Sample records for properties dna binding

  1. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  2. Predicting and analyzing DNA-binding domains using a systematic approach to identifying a set of informative physicochemical and biochemical properties

    PubMed Central

    2011-01-01

    Background Existing methods of predicting DNA-binding proteins used valuable features of physicochemical properties to design support vector machine (SVM) based classifiers. Generally, selection of physicochemical properties and determination of their corresponding feature vectors rely mainly on known properties of binding mechanism and experience of designers. However, there exists a troublesome problem for designers that some different physicochemical properties have similar vectors of representing 20 amino acids and some closely related physicochemical properties have dissimilar vectors. Results This study proposes a systematic approach (named Auto-IDPCPs) to automatically identify a set of physicochemical and biochemical properties in the AAindex database to design SVM-based classifiers for predicting and analyzing DNA-binding domains/proteins. Auto-IDPCPs consists of 1) clustering 531 amino acid indices in AAindex into 20 clusters using a fuzzy c-means algorithm, 2) utilizing an efficient genetic algorithm based optimization method IBCGA to select an informative feature set of size m to represent sequences, and 3) analyzing the selected features to identify related physicochemical properties which may affect the binding mechanism of DNA-binding domains/proteins. The proposed Auto-IDPCPs identified m=22 features of properties belonging to five clusters for predicting DNA-binding domains with a five-fold cross-validation accuracy of 87.12%, which is promising compared with the accuracy of 86.62% of the existing method PSSM-400. For predicting DNA-binding sequences, the accuracy of 75.50% was obtained using m=28 features, where PSSM-400 has an accuracy of 74.22%. Auto-IDPCPs and PSSM-400 have accuracies of 80.73% and 82.81%, respectively, applied to an independent test data set of DNA-binding domains. Some typical physicochemical properties discovered are hydrophobicity, secondary structure, charge, solvent accessibility, polarity, flexibility, normalized Van Der Waals volume, pK (pK-C, pK-N, pK-COOH and pK-a(RCOOH)), etc. Conclusions The proposed approach Auto-IDPCPs would help designers to investigate informative physicochemical and biochemical properties by considering both prediction accuracy and analysis of binding mechanism simultaneously. The approach Auto-IDPCPs can be also applicable to predict and analyze other protein functions from sequences. PMID:21342579

  3. Assessment of amsacrine binding with DNA using UV-visible, circular dichroism and Raman spectroscopic techniques.

    PubMed

    Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana

    2012-09-03

    Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Does TATA matter? A structural exploration of the selectivity determinants in its complexes with TATA box-binding protein.

    PubMed Central

    Pastor, N; Pardo, L; Weinstein, H

    1997-01-01

    The binding of the TATA box-binding protein (TBP) to a TATA sequence in DNA is essential for eukaryotic basal transcription. TBP binds in the minor groove of DNA, causing a large distortion of the DNA helix. Given the apparent stereochemical equivalence of AT and TA basepairs in the minor groove, DNA deformability must play a significant role in binding site selection, because not all AT-rich sequences are bound effectively by TBP. To gain insight into the precise role that the properties of the TATA sequence have in determining the specificity of the DNA substrates of TBP, the solution structure and dynamics of seven DNA dodecamers have been studied by using molecular dynamics simulations. The analysis of the structural properties of basepair steps in these TATA sequences suggests a reason for the preference for alternating pyrimidine-purine (YR) sequences, but indicates that these properties cannot be the sole determinant of the sequence specificity of TBP. Rather, recognition depends on the interplay between the inherent deformability of the DNA and steric complementarity at the molecular interface. Images FIGURE 2 PMID:9251783

  5. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    PubMed

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

    2017-10-13

    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle.

    DTIC Science & Technology

    1996-08-01

    J-4030 TITLE: The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle PRINCIPAL...The In Vivo DNA Binding Properties of 5. FUNDING NUMBERS Wild-Type and Mutant p53 Proteins in Mammary Cell Lines DAMD17-94-J-4030 During the Course of...ABSTRACT (Maximum 200 Using a pair of murine cell lines, one lacking p53 and a derivative cell line containing temperature sensitive p53 val 135

  7. Strong DNA deformation required for extremely slow DNA threading intercalation by a binuclear ruthenium complex

    PubMed Central

    Almaqwashi, Ali A.; Paramanathan, Thayaparan; Lincoln, Per; Rouzina, Ioulia; Westerlund, Fredrik; Williams, Mark C.

    2014-01-01

    DNA intercalation by threading is expected to yield high affinity and slow dissociation, properties desirable for DNA-targeted therapeutics. To measure these properties, we utilize single molecule DNA stretching to quantify both the binding affinity and the force-dependent threading intercalation kinetics of the binuclear ruthenium complex Δ,Δ-[μ‐bidppz‐(phen)4Ru2]4+ (Δ,Δ-P). We measure the DNA elongation at a range of constant stretching forces using optical tweezers, allowing direct characterization of the intercalation kinetics as well as the amount intercalated at equilibrium. Higher forces exponentially facilitate the intercalative binding, leading to a profound decrease in the binding site size that results in one ligand intercalated at almost every DNA base stack. The zero force Δ,Δ-P intercalation Kd is 44 nM, 25-fold stronger than the analogous mono-nuclear ligand (Δ-P). The force-dependent kinetics analysis reveals a mechanism that requires DNA elongation of 0.33 nm for association, relaxation to an equilibrium elongation of 0.19 nm, and an additional elongation of 0.14 nm from the equilibrium state for dissociation. In cells, a molecule with binding properties similar to Δ,Δ-P may rapidly bind DNA destabilized by enzymes during replication or transcription, but upon enzyme dissociation it is predicted to remain intercalated for several hours, thereby interfering with essential biological processes. PMID:25245944

  8. Synthesis, DNA Binding, and Antiproliferative Activity of Novel Acridine-Thiosemicarbazone Derivatives

    PubMed Central

    de Almeida, Sinara Mônica Vitalino; Lafayette, Elizabeth Almeida; Gomes da Silva, Lúcia Patrícia Bezerra; Amorim, Cézar Augusto da Cruz; de Oliveira, Tiago Bento; Gois Ruiz, Ana Lucia Tasca; de Carvalho, João Ernesto; de Moura, Ricardo Olímpio; Beltrão, Eduardo Isidoro Carneiro; de Lima, Maria do Carmo Alves; de Carvalho Júnior, Luiz Bezerra

    2015-01-01

    In this work, the acridine nucleus was used as a lead-compound for structural modification by adding different substituted thiosemicarbazide moieties. Eight new (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide derivatives (3a–h) were synthesized, their antiproliferative activities were evaluated, and DNA binding properties were performed with calf thymus DNA (ctDNA) by electronic absorption and fluorescence spectroscopies. Both hyperchromic and hypochromic effects, as well as red or blue shifts were demonstrated by addition of ctDNA to the derivatives. The calculated binding constants ranged from 1.74 × 104 to 1.0 × 106 M−1 and quenching constants from −0.2 × 104 to 2.18 × 104 M−1 indicating high affinity to ctDNA base pairs. The most efficient compound in binding to ctDNA in vitro was (Z)-2-(acridin-9-ylmethylene)-N-(4-chlorophenyl) hydrazinecarbothioamide (3f), while the most active compound in antiproliferative assay was (Z)-2-(acridin-9-ylmethylene)-N-phenylhydrazinecarbothioamide (3a). There was no correlation between DNA-binding and in vitro antiproliferative activity, but the results suggest that DNA binding can be involved in the biological activity mechanism. This study may guide the choice of the size and shape of the intercalating part of the ligand and the strategic selection of substituents that increase DNA-binding or antiproliferative properties. PMID:26068233

  9. The effects of linear assembly of two carbazole groups on acid-base and DNA-binding properties of a ruthenium(II) complex.

    PubMed

    Chen, Xi; Xue, Long-Xin; Ju, Chun-Chuan; Wang, Ke-Zhi

    2013-07-01

    A novel Ru(II) complex of [Ru(bpy)2(Hbcpip)](ClO4)2 {where bpy=2,2-bipyridine, Hbcpip=2-(4-(9H-3,9'-bicarbazol-9-yl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline} is synthesized and characterized. Calf-thymus DNA-binding properties of the complex were studied by UV-vis absorption and luminescence titrations, steady-state emission quenching by [Fe(CN)6](4-), DNA competitive binding with ethidium bromide, thermal denaturation and DNA viscosity measurements. The results indicate that the complex partially intercalated into the DNA with a binding constant of (5.5±1.4)×10(5) M(-1) in buffered 50 mM NaCl. The acid-base properties of the complex were also studied by UV-visible and luminescence spectrophotometric pH titrations, and ground- and excited-state acidity ionization constant values were derived. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Binding of anticancer drug daunomycin to a TGGGGT G-quadruplex DNA probed by all-atom molecular dynamics simulations: additional pure groove binding mode and implications on designing more selective G-quadruplex ligands.

    PubMed

    Shen, Zhanhang; Mulholland, Kelly A; Zheng, Yujun; Wu, Chun

    2017-09-01

    DNA G-quadruplex structures are emerging cancer-specific targets for chemotherapeutics. Ligands that bind to and stabilize DNA G-quadruplexes have the potential to be anti-cancer drugs. Lack of binding selectivity to DNA G-quadruplex over DNA duplex remains a major challenge when attempting to develop G-quadruplex ligands into successful anti-cancer drugs. Thorough understanding of the binding nature of existing non-selective ligands that bind to both DNA quadruplex and DNA duplex will help to address this challenge. Daunomycin and doxorubicin, two commonly used anticancer drugs, are examples of non-selective DNA ligands. In this study, we extended our early all-atom binding simulation studies between doxorubicin and a DNA duplex (d(CGATCG) 2 ) to probe the binding between daunomycin and a parallel DNA quadruplex (d(TGGGGT) 4 ) and DNA duplex. In addition to the end stacking mode, which mimics the mode in the crystal structure, a pure groove binding mode was observed in our free binding simulations. The dynamic and energetic properties of these two binding modes are thoroughly examined, and a detailed comparison is made between DNA quadruplex binding modes and DNA duplex binding modes. Implications on the design of more selective DNA quadruplex ligands are also discussed. Graphical abstract Top stacking and groov binding modes from the MD simulations.

  11. Modulation of DNA binding by gene-specific transcription factors.

    PubMed

    Schleif, Robert F

    2013-10-01

    The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

  12. Experimental and computational studies on the effects of valganciclovir as an antiviral drug on calf thymus DNA.

    PubMed

    Shahabadi, Nahid; Pourfoulad, Mehdi; Moghadam, Neda Hosseinpour

    2017-01-02

    DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K a , is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.

  13. Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.

    PubMed

    Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay

    2014-05-01

    The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.

  14. New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong

    Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less

  15. Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

    PubMed

    Johnson, G G; Geiduschek, E P

    1977-04-05

    The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

  16. Molecular characterization of the host defense activity of the barrier to autointegration factor against vaccinia virus.

    PubMed

    Ibrahim, Nouhou; Wicklund, April; Wiebe, Matthew S

    2011-11-01

    The barrier to autointegration factor (BAF) is an essential cellular protein with functions in mitotic nuclear reassembly, retroviral preintegration complex stability, and transcriptional regulation. Molecular properties of BAF include the ability to bind double-stranded DNA in a sequence-independent manner, homodimerize, and bind proteins containing a LEM domain. These capabilities allow BAF to compact DNA and assemble higher-order nucleoprotein complexes, the nature of which is poorly understood. Recently, it was revealed that BAF also acts as a potent host defense against poxviral DNA replication in the cytoplasm. Here, we extend these observations by examining the molecular mechanism through which BAF acts as a host defense against vaccinia virus replication and cytoplasmic DNA in general. Interestingly, BAF rapidly relocalizes to transfected DNA from a variety of sources, demonstrating that BAF's activity as a host defense factor is not limited to poxviral infection. BAF's relocalization to cytoplasmic foreign DNA is highly dependent upon its DNA binding and dimerization properties but does not appear to require its LEM domain binding activity. However, the LEM domain protein emerin is recruited to cytoplasmic DNA in a BAF-dependent manner during both transfection and vaccinia virus infection. Finally, we demonstrate that the DNA binding and dimerization capabilities of BAF are essential for its function as an antipoxviral effector, while the presence of emerin is not required. Together, these data provide further mechanistic insight into which of BAF's molecular properties are employed by cells to impair the replication of poxviruses or respond to foreign DNA in general.

  17. Multivalent DNA-binding properties of the HMG-1 proteins.

    PubMed Central

    Maher, J F; Nathans, D

    1996-01-01

    HMG-I proteins are DNA-binding proteins thought to affect the formation and function of transcription complexes. Each protein contains three DNA-binding motifs, known as AT-hooks, that bind in the minor groove of AT tracts in DNA. Multiple AT-hooks within a polypeptide chain should contact multiple AT tracts, but the rules governing these interactions have not been defined. In this study, we demonstrate that high-affinity binding uses two or three appropriately spaced AT tracts as a single multivalent binding site. These principles have implications for binding to regulatory elements such as the interferon beta enhancer, TATA boxes, and serum response elements. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8692884

  18. DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

    PubMed

    Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

    2017-10-01

    Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  19. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    PubMed Central

    Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

    2011-01-01

    Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

  20. Unveiling Stability Criteria of DNA-Carbon Nanotubes Constructs by Scanning Tunneling Microscopy and Computational Modeling

    DOE PAGES

    Kilina, Svetlana; Yarotski, Dzmitry A.; Talin, A. Alec; ...

    2011-01-01

    We present a combined approach that relies on computational simulations and scanning tunneling microscopy (STM) measurements to reveal morphological properties and stability criteria of carbon nanotube-DNA (CNT-DNA) constructs. Application of STM allows direct observation of very stable CNT-DNA hybrid structures with the well-defined DNA wrapping angle of 63.4 ° and a coiling period of 3.3 nm. Using force field simulations, we determine how the DNA-CNT binding energy depends on the sequence and binding geometry of a single strand DNA. This dependence allows us to quantitatively characterize the stability of a hybrid structure with an optimal π-stacking between DNA nucleotides and themore » tube surface and better interpret STM data. Our simulations clearly demonstrate the existence of a very stable DNA binding geometry for (6,5) CNT as evidenced by the presence of a well-defined minimum in the binding energy as a function of an angle between DNA strand and the nanotube chiral vector. This novel approach demonstrates the feasibility of CNT-DNA geometry studies with subnanometer resolution and paves the way towards complete characterization of the structural and electronic properties of drug-delivering systems based on DNA-CNT hybrids as a function of DNA sequence and a nanotube chirality.« less

  1. Deciphering the mechanism of interaction of edifenphos with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Ahmad, Ajaz; Ahmad, Masood

    2018-01-01

    Edifenphos is an important organophosphate pesticide with many antifungal and anti-insecticidal properties but it may cause potential hazards to human health. In this work, we have tried to explore the binding mode of action and mechanism of edifenphos to calf thymus DNA (CT-DNA). Several experiments such as ultraviolet-visible absorption spectra and emission spectroscopy showed complex formation between edifenphos and CT-DNA and low binding constant values supporting groove binding mode. These results were further confirmed by circular dichroism (CD), CT-DNA melting studies, viscosity measurements, density functional theory and molecular docking. CD study suggests that edifenphos does not alter native structure of CT-DNA. Isothermal calorimetry reveals that binding of edifenphos with CT-DNA is enthalpy driven process. Competitive binding assay and effect of ionic strength showed that edifenphos binds to CT-DNA via groove binding manner. Hence, edifenphos is a minor groove binder preferably interacting with A-T regions with docking score - 6.84 kJ/mol.

  2. β -Cyclodextrin polymer binding to DNA: Modulating the physicochemical parameters

    NASA Astrophysics Data System (ADS)

    Rocha, J. C. B.; Silva, E. F.; Oliveira, M. F.; Sousa, F. B.; Teixeira, A. V. N. C.; Rocha, M. S.

    2017-05-01

    Cyclodextrins and cyclodextrins-modified molecules have interesting and appealing properties due to their capacity to host components that are normally insoluble or poorly soluble in water. In this work, we investigate the interaction of a β -cyclodextrin polymer (poly-β -CD) with λ -DNA. The polymers are obtained by the reaction of β -CD with epichlorohydrin in alkaline conditions. We have used optical tweezers to characterize the changes of the mechanical properties of DNA molecules by increasing the concentration of poly-β -CD in the sample. The physical chemistry of the interaction is then deduced from these measurements by using a recently developed quenched-disorder statistical model. It is shown that the contour length of the DNA does not change in the whole range of poly-β -CD concentration (<300 μ M ). On the other hand, significant alterations were observed in the persistence length that identifies two binding modes corresponding to the clustering of ˜2.6 and ˜14 polymer molecules along the DNA double helix, depending on the polymer concentration. Comparing these results with the ones obtained for monomeric β -CD, it was observed that the concentration of CD that alters the DNA persistence length is considerably smaller when in the polymeric form. Also, the binding constant of the polymer-DNA interaction is three orders of magnitude higher than the one found for native (monomeric) β -CD. These results show that the polymerization of the β -CD strongly increases its binding affinity to the DNA molecule. This property can be wisely used to modulate the binding of cyclodextrins to the DNA double helix.

  3. Extracting physical chemistry from mechanics: a new approach to investigate DNA interactions with drugs and proteins in single molecule experiments.

    PubMed

    Rocha, M S

    2015-09-01

    In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.

  4. The Arabidopsis class I TCP transcription factor AtTCP11 is a developmental regulator with distinct DNA-binding properties due to the presence of a threonine residue at position 15 of the TCP domain.

    PubMed

    Viola, Ivana L; Uberti Manassero, Nora G; Ripoll, Rodrigo; Gonzalez, Daniel H

    2011-04-01

    The TCP domain is a DNA-binding domain present in plant transcription factors that modulate different processes. In the present study, we show that Arabidopsis class I TCP proteins are able to interact with a dyad-symmetric sequence composed of two GTGGG half-sites. TCP20 establishes symmetric interactions with the 5' half of each strand, whereas TCP11 interacts mainly with the 3' half. SELEX (systematic evolution of ligands by exponential enrichment) experiments with TCP15 and TCP20 indicated that these proteins have similar, although not identical, DNA-binding preferences and are able to interact with non-palindromic binding sites of the type GTGGGNCCNN. TCP11 shows a different DNA-binding specificity, with a preference for the sequence GTGGGCCNNN. The distinct DNA-binding properties of TCP11 are due to the presence of a threonine residue at position 15 of the TCP domain, a position that is occupied by an arginine residue in most TCP proteins. TCP11 also forms heterodimers with TCP15 that have increased DNA-binding efficiency. The expression in plants of a repressor form of TCP11 demonstrated that this protein is a developmental regulator that influences the growth of leaves, stems and petioles, and pollen development. The results suggest that changes in DNA-binding preferences may be one of the mechanisms through which class I TCP proteins achieve functional specificity.

  5. Effect of Escherichia coli DNA binding protein on the transcription of single-stranded phage M13 DNA by Escherichia coli RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Ratrie, H. III; Datta, A.K.

    E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less

  6. Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

    PubMed

    Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

    2017-09-01

    Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

  7. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  8. DNA-bending properties of TF1.

    PubMed

    Schneider, G J; Sayre, M H; Geiduschek, E P

    1991-10-05

    Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TF1 dimer binding to one of its preferred sites in (5-hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TF1 and E. coli IHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding "arm" of TF1 are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TF1 binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TF1 is proposed. Under the assumptions of this analysis, the reduced affinity of TF1 for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TF1-DNA interaction has also been extended by hydroxyl radical (.OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TF1 strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten base-pairs of the two TF1 binding sites quantitatively diminishes, but does not abolish, TF1 binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TF1 dimer, considerably deforming the DNA B-helix in the process.

  9. The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

    PubMed

    Alam, Tanfis I; Rao, Venigalla B

    2008-03-07

    Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

  10. Autoinhibitory mechanisms of ERG studied by molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Lu, Yan; Salsbury, Freddie R.

    2015-01-01

    ERG, an ETS-family transcription factor, acts as a regulator of differentiation of early hematopoietic cells. It contains an autoinhibitory domain, which negatively regulates DNA-binding. The mechanism of autoinhibitory is still illusive. To understand the mechanism, we study the dynamical properties of ERG protein by molecular dynamics simulations. These simulations suggest that DNA binding autoinhibition associates with the internal dynamics of ERG. Specifically, we find that (1), The N-C terminal correlation in the inhibited ERG is larger than that in uninhibited ERG that contributes to the autoinhibition of DNA-binding. (2), DNA-binding changes the property of the N-C terminal correlation from being anti-correlated to correlated, that is, changing the relative direction of the correlated motions and (3), For the Ets-domain specifically, the inhibited and uninhibited forms exhibit essentially the same dynamics, but the binding of the DNA decreases the fluctuation of the Ets-domain. We also find from PCA analysis that the three systems, even with quite different dynamics, do have highly similar free energy surfaces, indicating that they share similar conformations.

  11. DNA binding properties and biological evaluation of dihydropyrimidinones derivatives as potential antitumor agents.

    PubMed

    Wang, Gongke; Li, Xiangrong; Gou, Yaping; Chen, Yuhan; Yan, Changling; Lu, Yan

    2013-10-01

    The binding properties of two medicinally important dihydropyrimidinones derivatives 5-(Ethoxycarbonyl)-6-methyl-4-phenyl-3,4-dihydropyrimidin-2(1H)-one (EMPD) and 5-(Ethoxycarbonyl)-6-methyl-4-(4-chlorophenyl)-3,4-dihydropyrimidin-2(1H)-one (EMCD) with calf-thymus DNA (ctDNA) were investigated by spectroscopy, viscosity, isothermal titration calorimetry (ITC) and molecular modeling techniques. Simultaneously, their biological activities were evaluated with MTT assay method. The binding constants determined with spectroscopic titration and ITC were found to be in the same order of 10(4)M(-1). According to the results of viscosity studies, fluorescence competitive binding experiment and ITC investigations, intercalative binding was evaluated as the dominant binding modes between the two compounds and ctDNA. Furthermore, the results of molecular modeling corroborated those obtained from spectroscopic, viscosimetric and ITC investigations. Evaluation of the antitumor activities of the two derivatives against different tumor cell lines proved that they exhibited significant tumor cell inhibition rate, accordingly blocking DNA transcription and replication. The present results favor the development of potential drugs related with dihydropyrimidinones derivatives in the treatment of some diseases. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. A comprehensive approach to ascertain the binding mode of curcumin with DNA

    NASA Astrophysics Data System (ADS)

    Haris, P.; Mary, Varughese; Aparna, P.; Dileep, K. V.; Sudarsanakumar, C.

    2017-03-01

    Curcumin is a natural phytochemical from the rhizoma of Curcuma longa, the popular Indian spice that exhibits a wide range of pharmacological properties like antioxidant, anticancer, anti-inflammatory, antitumor, and antiviral activities. In the published literatures we can see different studies and arguments on the interaction of curcumin with DNA. The intercalative binding, groove binding and no binding of curcumin with DNA were reported. In this context, we conducted a detailed study to understand the mechanism of recognition of dimethylsulfoxide-solubilized curcumin by DNA. The interaction of curcumin with calf thymus DNA (ctDNA) was confirmed by agarose gel electrophoresis. The nature of binding and energetics of interaction were studied by Isothermal Titration Calorimetry (ITC), Differential Scanning Calorimetry (DSC), UV-visible, fluorescence and melting temperature (Tm) analysis. The experimental data were compared with molecular modeling studies. Our investigation confirmed that dimethylsulfoxide-solubilized curcumin binds in the minor groove of the ctDNA without causing significant structural alteration to the DNA.

  13. Effects of mutations at amino acid 61 in the arm of TF1 on its DNA-binding properties.

    PubMed

    Sayre, M H; Geiduschek, E P

    1990-12-20

    Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of bacterial DNA-binding proteins that includes Escherichia coli HU and integration host factor (IHF). We have initiated a mutational analysis of the TF1 molecule to understand better its unique DNA-binding properties and to investigate its physiological function. We report here the consequences of mutating the putative DNA-binding "arms" of TF1. At position 61 in its primary sequence, TF1 contains a Phe residue in place of the Arg residue found in all other known members of the HU family. Substituting polar, uncharged residues for Phe61 substantially reduced the DNA-binding affinity and site-selectivity of TF1 in vitro, whereas the substitution of Tyr had no effect. Substituting Trp or Arg for Phe61 had little effect on the affinity of TF1 for SPO1 DNA, but altered the electrophoretic mobilities of protein-DNA complexes in non-denaturing gels. The Arg61 substitution increased the affinity of the protein for non-specific sites on thymine-containing DNA, thus reducing the natural preference of TF1 for (5-hydroxymethyluracil)-containing DNA. The Phe61-to-Arg mutation was also correlated with decreased phage yield and aberrant regulation of viral protein synthesis in vivo.

  14. Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

    PubMed

    Song, Wei; Guo, Jun-Tao

    2015-01-01

    Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

  15. Understanding the mechanisms of protein-DNA interactions

    NASA Astrophysics Data System (ADS)

    Lavery, Richard

    2004-03-01

    Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

  16. DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.

    PubMed

    Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G

    2012-04-01

    Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

  17. DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

    PubMed

    Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

    2014-02-03

    The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

  18. (CAG)(n)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition.

    PubMed

    Owen, Barbara A L; Yang, Zungyoon; Lai, Maoyi; Gajec, Maciej; Gajek, Maciez; Badger, John D; Hayes, Jeffrey J; Edelmann, Winfried; Kucherlapati, Raju; Wilson, Teresa M; McMurray, Cynthia T

    2005-08-01

    Cells have evolved sophisticated DNA repair systems to correct damaged DNA. However, the human DNA mismatch repair protein Msh2-Msh3 is involved in the process of trinucleotide (CNG) DNA expansion rather than repair. Using purified protein and synthetic DNA substrates, we show that Msh2-Msh3 binds to CAG-hairpin DNA, a prime candidate for an expansion intermediate. CAG-hairpin binding inhibits the ATPase activity of Msh2-Msh3 and alters both nucleotide (ADP and ATP) affinity and binding interfaces between protein and DNA. These changes in Msh2-Msh3 function depend on the presence of A.A mispaired bases in the stem of the hairpin and on the hairpin DNA structure per se. These studies identify critical functional defects in the Msh2-Msh3-CAG hairpin complex that could misdirect the DNA repair process.

  19. Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

    PubMed Central

    Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

    2010-01-01

    The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

  20. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Spectroscopic and viscometric elucidation of the interaction between a potential chloride channel blocker and calf-thymus DNA: the effect of medium ionic strength on the binding mode.

    PubMed

    Ganguly, Aniruddha; Ghosh, Soumen; Guchhait, Nikhil

    2015-01-07

    The present study demonstrates a detailed characterization of the binding interaction of a potential chloride channel blocker 9-methyl anthroate (9-MA) with calf-thymus DNA. The modulated photophysical properties of the emissive molecule within the microheterogeneous bio-assembly have been spectroscopically exploited to monitor the drug-DNA binding interaction. Experimental results based on fluorescence and absorption spectroscopy aided with DNA-melting, viscometric and circular dichroism studies unambiguously establish the binding mode between the drug and DNA to be principally intercalative. Concomitantly, a discernible dependence of the mode of binding between the concerned moieties on the ionic strength of the medium is noteworthy. A dip-and-rise characteristic of the rotational relaxation profile of the drug within the DNA environment has been argued to be originating from a substantial difference in the lifetime as well as amplitude of the free and DNA bound drug molecule. In view of the prospective biological applications of the drug, the issue of facile dissociation of the intercalated drug from the DNA helix via a simple detergent-sequestration technique has also been unveiled. The utility of the present work resides in exploring the potential applicability of the fluorescence properties of 9-MA for studying its interactions with other relevant biological or biomimicking targets.

  2. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  3. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  4. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Xun; Guanga, Gerald P; Wan, Cheng

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

  5. Preparation and DNA-binding properties of substituted triostin antibiotics.

    PubMed

    Cornish, A; Fox, K R; Waring, M J

    1983-02-01

    Novel derivatives of the triostin group of antibiotics were prepared by supplementing cultures of the producing organism Streptomyces triostinicus with a variety of aromatic carboxylic acids. Five new antibiotics, each having both the natural quinoxaline chromophores replaced by a substituted ring system, were purified to homogeneity and characterized by high-pressure liquid chromatography and nuclear magnetic resonance. Their antibacterial activities and DNA-binding properties were investigated. Addition of a halogen atom at position 6 of the quinoxaline ring or an amino group at position 3 had little effect on either the biological activity or the DNA-binding characteristics. The bis-3-amino derivative is fluorescent, and its fluorescence is strongly quenched by calf thymus DNA and polydeoxyguanylate-polydeoxycytidylate but not by polydeoxyadenylate-polydeoxythymidylate, suggesting that it binds preferentially to guanosine-cytosine-rich sequences in natural DNA. Binding constants for the bis-6-chloro and bis-3-amino derivatives do not differ greatly from those of unsubstituted triostin A. The analogs having two quinoline chromophores or a chlorine atom in position 7 of the quinoxaline ring display little or no detectable antibacterial activity, in marked contrast to the other congeners. Bis-7-chloro-triostin A binds conspicuously more tightly to polydeoxyadenylate-polydeoxythymidylate than to any other polynucleotide tested.

  6. Screening and analysis of bioactive compounds with biofingerprinting chromatogram analysis of traditional Chinese medicines targeting DNA by microdialysis/HPLC.

    PubMed

    Su, Xingye; Kong, Liang; Li, Xin; Chen, Xueguo; Guo, Ming; Zou, Hanfa

    2005-05-27

    Biofingerprinting chromatogram analysis, which is defined as the comparison of fingerprinting chromatograms of the extract of traditional Chinese medicines (TCMs) before and after the interaction with biological systems (DNA, protein, cell, etc.), was proposed for screening and analysis of the multiple bioactive compounds in TCMs. A method of microdialysis sampling combined with high performance liquid chromatography (HPLC) was applied to the study of DNA-binding property for the extracts of TCMs. Seven compounds were found to bind to calf thymus DNA (ct-DNA) from the TCMs of Coptis chinensis Franch (Coptis), but only three ones from Phellodendron amurense Rupr. (Phellodendron) and none from Sophoraflavescens Ait. (Sophora) to bind to ct-DNA, respectively. Three of them were identified as berberine, palmatine and jatrorrhizine and their association constants (K) to ct-DNA were determined by microdialysis/HPLC. Competitive binding behaviors of them to ct-DNA were also investigated.

  7. New phthalimide-appended Schiff bases: Studies of DNA binding, molecular docking and antioxidant activities.

    PubMed

    Nayab, Pattan Sirajuddin; Akrema; Ansari, Istikhar A; Shahid, Mohammad; Rahisuddin

    2017-08-01

    Herein, we investigated new phthalimide-based Schiff base molecules as promising DNA-binding and free radical scavenging agents. Physicochemical properties of these molecules were demonstrated on the basis of elemental analysis, ultraviolet-visible (UV-Vis), infra-red (IR), 1 H and 13 C nuclear magnetic resonance (NMR) spectroscopy. All spectral data are agreed well with the proposed Schiff base framework. The DNA-binding potential of synthesized compounds were investigated by means of UV-visible, fluorescence, iodide quenching, circular dichroism, viscosity and thermal denaturation studies. The intrinsic binding constants (K b ) were calculated from absorption studies were found to be 1.1 × 10 4 and 1.0 × 10 4  M -1 for compounds 2a and 2b suggesting that compound 2a binding abilities with DNA were stronger than the compound 2b. Our studies showed that the presented compounds interact with DNA through groove binding. Molecular docking studies were carried out to predict the binding between Ct-DNA and test compounds. Interestingly, in silico predictions were corroborated with in vitro DNA-binding conclusions. Furthermore, the title compounds displayed remarkable antioxidant activity compared with reference standard. Copyright © 2016 John Wiley & Sons, Ltd.

  8. A Key Evolutionary Mutation Enhances DNA Binding of the FOXP2 Forkhead Domain.

    PubMed

    Morris, Gavin; Fanucchi, Sylvia

    2016-04-05

    Forkhead box (FOX) transcription factors share a conserved forkhead DNA binding domain (FHD) and are key role players in the development of many eukaryotic species. Their involvement in various congenital disorders and cancers makes them clinically relevant targets for novel therapeutic strategies. Among them, the FOXP subfamily of multidomain transcriptional repressors is unique in its ability to form DNA binding homo and heterodimers. The truncated FOXP2 FHD, in the absence of the leucine zipper, exists in equilibrium between monomeric and domain-swapped dimeric states in vitro. As a consequence, determining the DNA binding properties of the FOXP2 FHD becomes inherently difficult. In this work, two FOXP2 FHD hinge loop mutants have been generated to successfully prevent both the formation (A539P) and the dissociation (F541C) of the homodimers. This allows for the separation of the two species for downstream DNA binding studies. Comparison of DNA binding of the different species using electrophoretic mobility shift assay, fluorescence anisotropy and isothermal titration calorimetry indicates that the wild-type FOXP2 FHD binds DNA as a monomer. However, comparison of the DNA-binding energetics of the monomer and wild-type FHD, reveals that there is a difference in the mechanism of binding between the two species. We conclude that the naturally occurring reverse mutation (P539A) seen in the FOXP subfamily increases DNA binding affinity and may increase the potential for nonspecific binding compared to other FOX family members.

  9. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

    NASA Astrophysics Data System (ADS)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

    2012-02-01

    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  10. Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Mitra, S.

    Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

  11. Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

    PubMed

    Malhotra, Sony; Sowdhamini, Ramanathan

    2013-08-01

    The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

  12. Yeast mitochondrial HMG proteins: DNA-binding properties of the most evolutionarily divergent component of mitochondrial nucleoids.

    PubMed

    Bakkaiova, Jana; Marini, Victoria; Willcox, Smaranda; Nosek, Jozef; Griffith, Jack D; Krejci, Lumir; Tomaska, Lubomir

    2015-12-08

    Yeast mtDNA is compacted into nucleoprotein structures called mitochondrial nucleoids (mt-nucleoids). The principal mediators of nucleoid formation are mitochondrial high-mobility group (HMG)-box containing (mtHMG) proteins. Although these proteins are some of the fastest evolving components of mt-nucleoids, it is not known whether the divergence of mtHMG proteins on the level of their amino acid sequences is accompanied by diversification of their biochemical properties. In the present study we performed a comparative biochemical analysis of yeast mtHMG proteins from Saccharomyces cerevisiae (ScAbf2p), Yarrowia lipolytica (YlMhb1p) and Candida parapsilosis (CpGcf1p). We found that all three proteins exhibit relatively weak binding to intact dsDNA. In fact, ScAbf2p and YlMhb1p bind quantitatively to this substrate only at very high protein to DNA ratios and CpGcf1p shows only negligible binding to dsDNA. In contrast, the proteins exhibit much higher preference for recombination intermediates such as Holliday junctions (HJ) and replication forks (RF). Therefore, we hypothesize that the roles of the yeast mtHMG proteins in maintenance and compaction of mtDNA in vivo are in large part mediated by their binding to recombination/replication intermediates. We also speculate that the distinct biochemical properties of CpGcf1p may represent one of the prerequisites for frequent evolutionary tinkering with the form of the mitochondrial genome in the CTG-clade of hemiascomycetous yeast species. © 2016 Authors.

  13. Direct DNA binding by Brca1.

    PubMed

    Paull, T T; Cortez, D; Bowers, B; Elledge, S J; Gellert, M

    2001-05-22

    The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein-DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription.

  14. DNABP: Identification of DNA-Binding Proteins Based on Feature Selection Using a Random Forest and Predicting Binding Residues.

    PubMed

    Ma, Xin; Guo, Jing; Sun, Xiao

    2016-01-01

    DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.

  15. DNA binding of supramolecular mixed-metal complexes

    NASA Astrophysics Data System (ADS)

    Swavey, Shawn; Williams, Rodd L.; Fang, Zhenglai; Milkevitch, Matthew; Brewer, Karen J.

    2001-10-01

    The high binding affinity of cisplatin toward DNA has led to its popularity as an anticancer agent. Due to cumulative drug resistance and toxic side effects, researchers are exploring related metallodrugs. Our approach involves the use of supramolecular complexes. These mixed-metal complexes incorporate a reactive platinum moiety bridged by a polyazine ligand to a light absorbing metal-based chromophore. The presence of the light absorber allows excitation of these systems, opening up the possibility of photoactivation. The use of a supramolecular design allows components of the assembly to be varied to enhance device function and light absorbing properties. Aspects of our molecular design process and results on the DNA binding properties for a number of these mixed-metal complexes will be discussed.

  16. Sequence-Specific Recognition of DNA by Proteins: Binding Motifs Discovered Using a Novel Statistical/Computational Analysis

    PubMed Central

    Jakubec, David; Laskowski, Roman A.; Vondrasek, Jiri

    2016-01-01

    Decades of intensive experimental studies of the recognition of DNA sequences by proteins have provided us with a view of a diverse and complicated world in which few to no features are shared between individual DNA-binding protein families. The originally conceived direct readout of DNA residue sequences by amino acid side chains offers very limited capacity for sequence recognition, while the effects of the dynamic properties of the interacting partners remain difficult to quantify and almost impossible to generalise. In this work we investigated the energetic characteristics of all DNA residue—amino acid side chain combinations in the conformations found at the interaction interface in a very large set of protein—DNA complexes by the means of empirical potential-based calculations. General specificity-defining criteria were derived and utilised to look beyond the binding motifs considered in previous studies. Linking energetic favourability to the observed geometrical preferences, our approach reveals several additional amino acid motifs which can distinguish between individual DNA bases. Our results remained valid in environments with various dielectric properties. PMID:27384774

  17. Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

    PubMed

    Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

    2018-01-09

    Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

    2018-03-01

    DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH < 0 and ΔS < 0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking.

  19. Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

    NASA Astrophysics Data System (ADS)

    Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

    Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

  20. The Staphylococcus aureus group II biotin protein ligase BirA is an effective regulator of biotin operon transcription and requires the DNA binding domain for full enzymatic activity.

    PubMed

    Henke, Sarah K; Cronan, John E

    2016-11-01

    Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.

  1. Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

    PubMed Central

    Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

    2013-01-01

    Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

  2. The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange

    PubMed Central

    Qian, Yufeng; Johnson, Kenneth A.

    2017-01-01

    The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB–ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 109 m−1 s−1) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. PMID:28615444

  3. Reshaping the Energy Landscape Transforms the Mechanism and Binding Kinetics of DNA Threading Intercalation.

    PubMed

    Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C

    2018-02-06

    Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.

  4. Multiple Intrinsically Disordered Sequences Alter DNA Binding by the Homeodomain of the Drosophila Hox Protein Ultrabithorax*S⃞

    PubMed Central

    Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.

    2008-01-01

    During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761

  5. Mechanically tunable actin networks using programmable DNA based cross-linkers

    NASA Astrophysics Data System (ADS)

    Schnauss, Joerg; Lorenz, Jessica; Schuldt, Carsten; Kaes, Josef; Smith, David

    Cells employ multiple cross-linkers with very different properties. Studies of the entire phase space, however, were infeasible since they were restricted to naturally occurring cross-linkers. These components cannot be controllably varied and differ in many parameters. We resolve this limitation by forming artificial actin cross-linkers, which can be controllably varied. The basic building block is DNA enabling a well-defined length variation. DNA can be attached to actin binding peptides with known binding affinities. We used bulk rheology to investigate mechanical properties of these networks. We were able to reproduce mechanical features of actin networks cross-linked by fascin by using a short version of our artificial complex with a high binding affinity. Additionally, we were able to resemble findings for the cross-linker alpha-actinin by employing a long cross-linker with a low binding affinity. Between these natural limits we investigated three different cross-linker lengths each with two different binding affinities. With these controlled variations we are able to precisely screen the phase space of cross-linked actin networks by changing only one specific parameter and not the entire set of properties as in the case of naturally occurring cross-linking complexes.

  6. The structure and DNA-binding properties of Mgm101 from a yeast with a linear mitochondrial genome

    PubMed Central

    Pevala, Vladimír; Truban, Dominika; Bauer, Jacob A.; Košťan, Július; Kunová, Nina; Bellová, Jana; Brandstetter, Marlene; Marini, Victoria; Krejčí, Lumír; Tomáška, Ľubomír; Nosek, Jozef; Kutejová, Eva

    2016-01-01

    To study the mechanisms involved in the maintenance of a linear mitochondrial genome we investigated the biochemical properties of the recombination protein Mgm101 from Candida parapsilosis. We show that CpMgm101 complements defects associated with the Saccharomyces cerevisiae mgm101–1ts mutation and that it is present in both the nucleus and mitochondrial nucleoids of C. parapsilosis. Unlike its S. cerevisiae counterpart, CpMgm101 is associated with the entire nucleoid population and is able to bind to a broad range of DNA substrates in a non-sequence specific manner. CpMgm101 is also able to catalyze strand annealing and D-loop formation. CpMgm101 forms a roughly C-shaped trimer in solution according to SAXS. Electron microscopy of a complex of CpMgm101 with a model mitochondrial telomere revealed homogeneous, ring-shaped structures at the telomeric single-stranded overhangs. The DNA-binding properties of CpMgm101, together with its DNA recombination properties, suggest that it can play a number of possible roles in the replication of the mitochondrial genome and the maintenance of its telomeres. PMID:26743001

  7. Imaging chromatin nanostructure with binding-activated localization microscopy based on DNA structure fluctuations

    PubMed Central

    Szczurek, Aleksander; Klewes, Ludger; Xing, Jun; Gourram, Amine; Birk, Udo; Knecht, Hans; Dobrucki, Jurek W.; Mai, Sabine

    2017-01-01

    Abstract Advanced light microscopy is an important tool for nanostructure analysis of chromatin. In this report we present a general concept for Single Molecule localization Microscopy (SMLM) super-resolved imaging of DNA-binding dyes based on modifying the properties of DNA and the dye. By careful adjustment of the chemical environment leading to local, reversible DNA melting and hybridization control over the fluorescence signal of the DNA-binding dye molecules can be introduced. We postulate a transient binding as the basis for our variation of binding-activated localization microscopy (BALM). We demonstrate that several intercalating and minor-groove binding DNA dyes can be used to register (optically isolate) only a few DNA-binding dye signals at a time. To highlight this DNA structure fluctuation-assisted BALM (fBALM), we applied it to measure, for the first time, nanoscale differences in nuclear architecture in model ischemia with an anticipated structural resolution of approximately 50 nm. Our data suggest that this approach may open an avenue for the enhanced microscopic analysis of chromatin nano-architecture and hence the microscopic analysis of nuclear structure aberrations occurring in various pathological conditions. It may also become possible to analyse nuclear nanostructure differences in different cell types, stages of development or environmental stress conditions. PMID:28082388

  8. Interrelations of secondary structure stability and DNA-binding affinity in the bacteriophage SPO1-encoded type II DNA-binding protein TF1.

    PubMed

    Andera, L; Spangler, C J; Galeone, A; Mayol, L; Geiduschek, E P

    1994-02-11

    TF1, a homodimeric DNA-binding and -bending protein with a preference for hydroxymethyluracil-containing DNA is the Bacillus subtilis-encoded homolog of the bacterial HU proteins and of the E. coli integration host factor. A temperature-sensitive mutation at amino acid 25 of TF1 (L25-->A) and two intragenic second site revertants at amino acids 15 (E15-->G) and 32 (L32-->I) were previously identified and their effects on virus development were examined. The DNA-binding properties of these proteins and the thermal stability of their secondary structures have now been analyzed. Amino acids 15 and 32 are far removed from the putative DNA-binding domains of TF1 but changes there exert striking effects on DNA affinity that correlate with effects on structure. The double mutant protein TF1-G15I32 binds to a preferred site in hydroxymethyluracil-containing DNA 40 times more tightly, denatures at higher temperature (delta tm = 21 degrees C), and also exchanges subunits much more slowly than does the wild-type protein. The L25-->A mutation makes TF1 secondary structure and DNA-binding highly salt concentration-dependent. The E15-->G mutation partly suppresses this effect: secondary structure of TF1-A25G15 is restored at 21 degrees C by 1 M NaCl or, at low NaCl concentration, by binding to DNA.

  9. Interaction studies of resistomycin from Streptomyces aurantiacus AAA5 with calf thymus DNA and bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Vijayabharathi, R.; Sathyadevi, P.; Krishnamoorthy, P.; Senthilraja, D.; Brunthadevi, P.; Sathyabama, S.; Priyadarisini, V. Brindha

    2012-04-01

    Resistomycin, a secondary metabolite produced by Streptomyces aurantiacus AAA5. The binding interaction of resistomycin with calf thymus DNA (CT DNA) and bovine serum albumin (BSA) was investigated by spectrophotometry, spectrofluorimetry, circular dichroism (CD) and synchronous fluorescence techniques under physiological conditions in vitro. Absorption spectral studies along with the fluorescence competition with ethidium bromide measurements and circular dichroism clearly suggest that the resistomycin bind with CT DNA relatively strong via groove binding. BSA interaction results revealed that the drug was found to quench the fluorescence intensity of the protein through a static quenching mechanism. The number of binding sites 'n' and apparent binding constant 'K' calculated according to the Scatchard equation exhibit a good binding property to bovine serum albumin protein. In addition, the results observed from synchronous fluorescence measurements clearly demonstrate the occurrence of conformational changes of BSA upon addition of the test compound.

