baldacchino, V; Hamet, P; Tremblay, J; Lacroix, A
2004-07-01
Gastric inhibitory polypeptide (GIP)-dependent Cushing's syndrome (CS) results from the ectopic expression of non-mutated GIP receptor (hGIPR) in the adrenal cortex. We evaluated whether mutations or polymorphisms in the regulatory region of the GIPR gene could lead to this aberrant expression. We studied 9.0kb upstream and 1.3kb downstream of the GIPR gene putative promoter (pProm) by sequencing leukocyte DNA from controls and from adrenal tissues of GIP- and non-GIP-dependent CS patients. The putative proximal promoter region (800 bp) and the first exon and intron of the hGIPR gene were sequenced on adrenal DNA from nine GIP-dependent CS, as well as on leukocyte DNA of nine normal controls. Three variations found in this region were found in all patients and controls; at position -4/-5, an insertion of a T was seen in four out of nine patients and in five out of nine controls. Transient transfection studies conducted in rat GC and mouse Y1 cells showed that the TT allele confers loss of 40% in the promoter activity. The analysis of the 8-kb distal pProm region revealed eight distal single nucleotide polymorphisms (SNPs) without probable association with the disease, since frequencies in patients and controls were very similar. In conclusion, mutations or SNPs in the regulatory region of the GIPR gene are unlikely to underlie GIP-dependent CS. Copyright 2004 Elsevier Ltd.
Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy
2018-05-09
Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.
Guo, Hongfang; Raza, Sayed Haidar Abbas; Schreurs, Nicola M; Khan, Rajwali; Wei, Dawei; Wang, Li; Zhang, Song; Zhang, Le; Wu, Sen; Ullah, Irfan; Hosseini, Seyed Mahdi; Zan, Linsen
2018-06-08
Krüppel-like factor 3 (KLF3), a member of the Krüppel-like factor (KLF) family, plays an important role in adipogenesis and lipid metabolism. The aim of this study was to investigate whether KLF3 could be used as a candidate gene in the breeding of cattle. The expression pattern of bovine KLF3 gene revealed that it was highly expressed in abdominal fat and perirenal fat. Using DNA sequencing, three single nucleotide polymorphisms (SNPs) within the promoter regions of KLF3 gene were identified in 448 Qinchuan cattle, which are located in the recognition sequences of 11 transcription factors and the four haplotypes representing four potential different compositions of polymorphic potential cis-acting elements. Association analysis results indicated that individuals with the Hap7/7 diplotype showed higher (P < 0.05) intramuscular fat content (IFC) than those with H7/8. In addition, the H7 haplotype had much higher (P < 0.05) transcriptional activity than the H8 haplotype, consistent with the association analysis. We speculated that polymorphisms in transcription factor binding sites of the KLF3 promoter region affected transcriptional activity of KLF3, which subsequently influence intramuscular fat content in Qinchuan cattle and KLF3 gene could be used as molecular markers for fat deposition traits using early marker-assisted selection (MAS) of Qinchuan cattle breeding in the future. Copyright © 2017. Published by Elsevier B.V.
Panesso, Diana; Abadía-Patiño, Lorena; Vanegas, Natasha; Reynolds, Peter E.; Courvalin, Patrice; Arias, Cesar A.
2005-01-01
The vanC glycopeptide resistance gene cluster encodes enzymes required for synthesis of peptidoglycan precursors ending in d-Ala-d-Ser. Enterococcus gallinarum BM4174 and SC1 are constitutively and inducibly resistant to vancomycin, respectively. Analysis of peptidoglycan precursors in both strains indicated that UDP-MurNAc-tetrapeptide and UDP-MurNAc-pentapeptide[d-Ser] were synthesized in E. gallinarum SC1 only in the presence of vancomycin (4 μg/ml), whereas the “resistance” precursors accumulated in the cytoplasm of BM4174 cells under both inducing and noninducing conditions. Northern hybridization and reverse transcription-PCR experiments revealed that all the genes from the cluster, vanC-1, vanXYC, vanT, vanRC, and vanSC, were transcribed from a single promoter. In the inducible SC1 isolate, transcriptional regulation appeared to be responsible for inducible expression of resistance. Promoter mapping in E. gallinarum BM4174 revealed that the transcriptional start site was located 30 nucleotides upstream from vanC-1 and that the −10 promoter consensus sequence had high identity with that of the vanA cluster. Comparison of the deduced sequence of the vanSC genes from isolates with constitutive and inducible resistance revealed several amino acid substitutions located in the X box (R200L) and in the region between the F and G2 boxes (D312N, D312A, and G320S) of the putative sensor kinase proteins from isolates with constitutive resistance. PMID:15728903
Reducing DNA context dependence in bacterial promoters
Carr, Swati B.; Densmore, Douglas M.
2017-01-01
Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998
Paul-Samojedny, Monika; Kowalczyk, Malgorzata; Suchanek, Renata; Owczarek, Aleksander; Fila-Danilow, Anna; Szczygiel, Aleksandra; Kowalski, Jan
2010-09-01
Schizophrenia is a multifactorial disease with changes in immunological system. Such changes are the result of cytokine-level disturbances connected with cytokine gene polymorphisms. However, research about cytokine gene polymorphisms in schizophrenia has been surprisingly limited and ambiguous. The aim of the study was to identify whether polymorphisms of interleukin (IL)-6 and IL-10 are risk factors for the development of paranoid schizophrenia in case-control study. IL-6 (-174G/C; rs 1800795) and IL-10 (-1082G/A; rs 1800896) promoter polymorphisms in patients with paranoid schizophrenia and healthy individuals were genotyped using polymerase chain reaction-restriction fragment length polymorphism method. Differences in IL-6 and IL-10 promoter haplotypes may play an important role in determining the transcription level for IL-6 and IL-10 genes in schizophrenic patients. The presence of allele C at position -174 of IL-6 promoter sequence may correlate with increasing risk of paranoid schizophrenia in the Polish population, but research on a broadened group of people is needed. The presence of allele G at position -1082 of IL-10 promoter sequence correlates with increasing risk of paranoid schizophrenia in the Polish population. The coexistence of genotype GG at position -1082 of IL-10 promoter sequence and genotype GC at position -174 of IL-6 promoter sequence correlates with increasing risk of paranoid schizophrenia in the Polish population.
Cloning and characterization of the mouse XPAC gene.
van Oostrom, C T; de Vries, A; Verbeek, S J; van Kreijl, C F; van Steeg, H
1994-01-01
Xeroderma Pigmentosum is a human disease, which is, among others, characterized by a high incidence of (sunlight induced) skin cancer, due to a defect in nucleotide excision repair (NER). The human DNA repair gene XPAC corrects this defect in cells isolated from Xeroderma Pigmentosum complementation group A (XP-A) patients. To enable the development of a transgenic mouse model for XP-A by gene targeting in embryonic stem cells, we cloned and characterized the mouse homologue of the XPAC gene. The mouse XPAC gene was found to consist of 6 exons, spanning approximately 21 kb. The nucleotide sequence of the exons is identical to that of the also cloned the mouse XPAC cDNA. Furthermore, the deduced amino acid sequence of the XPAC protein is the same as the one published previously by Tanaka et al. From CAT assay analysis, the promoter of the XPAC gene appeared to be located within 313 bp upstream of the assumed transcriptional start site. Like the promoters of other eukaryotic DNA repair genes (i.e. ERCC-1 and XPBC/ERCC-3), the mouse XPAC promoter region lacks classical promoter elements like TATA-, GC- and CAAT boxes. However, it contains an unique polypyrimidine-rich box, which is so far only found in genes encoding DNA repair enzymes. The function of this box in the regulation of transcription is still unclear. PMID:8127648
Lu, Zefu; Yu, Hong; Xiong, Guosheng; Wang, Jing; Jiao, Yongqing; Liu, Guifu; Jing, Yanhui; Meng, Xiangbing; Hu, Xingming; Qian, Qian; Fu, Xiangdong; Wang, Yonghong; Li, Jiayang
2013-01-01
IDEAL PLANT ARCHITECTURE1 (IPA1) is critical in regulating rice (Oryza sativa) plant architecture and substantially enhances grain yield. To elucidate its molecular basis, we first confirmed IPA1 as a functional transcription activator and then identified 1067 and 2185 genes associated with IPA1 binding sites in shoot apices and young panicles, respectively, through chromatin immunoprecipitation sequencing assays. The SQUAMOSA PROMOTER BINDING PROTEIN-box direct binding core motif GTAC was highly enriched in IPA1 binding peaks; interestingly, a previously uncharacterized indirect binding motif TGGGCC/T was found to be significantly enriched through the interaction of IPA1 with proliferating cell nuclear antigen PROMOTER BINDING FACTOR1 or PROMOTER BINDING FACTOR2. Genome-wide expression profiling by RNA sequencing revealed IPA1 roles in diverse pathways. Moreover, our results demonstrated that IPA1 could directly bind to the promoter of rice TEOSINTE BRANCHED1, a negative regulator of tiller bud outgrowth, to suppress rice tillering, and directly and positively regulate DENSE AND ERECT PANICLE1, an important gene regulating panicle architecture, to influence plant height and panicle length. The elucidation of target genes of IPA1 genome-wide will contribute to understanding the molecular mechanisms underlying plant architecture and to facilitating the breeding of elite varieties with ideal plant architecture. PMID:24170127
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kerr, J.M.; Fisher, L.W.; Termine, J.D.
The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less
Guida, Natascia; Laudati, Giusy; Serani, Angelo; Mascolo, Luigi; Molinaro, Pasquale; Montuori, Paolo; Di Renzo, Gianfranco; Canzoniero, Lorella M T; Formisano, Luigi
2017-10-15
Our previous study showed that the environmental neurotoxicant non-dioxin-like polychlorinated biphenyl (PCB)-95 increases RE1-silencing transcription factor (REST) expression, which is related to necrosis, but not apoptosis, of neurons. Meanwhile, necroptosis is a type of a programmed necrosis that is positively regulated by receptor interacting protein kinase 1 (RIPK1), RIPK3 and mixed lineage kinase domain-like (MLKL) and negatively regulated by caspase-8. Here we evaluated whether necroptosis contributes to PCB-95-induced neuronal death through REST up-regulation. Our results demonstrated that in cortical neurons PCB-95 increased RIPK1, RIPK3, and MLKL expression and decreased caspase-8 at the gene and protein level. Furthermore, the RIPK1 inhibitor necrostatin-1 or siRNA-mediated RIPK1, RIPK3 and MLKL expression knockdown significantly reduced PCB-95-induced neuronal death. Intriguingly, PCB-95-induced increases in RIPK1, RIPK3, MLKL expression and decreases in caspase-8 expression were reversed by knockdown of REST expression with a REST-specific siRNA (siREST). Notably, in silico analysis of the rat genome identified a REST consensus sequence in the caspase-8 gene promoter (Casp8-RE1), but not the RIPK1, RIPK3 and MLKL promoters. Interestingly, in PCB-95-treated neurons, REST binding to the Casp8-RE1 sequence increased in parallel with a reduction in its promoter activity, whereas under the same experimental conditions, transfection of siREST or mutation of the Casp8-RE1 sequence blocked PCB-95-induced caspase-8 reduction. Since RIPK1, RIPK3 and MLKL rat genes showed no putative REST binding site, we assessed whether the transcription factor cAMP Responsive Element Binding Protein (CREB), which has a consensus sequence in all three genes, affected neuronal death. In neurons treated with PCB-95, CREB protein expression decreased in parallel with a reduction in binding to the RIPK1, RIPK3 and MLKL gene promoter sequence. Furthermore, CREB overexpression was associated with reduced promoter activity of the RIPK1, RIPK3 and MLKL genes. Collectively, these results indicate that PCB-95 was associated with REST-induced necroptotic cell death by increasing RIPK1, RIPK3 and MLKL expression and reducing caspase-8 levels. In addition, since REST is involved in several neurological disorders, therapies that block REST-induced necroptosis could be a new strategy to revert the neurodetrimental effects associated to its overexpression. Copyright © 2017 Elsevier Inc. All rights reserved.