  10. Deciphering the groove binding modes of tau-fluvalinate and flumethrin with calf thymus DNA

    NASA Astrophysics Data System (ADS)

    Tao, Mo; Zhang, Guowen; Pan, Junhui; Xiong, Chunhong

    2016-02-01

    Tau-fluvalinate (TFL) and flumethrin (FL), widely used in agriculture and a class of synthetic pyrethroid pesticides with a similar structure, may cause a potential security risk. Herein, the modes of binding in vitro of TFL and FL with calf thymus DNA (ctDNA) were characterized by fluorescence, UV-vis absorption, circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy with the aid of viscosity measurements, melting analyses and molecular docking studies. The fluorescence titration indicated that both TFL and FL bound to ctDNA forming complexes through hydrogen bonding and van der Waals forces. The binding constants of TFL and FL with ctDNA were in the range of 104 L mol- 1, and FL exhibited a higher binding propensity than TFL. The iodide quenching effect, single/double-stranded DNA effects, and ctDNA melting and viscosity measurements demonstrated that the binding of both TFL and FL to ctDNA was groove mode. The FT-IR analyses suggested the A-T region of the minor groove of ctDNA as the preferential binding for TFL and FL, which was confirmed by the displacement assays with Hoechst 33258 probe, and the molecular docking visualized the specific binding. The changes in CD spectra indicated that both FL and TFL induced the perturbation on the base stacking and helicity of B-DNA, but the disturbance caused by FL was more obvious. Gel electrophoresis analyses indicated that both TFL and FL did not cause significant DNA cleavage. This study provides novel insights into the binding properties of TFL/FL with ctDNA and its toxic mechanisms.

  11. Insights into the nature of DNA binding of AbrB-like transcription factors

    PubMed Central

    Sullivan, Daniel M.; Bobay, Benjamin G.; Kojetin, Douglas J.; Thompson, Richele J.; Rance, Mark; Strauch, Mark A.; Cavanagh, John

    2008-01-01

    Summary Understanding the DNA recognition and binding by the AbrB-like family of transcriptional regulators is of significant interest since these proteins enable bacteria to elicit the appropriate response to diverse environmental stimuli. Although these ‘transition-state regulator’ proteins have been well characterized at the genetic level, the general and specific mechanisms of DNA binding remain elusive. We present RDC-refined NMR solution structures and dynamic properties of the DNA-binding domains of three Bacillus subtilis transition-state regulators AbrB, Abh, and SpoVT. We combined previously investigated DNase I footprinting, DNA methylation, gel shift assays, mutagenic and NMR studies to generate a structural model of the complex between AbrBN55 and its cognate promoter, abrB8. These investigations have enabled us to generate the first model for the specific nature of the transition-state regulator-DNA interaction. PMID:19000822

  12. D-glucose derived novel gemini surfactants: synthesis and study of their surface properties, interaction with DNA, and cytotoxicity.

    PubMed

    Kumar, Vikash; Chatterjee, Amrita; Kumar, Nupur; Ganguly, Anasuya; Chakraborty, Indranil; Banerjee, Mainak

    2014-10-09

    Four new D-glucose derived m-s-m type gemini surfactants with variable spacer and tail length have been synthesized by a simple and efficient synthetic methodology utilizing the free C-3 hydroxy group of diisopropylidene glucose. The synthetic route to these gemini surfactants with a quaternary ammonium group as polar head group involves a sequence of simple reactions including alkylation, imine formation, quaternization of amine etc. The surface properties of the new geminis were evaluated by surface tension and conductivity measurements. These gemini surfactants showed low cytotoxicity by MTT assay on HeLa cell line. The DNA binding capabilities of these surfactants were determined by agarose gel electrophoresis, fluorescence titration, and DLS experiments. The preliminary studies by agarose gel electrophoresis indicated chain length dependent DNA binding abilities, further supported by ethidium bromide exclusion experiments. Two of the D-glucose derived gemini surfactants showed effective binding with pET-28a plasmid DNA (pDNA) at relatively low N/P ratio (i.e., cationic nitrogen/DNA phosphate molar ratio). Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Structural determinants of HIV-1 nucleocapsid protein for cTAR DNA binding and destabilization, and correlation with inhibition of self-primed DNA synthesis.

    PubMed

    Beltz, Hervé; Clauss, Céline; Piémont, Etienne; Ficheux, Damien; Gorelick, Robert J; Roques, Bernard; Gabus, Caroline; Darlix, Jean-Luc; de Rocquigny, Hugues; Mély, Yves

    2005-05-20

    The nucleocapsid protein (NC) of human immunodeficiency virus type 1 (HIV-1) is formed of two highly conserved CCHC zinc fingers flanked by small basic domains. NC is required for the two obligatory strand transfers in viral DNA synthesis through its nucleic acid chaperoning properties. The first DNA strand transfer relies on NC's ability to bind and destabilize the secondary structure of complementary transactivation response region (cTAR) DNA, to inhibit self-priming, and to promote the annealing of cTAR to TAR RNA. To further investigate NC chaperone properties, our aim was to identify by fluorescence spectroscopy and gel electrophoresis, the NC structural determinants for cTAR binding and destabilization, and for the inhibition of self-primed DNA synthesis on a model system using a series of NC mutants and HIV-1 reverse transcriptase. NC destabilization and self-priming inhibition properties were found to be supported by the two fingers in their proper context and the basic (29)RAPRKKG(35) linker. The strict requirement of the native proximal finger suggests that its hydrophobic platform (Val13, Phe16, Thr24 and Ala25) is crucial for binding, destabilization and inhibition of self-priming. In contrast, only partial folding of the distal finger is required, probably for presenting the Trp37 residue in an appropriate orientation. Also, Trp37 and the hydrophobic residues of the proximal finger appear to be essential for the propagation of the melting from the cTAR ends up to the middle of the stem. Finally, both N-terminal and C-terminal basic domains contribute to cTAR binding but not to its destabilization.

  14. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces.

    PubMed

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-09-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design.

  15. The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site.

    PubMed

    Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

    2017-01-31

    Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.

  16. The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site

    PubMed Central

    Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

    2017-01-01

    Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759

  17. Selective detection of Mg2+ ions via enhanced fluorescence emission using Au–DNA nanocomposites

    PubMed Central

    Basu, Tanushree; Rana, Khyati; Das, Niranjan

    2017-01-01

    The biophysical properties of DNA-modified Au nanoparticles (AuNPs) have attracted a great deal of research interest for various applications in biosensing. AuNPs have strong binding capability to the phosphate and sugar groups in DNA, rendering unique physicochemical properties for detection of metal ions. The formation of Au–DNA nanocomposites is evident from the observed changes in the optical absorption, plasmon band, zeta potential, DLS particle size distribution, as well as TEM and AFM surface morphology analysis. Circular dichroism studies also revealed that DNA-functionalized AuNP binding caused a conformational change in the DNA structure. Due to the size and shape dependent plasmonic interactions of AuNPs (33–78 nm) with DNA, the resultant Au–DNA nanocomposites (NCs) exhibit superior fluorescence emission due to chemical binding with Ca2+, Fe2+ and Mg2+ ions. A significant increase in fluorescence emission (λex = 260 nm) of Au–DNA NCs was observed after selectively binding with Mg2+ ions (20–800 ppm) in an aqueous solution where a minimum of 100 ppm Mg2+ ions was detected based on the linearity of concentration versus fluorescence intensity curve (λem = 400 nm). The effectiveness of Au–DNA nanocomposites was further verified by comparing the known concentration (50–120 ppm) of Mg2+ ions in synthetic tap water and a real life sample of Gelusil (300–360 ppm Mg2+), a widely used antacid medicine. Therefore, this method could be a sensitive tool for the estimation of water hardness after careful preparation of a suitably designed Au–DNA nanostructure. PMID:28487819

  18. Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA.

    PubMed

    Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

    2018-03-05

    DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (K b ) between TMG and DNA was 2.27×10 4 M -1 , that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH<0 and ΔS<0) at different temperatures indicated that van der Waals forces and hydrogen bonds were involved in the binding process of TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    PubMed

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures

    PubMed Central

    Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca

    2018-01-01

    Abstract The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases. PMID:29718412

  1. T7 RNA polymerase non-specifically transcribes and induces disassembly of DNA nanostructures.

    PubMed

    Schaffter, Samuel W; Green, Leopold N; Schneider, Joanna; Subramanian, Hari K K; Schulman, Rebecca; Franco, Elisa

    2018-06-01

    The use of proteins that bind and catalyze reactions with DNA alongside DNA nanostructures has broadened the functionality of DNA devices. DNA binding proteins have been used to specifically pattern and tune structural properties of DNA nanostructures and polymerases have been employed to directly and indirectly drive structural changes in DNA structures and devices. Despite these advances, undesired and poorly understood interactions between DNA nanostructures and proteins that bind DNA continue to negatively affect the performance and stability of DNA devices used in conjunction with enzymes. A better understanding of these undesired interactions will enable the construction of robust DNA nanostructure-enzyme hybrid systems. Here, we investigate the undesired disassembly of DNA nanotubes in the presence of viral RNA polymerases (RNAPs) under conditions used for in vitro transcription. We show that nanotubes and individual nanotube monomers (tiles) are non-specifically transcribed by T7 RNAP, and that RNA transcripts produced during non-specific transcription disassemble the nanotubes. Disassembly requires a single-stranded overhang on the nanotube tiles where transcripts can bind and initiate disassembly through strand displacement, suggesting that single-stranded domains on other DNA nanostructures could cause unexpected interactions in the presence of viral RNA polymerases.

  2. Synthesis, crystal structure, DFT calculation and DNA binding studies of new water-soluble derivatives of dppz

    NASA Astrophysics Data System (ADS)

    Aminzadeh, Mohammad; Eslami, Abbas; Kia, Reza; Aleeshah, Roghayeh

    2017-10-01

    Diquaternarization of dipyrido-[2,3-a:2‧,3‧-c]-phenazine,(dppz) and its analogous dipyrido-[2,3-a:2‧,3‧-c]-dimethylphenazine,(dppx) using 1,3-dibromopropane afford new water-soluble derivatives of phenazine, propylene-bipyridyldiylium-phenazine (1) and propylene-bipyridyldiylium-dimethylphenazine (2). The compounds have been characterized by means of FT-IR, NMR, elemental analysis and conductometric measurements and their structure were determined by X-ray crystallography. The experimental studies on the compounds have been accompanied computationally by Density Functional Theory (DFT) calculations. The DNA binding properties of both compounds to calf thymus DNA (ctDNA) were investigated by UV-Vis absorption and emission methods. The expanded UV-Vis spectral data matrix was analyzed by multivariate curve resolution-alternating least squares (MCR-ALS) technique to obtain the concentration profile and pure spectra of all reaction species which existed in the interaction procedure. Multivariate curve resolution may help us to give a better understanding of the 1(Cl)2-ctDNA and 2(Cl)2-ctDNA interaction mechanism. The results suggest that both compounds bind tightly to DNA through intercalation mechanism and the DNA binding affinity of 2 is slightly lower than that of 1 due to steric hindrance of the methyl group. Also, thermal denaturation studies reveal that these compounds show strong affinity for binding with calf thymus DNA. The thermodynamic parameters of the DNA binding process were obtained from the temperature dependence of the binding constants and the results showed that binding of both compounds to DNA is an enthalpically driven process that is in agreement with proposed DNA intercalation capability of these compounds.

  3. Presynaptic Filament Dynamics in Homologous Recombination and DNA Repair

    PubMed Central

    Liu, Jie; Ehmsen, Kirk T.; Heyer, Wolf-Dietrich; Morrical, Scott W.

    2014-01-01

    Homologous Recombination (HR) is an essential genome stability mechanism used for high-fidelity repair of DNA double-strand breaks and for the recovery of stalled or collapsed DNA replication forks. The crucial homology search and DNA strand exchange steps of HR are catalyzed by presynaptic filaments—helical filaments of a recombinase enzyme bound to single-stranded DNA. Presynaptic filaments are fundamentally dynamic structures, the assembly, catalytic turnover, and disassembly of which must be closely coordinated with other elements of the DNA recombination, repair, and replication machinery in order for genome maintenance functions to be effective. Here, we review the major dynamic elements controlling the assembly, activity, and disassembly of presynaptic filaments: some intrinsic such as recombinase ATP binding and hydrolytic activities, others extrinsic such as ssDNA-binding proteins, mediator proteins, and DNA motor proteins. We examine dynamic behavior on multiple levels, including atomic- and filament-level structural changes associated with ATP binding and hydrolysis as evidenced in crystal structures, as well as subunit binding and dissociation events driven by intrinsic and extrinsic factors. We examine the biochemical properties of recombination proteins from four model systems (T4 phage, E. coli, S. cerevisiae, and H. sapiens), demonstrating how their properties are tailored for the context-specific requirements in these diverse species. We propose that the presynaptic filament has evolved to rely on multiple external factors for increased multi-level regulation of HR processes in genomes with greater structural and sequence complexity. PMID:21599536

  4. Solution properties of the archaeal CRISPR DNA repeat-binding homeodomain protein Cbp2

    PubMed Central

    Kenchappa, Chandra S.; Heidarsson, Pétur O.; Kragelund, Birthe B.; Garrett, Roger A.; Poulsen, Flemming M.

    2013-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) form the basis of diverse adaptive immune systems directed primarily against invading genetic elements of archaea and bacteria. Cbp1 of the crenarchaeal thermoacidophilic order Sulfolobales, carrying three imperfect repeats, binds specifically to CRISPR DNA repeats and has been implicated in facilitating production of long transcripts from CRISPR loci. Here, a second related class of CRISPR DNA repeat-binding protein, denoted Cbp2, is characterized that contains two imperfect repeats and is found amongst members of the crenarchaeal thermoneutrophilic order Desulfurococcales. DNA repeat-binding properties of the Hyperthermus butylicus protein Cbp2Hb were characterized and its three-dimensional structure was determined by NMR spectroscopy. The two repeats generate helix-turn-helix structures separated by a basic linker that is implicated in facilitating high affinity DNA binding of Cbp2 by tethering the two domains. Structural studies on mutant proteins provide support for Cys7 and Cys28 enhancing high thermal stability of Cbp2Hb through disulphide bridge formation. Consistent with their proposed CRISPR transcriptional regulatory role, Cbp2Hb and, by inference, other Cbp1 and Cbp2 proteins are closely related in structure to homeodomain proteins with linked helix-turn-helix (HTH) domains, in particular the paired domain Pax and Myb family proteins that are involved in eukaryal transcriptional regulation. PMID:23325851

  5. Xeroderma pigmentosum complementation group C protein (XPC) serves as a general sensor of damaged DNA

    PubMed Central

    Shell, Steven M.; Hawkins, Edward K.; Tsai, Miaw-Sheue; Hlaing, Aye Su; Rizzo, Carmelo J.; Chazin, Walter J.

    2013-01-01

    The xeroderma pigmentosum complementation group C protein (XPC) serves as the primary initiating factor in the global genome nucleotide excision repair pathway (GG-NER). Recent reports suggest XPC also stimulates repair of oxidative lesions by base excision repair. However, whether XPC distinguishes among various types of DNA lesions remains unclear. Although the DNA binding properties of XPC have been studied by several groups, there is a lack of consensus over whether XPC discriminates between DNA damaged by lesions associated with NER activity versus those that are not. In this study we report a high-throughput fluorescence anisotropy assay used to measure the DNA binding affinity of XPC for a panel of DNA substrates containing a range of chemical lesions in a common sequence. Our results demonstrate that while XPC displays a preference for binding damaged DNA, the identity of the lesion has little effect on the binding affinity of XPC. Moreover, XPC was equally capable of binding to DNA substrates containing lesions not repaired by GG-NER. Our results support an indirect read-out model for sensing the presence of lesions by human XPC and suggest XPC may act as a general sensor of damaged DNA capable of recognizing DNA containing lesions not repaired by NER. PMID:24051049

  6. Comparison of Iron-Binding Ability Between Thr70-NapA and Ser70-NapA of Helicobacter pylori.

    PubMed

    Shan, Weiran; Kung, Hsiang-Fu; Ge, Ruiguang

    2016-06-01

    The neutrophil-activating protein (NapA) of Helicobacter pylori (H. pylori), with DNA-binding and iron seizing properties, is a fundamental virulence factor involved in H. pylori-related diseases. Compared with Ser70-NapA strain, Thr70-NapA strain is more intimately correlated with iron-deficiency anemia. To investigate whether two types of proteins differ in iron-binding ability, mutated Thr70-NapA and Ser70-NapA strains were established. Isothermal titration calorimetry (ITC) method was conducted to measure the binding between the NapA protein and Fe(2+) . The structural changes of NapA protein were also tested during iron interaction by fast protein liquid chromatography (FPLC) and circular dichroism (CD) methods. DNA-binding assay was performed for evaluate the affinity of both mutated and wild types of NapA with DNA. Mutated Thr70-NapA had higher iron-binding ability than wild Ser70-NapA. The structural stability of Thr70-NapA was disrupted and became more active along with the rising concentration of Fe(2+) , whereas no similar association was observed between Ser70-NapA and Fe(2+) level. When the iron/protein molar ratio ranged from 10 to 20, both Ser70-NapA and Thr70-NapA displayed weaker DNA-binding ability. Thr70-NapA has much stronger ability to sequester ferrous ion compared with Ser70-NapA in H. pylori. In addition, the DNA-binding property of NapA is dependent upon the Fe(2+) concentration. © 2015 John Wiley & Sons Ltd.

  7. The structure and DNA-binding properties of Mgm101 from a yeast with a linear mitochondrial genome.

    PubMed

    Pevala, Vladimír; Truban, Dominika; Bauer, Jacob A; Košťan, Július; Kunová, Nina; Bellová, Jana; Brandstetter, Marlene; Marini, Victoria; Krejčí, Lumír; Tomáška, Ľubomír; Nosek, Jozef; Kutejová, Eva

    2016-03-18

    To study the mechanisms involved in the maintenance of a linear mitochondrial genome we investigated the biochemical properties of the recombination protein Mgm101 from Candida parapsilosis. We show that CpMgm101 complements defects associated with the Saccharomyces cerevisiae mgm101-1(ts) mutation and that it is present in both the nucleus and mitochondrial nucleoids of C. parapsilosis. Unlike its S. cerevisiae counterpart, CpMgm101 is associated with the entire nucleoid population and is able to bind to a broad range of DNA substrates in a non-sequence specific manner. CpMgm101 is also able to catalyze strand annealing and D-loop formation. CpMgm101 forms a roughly C-shaped trimer in solution according to SAXS. Electron microscopy of a complex of CpMgm101 with a model mitochondrial telomere revealed homogeneous, ring-shaped structures at the telomeric single-stranded overhangs. The DNA-binding properties of CpMgm101, together with its DNA recombination properties, suggest that it can play a number of possible roles in the replication of the mitochondrial genome and the maintenance of its telomeres. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. C60 fullerene binding to DNA

    NASA Astrophysics Data System (ADS)

    Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

    2014-09-01

    Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.

  9. Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2010-01-01

    Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.

  10. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces

    PubMed Central

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-01-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design. PMID:21693557

  11. Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

    PubMed

    Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

    2005-06-01

    A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

  12. A ruthenium dimer complex with a flexible linker slowly threads between DNA bases in two distinct steps.

    PubMed

    Bahira, Meriem; McCauley, Micah J; Almaqwashi, Ali A; Lincoln, Per; Westerlund, Fredrik; Rouzina, Ioulia; Williams, Mark C

    2015-10-15

    Several multi-component DNA intercalating small molecules have been designed around ruthenium-based intercalating monomers to optimize DNA binding properties for therapeutic use. Here we probe the DNA binding ligand [μ-C4(cpdppz)2(phen)4Ru2](4+), which consists of two Ru(phen)2dppz(2+) moieties joined by a flexible linker. To quantify ligand binding, double-stranded DNA is stretched with optical tweezers and exposed to ligand under constant applied force. In contrast to other bis-intercalators, we find that ligand association is described by a two-step process, which consists of fast bimolecular intercalation of the first dppz moiety followed by ∼10-fold slower intercalation of the second dppz moiety. The second step is rate-limited by the requirement for a DNA-ligand conformational change that allows the flexible linker to pass through the DNA duplex. Based on our measured force-dependent binding rates and ligand-induced DNA elongation measurements, we are able to map out the energy landscape and structural dynamics for both ligand binding steps. In addition, we find that at zero force the overall binding process involves fast association (∼10 s), slow dissociation (∼300 s), and very high affinity (Kd ∼10 nM). The methodology developed in this work will be useful for studying the mechanism of DNA binding by other multi-step intercalating ligands and proteins. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Nickel-quinolones interaction. Part 4. Structure and biological evaluation of nickel(II)-enrofloxacin complexes compared to zinc(II) analogues.

    PubMed

    Skyrianou, Kalliopi C; Psycharis, Vassilis; Raptopoulou, Catherine P; Kessissoglou, Dimitris P; Psomas, George

    2011-01-01

    The nickel(II) complexes with the second-generation quinolone antibacterial agent enrofloxacin in the presence or absence of the nitrogen-donor heterocyclic ligands 1,10-phenanthroline, 2,2'-bipyridine or pyridine have been synthesized and characterized. Enrofloxacin acts as bidentate ligand coordinated to Ni(II) ion through the ketone oxygen and a carboxylato oxygen. The crystal structure of (1,10-phenanthroline)bis(enrofloxacinato)nickel(II) has been determined by X-ray crystallography. UV study of the interaction of the complexes with calf-thymus DNA (CT DNA) has shown that they bind to CT DNA and bis(pyridine)bis(enrofloxacinato)nickel(II) exhibits the highest binding constant to CT DNA. The cyclic voltammograms of the complexes have shown that in the presence of CT DNA the complexes can bind to CT DNA by the intercalative binding mode which has also been verified by DNA solution viscosity measurements. Competitive study with ethidium bromide (EB) has shown that the complexes can displace the DNA-bound EB indicating that they bind to DNA in strong competition with EB. The complexes exhibit good binding propensity to human or bovine serum albumin protein having relatively high binding constant values. The biological properties of the complexes have been evaluated in comparison to the corresponding Zn(II) enrofloxacinato complexes as well as Ni(II) complexes with the first-generation quinolone oxolinic acid. Copyright © 2010 Elsevier Inc. All rights reserved.

  14. Switching bonds in a DNA gel: an all-DNA vitrimer.

    PubMed

    Romano, Flavio; Sciortino, Francesco

    2015-02-20

    We design an all-DNA system that behaves like vitrimers, innovative plastics with self-healing and stress-releasing properties. The DNA sequences are engineered to self-assemble first into tetra- and bifunctional units which, upon further cooling, bind to each other forming a fully bonded network gel. An innovative design of the binding regions of the DNA sequences, exploiting a double toehold-mediated strand displacement, generates a network gel which is able to reshuffle its bonds, retaining at all times full bonding. As in vitrimers, the rate of bond switching can be controlled via a thermally activated catalyst, which in the present design is very short DNA strands.

  15. Specific DNA binding activity of T antigen subclasses varies among different SV40-transformed cell lines.

    PubMed

    Burger, C; Fanning, E

    1983-04-15

    Large tumor antigen (T antigen) occurs in at least three different oligomeric subclasses in cells infected or transformed by simian virus 40 (SV40): 5-7 S, 14-16 S, and 23-25 S. The 23-25 S form is complexed with a host phosphoprotein (p53). The DNA binding properties of these three subclasses of T antigen from nine different cell lines and free p53 protein were compared using an immunoprecipitation assay. All three subclasses of T antigen bound specifically to SV40 DNA sequences near the origin of replication. However, the DNA binding activity varied between different cell lines over a 40- to 50-fold range. The 23-25 S and 14-16 S forms from most of the cell lines tested bound much less SV40 origin DNA than 5-7 S T antigen. The free p53 phosphoprotein did not bind specifically to any SV40 DNA sequences.

  16. Solution structure and DNA-binding properties of the C-terminal domain of UvrC from E.coli

    PubMed Central

    Singh, S.; Folkers, G.E.; Bonvin, A.M.J.J.; Boelens, R.; Wechselberger, R.; Niztayev, A.; Kaptein, R.

    2002-01-01

    The C-terminal domain of the UvrC protein (UvrC CTD) is essential for 5′ incision in the prokaryotic nucleotide excision repair process. We have determined the three-dimensional structure of the UvrC CTD using heteronuclear NMR techniques. The structure shows two helix–hairpin–helix (HhH) motifs connected by a small connector helix. The UvrC CTD is shown to mediate structure-specific DNA binding. The domain binds to a single-stranded–double-stranded junction DNA, with a strong specificity towards looped duplex DNA that contains at least six unpaired bases per loop (‘bubble DNA’). Using chemical shift perturbation experiments, the DNA-binding surface is mapped to the first hairpin region encompassing the conserved glycine–valine–glycine residues followed by lysine–arginine–arginine, a positively charged surface patch and the second hairpin region consisting of glycine–isoleucine–serine. A model for the protein– DNA complex is proposed that accounts for this specificity. PMID:12426397

  17. Compartmentalized self-replication (CSR) selection of Thermococcus litoralis Sh1B DNA polymerase for diminished uracil binding.

    PubMed

    Tubeleviciute, Agne; Skirgaila, Remigijus

    2010-08-01

    The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.

  18. DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

    PubMed

    Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

    1995-09-05

    Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

  19. Strong positive cooperativity in binding to the A3T3 repeat by Hoechst 33258 derivatives attaching the quinoline units at the end of a branched linker.

    PubMed

    Koda, Hironori; Brazier, John Alan; Onishi, Ippei; Sasaki, Shigeki

    2015-08-01

    Hoechst 33258 derivatives with additional interacting moieties attached at the ends of branched linkers were synthesized, and their DNA binding properties were investigated with regard to the A3T3 repeat by measuring fluorescence spectra. The binding property of the ligand was investigated by fluorescence titration, and the titration data were analyzed using the McGhee-von Hippel method. Ligand 6Q with the quinolin-6-yloxyacetyl group and Ligand IQ with isoquinolin-6-yloxyacetyl group at the ends of the branched linkers exhibit highly positive cooperativity for the DNA having 5 A3T3 sites with 3 base-insertions between them with sequence selectivity. The strategy developed in this study may be generally applicable for designing ligands for repetitive DNA sequences. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

    PubMed

    Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

    2014-11-28

    We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Excited State Proton Transfer of Natural Flavonoids and Their Chromophores in Duplex and Tetraplex DNAs

    PubMed Central

    2015-01-01

    Fisetin (3,7,3′,4′-tetrahydroxyflavone) and quercetin (3,5,7,3′,4′-pentahydroxyflavone) are the bioactive plant flavonoids that are potentially useful therapeutic drugs for the treatment of a broad spectrum of diseases, including atherosclerosis, cardiovascular disease, obesity, hypertension, and cancer. 3-Hydroxyflavone (3HF) and 7-hydroxyflavone (7HF) are the synthetic chromophores of fisetin and quercetin. We have exploited dual luminescence properties of fisetin and quercetin along with 3-HF and 7HF to examine their efficacy of binding and compare their interactions with DNA, which is one of the macromolecular targets of flavonoids in physiological systems. Following the sequence of the human telomeric DNA 5′-d (CCCTAA-)n/(-TTAGGG)n-5′, two single-stranded DNA oligonucleotides, 5′-d(C3TA2)3C3-3′ and 5′-d(T2AG3)4-3′, and their duplex were used as receptors to study binding by the ligands quercetin, fisetin, and their chromophores. Circular dichroism, differential absorption, UV thermal melting, and size exclusion chromatographic studies indicated the formation of unusual DNA structures (such as C4 and G4 tetraplexes) for both the C- and G-rich single-stranded DNAs. Upon binding to DNA, dramatic changes were observed in the intrinsic fluorescence behavior of the flavonoids. Molecular docking studies were performed to describe the likely binding sites for the ligands. The spectroscopic studies on flavonoid–DNA interactions described herein demonstrate a powerful approach for examining their DNA binding through exploiting the highly sensitive intrinsic fluorescence properties of the flavonoids as their own “reporter” for their interactions with macromolecular targets. PMID:25393681

  2. Multiple conformations of the cytidine repressor DNA-binding domain coalesce to one upon recognition of a specific DNA surface.

    PubMed

    Moody, Colleen L; Tretyachenko-Ladokhina, Vira; Laue, Thomas M; Senear, Donald F; Cocco, Melanie J

    2011-08-09

    The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties. © 2011 American Chemical Society

  3. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

  4. Light-up fluorescent probes utilizing binding behavior of perylenediimide derivatives to a hydrophobic pocket within DNA.

    PubMed

    Takada, Tadao; Yamaguchi, Kosato; Tsukamoto, Suguru; Nakamura, Mitsunobu; Yamana, Kazushige

    2014-08-21

    Here we study the binding behavior of perylenediimide () derivatives to a hydrophobic pocket created inside DNA and their photochemical properties capable of designing a light-up fluorescent sensor for short single-stranded DNA or RNA. The perylenediimide derivative with alkoxy groups () suppressing electron transfer quenching was examined. The bound randomly to DNA showed negligible fluorescence due to the aggregation-induced quenching, whereas the bound to the pocket as a monomeric form showed more than 100-fold fluorescence enhancement. Switching the binding states of the corresponded to a change in the fluorescence response for the hybridization event, which allowed us to design a fluorescent sensor of nucleic acids with a nanomolar detection limit.

  5. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    ERIC Educational Resources Information Center

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  6. The effects of structural variations of thiophene-containing Ru(II) complexes on the acid-base and DNA binding properties.

    PubMed

    Yuan, Cui-Li; Zhang, An-Guo; Zheng, Ze-Bo; Wang, Ke-Zhi

    2013-03-01

    A phenylthiophenyl-bearing Ru(II) complex of [Ru(bpy)₂(Hbptip)](PF₆)₂ {bpy = 2,2'-bipyridine, Hbptip = 2-(4-phenylthiophen-2-yl)-1H-imidazo[4,5-f][1,10]phenanthroline} was synthesized and characterized by elemental analysis, ¹H NMR spectroscopy, and electrospray ionization mass spectrometry. The ground- and excited-state acid-base properties of the complex were studied by UV-visible absorption and photoluminescence spectrophotometric pH titrations and the negative logarithm values of the ground-state acid ionization constants were derived to be pK(a1) = 1.31 ± 0.09 and pK(a2) = 5.71 ± 0.11 with the pK(a2) associated deprotonation/protonation process occurring over 3 pK(a) units more acidic than thiophenyl-free parent complex of [Ru(bpy)₂(Hpip)]²⁺ {Hpip = 2-phenyl-1H-imidazo[4,5-f][1,10]phenanthroline}. The calf thymus DNA-binding properties of [Ru(bpy)₂(Hbptip)]²⁺ in Tris-HCl buffer (pH 7.1 and 50 mM NaCl) were investigated by DNA viscosities and density functional theoretical calculations as well as UV-visible and emission spectroscopy techniques of UV-visible and luminescence titrations, steady-state emission quenching by [Fe(CN)₆]⁴⁻, DNA competitive binding with ethidium bromide, DNA melting experiments, and reverse salt effects. The complex was evidenced to bind to the DNA intercalatively with binding affinity being greater than those for previously reported analogs of [Ru(bpy)₂(Hip)]²⁺, [Ru(bpy)₂(Htip)]²⁺, and [Ru(bpy)₂(Haptip)]²⁺ {Hip = 1H-imidazo[4,5-f][1,10]phenanthroline, Htip = 2-thiophenimidazo[4,5-f][1,10]phenanthroline, Haptip = 2-(5-phenylthiophen-2-yl)-1H-imidazo[4,5-f][1,10]phenanthroline}.

  7. DNA-magnetic Particle Binding Analysis by Dynamic and Electrophoretic Light Scattering.

    PubMed

    Haddad, Yazan; Dostalova, Simona; Kudr, Jiri; Zitka, Ondrej; Heger, Zbynek; Adam, Vojtech

    2017-11-09

    Isolation of DNA using magnetic particles is a field of high importance in biotechnology and molecular biology research. This protocol describes the evaluation of DNA-magnetic particles binding via dynamic light scattering (DLS) and electrophoretic light scattering (ELS). Analysis by DLS provides valuable information on the physicochemical properties of particles including particle size, polydispersity, and zeta potential. The latter describes the surface charge of the particle which plays major role in electrostatic binding of materials such as DNA. Here, a comparative analysis exploits three chemical modifications of nanoparticles and microparticles and their effects on DNA binding and elution. Chemical modifications by branched polyethylenimine, tetraethyl orthosilicate and (3-aminopropyl)triethoxysilane are investigated. Since DNA exhibits a negative charge, it is expected that zeta potential of particle surface will decrease upon binding of DNA. Forming of clusters should also affect particle size. In order to investigate the efficiency of these particles in isolation and elution of DNA, the particles are mixed with DNA in low pH (~6), high ionic strength and dehydration environment. Particles are washed on magnet and then DNA is eluted by Tris-HCl buffer (pH = 8). DNA copy number is estimated using quantitative polymerase chain reaction (PCR). Zeta potential, particle size, polydispersity and quantitative PCR data are evaluated and compared. DLS is an insightful and supporting method of analysis that adds a new perspective to the process of screening of particles for DNA isolation.

  8. Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

    PubMed Central

    Evers, R; Grummt, I

    1995-01-01

    Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

  9. A plasma modified cellulose-chitosan porous membrane allows efficient DNA binding and provides antibacterial properties: A step towards developing a new DNA collecting card.

    PubMed

    Chumwangwapee, Sasiwimon; Chingsungnoen, Artit; Siri, Sineenat

    2016-11-01

    In forensic DNA analyses, biological specimens are collected and stored for subsequent recovery and analysis of DNA. A cost-effective and efficient DNA recovery approach is therefore a need. This study aims to produce a plasma modified cellulose-chitosan membrane (pCE-CS) that efficiently binds and retains DNA as a potential DNA collecting card. The pCE-CS membrane was produced by a phase separation of ionic liquid dissolving CE and CS in water with subsequent surface-modification by a two-step exposure of argon plasma and nitrogen gas. Through plasma modification, the pCE-CS membrane demonstrated better DNA retention after a washing process and higher rate of DNA recovery as compared with the original CE-CS membrane and the commercial FTA card. In addition, the pCE-CS membrane exhibited anti-bacterial properties against both Escherichia coli and Staphylococcus aureus. The results of this work suggest a potential function of the pCE-CS membrane as a DNA collecting card with a high recovery rate of captured DNA. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Accurate Prediction of Inducible Transcription Factor Binding Intensities In Vivo

    PubMed Central

    Siepel, Adam; Lis, John T.

    2012-01-01

    DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF) binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB–seq), that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF), which inducibly binds a target DNA sequence element (HSE) following heat shock stress. PB–seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF–bound and HSF–free DNA, and then detecting HSF–bound DNA by high-throughput sequencing. We compared PB–seq binding profiles with ones observed in vivo by ChIP–seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase–seq data and the ChIP–chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF), tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity. PMID:22479205

  11. Binding and thermodynamics of REV peptide-ctDNA interaction.

    PubMed

    Upadhyay, Santosh Kumar

    2017-03-01

    The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.

  12. HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

    PubMed Central

    Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

    1996-01-01

    HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

  13. An analysis of subunit exchange in the dimeric DNA-binding and DNA-bending protein, TF1.

    PubMed

    Andera, L; Schneider, G J; Geiduschek, E P

    1994-01-01

    TF1 is the Bacillus subtilis bacteriophage-encoded dimeric type II DNA-binding protein. This relative of the eubacterial HU proteins and of the Escherichia coli integration host factor binds preferentially to 5-(hydroxymethyluracil)-containing DNA. We have examined the dynamics of exchange of monomer subunits between molecules of dimeric TF1. The analysis takes advantage of the fact that replacement of phenylalanine with arginine at amino acid 61 in the beta-loop 'arm' of TF1 alters DNA-bending and -binding properties, generating DNA complexes with distinctively different mobilities in gel electrophoresis. New species of DNA-protein complexes were formed by mixtures of wild type and mutant TF1, reflecting the formation of heterodimeric TF1, and making the dynamics of monomer exchange between TF1 dimers accessible to a simple gel retardation analysis. Exchange was rapid at high protein concentrations, even at 0 degrees C, and is proposed to be capable of proceeding through an interaction of molecules of TF1 dimer rather than exclusively through dissociation into monomer subunits. Evidence suggesting that DNA-bound TF1 dimers do not exchange subunits readily is also presented.

  14. In vitro DNA binding studies of lenalidomide using spectroscopic in combination with molecular docking techniques

    NASA Astrophysics Data System (ADS)

    Xu, Liang; Hu, Yan-Xi; Li, Yan-Cheng; Zhang, Li; Ai, Hai-Xin; Liu, Yu-Feng; Liu, Hong-Sheng

    2018-02-01

    In the present work, the binding interaction between lenalidomide (LEN) and calf thymus DNA (ct-DNA) was systematically studied by using fluorescence, ultraviolet-visible (UV-vis) absorption, circular dichroism (CD) spectroscopies under imitated physiological conditions (pH = 7.4) coupled with molecular docking. It was found that LEN was bound to ct-DNA with high binding affinity (Ka = 2.308 × 105 M-1 at 283 K) through groove binding as evidenced by a slight decrease in the absorption intensity in combination with CD spectra. Thermodynamic parameters (ΔG < 0, ΔH > 0 and ΔS < 0) of the LEN-DNA system obtained at three different temperatures suggested that the binding process was spontaneous and was primarily driven by hydrogen bonds and hydrophobic interaction. Furthermore, competitive binding experiments with ethidium bromide and 4‧, 6-dia-midino-2-phenylindoleas probes showed that LEN could preferentially bind in the minor groove of double-stranded DNA. The average lifetime of LEN was calculated to be 7.645 ns. The φ of LEN was measured as 0.09 and non-radiation energy transfer between LEN and DNA had occurred. The results of the molecular docking were consistent with the experimental results. This study explored the potential applicability of the spectroscopic properties of LEN and also investigated its interactions with relevant biological targets. In addition, it will provide some theoretical references for the deep research of simultaneous administration of LEN with other drugs.

  15. Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.

    PubMed

    Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D

    2003-08-15

    DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.

  16. Investigation of the electrostatic and hydration properties of DNA minor groove-binding by a heterocyclic diamidine by osmotic pressure.

    PubMed

    Erlitzki, Noa; Huang, Kenneth; Xhani, Suela; Farahat, Abdelbasset A; Kumar, Arvind; Boykin, David W; Poon, Gregory M K

    2017-12-01

    Previous investigations of sequence-specific DNA binding by model minor groove-binding compounds showed that the ligand/DNA complex was destabilized in the presence of compatible co-solutes. Inhibition was interpreted in terms of osmotic stress theory as the uptake of significant numbers of excess water molecules from bulk solvent upon complex formation. Here, we interrogated the AT-specific DNA complex formed with the symmetric heterocyclic diamidine DB1976 as a model for minor groove DNA recognition using both ionic (NaCl) and non-ionic cosolutes (ethylene glycol, glycine betaine, maltose, nicotinamide, urea). While the non-ionic cosolutes all destabilized the ligand/DNA complex, their quantitative effects were heterogeneous in a cosolute- and salt-dependent manner. Perturbation with NaCl in the absence of non-ionic cosolute showed that preferential hydration water was released upon formation of the DB1976/DNA complex. As salt probes counter-ion release from charged groups such as the DNA backbone, we propose that the preferential hydration uptake in DB1976/DNA binding observed in the presence of osmolytes reflects the exchange of preferentially bound cosolute with hydration water in the environs of the bound DNA, rather than a net uptake of hydration waters by the complex. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.

    PubMed

    Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L

    2001-04-06

    The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.

  18. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    PubMed

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  19. Two-photon fluorescence and fluorescence imaging of two styryl heterocyclic dyes combined with DNA

    NASA Astrophysics Data System (ADS)

    Gao, Chao; Liu, Shu-yao; Zhang, Xian; Liu, Ying-kai; Qiao, Cong-de; Liu, Zhao-e.

    2016-03-01

    Two new styryl heterocyclic two-photon (TP) materials, 4-[4-(N-methyl)styrene]-imidazo [4,5-f][1,10] phenanthroline-benzene iodated salt (probe-1) and 4,4- [4-(N-methyl)styrene] -benzene iodated salt (probe-2) were successfully synthesized and studied as potential fluorescent probes of DNA detection. The linear and nonlinear photophysical properties of two compounds in different solvents were investigated. The absorption, one- and two-photon fluorescent spectra of the free dye and dye-DNA complex were also examined to evaluate their photophysical properties. The binding constants of dye-DNA were obtained according to Scatchard equation with good values. The results showed that two probes could be used as fluorescent DNA probes by two-photon excitation, and TP fluorescent properties of probe-1 are superior to that of probe-2. The fluorescent method date indicated that the mechanisms of dye-DNA complex interaction may be groove binding for probe-1 and electrostatic interaction for probe-2, respectively. The MTT assay experiments showed two probes are low toxicity. Moreover, the TP fluorescence imaging of DNA detection in living cells at 800 nm indicated that the ability to locate in cell nuclei of probe-1 is better than that of probe-2.

  20. Two-photon fluorescence and fluorescence imaging of two styryl heterocyclic dyes combined with DNA.

    PubMed

    Gao, Chao; Liu, Shu-yao; Zhang, Xian; Liu, Ying-kai; Qiao, Cong-de; Liu, Zhao-e

    2016-03-05

    Two new styryl heterocyclic two-photon (TP) materials, 4-[4-(N-methyl)styrene]-imidazo [4,5-f][1,10] phenanthroline-benzene iodated salt (probe-1) and 4,4-[4-(N-methyl)styrene]-benzene iodated salt (probe-2) were successfully synthesized and studied as potential fluorescent probes of DNA detection. The linear and nonlinear photophysical properties of two compounds in different solvents were investigated. The absorption, one- and two-photon fluorescent spectra of the free dye and dye-DNA complex were also examined to evaluate their photophysical properties. The binding constants of dye-DNA were obtained according to Scatchard equation with good values. The results showed that two probes could be used as fluorescent DNA probes by two-photon excitation, and TP fluorescent properties of probe-1 are superior to that of probe-2. The fluorescent method date indicated that the mechanisms of dye-DNA complex interaction may be groove binding for probe-1 and electrostatic interaction for probe-2, respectively. The MTT assay experiments showed two probes are low toxicity. Moreover, the TP fluorescence imaging of DNA detection in living cells at 800 nm indicated that the ability to locate in cell nuclei of probe-1 is better than that of probe-2. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Drug-DNA interactions at single molecule level: A view with optical tweezers

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan

    Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.

  2. High precision and high yield fabrication of dense nanoparticle arrays onto DNA origami at statistically independent binding sites

    NASA Astrophysics Data System (ADS)

    Takabayashi, Sadao; Klein, William P.; Onodera, Craig; Rapp, Blake; Flores-Estrada, Juan; Lindau, Elias; Snowball, Lejmarc; Sam, Joseph T.; Padilla, Jennifer E.; Lee, Jeunghoon; Knowlton, William B.; Graugnard, Elton; Yurke, Bernard; Kuang, Wan; Hughes, William L.

    2014-10-01

    High precision, high yield, and high density self-assembly of nanoparticles into arrays is essential for nanophotonics. Spatial deviations as small as a few nanometers can alter the properties of near-field coupled optical nanostructures. Several studies have reported assemblies of few nanoparticle structures with controlled spacing using DNA nanostructures with variable yield. Here, we report multi-tether design strategies and attachment yields for homo- and hetero-nanoparticle arrays templated by DNA origami nanotubes. Nanoparticle attachment yield via DNA hybridization is comparable with streptavidin-biotin binding. Independent of the number of binding sites, >97% site-occupation was achieved with four tethers and 99.2% site-occupation is theoretically possible with five tethers. The interparticle distance was within 2 nm of all design specifications and the nanoparticle spatial deviations decreased with interparticle spacing. Modified geometric, binomial, and trinomial distributions indicate that site-bridging, steric hindrance, and electrostatic repulsion were not dominant barriers to self-assembly and both tethers and binding sites were statistically independent at high particle densities.High precision, high yield, and high density self-assembly of nanoparticles into arrays is essential for nanophotonics. Spatial deviations as small as a few nanometers can alter the properties of near-field coupled optical nanostructures. Several studies have reported assemblies of few nanoparticle structures with controlled spacing using DNA nanostructures with variable yield. Here, we report multi-tether design strategies and attachment yields for homo- and hetero-nanoparticle arrays templated by DNA origami nanotubes. Nanoparticle attachment yield via DNA hybridization is comparable with streptavidin-biotin binding. Independent of the number of binding sites, >97% site-occupation was achieved with four tethers and 99.2% site-occupation is theoretically possible with five tethers. The interparticle distance was within 2 nm of all design specifications and the nanoparticle spatial deviations decreased with interparticle spacing. Modified geometric, binomial, and trinomial distributions indicate that site-bridging, steric hindrance, and electrostatic repulsion were not dominant barriers to self-assembly and both tethers and binding sites were statistically independent at high particle densities. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr03069a

  3. A nucleotide binding rectification Brownian ratchet model for translocation of Y-family DNA polymerases

    PubMed Central

    2011-01-01

    Y-family DNA polymerases are characterized by low-fidelity synthesis on undamaged DNA and ability to catalyze translesion synthesis over the damaged DNA. Their translocation along the DNA template is an important event during processive DNA synthesis. In this work we present a Brownian ratchet model for this translocation, where the directed translocation is rectified by the nucleotide binding to the polymerase. Using the model, different features of the available structures for Dpo4, Dbh and polymerase ι in binary and ternary forms can be easily explained. Other dynamic properties of the Y-family polymerases such as the fast translocation event upon dNTP binding for Dpo4 and the considerable variations of the processivity among the polymerases can also be well explained by using the model. In addition, some predicted results of the DNA synthesis rate versus the external force acting on Dpo4 and Dbh polymerases are presented. Moreover, we compare the effect of the external force on the DNA synthesis rate of the Y-family polymerase with that of the replicative DNA polymerase. PMID:21699732

  4. Synthesis of trimethoprim metal complexes: Spectral, electrochemical, thermal, DNA-binding and surface morphology studies.

    PubMed

    Demirezen, Nihat; Tarınç, Derya; Polat, Duygu; Ceşme, Mustafa; Gölcü, Ayşegül; Tümer, Mehmet

    2012-08-01

    Complexes of trimethoprim (TMP), with Cu(II), Zn(II), Pt(II), Ru(III) and Fe(III) have been synthesized. Then, these complexes have been characterized by spectroscopic techniques involving UV-vis, IR, mass and (1)H NMR. CHN elemental analysis, electrochemical and thermal behavior of complexes have also been investigated. The electrochemical properties of all complexes have been investigated by cyclic voltammetry (CV) using glassy carbon electrode. The biological activity of the complexes has been evaluated by examining their ability to bind to calf-thymus DNA (CT DNA) with UV spectroscopy and cyclic voltammetry. UV studies of the interaction of the complexes with DNA have shown that these compounds can bind to CT DNA. The binding constants of the complexes with CT DNA have also been calculated. The cyclic voltammograms of the complexes in the presence of CT DNA have shown that the complexes can bind to CT DNA by both the intercalative and the electrostatic binding mode. The antimicrobial activity of these complexes has been evaluated against three Gram-positive and four Gram-negative bacteria. Antifungal activity against two different fungi has been evaluated and compared with the reference drug TMP. Almost all types of complexes show excellent activity against all type of bacteria and fungi. The morphology of the CT DNA, TMP, metal ions and metal complexes has been investigated by scanning electron microscopy (SEM). To get the SEM images, the interaction of compounds with CT DNA has been studied by means of differential pulse voltammetry (DPV) at CT DNA modified pencil graphite electrode (PGE). The decrease in intensity of the guanine oxidation signals has been used as an indicator for the interaction mechanism. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Light-controlled cellular internalization and cytotoxicity of nucleic acid-binding agents. Studies in vitro and in zebrafish embryos

    PubMed Central

    Penas, Cristina; Sánchez, Mateo I.; Guerra-Varela, Jorge; Sanchez-Piñón, Laura; Vázquez, M. Eugenio; Mascareñas, José L.

    2016-01-01

    We have synthesized oligoarginine conjugates of selected DNA-binding agents (a bisbenzamidine, acridine and thiazole orange) and demonstrated that the DNA binding and cell internalization properties of such conjugates can be inhibited by appending a negatively charged oligoglutamic tail through a photolabile linker. Irradiation with UV light releases the parent octaarginine conjugates, thus restoring their cell internalization and biological activity. Preliminary assays using zebrafish embryos demonstrates the potential of this prodrug strategy for controlling in vivo cytotoxicity. PMID:26534774

  6. Photophysicochemical, calf thymus DNA binding and in vitro photocytotoxicity properties of tetra-morpholinoethoxy-substituted phthalocyanines and their water-soluble quaternized derivatives.

    PubMed

    Koçan, Halit; Kaya, Kerem; Özçeşmeci, İbrahim; Sesalan, B Şebnem; Göksel, Meltem; Durmuş, Mahmut; Burat, Ayfer Kalkan

    2017-12-01

    In this study, morpholinoethoxy-substituted metal-free (3), zinc(II) (4) and indium(III) (5) phthalocyanines were synthesized. These phthalocyanines were converted to their water-soluble quaternized derivatives (3Q-5Q) using excess methyl iodide as a quaternization agent. All these phthalocyanines (Pcs) were characterized by elemental analysis and different spectroscopic methods such as FT-IR, 1 H NMR, UV-Vis and mass spectrometry. The photophysical and photochemical properties such as fluorescence and generation of singlet oxygen were investigated for determination of these phthalocyanines as photosensitizers in photodynamic therapy (PDT) applications. The binding properties of quaternized phthalocyanines (3Q-5Q) to calf thymus DNA (CT-DNA) were investigated by UV-Vis and fluorescence spectrophotometric methods. The quenching effect of all quaternized phthalocyanines on the fluorescence intensity of SYBR Green-DNA complex was determined. The mixtures of 3Q, 4Q or 5Q and DNA solutions were used to determine the change in T m of double helix DNA with thermal denaturation profile. In addition, thermodynamic parameters considering their aggregation in buffer solution, which shows the spontaneity of the reactions between DNA and quaternized Pcs were investigated. On the other hand, in vitro phototoxicity and cytotoxicity behavior of the quaternized water-soluble phthalocyanine photosensitizers (3Q-5Q) were tested against the cervical cancer cell line named HeLa for evaluation of their suitability for treatment of cancer by PDT method. Peripherally tetra-substituted neutral and quaternized metal-free and metallophthalocyanines (MPcs) (Zn, In) bearing morpholinoethoxy groups were prepared. The binding of quaternized compounds (3Q-5Q) to CT-DNA were examined using UV-Vis, fluorescence spectra, thermal denaturation profiles and K SV values. Besides, thermodynamic studies indicated that binding of 3Q-5Q to DNA was spontaneous. On the other hand, in vitro phototoxicity and cytotoxicity behavior of the quaternized water-soluble phthalocyanine photosensitizers (3Q-5Q) were tested against the cervical cancer cell line named HeLa for evaluation of their suitability for treatment of cancer by PDT method.

  7. ( sup 3 H)-DOB(4-bromo-2,5-dimethoxyphenylisopropylamine) and ( sup 3 H) ketanserin label two affinity states of the cloned human 5-hydroxytryptamine2 receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Branchek, T.; Adham, N.; Macchi, M.

    1990-11-01

    The binding properties of the 5-hydroxytryptamine2 (5-HT2) receptor have been the subject of much interest and debate in recent years. The hallucinogenic amphetamine derivative 4-bromo-2,5-dimethoxyphenylisopropylamine (DOB) has been shown to bind to a small number of binding sites with properties very similar to (3H)ketanserin-labeled 5-HT2 receptors, but with much higher agonist affinities. Some researchers have interpreted this as evidence for the existence of a new subtype of 5-HT2 receptor (termed 5-HT2A), whereas others have interpreted these data as indicative of agonist high affinity and agonist low affinity states for the 5-HT2 receptor. In this investigation, a cDNA clone encoding themore » serotonin 5-HT2 receptor was transiently transfected into monkey kidney Cos-7 cells and stably transfected into mouse fibroblast L-M(TK-) cells. In both systems, expression of this single serotonin receptor cDNA led to the appearance of both (3H)DOB and (3H)ketanserin binding sites with properties that matched their binding characteristics in mammalian brain homogenates. Addition of guanosine 5'-(beta, gamma-imido) triphosphate (Gpp(NH)p) to this system caused a rightward shift and steepening of agonist competition curves for (3H) ketanserin binding, converting a two-site binding curve to a single low affinity binding state. Gpp(NH)p addition also caused a 50% decrease in the number of high affinity (3H)DOB binding sites, with no change in the dissociation constant of the remaining high affinity states. These data on a single human 5-HT2 receptor cDNA expressed in two different transfection host cells indicate that (3H)DOB and (3H)ketanserin binding reside on the same gene product, apparently interacting with agonist and antagonist conformations of a single human 5-HT2 receptor protein.« less

  8. Molecular Toxicology of Chromatin

    DTIC Science & Technology

    1992-01-01

    towards the DNA analogs used as coenzymes suggests that the maximal activation by spermine , that depends on coDNA, may involve DNA structures which...evidence for the participation of spermine in an ADPRT-mediated regulatory system that can modify DNA structures , it seems plausible to assume tnat ADPRT may...DNA-dependent manner. The binding properties of spermine -, polylysine- and p olyarginine-Sepharose 4B affinity matrices were also determined. The

  9. Biochemical Regulatory Features of Activation-Induced Cytidine Deaminase Remain Conserved from Lampreys to Humans

    PubMed Central

    King, Justin J.; Amemiya, Chris T.; Hsu, Ellen

    2017-01-01

    ABSTRACT Activation-induced cytidine deaminase (AID) is a genome-mutating enzyme that initiates class switch recombination and somatic hypermutation of antibodies in jawed vertebrates. We previously described the biochemical properties of human AID and found that it is an unusual enzyme in that it exhibits binding affinities for its substrate DNA and catalytic rates several orders of magnitude higher and lower, respectively, than a typical enzyme. Recently, we solved the functional structure of AID and demonstrated that these properties are due to nonspecific DNA binding on its surface, along with a catalytic pocket that predominantly assumes a closed conformation. Here we investigated the biochemical properties of AID from a sea lamprey, nurse shark, tetraodon, and coelacanth: representative species chosen because their lineages diverged at the earliest critical junctures in evolution of adaptive immunity. We found that these earliest-diverged AID orthologs are active cytidine deaminases that exhibit unique substrate specificities and thermosensitivities. Significant amino acid sequence divergence among these AID orthologs is predicted to manifest as notable structural differences. However, despite major differences in sequence specificities, thermosensitivities, and structural features, all orthologs share the unusually high DNA binding affinities and low catalytic rates. This absolute conservation is evidence for biological significance of these unique biochemical properties. PMID:28716949

  10. Dimerization-induced corepressor binding and relaxed DNA-binding specificity are critical for PML/RARA-induced immortalization

    PubMed Central

    Zhou, Jun; Pérès, Laurent; Honoré, Nicole; Nasr, Rihab; Zhu, Jun; de Thé, Hugues

    2006-01-01

    The pathogenesis of acute promyelocytic leukemia involves the transcriptional repression of master genes of myeloid differentiation by the promyelocytic leukemia–retinoic acid receptor α (PML/RARA) oncogene. PML-enforced RARA homodimerization allows the tighter binding of corepressors, silencing RARA target genes. In addition, homodimerization dramatically extends the spectrum of DNA-binding sites of the fusion protein compared with those of normal RARA. Yet, any contribution of these two properties of PML/RARA to differentiation arrest and immortalization of primary mouse hematopoietic progenitors was unknown. We demonstrate that dimerization-induced silencing mediator of retinoid and thyroid receptors (SMRT)-enhanced binding and relaxed DNA-binding site specificity are both required for efficient immortalization. Thus, enforced RARA dimerization is critical not only for triggering transcriptional repression but also for extending the repertoire of target genes. Our studies exemplify how dimerization-induced gain of functions converts an unessential transcription factor into a dominant oncogenic protein. PMID:16757557

  11. Using Atomic Force Microscopy to Characterize the Conformational Properties of Proteins and Protein-DNA Complexes That Carry Out DNA Repair.

    PubMed

    LeBlanc, Sharonda; Wilkins, Hunter; Li, Zimeng; Kaur, Parminder; Wang, Hong; Erie, Dorothy A

    2017-01-01

    Atomic force microscopy (AFM) is a scanning probe technique that allows visualization of single biomolecules and complexes deposited on a surface with nanometer resolution. AFM is a powerful tool for characterizing protein-protein and protein-DNA interactions. It can be used to capture snapshots of protein-DNA solution dynamics, which in turn, enables the characterization of the conformational properties of transient protein-protein and protein-DNA interactions. With AFM, it is possible to determine the stoichiometries and binding affinities of protein-protein and protein-DNA associations, the specificity of proteins binding to specific sites on DNA, and the conformations of the complexes. We describe methods to prepare and deposit samples, including surface treatments for optimal depositions, and how to quantitatively analyze images. We also discuss a new electrostatic force imaging technique called DREEM, which allows the visualization of the path of DNA within proteins in protein-DNA complexes. Collectively, these methods facilitate the development of comprehensive models of DNA repair and provide a broader understanding of all protein-protein and protein-nucleic acid interactions. The structural details gleaned from analysis of AFM images coupled with biochemistry provide vital information toward establishing the structure-function relationships that govern DNA repair processes. © 2017 Elsevier Inc. All rights reserved.

  12. Nanopore sensing of individual transcription factors bound to DNA

    PubMed Central

    Squires, Allison; Atas, Evrim; Meller, Amit

    2015-01-01

    Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes. PMID:26109509

  13. Nanopore sensing of individual transcription factors bound to DNA

    NASA Astrophysics Data System (ADS)

    Squires, Allison; Atas, Evrim; Meller, Amit

    2015-06-01

    Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes.

  14. Computational characterization of DNA/peptide/nanotube self assembly for bioenergy applications

    NASA Astrophysics Data System (ADS)

    Ortiz, Vanessa; Araki, Ruriko; Collier, Galen

    2012-02-01

    Multi-enzyme pathways have become a subject of increasing interest for their role in the engineering of biomimetic systems for applications including biosensors, bioelectronics, and bioenergy. The efficiencies found in natural metabolic pathways partially arise from biomolecular self-assembly of the component enzymes in an effort to avoid transport limitations. The ultimate goal of this effort is to design and build biofuel cells with efficiencies similar to those of native systems by introducing biomimetic structures that immobilize multiple enzymes in specific orientations on a bioelectrode. To achieve site-specific immobilization, the specificity of DNA-binding domains is exploited with an approach that allows any redox enzyme to be modified to site-specifically bind to double stranded (ds) DNA while retaining activity. Because of its many desirable properties, the bioelectrode of choice is single-wall carbon nanotubes (SWNTs), but little is known about dsDNA/SWNT assembly and how this might affect the activity of the DNA-binding domains. Here we evaluate the feasibility of the proposed assembly by performing atomistic molecular dynamics simulations to look at the stability and conformations adopted by dsDNA when bound to a SWNT. We also evaluate the effects of the presence of a SWNT on the stability of the complex formed by a DNA-binding domain and DNA.

  15. Spectroscopic studies of the interaction of aspirin and its important metabolite, salicylate ion, with DNA, A·T and G·C rich sequences

    NASA Astrophysics Data System (ADS)

    Bathaie, S. Z.; Nikfarjam, L.; Rahmanpour, R.; Moosavi-Movahedi, A. A.

    2010-12-01

    Among different biological effects of acetylsalicylic acid (ASA), its anticancer property is controversial. Since ASA hydrolyzes rapidly to salicylic acid (SA), especially in the blood, interaction of both ASA and SA (as the small molecules) with ctDNA, oligo(dA·dT) 15 and oligo(dG·dC) 15, as a possible mechanism of their action, is investigated here. The results show that the rate of ASA hydrolysis in the absence and presence of ctDNA is similar. The spectrophotometric results indicate that both ASA and SA cooperatively bind to ctDNA. The binding constants ( K) are (1.7 ± 0.7) × 10 3 M -1 and (6.7 ± 0.2) × 10 3 M -1 for ASA and SA, respectively. Both ligands quench the fluorescence emission of ethidium bromide (Et)-ctDNA complex. The Scatchard plots indicate the non-displacement based quenching (non-intercalative binding). The circular dichroism (CD) spectra of ASA- or SA-ctDsNA complexes show the minor distortion of ctDNA structure, with no characteristic peaks for intercalation of ligands. Tm of ctDNA is decreased up to 3 °C upon ASA binding. The CD results also indicate more distortions on oligo(dG·dC) 15 structure due to the binding of both ASA and SA in comparison with oligo(dA·dT) 15. All data indicate the more affinity for SA binding with DNA minor groove in comparison with ASA which has more hydrophobic character.

  16. Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

    PubMed

    Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

    2013-03-01

    N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

  17. Sanguinarine interacts with chromatin, modulates epigenetic modifications, and transcription in the context of chromatin.

    PubMed

    Selvi B, Ruthrotha; Pradhan, Suman Kalyan; Shandilya, Jayasha; Das, Chandrima; Sailaja, Badi Sri; Shankar G, Naga; Gadad, Shrikanth S; Reddy, Ashok; Dasgupta, Dipak; Kundu, Tapas K

    2009-02-27

    DNA-binding anticancer agents cause alteration in chromatin structure and dynamics. We report the dynamic interaction of the DNA intercalator and potential anticancer plant alkaloid, sanguinarine (SGR), with chromatin. Association of SGR with different levels of chromatin structure was enthalpy driven with micromolar dissociation constant. Apart from DNA, it binds with comparable affinity with core histones and induces chromatin aggregation. The dual binding property of SGR leads to inhibition of core histone modifications. Although it potently inhibits H3K9 methylation by G9a in vitro, H3K4 and H3R17 methylation are more profoundly inhibited in cells. SGR inhibits histone acetylation both in vitro and in vivo. It does not affect the in vitro transcription from DNA template but significantly represses acetylation-dependent chromatin transcription. SGR-mediated repression of epigenetic marks and the alteration of chromatin geography (nucleography) also result in the modulation of global gene expression. These data, conclusively, show an anticancer DNA binding intercalator as a modulator of chromatin modifications and transcription in the chromatin context.

  18. From oleic acid-capped iron oxide nanoparticles to polyethyleneimine-coated single-particle magnetofectins

    NASA Astrophysics Data System (ADS)

    Cruz-Acuña, Melissa; Maldonado-Camargo, Lorena; Dobson, Jon; Rinaldi, Carlos

    2016-09-01

    Various inorganic nanoparticle designs have been developed and used as non-viral gene carriers. Magnetic gene carriers containing polyethyleneimine (PEI), a well-known transfection agent, have been shown to improve DNA transfection speed and efficiency in the presence of applied magnetic field gradients that promote particle-cell interactions. Here we report a method to prepare iron oxide nanoparticles conjugated with PEI that: preserves the narrow size distribution of the nanoparticles, conserves magnetic properties throughout the process, and results in efficient transfection. We demonstrate the ability of the particles to electrostatically bind with DNA and transfect human cervical cancer (HeLa) cells by the use of an oscillating magnet array. Their transfection efficiency is similar to that of Lipofectamine 2000™, a commercial transfection reagent. PEI-coated particles were subjected to acidification, and acidification in the presence of salts, before DNA binding. Results show that although these pre-treatments did not affect the ability of particles to bind DNA they did significantly enhanced transfection efficiency. Finally, we show that these magnetofectins (PEI-MNP/DNA) complexes have no effect on the viability of cells at the concentrations used in the study. The systematic preparation of magnetic vectors with uniform physical and magnetic properties is critical to progressing this non-viral transfection technology.

  19. Optical tweezers reveal how proteins alter replication

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy

    Single molecule force spectroscopy is a powerful method that explores the DNA interaction properties of proteins involved in a wide range of fundamental biological processes such as DNA replication, transcription, and repair. We use optical tweezers to capture and stretch a single DNA molecule in the presence of proteins that bind DNA and alter its mechanical properties. We quantitatively characterize the DNA binding mechanisms of proteins in order to provide a detailed understanding of their function. In this work, we focus on proteins involved in replication of Escherichia coli (E. coli ), endogenous eukaryotic retrotransposons Ty3 and LINE-1, and human immunodeficiency virus (HIV). DNA polymerases replicate the entire genome of the cell, and bind both double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) during DNA replication. The replicative DNA polymerase in the widely-studied model system E. coli is the DNA polymerase III subunit alpha (DNA pol III alpha). We use optical tweezers to determine that UmuD, a protein that regulates bacterial mutagenesis through its interactions with DNA polymerases, specifically disrupts alpha binding to ssDNA. This suggests that UmuD removes alpha from its ssDNA template to allow DNA repair proteins access to the damaged DNA, and to facilitate exchange of the replicative polymerase for an error-prone translesion synthesis (TLS) polymerase that inserts nucleotides opposite the lesions, so that bacterial DNA replication may proceed. This work demonstrates a biophysical mechanism by which E. coli cells tolerate DNA damage. Retroviruses and retrotransposons reproduce by copying their RNA genome into the nuclear DNA of their eukaryotic hosts. Retroelements encode proteins called nucleic acid chaperones, which rearrange nucleic acid secondary structure and are therefore required for successful replication. The chaperone activity of these proteins requires strong binding affinity for both single- and double-stranded nucleic acids. We use single molecule DNA stretching to show that the nucleocapsid protein (NC) of the yeast retrotransposon Ty3, which is likely to be an ancestor of HIV NC, has optimal nucleic acid chaperone activity with only a single zinc finger. We also show that the chaperone activity of the ORF1 protein is responsible for successful replication of the mouse LINE-1 retrotransposon. LINE-1 is also 17% of the human genome, where it generates insertion mutations and alters gene expression. Retrotransposons such as LINE-1 and Ty3 are likely to be ancestors of retroviruses such as HIV. Human APOBEC3G (A3G) inhibits HIV-1 replication via cytidine deamination of the viral ssDNA genome, as well as via a distinct deamination-independent mechanism. Efficient deamination requires rapid on-off binding kinetics, but a slow dissociation rate is required for the proposed deaminase-independent mechanism. We resolve this apparent contradiction with a new quantitative single molecule method, which shows that A3G initially binds ssDNA with fast on-off rates and subsequently converts to a slow binding mode. This suggests that oligomerization transforms A3G from a fast enzyme to a slow binding protein, which is the biophysical mechanism that allows A3G to inhibit HIV replication. A complete understanding of the mechanism of A3G-mediated antiviral activity is required to design drugs that disrupt the viral response to A3G, enhance A3G packaging inside the viral core, and other potential strategies for long-term treatment of HIV infection. We use single molecule biophysics to explore the function of proteins involved in bacterial DNA replication, endogenous retrotransposition of retroelements in eukaryotic hosts such yeast and mice, and HIV replication in human cells. Our quantitative results provide insight into protein function in a range of complex biological systems and have wide-ranging implications for human health.

  20. Covalently bound DNA on naked iron oxide nanoparticles: Intelligent colloidal nano-vector for cell transfection.

    PubMed

    Magro, Massimiliano; Martinello, Tiziana; Bonaiuto, Emanuela; Gomiero, Chiara; Baratella, Davide; Zoppellaro, Giorgio; Cozza, Giorgio; Patruno, Marco; Zboril, Radek; Vianello, Fabio

    2017-11-01

    Conversely to common coated iron oxide nanoparticles, novel naked surface active maghemite nanoparticles (SAMNs) can covalently bind DNA. Plasmid (pDNA) harboring the coding gene for GFP was directly chemisorbed onto SAMNs, leading to a novel DNA nanovector (SAMN@pDNA). The spontaneous internalization of SAMN@pDNA into cells was compared with an extensively studied fluorescent SAMN derivative (SAMN@RITC). Moreover, the transfection efficiency of SAMN@pDNA was evaluated and explained by computational model. SAMN@pDNA was prepared and characterized by spectroscopic and computational methods, and molecular dynamic simulation. The size and hydrodynamic properties of SAMN@pDNA and SAMN@RITC were studied by electron transmission microscopy, light scattering and zeta-potential. The two nanomaterials were tested by confocal scanning microscopy on equine peripheral blood-derived mesenchymal stem cells (ePB-MSCs) and GFP expression by SAMN@pDNA was determined. Nanomaterials characterized by similar hydrodynamic properties were successfully internalized and stored into mesenchymal stem cells. Transfection by SAMN@pDNA occurred and GFP expression was higher than lipofectamine procedure, even in the absence of an external magnetic field. A computational model clarified that transfection efficiency can be ascribed to DNA availability inside cells. Direct covalent binding of DNA on naked magnetic nanoparticles led to an extremely robust gene delivery tool. Hydrodynamic and chemical-physical properties of SAMN@pDNA were responsible of the successful uptake by cells and of the efficiency of GFP gene transfection. SAMNs are characterized by colloidal stability, excellent cell uptake, persistence in the host cells, low toxicity and are proposed as novel intelligent DNA nanovectors for efficient cell transfection. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Role of advanced glycation on aggregation and DNA binding properties of α-synuclein.

    PubMed

    Padmaraju, Vasudevaraju; Bhaskar, Jamuna J; Prasada Rao, Ummiti J S; Salimath, Paramahans V; Rao, K S

    2011-01-01

    Parkinson's disease (PD) is a neurodegenerative disease with multiple etiologies. Advanced glycation end products (AGEs) accumulate in the aging brain and could be one of the reasons for age-related diseases like PD. Oxidative stress also leads to the formation of AGEs and may be involved in neurodegeneration by altering the properties of proteins. α-Synuclein is involved in pathogenesis of PD and there are limited studies on the role of AGE-α-synuclein in neurodegeneration. We studied the aggregation and DNA binding ability of AGE-α-synuclein in vitro. α-Synuclein is glycated using methylglyoxal and formation of AGE-α-synuclein is characterized using fluorescence studies, intrinsic tyrosine fluorescence, and fructosamine estimation. The results indicated that AGE-α-synuclein aggregates into smaller globular-like aggregates compared to fibrils formed with native α-synuclein. Further, it is found that AGE-α-synuclein induced conformational changes in scDNA from B-form to B-C-A mixed conformation. Additionally, AGE-α-synuclein altered DNA integrity as evidenced by the melting temperature, ethidium bromide, and DNAse I sensitivity studies. AGE-α-synuclein converted biphasic Tm to higher monophasic Tm. The Tm of AGE-α-synuclein-scDNA complex is more than that of native α-synuclein-scDNA complex, indicating that AGE-α-synuclein stabilized the uncoiled scDNA. AGE-α-synuclein could stabilize the uncoiled scDNA, as shown by the decrease in the number of ethidium bromide binding molecules per base pair of DNA. DNAse I sensitive studies indicated that both AGE-α-synuclein-scDNA and α-synuclein-scDNA are resistant to DNAse I digestion. The relevance of these findings to neuronal cell death is discussed.

  2. Identification and preliminary characterization of a protein motif related to the zinc finger.

    PubMed Central

    Lovering, R; Hanson, I M; Borden, K L; Martin, S; O'Reilly, N J; Evan, G I; Rahman, D; Pappin, D J; Trowsdale, J; Freemont, P S

    1993-01-01

    We have identified a protein motif, related to the zinc finger, which defines a newly discovered family of proteins. The motif was found in the sequence of the human RING1 gene, which is proximal to the major histocompatibility complex region on chromosome six. We propose naming this motif the "RING finger" and it is found in 27 proteins, all of which have putative DNA binding functions. We have synthesized a peptide corresponding to the RING1 motif and examined a number of properties, including metal and DNA binding. We provide evidence to support the suggestion that the RING finger motif is the DNA binding domain of this newly defined family of proteins. Images Fig. 1 Fig. 4 PMID:7681583

  3. Engineering a trifunctional proline utilization A chimaera by fusing a DNA-binding domain to a bifunctional PutA.

    PubMed

    Arentson, Benjamin W; Hayes, Erin L; Zhu, Weidong; Singh, Harkewal; Tanner, John J; Becker, Donald F

    2016-12-01

    Proline utilization A (PutA) is a bifunctional flavoenzyme with proline dehydrogenase (PRODH) and Δ 1 -pyrroline-5-carboxylate (P5C) dehydrogenase (P5CDH) domains that catalyses the two-step oxidation of proline to glutamate. Trifunctional PutAs also have an N-terminal ribbon-helix-helix (RHH) DNA-binding domain and moonlight as autogenous transcriptional repressors of the put regulon. A unique property of trifunctional PutA is the ability to switch functions from DNA-bound repressor to membrane-associated enzyme in response to cellular nutritional needs and proline availability. In the present study, we attempt to construct a trifunctional PutA by fusing the RHH domain of Escherichia coli PutA (EcRHH) to the bifunctional Rhodobacter capsulatus PutA (RcPutA) in order to explore the modular design of functional switching in trifunctional PutAs. The EcRHH-RcPutA chimaera retains the catalytic properties of RcPutA while acquiring the oligomeric state, quaternary structure and DNA-binding properties of EcPutA. Furthermore, the EcRHH-RcPutA chimaera exhibits proline-induced lipid association, which is a fundamental characteristic of functional switching. Unexpectedly, RcPutA lipid binding is also activated by proline, which shows for the first time that bifunctional PutAs exhibit a limited form of functional switching. Altogether, these results suggest that the C-terminal domain (CTD), which is conserved by trifunctional PutAs and certain bifunctional PutAs, is essential for functional switching in trifunctional PutAs. © 2016 The Author(s).

  4. Engineering a trifunctional proline utilization A chimaera by fusing a DNA-binding domain to a bifunctional PutA

    PubMed Central

    Arentson, Benjamin W.; Hayes, Erin L.; Zhu, Weidong; Singh, Harkewal; Tanner, John J.; Becker, Donald F.

    2016-01-01

    Proline utilization A (PutA) is a bifunctional flavoenzyme with proline dehydrogenase (PRODH) and Δ1-pyrroline-5-carboxylate (P5C) dehydrogenase (P5CDH) domains that catalyses the two-step oxidation of proline to glutamate. Trifunctional PutAs also have an N-terminal ribbon–helix–helix (RHH) DNA-binding domain and moonlight as autogenous transcriptional repressors of the put regulon. A unique property of trifunctional PutA is the ability to switch functions from DNA-bound repressor to membrane-associated enzyme in response to cellular nutritional needs and proline availability. In the present study, we attempt to construct a trifunctional PutA by fusing the RHH domain of Escherichia coli PutA (EcRHH) to the bifunctional Rhodobacter capsulatus PutA (RcPutA) in order to explore the modular design of functional switching in trifunctional PutAs. The EcRHH–RcPutA chimaera retains the catalytic properties of RcPutA while acquiring the oligomeric state, quaternary structure and DNA-binding properties of EcPutA. Furthermore, the EcRHH–RcPutA chimaera exhibits proline-induced lipid association, which is a fundamental characteristic of functional switching. Unexpectedly, RcPutA lipid binding is also activated by proline, which shows for the first time that bifunctional PutAs exhibit a limited form of functional switching. Altogether, these results suggest that the C-terminal domain (CTD), which is conserved by trifunctional PutAs and certain bifunctional PutAs, is essential for functional switching in trifunctional PutAs. PMID:27742866

  5. Filtration recovery of extracellular DNA from environmental ...

    EPA Pesticide Factsheets

    qPCR methods are able to analyze DNA from microbes within hours of collecting water samples, providing the promptest notification and public awareness possible when unsafe pathogenic levels are reached. Health risk, however, may be overestimated by the presence of extracellular DNA (eDNA) that is co-recovered by the filtration procedure which is the most commonly used method to concentrate target microbes from environmental waters. Using C. parvum 18S rRNA gene fragment as a representative of eDNA, we examined the impact of filters (types and pore sizes) and physiochemical properties of surface water samples on the recovery of spiked DNA. Our results indicated that binding affinities of various filter membranes were quantifiably different for eDNA fragments with the polycarbonate (PC) binding the least and mixed cellulose acetate and cellulose nitrate (MCE) binding the most as evidenced by up to 16% recovery of the spiked plasmid DNA with a pore size of 0.2µm. Water quality parameters also had a distinct influence on the recovery of eDNA which was enhanced by the presence of high total suspended solid (TSS) concentrations and reduced pH. At pH 5.5, with 150mg/L of clay, DNA recovery was increased to as much as 18%. By shielding the negative charge, thus increasing the interaction of DNA and colloids, the increase of Na+ and Ca+2 concentrations resulted in more DNA binding and consequently more recovery from environmental water samples. Therefore, in addition

  6. Evaluation of DNA, BSA binding, and antimicrobial activity of new synthesized neodymium complex containing 29-dimethyl 110-phenanthroline.

    PubMed

    Moradi, Zohreh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam

    2018-02-01

    In order to evaluate biological potential of a novel synthesized complex [Nd(dmp) 2 Cl 3 .OH 2 ] where dmp is 29-dimethyl 110-phenanthroline, the DNA-binding, cleavage, BSA binding, and antimicrobial activity properties of the complex are investigated by multispectroscopic techniques study in physiological buffer (pH 7.2).The intrinsic binding constant (K b ) for interaction of Nd(III) complex and FS-DNA is calculated by UV-Vis (K b  = 2.7 ± 0.07 × 10 5 ) and fluorescence spectroscopy (K b  = 1.13 ± 0.03 × 10 5 ). The Stern-Volmer constant (K SV ), thermodynamic parameters including free energy change (ΔG°), enthalpy change (∆H°), and entropy change (∆S°), are calculated by fluorescent data and Vant' Hoff equation. The experimental results show that the complex can bind to FS-DNA and the major binding mode is groove binding. Meanwhile, the interaction of Nd(III) complex with protein, bovine serum albumin (BSA), has also been studied by using absorption and emission spectroscopic tools. The experimental results show that the complex exhibits good binding propensity to BSA. The positive ΔH° and ∆S° values indicate that the hydrophobic interaction is main force in the binding of the Nd(III) complex to BSA, and the complex can quench the intrinsic fluorescence of BSA remarkably through a static quenching process. Also, DNA cleavage was investigated by agarose gel electrophoresis that according to the results cleavage of DNA increased with increasing of concentration of the complex. Antimicrobial screening test gives good results in the presence of Nd(III) complex system.

  7. The UL5 and UL52 subunits of the herpes simplex virus type 1 helicase-primase subcomplex exhibit a complex interdependence for DNA binding.

    PubMed

    Biswas, N; Weller, S K

    2001-05-18

    Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8 genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5'-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought.

  8. USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

    PubMed

    Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

    1991-09-11

    The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

  9. Exploring the DNA binding/cleavage, cellular accumulation and topoisomerase inhibition of 2-hydroxy-3-(aminomethyl)-1,4-naphthoquinone Mannich bases and their platinum(II) complexes.

    PubMed

    Neves, Amanda P; Pereira, Michelle X G; Peterson, Erica J; Kipping, Ralph; Vargas, Maria D; Silva, Floriano P; Carneiro, J Walkimar M; Farrell, Nicholas P

    2013-02-01

    Several chlorido and amino Pt(2+) complexes of 2-hydroxy-3-(aminomethyl)-1,4-naphthoquinone Mannich bases HL exhibiting moderate to high cytotoxicity against cancer cell lines were studied in order to investigate their modes of DNA binding, in vitro DNA strand breaks, mechanism of topoisomerase (Topo I) inhibition and cellular accumulation. DNA model base studies have shown that complex 1a [Pt(HL1)Cl(2)] was capable of binding covalently to 9-ethylguanine (9-EtG) and 5'-GMP. (1)H NMR and mass spectrometry studies have shown that both chlorides were substituted by 9-EtG ligands, whereas 5'-GMP was able to replace only one chlorido ligand, due to steric hindrance. The chlorido Pt(2+) complexes [Pt(HL)Cl(2)] highly accumulate in prostate (PC-3) and melanoma (MDA-MB-435) cell lines, being able to induce DNA strand breaks in vitro and inhibit Topo I by a catalytic mode. On the other hand, the free 2-hydroxy-3-(aminomethyl)-1,4-naphthoquinones HL and the amino Pt(2+) complexes [Pt(L(-))(NH(3))(2)]NO(3) neither cause DNA strand breakage nor exhibit strong DNA interaction, nevertheless the latter were also found to be catalytic inhibitors of Topo I at 100μM. Thus, coordination of the Mannich bases HL to the "PtCl(2)" fragment substantially affects the chemical and biophysical properties of the pro-ligands, leading to an improvement of their DNA binding properties and generating compounds that cleave DNA and catalytically inhibit Topo I. Finally, the high cytotoxicity exhibited by the free (uncomplexed) 2-hydroxy-3-(aminomethyl)-1,4-naphthoquinones might be associated with their decomposition in solution, which is not observed for the Pt(2+) complexes. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

    PubMed

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

    2018-01-01

    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Deppdb--DNA electrostatic potential properties database: electrostatic properties of genome DNA.

    PubMed

    Osypov, Alexander A; Krutinin, Gleb G; Kamzolova, Svetlana G

    2010-06-01

    The electrostatic properties of genome DNA influence its interactions with different proteins, in particular, the regulation of transcription by RNA-polymerases. DEPPDB--DNA Electrostatic Potential Properties Database--was developed to hold and provide all available information on the electrostatic properties of genome DNA combined with its sequence and annotation of biological and structural properties of genome elements and whole genomes. Genomes in DEPPDB are organized on a taxonomical basis. Currently, the database contains all the completely sequenced bacterial and viral genomes according to NCBI RefSeq. General properties of the genome DNA electrostatic potential profile and principles of its formation are revealed. This potential correlates with the GC content but does not correspond to it exactly and strongly depends on both the sequence arrangement and its context (flanking regions). Analysis of the promoter regions for bacterial and viral RNA polymerases revealed a correspondence between the scale of these proteins' physical properties and electrostatic profile patterns. We also discovered a direct correlation between the potential value and the binding frequency of RNA polymerase to DNA, supporting the idea of the role of electrostatics in these interactions. This matches a pronounced tendency of the promoter regions to possess higher values of the electrostatic potential.

  12. Novel FeII and CoII Complexes of Natural Product Tryptanthrin: Synthesis and Binding with G-Quadruplex DNA

    PubMed Central

    Zhong, Yi-ning; Zhang, Yan; Gu, Yun-qiong; Wu, Shi-yun; Shen, Wen-ying

    2016-01-01

    Tryptanthrin is one of the most important members of indoloquinoline alkaloids. We obtained this alkaloid from Isatis. Two novel FeII and CoII complexes of tryptanthrin were first synthesized. Single-crystal X-ray diffraction analyses show that these complexes display distorted four-coordinated tetrahedron geometry via two heterocyclic nitrogen and oxygen atoms from tryptanthrin ligand. Binding with G-quadruplex DNA properties revealed that both complexes were found to exhibit significant interaction with G-quadruplex DNA. This study may potentially serve as the basis of future rational design of metal-based drugs from natural products that target the G-quadruplex DNA. PMID:27698647

  13. On the origin of the decrease in stability of the DNA hairpin d(GCGAAGC) on complexation with aromatic drugs.

    PubMed

    Kostjukov, V V; Lantushenko, A O; Davies, D B; Evstigneev, M P

    2007-08-01

    Molecular dynamics simulations of drug-DNA complexes have been carried out in order to explain the experimentally observed decrease in thermal stability of the DNA hairpin d(GCGAAGC) on binding the aromatic drug molecules, daunomycin, ethidium bromide, novantrone and proflavine. This complexation behavior is in contrast to the stabilizing effect of the same aromatic drug molecules on DNA duplexes. Analysis of the energy parameters and the hydration properties of the complexes shows that the main factor correlating with the decrease in melting temperatures of the drug-hairpin complexes is the number of water bridges, with a reduction of at least 40% on ligand binding.

  14. Prokaryotic and eukaryotic DNA helicases. Essential molecular motor proteins for cellular machinery.

    PubMed

    Tuteja, Narendra; Tuteja, Renu

    2004-05-01

    DNA helicases are ubiquitous molecular motor proteins which harness the chemical free energy of ATP hydrolysis to catalyze the unwinding of energetically stable duplex DNA, and thus play important roles in nearly all aspects of nucleic acid metabolism, including replication, repair, recombination, and transcription. They break the hydrogen bonds between the duplex helix and move unidirectionally along the bound strand. All helicases are also translocases and DNA-dependent ATPases. Most contain conserved helicase motifs that act as an engine to power DNA unwinding. All DNA helicases share some common properties, including nucleic acid binding, NTP binding and hydrolysis, and unwinding of duplex DNA in the 3' to 5' or 5' to 3' direction. The minichromosome maintenance (Mcm) protein complex (Mcm4/6/7) provides a DNA-unwinding function at the origin of replication in all eukaryotes and may act as a licensing factor for DNA replication. The RecQ family of helicases is highly conserved from bacteria to humans and is required for the maintenance of genome integrity. They have also been implicated in a variety of human genetic disorders. Since the discovery of the first DNA helicase in Escherichia coli in 1976, and the first eukaryotic one in the lily in 1978, a large number of these enzymes have been isolated from both prokaryotic and eukaryotic systems, and the number is still growing. In this review we cover the historical background of DNA helicases, helicase assays, biochemical properties, prokaryotic and eukaryotic DNA helicases including Mcm proteins and the RecQ family of helicases. The properties of most of the known DNA helicases from prokaryotic and eukaryotic systems, including viruses and bacteriophages, are summarized in tables.

  15. Synthesis, structure, DNA/protein binding, and cytotoxic activity of a rhodium(III) complex with 2,6-bis(2-benzimidazolyl)pyridine.

    PubMed

    Esteghamat-Panah, Roya; Hadadzadeh, Hassan; Farrokhpour, Hossein; Simpson, Jim; Abdolmaleki, Amir; Abyar, Fatemeh

    2017-02-15

    A new mononuclear rhodium(III) complex, [Rh(bzimpy)Cl 3 ] (bzimpy = 2,6-bis(2-benzimidazolyl)pyridine), was synthesized and characterized by elemental analysis and spectroscopic methods. The molecular structure of the complex was confirmed by single-crystal X-ray crystallography. The interaction of the complex with fish sperm DNA (FS-DNA) was investigated by UV spectroscopy, emission titration, and viscosity measurement in order to evaluate the possible DNA-binding mode and to calculate the corresponding DNA-binding constant. The results reveal that the Rh(III) complex interacts with DNA through groove binding mode with a binding affinity on the order of 10 4 . In addition, the binding of the Rh(III) complex to bovine serum albumin (BSA) was monitored by UV-Vis and fluorescence emission spectroscopy at different temperatures. The mechanism of the complex interaction was found to be static quenching. The thermodynamic parameters (ΔH, ΔS, and ΔG) obtained from the fluorescence spectroscopy data show that van der Waals interactions and hydrogen bonds play a major role in the binding of the Rh(III) complex to BSA. For the comparison of the DNA- and BSA-binding affinities of the free bzimpy ligand with its Rh(III) complex, the absorbance titration and fluorescence quenching experiments of the free bzimpy ligand with DNA and BSA were carried out. Competitive experiments using eosin Y and ibuprofen as site markers indicated that the complex was mainly located in the hydrophobic cavity of site I of the protein. These experimental results were confirmed by the results of molecular docking. Finally, the in vitro cytotoxicity properties of the Rh(III) complex against the MCF-7, K562, and HT-29 cell lines were evaluated and compared with those of the free ligand (bzimpy). It was found that the complexation process improved the anticancer activity significantly. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. DNA binding by a new metallointercalator that contains a proflavine group bearing a hanging chelating unit.

    PubMed

    Bazzicalupi, Carla; Bencini, Andrea; Bianchi, Antonio; Biver, Tarita; Boggioni, Alessia; Bonacchi, Sara; Danesi, Andrea; Giorgi, Claudia; Gratteri, Paola; Ingraín, Antonio Marchal; Secco, Fernando; Sissi, Claudia; Valtancoli, Barbara; Venturini, Marcella

    2008-01-01

    The new bifunctional molecule 3,6-diamine-9-[6,6-bis(2-aminoethyl)-1,6-diaminohexyl]acridine (D), which is characterised by both an aromatic moiety and a separate metal-complexing polyamine centre, has been synthesised. The characteristics of D and its ZnII complex ([ZnD]) (protonation and metal-complexing constants, optical properties and self-aggregation phenomena) have been analysed by means of NMR spectroscopy, potentiometric, spectrophotometric and spectrofluorimetric techniques. The equilibria and kinetics of the binding process of D and [ZnD] to calf thymus DNA have been investigated at I=0.11 M (NaCl) and 298.1 K by using spectroscopic methods and the stopped-flow technique. Static measurements show biphasic behaviour for both D-DNA and [ZnD]-DNA systems; this reveals the occurrence of two different binding processes depending on the polymer-to-dye molar ratio (P/D). The binding mode that occurs at low P/D values is interpreted in terms of external binding with a notable contribution from the polyamine residue. The binding mode at high P/D values corresponds to intercalation of the proflavine residue. Stopped-flow, circular dichroism and supercoiled-DNA unwinding experiments corroborate the proposed mechanism. Molecular-modelling studies support the intercalative process and evidence the influence of NH+...O interactions between the protonated acridine nitrogen atom and the oxygen atoms of the polyanion; these interactions play a key role in determining the conformation of DNA adducts.

  17. Purification and DNA binding properties of the blaI gene product, repressor for the beta-lactamase gene, blaP, of Bacillus licheniformis.

    PubMed Central

    Grossman, M J; Lampen, J O

    1987-01-01

    The location of the repressor gene, blaI, for the beta-lactamase gene blaP of Bacillus licheniformis 749, on the 5' side of blaP, was confirmed by sequencing the bla region of the constitutive mutant 749/C. An amber stop codon, likely to result in a nonfunctional truncated repressor, was found at codon 32 of the 128 codon blaI open reading frame (ORF) located 5' to blaP. In order to study the DNA binding activity of the repressor, the structural gene for blaI, from strain 749, with its ribosome binding site was expressed using a two plasmid T7 RNA polymerase/promotor system (S. Tabor and C. C. Richardson. Proc. Natl. Acad. Sci. 82, 1074-1078 (1985). Heat induction of this system in Escherichia coli K38 resulted in the production of BlaI as 5-10% of the soluble cell protein. Repressor protein was then purified by ammonium sulfate fractionation and cation exchange chromatography. The sequence of the N-terminal 28 amino acid residues was determined and was as predicted from the DNA. Binding of BlaI to DNA was detected by the slower migration of protein DNA complexes during polyacrylamide gel electrophoresis. BlaI was shown to selectively bind DNA fragments carrying the promoter regions of blaI and blaP. Images PMID:3498148

  18. High-Affinity Low-Capacity and Low-Affinity High-Capacity N-Acetyl-2-Aminofluorene (AAF) Macromolecular Binding Sites Are Revealed During the Growth Cycle of Adult Rat Hepatocytes in Primary Culture.