Oem, Jae-Ku; Xiang, Zhonghua; Zhou, Yan; Babiuk, Lorne A; Liu, Qiang
2007-09-01
Hepatitis C virus (HCV) causes severe liver diseases in a large population worldwide. HCV protein translation is controlled by an internal ribosomal entry site (IRES) within the 5'-untranslated region (UTR). HCV IRES-dependent translation is critical for HCV-associated pathogenesis. To develop a plasmid DNA transfection system by using RNA polymerase I promoter and terminator sequences for studying HCV IRES-dependent translation. A gene cassette containing HCV 5'-UTR, Renilla luciferase reporter gene, and HCV 3'-UTR was inserted between RNA polymerase I promoter and terminator sequences. HCV IRES-directed translation was determined by luciferase assay after transfection. Transfection of the RNA polymerase I-HCV IRES plasmid into human hepatoma Huh-7 and HepG2 cells resulted in luciferase gene expression. Deletion of the IIIf domain in HCV IRES dramatically reduced luciferase activity. Our results indicated that the plasmid vector system-based on RNA polymerase I promoter and terminator sequences represents an effective approach for the study of HCV IRES-dependent translation.
Characterization of short interspersed elements (SINEs) in a red alga, Porphyra yezoensis.
Zhang, Wenbo; Lin, Xiaofei; Peddigari, Suresh; Takechi, Katsuaki; Takano, Hiroyoshi; Takio, Susumu
2007-02-01
Short interspersed element (SINE)-like sequences referred to as PySN1 and PySN2 were identified in a red alga, Porphyra yezoensis. Both elements contained an internal promoter with motifs (A box and B box) recognized by RNA polymerase III, and target site duplications at both ends. Genomic Southern blot analysis revealed that both elements were widely and abundantly distributed on the genome. 3' and 5' RACE suggested that PySN1 was expressed as a chimera transcript with flanking SINE-unrelated sequences and possessed the poly-A tail at the same position near the 3' end of PySN1.
Lee, Sunhee; Reth, Alexander; Meletzus, Dietmar; Sevilla, Myrna; Kennedy, Christina
2000-01-01
A major 30.5-kb cluster of nif and associated genes of Acetobacter diazotrophicus (syn. Gluconacetobacter diazotrophicus), a nitrogen-fixing endophyte of sugarcane, was sequenced and analyzed. This cluster represents the largest assembly of contiguous nif-fix and associated genes so far characterized in any diazotrophic bacterial species. Northern blots and promoter sequence analysis indicated that the genes are organized into eight transcriptional units. The overall arrangement of genes is most like that of the nif-fix cluster in Azospirillum brasilense, while the individual gene products are more similar to those in species of Rhizobiaceae or in Rhodobacter capsulatus. PMID:11092875
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
Definition of RNA polymerase II CoTC terminator elements in the human genome.
Nojima, Takayuki; Dienstbier, Martin; Murphy, Shona; Proudfoot, Nicholas J; Dye, Michael J
2013-04-25
Mammalian RNA polymerase II (Pol II) transcription termination is an essential step in protein-coding gene expression that is mediated by pre-mRNA processing activities and DNA-encoded terminator elements. Although much is known about the role of pre-mRNA processing in termination, our understanding of the characteristics and generality of terminator elements is limited. Whereas promoter databases list up to 40,000 known and potential Pol II promoter sequences, fewer than ten Pol II terminator sequences have been described. Using our knowledge of the human β-globin terminator mechanism, we have developed a selection strategy for mapping mammalian Pol II terminator elements. We report the identification of 78 cotranscriptional cleavage (CoTC)-type terminator elements at endogenous gene loci. The results of this analysis pave the way for the full understanding of Pol II termination pathways and their roles in gene expression. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Santi, Melissa; Maccari, Giuseppe; Mereghetti, Paolo; Voliani, Valerio; Rocchiccioli, Silvia; Ucciferri, Nadia; Luin, Stefano; Signore, Giovanni
2017-02-15
The transferrin receptor (TfR) is a promising target in cancer therapy owing to its overexpression in most solid tumors and on the blood-brain barrier. Nanostructures chemically derivatized with transferrin are employed in TfR targeting but often lose their functionality upon injection in the bloodstream. As an alternative strategy, we rationally designed a peptide coating able to bind transferrin on suitable pockets not involved in binding to TfR or iron by using an iterative multiscale-modeling approach coupled with quantitative structure-activity and relationship (QSAR) analysis and evolutionary algorithms. We tested that selected sequences have low aspecific protein adsorption and high binding energy toward transferrin, and one of them is efficiently internalized in cells with a transferrin-dependent pathway. Furthermore, it promotes transferrin-mediated endocytosis of gold nanoparticles by modifying their protein corona and promoting oriented adsorption of transferrin. This strategy leads to highly effective nanostructures, potentially useful in diagnostic and therapeutic applications, which exploit (and do not suffer) the protein solvation for achieving a better targeting.
Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng
2016-03-01
A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh
2011-04-29
Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.
Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A.; Mateos, Luís M.
2006-01-01
The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP. PMID:16385030
Letek, Michal; Valbuena, Noelia; Ramos, Angelina; Ordóñez, Efrén; Gil, José A; Mateos, Luís M
2006-01-01
The genes involved in gluconate catabolism (gntP and gntK) in Corynebacterium glutamicum are scattered in the chromosome, and no regulatory genes are apparently associated with them, in contrast with the organization of the gnt operon in Escherichia coli and Bacillus subtilis. In C. glutamicum, gntP and gntK are essential genes when gluconate is the only carbon and energy source. Both genes contain upstream regulatory regions consisting of a typical promoter and a hypothetical cyclic AMP (cAMP) receptor protein (CRP) binding region but lack the expected consensus operator region for binding of the GntR repressor protein. Expression analysis by Northern blotting showed monocistronic transcripts for both genes. The expression of gntP and gntK is not induced by gluconate, and the gnt genes are subject to catabolite repression by sugars, such as glucose, fructose, and sucrose, as was detected by quantitative reverse transcription-PCR (qRT-PCR). Specific analysis of the DNA promoter sequences (PgntK and PgntP) was performed using bifunctional promoter probe vectors containing mel (involved in melanin production) or egfp2 (encoding a green fluorescent protein derivative) as the reporter gene. Using this approach, we obtained results parallel to those from qRT-PCR. An applied example of in vivo gene expression modulation of the divIVA gene in C. glutamicum is shown, corroborating the possible use of the gnt promoters to control gene expression. glxR (which encodes GlxR, the hypothetical CRP protein) was subcloned from the C. glutamicum chromosomal DNA and overexpressed in corynebacteria; we found that the level of gnt expression was slightly decreased compared to that of the control strains. The purified GlxR protein was used in gel shift mobility assays, and a specific interaction of GlxR with sequences present on PgntP and PgntK fragments was detected only in the presence of cAMP.
Genomic Analysis and Isolation of RNA Polymerase II Dependent Promoters from Spodoptera frugiperda.
Bleckmann, Maren; Fritz, Markus H-Y; Bhuju, Sabin; Jarek, Michael; Schürig, Margitta; Geffers, Robert; Benes, Vladimir; Besir, Hüseyin; van den Heuvel, Joop
2015-01-01
The Baculoviral Expression Vector System (BEVS) is the most commonly used method for high expression of recombinant protein in insect cells. Nevertheless, expression of some target proteins--especially those entering the secretory pathway--provides a severe challenge for the baculovirus infected insect cells, due to the reorganisation of intracellular compounds upon viral infection. Therefore, alternative strategies for recombinant protein production in insect cells like transient plasmid-based expression or stable expression cell lines are becoming more popular. However, the major bottleneck of these systems is the lack of strong endogenous polymerase II dependent promoters, as the strong baculoviral p10 and polH promoters used in BEVS are only functional in presence of the viral transcription machinery during the late phase of infection. In this work we present a draft genome and a transcriptome analysis of Sf21 cells for the identification of the first known endogenous Spodoptera frugiperda promoters. Therefore, putative promoter sequences were identified and selected because of high mRNA level or in analogy to other strong promoters in other eukaryotic organism. The chosen endogenous Sf21 promoters were compared to early viral promoters for their efficiency to trigger eGFP expression using transient plasmid based transfection in a BioLector Microfermentation system. Furthermore, promoter activity was not only shown in Sf21 cells but also in Hi5 cells. The novel endogenous Sf21 promoters were ranked according to their activity and expand the small pool of available promoters for stable insect cell line development and transient plasmid expression in insect cells. The best promoter was used to improve plasmid based transient transfection in insect cells substantially.
Gui, Linsheng; Hong, Jieyun; Raza, Sayed Haidar Abbas; Zan, Linsen
2017-04-01
Sirtuin 3 (SIRT3) is a mitochondrial nicotinamide adenine dinucleotide (NAD)-dependent deacetylase. It has crucial roles in regulating the respiratory chain, in adenosine triphosphate (ATP) production, and in both the citric acid and urea cycles. The aim of this study was to investigate whether SIRT3 could be used as a candidate gene in the breeding of cattle. Expression analysis by quantitative real-time polymerase chain reactions (qPCR) indicated that expression levels of SIRT3 were highest in the kidney, rumen, liver, omasum and muscle. Using sequencing technology on a total of 913 cattle representing three indigenous Chinese beef cattle breeds, three single nucleotide polymorphisms (SNPs) were identified in the promoter region of SIRT3, and five haplotypes representing five potential transcription factor compositions of polymorphic potential cis-acting elements. Association analysis indicated that the Hap3/8 diplotype performed better than other combinations in intramuscular fat content. In addition, the promoter activity with Hap1 haplotype was higher than the Hap8 haplotype, consistent with the association analysis. The results indicate that the polymorphisms in transcription factor binding sites of SIRT3 promoter may affect the transcriptional activity of SIRT3, and thus alter intramuscular fat content in beef cattle. Copyright © 2016 Elsevier Ltd. All rights reserved.
Association and Promoter Analysis of AVPR1A in Finnish Autism Families.