    PubMed

    Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L

    2018-05-01

    Long-term cultures of primary adult rat hepatocytes were used to study the effects of N-acetyl-2-aminofluorene (AAF) on hepatocyte proliferation during the growth cycle; on the initiation of hepatocyte DNA synthesis in quiescent cultures; and, on hepatocyte DNA replication following the initiation of DNA synthesis. Scatchard analyses were used to identify the pharmacologic properties of radiolabeled AAF metabolite binding to hepatocyte macromolecules. Two classes of growth cycle-dependent AAF metabolite binding sites-a high-affinity low-capacity site (designated Site I) and a low-affinity high-capacity site (designated Site II)-associated with two spatially distinct classes of macromolecular targets, were revealed. Based upon radiolabeled AAF metabolite binding to purified hepatocyte genomic DNA or to DNA, RNA, proteins, and lipids from isolated nuclei, Site IDAY 4 targets (KD[APPARENT] ≈ 2-4×10-6 M and BMAX[APPARENT] ≈ 6 pmol/106 cells/24 h) were consistent with genomic DNA; and with AAF metabolized by a nuclear cytochrome P450. Based upon radiolabeled AAF binding to total cellular lysates, Site IIDAY 4 targets (KD[APPARENT] ≈ 1.5×10-3 M and BMAX[APPARENT] ≈ 350 pmol/106 cells/24 h) were consistent with cytoplasmic proteins; and with AAF metabolized by cytoplasmic cytochrome P450s. DNA synthesis was not inhibited by concentrations of AAF that saturated DNA binding in the neighborhood of the Site I KD. Instead, hepatocyte DNA synthesis inhibition required higher concentrations of AAF approaching the Site II KD. These observations raise the possibility that carcinogenic DNA adducts derived from AAF metabolites form below concentrations of AAF that inhibit replicative and repair DNA synthesis.

  19. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats

    PubMed Central

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-01-01

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. PMID:26481363

  20. Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

    PubMed

    Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

    2005-11-01

    The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

  1. AzaHx, a novel fluorescent, DNA minor groove and G·C recognition element: Synthesis and DNA binding properties of a p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (azaHx-PI) polyamide.

    PubMed

    Satam, Vijay; Babu, Balaji; Patil, Pravin; Brien, Kimberly A; Olson, Kevin; Savagian, Mia; Lee, Megan; Mepham, Andrew; Jobe, Laura Beth; Bingham, John P; Pett, Luke; Wang, Shuo; Ferrara, Maddi; Bruce, Chrystal D; Wilson, W David; Lee, Moses; Hartley, John A; Kiakos, Konstantinos

    2015-09-01

    The design, synthesis, and DNA binding properties of azaHx-PI or p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (5) are described. AzaHx, 2-(p-anisyl)-4-aza-benzimidazole-5-carboxamide, is a novel, fluorescent DNA recognition element, derived from Hoechst 33258 to recognize G·C base pairs. Supported by theoretical data, the results from DNase I footprinting, CD, ΔT(M), and SPR studies provided evidence that an azaHx/IP pairing, formed from antiparallel stacking of two azaHx-PI molecules in a side-by-side manner in the minor groove, selectively recognized a C-G doublet. AzaHx-PI was found to target 5'-ACGCGT-3', the Mlu1 Cell Cycle Box (MCB) promoter sequence with specificity and significant affinity (K(eq) 4.0±0.2×10(7) M(-1)). Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Assays for the determination of the activity of DNA nucleases based on the fluorometric properties of the YOYO dye.

    PubMed

    Fernández-Sierra, Mónica; Quiñones, Edwin

    2015-03-15

    Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. The T4 Phage DNA Mimic Protein Arn Inhibits the DNA Binding Activity of the Bacterial Histone-like Protein H-NS*

    PubMed Central

    Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.

    2014-01-01

    The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281

  4. Unveiling the Mode of Interaction of Berberine Alkaloid in Different Supramolecular Confined Environments: Interplay of Surface Charge between Nano-Confined Charged Layer and DNA.

    PubMed

    Kundu, Niloy; Roy, Arpita; Banik, Debasis; Sarkar, Nilmoni

    2016-02-18

    In this Article, we demonstrate a detailed characterization of binding interaction of berberine chloride (BBCl) with calf-thymus DNA (CT-DNA) in buffer solution as well as in two differently charged reverse micelles (RMs). The photophyscial properties of this alkaloid have been modulated within these microheterogeneous bioassemblies. The mode of binding of this alkaloid with DNA is of debate to date. However, fluorescence spectroscopic measurements, circular dichroism (CD) measurement, and temperature-dependent study unambiguously establish that BBCl partially intercalates into the DNA base pairs. The nonplanarity imposed by partial saturation in their structure causes the nonclassical types of intercalation into DNA. Besides the intercalation, electrostatic interactions also play a significant role in the binding between BBCl and DNA. DNA structure turns into a condensed form after encapsulation into RMs, which is followed by the CD spectra and microscopy study. The probe location and dynamics in the nanopool of the RMs depended on the electrostatic interaction between the charged surfactants and cationic berberine. The structural alteration of CT-DNA from B form to condensed form and the interplay of surface charge between RMs and DNA determine the interaction between the alkaloid and DNA in RMs. Time-resolved study and fluorescence anisotropy measurements successfully provide the binding interaction of BBCl in the nanopool of the RMs in the absence and in the presence of DNA. This study motivates us to judge further the potential applicability of this alkaloid in other biological systems or other biomimicking organized assemblies.

  5. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

    PubMed

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

    2011-10-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

  6. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

    PubMed Central

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

    2011-01-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

  7. Tailoring charge density and hydrogen bonding of imidazolium copolymers for efficient gene delivery.

    PubMed

    Allen, Michael H; Green, Matthew D; Getaneh, Hiwote K; Miller, Kevin M; Long, Timothy E

    2011-06-13

    Conventional free radical polymerization with subsequent postpolymerization modification afforded imidazolium copolymers with controlled charge density and side chain hydroxyl number. Novel imidazolium-containing copolymers where each permanent cation contained one or two adjacent hydroxyls allowed precise structure-transfection efficiency studies. The degree of polymerization was identical for all copolymers to eliminate the influence of molecular weight on transfection efficiency. DNA binding, cytotoxicity, and in vitro gene transfection in African green monkey COS-7 cells revealed structure-property-transfection relationships for the copolymers. DNA gel shift assays indicated that higher charge densities and hydroxyl concentrations increased DNA binding. As the charge density of the copolymers increased, toxicity of the copolymers also increased; however, as hydroxyl concentration increased, cytotoxicity remained constant. Changing both charge density and hydroxyl levels in a systematic fashion revealed a dramatic influence on transfection efficiency. Dynamic light scattering of the polyplexes, which were composed of copolymer concentrations required for the highest luciferase expression, showed an intermediate DNA-copolymer binding affinity. Our studies supported the conclusion that cationic copolymer binding affinity significantly impacts overall transfection efficiency of DNA delivery vehicles, and the incorporation of hydroxyl sites offers a less toxic and effective alternative to more conventional highly charged copolymers.

  8. In vitro fluorescence studies of transcription factor IIB-DNA interaction.

    PubMed

    Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

    2015-01-01

    General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

  9. Effects of polyamines on the DNA-reactive properties of dimeric mithramycin complexed with cobalt(II): implications for anticancer therapy.

    PubMed

    Hou, Ming-Hon; Lu, Wen-Je; Huang, Chun-Yu; Fan, Ruey-Jane; Yuann, Jeu-Ming P

    2009-06-09

    Few studies have examined the effects of polyamines on the action of DNA-binding anticancer drugs. Here, a Co(II)-mediated dimeric mithramycin (Mith) complex, (Mith)(2)-Co(II), was shown to be resistant to polyamine competition toward the divalent metal ion when compared to the Fe(II)-mediated drug complexes. Surface plasmon resonance experiments demonstrated that polyamines interfered with the binding capacity and association rates of (Mith)(2)-Co(II) binding to DNA duplexes, while the dissociation rates were not affected. Although (Mith)(2)-Co(II) exhibited the highest oxidative activity under physiological conditions (pH 7.3 and 37 degrees C), polyamines (spermine in particular) inhibited the DNA cleavage activity of the (Mith)(2)-Co(II) in a concentration-dependent manner. Depletion of intracellular polyamines by methylglyoxal bis(guanylhydrazone) (MGBG) enhanced the sensitivity of A549 lung cancer cells to (Mith)(2)-Co(II), most likely due to the decreased intracellular effect of polyamines on the action of (Mith)(2)-Co(II). Our study suggests a novel method for enhancing the anticancer activity of DNA-binding metalloantibiotics through polyamine depletion.

  10. Predicting DNA binding proteins using support vector machine with hybrid fractal features.

    PubMed

    Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo

    2014-02-21

    DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

  11. New cobalt(II) and nickel(II) complexes of benzyl carbazate Schiff bases: Syntheses, crystal structures, in vitro DNA and HSA binding studies.

    PubMed

    Nithya, Palanivelu; Helena, Sannasi; Simpson, Jim; Ilanchelian, Malaichamy; Muthusankar, Aathi; Govindarajan, Subbiah

    2016-12-01

    In the present study, new Schiff base complexes with the composition [M(NCS) 2 (L1) 2 ]·nH 2 O, where M=Co (n=0) (1) and Ni (n=2) (2); [M(NCS) 2 (L2) 2 ], M=Co (3) and Ni (4) as well as [M(NCS) 2 (L3) 2 ], M=Co (5) and Ni (6); (L1=benzyl 2-(propan-2-ylidene)hydrazinecarboxylate, L2=benzyl 2-(butan-2-ylidene)hydrazinecarboxylate and L3=benzyl 2-(pentan-3-ylidene)hydrazinecarboxylate) have been synthesized by a template method. The complexes were characterised by analytical methods, spectroscopic studies, thermal and X-ray diffraction techniques. The structures of all the complexes explore that the metal(II) cation has a trans-planar coordination environment, the monomeric units containing a six-coordinated metal center in octahedral geometry with N-bound isothiocyanate anions coordinated as terminal ligands. Furthermore, the binding of the two Schiff base ligands to the metal centers involves the azomethine nitrogen and the carbonyl oxygen in mutually trans configuration. The binding interactions of all the complexes with Calf thymus-deoxyribonucleic acid (CT-DNA) and human serum albumin (HSA) have been investigated using absorption and emission spectral techniques. The CT-DNA binding properties of these complexes reveal that they bind to CT-DNA through a partial intercalation mode and the binding constant values were calculated using the absorption and emission spectral data. The binding constant values (~10×10 6 moldm -3 ) indicate strong binding of metal complexes with CT-DNA. HSA binding interaction studies showed that the cobalt and nickel complexes can quench the intrinsic fluorescence of HSA through static quenching process. Also, molecular docking studies were supported out to apprehend the binding interactions of these complexes with DNA and HSA which offer new understandings into the experimental model observations. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

    PubMed

    Pessler, Frank; Hernandez, Nouria

    2003-08-01

    POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

  13. Copper complexes containing thiosemicarbazones derived from 6-nitropiperonal: Antimicrobial and biophysical properties

    NASA Astrophysics Data System (ADS)

    Beckford, Floyd A.; Webb, Kelsey R.

    2017-08-01

    A series of four thiosemicarbazones from 6-nitropiperonal along with the corresponding copper complexes were synthesized. The biophysical characteristics of the complexes were investigated by the binding to DNA and human serum albumin. The binding to DNA is moderate; the binding constants run from (0.49-7.50) × 104 M- 1. In relation to HSA, the complexes interact strongly with binding constants on the order of 105 M- 1. The complexes also display antioxidant behavior as determined by the ability to scavenge diphenylpicrylhydrazyl (dpph) and nitric oxide radicals. The antimicrobial profiles of the compounds, tested against a panel of microbes including five of the ESKAPE pathogens (Staphylococcus aureus, MRSA, Escherichia coli, Klebsiella pneumoniae, MDR, Acinetobacter baumannii, Pseudomonas aeruginosa) and two yeasts (Candida albicans and Cryptococcus neoformans var. grubii), are also described. The compounds contain a core moiety that is similar to oxolinic acid, a quinolone antibiotic that targets DNA gyrase and topoisomerase (IV). The binding interaction between the complexes and these important antibacterial targets were studied by computational methods, chiefly docking studies. The calculated dissociation constants for the interaction with DNA gyrase B (from Staphylococcus aureus) range from 4.32 to 24.65 μM; the binding was much stronger to topoisomerase IV, with dissociation constants ranging from 0.37 to 1.27 μM.

  14. Spectro Analytical, Computational and In Vitro Biological Studies of Novel Substituted Quinolone Hydrazone and it's Metal Complexes.

    PubMed

    Nagula, Narsimha; Kunche, Sudeepa; Jaheer, Mohmed; Mudavath, Ravi; Sivan, Sreekanth; Ch, Sarala Devi

    2018-01-01

    Some novel transition metal [Cu (II), Ni (II) and Co (II)] complexes of nalidixic acid hydrazone have been prepared and characterized by employing spectro-analytical techniques viz: elemental analysis, 1 H-NMR, Mass, UV-Vis, IR, TGA-DTA, SEM-EDX, ESR and Spectrophotometry studies. The HyperChem 7.5 software was used for geometry optimization of title compound in its molecular and ionic forms. Quantum mechanical parameters, contour maps of highest occupied molecular orbitals (HOMO) and lowest unoccupied molecular orbitals (LUMO) and corresponding binding energy values were computed using semi empirical single point PM3 method. The stoichiometric equilibrium studies of metal complexes carried out spectrophotometrically using Job's continuous variation and mole ratio methods inferred formation of 1:2 (ML 2 ) metal complexes in respective systems. The title compound and its metal complexes screened for antibacterial and antifungal properties, exemplified improved activity in metal complexes. The studies of nuclease activity for the cleavage of CT- DNA and MTT assay for in vitro cytotoxic properties involving metal complexes exhibited high activity. In addition, the DNA binding properties of Cu (II), Ni (II) and Co (II) complexes investigated by electronic absorption and fluorescence measurements revealed their good binding ability and commended agreement of K b values obtained from both the techniques. Molecular docking studies were also performed to find the binding affinity of synthesized compounds with DNA (PDB ID: 1N37) and "Thymidine phosphorylase from E.coli" (PDB ID: 4EAF) protein targets.

  15. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  16. Probing Human Telomeric DNA and RNA Topology and Ligand Binding in a Cellular Model by Using Responsive Fluorescent Nucleoside Probes.

    PubMed

    Manna, Sudeshna; Panse, Cornelia H; Sontakke, Vyankat A; Sangamesh, Sarangamath; Srivatsan, Seergazhi G

    2017-08-17

    The development of biophysical systems that enable an understanding of the structure and ligand-binding properties of G-quadruplex (GQ)-forming nucleic acid sequences in cells or models that mimic the cellular environment would be highly beneficial in advancing GQ-directed therapeutic strategies. Herein, the establishment of a biophysical platform to investigate the structure and recognition properties of human telomeric (H-Telo) DNA and RNA repeats in a cell-like confined environment by using conformation-sensitive fluorescent nucleoside probes and a widely used cellular model, bis(2-ethylhexyl) sodium sulfosuccinate reverse micelles (RMs), is described. The 2'-deoxy and ribonucleoside probes, composed of a 5-benzofuran uracil base analogue, faithfully report the aqueous micellar core through changes in their fluorescence properties. The nucleoside probes incorporated into different loops of H-Telo DNA and RNA oligonucleotide repeats are minimally perturbing and photophysically signal the formation of respective GQ structures in both aqueous buffer and RMs. Furthermore, these sensors enable a direct comparison of the binding affinity of a ligand to H-Telo DNA and RNA GQ structures in the bulk and confined environment of RMs. These results demonstrate that this combination of a GQ nucleoside probe and easy-to-handle RMs could provide new opportunities to study and devise screening-compatible assays in a cell-like environment to discover GQ binders of clinical potential. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Construction and properties of a temperature-sensitive mutation in the gene for the bacteriophage SPO1 DNA-binding protein TF1.

    PubMed

    Sayre, M H; Geiduschek, E P

    1990-08-01

    The Bacillus subtilis bacteriophage SPO1 encodes the DNA-binding protein TF1, a homolog of the ubiquitous type II DNA-binding proteins that are components of bacterial chromatin. The known three-dimensional structure of a related protein was used in devising a scheme of site-directed mutagenesis that led to the creation of a temperature-sensitive mutation in the TF1 gene. At the nonpermissive temperature, this mutation disrupted the temporal regulation of viral protein synthesis and processing, altered the kinetics of accumulation of at least one viral transcript, and prohibited the production of infective progeny phage. We suggest that TF1 function is required to shut off the expression of several early-middle and middle viral genes and that TF1 plays a role in phage head morphogenesis. Spontaneous second-site mutations of the temperature-sensitive mutant TF1 allele that suppressed its associated phenotypes were analyzed. These suppressor mutations conferred greater amino acid sequence homology with the type II DNA-binding protein from the thermophile Bacillus stearothermophilus.

  18. “Ultra-high resolution optical trap with single fluorophore sensitivity”

    PubMed Central

    Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R

    2013-01-01

    We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286

  19. Efficient DNA binding and nuclear uptake by distamycin derivatives conjugated to octa-arginine sequences.

    PubMed

    Vázquez, Olalla; Blanco-Canosa, Juan B; Vázquez, M Eugenio; Martínez-Costas, Jose; Castedo, Luis; Mascareñas, José L

    2008-11-24

    Efficient targeting of DNA by designed molecules requires not only careful fine-tuning of their DNA-recognition properties, but also appropriate cell internalization of the compounds so that they can reach the cell nucleus in a short period of time. Previous observations in our group on the relatively high affinity displayed by conjugates between distamycin derivatives and bZIP basic regions for A-rich DNA sites, led us to investigate whether the covalent attachment of a positively charged cell-penetrating peptide to a distamycin-like tripyrrole might yield high affinity DNA binders with improved cell internalization properties. Our work has led to the discovery of synthetic tripyrrole-octa-arginine conjugates that are capable of targeting specific DNA sites that contain A-rich tracts with low nanomolar affinity; they simultaneously exhibit excellent membrane and nuclear translocation properties in living HeLa cells.

  20. Simulation studies of DNA at the nanoscale: Interactions with proteins, polycations, and surfaces

    NASA Astrophysics Data System (ADS)

    Elder, Robert M.

    Understanding the nanoscale interactions of DNA, a multifunctional biopolymer with sequence-dependent properties, with other biological and synthetic substrates and molecules is essential to advancing these technologies. This doctoral thesis research is aimed at understanding the thermodynamics and molecular-level structure when DNA interacts with proteins, polycations, and functionalized surfaces. First, we investigate the ability of a DNA damage recognition protein (HMGB1a) to bind to anti-cancer drug-induced DNA damage, seeking to explain how HMGB1a differentiates between the drugs in vivo. Using atomistic molecular dynamics simulations, we show that the structure of the drug-DNA molecule exhibits drug- and base sequence-dependence that explains some of the experimentally observed differential recognition of the drugs in various sequence contexts. Then, we show how steric hindrance from the drug decreases the deformability of the drug-DNA molecule, which decreases recognition by the protein, a concept that can be applied to rational drug design. Second, we study how polycation architecture and chemistry affect polycation-DNA binding so as to design optimal polycations for high efficiency gene (DNA) delivery. Using a multiscale computational approach involving atomistic and coarse-grained simulations, we examine how rearranging polylysine from a linear to a grafted architecture, and several aspects of the grafted architecture, affect polycation-DNA binding and the structure of polycation-DNA complexes. Next, going beyond lysine we examine how oligopeptide chemistry and sequence in the grafted architecture affects polycation-DNA binding and find that strategic placement of hydrophobic peptides might be used to tailor binding strength. Third, we study the adsorption and conformations of single-stranded DNA (an amphiphilic biopolymer) on model hydrophilic and hydrophobic surfaces. Short ssDNA oligomers adsorb to both surfaces with similar strength, with the strength of adsorption to the hydrophobic surface depending on the composition of the DNA strands, i.e. purine or pyrimidine bases. Additionally, DNA-surface and DNA-water interactions near the surfaces govern the adsorption. For longer ssDNA oligomers, the effects of surface chemistry and temperature on ssDNA conformations are rather small, but either the hydrophilic surface or increased temperature favor slightly more compact conformations due to energetic and entropic effects, respectively.

  1. Conformational and mechanical changes of DNA upon transcription factor binding detected by a QCM and transmission line model.

    PubMed

    de-Carvalho, Jorge; Rodrigues, Rogério M M; Tomé, Brigitte; Henriques, Sílvia F; Mira, Nuno P; Sá-Correia, Isabel; Ferreira, Guilherme N M

    2014-04-21

    A novel quartz crystal microbalance (QCM) analytical method is developed based on the transmission line model (TLM) algorithm to analyze the binding of transcription factors (TFs) to immobilized DNA oligoduplexes. The method is used to characterize the mechanical properties of biological films through the estimation of the film dynamic shear moduli, G and G, and the film thickness. Using the Saccharomyces cerevisiae transcription factor Haa1 (Haa1DBD) as a biological model two sensors were prepared by immobilizing DNA oligoduplexes, one containing the Haa1 recognition element (HRE(wt)) and another with a random sequence (HRE(neg)) used as a negative control. The immobilization of DNA oligoduplexes was followed in real time and we show that DNA strands initially adsorb with low or non-tilting, laying flat close to the surface, which then lift-off the surface leading to final film tilting angles of 62.9° and 46.7° for HRE(wt) and HRE(neg), respectively. Furthermore we show that the binding of Haa1DBD to HRE(wt) leads to a more ordered and compact film, and forces a 31.7° bending of the immobilized HRE(wt) oligoduplex. This work demonstrates the suitability of the QCM to monitor the specific binding of TFs to immobilized DNA sequences and provides an analytical methodology to study protein-DNA biophysics and kinetics.

  2. Arginine homopeptides for plasmid DNA purification using monolithic supports.

    PubMed

    Cardoso, Sara; Sousa, Ângela; Queiroz, João A; Azzoni, Adriano R; Sousa, Fani

    2018-06-15

    Purification of plasmid DNA targeting therapeutic applications still presents many challenges, namely on supports and specific ligand development. Monolithic supports have emerged as interesting approaches for purifying pDNA due to its excellent mass transfer properties and higher binding capacity values. Moreover, arginine ligands were already described to establish specific and preferential interactions with pDNA. Additionally, some studies revealed the ability of arginine based cationic peptides to condense plasmid DNA, which increased lengthening can result in strongest interactions with higher binding capacities for chromatographic purposes of large molecules such as pDNA. In this work, arginine homopeptides were immobilized in monolithic supports and their performance was evaluated and compared with a single arginine monolithic column regarding supercoiled (sc) plasmid DNA purification. Specific interactions of arginine based peptides with several nucleic acids present in a clarified Escherichia coli lysate sample showed potential for the sc pDNA purification. Effectively, the immobilization of the arginine homopeptides became more functional compared with the single arginine amino acid, showing higher binding capacities, which was also reflected in the intensity of the interactions. The combination of structural versatilities of monoliths with the specificity of arginine peptides raised as a promising strategy for sc pDNA purification. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Electronic transport in methylated fragments of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  4. Electronic transport in methylated fragments of DNA

    NASA Astrophysics Data System (ADS)

    de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

    2015-11-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  5. DNA incision evaluation, binding investigation and biocidal screening of Cu(II), Ni(II) and Co(II) complexes with isoxazole Schiff bases.

    PubMed

    Ganji, Nirmala; Chityala, Vijay Kumar; Marri, Pradeep Kumar; Aveli, Rambabu; Narendrula, Vamsikrishna; Daravath, Sreenu; Shivaraj

    2017-10-01

    Two new series of binary metal complexes [M(L 1 ) 2 ] and [M(L 2 ) 2 ] where, M=Cu(II), Ni(II) & Co(II) and L 1 =4-((3,4-dimethylisoxazol-5-ylimino)methyl)benzene-1,3-diol; L 2 =2-((3,4-dimethylisoxazol-5-ylimino)methyl)-5-methoxyphenol were synthesized and characterized by elemental analysis, 1 H NMR, 13 C NMR, FT-IR, ESI mass, UV-Visible, magnetic moment, ESR, SEM and powder XRD studies. Based on these results, a square planar geometry is assigned for all the metal complexes where the Schiff base acts as uninegatively charged bidentate chelating agent via the hydroxyl oxygen and azomethine nitrogen atoms. DNA binding studies of all the complexes with calf thymus DNA have been comprehensively investigated using electronic absorption spectroscopy, fluorescence quenching and viscosity studies. The oxidative and photo cleavage affinity of metal complexes towards supercoiled pBR322 DNA has been ascertained by agarose gel electrophoresis assay. From the results, it is observed that all the metal complexes bind effectively to CT-DNA via an intercalative mode of binding and also cleave pBR322 DNA in a promising manner. Further the Cu(II) complexes have shown better binding and cleavage properties towards DNA. The antimicrobial activities of the Schiff bases and their metal complexes were studied on bacterial and fungal strains and the results denoted that the complexes are more potent than their Schiff base ligands. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

    PubMed

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-11-16

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. DNA/RNA binding and anticancer/antimicrobial activities of polymer-copper(II) complexes

    NASA Astrophysics Data System (ADS)

    Lakshmipraba, Jagadeesan; Arunachalam, Sankaralingam; Riyasdeen, Anvarbatcha; Dhivya, Rajakumar; Vignesh, Sivanandham; Akbarsha, Mohammad Abdulkader; James, Rathinam Arthur

    2013-05-01

    Water soluble polymer-copper(II) complexes with various degrees of coordination in the polymer chain were synthesized and characterized by elemental analysis, IR, UV-visible and EPR spectra. The DNA/RNA binding behavior of these polymer-copper(II) complexes was examined by UV-visible absorption, emission and circular dichroism spectroscopic methods, and cyclic voltammetry techniques. The binding of the polymer-copper(II) complexes with DNA/RNA was mainly through intercalation but some amount of electrostatic interaction was also observed. This binding capacity increased with the degree of coordination of the complexes. The polymer-copper(II) complex having the highest degree of coordination was subjected to analysis of cytotoxic and antimicrobial properties. The cytotoxicity study indicated that the polymer-copper(II) complexes affected the viability of MCF-7 mammary carcinoma cells, and the cells responded to the treatment with mostly through apoptosis although a few cells succumbed to necrosis. The antimicrobial screening showed activity against some human pathogens.

  8. Synthesis and characterization of azo-guanidine based alcoholic media naked eye DNA sensor

    PubMed Central

    Hashmat, Uzma; Yousaf, Muhammad; Lal, Bhajan; Ullah, Shafiq; Holder, Alvin A.; Badshah, Amin

    2016-01-01

    DNA sensing always has an open meadow of curiosity for biotechnologists and other researchers. Recently, in this field, we have introduced an emerging class of molecules containing azo and guanidine functionalities. In this study, we have synthesized three new compounds (UA1, UA6 and UA7) for potential application in DNA sensing in alcoholic medium. The synthesized materials were characterized by elemental analysis, FTIR, UV-visible, 1H NMR and 13C NMR spectroscopies. Their DNA sensing potential were investigated by UV-visible spectroscopy. The insight of interaction with DNA was further investigated by electrochemical (cyclic voltammetry) and hydrodynamic (viscosity) studies. The results showed that compounds have moderate DNA binding properties, with the binding constants range being 7.2 × 103, 2.4 × 103 and 0.2 × 103 M−1, for UA1, UA6 and UA7, respectively. Upon binding with DNA, there was a change in colour (a blue shift in the λmax value) which was observable with a naked eye. These results indicated the potential of synthesized compounds as DNA sensors with detection limit 1.8, 5.8 and 4.0 ng µl−1 for UA1, UA6 and UA7, respectively. PMID:28018613

  9. DNA-Binding Properties of African Swine Fever Virus pA104R, a Histone-Like Protein Involved in Viral Replication and Transcription.

    PubMed

    Frouco, Gonçalo; Freitas, Ferdinando B; Coelho, João; Leitão, Alexandre; Martins, Carlos; Ferreira, Fernando

    2017-06-15

    African swine fever virus (ASFV) codes for a putative histone-like protein (pA104R) with extensive sequence homology to bacterial proteins that are implicated in genome replication and packaging. Functional characterization of purified recombinant pA104R revealed that it binds to single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) over a wide range of temperatures, pH values, and salt concentrations and in an ATP-independent manner, with an estimated binding site size of about 14 to 16 nucleotides. Using site-directed mutagenesis, the arginine located in pA104R's DNA-binding domain, at position 69, was found to be relevant for efficient DNA-binding activity. Together, pA104R and ASFV topoisomerase II (pP1192R) display DNA-supercoiling activity, although none of the proteins by themselves do, indicating that the two cooperate in this process. In ASFV-infected cells, A104R transcripts were detected from 2 h postinfection (hpi) onward, reaching a maximum concentration around 16 hpi. pA104R was detected from 12 hpi onward, localizing with viral DNA replication sites and being found exclusively in the Triton-insoluble fraction. Small interfering RNA (siRNA) knockdown experiments revealed that pA104R plays a critical role in viral DNA replication and gene expression, with transfected cells showing lower viral progeny numbers (up to a reduction of 82.0%), lower copy numbers of viral genomes (-78.3%), and reduced transcription of a late viral gene (-47.6%). Taken together, our results strongly suggest that pA104R participates in the modulation of viral DNA topology, probably being involved in viral DNA replication, transcription, and packaging, emphasizing that ASFV mutants lacking the A104R gene could be used as a strategy to develop a vaccine against ASFV. IMPORTANCE Recently reintroduced in Europe, African swine fever virus (ASFV) causes a fatal disease in domestic pigs, causing high economic losses in affected countries, as no vaccine or treatment is currently available. Remarkably, ASFV is the only known mammalian virus that putatively codes for a histone-like protein (pA104R) that shares extensive sequence homology with bacterial histone-like proteins. In this study, we characterized the DNA-binding properties of pA104R, analyzed the functional importance of two conserved residues, and showed that pA104R and ASFV topoisomerase II cooperate and display DNA-supercoiling activity. Moreover, pA104R is expressed during the late phase of infection and accumulates in viral DNA replication sites, and its downregulation revealed that pA104R is required for viral DNA replication and transcription. These results suggest that pA104R participates in the modulation of viral DNA topology and genome packaging, indicating that A104R deletion mutants may be a good strategy for vaccine development against ASFV. Copyright © 2017 American Society for Microbiology.

  10. Ternary copper(II) complexes with amino acid chains and heterocyclic bases: DNA binding, cytotoxic and cell apoptosis induction properties.

    PubMed

    Ma, Tieliang; Xu, Jun; Wang, Yuan; Yu, Hao; Yang, Yong; Liu, Yang; Ding, Weiliang; Zhu, Wenjiao; Chen, Ruhua; Ge, Zhijun; Tan, Yongfei; Jia, Lei; Zhu, Taofeng

    2015-03-01

    Nowadays, chemotherapy is a common means of oncology. However, it is difficult to find excellent chemotherapy drugs. Here we reported three new ternary copper(II) complexes which have potential chemotherapy characteristics with reduced Schiff base ligand and heterocyclic bases (TBHP), [Cu(phen)(TBHP)]H2O (1), [Cu(dpz)(TBHP)]H2O (2) and [Cu(dppz)(TBHP)]H2O (3) (phen=1,10-phenanthroline, dpz=dipyrido [3,2:2',3'-f]quinoxaline, dppz=dipyrido [3,2-a:2',3'-c]phenazine, H2TBHP=2-(3,5-di-tert-butyl-2-hydroxybenzylamino)-2-benzyl-acetic acid). The DNA-binding properties of the complexes were investigated by spectrometric titrations, ethidium bromide displacement experiments and viscosity measurements. The results indicated that the three complexes, especially the complex 13, can strongly bind to calf-thymus DNA (CT-DNA). The intrinsic binding constants Kb of the ternary copper(II) complexes with CT-DNA were 1.37×10(5), 1.81×10(5) and 3.21×10(5) for 1, 2 and 3 respectively. Comparative cytotoxic activities of the copper(II) complexes were also determined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results showed that the ternary copper(II) complexes had significant cytotoxic activity against the human lung cancer (A549), human esophageal cancer (Eca109) and human gastric cancer (SGC7901) cell lines. Cell apoptosis were detected by AnnexinV/PI flow cytometry and by Western blotting with the protein expression of p53, Bax and Bcl-2. All the three copper complexes can effectively induce apoptosis of the three human tumor cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. A “Coiled-Coil” Motif Is Important for Oligomerization and DNA Binding Properties of Human Cytomegalovirus Protein UL77

    PubMed Central

    Dittmer, Alexandra; Lapp, Sara; Bogner, Elke

    2011-01-01

    Human cytomegalovirus (HCMV) UL77 gene encodes the essential protein UL77, its function is characterized in the present study. Immunoprecipitation identified monomeric and oligomeric pUL77 in HCMV infected cells. Immunostaining of purified virions and subviral fractions showed that pUL77 is a structural protein associated with capsids. In silico analysis revealed the presence of a coiled-coil motif (CCM) at the N-terminus of pUL77. Chemical cross-linking of either wild-type pUL77 or CCM deletion mutant (pUL77ΔCCM) implicated that CCM is critical for oligomerization of pUL77. Furthermore, co-immunoprecipitations of infected and transfected cells demonstrated that pUL77 interacts with the capsid-associated DNA packaging motor components, pUL56 and pUL104, as well as the major capsid protein. The ability of pUL77 to bind dsDNA was shown by an in vitro assay. Binding to certain DNA was further confirmed by an assay using biotinylated 36-, 250-, 500-, 1000-meric dsDNA and 966-meric HCMV-specific dsDNA designed for this study. The binding efficiency (BE) was determined by image processing program defining values above 1.0 as positive. While the BE of the pUL56 binding to the 36-mer bio-pac1 containing a packaging signal was 10.0±0.63, the one for pUL77 was only 0.2±0.03. In contrast to this observation the BE of pUL77 binding to bio-500 bp or bio-1000 bp was 2.2±0.41 and 4.9±0.71, respectively. By using pUL77ΔCCM it was demonstrated that this protein could not bind to dsDNA. These data indicated that pUL77 (i) could form homodimers, (ii) CCM of pUL77 is crucial for oligomerization and (iii) could bind to dsDNA in a sequence independent manner. PMID:21998635

  12. Evolutionary and biophysical relationships among the papillomavirus E2 proteins.

    PubMed

    Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael

    2009-01-01

    Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.

  13. Macroscopic modeling and simulations of supercoiled DNA with bound proteins

    NASA Astrophysics Data System (ADS)

    Huang, Jing; Schlick, Tamar

    2002-11-01

    General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.

  14. DNA Physical Properties and Nucleosome Positions Are Major Determinants of HIV-1 Integrase Selectivity

    PubMed Central

    Naughtin, Monica; Haftek-Terreau, Zofia; Xavier, Johan; Meyer, Sam; Silvain, Maud; Jaszczyszyn, Yan; Levy, Nicolas; Miele, Vincent; Benleulmi, Mohamed Salah; Ruff, Marc; Parissi, Vincent; Vaillant, Cédric; Lavigne, Marc

    2015-01-01

    Retroviral integrases (INs) catalyse the integration of the reverse transcribed viral DNA into the host cell genome. This process is selective, and chromatin has been proposed to be a major factor regulating this step in the viral life cycle. However, the precise underlying mechanisms are still under investigation. We have developed a new in vitro integration assay using physiologically-relevant, reconstituted genomic acceptor chromatin and high-throughput determination of nucleosome positions and integration sites, in parallel. A quantitative analysis of the resulting data reveals a chromatin-dependent redistribution of the integration sites and establishes a link between integration sites and nucleosome positions. The co-activator LEDGF/p75 enhanced integration but did not modify the integration sites under these conditions. We also conducted an in cellulo genome-wide comparative study of nucleosome positions and human immunodeficiency virus type-1 (HIV-1) integration sites identified experimentally in vivo. These studies confirm a preferential integration in nucleosome-covered regions. Using a DNA mechanical energy model, we show that the physical properties of DNA probed by IN binding are important in determining IN selectivity. These novel in vitro and in vivo approaches confirm that IN has a preference for integration into a nucleosome, and suggest the existence of two levels of IN selectivity. The first depends on the physical properties of the target DNA and notably, the energy required to fit DNA into the IN catalytic pocket. The second depends on the DNA deformation associated with DNA wrapping around a nucleosome. Taken together, these results indicate that HIV-1 IN is a shape-readout DNA binding protein. PMID:26075397

  15. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    USDA-ARS?s Scientific Manuscript database

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  16. Synthesis and DNA binding properties of 1-(3-aminopropyl)-imidazole-containing triamide f-Im*PyIm: a novel diamino polyamide designed to target 5'-ACGCGT-3'.

    PubMed

    Satam, Vijay; Babu, Balaji; Porte, Alexander; Savagian, Mia; Lee, Megan; Smeltzer, Thomas; Liu, Yang; Ramos, Joseph; Wilson, W David; Lin, Shicai; Kiakos, Kostantinos; Hartley, John A; Lee, Moses

    2012-09-15

    A novel diamino/dicationic polyamide f-Im(*)PyIm (5) that contains an orthogonally positioned aminopropyl chain on an imidazole (Im(*)) moiety was designed to target 5'-ACGCGT-3'. The DNA binding properties of the diamino polyamide 5, determined by CD, ΔT(M), DNase I footprinting, SPR, and ITC studies, were compared with those of its monoamino/monocationic counterpart f-ImPyIm (1) and its diamino/dicationic isomer f-ImPy(*)Im (2), which has the aminopropyl group attached to the central pyrrole unit (Py(*)). The results gave evidence for the minor groove binding and selectivity of polyamide 5 for the cognate sequence 5'-ACGCGT-3', and with strong affinity (K(eq)=2.3×10(7) M(-1)). However, the binding affinities varied according to the order: f-ImPy(*)Im (2)>f-ImPyIm (1)≥f-Im(*)PyIm (5) confirming that the second amino group can improve affinity, but its position within the polyamide can affect affinity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Nonlinear optical and G-Quadruplex DNA stabilization properties of novel mixed ligand copper(II) complexes and coordination polymers: Synthesis, structural characterization and computational studies

    NASA Astrophysics Data System (ADS)

    Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka

    2018-03-01

    The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.

  18. Conformational and thermodynamic hallmarks of DNA operator site specificity in the copper sensitive operon repressor from Streptomyces lividans

    PubMed Central

    Tan, Benedict G.; Vijgenboom, Erik; Worrall, Jonathan A. R.

    2014-01-01

    Metal ion homeostasis in bacteria relies on metalloregulatory proteins to upregulate metal resistance genes and enable the organism to preclude metal toxicity. The copper sensitive operon repressor (CsoR) family is widely distributed in bacteria and controls the expression of copper efflux systems. CsoR operator sites consist of G-tract containing pseudopalindromes of which the mechanism of operator binding is poorly understood. Here, we use a structurally characterized CsoR from Streptomyces lividans (CsoRSl) together with three specific operator targets to reveal the salient features pertaining to the mechanism of DNA binding. We reveal that CsoRSl binds to its operator site through a 2-fold axis of symmetry centred on a conserved 5′-TAC/GTA-3′ inverted repeat. Operator recognition is stringently dependent not only on electropositive residues but also on a conserved polar glutamine residue. Thermodynamic and circular dichroic signatures of the CsoRSl–DNA interaction suggest selectivity towards the A-DNA-like topology of the G-tracts at the operator site. Such properties are enhanced on protein binding thus enabling the symmetrical binding of two CsoRSl tetramers. Finally, differential binding modes may exist in operator sites having more than one 5′-TAC/GTA-3′ inverted repeat with implications in vivo for a mechanism of modular control. PMID:24121681

  19. Mechanistic Insights into Archaeal and Human Argonaute Substrate Binding and Cleavage Properties

    PubMed Central

    Willkomm, Sarah; Zander, Adrian; Grohmann, Dina; Restle, Tobias

    2016-01-01

    Argonaute (Ago) proteins from all three domains of life are key players in processes that specifically regulate cellular nucleic acid levels. Some of these Ago proteins, among them human Argonaute2 (hAgo2) and Ago from the archaeal organism Methanocaldococcus jannaschii (MjAgo), are able to cleave nucleic acid target strands that are recognised via an Ago-associated complementary guide strand. Here we present an in-depth kinetic side-by-side analysis of hAgo2 and MjAgo guide and target substrate binding as well as target strand cleavage, which enabled us to disclose similarities and differences in the mechanistic pathways as a function of the chemical nature of the substrate. Testing all possible guide-target combinations (i.e. RNA/RNA, RNA/DNA, DNA/RNA and DNA/DNA) with both Ago variants we demonstrate that the molecular mechanism of substrate association is highly conserved among archaeal-eukaryotic Argonautes. Furthermore, we show that hAgo2 binds RNA and DNA guide strands in the same fashion. On the other hand, despite striking homology between the two Ago variants, MjAgo cannot orientate guide RNA substrates in a way that allows interaction with the target DNA in a cleavage-compatible orientation. PMID:27741323

  20. Why double-stranded RNA resists condensation

    PubMed Central

    Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.

    2014-01-01

    The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663

  1. Coelenterazine-binding protein of Renilla muelleri: cDNA cloning, overexpression, and characterization as a substrate of luciferase.

    PubMed

    Titushin, Maxim S; Markova, Svetlana V; Frank, Ludmila A; Malikova, Natalia P; Stepanyuk, Galina A; Lee, John; Vysotski, Eugene S

    2008-02-01

    The Renilla bioluminescent system in vivo is comprised of three proteins--the luciferase, green-fluorescent protein, and coelenterazine-binding protein (CBP), previously called luciferin-binding protein (LBP). This work reports the cloning of the full-size cDNA encoding CBP from soft coral Renilla muelleri, its overexpression and properties of the recombinant protein. The apo-CBP was quantitatively converted to CBP by simple incubation with coelenterazine. The physicochemical properties of this recombinant CBP are determined to be practically the same as those reported for the CBP (LBP) of R. reniformis. CBP is a member of the four-EF-hand Ca(2+)-binding superfamily of proteins with only three of the EF-hand loops having the Ca(2+)-binding consensus sequences. There is weak sequence homology with the Ca(2+)-regulated photoproteins but only as a result of the necessary Ca(2+)-binding loop structure. In combination with Renilla luciferase, addition of only one Ca(2+) is sufficient to release the coelenterazine as a substrate for the luciferase for bioluminescence. This combination of the two proteins generates bioluminescence with higher reaction efficiency than using free coelenterazine alone as the substrate for luciferase. This increased quantum yield, a difference of bioluminescence spectra, and markedly different kinetics, implicate that a CBP-luciferase complex might be involved.

  2. Influence of hydroxyl groups on the biological properties of cationic polymethacrylates as gene vectors.

    PubMed

    Ma, Ming; Li, Feng; Yuan, Zhe-fan; Zhuo, Ren-xi

    2010-07-01

    In this study poly(aminoethyl methacrylate) (PAEMA), poly(3-amino-2-hydroxypropyl methacrylate) (PAHPMA), poly(2-(2-aminoethylamino)ethyl methacrylate) (PAEAEMA) and poly(3-(2-aminoethylamino) 2-hydroxypropyl methacrylate) (PAEAHPMA) were synthesized using atom transfer radical polymerization to evaluate the effect of hydroxyl groups on the relative properties of cationic polymeric gene vectors. The results of heparin displacement assays showed that PAHPMA possessed a stronger binding capacity than PAEMA. PAHPMA/DNA complexes and PAEAHPMA/DNA complexes had lower zeta potentials than those of PAEMA and PAEAEMA. MTT assay results indicated that PAHPMA and PAEAHPMA exhibited obviously lower cytotoxicities than PAEMA and PAEAEMA. Subsequently, in vitro gene transfection studies in 293T cells without serum showed that PAHPMA exhibited a lower transfection efficiency than PAEMA and PAEAHPMA/DNA complexes possessed a similar transfection efficiency to PAEAEMA/DNA complexes. Moreover, PAHPMA and PAEAHPMA retained similar transfection efficiencies in DMEM with 10% serum, but PAEMA and PAEAEMA showed slightly lower transfection efficiencies than in the absence of serum. The reason for these phenomena might be attributed to the introduction of hydroxyl groups into PAHPMA and PAEAHPMA, i.e. the existence of hydroxyl groups might increase the binding capacity to DNA and at the same time decrease the surface charge of the polymer/DNA complexes due to the formation of hydrogen bonds between the polymers and DNA. Therefore, a lower zeta potential and stronger binding ability may result in a lower gene transfection efficiency. This effect of hydroxyl groups decreased with increasing amino group density on the polymer. Copyright 2010 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  3. A novel DNA nanosensor based on CdSe/ZnS quantum dots and synthesized Fe3O4 magnetic nanoparticles.

    PubMed

    Hushiarian, Roozbeh; Yusof, Nor Azah; Abdullah, Abdul Halim; Ahmad, Shahrul Ainliah Alang; Dutse, Sabo Wada

    2014-04-09

    Although nanoparticle-enhanced biosensors have been extensively researched, few studies have systematically characterized the roles of nanoparticles in enhancing biosensor functionality. This paper describes a successful new method in which DNA binds directly to iron oxide nanoparticles for use in an optical biosensor. A wide variety of nanoparticles with different properties have found broad application in biosensors because their small physical size presents unique chemical, physical, and electronic properties that are different from those of bulk materials. Of all nanoparticles, magnetic nanoparticles are proving to be a versatile tool, an excellent case in point being in DNA bioassays, where magnetic nanoparticles are often used for optimization of the hybridization and separation of target DNA. A critical step in the successful construction of a DNA biosensor is the efficient attachment of biomolecules to the surface of magnetic nanoparticles. To date, most methods of synthesizing these nanoparticles have led to the formation of hydrophobic particles that require additional surface modifications. As a result, the surface to volume ratio decreases and nonspecific bindings may occur so that the sensitivity and efficiency of the device deteriorates. A new method of large-scale synthesis of iron oxide (Fe3O4) nanoparticles which results in the magnetite particles being in aqueous phase, was employed in this study. Small modifications were applied to design an optical DNA nanosensor based on sandwich hybridization. Characterization of the synthesized particles was carried out using a variety of techniques and CdSe/ZnS core-shell quantum dots were used as the reporter markers in a spectrofluorophotometer. We showed conclusively that DNA binds to the surface of ironoxide nanoparticles without further surface modifications and that these magnetic nanoparticles can be efficiently utilized as biomolecule carriers in biosensing devices.

  4. The Effects of Extending of Co-planarity in a Series of Structurally Relative Polypyridyl Palladium(II) Complexes on DNA-binding and Cytotoxicity Properties

    PubMed Central

    Shahraki, Somaye; Mansouri-Torshizi, Hassan; Sori Nezami, Ziba; Ghahghaei, Arezou; Yaghoubi, Fatemeh; Divsalar, Adeleh; Saboury, Ali-Akbar; H. Shirazi, Farshad

    2014-01-01

    In depth interaction studies between calf thymus deoxyribonucleic acid (CT-DNA) and a series of four structurally relative palladium(II) complexes [Pd(en)(HB)](NO3)2 (a-d), where en is ethylenediamine and heterocyclic base (HB) is 2,2'-bipyridine (bpy, a); 1,10-phenanthroline (phen, b); dipyridoquinoxaline (dpq, c) and dipyridophenazine (dppz, d) (Figure 1), were performed. These studies have been investigated by utilizing the electronic absorption spectroscopy, fluorescence spectra and ethidium bromide (EBr) displacement and gel filtration techniques. a-d complexes cooperatively bind and denature the DNA at low concentrations. Their concentration at midpoint of transition, L1/2, follows the order a >> b > c > d. Also the g, the number of binding sites per 1000 nucleotides, follows the order a >> b ~ c > d. EBr and Scatchard experiments for a-d complexes suggest efficient intercalative binding affinity to CT-DNA giving the order: d > c > b > a. Several binding and thermodynamic parameters are also described. The biological activity of these cationic and water soluble palladium complexes were tested against chronic myelogenous leukemia cell line, K562. b, c and d complexes show cytotoxic concentration (Cc50) values much lower than cisplatin. PMID:25587317

  5. Mononuclear zinc(II) complexes of 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols: Synthesis, structural characterization, DNA binding and cheminuclease activities

    NASA Astrophysics Data System (ADS)

    Ravichandran, J.; Gurumoorthy, P.; Karthick, C.; Kalilur Rahiman, A.

    2014-03-01

    Four new zinc(II) complexes [Zn(HL1-4)Cl2] (1-4), where HL1-4 = 2-((2-(piperazin-1-yl)ethylimino)methyl)-4-substituted phenols, have been isolated and fully characterized using various spectro-analytical techniques. The X-ray crystal structure of complex 4 shows the distorted trigonal-bipyramidal coordination geometry around zinc(II) ion. The crystal packing is stabilized by intermolecular NH⋯O hydrogen bonding interaction. The complexes display no d-d electronic band in the visible region due to d10 electronic configuration of zinc(II) ion. The electrochemical properties of the synthesized ligands and their complexes exhibit similar voltammogram at reduction potential due to electrochemically innocent Zn(II) ion, which evidenced that the electron transfer is due to the nature of the ligand. Binding interaction of complexes with calf thymus DNA was studied by UV-Vis absorption titration, viscometric titration and cyclic voltammetry. All complexes bind with CT DNA by intercalation, giving the binding affinity in the order of 2 > 1 ≫ 3 > 4. The prominent cheminuclease activity of complexes on plasmid DNA (pBR322 DNA) was observed in the absence and presence of H2O2. Oxidative pathway reveals that the underlying mechanism involves hydroxyl radical.

  6. Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

    PubMed Central

    Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

    2015-01-01

    CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

  7. Interaction of cholinesterase modulators with DNA and their cytotoxic activity.

    PubMed

    Janockova, Jana; Gulasova, Zuzana; Plsikova, Jana; Musilek, Kamil; Kuca, Kamil; Mikes, Jaromir; Culka, Lubomir; Fedorocko, Peter; Kozurkova, Maria

    2014-03-01

    This research was focused on a study of the binding properties of a series of cholinesterase reactivators compounds K075 (1), K027 (2) and inhibitors compounds K524, K009 and 7-MEOTA (3-5) with calf thymus DNA. The nature of the interactions between compounds 1-5 and DNA were studied using spectroscopic techniques (UV-vis, fluorescence spectroscopy and circular dichroism). The binding constants for complexes of cholinesterase modulators with DNA were determined from UV-vis spectroscopic titrations (K=0.5 × 10(4)-8.9 × 10(5)M(-1)). The ability of the prepared analogues to relax topoisomerase I was studied with electrophoretic techniques and it was proved that ligands 4 and 5 inhibited this enzyme at a concentration of 30 μM. The biological activity of the novel compounds was assessed through an examination of changes in cell cycle distribution, mitochondrial membrane potential and cellular viability. Inhibitors 3-5 exhibited a cytotoxic effect on HL-60 (human acute promyelocytic leukaemia) cell culture, demonstrated a tendency to affect mitochondrial physiology and viability, and also forced cells to accumulate in the G1/G0-phase of the cell cycle. The cholinesterase reactivators 1 and 2 were found relatively save from the point of view of DNA binding, whereas cholinesterase inhibitors 3-5 resulted as strong DNA binding agents that limit their plausible use. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Variola virus E3L Zα domain, but not its Z-DNA binding activity, is required for PKR inhibition.

    PubMed

    Thakur, Meghna; Seo, Eun Joo; Dever, Thomas E

    2014-02-01

    Responding to viral infection, the interferon-induced, double-stranded RNA (dsRNA)-activated protein kinase PKR phosphorylates translation initiation factor eIF2α to inhibit cellular and viral protein synthesis. To overcome this host defense mechanism, many poxviruses express the protein E3L, containing an N-terminal Z-DNA binding (Zα) domain and a C-terminal dsRNA-binding domain (dsRBD). While E3L is thought to inhibit PKR activation by sequestering dsRNA activators and by directly binding the kinase, the role of the Zα domain in PKR inhibition remains unclear. Here, we show that the E3L Zα domain is required to suppress the growth-inhibitory properties associated with expression of human PKR in yeast, to inhibit PKR kinase activity in vitro, and to reverse the inhibitory effects of PKR on reporter gene expression in mammalian cells treated with dsRNA. Whereas previous studies revealed that the Z-DNA binding activity of E3L is critical for viral pathogenesis, we identified point mutations in E3L that functionally uncouple Z-DNA binding and PKR inhibition. Thus, our studies reveal a molecular distinction between the nucleic acid binding and PKR inhibitory functions of the E3L Zα domain, and they support the notion that E3L contributes to viral pathogenesis by targeting PKR and other components of the cellular anti-viral defense pathway.

  9. Molecular Recognition of Azelaic Acid and Related Molecules with DNA Polymerase I Investigated by Molecular Modeling Calculations.

    PubMed

    Shawon, Jakaria; Khan, Akib Mahmud; Rahman, Adhip; Hoque, Mohammad Mazharol; Khan, Mohammad Abdul Kader; Sarwar, Mohammed G; Halim, Mohammad A

    2016-10-01

    Molecular recognition has central role on the development of rational drug design. Binding affinity and interactions are two key components which aid to understand the molecular recognition in drug-receptor complex and crucial for structure-based drug design in medicinal chemistry. Herein, we report the binding affinity and the nonbonding interactions of azelaic acid and related compounds with the receptor DNA polymerase I (2KFN). Quantum mechanical calculation was employed to optimize the modified drugs using B3LYP/6-31G(d,p) level of theory. Charge distribution, dipole moment and thermodynamic properties such as electronic energy, enthalpy and free energy of these optimized drugs are also explored to evaluate how modifications impact the drug properties. Molecular docking calculation was performed to evaluate the binding affinity and nonbonding interactions between designed molecules and the receptor protein. We notice that all modified drugs are thermodynamically more stable and some of them are more chemically reactive than the unmodified drug. Promise in enhancing hydrogen bonds is found in case of fluorine-directed modifications as well as in the addition of trifluoroacetyl group. Fluorine participates in forming fluorine bonds and also stimulates alkyl, pi-alkyl interactions in some drugs. Designed drugs revealed increased binding affinity toward 2KFN. A1, A2 and A3 showed binding affinities of -8.7, -8.6 and -7.9 kcal/mol, respectively against 2KFN compared to the binding affinity -6.7 kcal/mol of the parent drug. Significant interactions observed between the drugs and Thr358 and Asp355 residues of 2KFN. Moreover, designed drugs demonstrated improved pharmacokinetic properties. This study disclosed that 9-octadecenoic acid and drugs containing trifluoroacetyl and trifluoromethyl groups are the best 2KFN inhibitors. Overall, these results can be useful for the design of new potential candidates against DNA polymerase I.

  10. Investigations of the CLOCK and BMAL1 Proteins Binding to DNA: A Molecular Dynamics Simulation Study.

    PubMed

    Xue, Tuo; Song, Chunnian; Wang, Qing; Wang, Yan; Chen, Guangju

    2016-01-01

    The circadian locomotor output cycles kaput (CLOCK), and brain and muscle ARNT-like 1 (BMAL1) proteins are important transcriptional factors of the endogenous circadian clock. The CLOCK and BMAL1 proteins can regulate the transcription-translation activities of the clock-related genes through the DNA binding. The hetero-/homo-dimerization and DNA combination of the CLOCK and BMAL1 proteins play a key role in the positive and negative transcriptional feedback processes. In the present work, we constructed a series of binary and ternary models for the bHLH/bHLH-PAS domains of the CLOCK and BMAL1 proteins, and the DNA molecule, and carried out molecular dynamics simulations, free energy calculations and conformational analysis to explore the interaction properties of the CLOCK and BMAL1 proteins with DNA. The results show that the bHLH domains of CLOCK and BMAL1 can favorably form the heterodimer of the bHLH domains of CLOCK and BMAL1 and the homodimer of the bHLH domains of BMAL1. And both dimers could respectively bind to DNA at its H1-H1 interface. The DNA bindings of the H1 helices in the hetero- and homo-bHLH dimers present the rectangular and diagonal binding modes, respectively. Due to the function of the α-helical forceps in these dimers, the tight gripping of the H1 helices to the major groove of DNA would cause the decrease of interactions at the H1-H2 interfaces in the CLOCK and BMAL1 proteins. The additional PAS domains in the CLOCK and BMAL1 proteins affect insignificantly the interactions of the CLOCK and BMAL1 proteins with the DNA molecule due to the flexible and long loop linkers located at the middle of the PAS and bHLH domains. The present work theoretically explains the interaction mechanisms of the bHLH domains of the CLOCK and BMAL1 proteins with DNA.

  11. Heat shock of Escherichia coli increases binding of dnaK (the hsp70 homolog) to polypeptides by promoting its phosphorylation.

    PubMed Central

    Sherman, M Y; Goldberg, A L

    1993-01-01

    The "molecular chaperone", dnaK, is induced in Escherichia coli upon heat shock and promotes ATP-dependent refolding or degradation of damaged proteins. When cells were grown at 25 degrees C and disrupted, a small fraction of the dnaK bound to affinity columns containing unfolded polypeptides (e.g., a fusion protein named CRAG or casein) and could be dissociated by ATP-Mg2+. After shifting cells to 42 degrees C for 30 min, up to 5-fold more dnaK bound to these columns than after growth at 25 degrees C. This enhanced binding capacity was reversed after shifting cells back to 25 degrees C. It resulted from a covalent modification, which decreases dnaK's electrophoretic mobility and isoelectric point. This modification appears to be phosphorylation; after treatment with phosphatases, the ATP-eluted dnaK resembled the predominant form in electrophoretic and binding properties. In addition, after incubating cells with [32P]orthophosphate at 42 degrees C, the 32P-labeled dnaK bound quantitatively to the CRAG column, unlike the nonlabeled protein. Thus, the phosphorylated dnaK is a special form of the chaperone with enhanced affinity for unfolded proteins. Its accumulation at high temperatures may account for dnaK's function as the "cellular thermometer." Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8378342

  12. Focus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics

    NASA Astrophysics Data System (ADS)

    Verona, Massimiliano Donato; Verdolino, Vincenzo; Palazzesi, Ferruccio; Corradini, Roberto

    2017-02-01

    Peptide Nucleic Acids (PNAs) can efficiently target DNA or RNA acting as chemical tools for gene regulation. Their backbone modification and functionalization is often used to increase the affinity for a particular sequence improving selectivity. The understanding of the trading forces that lead the single strand PNA to bind the DNA or RNA sequence is preparatory for any further rational design, but a clear and unique description of this process is still not complete. In this paper we report further insights into this subject, by a computational investigation aiming at the characterization of the conformations of a single strand PNA and how these can be correlated to its capability in binding DNA/RNA. Employing Metadynamics we were able to better define conformational pre-organizations of the single strand PNA and γ-modified PNA otherwise unrevealed through classical molecular dynamics. Our simulations driven on backbone modified PNAs lead to the conclusion that this γ-functionalization affects the single strand preorganization and targeting properties to the DNA/RNA, in agreement with circular dichroism (CD) spectra obtained for this class of compounds. MD simulations on PNA:RNA dissociation and association mechanisms allowed to reveal the critical role of central bases and preorganization in the binding process.

  13. Focus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics.

    PubMed

    Verona, Massimiliano Donato; Verdolino, Vincenzo; Palazzesi, Ferruccio; Corradini, Roberto

    2017-02-17

    Peptide Nucleic Acids (PNAs) can efficiently target DNA or RNA acting as chemical tools for gene regulation. Their backbone modification and functionalization is often used to increase the affinity for a particular sequence improving selectivity. The understanding of the trading forces that lead the single strand PNA to bind the DNA or RNA sequence is preparatory for any further rational design, but a clear and unique description of this process is still not complete. In this paper we report further insights into this subject, by a computational investigation aiming at the characterization of the conformations of a single strand PNA and how these can be correlated to its capability in binding DNA/RNA. Employing Metadynamics we were able to better define conformational pre-organizations of the single strand PNA and γ-modified PNA otherwise unrevealed through classical molecular dynamics. Our simulations driven on backbone modified PNAs lead to the conclusion that this γ-functionalization affects the single strand preorganization and targeting properties to the DNA/RNA, in agreement with circular dichroism (CD) spectra obtained for this class of compounds. MD simulations on PNA:RNA dissociation and association mechanisms allowed to reveal the critical role of central bases and preorganization in the binding process.

  14. Effect of the cyclobutane cytidine dimer on the properties of Escherichia coli DNA photolyase.

    PubMed

    Murphy, Anar K; Tammaro, Margaret; Cortazar, Frank; Gindt, Yvonne M; Schelvis, Johannes P M

    2008-11-27

    Cyclobutane pyrimidine dimer (CPD) photolyases are structure specific DNA-repair enzymes that specialize in the repair of CPDs, the major photoproducts that are formed upon irradiation of DNA with ultraviolet light. The purified enzyme binds a flavin adenine dinucleotide (FAD), which is in the neutral radical semiquinone (FADH(*)) form. The CPDs are repaired by a light-driven, electron transfer from the anionic hydroquinone (FADH(-)) singlet excited state to the CPD, which is followed by reductive cleavage of the cyclobutane ring and subsequent monomerization of the pyrimidine bases. CPDs formed between two adjacent thymidine bases (T< >T) are repaired with greater efficiency than those formed between two adjacent cytidine bases (C< >C). In this paper, we investigate the changes in Escherichia coli photolyase that are induced upon binding to DNA containing C< >C lesions using resonance Raman, UV-vis absorption, and transient absorption spectroscopies, spectroelectrochemistry, and computational chemistry. The binding of photolyase to a C< >C lesion modifies the energy levels of FADH(*), the rate of charge recombination between FADH(-) and Trp(306)(*), and protein-FADH(*) interactions differently than binding to a T< >T lesion. However, the reduction potential of the FADH(-)/FADH(*) couple is modified in the same way with both substrates. Our calculations show that the permanent electric dipole moment of C< >C is stronger (12.1 D) and oriented differently than that of T< >T (8.7 D). The possible role of the electric dipole moment of the CPD in modifying the physicochemical properties of photolyase as well as in affecting CPD repair will be discussed.

  15. Implications of the dependence of the elastic properties of DNA on nucleotide sequence.

    PubMed

    Olson, Wilma K; Swigon, David; Coleman, Bernard D

    2004-07-15

    Recent advances in structural biochemistry have provided evidence that not only the geometric properties but also the elastic moduli of duplex DNA are strongly dependent on nucleotide sequence in a way that is not accounted for by classical rod models of the Kirchhoff type. A theory of sequence-dependent DNA elasticity is employed here to calculate the dependence of the equilibrium configurations of circular DNA on the binding of ligands that can induce changes in intrinsic twist at a single base-pair step. Calculations are presented of the influence on configurations of the assumed values and distribution along the DNA of intrinsic roll and twist and a modulus coupling roll to twist. Among the results obtained are the following. For minicircles formed from intrinsically straight DNA, the distribution of roll-twist coupling strongly affects the dependence of the total elastic energy Psi on the amount alpha of imposed untwisting, and that dependence can be far from quadratic. (In fact, for a periodic distribution of roll-twist coupling with a period equal to the intrinsic helical repeat length, Psi can be essentially independent of alpha for -90 degrees < alpha <90 degrees.) When the minicircle is homogeneous and without roll-twist coupling, but with uniform positive intrinsic roll, the point at which Psi attains its minimum value shifts towards negative values of alpha. It is remarked that there are cases in which one can relate graphs of Psi versus alpha to the 'effective values' of bending and twisting moduli and helical repeat length obtained from measurements of equilibrium distributions of topoisomers and probabilities of ring closure. For a minicircle formed from DNA that has an 'S' shape when stress-free, the graphs of Psi versus alpha have maxima at alpha = 0. As the binding of a twisting agent to such a minicircle results in a net decrease in Psi, the affinity of the twisting agent for binding to the minicircle is greater than its affinity for binding to unconstrained DNA with the same sequence.

  16. SA1 and TRF1 synergistically bind to telomeric DNA and promote DNA-DNA pairing

    NASA Astrophysics Data System (ADS)

    Wang, Hong; Lin, Jiangguo; Countryman, Preston; Pan, Hai; Parminder Kaur Team; Robert Riehn Team; Patricia Opresko Team; Jane Tao Team; Susan Smith Team

    Impaired telomere cohesion leads to increased aneuploidy and early onset of tumorigenesis. Cohesion is thought to occur through the entrapment of two DNA strands within tripartite cohesin ring(s), along with a fourth subunit (SA1/SA2). Surprisingly, cohesion rings are not essential for telomere cohesion, which instead requires SA1 and shelterin proteins including TRF1. However, neither this unique cohesion mechanism at telomeres or DNA-binding properties of SA1 is understood. Here, using single-molecule fluorescence imaging of quantum dot-labeled proteins on DNA we discover that while SA1 diffuses across multiple telomeric and non-telomeric regions, the diffusion mediated through its N-terminal domain is slower at telomeric regions. However, addition of TRF1 traps SA1 within telomeric regions, which form longer DNA-DNA pairing tracts than with TRF1 alone, as revealed by atomic force microscopy. Together, these experimental results and coarse-grained molecular dynamics simulations suggest that TRF1 and SA1 synergistically interact with DNA to support telomere cohesion without cohesin rings.

  17. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization.

  18. Characterization and modification of phage T7 DNA polymerase for use in DNA sequencing; Progress report, June 1, 1990--May 31, 1993

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Richardson, C.C.

    1993-12-31

    This project focuses on the DNA polymerase (gene 5 protein) of phage T7 for use in DNA sequence analysis. Gene 5 protein interacts with accessory proteins to acquire properties essential for DNA replication. One goal is to understand these interactions in order to modify the proteins for use in DNA sequencing. E. coli thioredoxin, binds to gene 5 protein and clamps it to a primer-template. They have analyzed the binding of gene 5 protein-thioredoxin to primer-templates and have defined the optimal conditions to form an extremely stable complex with a dNTP in the polymerase catalytic site. The spatial proximity ofmore » these components has been determined using fluorescence emission anisotropy. The T7 DNA binding protein, the gene 2.5 protein, interacts with gene 5 protein and gene 4 protein to increase processivity and primer synthesis, respectively. Mutant gene 2.5 proteins have been isolated that do not interact with T7 DNA polymerase and can not support T7 growth. The nucleotide binding site of the T7 helicase has been identified and mutations affecting the site provide information on how the hydrolysis of NTPs fuel its unidirectional translocation. The sequence, GTC, has been shown to be necessary and sufficient for recognition by the T7 primase. The T7 gene 5.5 protein interacts with the E. coli nucleoid protein, H-NS, and also overcomes the phage {lambda} rex restriction system.« less

  19. Sedimentation properties in density gradients correspond with levels of sperm DNA fragmentation, chromatin compaction and binding affinity to hyaluronic acid.

    PubMed

    Torabi, Forough; Binduraihem, Adel; Miller, David

    2017-03-01

    Mature spermatozoa bind hyaluronic acid in the extracellular matrix via hyaladherins. Immature spermatozoa may be unable to interact because they do not express the appropriate hyaladherins on their surface. Fresh human semen samples were fractionated using differential density gradient centrifugation (DDGC) and the ability of these fractions to bind hyaluronic acid was evaluated. The presence of sperm hyaladherins was also assessed. CD44 was located mainly on the acrosome and equatorial segment and became more restricted to the equatorial segment in capacitated spermatozoa. Hyaluronic acid-TRITC (hyaluronic acid conjugated with tetramethylrhodamine isothiocyanante), a generic hyaluronic-acid-binding reagent, labelled the membrane and the neck region, particularly after capacitation. Sperm populations obtained after DDGC or after interaction with hyaluronic acid were assessed for DNA fragmentation and chromatin maturity. Strong relationships between both measures and sperm sedimentation and hyaluronic-acid-binding profiles were revealed. Capacitation enhanced hyaluronic acid binding of both DDGC-pelleted sperm and sperm washed free of seminal fluid. In conclusion, hyaladherins were detected on human sperm and a higher capacity for sperm hyaluronic-acid-binding was shown to correspond with their DDGC sedimentation profiles and with lower levels of DNA fragmentation and better chromatin maturity. Capacitation induced changes in the distribution and presence of hyaladherins may enhance hyaluronic-acid-binding. Copyright © 2016 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  20. Cytotoxic activity of proflavine diureas: synthesis, antitumor, evaluation and DNA binding properties of 1',1''-(acridin-3,6-diyl)-3',3''-dialkyldiureas.

    PubMed

    Kozurková, Mária; Sabolová, Danica; Janovec, Ladislav; Mikes, Jaromír; Koval', Ján; Ungvarský, Ján; Stefanisinová, Miroslava; Fedorocko, Peter; Kristian, Pavol; Imrich, Ján

    2008-04-01

    The synthesis of novel 1',1''-(acridin-3,6-diyl)-3',3''-dialkyldiureas was reported. Their biological activity to inhibit cell proliferation was assessed by a MTT assay on two cell lines, HeLa and HCT-116, at micromolar concentration. 1',1''-(Acridin-3,6-diyl)-3',3''-dihexyldiurea hydrochloride was active on a HCT-116 cell line with an IC(50) value of 3.1 microM. The interaction of these compounds with calf thymus DNA was investigated by a variety of spectroscopic techniques including UV-vis, fluorescence and CD spectroscopy. From spectrofluorimetric titrations, binding constants for the DNA-drug complexes were determined (K=0.9-4.2x10(5) M(-1)). Antiproliferative activity of synthesized derivatives might be related to their intercalation into DNA.

  1. Structure and Biophysics of CBFβ/RUNX and Its Translocation Products.

    PubMed

    Tahirov, Tahir H; Bushweller, John

    2017-01-01

    The core binding factor (CBF) transcription factor is somewhat unique in that it is composed of a DNA binding RUNX subunit (RUNX1, 2, or 3) and a non-DNA binding CBFβ subunit, which modulates RUNX protein activity by modulating the auto-inhibition of the RUNX subunits. Since the discovery of this fascinating transcription factor more than 20 years ago, there has been a robust effort to characterize the structure as well as the biochemical properties of CBF. More recently, these efforts have also extended to the fusion proteins that arise from the subunits of CBF in leukemia. This chapter highlights the work of numerous labs which has provided a detailed understanding of the structure and function of this transcription factor and its fusion proteins.

  2. Analysis of Oligonucleotide DNA Binding and Sedimentation Properties of Montmorillonite Clay Using Ultraviolet Light Spectroscopy

    PubMed Central

    Beall, Gary W.; Sowersby, Drew S.; Roberts, Rachel D.; Robson, Michael H.; Lewis, L. Kevin

    2009-01-01

    Smectite clays such as montmorillonite form complexes with a variety of biomolecules, including the nucleic acids DNA and RNA. Most previous studies of DNA adsorption onto clay have relied upon spectrophotometric analysis after separation of free nucleic acids from bound complexes by centrifugation. In the current work we demonstrate that such studies produce a consistent error due to (a) incomplete sedimentation of montmorillonite and (b) strong absorbance of the remaining clay at 260 nm. Clay sedimentation efficiency was strongly dependent upon cation concentration (Na+ or Mg2+) and on the level of dispersion of the original suspension. An improved clay:DNA adsorption assay was developed and utilized to assess the impact of metal counterions on binding of single-stranded DNA to montmorillonite. X-ray diffraction demonstrated, for the first time, formation of intercalated structures consistent with orientation of the DNA strands parallel to the clay surface. Observed gallery spacings were found to closely match values calculated utilizing atomistic modeling techniques. PMID:19061334

  3. DNA damage may drive nucleosomal reorganization to facilitate damage detection

    NASA Astrophysics Data System (ADS)

    LeGresley, Sarah E.; Wilt, Jamie; Antonik, Matthew

    2014-03-01

    One issue in genome maintenance is how DNA repair proteins find lesions at rates that seem to exceed diffusion-limited search rates. We propose a phenomenon where DNA damage induces nucleosomal rearrangements which move lesions to potential rendezvous points in the chromatin structure. These rendezvous points are the dyad and the linker DNA between histones, positions in the chromatin which are more likely to be accessible by repair proteins engaged in a random search. The feasibility of this mechanism is tested by considering the statistical mechanics of DNA containing a single lesion wrapped onto the nucleosome. We consider lesions which make the DNA either more flexible or more rigid by modeling the lesion as either a decrease or an increase in the bending energy. We include this energy in a partition function model of nucleosome breathing. Our results indicate that the steady state for a breathing nucleosome will most likely position the lesion at the dyad or in the linker, depending on the energy of the lesion. A role for DNA binding proteins and chromatin remodelers is suggested based on their ability to alter the mechanical properties of the DNA and DNA-histone binding, respectively. We speculate that these positions around the nucleosome potentially serve as rendezvous points where DNA lesions may be encountered by repair proteins which may be sterically hindered from searching the rest of the nucleosomal DNA. The strength of the repositioning is strongly dependent on the structural details of the DNA lesion and the wrapping and breathing of the nucleosome. A more sophisticated evaluation of this proposed mechanism will require detailed information about breathing dynamics, the structure of partially wrapped nucleosomes, and the structural properties of damaged DNA.

  4. High-resolution biophysical analysis of the dynamics of nucleosome formation

    PubMed Central

    Hatakeyama, Akiko; Hartmann, Brigitte; Travers, Andrew; Nogues, Claude; Buckle, Malcolm

    2016-01-01

    We describe a biophysical approach that enables changes in the structure of DNA to be followed during nucleosome formation in in vitro reconstitution with either the canonical “Widom” sequence or a judiciously mutated sequence. The rapid non-perturbing photochemical analysis presented here provides ‘snapshots’ of the DNA configuration at any given moment in time during nucleosome formation under a very broad range of reaction conditions. Changes in DNA photochemical reactivity upon protein binding are interpreted as being mainly induced by alterations in individual base pair roll angles. The results strengthen the importance of the role of an initial (H3/H4)2 histone tetramer-DNA interaction and highlight the modulation of this early event by the DNA sequence. (H3/H4)2 binding precedes and dictates subsequent H2A/H2B-DNA interactions, which are less affected by the DNA sequence, leading to the final octameric nucleosome. Overall, our results provide a novel, exciting way to investigate those biophysical properties of DNA that constitute a crucial component in nucleosome formation and stabilization. PMID:27263658

  5. Identification and Characterization of the UL37 Protein of Herpes Simplex Virus Type 1 and Demonstration that it Interacts with ICP8, the Major DNA Binding Protein of Herpes Simplex Virus

    DTIC Science & Technology

    1992-10-20

    Identification of ORFs HSV DNA binding proteins • 1 3 3 5 7 7 11 17 18 22 reps and its role in HSV replication 23 Biochemical properties . . 23...Figure 1 . 2. 3 • 4. 5. 6. 7. 8. Structural model of the herpesvirus virion Schematic diagram of HSV pathogenesis . Diagram of the main...vaccinia virus- 13. Autoradiogram of an immunoblot of HSV - 1 -infected cell proteins harvested at various times postinfec- 85 tioD probed with anti-UL42

  6. Synthesis Characterization and DNA Interaction Studies of a New Zn(II) Complex Containing Different Dinitrogen Aromatic Ligands

    PubMed Central

    Shahabadi, Nahid; Mohammadi, Somaye

    2012-01-01

    A mononuclear complex of Zn(II), [Zn(DIP)2 (DMP)] (NO3)2 ·2H2O in which DIP is 4,7-diphenyl-1,10-phenanthroline and DMP is 4,4′-dimethyl-2,2′-bipyridine has been prepared and characterized by 1HNMR spectroscopy, FT-IR, UV-Vis and elemental analysis techniques. DNA-binding properties of the complex were studied using UV-vis spectra, circular dichroism (CD) spectra, fluorescence, cyclic voltammetry (CV), and viscosity measurements. The results indicate that this zinc(II) complex can intercalate into the stacked base pairs of DNA and compete with the strong intercalator ethidium bromide for the intercalative binding sites. PMID:22956919

  7. Structural and Functional Basis for an EBNA1 Hexameric Ring in Epstein-Barr Virus Episome Maintenance.

    PubMed

    Deakyne, Julianna S; Malecka, Kimberly A; Messick, Troy E; Lieberman, Paul M

    2017-10-01

    Epstein-Barr virus (EBV) establishes a stable latent infection that can persist for the life of the host. EBNA1 is required for the replication, maintenance, and segregation of the latent episome, but the structural features of EBNA1 that confer each of these functions are not completely understood. Here, we have solved the X-ray crystal structure of an EBNA1 DNA-binding domain (DBD) and discovered a novel hexameric ring oligomeric form. The oligomeric interface pivoted around residue T585 as a joint that links and stabilizes higher-order EBNA1 complexes. Substitution mutations around the interface destabilized higher-order complex formation and altered the cooperative DNA-binding properties of EBNA1. Mutations had both positive and negative effects on EBNA1-dependent DNA replication and episome maintenance with OriP. We found that one naturally occurring polymorphism in the oligomer interface (T585P) had greater cooperative DNA binding in vitro , minor defects in DNA replication, and pronounced defects in episome maintenance. The T585P mutant was compromised for binding to OriP in vivo as well as for assembling the origin recognition complex subunit 2 (ORC2) and trimethylated histone 3 lysine 4 (H3K4me3) at OriP. The T585P mutant was also compromised for forming stable subnuclear foci in living cells. These findings reveal a novel oligomeric structure of EBNA1 with an interface subject to naturally occurring polymorphisms that modulate EBNA1 functional properties. We propose that EBNA1 dimers can assemble into higher-order oligomeric structures important for diverse functions of EBNA1. IMPORTANCE Epstein-Barr virus is a human gammaherpesvirus that is causally associated with various cancers. Carcinogenic properties are linked to the ability of the virus to persist in the latent form for the lifetime of the host. EBNA1 is a sequence-specific DNA-binding protein that is consistently expressed in EBV tumors and is the only viral protein required to maintain the viral episome during latency. The structural and biochemical mechanisms by which EBNA1 allows the long-term persistence of the EBV genome are currently unclear. Here, we have solved the crystal structure of an EBNA1 hexameric ring and characterized key residues in the interface required for higher-order complex formation and long-term plasmid maintenance. Copyright © 2017 American Society for Microbiology.

  8. An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

    PubMed

    Lee, C K; Knipe, D M

    1985-06-01

    An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

  9. Exploring DNA binding and nucleolytic activity of few 4-aminoantipyrine based amino acid Schiff base complexes: A comparative approach

    NASA Astrophysics Data System (ADS)

    Raman, N.; Sakthivel, A.; Pravin, N.

    A series of novel Co(II), Cu(II), Ni(II) and Zn(II) complexes were synthesized from Schiff base(s), obtained by the condensation of 4-aminoantipyrine with furfural and amino acid (glycine(L1)/alanine(L2)/valine(L3)) and respective metal(II) chloride. Their structural features and other properties were explored from the analytical and spectral methods. The binding behaviors of the complexes to calf thymus DNA were investigated by absorption spectra, viscosity measurements and cyclic voltammetry. The intrinsic binding constants for the above synthesized complexes are found to be in the order of 102 to 105 indicating that most of the synthesized complexes are good intercalators. The binding constant values (Kb) clearly indicate that valine Schiff-base complexes have more intercalating ability than alanine and glycine Schiff-base complexes. The results indicate that the complexes bind to DNA through intercalation and act as efficient cleaving agents. The in vitro antibacterial and antifungal assay indicates that these complexes are good antimicrobial agents against various pathogens. The IC50 values of [Ni(L1)2] and [Zn(L1)2] complexes imply that these complexes have preferable ability to scavenge hydroxyl radical.

  10. Novel water soluble morpholine substituted Zn(II) phthalocyanine: Synthesis, characterization, DNA/BSA binding, DNA photocleavage and topoisomerase I inhibition.

    PubMed

    Barut, Burak; Demirbaş, Ümit; Özel, Arzu; Kantekin, Halit

    2017-12-01

    In this study, novel peripherally tetra 3-morpholinophenol substituted zinc(II) phthalocyanine (4) and its water soluble form quaternized zinc(II) phthalocyanine (ZnQ) were synthesized for the first time. These novel compounds were characterized by a combination of different spectroscopic techniques such as FT-IR, 1 H NMR, 13 C NMR, UV-vis and mass. The DNA binding of ZnQ was investigated using UV-vis absorption titration, competitive ethidium bromide, thermal denaturation and viscosity experiments that the ZnQ bound to CT-DNA via intercalation mode. ZnQ indicated photocleavage activity on supercoiled pBR322 plasmid DNA via formation of singlet oxygen under irradiation at 700nm. Besides, the topoisomerase I inhibitory effect experiments showed that ZnQ inhibited topoisomerase I enzyme in a concentration-dependent manner. The bovine serum albumin (BSA) binding experiments indicated that ZnQ bound to proteins through a static quenching mechanism. All of these results claim that ZnQ has potential agent for photodynamic therapy owing to its nucleic acid interactions and photobiological or photochemical properties. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Helix–hairpin–helix motifs confer salt resistance and processivity on chimeric DNA polymerases

    PubMed Central

    Pavlov, Andrey R.; Belova, Galina I.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

    2002-01-01

    Helix–hairpin–helix (HhH) is a widespread motif involved in sequence-nonspecific DNA binding. The majority of HhH motifs function as DNA-binding modules with typical occurrence of one HhH motif or one or two (HhH)2 domains in proteins. We recently identified 24 HhH motifs in DNA topoisomerase V (Topo V). Although these motifs are dispensable for the topoisomerase activity of Topo V, their removal narrows the salt concentration range for topoisomerase activity tenfold. Here, we demonstrate the utility of Topo V's HhH motifs for modulating DNA-binding properties of the Stoffel fragment of TaqDNA polymerase and Pfu DNA polymerase. Different HhH cassettes fused with either NH2 terminus or COOH terminus of DNA polymerases broaden the salt concentration range of the polymerase activity significantly (up to 0.5 M NaCl or 1.8 M potassium glutamate). We found that anions play a major role in the inhibition of DNA polymerase activity. The resistance of initial extension rates and the processivity of chimeric polymerases to salts depend on the structure of added HhH motifs. Regardless of the type of the construct, the thermal stability of chimeric Taq polymerases increases under the optimal ionic conditions, as compared with that of TaqDNA polymerase or its Stoffel fragment. Our approach to raise the salt tolerance, processivity, and thermostability of Taq and Pfu DNA polymerases may be applied to all pol1- and polB-type polymerases, as well as to other DNA processing enzymes. PMID:12368475

  12. Binding mechanisms of DNA/RNA nucleobases adsorbed on graphene under charging: first-principles van der Waals study

    NASA Astrophysics Data System (ADS)

    Gürel, Hikmet Hakan; Salmankurt, Bahadır

    2017-06-01

    Graphene is a 2D material that has attracted much attention due to its outstanding properties. Because of its high surface area and unique chemical and physical properties, graphene is a good candidate for biological applications. For this reason, a deep understanding of the mechanism of interaction of graphene with biomolecules is required. In this study, theoretical investigation of van der Waals effects has been conducted using density functional theory. Here we show that the order of the binding energies of five nucleobases with graphene is G  >  A  >  T  >  C  >   U. This trend is in good agreement with most of the theoretical and experimental data. Also, the effects of charging on the electronic and structural properties of the graphene-nucleubase systems are studied for the first time. We show that the binding energy can be changed by adding or removing an electron from the system. The results presented in this work provide fundamental insights into the quantum interactions of DNA with carbon-based nanostructures and will be useful for developments in biotechnology and nanotechnology.

  13. Statistical-Mechanical Studies of the Collective Binding of Proteins to DNA

    NASA Astrophysics Data System (ADS)

    Zhang, Houyin

    My dissertation work focuses on the microscopic statistical-mechanical studies of DNA-protein interactions and mainly comprises of three projects. In living cells, binding of proteins to DNA controls gene expression and packaging of the genome. Single-DNA stretching and twisting experiments provide a powerful tool to detect binding of proteins, via detection of their modification of DNA mechanical properties. However, it is often difficult or impossible to determine the numbers of proteins bound in such experiments, especially when the proteins interact nonspecifically with DNA. In the first project, we developed single-molecule versions of classical thermodynamic Maxwell relations and proposed that these relations could be used to measure DNA-bound protein numbers, changes in DNA double-helix torque with force, and many other quantities which are hard to directly measure. This approach does not need any theoretical assumptions beyond the existence of thermodynamic equilibrium and has been used in single-DNA experiments. Many single-molecule experiments associated with DNA-bending proteins suggest the existence of cooperative interactions between adjacent DNA-bound proteins. In the second project, we studied a statistical-mechanical worm-like chain model including binding cooperativity effects and found that the intrinsic cooperativity of binding sharpens force-extension curves and causes enhancement of fluctuation of extension and protein occupation. This model also allows us to estimate the intrinsic cooperativity in experiments. We also analyzed force-generated cooperativity and found that the related interaction between proteins is always attractive. This suggests that tension in DNA in vivo could alter the distribution of proteins bound along DNA, causing chromosome refolding, or changes in gene expression. In the third project, we investigated the correlations along DNA-protein complexes. We found there are two different correlation lengths corrected to the geometry of DNA bending - the shorter “longitudinal” correlation length ξ∥(f, μ) and the longer “transverse” correlation length ξ⊥( f, μ). In the high-force limit, ξ∥(f, μ) = ξ⊥(f, μ)/2 = A/4bf . Surprisingly, the range of the interaction between DNA-bending proteins is controlled by the second-longest correlation length. The effect arises from the protein-bend contribution to the Hamiltonian having an axial rotational symmetry which eliminates its coupling to the transverse bending fluctuations.

  14. Plasmodium falciparum Nucleosomes Exhibit Reduced Stability and Lost Sequence Dependent Nucleosome Positioning

    PubMed Central

    Silberhorn, Elisabeth; Schwartz, Uwe; Symelka, Anne; de Koning-Ward, Tania; Längst, Gernot

    2016-01-01

    The packaging and organization of genomic DNA into chromatin represents an additional regulatory layer of gene expression, with specific nucleosome positions that restrict the accessibility of regulatory DNA elements. The mechanisms that position nucleosomes in vivo are thought to depend on the biophysical properties of the histones, sequence patterns, like phased di-nucleotide repeats and the architecture of the histone octamer that folds DNA in 1.65 tight turns. Comparative studies of human and P. falciparum histones reveal that the latter have a strongly reduced ability to recognize internal sequence dependent nucleosome positioning signals. In contrast, the nucleosomes are positioned by AT-repeat sequences flanking nucleosomes in vivo and in vitro. Further, the strong sequence variations in the plasmodium histones, compared to other mammalian histones, do not present adaptations to its AT-rich genome. Human and parasite histones bind with higher affinity to GC-rich DNA and with lower affinity to AT-rich DNA. However, the plasmodium nucleosomes are overall less stable, with increased temperature induced mobility, decreased salt stability of the histones H2A and H2B and considerable reduced binding affinity to GC-rich DNA, as compared with the human nucleosomes. In addition, we show that plasmodium histone octamers form the shortest known nucleosome repeat length (155bp) in vitro and in vivo. Our data suggest that the biochemical properties of the parasite histones are distinct from the typical characteristics of other eukaryotic histones and these properties reflect the increased accessibility of the P. falciparum genome. PMID:28033404

  15. DNA stabilization at the Bacillus subtilis PolX core—a binding model to coordinate polymerase, AP-endonuclease and 3′-5′ exonuclease activities

    PubMed Central

    Baños, Benito; Villar, Laurentino; Salas, Margarita; de Vega, Miguel

    2012-01-01

    Family X DNA polymerases (PolXs) are involved in DNA repair. Their binding to gapped DNAs relies on two conserved helix-hairpin-helix motifs, one located at the 8-kDa domain and the other at the fingers subdomain. Bacterial/archaeal PolXs have a specifically conserved third helix-hairpin-helix motif (GFGxK) at the fingers subdomain whose putative role in DNA binding had not been established. Here, mutagenesis at the corresponding residues of Bacillus subtilis PolX (PolXBs), Gly130, Gly132 and Lys134 produced enzymes with altered DNA binding properties affecting the three enzymatic activities of the protein: polymerization, located at the PolX core, 3′-5′ exonucleolysis and apurinic/apyrimidinic (AP)-endonucleolysis, placed at the so-called polymerase and histidinol phosphatase domain. Furthermore, we have changed Lys192 of PolXBs, a residue moderately conserved in the palm subdomain of bacterial PolXs and immediately preceding two catalytic aspartates of the polymerization reaction. The results point to a function of residue Lys192 in guaranteeing the right orientation of the DNA substrates at the polymerization and histidinol phosphatase active sites. The results presented here and the recently solved structures of other bacterial PolX ternary complexes lead us to propose a structural model to account for the appropriate coordination of the different catalytic activities of bacterial PolXs. PMID:22844091

  16. Architecture of TAF11/TAF13/TBP complex suggests novel regulation properties of general transcription factor TFIID

    PubMed Central

    Gupta, Kapil; Watson, Aleksandra A; Baptista, Tiago; Scheer, Elisabeth; Chambers, Anna L; Koehler, Christine; Zou, Juan; Obong-Ebong, Ima; Kandiah, Eaazhisai; Temblador, Arturo; Round, Adam; Forest, Eric; Man, Petr; Bieniossek, Christoph; Laue, Ernest D; Lemke, Edward A; Rappsilber, Juri; Robinson, Carol V; Devys, Didier

    2017-01-01

    General transcription factor TFIID is a key component of RNA polymerase II transcription initiation. Human TFIID is a megadalton-sized complex comprising TATA-binding protein (TBP) and 13 TBP-associated factors (TAFs). TBP binds to core promoter DNA, recognizing the TATA-box. We identified a ternary complex formed by TBP and the histone fold (HF) domain-containing TFIID subunits TAF11 and TAF13. We demonstrate that TAF11/TAF13 competes for TBP binding with TATA-box DNA, and also with the N-terminal domain of TAF1 previously implicated in TATA-box mimicry. In an integrative approach combining crystal coordinates, biochemical analyses and data from cross-linking mass-spectrometry (CLMS), we determine the architecture of the TAF11/TAF13/TBP complex, revealing TAF11/TAF13 interaction with the DNA binding surface of TBP. We identify a highly conserved C-terminal TBP-interaction domain (CTID) in TAF13, which is essential for supporting cell growth. Our results thus have implications for cellular TFIID assembly and suggest a novel regulatory state for TFIID function. PMID:29111974

  17. Cooperative DNA binding and protein/DNA fiber formation increases the activity of the Dnmt3a DNA methyltransferase.

    PubMed

    Emperle, Max; Rajavelu, Arumugam; Reinhardt, Richard; Jurkowska, Renata Z; Jeltsch, Albert

    2014-10-24

    The Dnmt3a DNA methyltransferase has been shown to bind cooperatively to DNA and to form large multimeric protein/DNA fibers. However, it has also been reported to methylate DNA in a processive manner, a property that is incompatible with protein/DNA fiber formation. We show here that the DNA methylation rate of Dnmt3a increases more than linearly with increasing enzyme concentration on a long DNA substrate, but not on a short 30-mer oligonucleotide substrate. We also show that addition of a catalytically inactive Dnmt3a mutant, which carries an amino acid exchange in the catalytic center, increases the DNA methylation rate by wild type Dnmt3a on the long substrate but not on the short one. In agreement with this finding, preincubation experiments indicate that stable protein/DNA fibers are formed on the long, but not on the short substrate. In addition, methylation experiments with substrates containing one or two CpG sites did not provide evidence for a processive mechanism over a wide range of enzyme concentrations. These data clearly indicate that Dnmt3a binds to DNA in a cooperative reaction and that the formation of stable protein/DNA fibers increases the DNA methylation rate. Fiber formation occurs at low μm concentrations of Dnmt3a, which are in the range of Dnmt3a concentrations in the nucleus of embryonic stem cells. Understanding the mechanism of Dnmt3a is of vital importance because Dnmt3a is a hotspot of somatic cancer mutations one of which has been implicated in changing Dnmt3a processivity. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Heterodimerization of Msx and Dlx homeoproteins results in functional antagonism.