Kantojärvi, Katri; Oikkonen, Jaana; Kotala, Ilona; Kallela, Jenni; Vanhala, Raija; Onkamo, Päivi; Järvelä, Irma
2015-10-01
The arginine vasopressin receptor 1A gene (AVPR1A) is known to affect social communication and has been reported to associate with autism in several studies. Given that the microsatellite RS1 and a few SNPs in the promoter region of the AVPR1A have repeatedly associated with several traits, including autism it is rather surprising that the molecular explanation for these associations has remained unknown, although it has been reported that the allele length of the AVPR1A microsatellites might affect disease risk. Here we carried out an extended association analysis of three microsatellites and 12 tag single nucleotide polymorphisms (SNPs) in and around the AVPR1A gene in 205 Finnish families followed by promoter analysis. FBAT version v2.0.3 was used for family-based genetic association analyses of AVPR1A microsatellites and SNPs. The nearby microsatellite RS1 was found to harbor the best association. Interestingly, there are two potentially relevant transcription factor (TF) binding sites at RS1: for MEF2C and PBX, predicted with the Match algorithm in the TRANSFAC database. Sequence variations changing the affinity of these TFs might partly explain the AVPR1A promoter region associations shown in autism. © 2015 International Society for Autism Research, Wiley Periodicals, Inc.
Kinetic Competition between Elongation Rate and Binding of NELF Controls Promoter Proximal Pausing
Li, Jian; Liu, Yingyun; Rhee, Ho Sung; Ghosh, Saikat Kumar B.; Bai, Lu; Pugh, B. Franklin; Gilmour, David S.
2013-01-01
Summary Pausing of RNA polymerase II (Pol II) 20-60 bp downstream of transcription start sites is a major checkpoint during transcription in animal cells. Mechanisms that control pausing are largely unknown. We developed permanganate-ChIP-seq to evaluate the state of Pol II at promoters throughout the Drosophila genome, and a biochemical system that reconstitutes promoter-proximal pausing to define pausing mechanisms. Stable open complexes of Pol II are largely absent from the transcription start sites of most mRNA genes, but are present at snRNA genes and the highly transcribed heat shock genes following their induction. The location of the pause is influenced by the timing between when NELF loads onto Pol II and how fast Pol II escapes the promoter region. Our biochemical analysis reveals that the sequence-specific transcription factor, GAF, orchestrates efficient pausing by recruiting NELF to promoters before transcription initiation and by assisting in loading NELF onto Pol II after initiation. PMID:23746353
Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
Bhat, Abhay Prasad; Shin, Minsang; Choy, Hyon E
2014-07-01
Histone-like nucleoid structuring protein (H-NS) is a small but abundant protein present in enteric bacteria and is involved in compaction of the DNA and regulation of the transcription. Recent reports have suggested that H-NS binds to a specific AT rich DNA sequence than to intrinsically curved DNA in sequence independent manner. We detected two high-specificity H-NS binding sites in LEE5 promoter of EPEC centered at -110 and -138, which were close to the proposed consensus H-NS binding motif. To identify H-NS binding sequence in LEE5 promoter, we took a random mutagenesis approach and found the mutations at around -138 were specifically defective in the regulation by H-NS. It was concluded that H-NS exerts maximum repression via the specific sequence at around -138 and subsequently contacts a subunit of RNAP through oligomerization.
The s29x gene of symbiotic bacteria in Amoeba proteus with a novel promoter.
Pak, J W; Jeon, K W
1996-05-24
Gram-symbiotic bacteria (called X-bacteria), present in the xD strain of Amoeba proteus as required cell components, synthesize and export a large amount of a 29-kDa protein, S29x. S29x is exported into the host's cytoplasm across the bacterial membranes and the symbiosome membrane. The complete nucleotide (nt) sequence of the s29x gene of X-bacteria has been determined, and the promoter sequence and tsp have also been identified. The gene has a nonconventional promoter with putative nt sequences different from the known consensus sequences. When Escherichia coli cells are transformed with s29x, the gene is expressed and the product is secreted into the culture medium. Functions of S29x are not fully known, but it is suspected that S29x plays an important role in the symbiotic relationship between amoebae and X-bacteria.
Yu, Yihe; Xu, Weirong; Wang, Jie; Wang, Lei; Yao, Wenkong; Xu, Yan; Ding, Jiahua; Wang, Yuejin
2013-01-01
RING-finger proteins (RFP) function as ubiquitin ligases and play key roles in plant responses to biotic and abiotic stresses. However, little information is available on the regulation of RFP expression. Here, we isolate and characterize the RFP promoter sequence from the disease-resistant Chinese wild grape Vitis pseudoreticulata accession Baihe-35-1. Promoter-GUS fusion assays revealed that defense signaling molecules, powdery mildew infection, and heat stress induce VpRFP1 promoter activity. By contrast, the RFP1 promoter isolated from Vitis vinifera was only slightly induced by pathogen infection and heat treatment. By promoter deletion analysis, we found that the -148 bp region of the VpRFP1 promoter was the core functional promoter region. We also found that, in Arabidopsis, VpRFP1 expressed under its own promoter activated defense-related gene expression and improved disease resistance, but the same construct using the VvRFP1 promoter slightly improve disease resistance. Our results demonstrated that the -148 bp region of the VpRFP1 promoter plays a key role in response to pathogen and heat stress, and suggested that expression differences between VpRFP1 and VvRFP1 may be key for the differing disease resistance phenotypes of the two Vitis genotypes.
Promoter variants of Xa23 alleles affect bacterial blight resistance and evolutionary pattern
Xu, Feifei; Tang, Yongchao; Gao, Ying
2017-01-01
Bacterial blight, caused by Xanthomonas oryzae pv. oryzae (Xoo), is the most important bacterial disease in rice (Oryza sativa L.). Our previous studies have revealed that the bacterial blight resistance gene Xa23 from wild rice O. rufipogon Griff. confers the broadest-spectrum resistance against all the naturally occurring Xoo races. As a novel executor R gene, Xa23 is transcriptionally activated by the bacterial avirulence (Avr) protein AvrXa23 via binding to a 28-bp DNA element (EBEAvrXa23) in the promoter region. So far, the evolutionary mechanism of Xa23 remains to be illustrated. Here, a rice germplasm collection of 97 accessions, including 29 rice cultivars (indica and japonica) and 68 wild relatives, was used to analyze the evolution, phylogeographic relationship and association of Xa23 alleles with bacterial blight resistance. All the ~ 473 bp DNA fragments consisting of promoter and coding regions of Xa23 alleles in the germplasm accessions were PCR-amplified and sequenced, and nine single nucleotide polymorphisms (SNPs) were detected in the promoter regions (~131 bp sequence upstream from the start codon ATG) of Xa23/xa23 alleles while only two SNPs were found in the coding regions. The SNPs in the promoter regions formed 5 haplotypes (Pro-A, B, C, D, E) which showed no significant difference in geographic distribution among these 97 rice accessions. However, haplotype association analysis indicated that Pro-A is the most favored haplotype for bacterial blight resistance. Moreover, SNP changes among the 5 haplotypes mostly located in the EBE/ebe regions (EBEAvrXa23 and corresponding ebes located in promoters of xa23 alleles), confirming that the EBE region is the key factor to confer bacterial blight resistance by altering gene expression. Polymorphism analysis and neutral test implied that Xa23 had undergone a bottleneck effect, and selection process of Xa23 was not detected in cultivated rice. In addition, the Xa23 coding region was found highly conserved in the Oryza genus but absent in other plant species by searching the plant database, suggesting that Xa23 originated along with the diversification of the Oryza genus from the grass family during evolution. This research offers a potential for flexible use of novel Xa23 alleles in rice breeding programs and provide a model for evolution analysis of other executor R genes. PMID:28982185
Promoter variants of Xa23 alleles affect bacterial blight resistance and evolutionary pattern.
Cui, Hua; Wang, Chunlian; Qin, Tengfei; Xu, Feifei; Tang, Yongchao; Gao, Ying; Zhao, Kaijun
2017-01-01
Bacterial blight, caused by Xanthomonas oryzae pv. oryzae (Xoo), is the most important bacterial disease in rice (Oryza sativa L.). Our previous studies have revealed that the bacterial blight resistance gene Xa23 from wild rice O. rufipogon Griff. confers the broadest-spectrum resistance against all the naturally occurring Xoo races. As a novel executor R gene, Xa23 is transcriptionally activated by the bacterial avirulence (Avr) protein AvrXa23 via binding to a 28-bp DNA element (EBEAvrXa23) in the promoter region. So far, the evolutionary mechanism of Xa23 remains to be illustrated. Here, a rice germplasm collection of 97 accessions, including 29 rice cultivars (indica and japonica) and 68 wild relatives, was used to analyze the evolution, phylogeographic relationship and association of Xa23 alleles with bacterial blight resistance. All the ~ 473 bp DNA fragments consisting of promoter and coding regions of Xa23 alleles in the germplasm accessions were PCR-amplified and sequenced, and nine single nucleotide polymorphisms (SNPs) were detected in the promoter regions (~131 bp sequence upstream from the start codon ATG) of Xa23/xa23 alleles while only two SNPs were found in the coding regions. The SNPs in the promoter regions formed 5 haplotypes (Pro-A, B, C, D, E) which showed no significant difference in geographic distribution among these 97 rice accessions. However, haplotype association analysis indicated that Pro-A is the most favored haplotype for bacterial blight resistance. Moreover, SNP changes among the 5 haplotypes mostly located in the EBE/ebe regions (EBEAvrXa23 and corresponding ebes located in promoters of xa23 alleles), confirming that the EBE region is the key factor to confer bacterial blight resistance by altering gene expression. Polymorphism analysis and neutral test implied that Xa23 had undergone a bottleneck effect, and selection process of Xa23 was not detected in cultivated rice. In addition, the Xa23 coding region was found highly conserved in the Oryza genus but absent in other plant species by searching the plant database, suggesting that Xa23 originated along with the diversification of the Oryza genus from the grass family during evolution. This research offers a potential for flexible use of novel Xa23 alleles in rice breeding programs and provide a model for evolution analysis of other executor R genes.
Analysis of Morphogenic Effect of hDAB2IP on Prostate Cancer and its Disease Correlation
2007-02-01
variety of or- gans and cell lines. By determining the promoter sequence from the 5’- flanking region of the mDab2ip gene in mouse prosta - tic epithelial...patient with de novo acute myeloid leukemia. Genes Chromo- somes Cancer 39, 324 –334. WANG, Z., TSENG, C.P., PONG, R.C., CHEN, H., MCCONNELL, J.D
Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S
1988-01-01
The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996
Promoters, toll like receptors and microRNAs: a strange association.
Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K
2013-06-01
Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.