    PubMed

    Zhang, H; Hu, G; Wang, H; Sciavolino, P; Iler, N; Shen, M M; Abate-Shen, C

    1997-05-01

    Protein-protein interactions are known to be essential for specifying the transcriptional activities of homeoproteins. Here we show that representative members of the Msx and Dlx homeoprotein families form homo- and heterodimeric complexes. We demonstrate that dimerization by Msx and Dlx proteins is mediated through their homeodomains and that the residues required for this interaction correspond to those necessary for DNA binding. Unlike most other known examples of homeoprotein interactions, association of Msx and Dlx proteins does not promote cooperative DNA binding; instead, dimerization and DNA binding are mutually exclusive activities. In particular, we show that Msx and Dlx proteins interact independently and noncooperatively with homeodomain DNA binding sites and that dimerization is specifically blocked by the presence of such DNA sites. We further demonstrate that the transcriptional properties of Msx and Dlx proteins display reciprocal inhibition. Specifically, Msx proteins act as transcriptional repressors and Dlx proteins act as activators, while in combination, Msx and Dlx proteins counteract each other's transcriptional activities. Finally, we show that the expression patterns of representative Msx and Dlx genes (Msx1, Msx2, Dlx2, and Dlx5) overlap in mouse embryogenesis during limb bud and craniofacial development, consistent with the potential for their protein products to interact in vivo. Based on these observations, we propose that functional antagonism through heterodimer formation provides a mechanism for regulating the transcriptional actions of Msx and Dlx homeoproteins in vivo.

  19. Physical signals for protein-DNA recognition

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2009-09-01

    This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.

  20. Functional interactions of nucleocapsid protein of feline immunodeficiency virus and cellular prion protein with the viral RNA.

    PubMed

    Moscardini, Mila; Pistello, Mauro; Bendinelli, M; Ficheux, Damien; Miller, Jennifer T; Gabus, Caroline; Le Grice, Stuart F J; Surewicz, Witold K; Darlix, Jean-Luc

    2002-04-19

    All lentiviruses and oncoretroviruses examined so far encode a major nucleic-acid binding protein (nucleocapsid or NC* protein), approximately 2500 molecules of which coat the dimeric RNA genome. Studies on HIV-1 and MoMuLV using in vitro model systems and in vivo have shown that NC protein is required to chaperone viral RNA dimerization and packaging during virus assembly, and proviral DNA synthesis by reverse transcriptase (RT) during infection. The human cellular prion protein (PrP), thought to be the major component of the agent causing transmissible spongiform encephalopathies (TSE), was recently found to possess a strong affinity for nucleic acids and to exhibit chaperone properties very similar to HIV-1 NC protein in the HIV-1 context in vitro. Tight binding of PrP to nucleic acids is proposed to participate directly in the prion disease process. To extend our understanding of lentiviruses and of the unexpected nucleic acid chaperone properties of the human prion protein, we set up an in vitro system to investigate replication of the feline immunodeficiency virus (FIV), which is functionally and phylogenetically distant from HIV-1. The results show that in the FIV model system, NC protein chaperones viral RNA dimerization, primer tRNA(Lys,3) annealing to the genomic primer-binding site (PBS) and minus strand DNA synthesis by the homologous FIV RT. FIV NC protein is able to trigger specific viral DNA synthesis by inhibiting self-priming of reverse transcription. The human prion protein was found to mimic the properties of FIV NC with respect to primer tRNA annealing to the viral RNA and chaperoning minus strand DNA synthesis. Copyright 2002 Elsevier Science Ltd.

  1. Binding of nucleotides by T4 DNA ligase and T4 RNA ligase: optical absorbance and fluorescence studies.

    PubMed Central

    Cherepanov, A V; de Vries, S

    2001-01-01

    The interaction of nucleotides with T4 DNA and RNA ligases has been characterized using ultraviolet visible (UV-VIS) absorbance and fluorescence spectroscopy. Both enzymes bind nucleotides with the K(d) between 0.1 and 20 microM. Nucleotide binding results in a decrease of absorbance at 260 nm due to pi-stacking with an aromatic residue, possibly phenylalanine, and causes red-shifting of the absorbance maximum due to hydrogen bonding with the exocyclic amino group. T4 DNA ligase is shown to have, besides the catalytic ATP binding site, another noncovalent nucleotide binding site. ATP bound there alters the pi-stacking of the nucleotide in the catalytic site, increasing its optical extinction. The K(d) for the noncovalent site is approximately 1000-fold higher than for the catalytic site. Nucleotides quench the protein fluorescence showing that a tryptophan residue is located in the active site of the ligase. The decrease of absorbance around 298 nm suggests that the hydrogen bonding interactions of this tryptophan residue are weakened in the ligase-nucleotide complex. The excitation/emission properties of T4 RNA ligase indicate that its ATP binding pocket is in contact with solvent, which is excluded upon binding of the nucleotide. Overall, the spectroscopic analysis reveals important similarities between T4 ligases and related nucleotidyltransferases, despite the low sequence similarity. PMID:11721015

  2. Stk1-mediated phosphorylation stimulates the DNA-binding properties of the Staphylococcus aureus SpoVG transcriptional factor.

    PubMed

    Bischoff, Markus; Brelle, Solène; Minatelli, Sabrina; Molle, Virginie

    2016-05-13

    The stage V sporulation protein G (SpoVG) homolog of Staphylococcus aureus is a modulator of virulence factor synthesis and antibiotic resistance in this clinically important gram-positive pathogen. Here we demonstrate that SpoVG can be phosphorylated by the staphylococcal Ser/Thr protein kinase Stk1 and that phosphorylation positively affects its DNA-binding properties. Mass spectrometric analyses and site directed mutagenesis identified Thr4, Thr13, Thr24 and Ser41 as phospho-acceptors. Stk1-mediated phosphorylation markedly enhanced the DNA binding activity of SpoVG towards the promoter regions of target genes such as capA, lip, and nuc1. Similarly, trans-complementation of the S. aureus ΔyabJ-spoVG mutant SM148 with a SpoVG derivative that mimics constitutive phosphorylation, SpoVG_Asp, exhibited capA, lip, and nuc1 transcript levels that were comparable to the levels seen with the wild-type, whereas trans-complementation with a phosphoablative variant of SpoVG (SpoVG_Ala) produced transcript levels similar to the ones seen in SM148. Our data suggest that the expression/activity of this transcription factor is tightly controlled in S. aureus by transcriptional, post-transcriptional and post-translational mechanisms. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Salmonella typhimurium PtsJ is a novel MocR-like transcriptional repressor involved in regulating the vitamin B6 salvage pathway.

    PubMed

    Tramonti, Angela; Milano, Teresa; Nardella, Caterina; di Salvo, Martino L; Pascarella, Stefano; Contestabile, Roberto

    2017-02-01

    The vitamin B 6 salvage pathway, involving pyridoxine 5'-phosphate oxidase (PNPOx) and pyridoxal kinase (PLK), recycles B 6 vitamers from nutrients and protein turnover to produce pyridoxal 5'-phosphate (PLP), the catalytically active form of the vitamin. Regulation of this pathway, widespread in living organisms including humans and many bacteria, is very important to vitamin B 6 homeostasis but poorly understood. Although some information is available on the enzymatic regulation of PNPOx and PLK, little is known on their regulation at the transcriptional level. In the present work, we identified a new MocR-like regulator, PtsJ from Salmonella typhimurium, which controls the expression of the pdxK gene encoding one of the two PLKs expressed in this organism (PLK1). Analysis of pdxK expression in a ptsJ knockout strain demonstrated that PtsJ acts as a transcriptional repressor. This is the first case of a MocR-like regulator acting as repressor of its target gene. Expression and purification of PtsJ allowed a detailed characterisation of its effector and DNA-binding properties. PLP is the only B 6 vitamer acting as effector molecule for PtsJ. A DNA-binding region composed of four repeated nucleotide sequences is responsible for binding of PtsJ to its target promoter. Analysis of binding stoichiometry revealed that protein subunits/DNA molar ratio varies from 4 : 1 to 2 : 1, depending on the presence or absence of PLP. Structural characteristics of DNA transcriptional factor-binding sites suggest that PtsJ binds DNA according to a different model with respect to other characterised members of the MocR subgroup. © 2016 Federation of European Biochemical Societies.

  4. Novel Function of the Fanconi Anemia Group J or RECQ1 Helicase to Disrupt Protein-DNA Complexes in a Replication Protein A-stimulated Manner*

    PubMed Central

    Sommers, Joshua A.; Banerjee, Taraswi; Hinds, Twila; Wan, Bingbing; Wold, Marc S.; Lei, Ming; Brosh, Robert M.

    2014-01-01

    Understanding how cellular machinery deals with chromosomal genome complexity is an important question because protein bound to DNA may affect various cellular processes of nucleic acid metabolism. DNA helicases are at the forefront of such processes, yet there is only limited knowledge how they remodel protein-DNA complexes and how these mechanisms are regulated. We have determined that representative human RecQ and Fe-S cluster DNA helicases are potently blocked by a protein-DNA interaction. The Fanconi anemia group J (FANCJ) helicase partners with the single-stranded DNA-binding protein replication protein A (RPA) to displace BamHI-E111A bound to duplex DNA in a specific manner. Protein displacement was dependent on the ATPase-driven function of the helicase and unique properties of RPA. Further biochemical studies demonstrated that the shelterin proteins TRF1 and TRF2, which preferentially bind the telomeric repeat found at chromosome ends, effectively block FANCJ from unwinding the forked duplex telomeric substrate. RPA, but not the Escherichia coli single-stranded DNA-binding protein or shelterin factor Pot1, stimulated FANCJ ejection of TRF1 from the telomeric DNA substrate. FANCJ was also able to displace TRF2 from the telomeric substrate in an RPA-dependent manner. The stimulation of helicase-catalyzed protein displacement is also observed with the DNA helicase RECQ1, suggesting a conserved functional interaction of RPA-interacting helicases. These findings suggest that partnerships between RPA and interacting human DNA helicases may greatly enhance their ability to dislodge proteins bound to duplex DNA, an activity that is likely to be highly relevant to their biological roles in DNA metabolism. PMID:24895130

  5. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kundu, Sourav, E-mail: sourav.kundu@saha.ac.in; Karmakar, S. N., E-mail: sachindranath.karmakar@saha.ac.in

    We present a tight-binding study of conformation dependent electronic transport properties of DNA double-helix including its helical symmetry. We have studied the changes in the localization properties of DNA as we alter the number of stacked bases within every pitch of the double-helix keeping fixed the total number of nitrogen bases within the DNA molecule. We take three DNA sequences, two of them are periodic and one is random and observe that in all the cases localization length increases as we increase the radius of DNA double-helix i.e., number of nucleobases within a pitch. We have also investigated the effectmore » of backbone energetic on the I-V response of the system and found that in presence of helical symmetry, depending on the interplay of conformal variation and disorder, DNA can be found in either metallic, semiconducting and insulating phases, as observed experimentally.« less

  7. Scarabaecin, a novel cysteine-containing antifungal peptide from the rhinoceros beetle, Oryctes rhinoceros.

    PubMed

    Tomie, Tetsuya; Ishibashi, Jun; Furukawa, Seiichi; Kobayashi, Satoe; Sawahata, Ryoko; Asaoka, Ai; Tagawa, Michito; Yamakawa, Minoru

    2003-07-25

    A novel antifungal peptide, scarabaecin (4080Da), was isolated from the coconut rhinoceros beetle, Oryctes rhinoceros. Scarabaecin cDNA was cloned by reverse transcriptase-polymerase chain reactions (RT-PCR) using a primer based on the N-terminal amino acid sequence. The amino acid sequence deduced from scarabaecin cDNA showed no significant similarity to those of reported proteins. Chemically synthesized scarabaecin indicated antifungal activity against phytopathogenic fungi such as Pyricularia oryzae, Rhizoctonia solani, and Botrytis cinerea, but not against phytopathogenic bacteria. It showed weak activity against Bauberia bassiana, an insect pathogenic fungus, and Staphylococcus aureus, a pathogenic bacterium. Scarabaecin showed chitin binding property and its K(d) was 1.315 microM. A comparison of putative chitin-binding domains among scarabaecin, invertebrate, and plant chitin-binding proteins suggests that scarabaecin is a new member of chitin-binding antimicrobial proteins.

  8. The centromeric nucleosome-like CENP–T–W–S–X complex induces positive supercoils into DNA

    PubMed Central

    Takeuchi, Kozo; Nishino, Tatsuya; Mayanagi, Kouta; Horikoshi, Naoki; Osakabe, Akihisa; Tachiwana, Hiroaki; Hori, Tetsuya; Kurumizaka, Hitoshi; Fukagawa, Tatsuo

    2014-01-01

    The centromere is a specific genomic region upon which the kinetochore is formed to attach to spindle microtubules for faithful chromosome segregation. To distinguish this chromosomal region from other genomic loci, the centromere contains a specific chromatin structure including specialized nucleosomes containing the histone H3 variant CENP–A. In addition to CENP–A nucleosomes, we have found that centromeres contain a nucleosome-like structure comprised of the histone-fold CENP–T–W–S–X complex. However, it is unclear how the CENP–T–W–S–X complex associates with centromere chromatin. Here, we demonstrate that the CENP–T–W–S–X complex binds preferentially to ∼100 bp of linker DNA rather than nucleosome-bound DNA. In addition, we find that the CENP–T–W–S–X complex primarily binds to DNA as a (CENP–T–W–S–X)2 structure. Interestingly, in contrast to canonical nucleosomes that negatively supercoil DNA, the CENP–T–W–S–X complex induces positive DNA supercoils. We found that the DNA-binding regions in CENP–T or CENP–W, but not CENP–S or CENP–X, are required for this positive supercoiling activity and the kinetochore targeting of the CENP–T–W–S–X complex. In summary, our work reveals the structural features and properties of the CENP–T–W–S–X complex for its localization to centromeres. PMID:24234442

  9. Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5′-flaps

    PubMed Central

    Koc, Katrina N.; Stodola, Joseph L.; Burgers, Peter M.; Galletto, Roberto

    2015-01-01

    The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3′–5′ exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo− to carry out strand displacement synthesis and discovered that it is regulated by the 5′-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5′-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5′-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities. PMID:25813050

  10. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  11. Evaluation of Impermeant, DNA-Binding Dye Fluorescence as a Real-Time Readout of Eukaryotic Cell Toxicity in a High Throughput Screening Format

    PubMed Central

    Chiaraviglio, Lucius

    2014-01-01

    Abstract Interpretation of high throughput screening (HTS) data in cell-based assays may be confounded by cytotoxic properties of screening compounds. Therefore, assessing cell toxicity in real time during the HTS process itself would be highly advantageous. Here, we investigate the potential of putatively impermeant, fluorescent, DNA-binding dyes to give cell toxicity readout during HTS. Amongst 19 DNA-binding dyes examined, three classes were identified that were (1) permeant, (2) cytotoxic, or (3) neither permeant nor cytotoxic during 3-day incubation with a macrophage cell line. In the last class, four dyes (SYTOX Green, CellTox Green, GelGreen, and EvaGreen) gave highly robust cytotoxicity data in 384-well screening plates. As proof of principle, successful combination with a luminescence-based assay in HTS format was demonstrated. Here, both intracellular growth of Legionella pneumophila (luminescence) and host cell viability (SYTOX Green exclusion) were assayed in the same screening well. Incorporation of membrane-impermeant, DNA-binding, fluorescent dyes in HTS assays should prove useful by allowing evaluation of cytotoxicity in real time, eliminating reagent addition steps and effort associated with endpoint cell viability analysis, and reducing the need for follow-up cytotoxicity screening. PMID:24831788

  12. Impact of low-frequency hotspot mutation R282Q on the structure of p53 DNA-binding domain as revealed by crystallography at 1.54 Å resolution

    PubMed Central

    Tu, Chao; Tan, Yu-Hong; Shaw, Gary; Zhou, Zheng; Bai, Yawen; Luo, Ray; Ji, Xinhua

    2008-01-01

    Tumor suppressor p53 is a sequence-specific DNA-binding protein and its central DNA-binding domain (DBD) harbors six hotspots (Arg175, Gly245, Arg248, Arg249, Arg273 and Arg282) for human cancers. Here, the crystal structure of a low-frequency hotspot mutant, p53DBD(R282Q), is reported at 1.54 Å resolution together with the results of molecular-dynamics simulations on the basis of the structure. In addition to eliminating a salt bridge, the R282Q mutation has a significant impact on the properties of two DNA-binding loops (L1 and L3). The L1 loop is flexible in the wild type, but it is not flexible in the mutant. The L3 loop of the wild type is not flexible, whereas it assumes two conformations in the mutant. Molecular-dynamics simulations indicated that both conformations of the L3 loop are accessible under biological conditions. It is predicted that the elimination of the salt bridge and the inversion of the flexibility of L1 and L3 are directly or indirectly responsible for deactivating the tumor suppressor p53. PMID:18453682

  13. Focus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics

    PubMed Central

    Verona, Massimiliano Donato; Verdolino, Vincenzo; Palazzesi, Ferruccio; Corradini, Roberto

    2017-01-01

    Peptide Nucleic Acids (PNAs) can efficiently target DNA or RNA acting as chemical tools for gene regulation. Their backbone modification and functionalization is often used to increase the affinity for a particular sequence improving selectivity. The understanding of the trading forces that lead the single strand PNA to bind the DNA or RNA sequence is preparatory for any further rational design, but a clear and unique description of this process is still not complete. In this paper we report further insights into this subject, by a computational investigation aiming at the characterization of the conformations of a single strand PNA and how these can be correlated to its capability in binding DNA/RNA. Employing Metadynamics we were able to better define conformational pre-organizations of the single strand PNA and γ-modified PNA otherwise unrevealed through classical molecular dynamics. Our simulations driven on backbone modified PNAs lead to the conclusion that this γ-functionalization affects the single strand preorganization and targeting properties to the DNA/RNA, in agreement with circular dichroism (CD) spectra obtained for this class of compounds. MD simulations on PNA:RNA dissociation and association mechanisms allowed to reveal the critical role of central bases and preorganization in the binding process. PMID:28211525

  14. An asymmetric structure of the Bacillus subtilis replication terminator protein in complex with DNA.

    PubMed

    Vivian, J P; Porter, C J; Wilce, J A; Wilce, M C J

    2007-07-13

    In Bacillus subtilis, the termination of DNA replication via polar fork arrest is effected by a specific protein:DNA complex formed between the replication terminator protein (RTP) and DNA terminator sites. We report the crystal structure of a replication terminator protein homologue (RTP.C110S) of B. subtilis in complex with the high affinity component of one of its cognate DNA termination sites, known as the TerI B-site, refined at 2.5 A resolution. The 21 bp RTP:DNA complex displays marked structural asymmetry in both the homodimeric protein and the DNA. This is in contrast to the previously reported complex formed with a symmetrical TerI B-site homologue. The induced asymmetry is consistent with the complex's solution properties as determined using NMR spectroscopy. Concomitant with this asymmetry is variation in the protein:DNA binding pattern for each of the subunits of the RTP homodimer. It is proposed that the asymmetric "wing" positions, as well as other asymmetrical features of the RTP:DNA complex, are critical for the cooperative binding that underlies the mechanism of polar fork arrest at the complete terminator site.

  15. Deconvolution of the role of metal and pH in metal coordinating polymers

    NASA Astrophysics Data System (ADS)

    Cazzell, Seth; Holten-Andersen, Niels

    Nature uses metal binding amino acids to engineer both mechanical properties and structural functionality. Some examples of this metal binding behavior can be found in both mussel foot protein and DNA binding protein. The mussel byssal thread contains reversible intermolecular protein-metal bonds, allowing it to withstand harsh intertidal environments. Zinc fingers form intramolecular protein-metal bonds to stabilize the tertiary structure of DNA binding proteins, allowing specific structural functionality. Inspired by both these metal-binding materials, we present mechanical and spectroscopic characterization of a model polymer system, designed to mimic this bonding. Through these studies, we are able to answer fundamental polymer physics questions, such as the role of pH and metal to ligand ratio, illuminating both the macroscopic and microscopic material behavior. These understandings further bio-inspired engineering techniques that are used to design viscoelastic soft materials. I was supported by the Department of Defense (DoD) through the National Defense Science & Engineering Graduate Fellowship (NDSEG) Program.

  16. An incoherent feedforward loop facilitates adaptive tuning of gene expression.

    PubMed

    Hong, Jungeui; Brandt, Nathan; Abdul-Rahman, Farah; Yang, Ally; Hughes, Tim; Gresham, David

    2018-04-05

    We studied adaptive evolution of gene expression using long-term experimental evolution of Saccharomyces cerevisiae in ammonium-limited chemostats. We found repeated selection for non-synonymous variation in the DNA binding domain of the transcriptional activator, GAT1, which functions with the repressor, DAL80 in an incoherent type-1 feedforward loop (I1-FFL) to control expression of the high affinity ammonium transporter gene, MEP2. Missense mutations in the DNA binding domain of GAT1 reduce its binding to the GATAA consensus sequence. However, we show experimentally, and using mathematical modeling, that decreases in GAT1 binding result in increased expression of MEP2 as a consequence of properties of I1-FFLs. Our results show that I1-FFLs, one of the most commonly occurring network motifs in transcriptional networks, can facilitate adaptive tuning of gene expression through modulation of transcription factor binding affinities. Our findings highlight the importance of gene regulatory architectures in the evolution of gene expression. © 2018, Hong et al.

  17. PrPC has nucleic acid chaperoning properties similar to the nucleocapsid protein of HIV-1.

    PubMed

    Derrington, Edmund; Gabus, Caroline; Leblanc, Pascal; Chnaidermann, Jonas; Grave, Linda; Dormont, Dominique; Swietnicki, Wieslaw; Morillas, Manuel; Marck, Daniel; Nandi, Pradip; Darlix, Jean-Luc

    2002-01-01

    The function of the cellular prion protein (PrPC) remains obscure. Studies suggest that PrPC functions in several processes including signal transduction and Cu2+ metabolism. PrPC has also been established to bind nucleic acids. Therefore we investigated the properties of PrPC as a putative nucleic acid chaperone. Surprisingly, PrPC possesses all the nucleic acid chaperoning properties previously specific to retroviral nucleocapsid proteins. PrPC appears to be a molecular mimic of NCP7, the nucleocapsid protein of HIV-1. Thus PrPC, like NCP7, chaperones the annealing of tRNA(Lys) to the HIV-1 primer binding site, the initial step of retrovirus replication. PrPC also chaperones the two DNA strand transfers required for production of a complete proviral DNA with LTRs. Concerning the functions of NCP7 during budding, PrPC also mimices NCP7 by dimerizing the HIV-1 genomic RNA. These data are unprecedented because, although many cellular proteins have been identified as nucleic acid chaperones, none have the properties of retroviral nucleocapsid proteins.

  18. Molecular and functional characterization of single-box high-mobility group B (HMGB) chromosomal protein from Aedes aegypti.

    PubMed

    de Abreu da Silva, Isabel Caetano; Vicentino, Amanda Roberta Revoredo; Dos Santos, Renata Coutinho; da Fonseca, Rodrigo Nunes; de Mendonça Amarante, Anderson; Carneiro, Vitor Coutinho; de Amorim Pinto, Marcia; Aguilera, Estefania Anahi; Mohana-Borges, Ronaldo; Bisch, Paulo Mascarello; da Silva-Neto, Mario Alberto Cardoso; Fantappié, Marcelo Rosado

    2018-05-30

    High-mobility group B (HMGB) proteins have highly conserved, unique DNA-binding domains, HMG boxes, that can bind non-B-type DNA structures, such as bent, kinked and unwound structures, with high affinity. HMGB proteins also promote DNA bending, looping and unwinding. In this study, we determined the role of the Aedes aegypti single HMG-box domain protein AaHMGB; characterized its structure, spatiotemporal expression levels, subcellular localization, and nucleic acid binding activities; and compared these properties with those of its double-HMG-box counterpart protein, AaHMGB1. Via qRT-PCR, we showed that AaHMGB is expressed at much higher levels than AaHMGB1 throughout mosquito development. In situ hybridization results suggested a role for AaHMGB and AaHMGB1 during embryogenesis. Immunolocalization in the midgut revealed that AaHMGB is exclusively nuclear. Circular dichroism and fluorescence spectroscopy analyses showed that AaHMGB exhibits common features of α-helical structures and is more stably folded than AaHMGB1, likely due to the presence of one or two HMG boxes. Using several DNA substrates or single-stranded RNAs as probes, we observed significant differences between AaHMGB and AaHMGB1 in terms of their binding patterns, activity and/or specificity. Importantly, we showed that the phosphorylation of AaHMGB plays a critical role in its DNA-binding activity. Our study provides additional insight into the roles of single- versus double-HMG-box-containing proteins in nucleic acid interactions for better understanding of mosquito development, physiology and homeostasis. Copyright © 2017. Published by Elsevier B.V.

  19. Cooperative Assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: A Molecular Dynamics Simulation Study

    PubMed Central

    Wang, Guihong; Li, Chaoqun; Wang, Yan; Chen, Guangju

    2013-01-01

    Background Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β) signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far. Methodology In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4) models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4) with DNA molecule. Results The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus. PMID:23326519

  20. Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors.

    PubMed

    Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel

    2006-04-28

    Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.

  1. Crystal Structure of the Chromodomain Helicase DNA-binding Protein 1 (Chd1) DNA-binding Domain in Complex with DNA*

    PubMed Central

    Sharma, Amit; Jenkins, Katherine R.; Héroux, Annie; Bowman, Gregory D.

    2011-01-01

    Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves. PMID:22033927

  2. Membrane Destruction and DNA Binding of Staphylococcus aureus Cells Induced by Carvacrol and Its Combined Effect with a Pulsed Electric Field.

    PubMed

    Wang, Lang-Hong; Wang, Man-Sheng; Zeng, Xin-An; Zhang, Zhi-Hong; Gong, De-Ming; Huang, Yan-Bo

    2016-08-17

    Carvacrol (5-isopropyl-2-methylphenol, CAR) is an antibacterial ingredient that occurs naturally in the leaves of the plant Origanum vulgare. The antimicrobial mechanism of CAR against Staphylococcus aureus ATCC 43300 was investigated in the study. Analysis of the membrane fatty acids by gas chromatography-mass spectrometry (GC-MS) showed that exposure to CAR at low concentrations induced a marked increase in the level of unbranched fatty acids (from 34.90 ± 1.77% to 62.37 ± 4.26%). Moreover, CAR at higher levels severely damaged the integrity and morphologies of the S. aureus cell membrane. The DNA-binding properties of CAR were also investigated using fluorescence, circular dichroism, molecular modeling, and atomic-force microscopy. The results showed that CAR bound to DNA via the minor-groove mode, mildly perturbed the DNA secondary structure, and induced DNA molecules to be aggregated. Furthermore, a combination of CAR with a pulsed-electric field was found to exhibit strong synergistic effects on S. aureus.

  3. Purification and general properties of the DNA-binding protein (P16) from rat liver mitochondria.

    PubMed

    Pavco, P A; Van Tuyle, G C

    1985-01-01

    The mitochondrial DNA-binding protein P16 was isolated from rat liver mitochondrial lysates by affinity chromatography on single strand DNA agarose and separated from DNA in the preparation by alkaline CsCl isopycnic gradients. The top fraction of the gradients contained a single polypeptide species (Mr approximately equal to 15,200) based upon SDS PAGE. Digestion of single strand DNA-bound P16 with proteinase K produced a protease-insensitive, DNA-binding fragment (Mr approximately equal to 6,000) that has been purified by essentially the same procedures used for intact P16. The partial amino acid compositions for P16 and the DNA-binding fragment were obtained by conventional methods. Analysis of subcellular fractions revealed that nearly all of the cellular P16 was located in the mitochondria and that only trace amounts of protein of comparable electrophoretic mobility could be isolated from the nuclear or cytoplasmic fractions. The labeling of P16 with [35S]methionine in primary rat hepatocyte cultures was inhibited by more than 90% by the cytoplasmic translation inhibitor cycloheximide, but unaffected by the mitochondrial-specific agent chloramphenicol. These results indicate that P16 is synthesized on cytoplasmic ribosomes and imported into the mitochondria. The addition of purified P16 to deproteinized mitochondrial DNA resulted in the complete protection of the labeled nascent strands of displacement loops against branch migrational loss during cleavage of parental DNA with SstI, thus providing strong evidence that P16 is the single entity required for this in vitro function. Incubation of P16 with single strand phi X174 DNA, double strand (RF) phi X174 DNA, or Escherichia coli ribosomal RNA and subsequent analysis of the nucleic acid species for bound protein indicated a strong preference of P16 for single strand DNA and no detectable affinity for RNA or double strand DNA. Examination of P16-single strand phi X174 DNA complexes by direct electron microscopy revealed thickened, irregular fibers characteristic of protein-associated single strand DNA.

  4. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

    NASA Astrophysics Data System (ADS)

    Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

    2016-03-01

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

  5. DNA-binding and oxidative properties of cationic phthalocyanines and their dimeric complexes with anionic phthalocyanines covalently linked to oligonucleotides.

    PubMed

    Kuznetsova, A A; Lukyanets, E A; Solovyeva, L I; Knorre, D G; Fedorova, O S

    2008-12-01

    Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the past decades. One actively pursued approach involves antisense or antigene oligonucleotide constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Fe(II) and Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. The binding of positively charged Fe(II) and Co(II) phthalocyanines with single- and double-stranded DNA was investigated. It was shown that these phthalocyanines interact with nucleic acids through an outside binding mode. The site-directed modification of single-stranded DNA by O2 and H2O2 in the presence of dimeric complexes of negatively and positively charged Fe(II) and Co(II) phthalocyanines was investigated. These complexes were formed directly on single-stranded DNA through interaction between negatively charged phthalocyanine in conjugate and positively charged phthalocyanine in solution. The resulting oppositely charged phthalocyanine complexes showed significant increase of catalytic activity compared with monomeric forms of phthalocyanines Fe(II) and Co(II). These complexes catalyzed the DNA oxidation with high efficacy and led to direct DNA strand cleavage. It was determined that oxidation of DNA by molecular oxygen catalyzed by complex of Fe(II)-phthalocyanines proceeds with higher rate than in the case of Co(II)-phthalocyanines but the latter led to a greater extent of target DNA modification.

  6. Dynamic binding of replication protein a is required for DNA repair

    PubMed Central

    Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

    2016-01-01

    Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

  7. The substrate binding interface of alkylpurine DNA glycosylase AlkD.

    PubMed

    Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F

    2014-01-01

    Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.

    PubMed

    Schneider, G J; Geiduschek, E P

    1990-06-25

    The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.

  9. Fluorescent DNA-templated silver nanoclusters

    NASA Astrophysics Data System (ADS)

    Lin, Ruoqian

    Because of the ultra-small size and biocompatibility of silver nanoclusters, they have attracted much research interest for their applications in biolabeling. Among the many ways of synthesizing silver nanoclusters, DNA templated method is particularly attractive---the high tunability of DNA sequences provides another degree of freedom for controlling the chemical and photophysical properties. However, systematic studies about how DNA sequences and concentrations are controlling the photophysical properties are still lacking. The aim of this thesis is to investigate the binding mechanisms of silver clusters binding and single stranded DNAs. Here in this thesis, we report synthesis and characterization of DNA-templated silver nanoclusters and provide a systematic interrogation of the effects of DNA concentrations and sequences, including lengths and secondary structures. We performed a series of syntheses utilizing five different sequences to explore the optimal synthesis condition. By characterizing samples with UV-vis and fluorescence spectroscopy, we achieved the most proper reactants ratio and synthesis conditions. Two of them were chosen for further concentration dependence studies and sequence dependence studies. We found that cytosine-rich sequences are more likely to produce silver nanoclusters with stronger fluorescence signals; however, sequences with hairpin secondary structures are more capable in stabilizing silver nanoclusters. In addition, the fluorescence peak emission intensities and wavelengths of the DNA templated silver clusters have sequence dependent fingerprints. This potentially can be applied to sequence sensing in the future. However all the current conclusions are not warranted; there is still difficulty in formulating general rules in DNA strand design and silver nanocluster production. Further investigation of more sequences could solve these questions in the future.

  10. Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

    PubMed Central

    Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.

    2015-01-01

    We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

  11. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  12. Replication initiator protein RepE of mini-F plasmid: functional differentiation between monomers (initiator) and dimers (autogenous repressor).

    PubMed Central

    Ishiai, M; Wada, C; Kawasaki, Y; Yura, T

    1994-01-01

    Replication of mini-F plasmid requires the plasmid-encoded RepE initiator protein and several host factors including DnaJ, DnaK, and GrpE, heat shock proteins of Escherichia coli. The RepE protein plays a crucial role in replication and exhibits two major functions: initiation of replication from the origin, ori2, and autogenous repression of repE transcription. One of the mini-F plasmid mutants that can replicate in the dnaJ-defective host produces an altered RepE (RepE54) with a markedly enhanced initiator activity but little or no repressor activity. RepE54 has been purified from cell extracts primarily in monomeric form, unlike the wild-type RepE that is recovered in dimeric form. Gel-retardation assays revealed that RepE54 monomers bind to ori2 (direct repeats) with a very high efficiency but hardly bind to the repE operator (inverted repeat), in accordance with the properties of RepE54 in vivo. Furthermore, the treatment of wild-type RepE dimers with protein denaturants enhanced their binding to ori2 but reduced binding to the operator: RepE dimers were partially converted to monomers, and the ori2 binding activity was uniquely associated with monomers. These results strongly suggest that RepE monomers represent an active form by binding to ori2 to initiate replication, whereas dimers act as an autogenous repressor by binding to the operator. We propose that RepE is structurally and functionally differentiated and that monomerization of RepE dimers, presumably mediated by heat shock protein(s), activates the initiator function and participates in regulation of mini-F DNA replication. Images PMID:8170998

  13. Molecular mechanisms by which oxidative DNA damage promotes telomerase activity.

    PubMed

    Lee, Hui-Ting; Bose, Arindam; Lee, Chun-Ying; Opresko, Patricia L; Myong, Sua

    2017-11-16

    Telomeres are highly susceptible to oxidative DNA damage, which if left unrepaired can lead to dysregulation of telomere length homeostasis. Here we employed single molecule FRET, single molecule pull-down and biochemical analysis to investigate how the most common oxidative DNA lesions, 8-oxoguanine (8oxoG) and thymine glycol (Tg), regulate the structural properties of telomeric DNA and telomerase extension activity. In contrast to 8oxoG which disrupts the telomeric DNA structure, Tg exhibits substantially reduced perturbation of G-quadruplex folding. As a result, 8oxoG induces high accessibility, whereas Tg retains limited accessibility, of telomeric G-quadruplex DNA to complementary single stranded DNA and to telomere binding protein POT1. Surprisingly, the Tg lesion stimulates telomerase loading and activity to a similar degree as an 8oxoG lesion. We demonstrate that this unexpected stimulation arises from Tg-induced conformational alterations and dynamics in telomeric DNA. Despite impacting structure by different mechanisms, both 8oxoG and Tg enhance telomerase binding and extension activity to the same degree, potentially contributing to oncogenesis. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Recent advances in α-synuclein functions, advanced glycation, and toxicity: implications for Parkinson's disease.

    PubMed

    Guerrero, Erika; Vasudevaraju, P; Hegde, Muralidhar L; Britton, G B; Rao, K S

    2013-04-01

    The toxicity of α-synuclein in the neuropathology of Parkinson's disease which includes its hallmark aggregation has been studied scrupulously in the last decade. Although little is known regarding the normal functions of α-synuclein, its association with membrane phospholipids suggests its potential role in signaling pathways. Following extensive evidences for its nuclear localization, we and others recently demonstrated DNA binding activity of α-synuclein that modulates its conformation as well as aggregation properties. Furthermore, we also underscored the similarities among various amyloidogenic proteins involved in neurodegenerative diseases including amyloid beta peptides and tau. Our more recent studies show that α-synuclein is glycated and glycosylated both in vitro and in neurons, significantly affecting its folding, oligomeric, and DNA binding properties. Glycated α-synuclein causes increased genome damage both via its direct interaction with DNA and by increased generation of reactive oxygen species as glycation byproduct. In this review, we discuss the mechanisms of glycation and other posttranslational modifications of α-synuclein, including phosphorylation and nitration, and their role in neuronal death in Parkinson's disease.

  15. SOD activity and DNA binding properties of a new symmetric porphyrin Schiff base ligand and its metal complexes.

    PubMed

    Çay, Sevim; Köse, Muhammet; Tümer, Ferhan; Gölcü, Ayşegül; Tümer, Mehmet

    2015-12-05

    4-Methoxy-2,6-bis(hydroxymethyl)phenol (1) was prepared from the reaction of 4-methoxyphenol and formaldehyde. The compound (1) was then oxidized to the 4-methoxy-2,6-diformylphenol (2) compound. Molecular structure of compound (2) was determined by X-ray diffraction method. A new symmetric porphyrin Schiff base ligand 4-methoxy-2,6-bis[5-(4-iminophenyl)-10,15,20-triphenylporphyrin]phenol (L) was prepared from the reaction of the 5-(4-aminophenyl)-10,15,20-triphenylporphyrin (TTP-NH2) and the compound (2) in the toluene solution. The metal complexes (Cu(II), Fe(III), Mn(III), Pt(II) and Zn(II)) of the ligand (L) were synthesized and characterized by the spectroscopic and analytical methods. The DNA (fish sperm FSdsDNA) binding studies of the ligand and its complexes were performed using UV-vis spectroscopy. Additionally, superoxide dismutase activities of the porphyrin Schiff base metal complexes were investigated. Additionally, electrochemical, photoluminescence and thermal properties of the compounds were investigated. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family.

    PubMed

    Dai, Qi; Ren, Aiming; Westholm, Jakub O; Duan, Hong; Patel, Dinshaw J; Lai, Eric C

    2015-01-01

    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain ("BEN-solo" factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional properties of this new family of transcription factors. © 2015 Dai et al.; Published by Cold Spring Harbor Laboratory Press.

  17. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family

    PubMed Central

    Dai, Qi; Ren, Aiming; Westholm, Jakub O.; Duan, Hong; Patel, Dinshaw J.

    2015-01-01

    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain (“BEN-solo” factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional properties of this new family of transcription factors. PMID:25561495

  18. Functions of the high mobility group protein, Abf2p, in mitochondrial DNA segregation, recombination and copy number in Saccharomyces cerevisiae.

    PubMed

    Zelenaya-Troitskaya, O; Newman, S M; Okamoto, K; Perlman, P S; Butow, R A

    1998-04-01

    Previous studies have established that the mitochondrial high mobility group (HMG) protein, Abf2p, of Saccharomyces cerevisiae influences the stability of wild-type (rho+) mitochondrial DNA (mtDNA) and plays an important role in mtDNA organization. Here we report new functions for Abf2p in mtDNA transactions. We find that in homozygous deltaabf2 crosses, the pattern of sorting of mtDNA and mitochondrial matrix protein is altered, and mtDNA recombination is suppressed relative to homozygous ABF2 crosses. Although Abf2p is known to be required for the maintenance of mtDNA in rho+ cells growing on rich dextrose medium, we find that it is not required for the maintenance of mtDNA in p cells grown on the same medium. The content of both rho+ and rho- mtDNAs is increased in cells by 50-150% by moderate (two- to threefold) increases in the ABF2 copy number, suggesting that Abf2p plays a role in mtDNA copy control. Overproduction of Abf2p by > or = 10-fold from an ABF2 gene placed under control of the GAL1 promoter, however, leads to a rapid loss of rho+ mtDNA and a quantitative conversion of rho+ cells to petites within two to four generations after a shift of the culture from glucose to galactose medium. Overexpression of Abf2p in rho- cells also leads to a loss of mtDNA, but at a slower rate than was observed for rho+ cells. The mtDNA instability phenotype is related to the DNA-binding properties of Abf2p because a mutant Abf2p that contains mutations in residues of both HMG box domains known to affect DNA binding in vitro, and that binds poorly to mtDNA in vivo, complements deltaabf2 cells only weakly and greatly lessens the effect of overproduction on mtDNA instability. In vivo binding was assessed by colocalization to mtDNA of fusions between mutant or wild-type Abf2p and green fluorescent protein. These findings are discussed in the context of a model relating mtDNA copy number control and stability to mtDNA recombination.

  19. Interactions of the C-terminal Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

    2007-01-01

    NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku(sub 70/80) complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The C-terminal domain of Ku70 (Ku70c, residues 559-609), contains an helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the Ku70c/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the subunit Ku70c and a 14 base pairs DNA duplex, whose starting structures are designed to be variable so as to mimic their different binding modes. By analyzing conformational changes and energetic properties of the complex during MD simulations, we found that interactions are preferred at DNA ends, and within the major groove, which is consistent with previous experimental investigations. In addition, the results indicate that cooperation of Ku70c with other subunits of Ku(sub 70/80) is necessary to explain the high affinity of binding as observed in experiments.

  20. Mycobacterium tuberculosis cAMP Receptor Protein (Rv3676) Differs from the Escherichia coli Paradigm in Its cAMP Binding and DNA Binding Properties and Transcription Activation Properties*

    PubMed Central

    Stapleton, Melanie; Haq, Ihtshamul; Hunt, Debbie M.; Arnvig, Kristine B.; Artymiuk, Peter J.; Buxton, Roger S.; Green, Jeffrey

    2010-01-01

    The pathogen Mycobacterium tuberculosis produces a burst of cAMP upon infection of macrophages. Bacterial cyclic AMP receptor proteins (CRP) are transcription factors that respond to cAMP by binding at target promoters when cAMP concentrations increase. Rv3676 (CRPMt) is a CRP family protein that regulates expression of genes (rpfA and whiB1) that are potentially involved in M. tuberculosis persistence and/or emergence from the dormant state. Here, the CRPMt homodimer is shown to bind two molecules of cAMP (one per protomer) at noninteracting sites. Furthermore, cAMP binding by CRPMt was relatively weak, entropy driven, and resulted in a relatively small enhancement in DNA binding. Tandem CRPMt-binding sites (CRP1 at −58.5 and CRP2 at −37.5) were identified at the whiB1 promoter (PwhiB1). In vitro transcription reactions showed that CRP1 is an activating site and that CRP2, which was only occupied in the presence of cAMP or at high CRPMt concentrations in the absence of cAMP, is a repressing site. Binding of CRPMt to CRP1 was not essential for open complex formation but was required for transcription activation. Thus, these data suggest that binding of CRPMt to the PwhiB1 CRP1 site activates transcription at a step after open complex formation. In contrast, high cAMP concentrations allowed occupation of both CRP1 and CRP2 sites, resulting in inhibition of open complex formation. Thus, M. tuberculosis CRP has evolved several distinct characteristics, compared with the Escherichia coli CRP paradigm, to allow it to regulate gene expression against a background of high concentrations of cAMP. PMID:20028978

  1. Crystal Structure of the GRAS Domain of SCARECROW-LIKE7 in Oryza sativa

    PubMed Central

    Li, Shengping; Zhao, Yanhe; Zhao, Zheng; Wu, Xiuling; Sun, Lifang; Liu, Qingsong; Wu, Yunkun

    2016-01-01

    GRAS proteins belong to a plant-specific protein family with many members and play essential roles in plant growth and development, functioning primarily in transcriptional regulation. Proteins in the family are minimally defined as containing the conserved GRAS domain. Here, we determined the structure of the GRAS domain of Os-SCL7 from rice (Oryza sativa) to 1.82 Å. The structure includes cap and core subdomains and elucidates the features of the conserved GRAS LRI, VHIID, LRII, PFYRE, and SAW motifs. The structure is a dimer, with a clear groove to accommodate double-stranded DNA. Docking a DNA segment into the groove to generate an Os-SCL7/DNA complex provides insight into the DNA binding mechanism of GRAS proteins. Furthermore, the in vitro DNA binding property of Os-SCL7 and model-defined recognition residues are assessed by electrophoretic mobility shift analysis and mutagenesis assays. These studies reveal the structure and preliminary DNA interaction mechanisms of GRAS proteins and open the door to in-depth investigation and understanding of the individual pathways in which they play important roles. PMID:27081181

  2. Exploring DNA-binding Proteins with In Vivo Chemical Cross-linking and Mass Spectrometry

    PubMed Central

    Qiu, Haibo; Wang, Yinsheng

    2009-01-01

    DNA-binding proteins are very important constituents of proteomes of all species and play crucial roles in transcription, DNA replication, recombination, repair and other activities associated with DNA. Although a number of DNA-binding proteins have been identified, many proteins involved in gene regulation and DNA repair are likely still unknown because of their dynamic and/or weak interactions with DNA. In this report, we described an approach for the comprehensive identification of DNA-binding proteins with in vivo formaldehyde cross-linking and LC-MS/MS. DNA-binding proteins could be purified via the isolation of DNA-protein complexes and released from the complexes by reversing the cross-linking. By using this method, we were able to identify more than one hundred DNA-binding proteins, such as proteins involved in transcription, gene regulation, DNA replication and repair, and a large number of proteins which are potentially associated with DNA and DNA-binding proteins. This method should be generally applicable to the investigation of other nucleic acid-binding proteins, and hold great potential in the comprehensive study of gene regulation, DNA damage response and repair, as well as many other critical biological processes at proteomic level. PMID:19714816

  3. The properties of small Ag clusters bound to DNA bases.

    PubMed

    Soto-Verdugo, Víctor; Metiu, Horia; Gwinn, Elisabeth

    2010-05-21

    We study the binding of neutral silver clusters, Ag(n) (n=1-6), to the DNA bases adenine (A), cytosine (C), guanine (G), and thymine (T) and the absorption spectra of the silver cluster-base complexes. Using density functional theory (DFT), we find that the clusters prefer to bind to the doubly bonded ring nitrogens and that binding to T is generally much weaker than to C, G, and A. Ag(3) and Ag(4) make the stronger bonds. Bader charge analysis indicates a mild electron transfer from the base to the clusters for all bases, except T. The donor bases (C, G, and A) bind to the sites on the cluster where the lowest unoccupied molecular orbital has a pronounced protrusion. The site where cluster binds to the base is controlled by the shape of the higher occupied states of the base. Time-dependent DFT calculations show that different base-cluster isomers may have very different absorption spectra. In particular, we find new excitations in base-cluster molecules, at energies well below those of the isolated components, and with strengths that depend strongly on the orientations of planar clusters with respect to the base planes. Our results suggest that geometric constraints on binding, imposed by designed DNA structures, may be a feasible route to engineering the selection of specific cluster-base assemblies.

  4. Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

    PubMed

    Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

    2018-05-23

    Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

  5. Purification and DNA-binding properties of the cro-type regulatory repressor protein cng encoded by the Lactobacillus plantarum phage phi g1e.

    PubMed

    Kakikawa, M; Ohkubo, S; Sakate, T; Sayama, M; Taketo, A; Kodaira, K

    2000-05-16

    The putative repressor protein Cng (10kDa on an SDS gel) for the lytic pathway of Lactobacillus plantarum phage φg1e was purified using the Escherichia coli Pt7 system, and its DNA-binding ability for the seven operator-like sequences, the GATAC-boxes (Gb1 to Gb7), was investigated in vitro. In gel-shift assays, Cng selectively bound to the DNA fragments containing the GATAC-box(es). In addition, DNase I footprinting analysis with supercoiled DNA demonstrated that Cng can specifically cover about a 25bp region centered around each of the GATAC-boxes, although two boxes, Gb4 and Gb6, were only partially protected. Moreover, protein crosslinking experiments using glutaraldehyde suggested that Cng most likely functions as a dimer. On the other hand, the binding ability of Cpg for the GATAC-boxes in supercoiled DNA was also examined under the same conditions as in Cng; unlike Cng, Cpg covered Gb4 and Gb6 completely sufficiently as well as the other five boxes. Thus, the present and previous [Kakikawa et al., Gene 215 (1998) 371-379; 242 (2000) 155-166] results indicate a possibility that the two proteins Cng and Cpg selectively bind to the GATAC-boxes that act as operators, and can decide between the lytic or lysogenic pathways through repression of the promoter activity of P(R) as well as P(L).

  6. DNA-histone complexes as ligands amplify cell penetration and nuclear targeting of anti-DNA antibodies via energy-independent mechanisms.

    PubMed

    Zannikou, Markella; Bellou, Sofia; Eliades, Petros; Hatzioannou, Aikaterini; Mantzaris, Michael D; Carayanniotis, George; Avrameas, Stratis; Lymberi, Peggy

    2016-01-01

    We have generated three monoclonal cell-penetrating antibodies (CPAbs) from a non-immunized lupus-prone (NZB × NZW)F1 mouse that exhibited high anti-DNA serum titres. These CPAbs are polyreactive because they bind to DNA and other cellular components, and localize mainly in the nucleus of HeLa cells, albeit with a distinct nuclear labelling profile. Herein, we have examined whether DNA-histone complexes (DHC) binding to CPAbs, before cell entry, could modify the cell penetration of CPAbs or their nuclear staining properties. By applying confocal microscopy and image analysis, we found that extracellular binding of purified CPAbs to DHC significantly enhanced their subsequent cell-entry, both in terms of percentages of positively labelled cells and fluorescence intensity (internalized CPAb amount), whereas there was a variable effect on their nuclear staining profile. Internalization of CPAbs, either alone or bound to DHC, remained unaltered after the addition of endocytosis-specific inhibitors at 37° or assay performance at 4°, suggesting the involvement of energy-independent mechanisms in the internalization process. These findings assign to CPAbs a more complex pathogenetic role in systemic lupus erythematosus where both CPAbs and nuclear components are abundant. © 2015 John Wiley & Sons Ltd.

  7. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-05

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  8. TRX-LOGOS - a graphical tool to demonstrate DNA information content dependent upon backbone dynamics in addition to base sequence.

    PubMed

    Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A

    2015-01-01

    It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software for molecular evolutionary genetics analysis to visually compare the human Forkhead box/FOX protein evolution to its binding site evolution. We also compared the DNA binding signatures of human TP53 tumor suppressor determined by two different laboratory methods (SELEX and ChIP-seq). Further analysis of the entire yeast genome, center aligned at the start codon, also revealed a distinct sequence-independent 3 bp periodic pattern in information content, present only in coding region, and perhaps indicative of the non-random organization of the genetic code. TRX-LOGOS is useful in any situation in which important information content in DNA can be better visualized at the positions of phosphate linkages (i.e. dinucleotides) where the dynamic properties of the DNA backbone functions to facilitate DNA-protein interaction.

  9. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor.

    PubMed

    Zhang, Xirui; Daaboul, George G; Spuhler, Philipp S; Dröge, Peter; Ünlü, M Selim

    2016-03-14

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.

  10. 'Petite' mutagenesis and mitotic crossing-over in yeast by DNA-targeted alkylating agents.

    PubMed

    Ferguson, L R; Turner, P M; Gourdie, T A; Valu, K K; Denny, W A

    1989-12-01

    Although the biological properties (cytotoxicity, mutagenicity and carcinogenicity) of alkylating agents result from their bonding interactions with DNA, such compounds generally do not show any special binding affinity for DNA. A series of acridine-linked aniline mustards of widely-varying alkylator reactivity have been designed as DNA-directed alkylating agents. We have considered whether such DNA targeting has an effect on mutagenic properties by evaluating this series of drugs in comparison with their untargeted counterparts for toxic, recombinogenic and mutagenic properties in Saccharomyces cerevisiae strain D5. The simple untargeted aniline mustards are effective inducers of mitotic crossing-over in this strain, but resemble other reported alkylators in being rather inefficient inducers of the "petite" or mitochondrial mutation in yeast. However, the majority of the DNA-targeted mustards were very efficient petite mutagens, while showing little evidence of mitotic crossing-over or other nuclear events. The 100% conversion of cells into petites and the lack of a differential between growing and non-growing cells are similar to the effects of the well characterised mitochondrial mutagen ethidium bromide. These data suggest very different modes of action between the DNA-targeted alkylators and their non-targeted counterparts.

  11. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    PubMed

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  12. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  13. Regular square planer bis-(4,4,4-trifluoro-1-(thiophen-2-yl)butane-1,3-dione)/copper(II) complex: Trans/cis-DFT isomerization, crystal structure, thermal, solvatochromism, hirshfeld surface and DNA-binding analysis

    NASA Astrophysics Data System (ADS)

    Hema, M. K.; Karthik, C. S.; Warad, Ismail; Lokanath, N. K.; Zarrouk, Abdelkader; Kumara, Karthik; Pampa, K. J.; Mallu, P.

    2018-04-01

    Trans-[Cu(O∩O)2] complex, O∩O = 4,4,4-trifluoro-1-(thiophen-2-yl)butane-1,3-dione was reported with high potential toward CT-DNA binder. The solved XRD-structure of complex indicated a perfect regular square-planer geometry around the Cu(II) center. The trans/cis-DFT-isomerization calculation supported the XRD seen in reflecting the trans-isomer as the kinetic-favor isomer. The desired complex structure was also characterized by conductivity measurement, CHN-elemental analyses, MS, EDX, SEM, UV-Vis., FT-IR, HAS and TG/DTG. The Solvatochromism behavior of the complex was evaluated using four different polar solvents. MPE and Hirshfeld surface analysis (HSA) come to an agreement that fluoride and thiophene protons atoms are with suitable electro-potential environment to form non-classical H-bonds of type CThsbnd H⋯F. The DNA-binding properties were investigated by viscosity tests and spectrometric titrations, the results revealed the complex as strong calf-thymus DNA binder. High intrinsic-binding constants value ∼1.8 × 105 was collected.

  14. DNA Binding, Cleavage and Antibacterial Activity of Mononuclear Cu(II), Ni(II) and Co(II) Complexes Derived from Novel Benzothiazole Schiff Bases.

    PubMed

    Vamsikrishna, Narendrula; Kumar, Marri Pradeep; Tejaswi, Somapangu; Rambabu, Aveli; Shivaraj

    2016-07-01

    A series of novel bivalent metal complexes M(L1)2 and M(L2)2 where M = Cu(II), Ni(II), Co(II) and L1 = 2-((benzo [d] thiazol-6-ylimino)methyl)-4-bromophenol [BTEMBP], L2 = 1-((benzo [d] thiazol-6-ylimino)methyl) naphthalen-2-ol [BTEMNAPP] were synthesized. All the compounds have been characterized by elemental analysis, SEM, Mass, (1)H NMR, (13)C NMR, UV-Vis, IR, ESR, spectral data and magnetic susceptibility measurements. Based on the analytical and spectral data four-coordinated square planar geometry is assigned to all the complexes. DNA binding properties of these complexes have been investigated by electronic absorption spectroscopy, fluorescence and viscosity measurements. It is observed that these binary complexes strongly bind to calf thymus DNA by an intercalation mode. DNA cleavage efficacy of these complexes was tested in presence of H2O2 and UV light by gel electrophoresis and found that all the complexes showed better nuclease activity. Finally the compounds were screened for antibacterial activity against few pathogens and found that the complexes have potent biocidal activity than their free ligands.

  15. The helical structure of DNA facilitates binding

    NASA Astrophysics Data System (ADS)

    Berg, Otto G.; Mahmutovic, Anel; Marklund, Emil; Elf, Johan

    2016-09-01

    The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction-diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general.

  16. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    PubMed Central

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  17. Comparison of the protein-protein interfaces in the p53-DNA crystal structures: towards elucidation of the biological interface.

    PubMed

    Ma, Buyong; Pan, Yongping; Gunasekaran, K; Venkataraghavan, R Babu; Levine, Arnold J; Nussinov, Ruth

    2005-03-15

    p53, the tumor suppressor protein, functions as a dimer of dimers. However, how the tetramer binds to the DNA is still an open question. In the crystal structure, three copies of the p53 monomers (containing chains A, B, and C) were crystallized with the DNA-consensus element. Although the structure provides crucial data on the p53-DNA contacts, the active oligomeric state is unclear because the two dimeric (A-B and B-C) interfaces present in the crystal cannot both exist in the tetramer. Here, we address the question of which of these two dimeric interfaces may be more biologically relevant. We analyze the sequence and structural properties of the p53-p53 dimeric interfaces and carry out extensive molecular dynamics simulations of the crystal structures of the human and mouse p53 dimers. We find that the A-B interface residues are more conserved than those of the B-C. Molecular dynamics simulations show that the A-B interface can provide a stable DNA-binding motif in the dimeric state, unlike B-C. Our results indicate that the interface between chains A-B in the p53-DNA complex constitutes a better candidate for a stable biological interface, whereas the B-C interface is more likely to be due to crystal packing. Thus, they have significant implications toward our understanding of DNA binding by p53 as well as p53-mediated interactions with other proteins.

  18. Coupled binding-bending-folding: The complex conformational dynamics of protein-DNA binding studied by atomistic molecular dynamics simulations.

    PubMed

    van der Vaart, Arjan

    2015-05-01

    Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.

  19. Role of allosteric switch residue histidine 195 in maintaining active-site asymmetry in presynaptic filaments of bacteriophage T4 UvsX recombinase.

    PubMed

    Farb, Joshua N; Morrical, Scott W

    2009-01-16

    Recombinases of the highly conserved RecA/Rad51 family play central roles in homologous recombination and DNA double-stranded break repair. RecA/Rad51 enzymes form presynaptic filaments on single-stranded DNA (ssDNA) that are allosterically activated to catalyze ATPase and DNA strand-exchange reactions. Information is conveyed between DNA- and ATP-binding sites, in part, by a highly conserved glutamine residue (Gln194 in Escherichia coli RecA) that acts as an allosteric switch. The T4 UvsX protein is a divergent RecA ortholog and contains histidine (His195) in place of glutamine at the allosteric switch position. UvsX and RecA catalyze similar strand-exchange reactions, but differ in other properties. UvsX produces both ADP and AMP as products of its ssDNA-dependent ATPase activity--a property that is unique among characterized recombinases. Details of the kinetics of ssDNA-dependent ATP hydrolysis reactions indicate that UvsX-ssDNA presynaptic filaments are asymmetric and contain two classes of ATPase active sites: one that generates ADP, and another that generates AMP. Active-site asymmetry is reduced by mutations at the His195 position, since UvsX-H195Q and UvsX-H195A mutants both exhibit stronger ssDNA-dependent ATPase activity, with lower cooperativity and markedly higher ADP/AMP product ratios, than wild-type UvsX. Reduced active-site asymmetry correlates strongly with reduced ssDNA-binding affinity and DNA strand-exchange activity in both H195Q and H195A mutants. These and other results support a model in which allosteric switch residue His195 controls the formation of an asymmetric conformation of UvsX-ssDNA filaments that is active in DNA strand exchange. The implications of our findings for UvsX recombination functions, and for RecA functions in general, are discussed.

  20. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  1. Synthesis, crystal structure and interaction of L-valine Schiff base divanadium(V) complex containing a V2O3 core with DNA and BSA.

    PubMed

    Guo, Qiong; Li, Lianzhi; Dong, Jianfang; Liu, Hongyan; Xu, Tao; Li, Jinghong

    2013-04-01

    A divanadium(V) complex, [V2O3(o-van-val)2] (o-van-val=Schiff base derived from o-vanillin and L-valine), has been synthesized and structurally characterized. The crystal structure shows that both of the vanadium centers in the complex have a distorted octahedral coordination environment composed of tridentate Schiff base ligand. A V2O3 core in molecular structure adopts intermediate between cis and trans configuration with the O1V1⋯V1AO1A torsion angle 115.22 (28)° and the V1⋯V1A distance 3.455Å. The binding properties of the complex with calf thymus DNA (CT-DNA) have been investigated by UV-vis absorption, fluorescence, CD spectra and viscosity measurement. The results indicate that the complex binds to CT-DNA in non-classical intercalative mode. Meanwhile, the interaction of the complex with bovine serum albumin (BSA) has been studied by UV-vis absorption, fluorescence and CD spectra. Results indicated that the complex can markedly quench the intrinsic fluorescence of BSA via a static quenching process, and cause its conformational change. The calculated apparent binding constant Kb was 1.05×10(6)M(-1) and the binding site number n was 1.18. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Monitoring ssDNA Binding to the DnaB Helicase from Helicobacter pylori by Solid-State NMR Spectroscopy.

    PubMed

    Wiegand, Thomas; Cadalbert, Riccardo; Gardiennet, Carole; Timmins, Joanna; Terradot, Laurent; Böckmann, Anja; Meier, Beat H

    2016-11-02

    DnaB helicases are bacterial, ATP-driven enzymes that unwind double-stranded DNA during DNA replication. Herein, we study the sequential binding of the "non-hydrolysable" ATP analogue AMP-PNP and of single-stranded (ss) DNA to the dodecameric DnaB helicase from Helicobacter pylori using solid-state NMR. Phosphorus cross-polarization experiments monitor the binding of AMP-PNP and DNA to the helicase. 13 C chemical-shift perturbations (CSPs) are used to detect conformational changes in the protein upon binding. The helicase switches upon AMP-PNP addition into a conformation apt for ssDNA binding, and AMP-PNP is hydrolyzed and released upon binding of ssDNA. Our study sheds light on the conformational changes which are triggered by the interaction with AMP-PNP and are needed for ssDNA binding of H. pylori DnaB in vitro. They also demonstrate the level of detail solid-state NMR can provide for the characterization of protein-DNA interactions and the interplay with ATP or its analogues. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Synthesis of mouse centromere-targeted polyamides and physico-chemical studies of their interaction with the target double-stranded DNA.

    PubMed

    Nozeret, Karine; Bonan, Marc; Yarmoluk, Serguiy M; Novopashina, Darya S; Boutorine, Alexandre S

    2015-09-01

    Synthetic minor groove-binding pyrrole-imidazole polyamides labeled by fluorophores are promising candidates for fluorescence imaging of double-stranded DNA in isolated chromosomes or fixed and living cells. We synthesized nine hairpin and two head-to-head tandem polyamides targeting repeated sequences from mouse major satellites. Their interaction with synthetic target dsDNA has been studied by physico-chemical methods in vitro before and after coupling to various fluorophores. Great variability in affinities and fluorescence properties reveals a conclusion that these properties do not only rely on recognition rules, but also on other known and unknown structural factors. Individual testing of each probe is needed before cellular applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  5. Binding of undamaged double stranded DNA to vaccinia virus uracil-DNA glycosylase

    DOE PAGES

    Schormann, Norbert; Banerjee, Surajit; Ricciardi, Robert; ...

    2015-06-02

    Background: Uracil-DNA glycosylases are evolutionarily conserved DNA repair enzymes. However, vaccinia virus uracil-DNA glycosylase (known as D4), also serves as an intrinsic and essential component of the processive DNA polymerase complex during DNA replication. In this complex D4 binds to a unique poxvirus specific protein A20 which tethers it to the DNA polymerase. At the replication fork the DNA scanning and repair function of D4 is coupled with DNA replication. So far, DNA-binding to D4 has not been structurally characterized. Results: This manuscript describes the first structure of a DNA-complex of a uracil-DNA glycosylase from the poxvirus family. This alsomore » represents the first structure of a uracil DNA glycosylase in complex with an undamaged DNA. In the asymmetric unit two D4 subunits bind simultaneously to complementary strands of the DNA double helix. Each D4 subunit interacts mainly with the central region of one strand. DNA binds to the opposite side of the A20-binding surface on D4. In comparison of the present structure with the structure of uracil-containing DNA-bound human uracil-DNA glycosylase suggests that for DNA binding and uracil removal D4 employs a unique set of residues and motifs that are highly conserved within the poxvirus family but different in other organisms. Conclusion: The first structure of D4 bound to a truly non-specific undamaged double-stranded DNA suggests that initial binding of DNA may involve multiple non-specific interactions between the protein and the phosphate backbone.« less

  6. Paramagnetic decoration of DNA origami nanostructures by Eu³⁺ coordination.

    PubMed

    Opherden, Lars; Oertel, Jana; Barkleit, Astrid; Fahmy, Karim; Keller, Adrian

    2014-07-15

    The folding of DNA into arbitrary two- and three-dimensional shapes, called DNA origami, represents a powerful tool for the synthesis of functional nanostructures. Here, we present the first approach toward the paramagnetic functionalization of DNA origami nanostructures by utilizing postassembly coordination with Eu(3+) ions. In contrast to the usual formation of toroidal dsDNA condensates in the presence of trivalent cations, planar as well as rod-like DNA origami maintain their shape and monomeric state even under high loading with the trivalent lanthanide. Europium coordination was demonstrated by the change in Eu(3+) luminescence upon binding to the two DNA origami. Their natural circular dichroism in the Mg(2+)- and Eu(3+)-bound state was found to be very similar to that of genomic DNA, evidencing little influence of the DNA origami superstructure on the local chirality of the stacked base pairs. In contrast, the magnetic circular dichroism of the Mg(2+)-bound DNA origami deviates from that of genomic DNA. Furthermore, the lanthanide affects the magnetic properties of DNA in a superstructure-dependent fashion, indicative of the existence of superstructure-specific geometry of Eu(3+) binding sites in the DNA origami that are not formed in genomic DNA. This simple approach lays the foundation for the generation of magneto-responsive DNA origami nanostructures. Such systems do not require covalent modifications and can be used for the magnetic manipulation of DNA nanostructures or for the paramagnetic alignment of molecules in NMR spectroscopy.

  7. In vitro antioxidant properties, DNA damage protective activity, and xanthine oxidase inhibitory effect of cajaninstilbene acid, a stilbene compound derived from pigeon pea [Cajanus cajan (L.) Millsp.] leaves.

    PubMed

    Wu, Nan; Kong, Yu; Fu, Yujie; Zu, Yuangang; Yang, Zhiwei; Yang, Mei; Peng, Xiao; Efferth, Thomas

    2011-01-12

    The antioxidant properties, DNA damage protective activities, and xanthine oxidase (XOD) inhibitory effect of cajaninstilbene acid (CSA) derived from pigeon pea leaves were studied in the present work. Compared with resveratrol, CSA showed stronger antioxidant properties, DNA damage protective activity, and XOD inhibition activity. The IC(50) values of CSA for superoxide radical scavenging, hydroxyl radical scavenging, nitric oxide scavenging, reducing power, lipid peroxidation, and XOD inhibition were 19.03, 6.36, 39.65, 20.41, 20.58, and 3.62 μM, respectively. CSA possessed good protective activity from oxidative DNA damage. Furthermore, molecular docking indicated that CSA was more potent than resveratrol or allopurinol to interact with the active site of XOD (calculated free binding energy: -229.71 kcal mol(-1)). On the basis of the results, we conclude that CSA represents a valuable natural antioxidant source and may potentially be applicable in health food industry.

  8. Curated collection of yeast transcription factor DNA binding specificity data reveals novel structural and gene regulatory insights

    PubMed Central

    2011-01-01

    Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060

  9. DNA-linked NanoParticle Lattices with Diamond Symmetry: Stability, Shape and Optical Properties

    NASA Astrophysics Data System (ADS)

    Emamy, Hamed; Tkachenko, Alexei; Gang, Oleg; Starr, Francis

    The linking of nanoparticles (NP) by DNA has been proven to be an effective means to create NP lattices with specific order. Lattices with diamond symmetry are predicted to offer novel photonic properties, but self-assembly of such lattices has proven to be challenging due to the low packing fraction, sensitivity to bond orientation, and local heterogeneity. Recently, we reported an approach to create diamond NP lattices based on the association between anisotropic particles with well-defined tetravalent DNA binding topology and isotropically functionalized NP. Here, we use molecular dynamics simulations to evaluate the Gibbs free energy of these lattices, and thereby determine the stability of these lattices as a function of NP size and DNA stiffness. We also predict the equilibrium shape for the cubic diamond crystallite using the Wulff construction method. Specifically, we predict the equilibrium shape using the surface energy for different crystallographic planes. We evaluate surface energy directly form molecular dynamics simulation, which we correlate with theoretical estimates from the expected number of broken DNA bonds along a facet. Furthermore we study the optical properties of this structure, e.g optical bandgap.

  10. Interaction of DNA with Simple and Mixed Ligand Copper(II) Complexes of 1,10-Phenanthrolines as Studied by DNA-Fiber EPR Spectroscopy

    PubMed Central

    Chikira, Makoto; Ng, Chew Hee; Palaniandavar, Mallayan

    2015-01-01

    The interaction of simple and ternary Cu(II) complexes of 1,10-phenanthrolines with DNA has been studied extensively because of their various interesting and important functions such as DNA cleavage activity, cytotoxicity towards cancer cells, and DNA based asymmetric catalysis. Such functions are closely related to the DNA binding modes of the complexes such as intercalation, groove binding, and electrostatic surface binding. A variety of spectroscopic methods have been used to study the DNA binding mode of the Cu(II) complexes. Of all these methods, DNA-fiber electron paramagnetic resonance (EPR) spectroscopy affords unique information on the DNA binding structures of the complexes. In this review we summarize the results of our DNA-fiber EPR studies on the DNA binding structure of the complexes and discuss them together with the data accumulated by using other measurements. PMID:26402668

  11. The effect of novel rhenium compounds on lymphosarcoma, PC-3 prostate and myeloid leukemia cancer cell lines and an investigation on the DNA binding properties of one of these compounds through electronic spectroscopy

    PubMed Central

    Parson, Carl; Smith, Valerie; Krauss, Christopher; Banerjee, Hirendra N.; Reilly, Christopher; Krause, Jeanette A.; Wachira, James M.; Giri, Dipak; Winstead, Angela; Mandal, Santosh K.

    2014-01-01

    Despite the tremendous success of cisplatin and other platinum-based anticancer drugs, severe toxicity and resistance to tumors limit their applications. It is believed that the coordination (formation of covalent bond) of the metal (platinum) to the nitrogen bases of DNA cause the ruptures of the cancer as well as normal cells. A search for anticancer drugs with different modes of action resulted in the synthesis of variety of novel compounds. Many of them are in clinical trials now. Recently we synthesized a series of novel rhenium pentylcarbonato compounds (PC1–PC6). The rhenium atom in each compound is coordinated (bonded) to a planar polypyridyl aromatic ligand, thereby forcing each compound to intercalate between the DNA bases. We have investigated the DNA binding properties of one of the PC-series of compounds (PC6) using electronic spectroscopy. The UV absorption titration of PC6 with DNA shows hypochromic effect with concomitant bathochromic shift of the charge transfer band at 290 nm. These results suggest that the compound PC6 binds to DNA through intercalation. It is therefore likely that the other PC-series of compounds will behave in a similar manner. Thus it is expected that these compounds will exhibit negligible or no side effect. We have observed that the PC-series of compounds are strong cytotoxic agents against lymphosarcoma (average GI50 ≈ 2±2.6 µM), PC-3 prostate (average GI50 ≈ 3±2.8 µM) and myeloid leukemia (average GI50 ≈ 3±2.8 µM) cancer cell lines. The average GI50 values of the PC-series of compounds are 2–3 less than the corresponding GI50 values of cisplatin. Also each of the PC-series of compounds exhibits less toxicity than cisplatin in the glomerular mesangial cells. PMID:25221731

  12. Changes in the zero-point energy of the protons as the source of the binding energy of water to A-phase DNA.

    PubMed

    Reiter, G F; Senesi, R; Mayers, J

    2010-10-01

    The measured changes in the zero-point kinetic energy of the protons are entirely responsible for the binding energy of water molecules to A phase DNA at the concentration of 6  water molecules/base pair. The changes in kinetic energy can be expected to be a significant contribution to the energy balance in intracellular biological processes and the properties of nano-confined water. The shape of the momentum distribution in the dehydrated A phase is consistent with coherent delocalization of some of the protons in a double well potential, with a separation of the wells of 0.2 Å.

  13. MCM ring hexamerization is a prerequisite for DNA-binding

    DOE PAGES

    Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

    2015-09-13

    The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

  14. Investigations on the Interactions of 5-Fluorouracil with Herring Sperm DNA: Steady State/Time Resolved and Molecular Modeling Studies

    NASA Astrophysics Data System (ADS)

    Chinnathambi, Shanmugavel; Karthikeyan, Subramani; Velmurugan, Devadasan; Hanagata, Nobutaka; Aruna, Prakasarao; Ganesan, Singaravelu

    2015-04-01

    In the present study, the interaction of 5-Fluorouracil with herring sperm DNA is reported using spectroscopic and molecular modeling techniques. This binding study of 5-FU with hs-DNA is of paramount importance in understanding chemico-biological interactions for drug design, pharmacy and biochemistry without altering the original structure. The challenge of the study was to find the exact binding mode of the drug 5-Fluorouracil with hs-DNA. From the absorption studies, a hyperchromic effect was observed for the herring sperm DNA in the presence of 5-Fluorouracil and a binding constant of 6.153 × 103 M-1 for 5-Fluorouracil reveals the existence of weak interaction between the 5-Fluorouracil and herring sperm DNA. Ethidium bromide loaded herring sperm DNA showed a quenching in the fluorescence intensity after the addition of 5-Fluorouracil. The binding constants for 5-Fluorouracil stranded DNA and competitive bindings of 5-FU interacting with DNA-EB systems were examined by fluorescence spectra. The Stern-Volmer plots and fluorescence lifetime results confirm the static quenching nature of the drug-DNA complex. The binding constant Kb was 2.5 × 104 L mol-1 and the number of binding sites are 1.17. The 5-FU on DNA system was calculated using double logarithmic plot. From the Forster nonradiative energy transfer study it has been found that the distance of 5-FU from DNA was 4.24 nm. In addition to the spectroscopic results, the molecular modeling studies also revealed the major groove binding as well as the partial intercalation mode of binding between the 5-Fluorouracil and herring sperm DNA. The binding energy and major groove binding as -6.04 kcal mol-1 and -6.31 kcal mol-1 were calculated from the modeling studies. All the testimonies manifested that binding modes between 5-Fluorouracil and DNA were evidenced to be groove binding and in partial intercalative mode.

  15. Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films

    NASA Astrophysics Data System (ADS)

    Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha

    2017-10-01

    We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ˜[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ˜[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current-voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped SDNA complex.

  16. Application of an in vitro DNA protection assay to visualize stress mediation properties of the Dps protein.

    PubMed

    Karas, Vlad O; Westerlaken, Ilja; Meyer, Anne S

    2013-05-31

    Oxidative stress is an unavoidable byproduct of aerobic life. Molecular oxygen is essential for terrestrial metabolism, but it also takes part in many damaging reactions within living organisms. The combination of aerobic metabolism and iron, which is another vital compound for life, is enough to produce radicals through Fenton chemistry and degrade cellular components. DNA degradation is arguably the most damaging process involving intracellular radicals, as DNA repair is far from trivial. The assay presented in this article offers a quantitative technique to measure and visualize the effect of molecules and enzymes on radical-mediated DNA damage. The DNA protection assay is a simple, quick, and robust tool for the in vitro characterization of the protective properties of proteins or chemicals. It involves exposing DNA to a damaging oxidative reaction and adding varying concentrations of the compound of interest. The reduction or increase of DNA damage as a function of compound concentration is then visualized using gel electrophoresis. In this article we demonstrate the technique of the DNA protection assay by measuring the protective properties of the DNA-binding protein from starved cells (Dps). Dps is a mini-ferritin that is utilized by more than 300 bacterial species to powerfully combat environmental stressors. Here we present the Dps purification protocol and the optimized assay conditions for evaluating DNA protection by Dps.

  17. Recent Insight into the Kinetic Mechanisms and Conformational Dynamics of Y-Family DNA Polymerases

    PubMed Central

    2015-01-01

    The kinetic mechanisms by which DNA polymerases catalyze DNA replication and repair have long been areas of active research. Recently discovered Y-family DNA polymerases catalyze the bypass of damaged DNA bases that would otherwise block replicative DNA polymerases and stall replication forks. Unlike DNA polymerases from the five other families, the Y-family DNA polymerases have flexible, solvent-accessible active sites that are able to tolerate various types of damaged template bases and allow for efficient lesion bypass. Their promiscuous active sites, however, also lead to fidelities that are much lower than those observed for other DNA polymerases and give rise to interesting mechanistic properties. Additionally, the Y-family DNA polymerases have several other unique structural features and undergo a set of conformational changes during substrate binding and catalysis different from those observed for replicative DNA polymerases. In recent years, pre-steady-state kinetic methods have been extensively employed to reveal a wealth of information about the catalytic properties of these fascinating noncanonical DNA polymerases. Here, we review many of the recent findings on the kinetic mechanisms of DNA polymerization with undamaged and damaged DNA substrates by the Y-family DNA polymerases, and the conformational dynamics employed by these error-prone enzymes during catalysis. PMID:24716482

  18. Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

    PubMed

    Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2017-09-01

    DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

    PubMed

    Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

    2017-08-01

    Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

  20. Non-Watson–Crick interactions between PNA and DNA inhibit the ATPase activity of bacteriophage T4 Dda helicase

    PubMed Central

    Tackett, Alan J.; Corey, David R.; Raney, Kevin D.

    2002-01-01

    Peptide nucleic acid (PNA) is a DNA mimic in which the nucleobases are linked by an N-(2-aminoethyl) glycine backbone. Here we report that PNA can interact with single-stranded DNA (ssDNA) in a non-sequence-specific fashion. We observed that a 15mer PNA inhibited the ssDNA-stimulated ATPase activity of a bacteriophage T4 helicase, Dda. Surprisingly, when a fluorescein-labeled 15mer PNA was used in binding studies no interaction was observed between PNA and Dda. However, fluorescence polarization did reveal non-sequence-specific interactions between PNA and ssDNA. Thus, the inhibition of ATPase activity of Dda appears to result from depletion of the available ssDNA due to non-Watson–Crick binding of PNA to ssDNA. Inhibition of the ssDNA-stimulated ATPase activity was observed for several PNAs of varying length and sequence. To study the basis for this phenomenon, we examined self-aggregation by PNAs. The 15mer PNA readily self-aggregates to the point of precipitation. Since PNAs are hydrophobic, they aggregate more than DNA or RNA, making the study of this phenomenon essential for understanding the properties of PNA. Non-sequence-specific interactions between PNA and ssDNA were observed at moderate concentrations of PNA, suggesting that such interactions should be considered for antisense and antigene applications. PMID:11842106

  1. Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

    PubMed

    Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

    2012-06-01

    DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. THAP5 is a DNA-binding transcriptional repressor that is regulated in melanoma cells during DNA damage-induced cell death

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balakrishnan, Meenakshi P.; Cilenti, Lucia; Ambivero, Camilla

    2011-01-07

    Research highlights: {yields} THAP5 is a DNA-binding protein and a transcriptional repressor. {yields} THAP5 is induced in melanoma cells upon exposure to UV or treatment with cisplatin. {yields} THAP5 induction correlates with the degree of apoptosis in melanoma cell population. {yields} THAP5 is a pro-apoptotic protein involved in melanoma cell death. -- Abstract: THAP5 was originally isolated as a specific interactor and substrate of the mitochondrial pro-apoptotic Omi/HtrA2 protease. It is a human zinc finger protein characterized by a restricted pattern of expression and the lack of orthologs in mouse and rat. The biological function of THAP5 is unknown butmore » our previous studies suggest it could regulate G2/M transition in kidney cells and could be involved in human cardiomyocyte cell death associated with coronary artery disease (CAD). In this report, we expanded our studies on the properties and function of THAP5 in human melanoma cells. THAP5 was expressed in primary human melanocytes as well as in all melanoma cell lines that were tested. THAP5 protein level was significantly induced by UV irradiation or cisplatin treatment, conditions known to cause DNA damage. The induction of THAP5 correlated with a significant increase in apoptotic cell death. In addition, we show that THAP5 is a nuclear protein that could recognize and bind a specific DNA motif. THAP5 could also repress the transcription of a reporter gene in a heterologous system. Our work suggests that THAP5 is a DNA-binding protein and a transcriptional repressor. Furthermore, THAP5 has a pro-apoptotic function and it was induced in melanoma cells under conditions that promoted cell death.« less

  3. Investigating DNA Binding and Conformational Variation in Temperature Sensitive p53 Cancer Mutants Using QM-MM Simulations

    PubMed Central

    Koulgi, Shruti; Achalere, Archana; Sonavane, Uddhavesh; Joshi, Rajendra

    2015-01-01

    The tp53 gene is found to be mutated in 50% of all the cancers. The p53 protein, a product of tp53 gene, is a multi-domain protein. It consists of a core DNA binding domain (DBD) which is responsible for its binding and transcription of downstream target genes. The mutations in p53 protein are responsible for creating cancerous conditions and are found to be occurring at a high frequency in the DBD region of p53. Some of these mutations are also known to be temperature sensitive (ts) in nature. They are known to exhibit partial or strong binding with DNA in the temperature range (298–306 K). Whereas, at 310 K and above they show complete loss in binding. We have analyzed the changes in binding and conformational behavior at 300 K and 310 K for three of the ts-mutants viz., V143A, R249S and R175H. QM-MM simulations have been performed on the wild type and the above mentioned ts-mutants for 30 ns each. The optimal estimate of free energy of binding for a particular number of interface hydrogen bonds was calculated using the maximum likelihood method as described by Chodera et. al (2007). This parameter has been observed to be able to mimic the binding affinity of the p53 ts-mutants at 300 K and 310 K. Thus the correlation between MM-GBSA free energy of binding and hydrogen bonds formed by the interface residues between p53 and DNA has revealed the temperature dependent nature of these mutants. The role of main chain dihedrals was obtained by performing dihedral principal component analysis (PCA). This analysis, suggests that the conformational variations in the main chain dihedrals (ϕ and ψ) of the p53 ts-mutants may have caused reduction in the overall stability of the protein. The solvent exposure of the side chains of the interface residues were found to hamper the binding of the p53 to the DNA. Solvent Accessible Surface Area (SASA) also proved to be a crucial property in distinguishing the conformers obtained at 300 K and 310 K for the three ts-mutants from the wild type at 300 K. PMID:26579714

  4. Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

    PubMed Central

    Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

    2016-01-01

    Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

  5. Recognition of RNA by amide modified backbone nucleic acids: molecular dynamics simulations of DNA-RNA hybrids in aqueous solution.

    PubMed

    Nina, Mafalda; Fonné-Pfister, Raymonde; Beaudegnies, Renaud; Chekatt, Habiba; Jung, Pierre M J; Murphy-Kessabi, Fiona; De Mesmaeker, Alain; Wendeborn, Sebastian

    2005-04-27

    Thermodynamic and structural properties of a chemically modified DNA-RNA hybrid in which a phosphodiester linkage is replaced by a neutral amide-3 linkage (3'-CH(2)-CONH-5') were investigated using UV melting experiments, molecular dynamics simulations in explicit water, and continuum solvent models. van't Hoff analysis of the experimental UV melting curves suggests that the significant increase of the thermodynamic stability of a 15-mer DNA-RNA with seven alternated amide-3 modifications (+11 degrees C) is mainly due to an increased binding enthalpy. To further evaluate the origin in the observed affinities differences, the electrostatic contribution to the binding free energy was calculated by solving the Poisson-Boltzmann equation numerically. The nonelectrostatic contribution was estimated as the product of a hydrophobic surface tension coefficient and the surface area that is buried upon double strand formation. Structures were taken from 10 ns molecular dynamics simulations computed in a consistent fashion using explicit solvent, counterions, and the particle-mesh Ewald procedure. The present preliminary thermodynamic study suggests that the favorable binding free energy of the amide-3 DNA single strand to the complementary RNA is equally driven by electrostatic and nonpolar contributions to the binding compared to their natural analogues. In addition, molecular dynamics simulations in explicit water were performed on an amide-3 DNA single strand and the corresponding natural DNA. Results from the conformations cluster analysis of the simulated amide-3 DNA single strand ensembles suggest that the 25% of the population sampled within 10 ns has a pre-organized conformation where the sugar C3' endo pucker is favored at the 3'-flanking nucleotides. These structural and thermodynamic features contribute to the understanding of the observed increased affinities of the amide-3 DNA-RNA hybrids at the microscopic level.

  6. In silico characterization and analysis of RTBP1 and NgTRF1 protein through MD simulation and molecular docking - A comparative study.

    PubMed

    Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran

    2015-02-06

    Gaining access to sequence and structure information of telomere binding proteins helps in understanding the essential biological processes involve in conserved sequence specific interaction between DNA and the proteins. Rice telomere binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix turn helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain but till now there is very less communication on the in silico studies of these complete proteins.Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK web server.Digging up all the facts about the proteins it was reveled that around 120 amino acids in the tail part was showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicates the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and Energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.

  7. In Silico Characterization and Analysis of RTBP1 and NgTRF1 Protein Through MD Simulation and Molecular Docking: A Comparative Study.

    PubMed

    Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran

    2015-09-01

    Gaining access to sequence and structure information of telomere-binding proteins helps in understanding the essential biological processes involve in conserved sequence-specific interaction between DNA and the proteins. Rice telomere-binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix-turn-helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain, but till now there is very less communication on the in silico studies of these complete proteins. Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK Web server. By digging up all the facts about the proteins, it was revealed that around 120 amino acids in the tail part were showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicate the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA-binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.

  8. Structural and biophysical analysis of interactions between cod and human uracil-DNA N-glycosylase (UNG) and UNG inhibitor (Ugi)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Assefa, Netsanet Gizaw; Niiranen, Laila; University of Turku, FIN-20014 Turku

    2014-08-01

    A structural and biophysical study of the interactions between cod and human uracil-DNA N-glycosylase (UNG) and their inhibitor Ugi is presented. The stronger interaction between cod UNG and Ugi can be explained by a greater positive electrostatic surface potential. Uracil-DNA N-glycosylase from Atlantic cod (cUNG) shows cold-adapted features such as high catalytic efficiency, a low temperature optimum for activity and reduced thermal stability compared with its mesophilic homologue human UNG (hUNG). In order to understand the role of the enzyme–substrate interaction related to the cold-adapted properties, the structure of cUNG in complex with a bacteriophage encoded natural UNG inhibitor (Ugi)more » has been determined. The interaction has also been analyzed by isothermal titration calorimetry (ITC). The crystal structure of cUNG–Ugi was determined to a resolution of 1.9 Å with eight complexes in the asymmetric unit related through noncrystallographic symmetry. A comparison of the cUNG–Ugi complex with previously determined structures of UNG–Ugi shows that they are very similar, and confirmed the nucleotide-mimicking properties of Ugi. Biophysically, the interaction between cUNG and Ugi is very strong and shows a binding constant (K{sub b}) which is one order of magnitude larger than that for hUNG–Ugi. The binding of both cUNG and hUNG to Ugi was shown to be favoured by both enthalpic and entropic forces; however, the binding of cUNG to Ugi is mainly dominated by enthalpy, while the entropic term is dominant for hUNG. The observed differences in the binding properties may be explained by an overall greater positive electrostatic surface potential in the protein–Ugi interface of cUNG and the slightly more hydrophobic surface of hUNG.« less

  9. Context influences on TALE–DNA binding revealed by quantitative profiling

    PubMed Central

    Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

    2015-01-01

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

  10. Context influences on TALE-DNA binding revealed by quantitative profiling.

    PubMed

    Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

    2015-06-11

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

  11. Changes in conformational dynamics of basic side chains upon protein–DNA association

    PubMed Central

    Esadze, Alexandre; Chen, Chuanying; Zandarashvili, Levani; Roy, Sourav; Pettitt, B. Montgometry; Iwahara, Junji

    2016-01-01

    Basic side chains play major roles in recognition of nucleic acids by proteins. However, dynamic properties of these positively charged side chains are not well understood. In this work, we studied changes in conformational dynamics of basic side chains upon protein–DNA association for the zinc-finger protein Egr-1. By nuclear magnetic resonance (NMR) spectroscopy, we characterized the dynamics of all side-chain cationic groups in the free protein and in the complex with target DNA. Our NMR order parameters indicate that the arginine guanidino groups interacting with DNA bases are strongly immobilized, forming rigid interfaces. Despite the strong short-range electrostatic interactions, the majority of the basic side chains interacting with the DNA phosphates exhibited high mobility, forming dynamic interfaces. In particular, the lysine side-chain amino groups exhibited only small changes in the order parameters upon DNA-binding. We found a similar trend in the molecular dynamics (MD) simulations for the free Egr-1 and the Egr-1–DNA complex. Using the MD trajectories, we also analyzed side-chain conformational entropy. The interfacial arginine side chains exhibited substantial entropic loss upon binding to DNA, whereas the interfacial lysine side chains showed relatively small changes in conformational entropy. These data illustrate different dynamic characteristics of the interfacial arginine and lysine side chains. PMID:27288446

  12. TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

    PubMed

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

  13. TFBSshape: a motif database for DNA shape features of transcription factor binding sites

    PubMed Central

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

  14. Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA

    PubMed Central

    Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk

    2013-01-01

    DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751

  15. Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

    PubMed Central

    Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

    1994-01-01

    To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

  16. Determinants of affinity and mode of DNA binding at the carboxy terminus of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1.

    PubMed

    Andera, L; Geiduschek, E P

    1994-03-01

    The role of the carboxy-terminal amino acids of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1, in DNA binding was analyzed. Chain-terminating mutations truncating the normally 99-amino-acid TF1 at amino acids 96, 97, and 98 were constructed, as were missense mutations substituting cysteine, arginine, and serine for phenylalanine at amino acid 97 and tryptophan for lysine at amino acid 99. The binding of the resulting proteins to a synthetic 44-bp binding site in 5-(hydroxymethyl)uracil DNA, to binding sites in larger SPO1 [5-(hydroxymethyl)uracil-containing] DNA fragments, and to thymine-containing homologous DNA was analyzed by gel retardation and also by DNase I and hydroxy radical footprinting. We conclude that the C tail up to and including phenylalanine at amino acid 97 is essential for DNA binding and that the two C-terminal amino acids, 98 and 99, are involved in protein-protein interactions between TF1 dimers bound to DNA.