Protein Information Resource: a community resource for expert annotation of protein data
Barker, Winona C.; Garavelli, John S.; Hou, Zhenglin; Huang, Hongzhan; Ledley, Robert S.; McGarvey, Peter B.; Mewes, Hans-Werner; Orcutt, Bruce C.; Pfeiffer, Friedhelm; Tsugita, Akira; Vinayaka, C. R.; Xiao, Chunlin; Yeh, Lai-Su L.; Wu, Cathy
2001-01-01
The Protein Information Resource, in collaboration with the Munich Information Center for Protein Sequences (MIPS) and the Japan International Protein Information Database (JIPID), produces the most comprehensive and expertly annotated protein sequence database in the public domain, the PIR-International Protein Sequence Database. To provide timely and high quality annotation and promote database interoperability, the PIR-International employs rule-based and classification-driven procedures based on controlled vocabulary and standard nomenclature and includes status tags to distinguish experimentally determined from predicted protein features. The database contains about 200 000 non-redundant protein sequences, which are classified into families and superfamilies and their domains and motifs identified. Entries are extensively cross-referenced to other sequence, classification, genome, structure and activity databases. The PIR web site features search engines that use sequence similarity and database annotation to facilitate the analysis and functional identification of proteins. The PIR-International databases and search tools are accessible on the PIR web site at http://pir.georgetown.edu/ and at the MIPS web site at http://www.mips.biochem.mpg.de. The PIR-International Protein Sequence Database and other files are also available by FTP. PMID:11125041
Synchronized tapping facilitates learning sound sequences as indexed by the P300.
Kamiyama, Keiko S; Okanoya, Kazuo
2014-01-01
The purpose of the present study was to determine whether and how single finger tapping in synchrony with sound sequences contributed to the auditory processing of them. The participants learned two unfamiliar sound sequences via different methods. In the tapping condition, they learned an auditory sequence while they tapped in synchrony with each sound onset. In the no tapping condition, they learned another sequence while they kept pressing a key until the sequence ended. After these learning sessions, we presented the two melodies again and recorded event-related potentials (ERPs). During the ERP recordings, 10% of the tones within each melody deviated from the original tones. An analysis of the grand average ERPs showed that deviant stimuli elicited a significant P300 in the tapping but not in the no-tapping condition. In addition, the significance of the P300 effect in the tapping condition increased as the participants showed highly synchronized tapping behavior during the learning sessions. These results indicated that single finger tapping promoted the conscious detection and evaluation of deviants within the learned sequences. The effect was related to individuals' musical ability to coordinate their finger movements along with external auditory events.
Synchronized tapping facilitates learning sound sequences as indexed by the P300
Kamiyama, Keiko S.; Okanoya, Kazuo
2014-01-01
The purpose of the present study was to determine whether and how single finger tapping in synchrony with sound sequences contributed to the auditory processing of them. The participants learned two unfamiliar sound sequences via different methods. In the tapping condition, they learned an auditory sequence while they tapped in synchrony with each sound onset. In the no tapping condition, they learned another sequence while they kept pressing a key until the sequence ended. After these learning sessions, we presented the two melodies again and recorded event-related potentials (ERPs). During the ERP recordings, 10% of the tones within each melody deviated from the original tones. An analysis of the grand average ERPs showed that deviant stimuli elicited a significant P300 in the tapping but not in the no-tapping condition. In addition, the significance of the P300 effect in the tapping condition increased as the participants showed highly synchronized tapping behavior during the learning sessions. These results indicated that single finger tapping promoted the conscious detection and evaluation of deviants within the learned sequences. The effect was related to individuals’ musical ability to coordinate their finger movements along with external auditory events. PMID:25400564
Mutations That Improve the pRE Promoter of Coliphage Lambda
Mahoney, Michael E.; Wulff, Daniel L.
1987-01-01
The dya5 mutation, a C→T change at position -43 of the λ pRE promoter, results in a twofold increase in pRE activity in vivo. Smaller increases in pRE activity are found for the dya2 mutation, a T→C change at position -1 of pRE, and the dya3 mutation, an A→G change at +5 of pRE. The mutant p RE promoters retain complete dependence on cII protein for activity. These observations argue, at least for pRE-like promoters, that promoter activities are influenced by nucleotide sequences at least eight nucleotides to the 5'-side of the conventional -35 region consensus sequence, and by nucleotide sequences near the start-site of transcription. Although Hawley and McClure (1983) found A·T pairs more frequently than G·TC pairs in the region of -40 to -45 of prokaryotic promoters, other mutations that change a G·TC pair to an A·T pair at positions -41, -44 and -45 of pRE do not result in increased promoter activity. We also found that a T→C change at position -42 results in a mild decrease in promoter activity. These observations argue that Ts at positions -42 and -43 of pRE are required for maximum promoter activity, but do not support the hypothesis that As and Ts in the -40 to -45 region generally lead to higher promoter activities. PMID:2953648
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, S.; Yomano, L.P.; Saleh, A.Z.
1999-06-01
Escherichia coli B has been engineered as a biocatalyst for the conversion of lignocellulose into ethanol. Previous research has demonstrated that derivatives of E. coli B can produce high levels of Erwinia chrysanthemi endoglucanase (encoded by celZ) as a periplasmic product and that this enzyme can function with commercial fungal cellulase to increase ethanol production. In this study, the authors have demonstrated two methods that improve celZ expression in E. coli B. Initially, with a low-copy-number vector, two E. coli glycolytic gene promoters (gap and eno) were tested and found to be less effective than the original celZ promoter. Bymore » screening 18,000 random fragments of Zymomonas mobilis DNA, a surrogate promoter was identified which increased celZ expression up to sixfold. With this promoter, large polar inclusion bodies were clearly evident in the periplasmic space. Sequencing revealed that the most active surrogate promoter is derived from five Sau3A1 fragments, one of which was previously sequenced in Z. mobilis. Visual inspection indicated that this DNA fragment contains at least five putative promoter regions, two of which were confirmed by primer extension analysis. Addition of the out genes from E. chrysanthemi EC16 caused a further increase in the production of active enzyme and facilitated secretion or release of over half of the activity into the extracellular environment. With the most active construct, of a total of 13,000 IU of active enzyme per liter of culture, 7,800 IU was in the supernatant. The total active endoglucanase was estimated to represent 4 to 6% of cellular protein.« less
Regulation of gene expression mediating indeterminate muscle growth in teleosts.
Ahammad, A K Shakur; Asaduzzaman, Md; Asakawa, Shuichi; Watabe, Shugo; Kinoshita, Shigeharu
2015-08-01
Teleosts are unique among vertebrates due to their indeterminate muscle growth, i.e., continued production of neonatal muscle fibers until death. However, the molecular mechanism(s) underlying this property is unknown. Here, we focused on the torafugu (Takifugu rubripes) myosin heavy chain gene, MYHM2528-1, which is specifically expressed in neonatal muscle fibers produced by indeterminate muscle growth. We examined the flanking region of MYHM2528-1 through an in vivo reporter assay using zebrafish (Danio rerio) and identified a 2100 bp 5'-flanking sequence that contained sufficient promoter activity to allow specific gene expression. The effects of enhanced promoter activity were observed at the outer region of the fast muscle and the dorsal edge of slow muscle in zebrafish larvae. At the juvenile stage, the promoter was specifically activated in small diameter muscle fibers scattered throughout fast muscle and in slow muscle near the septum separating slow and fast muscles. This spatio-temporal promoter activity overlapped with known myogenic zones involved in teleost indeterminate muscle growth. A deletion mutant analysis revealed that the -2100 to -600 bp 5'flanking sequence of MYHM2528-1 is essential for promoter activity. This region contains putative binding sites for several representative myogenesis-related transcription factors and nuclear factor of activated T-cell (NFAT), a transcription activator involved in regeneration of mammalian adult skeletal muscle. A significant reduction in the promoter activity of the MYHM2528-1 deletion constructs was observed in accordance with a reduction in the number of these binding sites, suggesting the involvement of specific transcription factors in indeterminate muscle growth. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Raibaud, A; Zalacain, M; Holt, T G; Tizard, R; Thompson, C J
1991-01-01
Nucleotide sequence analysis of a 5,000-bp region of the bialaphos antibiotic production (bap) gene cluster defined five open reading frames (ORFs) which predicted structural genes in the order bah, ORF1, ORF2, and ORF3 followed by the regulatory gene, brpA (H. Anzai, T. Murakami, S. Imai, A. Satoh, K. Nagaoka, and C.J. Thompson, J. Bacteriol. 169:3482-3488, 1987). The four structural genes were translationally coupled and apparently cotranscribed from an undefined promoter(s) under the positive control of the brpA gene product. S1 mapping experiments indicated that brpA was transcribed by two promoters (brpAp1 and brpAp2) which initiate transcription 150 and 157 bp upstream of brp A within an intergenic region and at least one promoter further upstream within the bap gene cluster (brpAp3). All three transcripts were present at low levels during exponential growth and increased just before the stationary phase. The levels of the brpAp3 band continued to increase at the onset of stationary phase, whereas brpAp1-and brpAp2-protected fragments showed no further change. BrpA contained a possible helix-turn-helix motif at its C terminus which was similar to the C-terminal regulatory motif found in the receiver component of a family of two-component transcriptional activator proteins. This motif was not associated with the N-terminal domain conserved in other members of the family. The structural gene cluster sequenced began with bah, encoding a bialaphos acetylhydrolase which removes the N-acetyl group from bialaphos as one of the final steps in the biosynthetic pathway. The observation that Bah was similar to a rat and to a bacterial (Acinetobacter calcoaceticus) lipase probably reflects the fact that the ester bonds of triglycerides and the amide bond linking acetate to phosphinothricin are similar and hydrolysis is catalyzed by structurally related enzymes. This was followed by two regions encoding ORF1 and ORF2 which were similar to each other (48% nucleotide identity, 31% amino acid identity), as well as to GrsT, a protein encoded by a gene located adjacent to gramicidin S synthetase in Bacillus brevis, and to vertebrate (mallard duck and rat) thioesterases. The amino acid sequence and hydrophobicity profile of ORF3 indicated that it was related to a family of membrane transport proteins. It was strikingly similar to the citrate uptake protein encoded by the transposon Tn3411. Images PMID:2066341
Ishizawa, Hidehiro; Kuroda, Masashi
2017-01-01
ABSTRACT Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. PMID:28818906
Ishizawa, Hidehiro; Kuroda, Masashi; Ike, Michihiko
2017-08-17
Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. Copyright © 2017 Ishizawa et al.
Differential principal component analysis of ChIP-seq.
Ji, Hongkai; Li, Xia; Wang, Qian-fei; Ning, Yang
2013-04-23
We propose differential principal component analysis (dPCA) for analyzing multiple ChIP-sequencing datasets to identify differential protein-DNA interactions between two biological conditions. dPCA integrates unsupervised pattern discovery, dimension reduction, and statistical inference into a single framework. It uses a small number of principal components to summarize concisely the major multiprotein synergistic differential patterns between the two conditions. For each pattern, it detects and prioritizes differential genomic loci by comparing the between-condition differences with the within-condition variation among replicate samples. dPCA provides a unique tool for efficiently analyzing large amounts of ChIP-sequencing data to study dynamic changes of gene regulation across different biological conditions. We demonstrate this approach through analyses of differential chromatin patterns at transcription factor binding sites and promoters as well as allele-specific protein-DNA interactions.
NASA Astrophysics Data System (ADS)
Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.
van Verk, Marcel C; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M
2008-04-01
PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of transcription factors in which the WRKY sequence is followed by a GKK rather than a GQK sequence. The binding sequence of NtWRKY12 (WK box TTTTCCAC) deviated significantly from the consensus sequence (W box TTGAC[C/T]) shown to be recognized by WRKY factors with the GQK sequence. Mutation of the GKK sequence in NtWRKY12 into GQK or GEK abolished binding to the WK box. The WK(1) box is in close proximity to binding sites in the PR-1a promoter for transcription factors TGA1a (as-1 box) and Myb1 (MBSII box). Expression studies with PR-1a promoterbeta-glucuronidase (GUS) genes in stably and transiently transformed tobacco indicated that NtWRKY12 and TGA1a act synergistically in PR-1a expression induced by salicylic acid and bacterial elicitors. Cotransfection of Arabidopsis thaliana protoplasts with 35SNtWRKY12 and PR-1aGUS promoter fusions showed that overexpression of NtWRKY12 resulted in a strong increase in GUS expression, which required functional WK boxes in the PR-1a promoter.
Regulatory link between DNA methylation and active demethylation in Arabidopsis
Lei, Mingguang; Zhang, Huiming; Julian, Russell; Tang, Kai; Xie, Shaojun; Zhu, Jian-Kang
2015-01-01
De novo DNA methylation through the RNA-directed DNA methylation (RdDM) pathway and active DNA demethylation play important roles in controlling genome-wide DNA methylation patterns in plants. Little is known about how cells manage the balance between DNA methylation and active demethylation activities. Here, we report the identification of a unique RdDM target sequence, where DNA methylation is required for maintaining proper active DNA demethylation of the Arabidopsis genome. In a genetic screen for cellular antisilencing factors, we isolated several REPRESSOR OF SILENCING 1 (ros1) mutant alleles, as well as many RdDM mutants, which showed drastically reduced ROS1 gene expression and, consequently, transcriptional silencing of two reporter genes. A helitron transposon element (TE) in the ROS1 gene promoter negatively controls ROS1 expression, whereas DNA methylation of an RdDM target sequence between ROS1 5′ UTR and the promoter TE region antagonizes this helitron TE in regulating ROS1 expression. This RdDM target sequence is also targeted by ROS1, and defective DNA demethylation in loss-of-function ros1 mutant alleles causes DNA hypermethylation of this sequence and concomitantly causes increased ROS1 expression. Our results suggest that this sequence in the ROS1 promoter region serves as a DNA methylation monitoring sequence (MEMS) that senses DNA methylation and active DNA demethylation activities. Therefore, the ROS1 promoter functions like a thermostat (i.e., methylstat) to sense DNA methylation levels and regulates DNA methylation by controlling ROS1 expression. PMID:25733903
Ramaniuk, Olga; Převorovský, Martin; Pospíšil, Jiří; Vítovská, Dragana; Kofroňová, Olga; Benada, Oldřich; Schwarz, Marek; Šanderová, Hana; Hnilicová, Jarmila; Krásný, Libor
2018-06-18
σ I from Bacillus subtilis is a σ factor associating with RNA polymerase (RNAP) that was previously implicated in adaptation of the cell to elevated temperature. Here we provide a comprehensive characterization of this transcriptional regulator. By RNA-seq of wt and σ I -null strains at 37°C and 52°C we identified ∼130 genes affected by the absence of σ I Further analysis revealed that the majority of these genes were affected by σ I indirectly. The σ I regulon, i.e., the genes directly regulated by σ I , consists of 16 genes of which eight (the dhb and yku operons) are involved in iron metabolism. The involvement of σ I in iron metabolism was confirmed phenotypically. Next, we set up an in vitro transcription system and defined and experimentally validated the promoter sequence logo that, in addition to -35 and -10 regions, also contains extended -35 and -10 motifs. Thus, σ I -dependent promoters are relatively information-rich in comparison with most other promoters. In summary, this study supplies information about the least explored σ factor from the industrially important model organism B. subtilis Importance In bacteria, σ factors are essential for transcription initiation. Knowledge about their regulons ( i.e., genes transcribed from promoters dependent on these σ factors) is the key for understanding how bacteria cope with the changing environment and could be instrumental for biotechnologically motivated rewiring of gene expression. Here, we characterize the σ I regulon from the industrially important model Gram-positive bacterium - Bacillus subtilis We reveal that σ I affects expression of ∼ 130 genes, of which 16 are directly regulated by σ I , including genes encoding proteins involved in iron homeostasis. Detailed analysis of promoter elements then identifies unique sequences important for σ I -dependent transcription. This study thus provides a comprehensive view on this underexplored component of the B. subtilis transcription machinery. Copyright © 2018 American Society for Microbiology.
Isolated yeast promoter sequence and a method of regulated heterologous expression
Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.
2005-05-31
The present invention provides the promoter clone discovery of a glucoamylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated glucoamylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.
Voss, T; Falkner, E; Ahorn, H; Krystek, E; Maurer-Fogy, I; Bodo, G; Hauptmann, R
1994-01-01
Human interferon-alpha 2c (IFN-alpha 2c) was produced in Escherichia coli under the control of the alkaline phosphatase promoter using a periplasmic expression system. Compared with other leader sequences, the heat-stable enterotoxin II leader of E. coli (STII) resulted in the highest rate of correct processing as judged by Western-blot analysis. The fermentation was designed as a batch-fed process in order to obtain a high yield of biomass. The processing rate of IFN-alpha 2c could be increased from 25% to more than 50% by shifting the fermentation pH from 7.0 to 6.7. IFN-alpha 2c extracted from the periplasm was purified by a new four-step chromatographic procedure. Whereas cytoplasmically produced IFN-alpha 2c does not have its full native structure, IFN-alpha 2c extracted from the periplasm was found to be correctly folded, as shown by c.d. spectroscopy. Peptide-map analysis in combination with m.s. revealed the correct formation of disulphide bridges. N-terminal sequence analysis showed complete removal of the leader sequence, creating the authentic N-terminus starting with cysteine. Images Figure 3 Figure 4 Figure 6 PMID:8141788
Gong, Liang; Zhong, Guo-Hua; Hu, Mei-Ying; Luo, Qian; Ren, Zhen-Zhen
2010-01-01
Chemosensory proteins play an important role in transporting chemical compounds to their receptors on dendrite membranes. In this study, two full-length cDNA codings for chemosensory proteins of Plutella xylostella (Lepidoptera: Plutellidae) were obtained by RACE-PCR. PxylCSP3 and Pxyl-CSP4, with GenBank accession numbers ABM92663 and ABM92664, respectively, were cloned and sequenced. The gene sequences both consisted of three exons and two introns. RT-PCR analysis showed that Pxyl-CSP3 and Pxyl-CSP4 had different expression patterns in the examined developmental stages, but were expressed in all larval stages. Phylogenetic analysis indicated that lepidopteran insects consist of three branches, and Pxyl-CSP3 and Pxyl-CSP4 belong to different branches. The 5′regulatory regions of Pxyl-CSP3 and Pxyl-CSP4 were isolated and analyzed, and the results consist of not only the core promoter sequences (TATA-box), but also several transcriptional elements (BR-C Z4, Hb, Dfd, CF2-II, etc.). This study provides clues to better understanding the various physiological functions of CSPs in P. xylostella and other insects. PMID:21073345
Raghu, G; Tevosian, S; Anant, S; Subramanian, K N; George, D L; Mirkin, S M
1994-01-01
The mouse c-Ki-ras protooncogene promoter contains an unusual DNA element consisting of a 27 bp-long homopurine-homopyrimidine mirror repeat (H-motif) adjacent to a d(C-G)5 repeat. We have previously shown that in vitro these repeats may adopt H and Z conformations, respectively, causing nuclease and chemical hypersensitivity. Here we have studied the functional role of these DNA stretches using fine deletion analysis of the promoter and a transient transcription assay in vivo. We found that while the H-motif is responsible for approximately half of the promoter activity in both mouse and human cell lines, the Z-forming sequence exhibits little, if any, such activity. Mutational changes introduced within the homopurine-homopyrimidine stretch showed that its sequence integrity, rather than its H-forming potential, is responsible for its effect on transcription. Electrophoretic mobility shift assays revealed that the putative H-motif tightly binds several nuclear proteins, one of which is likely to be transcription factor Sp1, as determined by competition experiments. Southwestern hybridization studies detected two major proteins specifically binding to the H-motif: a 97 kD protein which presumably corresponds to Sp1 and another protein of 60 kD in human and 64 kD in mouse cells. We conclude that the homopurine-homopyrimidine stretch is required for full transcriptional activity of the c-Ki-ras promoter and at least two distinct factors, Sp1 and an unidentified protein, potentially contribute to the positive effect on transcription. Images PMID:8078760
Casselli, Timothy; Bankhead, Troy
2015-01-01
The causative agent of Lyme disease, Borrelia burgdorferi, is an obligate parasite that requires either a tick vector or a mammalian host for survival. Identification of the bacterial genes that are specifically expressed during infection of the mammalian host could provide targets for novel therapeutics and vaccines. In vivo expression technology (IVET) is a reporter-based promoter trap system that utilizes selectable markers to identify promoters of bacterial host-specific genes. Using previously characterized genes for in vivo and in vitro selection, this study utilized an IVET system that allows for selection of B. burgdorferi sequences that act as active promoters only during murine infection. This promoter trap system was able to successfully distinguish active promoter sequences both in vivo and in vitro from control sequences and a library of cloned B. burgdorferi genomic fragments. However, a bottleneck effect during the experimental mouse infection limited the utility for genome-wide promoter screening. Overall, IVET was demonstrated as a tool for the identification of in vivo-induced promoter elements of B. burgdorferi, and the observed infection bottleneck apparent using a polyclonal infection pool provides insight into the dynamics of experimental infection with B. burgdorferi. © 2015 S. Karger AG, Basel.
Differential transcriptional control of the two tRNA(fMet) genes of Escherichia coli K-12.
Nagase, T; Ishii, S; Imamoto, F
1988-07-15
The metZ gene of Escherichia coli, which encodes the tRNA(f1Met), was cloned. Using the nucleotide sequence, in vitro transcription, and S1 nuclease mapping analyses, we identified the promoter region, transcriptional start point, the two tandem tRNA(f1Met) structural genes separated by an intergenic space of 33 bp, and the two Rho-independent transcriptional termination sites, in that order. We compared the promoter region of the metZ gene with that of the metY gene, which encodes the tRNA(f2Met) and is located in the promoter-proximal portion of the nusA operon. A G + C-rich sequence (5'-GCGCATCCAC-3'), similar to the corresponding sequence of the rrn promoters that are under stringent control, was found between the Pribnow box and the transcriptional start point of the metZ promoter, but not in the metY promoter region. We therefore examined the effect of guanosine 3'-diphosphate, 5'-diphosphate (ppGpp), the chemical mediator of stringent control, and found that ppGpp inhibited the transcription of the metZ gene, but not that of the metY gene. These data suggested that the promoters for metZ and metY have different physiological functions and are regulated by different mechanisms.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, YanHua, E-mail: liyanhua.1982@aliyun.com; Li, AiHua; Yang, Z.Q.
Cell death-inducing DNA fragmentation factor-α-like effector b (CIDEb) is a member of the CIDE family of apoptosis-inducing factors, CIDEa and CIDEc have been reported to be Lipid droplets (LDs)-associated proteins that promote atypical LD fusion in adipocytes, and responsible for liver steatosis under fasting and obese conditions, whereas CIDEb promotes lipid storage under normal diet conditions [1], and promotes the formation of triacylglyceride-enriched VLDL particles in hepatocytes [2]. Here, we report the gene cloning, chromosome mapping, tissue distribution, genetic expression analysis, and identification of a novel splicing variant of the porcine CIDEb gene. Sequence analysis shows that the open readingmore » frame of the normal porcine CIDEb isoform covers 660bp and encodes a 219-amino acid polypeptide, whereas its alternative splicing variant encodes a 142-amino acid polypeptide truncated at the fourth exon and comprised of the CIDE-N domain and part of the CIDE-C domain. The deduced amino acid sequence of normal porcine CIDEb shows an 85.8% similarity to the human protein and 80.0% to the mouse protein. The CIDEb genomic sequence spans approximately 6KB comprised of five exons and four introns. Radiation hybrid mapping demonstrated that porcine CIDEb is located at chromosome 7q21 and at a distance of 57cR from the most significantly linked marker, S0334, regions that are syntenic with the corresponding region in the human genome. Tissue expression analysis indicated that normal CIDEb mRNA is ubiquitously expressed in many porcine tissues. It was highly expressed in white adipose tissue and was observed at relatively high levels in the liver, lung, small intestine, lymphatic tissue and brain. The normal version of CIDEb was the predominant form in all tested tissues, whereas the splicing variant was expressed at low levels in all examined tissues except the lymphatic tissue. Furthermore, genetic expression analysis indicated that CIDEb mRNA levels were significantly higher in the white adipose tissue of lean pigs than their obese counterparts, in contrast to porcine CIDEa and CIDEc [3]. We therefore speculate that CIDEb may play a contrary role to the other CIDEs. The basic molecular information we provide here will be useful for further investigations of the physiological function of the gene, which will be helpful in better understanding the role of the CIDE family in lipid metabolism in pig models.« less
Burden, S; Lin, Y-X; Zhang, R
2005-03-01
Although a great deal of research has been undertaken in the area of promoter prediction, prediction techniques are still not fully developed. Many algorithms tend to exhibit poor specificity, generating many false positives, or poor sensitivity. The neural network prediction program NNPP2.2 is one such example. To improve the NNPP2.2 prediction technique, the distance between the transcription start site (TSS) associated with the promoter and the translation start site (TLS) of the subsequent gene coding region has been studied for Escherichia coli K12 bacteria. An empirical probability distribution that is consistent for all E.coli promoters has been established. This information is combined with the results from NNPP2.2 to create a new technique called TLS-NNPP, which improves the specificity of promoter prediction. The technique is shown to be effective using E.coli DNA sequences, however, it is applicable to any organism for which a set of promoters has been experimentally defined. The data used in this project and the prediction results for the tested sequences can be obtained from http://www.uow.edu.au/~yanxia/E_Coli_paper/SBurden_Results.xls alh98@uow.edu.au.
Fisher, R P; Topper, J N; Clayton, D A
1987-07-17
Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.
Cis-acting elements in the promoter region of the human aldolase C gene.
Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F
1993-08-16
We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pedersen, A.G.; Engelbrecht, J.
1995-12-31
In this paper we present a novel method for using the learning ability of a neural network as a measure of information in local regions of input data. Using the method to analyze Escherichia coli promoters, we discover all previously described signals, and furthermore find new signals that are regularly spaced along the promoter region. The spacing of all signals correspond to the helical periodicity of DNA, meaning that the signals are all present on the same face of the DNA helix in the promoter region. This is consistent with a model where the RNA polymerase contacts the promoter onmore » one side of the DNA, and suggests that the regions important for promoter recognition may include more positions on the DNA than usually assumed. We furthermore analyze the E.coli promoters by calculating the Kullback Leibler distance, and by constructing sequence logos.« less
Piya, Anil; Kaur, Jasmeet; Rice, Alan M; Bose, Himangshu S
2017-01-01
Cholesterol transport into the mitochondria is required for synthesis of the first steroid, pregnenolone. Cholesterol is transported by the steroidogenic acute regulatory protein (STAR), which acts at the outer mitochondrial membrane prior to its import. Mutations in the STAR protein result in lipoid congenital adrenal hyperplasia (CAH). Although the STAR protein consists of seven exons, biochemical analysis in nonsteroidogenic COS-1 cells showed that the first two were not essential for pregnenolone synthesis. Here, we present a patient with ambiguous genitalia, salt-lossing crisis within two weeks after birth and low cortisol levels. Sequence analysis of the STAR , including the exon-intron boundaries, showed the complete deletion of exon 1 as well as more than 50 nucleotides upstream of STAR promoter. Mitochondrial protein import with the translated protein through synthesis cassette of the mutant STAR lacking exon 1 showed protein translation, but it is less likely to have synthesized without a promoter in our patient. Thus, a full-length STAR gene is necessary for physiological mitochondrial cholesterol transport in vivo . STAR exon 1 deletion caused lipoid CAH.Exon 1 substitution does not affect biochemical activity.StAR promoter is responsible for gonadal development.
Piya, Anil; Kaur, Jasmeet; Rice, Alan M
2017-01-01
Summary Cholesterol transport into the mitochondria is required for synthesis of the first steroid, pregnenolone. Cholesterol is transported by the steroidogenic acute regulatory protein (STAR), which acts at the outer mitochondrial membrane prior to its import. Mutations in the STAR protein result in lipoid congenital adrenal hyperplasia (CAH). Although the STAR protein consists of seven exons, biochemical analysis in nonsteroidogenic COS-1 cells showed that the first two were not essential for pregnenolone synthesis. Here, we present a patient with ambiguous genitalia, salt-lossing crisis within two weeks after birth and low cortisol levels. Sequence analysis of the STAR, including the exon–intron boundaries, showed the complete deletion of exon 1 as well as more than 50 nucleotides upstream of STAR promoter. Mitochondrial protein import with the translated protein through synthesis cassette of the mutant STAR lacking exon 1 showed protein translation, but it is less likely to have synthesized without a promoter in our patient. Thus, a full-length STAR gene is necessary for physiological mitochondrial cholesterol transport in vivo. Learning points: STAR exon 1 deletion caused lipoid CAH. Exon 1 substitution does not affect biochemical activity. StAR promoter is responsible for gonadal development. PMID:28458886
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-04-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.
Hégarat, Nadia; Novopashina, Darya; Fokina, Alesya A; Boutorine, Alexandre S; Venyaminova, Alya G; Praseuth, Danièle; François, Jean-Christophe
2014-03-01
Inhibition of insulin-like growth factor I (IGF-I) signaling is a promising antitumor strategy and nucleic acid-based approaches have been investigated to target genes in the pathway. Here, we sought to modulate IGF-I transcriptional activity using triple helix formation. The IGF-I P1 promoter contains a purine/pyrimidine (R/Y) sequence that is pivotal for transcription as determined by deletion analysis and can be targeted with a triplex-forming oligonucleotide (TFO). We designed modified purine- and pyrimidine-rich TFOs to bind to the R/Y sequence. To monitor TFO binding, we developed a fluorescence-based gel-retardation assay that allowed independent detection of each strand in three-stranded complexes using end-labeling with Alexa 488, cyanine (Cy)3 and Cy5 fluorochromes. We characterized TFOs for their ability to inhibit restriction enzyme activity, compete with DNA-binding proteins and inhibit IGF-I transcription in reporter assays. TFOs containing modified nucleobases, 5-methyl-2'-deoxycytidine and 5-propynyl-2'-deoxyuridine, specifically inhibited restriction enzyme cleavage and formed triplexes on the P1 promoter fragment. In cells, deletion of the R/Y-rich sequence led to 48% transcriptional inhibition of a reporter gene. Transfection with TFOs inhibited reporter gene activity to a similar extent, whereas transcription from a mutant construct with an interrupted R/Y region was unaffected, strongly suggesting the involvement of triplex formation in the inhibitory mechanisms. Our results indicate that nuclease-resistant TFOs will likely inhibit endogenous IGF-I gene function in cells. © 2014 FEBS.
Molecular identification and transcriptional regulation of porcine IFIT2 gene.
Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di
2018-04-06
IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.
Gruel, Jérémy; LeBorgne, Michel; LeMeur, Nolwenn; Théret, Nathalie
2011-09-12
Regulation of gene expression plays a pivotal role in cellular functions. However, understanding the dynamics of transcription remains a challenging task. A host of computational approaches have been developed to identify regulatory motifs, mainly based on the recognition of DNA sequences for transcription factor binding sites. Recent integration of additional data from genomic analyses or phylogenetic footprinting has significantly improved these methods. Here, we propose a different approach based on the compilation of Simple Shared Motifs (SSM), groups of sequences defined by their length and similarity and present in conserved sequences of gene promoters. We developed an original algorithm to search and count SSM in pairs of genes. An exceptional number of SSM is considered as a common regulatory pattern. The SSM approach is applied to a sample set of genes and validated using functional gene-set enrichment analyses. We demonstrate that the SSM approach selects genes that are over-represented in specific biological categories (Ontology and Pathways) and are enriched in co-expressed genes. Finally we show that genes co-expressed in the same tissue or involved in the same biological pathway have increased SSM values. Using unbiased clustering of genes, Simple Shared Motifs analysis constitutes an original contribution to provide a clearer definition of expression networks.
2011-01-01
Background Regulation of gene expression plays a pivotal role in cellular functions. However, understanding the dynamics of transcription remains a challenging task. A host of computational approaches have been developed to identify regulatory motifs, mainly based on the recognition of DNA sequences for transcription factor binding sites. Recent integration of additional data from genomic analyses or phylogenetic footprinting has significantly improved these methods. Results Here, we propose a different approach based on the compilation of Simple Shared Motifs (SSM), groups of sequences defined by their length and similarity and present in conserved sequences of gene promoters. We developed an original algorithm to search and count SSM in pairs of genes. An exceptional number of SSM is considered as a common regulatory pattern. The SSM approach is applied to a sample set of genes and validated using functional gene-set enrichment analyses. We demonstrate that the SSM approach selects genes that are over-represented in specific biological categories (Ontology and Pathways) and are enriched in co-expressed genes. Finally we show that genes co-expressed in the same tissue or involved in the same biological pathway have increased SSM values. Conclusions Using unbiased clustering of genes, Simple Shared Motifs analysis constitutes an original contribution to provide a clearer definition of expression networks. PMID:21910886
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe
2014-06-01
Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.
Povedano, Eloy; Valverde, Alejandro; Ruiz-Valdepeñas Montiel, Víctor; Pedrero, María; Yáñez-Sedeño, Paloma; Barderas, Rodrigo; San Segundo-Acosta, Pablo; Peláez-García, Alberto; Mendiola, Marta; Hardisson, David; Campuzano, Susana; Pingarron, José Manuel
2018-05-09
We report a rapid and sensitive electrochemical strategy for the detection of gene-specific 5-methylcytosine DNA methylation. Magnetic beads (MBs) modified with an antibody specific for 5-methylcytosines (5-mC) are employed for the selective capture of any 5-mC methylated single-stranded (ss)DNA sequence. A flanking region next to the 5-mCs of the captured methylated ssDNA is recognized by selective hybridization with a synthetic biotinylated DNA sequence, further labeled with an HRP streptavidin conjugate. Amperometric transduction at disposable screen-printed carbon electrodes (SPCEs) is employed. The developed biosensor exhibits a dynamic range from 3.9 to 500 pM and a detection limit of 1.2 pM for the methylated synthetic sequence of the tumor suppressor gene O-6-methylguanine-DNA methyltransferase (MGMT) promoter region. The applicability of this strategy is demonstrated through the 45 min-analysis of specific methylation in the MGMT promoter region directly in raw spiked human serum samples and in genomic DNA extracted from U-87 glioblastoma cells and paraffin-embedded brain tumor tissues without any amplification and pretreatment step. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.
Clos, J; Buttgereit, D; Grummt, I
1986-01-01
A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157
A comprehensive bioinformatic analysis of hepatitis D virus full-length genomes.
Delfino, C M; Cerrudo, C S; Biglione, M; Oubiña, J R; Ghiringhelli, P D; Mathet, V L
2018-02-06
In association with hepatitis B virus (HBV), hepatitis delta virus (HDV) is a subviral agent that may promote severe acute and chronic forms of liver disease. Based on the percentage of nucleotide identity of the genome, HDV was initially classified into three genotypes. However, since 2006, the original classification has been further expanded into eight clades/genotypes. The intergenotype divergence may be as high as 35%-40% over the entire RNA genome, whereas sequence heterogeneity among the isolates of a given genotype is <20%; furthermore, HDV recombinants have been clearly demonstrated. The genetic diversity of HDV is related to the geographic origin of the isolates. This study shows the first comprehensive bioinformatic analysis of the complete available set of HDV sequences, using both nucleotide and protein phylogenies (based on an evolutionary model selection, gamma distribution estimation, tree inference and phylogenetic distance estimation), protein composition analysis and comparison (based on the presence of invariant residues, molecular signatures, amino acid frequencies and mono- and di-amino acid compositional distances), as well as amino acid changes in sequence evolution. Taking into account the congruent and consistent results of both nucleotide and amino acid analyses of GenBank available sequences (recorded as of January, 2017), we propose that the eight hepatitis D virus genotypes may be grouped into three large genogroups fully supported by their shared characteristics. © 2018 John Wiley & Sons Ltd.
Genetic alterations in seborrheic keratoses
Heidenreich, Barbara; Denisova, Evygenia; Rachakonda, Sivaramakrishna; Sanmartin, Onofre; Dereani, Timo; Hosen, Ismail; Nagore, Eduardo; Kumar, Rajiv
2017-01-01
Seborrheic keratoses are common benign epidermal lesions that are associated with increased age and sun-exposure. Those lesions despite harboring multiple somatic alterations in contrast to malignant tumors appear to be genetically stable. In order to investigate and characterize the presence of recurrent mutations, we performed exome sequencing on DNA from one seborrheic keratosis lesion and corresponding blood cells from the same patients with follow up investigation of alterations identified by exome sequencing in 24 additional lesions from as many patients. In addition we investigated alterations in all lesions at specific genes loci that included FGFR3, PIK3CA, HRAS, BRAF, CDKN2A and TERT and DHPH3 promoters. The exome sequencing data indicated three mutations per Mb of the targeted sequence. The mutational pattern depicted typical UV signature with majority of alterations being C>T and CC>TT base changes at dipyrimidinic sites. The FGFR3 mutations were the most frequent, detected in 12 of 25 (48%) lesions, followed by the PIK3CA (32%), TERT promoter (24%) and DPH3 promoter mutations (24%). TERT promoter mutations associated with increased age and were present mainly in the lesions excised from head and neck. Three lesions also carried alterations in CDKN2A. FGFR3, TERT and DPH3 expression did not correlate with mutations in the respective genes and promoters; however, increased FGFR3 transcript levels were associated with increased FOXN1 levels, a suggested positive feedback loop that stalls malignant progression. Thus, in this study we report overall mutation rate through exome sequencing and show the most frequent mutations seborrheic keratosis. PMID:28410231
Guilfoyle, Richard A.; Smith, Lloyd M.
1994-01-01
A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site.
Guilfoyle, R.A.; Smith, L.M.
1994-12-27
A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site. 2 figures.
Epigenetic Transgenerational Actions of Vinclozolin on Promoter Regions of the Sperm Epigenome
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K.
2010-01-01
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome. PMID:20927350
Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.
Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K
2010-09-30
Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.
Searching for nuclear export elements in hepatitis D virus RNA.
Freitas, Natália; Cunha, Celso
2013-08-12
To search for the presence of cis elements in hepatitis D virus (HDV) genomic and antigenomic RNA capable of promoting nuclear export. We made use of a well characterized chloramphenicol acetyl-transferase reporter system based on plasmid pDM138. Twenty cDNA fragments corresponding to different HDV genomic and antigenomic RNA sequences were inserted in plasmid pDM138, and used in transfection experiments in Huh7 cells. The relative amounts of HDV RNA in nuclear and cytoplasmic fractions were then determined by real-time polymerase chain reaction and Northern blotting. The secondary structure of the RNA sequences that displayed nuclear export ability was further predicted using a web interface. Finally, the sensitivity to leptomycin B was assessed in order to investigate possible cellular pathways involved in HDV RNA nuclear export. Analysis of genomic RNA sequences did not allow identifying an unequivocal nuclear export element. However, two regions were found to promote the export of reporter mRNAs with efficiency higher than the negative controls albeit lower than the positive control. These regions correspond to nucleotides 266-489 and 584-920, respectively. In addition, when analyzing antigenomic RNA sequences a nuclear export element was found in positions 214-417. Export mediated by the nuclear export element of HDV antigenomic RNA is sensitive to leptomycin B suggesting a possible role of CRM1 in this transport pathway. A cis-acting nuclear export element is present in nucleotides 214-417 of HDV antigenomic RNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Biaoyang; Nasir, J.; Kalchman, M.A.
1995-02-10
We have previously cloned and characterized the murine homologue of the Huntington disease (HD) gene and shown that it maps to mouse chromosome 5 within a region of conserved synteny with human chromosome 4p16.3. Here we present a detailed comparison of the sequence of the putative promoter and the organization of the 5{prime} genomic region of the murine (Hdh) and human HD genes encompassing the first five exons. We show that in this region these two genes share identical exon boundaries, but have different-size introns. Two dinucleotide (CT) and one trinucleotide intronic polymorphism in Hdh and an intronic CA polymorphismmore » in the HD gene were identified. Comparison of 940-bp sequence 5{prime} to the putative translation start site reveals a highly conserved region (78.8% nucleotide identity) between Hdh and the HD gene from nucleotide -56 to -206 (of Hdh). Neither Hdh nor the HD gene have typical TATA or CCAAT elements, but both show one putative AP2 binding site and numerous potential Sp1 binding sites. The high sequence identity between Hdh and the HD gene for approximately 200 bp 5{prime} to the putative translation start site indicates that these sequences may play a role in regulating expression of the Huntington disease gene. 30 refs., 4 figs., 2 tabs.« less
Means, A L; Farnham, P J
1990-02-01
We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).
Morelle, Sandrine; Carbonnelle, Etienne; Nassif, Xavier
2003-01-01
Interaction with host cells is essential in meningococcal pathogenesis especially at the blood-brain barrier. This step is likely to involve a common regulatory pathway allowing coordinate regulation of genes necessary for the interaction with endothelial cells. The analysis of the genomic sequence of Neisseria meningitidis Z2491 revealed the presence of many repeats. One of these, designated REP2, contains a −24/−12 type promoter and a ribosome binding site 5 to 13 bp before an ATG. In addition most of these REP2 sequences are located immediately upstream of an ORF. Among these REP2-associated genes are pilC1 and crgA, described as being involved in steps essential for the interaction of N. meningitidis with host cells. Furthermore, the REP2 sequences located upstream of pilC1 and crgA correspond to the previously identified promoters known to be induced during the initial localized adhesion of N. meningitidis with human cells. This characteristic led us to hypothesize that at least some of the REP2-associated genes were upregulated under the same circumstances as pilC1 and crgA. Quantitative PCR in real time demonstrated that the expression of 14 out of 16 REP2-associated genes were upregulated during the initial localized adhesion of N. meningitidis. Taken together, these data suggest that these repeats control a set of genes necessary for the efficient interaction of this pathogen with host cells. Subsequent mutational analysis was performed to address the role of these genes during meningococcus-cell interaction. PMID:12670987
Conservation of Transcription Start Sites within Genes across a Bacterial Genus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.
Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less
Huang, Rui-Lan; Gu, Fei; Kirma, Nameer B; Ruan, Jianhua; Chen, Chun-Liang; Wang, Hui-Chen; Liao, Yu-Ping; Chang, Cheng-Chang; Yu, Mu-Hsien; Pilrose, Jay M; Thompson, Ian M; Huang, Hsuan-Cheng; Huang, Tim Hui-Ming; Lai, Hung-Cheng; Nephew, Kenneth P
2013-06-01
Women with advanced stage ovarian cancer (OC) have a five-year survival rate of less than 25%. OC progression is associated with accumulation of epigenetic alterations and aberrant DNA methylation in gene promoters acts as an inactivating "hit" during OC initiation and progression. Abnormal DNA methylation in OC has been used to predict disease outcome and therapy response. To globally examine DNA methylation in OC, we used next-generation sequencing technology, MethylCap-sequencing, to screen 75 malignant and 26 normal or benign ovarian tissues. Differential DNA methylation regions (DMRs) were identified, and the Kaplan-Meier method and Cox proportional hazard model were used to correlate methylation with clinical endpoints. Functional role of specific genes identified by MethylCap-sequencing was examined in in vitro assays. We identified 577 DMRs that distinguished (p < 0.001) malignant from non-malignant ovarian tissues; of these, 63 DMRs correlated (p < 0.001) with poor progression free survival (PFS). Concordant hypermethylation and corresponding gene silencing of sonic hedgehog pathway members ZIC1 and ZIC4 in OC tumors was confirmed in a panel of OC cell lines, and ZIC1 and ZIC4 repression correlated with increased proliferation, migration and invasion. ZIC1 promoter hypermethylation correlated (p < 0.01) with poor PFS. In summary, we identified functional DNA methylation biomarkers significantly associated with clinical outcome in OC and suggest our comprehensive methylome analysis has significant translational potential for guiding the design of future clinical investigations targeting the OC epigenome. Methylation of ZIC1, a putative tumor suppressor, may be a novel determinant of OC outcome.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Köberl, Martina; White, Richard A.; Erschen, Sabine
The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.
Köberl, Martina; White, Richard A.; Erschen, Sabine; ...
2015-08-13
The genome sequence of Bacillus amyloliquefaciens strain Co1-6, a plant growth-promoting rhizobacterium (PGPR) with broad-spectrum antagonistic activity against plant-pathogenic fungi, bacteria, and nematodes, consists of a single 3.9-Mb circular chromosome. The genome reveals genes putatively responsible for its promising biocontrol and PGP properties.
Use of CYP52A2A promoter to increase gene expression in yeast
Craft, David L.; Wilson, C. Ron; Eirich, Dudley; Zhang, Yeyan
2004-01-06
A nucleic acid sequence including a CYP promoter operably linked to nucleic acid encoding a heterologous protein is provided to increase transcription of the nucleic acid. Expression vectors and host cells containing the nucleic acid sequence are also provided. The methods and compositions described herein are especially useful in the production of polycarboxylic acids by yeast cells.
Ogura, Yoshitoshi; Hayashi, Tetsuya; Kimbara, Kazuhide
2015-01-01
Methylobacterium species colonize plant surfaces and utilize methanol emitted from plants. Methylobacterium aquaticum strain 22A was isolated from a hydroponic culture of a moss, Racomitrium japonicum, and is a potent plant growth promoter. The complete genome sequencing of the strain confirmed the presence of genes related to plant growth promotion and methylotrophy. PMID:25858842
Genome Sequence of Herbaspirillum sp. Strain GW103, a Plant Growth-Promoting Bacterium
Lee, Gun Woong; Lee, Kui-Jae
2012-01-01
Herbaspirillum sp. strain GW103 was isolated from rhizosphere soil of the reed Phragmites australis on reclaimed land. Here we report the 5.05-Mb draft genome sequence of the strain, providing bioinformation about the agronomic benefits of this strain, such as multiple traits relevant to plant root colonization and plant growth promotion. PMID:22815460
Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S
2008-02-01
The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.
NASA Technical Reports Server (NTRS)
Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.
1999-01-01
Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.
Hu, Xuewei; Yang, Lei; Lai, Xinke; Yao, Qi; Chen, Kai
2017-10-03
This paper presented the influence of Al(III) on biodegradability, micromorphology, composition and functional groups characteristics of the biofilm extracellular polymeric substances (EPS) during different growth phases. The sequencing batch biofilm reactors were developed to cultivate biofilms under different Al(III) dosages. The results elucidated that Al(III) affected biofilm development adversely at the beginning of biofilm growth, but promoted the biofilm mass and improved the biofilm activity with the growth of the biofilm. The micromorphological observation indicated that Al(III) led to a reduction of the filaments and promotion of the EPS secretion in growth phases of the biofilm, also Al(III) could promote microorganisms to form larger colonies for mature biofilm. Then, the analysis of EPS contents and components suggested that Al(III) could increase the protein (PN) of tightly bound EPS (TB-EPS) which alleviated the metal toxicity inhibition on the biofilm during the initial phases of biofilm growth. The biofilm could gradually adapt to the inhibition caused by Al(III) at the biofilm maturation moment. Finally, through the Fourier transform infrared spectroscopy, it was found that Al(III) was beneficial for the proliferation and secretion of TB-EPS functional groups, especially the functional groups of protein and polysaccharides.
The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4
Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.
2013-01-01
The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524
Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters
NASA Astrophysics Data System (ADS)
Helbo, Alexandra Søgaard; Lay, Fides D.; Jones, Peter A.; Liang, Gangning; Grønbæk, Kirsten
2017-02-01
Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high-resolution analysis to show substantial differences in chromatin structure of pol II and pol III promoters, and between subtypes of pol III genes. Notably, the nucleosome depleted region at the transcription start site of pol III genes extends past the termination sequences, resulting in nucleosome free gene bodies. The +1 nucleosome is located further downstream than at pol II genes and furthermore displays weak positioning. The variable position of the +1 location is seen not only within individual cell populations and between cell types, but also between different pol III promoter subtypes, suggesting that the +1 nucleosome may be involved in the transcriptional regulation of pol III genes. We find that expression and DNA methylation patterns correlate with distinct accessibility patterns, where DNA methylation associates with the silencing and inaccessibility at promoters. Taken together, this study provides the first high-resolution map of nucleosome positioning and occupancy at human pol III promoters at specific loci and genome wide.
Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U
1999-11-19
As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.
Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae
Chatre, Laurent; Ricchetti, Miria
2011-01-01
The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151
Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.
Chatre, Laurent; Ricchetti, Miria
2011-03-08
The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.
Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.
Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M
2001-11-01
Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.
Meadows, J R S; Kijas, J W
2009-02-01
The male-specific region of the ovine Y chromosome (MSY) remains poorly characterized, yet sequence variants from this region have the potential to reveal the wild progenitor of domestic sheep or examples of domestic and wild paternal introgression. The 5' promoter region of the sex-determining gene SRY was re-sequenced using a subset of wild sheep including bighorn (Ovis canadensis), thinhorn (Ovis dalli spp.), urial (Ovis vignei), argali (Ovis ammon), mouflon (Ovis musimon) and domestic sheep (Ovis aries). Seven novel SNPs (oY2-oY8) were revealed; these were polymorphic between but not within species. Re-sequencing and fragment analysis was applied to the MSY microsatellite SRYM18. It contains a complex compound repeat structure and sequencing of three novel size fragments revealed that a pentanucleotide element remained fixed, whilst a dinucleotide element displayed variability within species. Comparison of the sequence between species revealed that urial and argali sheep grouped more closely to the mouflon and domestic breeds than the pachyceriforms (bighorn and thinhorn). SNP and microsatellite data were combined to define six previously undetected haplotypes. Analysis revealed the mouflon as the only species to share a haplotype with domestic sheep, consistent with its status as a feral domesticate that has undergone male-mediated exchange with domestic animals. A comparison of the remaining wild species and domestic sheep revealed that O. aries is free from signatures of wild sheep introgression.
Stepan, Ryan M; Sherwood, Julie S; Petermann, Shana R; Logue, Catherine M
2011-06-27
Salmonella species are recognized worldwide as a significant cause of human and animal disease. In this study the molecular profiles and characteristics of Salmonella enterica Senftenberg isolated from human cases of illness and those recovered from healthy or diagnostic cases in animals were assessed. Included in the study was a comparison with our own sequenced strain of S. Senfteberg recovered from production turkeys in North Dakota. Isolates examined in this study were subjected to antimicrobial susceptibility profiling using the National Antimicrobial Resistance Monitoring System (NARMS) panel which tested susceptibility to 15 different antimicrobial agents. The molecular profiles of all isolates were determined using Pulsed Field Gel Electrophoresis (PFGE) and the sequence types of the strains were obtained using Multi-Locus Sequence Type (MLST) analysis based on amplification and sequence interrogation of seven housekeeping genes (aroC, dnaN, hemD, hisD, purE, sucA, and thrA). PFGE data was input into BioNumerics analysis software to generate a dendrogram of relatedness among the strains. The study found 93 profiles among 98 S. Senftenberg isolates tested and there were primarily two sequence types associated with humans and animals (ST185 and ST14) with overlap observed in all host types suggesting that the distribution of S. Senftenberg sequence types is not host dependent. Antimicrobial resistance was observed among the animal strains, however no resistance was detected in human isolates suggesting that animal husbandry has a significant influence on the selection and promotion of antimicrobial resistance. The data demonstrates the circulation of at least two strain types in both animal and human health suggesting that S. Senftenberg is relatively homogeneous in its distribution. The data generated in this study could be used towards defining a pathotype for this serovar.
[Comparative genomics and evolutionary analysis of CRISPR loci in acetic acid bacteria].
Xia, Kai; Liang, Xin-le; Li, Yu-dong
2015-12-01
The clustered regularly interspaced short palindromic repeat (CRISPR) is a widespread adaptive immunity system that exists in most archaea and many bacteria against foreign DNA, such as phages, viruses and plasmids. In general, CRISPR system consists of direct repeat, leader, spacer and CRISPR-associated sequences. Acetic acid bacteria (AAB) play an important role in industrial fermentation of vinegar and bioelectrochemistry. To investigate the polymorphism and evolution pattern of CRISPR loci in acetic acid bacteria, bioinformatic analyses were performed on 48 species from three main genera (Acetobacter, Gluconacetobacter and Gluconobacter) with whole genome sequences available from the NCBI database. The results showed that the CRISPR system existed in 32 species of the 48 strains studied. Most of the CRISPR-Cas system in AAB belonged to type I CRISPR-Cas system (subtype E and C), but type II CRISPR-Cas system which contain cas9 gene was only found in the genus Acetobacter and Gluconacetobacter. The repeat sequences of some CRISPR were highly conserved among species from different genera, and the leader sequences of some CRISPR possessed conservative motif, which was associated with regulated promoters. Moreover, phylogenetic analysis of cas1 demonstrated that they were suitable for classification of species. The conservation of cas1 genes was associated with that of repeat sequences among different strains, suggesting they were subjected to similar functional constraints. Moreover, the number of spacer was positively correlated with the number of prophages and insertion sequences, indicating the acetic acid bacteria were continually invaded by new foreign DNA. The comparative analysis of CRISR loci in acetic acid bacteria provided the basis for investigating the molecular mechanism of different acetic acid tolerance and genome stability in acetic acid bacteria.
Wang, Juan; Shibayama, Yuki; Kobori, Hiroyuki; Liu, Ya; Kobara, Hideki; Masaki, Tsutomu; Wang, Zhiyu
2017-01-01
High glucose has been demonstrated to induce angiotensinogen (AGT) synthesis in the renal proximal tubular cells (RPTCs) of rats, which may further activate the intrarenal renin-angiotensin system (RAS) and contribute to diabetic nephropathy. This study aimed to investigate the effects of high glucose on AGT in the RPTCs of human origin and identify the glucose-responsive transcriptional factor(s) that bind(s) to the DNA sequences of AGT promoter in human RPTCs. Human kidney (HK)-2 cells were treated with normal glucose (5.5 mM) and high glucose (15.0 mM), respectively. Levels of AGT mRNA and AGT secretion of HK-2 cells were measured by real-time polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA), respectively. Consecutive 5’-end deletion mutant constructs and different site-directed mutagenesis products of human AGT promoter sequences were respectively transfected into HK-2 cells, followed by AGT promoter activity measurement through dual luciferase assay. High glucose significantly augmented the levels of AGT mRNA and AGT secretion of HK-2 cells, compared with normal glucose treatment. High glucose also significantly augmented AGT promoter activity in HK-2 cells transfected with the constructs of human AGT promoter sequences, compared with normal glucose treatment. Hepatocyte nuclear factor (HNF)-5 was found to be one of the glucose-responsive transcriptional factors of AGT in human RPTCs, since the mutation of its binding sites within AGT promoter sequences abolished the above effects of high glucose on AGT promoter activity as well as levels of AGT mRNA and its secretion. The present study has demonstrated, for the first time, that high glucose augments AGT in human RPTCs through HNF-5, which provides a potential therapeutic target for diabetic nephropathy. PMID:29053707