  17. DBC1 promotes castration-resistant prostate cancer by positively regulating DNA binding and stability of AR-V7.

    PubMed

    Moon, Sue Jin; Jeong, Byong Chang; Kim, Hwa Jin; Lim, Joung Eun; Kwon, Ghee Young; Kim, Jeong Hoon

    2018-03-01

    Constitutively active AR-V7, one of the major androgen receptor (AR) splice variants lacking the ligand-binding domain, plays a key role in the development of castration-resistant prostate cancer (CRPC) and anti-androgen resistance. However, our understanding of the regulatory mechanisms of AR-V7-driven transcription is limited. Here we report DBC1 as a key regulator of AR-V7 transcriptional activity and stability in CRPC cells. DBC1 functions as a coactivator for AR-V7 and is required for the expression of AR-V7 target genes including CDH2, a mesenchymal marker linked to CRPC progression. DBC1 is required for recruitment of AR-V7 to its target enhancers and for long-range chromatin looping between the CDH2 enhancer and promoter. Mechanistically, DBC1 enhances DNA-binding activity of AR-V7 by direct interaction and inhibits CHIP E3 ligase-mediated ubiquitination and degradation of AR-V7 by competing with CHIP for AR-V7 binding, thereby stabilizing and activating AR-V7. Importantly, DBC1 depletion suppresses the tumorigenic and metastatic properties of CRPC cells. Our results firmly establish DBC1 as a critical AR-V7 coactivator that plays a key role in the regulation of DNA binding and stability of AR-V7 and has an important physiological role in CRPC progression.

  18. Functional interaction of the DNA-binding transcription factor Sp1 through its DNA-binding domain with the histone chaperone TAF-I.

    PubMed

    Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo

    2003-08-01

    Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.

  19. Interaction of vasicine with calf thymus DNA: Molecular docking, spectroscopic and differential scanning calorimetric insights

    NASA Astrophysics Data System (ADS)

    R. S., Sai Murali; R. S., Sai Siddhardha; Rajesh Babu, D.; Venketesh, S.; Basavaraju, R.; Nageswara Rao, G.

    2017-06-01

    The present study brings out the interaction between vasicine, an alkaloid and Adhatoda vasica Nees with double stranded DNA. The physico-chemical interaction between small molecules and nucleic acids is a major area of focus in screening drugs against various cancers. Molecular probing in our study using Molecular Operating Environment (MOE) has revealed interaction of vasicine with DNA double helix. Here we report the interaction of vasicine with Calf thymus DNA. We present for the first time the results obtained from UV-visible, fluorescence spectroscopic and differential scanning calorimetric techniques that suggest a moderate to strong electrostatic, hydrophobic and van der Waals interactions mediating the DNA binding properties of vasicine, leading to disruption of DNA secondary structure.

  20. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  1. Vibrational, structural and electronic properties investigation by DFT calculations and molecular docking studies with DNA topoisomerase II of strychnobrasiline type alkaloids: A theoretical approach for potentially bioactive molecules

    NASA Astrophysics Data System (ADS)

    Costa, Renyer A.; Oliveira, Kelson M. T.; Costa, Emmanoel Vilaça; Pinheiro, Maria L. B.

    2017-10-01

    A combined experimental and theoretical DFT study of the structural, vibrational and electronic properties of strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline is presented using the Becke three-parameter Lee-Yang-Parr function (B3LYP) and 6-311G(2d,p) basis set. The theoretical geometry optimization data were compared with the X-ray data for a similar structure in the associated literature, showing close values. The calculated HOMO-LUMO gap values showed that the presence of substituents in the benzene ring influences the quantum properties which are directly related to the reactive properties. Theoretical UV spectra agreed well with the measured experimental data, with bands assigned. In addition, Natural Bond Orbitals (NBOs), Mapped molecular electrostatic potential surface (MEPS) and NLO calculations were also performed at the same theory level. The theoretical vibrational analysis revealed several characteristic vibrations that may be used as a diagnostic tool for other strychnobrasiline type alkaloids, simplifying their identification and structural characterization. Molecular docking calculations with DNA Topoisomerase II-DNA complex showed binding free energies values of -8.0 and -9.5 kcal/mol for strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline respectively, while for amsacrine, used for the treatment of leukemia, the binding free energy ΔG presented a value of -10.0 kcal/mol, suggesting that strychnobrasiline derivative alkaloids might exhibit an antineoplastic activity.

  2. Progressing single biomolecule force spectroscopy measurements for the screening of DNA binding agents

    NASA Astrophysics Data System (ADS)

    Zhang, Wenke; Barbagallo, Romina; Madden, Claire; Roberts, Clive J.; Woolford, Alison; Allen, Stephanie

    2005-10-01

    Recent studies have indicated that the force-extension properties of single molecules of double stranded (ds) DNA are sensitive to the presence of small molecule DNA binding agents, and also to their mode of binding. These observations raise the possibility of using this approach as a highly sensitive tool for the screening of such agents. However, particularly for studies employing the atomic force microscope (AFM), several non-trivial barriers hinder the progress of this approach to the non-specialist arena and hence also the full realization of this possibility. In this paper, we therefore address a series of key reproducibility and metrological issues associated with this type of measurement. Specifically, we present an improved immobilization method that covalently anchors one end (5' end) of a dual labelled (5'-thiol, 3'-biotin) p53 DNA molecule onto a gold substrate via gold-thiol chemistry, whilst the biotinylated 3' end is available for 'pick-up' using a streptavidin modified AFM tip. We also show that co-surface immobilization of DNA with 6-mercapto-1-hexanol (MCH) can also lead to a further increase the measured contour length. We demonstrate the impact of these improved protocols through the observation of the cooperative transition plateau in a DNA fragment of approximately 118 bp, a significantly smaller fragment than previously investigated. The results of a comparative study of the effects of a model minor groove binder (Hoechst 33258) and an intercalating drug (proflavine), alone, as a mixture and under different buffer conditions, are also presented.

  3. Electrochemical studies of DNA interaction and antimicrobial activities of MnII, FeIII, CoII and NiII Schiff base tetraazamacrocyclic complexes

    NASA Astrophysics Data System (ADS)

    Kumar, Anuj; Vashistha, Vinod Kumar; Tevatia, Prashant; Singh, Randhir

    2017-04-01

    Tetraazamacrocyclic complexes of MnII, FeIII, CoII and NiII have been synthesized by template method. These tetraazamacrocycles have been analyzed with various techniques like molar conductance, IR, UV-vis, mass spectral and cyclic voltammetric studies. On the basis of all these studies, octahedral geometry has been assigned to these tetraazamacrocyclic complexes. The DNA binding properties of these macrocyclic complexes have been investigated by electronic absorption spectra, fluorescence spectra, cyclic voltammetric and differential pulse voltammetric studies. The cyclic voltammetric data showed that ipc and ipa were effectively decreased in the presence of calf thymus DNA, which is a strong evidence for the interaction of these macrocyclic complexes with the calf thymus DNA (ct-DNA). The heterogeneous electron transfer rate constant found in the order: KCoII > KNiII > KMnII which indicates that CoII macrocyclic complex has formed a strong intercalated intermediate. The Stern-Volmer quenching constant (KSV) and voltammetric binding constant were found in the order KSV(CoII) > KSV(NiII) > KSV(MnII) and K+(CoII) > K+(NiII) > K+(MnII) which shows that CoII macrocyclic complex exhibits the high interaction affinity towards ct-DNA by the intercalation binding. Biological studies of the macrocyclic complexes compared with the standard drug like Gentamycin, have shown antibacterial activities against E. coli, P. aeruginosa, B. cereus, S. aureus and antifungal activity against C. albicans.

  4. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  5. Structure and spectroscopic investigations of a bi-dentate N‧-[(4-ethylphenyl)methylidene]-4-hydroxybenzohydrazide and its Co(II), Ni(II), Cu(II) and Cd(II) complexes: Insights relevant to biological properties

    NASA Astrophysics Data System (ADS)

    Gopal Reddy, N. B.; Krishna, P. Murali; Shantha Kumar, S. S.; Patil, Yogesh P.; Nethaji, Munirathinam

    2017-06-01

    The present paper describes the synthesis of novel ligand, N‧-[(4-ethylphenyl)methylidene]-4-hydroxy benzohydrazide (HL) and its Co(II), Ni(II), Cu(II) and Cd(II) complexes. The ligand (HL) crystallizes in orthorhombic lattice in P212121 space group with a = 7.9941 (7) Å, b = 11.6154 (10) Å, c = 15.2278 (13) Å, α = β = γ = 90°. Spectroscopic data gives the strong evidence that ligand is coordinated through azomethine nitrogen and enolic oxygen with metal ion. The DNA binding studies revealed that the complexes bind to CT-DNA via intercalation/electrostatic interaction. All the targeted compounds showed more pronounced DNA cleavage activity in the presence of H2O2 and also inhibit the growth of in vitro antibacterial activity against Gram-positive and Gram-negative bacteria.

  6. Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.

    PubMed

    Silva, M V; Pasternack, L B; Kearns, D R

    1997-12-15

    Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.

  7. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  8. Characterization of biochemical properties of Bacillus subtilis RecQ helicase.

    PubMed

    Qin, Wei; Liu, Na-Nv; Wang, Lijun; Zhou, Min; Ren, Hua; Bugnard, Elisabeth; Liu, Jie-Lin; Zhang, Lin-Hu; Vendôme, Jeremie; Hu, Jin-Shan; Xi, Xu Guang

    2014-12-01

    RecQ family helicases function as safeguards of the genome. Unlike Escherichia coli, the Gram-positive Bacillus subtilis bacterium possesses two RecQ-like homologues, RecQ[Bs] and RecS, which are required for the repair of DNA double-strand breaks. RecQ[Bs] also binds to the forked DNA to ensure a smooth progression of the cell cycle. Here we present the first biochemical analysis of recombinant RecQ[Bs]. RecQ[Bs] binds weakly to single-stranded DNA (ssDNA) and blunt-ended double-stranded DNA (dsDNA) but strongly to forked dsDNA. The protein exhibits a DNA-stimulated ATPase activity and ATP- and Mg(2+)-dependent DNA helicase activity with a 3' → 5' polarity. Molecular modeling shows that RecQ[Bs] shares high sequence and structure similarity with E. coli RecQ. Surprisingly, RecQ[Bs] resembles the truncated Saccharomyces cerevisiae Sgs1 and human RecQ helicases more than RecQ[Ec] with regard to its enzymatic activities. Specifically, RecQ[Bs] unwinds forked dsDNA and DNA duplexes with a 3'-overhang but is inactive on blunt-ended dsDNA and 5'-overhung duplexes. Interestingly, RecQ[Bs] unwinds blunt-ended DNA with structural features, including nicks, gaps, 5'-flaps, Kappa joints, synthetic replication forks, and Holliday junctions. We discuss these findings in the context of RecQ[Bs]'s possible functions in preserving genomic stability. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  10. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  11. Study on the binding of procaine hydrochloride to DNA/DNA bases and the effect of CdS nanoparticles on the binding behavior.

    PubMed

    Ping, Gang; Lv, Gang; Gutmann, Sebastian; Chen, Chen; Zhang, Renyun; Wang, Xuemei

    2006-01-01

    The interaction between procaine hydrochloride and DNA/DNA bases in the absence and presence of cadmium sulfide (CdS) nanoparticles has been explored in this study by using differential pulse voltammetry, atomic force microscopy (AFM) and so on, which illustrates the different binding behaviors of procaine hydrochloride with different DNA bases. The results clearly indicate that the binding of purines to procaine hydrochloride is stronger than that of pyrimidines and the binding affinity is in the order of G > A > T > C. In addition, it was observed that the presence of CdS nanoparticles could remarkably enhance the probing sensitivity for the interaction between procaine hydrochloride and DNA/DNA bases. Furthermore, AFM study illustrates that procaine hydrochloride can bind to some specific sites of DNA chains, which indicates that procaine hydrochloride may interact with some special sequences of DNA.

  12. A new structural framework for integrating replication protein A into DNA processing machinery

    PubMed Central

    Brosey, Chris A.; Yan, Chunli; Tsutakawa, Susan E.; Heller, William T.; Rambo, Robert P.; Tainer, John A.; Ivanov, Ivaylo; Chazin, Walter J.

    2013-01-01

    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA’s DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA’s DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamic on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways. PMID:23303776

  13. A new structural framework for integrating replication protein A into DNA processing machinery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brosey, Chris; Yan, Chunli; Tsutakawa, Susan

    2013-01-17

    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA's DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA's DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamicmore » on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways.« less

  14. Role of the Acidic Tail of High Mobility Group Protein B1 (HMGB1) in Protein Stability and DNA Bending

    PubMed Central

    Belgrano, Fabricio S.; de Abreu da Silva, Isabel C.; Bastos de Oliveira, Francisco M.; Fantappié, Marcelo R.; Mohana-Borges, Ronaldo

    2013-01-01

    High mobility group box (HMGB) proteins are abundant nonhistone proteins found in all eukaryotic nuclei and are capable of binding/bending DNA. The human HMGB1 is composed of two binding motifs, known as Boxes A and B, are L-shaped alpha-helix structures, followed by a random-coil acidic tail that consists of 30 Asp and Glu residues. This work aimed at evaluating the role of the acidic tail of human HMGB1 in protein stability and DNA interactions. For this purpose, we cloned, expressed and purified HMGB1 and its tailless form, HMGB1ΔC, in E. coli strain. Tryptophan fluorescence spectroscopy and circular dichroism (CD) experiments clearly showed an increase in protein stability promoted by the acidic tail under different conditions, such as the presence of the chemical denaturant guanidine hydrochloride (Gdn.HCl), high temperature and low pH. Folding intermediates found at low pH for both proteins were denatured only in the presence of chemical denaturant, thus showing a relatively high stability. The acidic tail did not alter the DNA-binding properties of the protein, although it enhanced the DNA bending capability from 76° (HMGB1ΔC) to 91° (HMGB1), as measured using the fluorescence resonance energy transfer technique. A model of DNA bending in vivo was proposed, which might help to explain the interaction of HMGB1 with DNA and other proteins, i.e., histones, and the role of that protein in chromatin remodeling. PMID:24255708

  15. Electrocatalysis in DNA Sensors

    PubMed Central

    Furst, Ariel; Hill, Michael G.; Barton, Jacqueline K.

    2014-01-01

    Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology. PMID:25435647

  16. Electrocatalysis in DNA Sensors.

    PubMed

    Furst, Ariel; Hill, Michael G; Barton, Jacqueline K

    2014-12-14

    Electrocatalysis is often thought of solely in the inorganic realm, most often applied to energy conversion in fuel cells. However, the ever-growing field of bioelectrocatalysis has made great strides in advancing technology for both biofuel cells as well as biological detection platforms. Within the context of bioelectrocatalytic detection systems, DNA-based platforms are especially prevalent. One subset of these platforms, the one we have developed, takes advantage of the inherent charge transport properties of DNA. Electrocatalysis coupled with DNA-mediated charge transport has enabled specific and sensitive detection of lesions, mismatches and DNA-binding proteins. Even greater signal amplification from these platforms is now being achieved through the incorporation of a secondary electrode to the platform both for patterning DNA arrays and for detection. Here, we describe the evolution of this new DNA sensor technology.

  17. Microwave-Induced Inactivation of DNA-Based Hybrid Catalyst in Asymmetric Catalysis

    PubMed Central

    Zhao, Hua; Shen, Kai

    2015-01-01

    DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. < 5 °C) for 2–3 days. Aiming to improve the reaction’s turnover rate, we evaluated microwave irradiation with simultaneous cooling as potential energy source since this method has been widely used to accelerate various chemical and enzymatic reactions. However, our data indicated that microwave irradiation induced an inactivation of DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA–metal ligand binding properties and thus poor DNA catalytic performance. PMID:26712696

  18. Directed evolution of glutathione transferases towards a selective glutathione-binding site and improved oxidative stability.

    PubMed

    Axarli, Irine; Muleta, Abdi W; Chronopoulou, Evangelia G; Papageorgiou, Anastassios C; Labrou, Nikolaos E

    2017-01-01

    Glutathione transferases (GSTs) are a family of detoxification enzymes that catalyze the conjugation of glutathione (GSH) to electrophilic compounds. A library of alpha class GSTs was constructed by DNA shuffling using the DNA encoding the human glutathione transferase A1-1 (hGSTA1-1) and the rat glutathione transferase A1-1 (rGSTA1-1). Activity screening of the library allowed the selection of a chimeric enzyme variant (GSTD4) that displayed high affinity towards GSH and GSH-Sepharose affinity adsorbent, higher k cat /K m and improved thermal stability, compared to the parent enzymes. The crystal structures of the GSTD4 enzyme in free form and in complex with GSH were determined to 1.6Šand 2.3Šresolution, respectively. Analysis of the GSTD4 structure showed subtle conformational changes in the GSH-binding site and in electron-sharing network that may contribute to the increased GSH affinity. The shuffled variant GSTD4 was further optimized for improved oxidative stability employing site-saturation mutagenesis. The Cys112Ser mutation confers optimal oxidative stability and kinetic properties in the GSTD4 enzyme. DNA shuffling allowed the creation of a chimeric enzyme variant with improved properties, compared to the parent enzymes. X-ray crystallography shed light on how recombination of a specific segment from homologous GSTA1-1 together with point mutations gives rise to a new functionally competent enzyme with improved binding, catalytic properties and stability. Such an engineered GST would be useful in biotechnology as affinity tool in affinity chromatography as well as a biocatalytic matrix for the construction of biochips or enzyme biosensors. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Role of the hydrophilic channels of simian virus 40 T-antigen helicase in DNA replication.

    PubMed

    Wang, Weiping; Manna, David; Simmons, Daniel T

    2007-05-01

    The simian virus 40 (SV40) hexameric helicase consists of a central channel and six hydrophilic channels located between adjacent large tier domains within each hexamer. To study the function of the hydrophilic channels in SV40 DNA replication, a series of single-point substitutions were introduced at sites not directly involved in protein-protein contacts. The mutants were characterized biochemically in various ways. All mutants oligomerized normally in the absence of DNA. Interestingly, 8 of the 10 mutants failed to unwind an origin-containing DNA fragment and nine of them were totally unable to support SV40 DNA replication in vitro. The mutants fell into four classes based on their biochemical properties. Class A mutants bound DNA normally and had normal ATPase and helicase activities but failed to unwind origin DNA and support SV40 DNA replication. Class B mutants were compromised in single-stranded DNA and origin DNA binding at low protein concentrations. They were defective in helicase activity and unwinding of the origin and in supporting DNA replication. Class C and D mutants possessed higher-than-normal single-stranded DNA binding activity at low protein concentrations. The class C mutants failed to separate origin DNA and support DNA replication. The class D mutants unwound origin DNA normally but were compromised in their ability to support DNA replication. Taken together, these results suggest that the hydrophilic channels have an active role in the unwinding of SV40 DNA from the origin and the placement of the resulting single strands within the helicase.

  20. Actinomycin D binding mode reveals the basis for its potent HIV-1 and cancer activity

    NASA Astrophysics Data System (ADS)

    Paramanathan, Thayaparan; Vladescu, Ioana D.; McCauley, Micah J.; Rouzina, Ioulia; Williams, Mark C.

    2011-03-01

    Actinomycin D (ActD) is one of the most studied antibiotics, which has been used as an anti-cancer agent and also shown to inhibit HIV reverse transcription. Initial studies with ActD established that it intercalates double stranded DNA (dsDNA). However, recent studies have shown that ActD binds with even higher affinity to single stranded DNA (ssDNA). In our studies we use optical tweezers to stretch and hold single dsDNA molecule at constant force in the presence of varying ActD concentrations until the binding reaches equilibrium. The change in dsDNA length upon ActD binding measured as a function of time yields the rate of binding in addition to the equilibrium lengthening of DNA. The results suggest extremely slow kinetics, on the order of several minutes and 0.52 +/- 0.06 μ M binding affinity. Holding DNA at constant force while stretching and relaxing suggests that ActD binds to two single strands that are close to each other rather than to pure dsDNA or ssDNA. This suggests that biological activity of ActD that contributes towards the inhibition of cellular replication is due to its ability to bind at DNA bubbles during RNA transcription, thereby stalling the transcription process.

  1. MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

    PubMed

    Ozaki, Haruka; Iwasaki, Wataru

    2016-08-01

    As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. A molecular description of the evolution of resistance

    NASA Technical Reports Server (NTRS)

    Ordoukhanian, P.; Joyce, G. F.

    1999-01-01

    BACKGROUND: In vitro evolution has been used to obtain nucleic acid molecules with interesting functional properties. The evolution process usually is carried out in a stepwise manner, involving successive rounds of selection, amplification and mutation. Recently, a continuous in vitro evolution system was devised for RNAs that catalyze the ligation of oligonucleotide substrates, allowing the evolution of catalytic function to be studied in real time. RESULTS: Continuous in vitro evolution of an RNA ligase ribozyme was carried out in the presence of a DNA enzyme that was capable of cleaving, and thereby inactivating, the ribozyme. The DNA concentration was increased steadily over 33.5 hours of evolution, reaching a final concentration that would have been sufficient to inactivate the starting population in one second. The evolved population of ribozymes developed resistance to the DNA enzyme, reducing their vulnerability to cleavage by 2000-fold but retaining their own catalytic function. Based on sequencing and kinetic analysis of the ribozymes, two mechanisms are proposed for this resistance. One involves three nucleotide substitutions, together with two compensatory mutations, that alter the site at which the DNA enzyme binds the ribozyme. The other involves enhancement of the ribozyme's ability to bind its own substrate in a way that protects it from cleavage by the DNA enzyme. CONCLUSIONS: The ability to direct the evolution of an enzyme's biochemical properties in response to the behavior of another macromolecule provides insight into the evolution of resistance and may be useful in developing enzymes with novel or enhanced function.

  3. Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.

    PubMed

    Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar

    2018-05-22

    Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.

  4. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  5. Pomegranate ( Punica granatum L.) expresses several nsLTP isoforms characterized by different immunoglobulin E-binding properties.

    PubMed

    Bolla, Michela; Zenoni, Sara; Scheurer, Stephan; Vieths, Stefan; San Miguel Moncin, Maria Del Mar; Olivieri, Mario; Antico, Andrea; Ferrer, Marta; Berroa, Felicia; Enrique, Ernesto; Avesani, Linda; Marsano, Francesco; Zoccatelli, Gianni

    2014-01-01

    Pomegranate allergy is associated with sensitization to non-specific lipid transfer proteins (nsLTPs). Our aim was to identify and characterize the non-specific nsLTPs expressed in pomegranate at the molecular level and to study their allergenic properties in terms of immunoglobulin E (IgE)-binding and cross-reactivity with peach nsLTP (Pru p 3). A non-equilibrium two-dimensional (2-D) electrophoretic approach based on acid-urea PAGE and sodium dodecyl sulfate PAGE was set up to separate pomegranate nsLTPs. Their immunoreactivity was tested by immunoblotting carried out with anti-Pru p 3 polyclonal antibodies and sera from pomegranate-allergic patients. For final identification, pomegranate nsLTPs were purified by chromatography and subjected to trypsin digestion and mass spectrometry (MS) analysis. For this purpose, the sequences obtained by cDNA cloning of three pomegranate nsLTPs were integrated in the database that was subsequently searched for MS data interpretation. Four nsLTPs were identified by 2-D immunoblotting. The detected proteins showed different IgE-binding capacity and partial cross-reactivity with Pru p 3. cDNA cloning and MS analyses led to the identification of three nsLTP isoforms with 66-68% amino acid sequence identity named Pun g 1.0101, Pun g 1.0201 and Pun g 1.0301. By 2-D electrophoresis, we could separate different nsLTP isoforms possessing different IgE-binding properties, which might reflect peculiar allergenic potencies. The contribution of Pru p 3 to prime sensitization is not central as in other plant nsLTPs. © 2014 S. Karger AG, Basel.

  6. DNA-Binding Interaction Studies of Microwave Assisted Synthesized Sulfonamide Substituted 8-Hydroxyquinoline Derivatives.

    PubMed

    Dixit, Ritu B; Patel, Tarosh S; Vanparia, Satish F; Kunjadiya, Anju P; Keharia, Harish R; Dixit, Bharat C

    2011-01-01

    Sulfonamide substituted 8-hydroxyquinoline derivatives were prepared using a microwave synthesizer. The interaction of sulfonamide substituted 8-hydroxyquinoline derivatives and their transition metal complexes with Plasmid (pUC 19) DNA and Calf Thymus DNA were investigated by UV spectroscopic studies and gel electrophoresis measurements. The interaction between ligand/metal complexes and DNA was carried out by increasing the concentration of DNA from 0 to 12 μl in UV spectroscopic study, while the concentration of DNA in gel electrophoresis remained constant at 10 μl. These studies supported the fact that, the complex binds to DNA by intercalation via ligand into the base pairs of DNA. The relative binding efficacy of the complexes to DNA was much higher than the binding efficacy of ligands, especially the complex of Cu-AHQMBSH had the highest binding ability to DNA. The mobility of the bands decreased as the concentration of the complex was increased, indicating that there was increase in the interaction between the metal ion and DNA. Complexes of AHQMBSH were excellent for DNA binding as compared to HQMABS.

  7. Unique structural modulation of a non-native substrate by cochaperone DnaJ.

    PubMed

    Tiwari, Satyam; Kumar, Vignesh; Jayaraj, Gopal Gunanathan; Maiti, Souvik; Mapa, Koyeli

    2013-02-12

    The role of bacterial DnaJ protein as a cochaperone of DnaK is strongly appreciated. Although DnaJ unaccompanied by DnaK can bind unfolded as well as native substrate proteins, its role as an individual chaperone remains elusive. In this study, we demonstrate that DnaJ binds a model non-native substrate with a low nanomolar dissociation constant and, more importantly, modulates the structure of its non-native state. The structural modulation achieved by DnaJ is different compared to that achieved by the DnaK-DnaJ complex. The nature of structural modulation exerted by DnaJ is suggestive of a unique unfolding activity on the non-native substrate by the chaperone. Furthermore, we demonstrate that the zinc binding motif along with the C-terminal substrate binding domain of DnaJ is necessary and sufficient for binding and the subsequent binding-induced structural alterations of the non-native substrate. We hypothesize that this hitherto unknown structural alteration of non-native states by DnaJ might be important for its chaperoning activity by removing kinetic traps of the folding intermediates.

  8. Influence of structural variation on nuclear localization of DNA-binding polyamide-fluorophore conjugates.

    PubMed

    Edelson, Benjamin S; Best, Timothy P; Olenyuk, Bogdan; Nickols, Nicholas G; Doss, Raymond M; Foister, Shane; Heckel, Alexander; Dervan, Peter B

    2004-01-01

    A pivotal step forward in chemical approaches to controlling gene expression is the development of sequence-specific DNA-binding molecules that can enter live cells and traffic to nuclei unaided. DNA-binding polyamides are a class of programmable, sequence-specific small molecules that have been shown to influence a wide variety of protein-DNA interactions. We have synthesized over 100 polyamide-fluorophore conjugates and assayed their nuclear uptake profiles in 13 mammalian cell lines. The compiled dataset, comprising 1300 entries, establishes a benchmark for the nuclear localization of polyamide-dye conjugates. Compounds in this series were chosen to provide systematic variation in several structural variables, including dye composition and placement, molecular weight, charge, ordering of the aromatic and aliphatic amino-acid building blocks and overall shape. Nuclear uptake does not appear to be correlated with polyamide molecular weight or with the number of imidazole residues, although the positions of imidazole residues affect nuclear access properties significantly. Generally negative determinants for nuclear access include the presence of a beta-Ala-tail residue and the lack of a cationic alkyl amine moiety, whereas the presence of an acetylated 2,4-diaminobutyric acid-turn is a positive factor for nuclear localization. We discuss implications of these data on the design of polyamide-dye conjugates for use in biological systems.

  9. A novel electrochemical aptasensor based on single-walled carbon nanotubes, gold electrode and complimentary strand of aptamer for ultrasensitive detection of cocaine.

    PubMed

    Taghdisi, Seyed Mohammad; Danesh, Noor Mohammad; Emrani, Ahmad Sarreshtehdar; Ramezani, Mohammad; Abnous, Khalil

    2015-11-15

    Cocaine is a strong central nervous system stimulant and one of the most commonly abused drugs. In this study, an electrochemical aptasensor was designed for sensitive and selective detection of cocaine, based on single-walled carbon nanotubes (SWNTs), gold electrode and complimentary strand of aptamer (CS). This electrochemical aptasensor inherits properties of SWNTs and gold such as large surface area and high electrochemical conductivity, as well as high affinity and selectivity of aptamer toward its target and the stronger interaction of SWNTs with single-stranded DNA (ssDNA) than double-stranded DNA (dsDNA). In the absence of cocaine, a little amount of SWNTs bind to Aptamer-CS-modified electrode, so that the electrochemical signal is weak. In the presence of cocaine, aptamer binds to cocaine, leaves the surface of electrode. So that, a large amount of SWNTs bind to CS-modified electrode, generating to a strong electrochemical signal. The designed electrochemical aptasensor showed good selectivity toward cocaine with a limit of detection (LOD) as low as 105 pM. Moreover, the fabricated electrochemical aptasensor was successfully applied to detect cocaine in serum with a LOD as low as 136 pM. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Purification and characterization of human mitochondrial transcription factor 1.

    PubMed Central

    Fisher, R P; Clayton, D A

    1988-01-01

    We purified to near homogeneity a transcription factor from human KB cell mitochondria. This factor, designated mitochondrial transcription factor 1 (mtTF1), is required for the in vitro recognition of both major promoters of human mitochondrial DNA by the homologous mitochondrial RNA polymerase. Furthermore, it has been shown to bind upstream regulatory elements of the two major promoters. After separation from RNA polymerase by phosphocellulose chromatography, mtTF1 was chromatographed on a MonoQ anion-exchange fast-performance liquid chromatography column. Analysis of mtTF1-containing fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single major polypeptide with an Mr of approximately 25,000. Centrifugation in analytical glycerol gradients indicated a sedimentation coefficient of approximately 2.5 S, consistent with a monomeric 25-kilodalton protein. Finally, when the 25-kilodalton polypeptide was excised from a stained sodium dodecyl sulfate-polyacrylamide gel and allowed to renature, it regained DNA-binding and transcriptional stimulatory activities at both promoters. Although mtTF1 is the only mitochondrial DNA-binding transcription factor to be purified and characterized, its properties, such as a high affinity for random DNA and a weak specificity for one of its target sequences, may typify this class of regulatory proteins. Images PMID:3211148

  11. Herpes simplex virus type 1 tegument protein VP22 interacts with TAF-I proteins and inhibits nucleosome assembly but not regulation of histone acetylation by INHAT.

    PubMed

    van Leeuwen, Hans; Okuwaki, Mitsuru; Hong, Rui; Chakravarti, Debabrata; Nagata, Kyosuke; O'Hare, Peter

    2003-09-01

    Affinity chromatography was used to identify cellular proteins that interact with the herpes simplex virus (HSV) tegument protein VP22. Among a small set of proteins that bind specifically to VP22, we identified TAF-I (template-activating factor I), a chromatin remodelling protein and close homologue of the histone chaperone protein NAP-1. TAF-I has been shown previously to promote more ordered transfer of histones to naked DNA through a direct interaction with histones. TAF-I, as a subunit of the INHAT (inhibitor of acetyltransferases) protein complex, also binds to histones and masks them from being substrates for the acetyltransferases p300 and PCAF. Using in vitro assays for TAF-I activity in chromatin assembly, we show that VP22 inhibits nucleosome deposition on DNA by binding to TAF-I. We also observed that VP22 binds non-specifically to DNA, an activity that is abolished by TAF-I. However, the presence of VP22 does not affect the property of INHAT in inhibiting the histone acetyltransferase activity of p300 or PCAF in vitro. We speculate that this interaction could be relevant to HSV DNA organization early in infection, for example, by interfering with nucleosomal deposition on the genome. Consistent with this possibility was the observation that overexpression of TAF-I in transfected cells interferes with the progression of HSV-1 infection.

  12. DNA interactions of non-chelating tinidazole-based coordination compounds and their structural, redox and cytotoxic properties.

    PubMed

    Castro-Ramírez, Rodrigo; Ortiz-Pastrana, Naytzé; Caballero, Ana B; Zimmerman, Matthew T; Stadelman, Bradley S; Gaertner, Andrea A E; Brumaghim, Julia L; Korrodi-Gregório, Luís; Pérez-Tomás, Ricardo; Gamez, Patrick; Barba-Behrens, Norah

    2018-05-23

    Novel tinidazole (tnz) coordination compounds of different geometries were synthesised, whose respective solid-state packing appears to be driven by inter- and intramolecular lone pairπ interactions. The copper(ii) compounds exhibit interesting redox properties originating from both the tnz and the metal ions. These complexes interact with DNA through two distinct ways, namely via electrostatic interactions or/and groove binding, and they can mediate the generation of ROS that damage the biomolecule. Cytotoxic studies revealed an interesting activity of the dinuclear compound [Cu(tnz)2(μ-Cl)Cl]2 7, which is further more efficient towards cancer cells, compared with normal cells.

  13. Negative Correlation between the Diffusion Coefficient and Transcriptional Activity of the Glucocorticoid Receptor.

    PubMed

    Mikuni, Shintaro; Yamamoto, Johtaro; Horio, Takashi; Kinjo, Masataka

    2017-08-25

    The glucocorticoid receptor (GR) is a transcription factor, which interacts with DNA and other cofactors to regulate gene transcription. Binding to other partners in the cell nucleus alters the diffusion properties of GR. Raster image correlation spectroscopy (RICS) was applied to quantitatively characterize the diffusion properties of EGFP labeled human GR (EGFP-hGR) and its mutants in the cell nucleus. RICS is an image correlation technique that evaluates the spatial distribution of the diffusion coefficient as a diffusion map. Interestingly, we observed that the averaged diffusion coefficient of EGFP-hGR strongly and negatively correlated with its transcriptional activities in comparison to that of EGFP-hGR wild type and mutants with various transcriptional activities. This result suggests that the decreasing of the diffusion coefficient of hGR was reflected in the high-affinity binding to DNA. Moreover, the hyper-phosphorylation of hGR can enhance the transcriptional activity by reduction of the interaction between the hGR and the nuclear corepressors.

  14. Hydrogen-Deuterium Exchange Mass Spectrometry Reveals Calcium Binding Properties and Allosteric Regulation of Downstream Regulatory Element Antagonist Modulator (DREAM).

    PubMed

    Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L

    2017-07-18

    Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.

  15. 5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

    PubMed

    Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

    2016-09-12

    We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

  16. [Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].

    PubMed

    Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V

    2009-01-01

    The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

  17. Dpb11 may function with RPA and DNA to initiate DNA replication.

    PubMed

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

  18. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  19. DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA

    PubMed Central

    Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly

    2010-01-01

    Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237

  20. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    PubMed

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Characterization of a protein that binds multiple sequences in mammalian type C retrovirus enhancers.

    PubMed Central

    Sun, W; O'Connell, M; Speck, N A

    1993-01-01

    Mammalian type C retrovirus enhancer factor 1 (MCREF-1) is a nuclear protein that binds several directly repeated sequences (CNGGN6CNGG) in the Moloney and Friend murine leukemia virus (MLV) enhancers (N. R. Manley, M. O'Connell, W. Sun, N. A. Speck, and N. Hopkins, J. Virol. 67:1967-1975, 1993). In this paper, we describe the partial purification of MCREF-1 from calf thymus nuclei and further characterize the binding properties of MCREF-1. MCREF-1 binds four sites in the Moloney MLV enhancer and three sites in the Friend MLV enhancer. Ethylation interference analysis suggests that the MCREF-1 binding site spans two adjacent minor grooves of DNA. Images PMID:8445719

  2. Probing the Characterization of the Interaction of Aflatoxins B1 and G1 with Calf Thymus DNA In Vitro

    PubMed Central

    Ma, Liang; Wang, Jiaman; Zhang, Yuhao

    2017-01-01

    The binding characterization of aflatoxins with calf thymus DNA (ctDNA) under physiological conditions was investigated. Multispectroscopic techniques, ctDNA melting, viscosity measurements, and molecular docking techniques were employed to elucidate the binding mechanism of the aflatoxins with DNA. The fluorescence results indicated that both aflatoxin B1 (AFB1) and aflatoxin G1 (AFG1) bound to the ctDNA, forming complexes through hydrogen bonding. The binding constants of AFB1 and AFG1 with ctDNA reached up to 103 L·mol−1 and 104 L·mol−1, respectively, and AFG1 exhibited a higher binding propensity than that of AFB1. Furthermore, both AFB1 and AFG1 bound to the ctDNA through groove binding, as evidenced by the results of the spectroscopic, iodide quenching effect, viscosity, and ctDNA melting measurements. Changes in the circular dichroism signal manifested that both AFB1 and AFG1 induced an increase in the right-handed helicity, but only minimally influenced the base stacking of the DNA. A molecular docking study of the aflatoxin’s binding with the DNA revealed a groove binding mode, which was driven mainly by hydrogen bonding. This study of aflatoxin–ctDNA interaction may provide novel insights into the toxicological effect of the mycotoxins. PMID:28671585

  3. DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

    PubMed

    Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

    2009-07-13

    Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

  4. Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

    PubMed Central

    Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

    2012-01-01

    In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

  5. Molecular simulations of polycation-DNA binding exploring the effect of peptide chemistry and sequence in nuclear localization sequence based polycations.

    PubMed

    Elder, Robert M; Jayaraman, Arthi

    2013-10-10

    Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.

  6. In vitro DNA binding studies of Aspartame, an artificial sweetener.

    PubMed

    Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

    2013-03-05

    A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Detection of DNA damage in individual cells by flow cytometric analysis using anti-DNA monoclonal antibody

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frankfurt, O.S.

    A new method for the measurement of DNA damage in individual cells treated with alkylating agents is described. The method is based on the binding of anti-DNA monoclonal antibody to DNA in situ. Binding of antibody was evaluated by flow cytometry with indirect immunofluorescence. No binding of antibody to DNA in non-treated HeLa S3 cells was detected. Treatment of cells with HN2 or L-phenylalanine mustard induced binding of antibody to DNA in situ. Binding of antibody was observed after treating cells with doses of drugs which reduced the surviving fraction below 20%. Intensity of binding increased in proportion to themore » drug dose. In HN2-treated cells a cell subset with the lowest antibody binding was observed among cells in G1 phase. Binding of antibody to DNA in HN2-treated cells was eliminated by single-strand (ss) specific S1 nuclease. In competition assay, antibody was inhibited by thermally denatured DNA, but not by native double-stranded (ds) DNA, RNA, nucleosides and deoxyribohomopolymers. Immunoreactivity of cells with the monoclonal antibody F7-26 may be a useful probe for the assessment of cell damage induced by alkylating agents, especially in heterogeneous cell populations.« less

  8. Sliding of proteins non-specifically bound to DNA: Brownian dynamics studies with coarse-grained protein and DNA models.

    PubMed

    Ando, Tadashi; Skolnick, Jeffrey

    2014-12-01

    DNA binding proteins efficiently search for their cognitive sites on long genomic DNA by combining 3D diffusion and 1D diffusion (sliding) along the DNA. Recent experimental results and theoretical analyses revealed that the proteins show a rotation-coupled sliding along DNA helical pitch. Here, we performed Brownian dynamics simulations using newly developed coarse-grained protein and DNA models for evaluating how hydrodynamic interactions between the protein and DNA molecules, binding affinity of the protein to DNA, and DNA fluctuations affect the one dimensional diffusion of the protein on the DNA. Our results indicate that intermolecular hydrodynamic interactions reduce 1D diffusivity by 30%. On the other hand, structural fluctuations of DNA give rise to steric collisions between the CG-proteins and DNA, resulting in faster 1D sliding of the protein. Proteins with low binding affinities consistent with experimental estimates of non-specific DNA binding show hopping along the CG-DNA. This hopping significantly increases sliding speed. These simulation studies provide additional insights into the mechanism of how DNA binding proteins find their target sites on the genome.

  9. Ferrocene conjugated oligonucleotide for electrochemical detection of DNA base mismatch.

    PubMed

    Hasegawa, Yusuke; Takada, Tadao; Nakamura, Mitsunobu; Yamana, Kazushige

    2017-08-01

    We describe the synthesis, binding, and electrochemical properties of ferrocene-conjugated oligonucleotides (Fc-oligos). The key step for the preparation of Fc-oligos contains the coupling of vinylferrocene to 5-iododeoxyuridine via Heck reaction. The Fc-conjugated deoxyuridine phosphoramidite was used in the Fc-oligonucleotide synthesis. We show that thiol-modified Fc-oligos deposited onto gold electrodes possess potential ability in electrochemical detection of DNA base mismatch. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Detection of Z DNA binding proteins in tissue culture cells.

    PubMed Central

    Leith, I R; Hay, R T; Russell, W C

    1988-01-01

    A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919

  11. Mapping the binding site of aflatoxin B/sub 1/ in DNA: systematic analysis of the reactivity of aflatoxin B/sub 1/ with guanines in different DNA sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Benasutti, M.; Ejadi, S.; Whitlow, M.D.

    The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines inmore » some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.« less

  12. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    2016-10-01

    The composition of a genome with respect to all possible short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional DNA binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. We demonstrate that the underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, a signal that we detect in all species across domains of life. We consider the possibility that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Likewise, we show that evolutionary mechanisms based on interference of protein-DNA binding with replication and mutational repair processes could yield similar results and operate with similar rates. On the basis of these modeling and bioinformatic results, we conclude that genome-wide word compositions have been molded by DNA binding proteins acting through tiny evolutionary steps over time scales spanning millions of generations.

  13. DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

    PubMed Central

    Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

    2000-01-01

    The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

  14. Surface shapes and surrounding environment analysis of single- and double-stranded DNA-binding proteins in protein-DNA interface.

    PubMed

    Wang, Wei; Liu, Juan; Sun, Lin

    2016-07-01

    Protein-DNA bindings are critical to many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the residues shape (peak, flat, or valley) and the surrounding environment of double-stranded DNA-binding proteins (DSBs) and single-stranded DNA-binding proteins (SSBs) in protein-DNA interfaces. In the results, we found that the interface shapes, hydrogen bonds, and the surrounding environment present significant differences between the two kinds of proteins. Built on the investigation results, we constructed a random forest (RF) classifier to distinguish DSBs and SSBs with satisfying performance. In conclusion, we present a novel methodology to characterize protein interfaces, which will deepen our understanding of the specificity of proteins binding to ssDNA (single-stranded DNA) or dsDNA (double-stranded DNA). Proteins 2016; 84:979-989. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  15. NMR structure of the DNA decamer duplex containing double T*G mismatches of cis-syn cyclobutane pyrimidine dimer: implications for DNA damage recognition by the XPC-hHR23B complex.

    PubMed

    Lee, Joon-Hwa; Park, Chin-Ju; Shin, Jae-Sun; Ikegami, Takahisa; Akutsu, Hideo; Choi, Byong-Seok

    2004-01-01

    The cis-syn cyclobutane pyrimidine dimer (CPD) is a cytotoxic, mutagenic and carcinogenic DNA photoproduct and is repaired by the nucleotide excision repair (NER) pathway in mammalian cells. The XPC-hHR23B complex as the initiator of global genomic NER binds to sites of certain kinds of DNA damage. Although CPDs are rarely recognized by the XPC-hHR23B complex, the presence of mismatched bases opposite a CPD significantly increased the binding affinity of the XPC-hHR23B complex to the CPD. In order to decipher the properties of the DNA structures that determine the binding affinity for XPC-hHR23B to DNA, we carried out structural analyses of the various types of CPDs by NMR spectroscopy. The DNA duplex which contains a single 3' T*G wobble pair in a CPD (CPD/GA duplex) induces little conformational distortion. However, severe distortion of the helical conformation occurs when a CPD contains double T*G wobble pairs (CPD/GG duplex) even though the T residues of the CPD form stable hydrogen bonds with the opposite G residues. The helical bending angle of the CPD/GG duplex was larger than those of the CPD/GA duplex and properly matched CPD/AA duplex. The fluctuation of the backbone conformation and significant changes in the widths of the major and minor grooves at the double T*G wobble paired site were also observed in the CPD/GG duplex. These structural features were also found in a duplex that contains the (6-4) adduct, which is efficiently recognized by the XPC-hHR23B complex. Thus, we suggest that the unique structural features of the DNA double helix (that is, helical bending, flexible backbone conformation, and significant changes of the major and/or minor grooves) might be important factors in determining the binding affinity of the XPC-hHR23B complex to DNA.

  16. Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

    PubMed Central

    Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

    2011-01-01

    Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

  17. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  18. Oligonucleotide-stabilized fluorescent silver nanoclusters for the specific and sensitive detection of biotin.

    PubMed

    Xiong, Xiaoli; Tang, Yan; Zhao, Jingjin; Zhao, Shulin

    2016-02-21

    A novel biotin fluorescent probe based on oligonucleotide-stabilized silver nanoclusters (DNA-AgNCs) was synthesized by employing a biotinylated cytosine-rich sequence as a synthesized template. The fluorescence properties of the DNA-AgNCs are related to the modified position of the DNA. When biotin is linked to the middle thymine base of the DNA sequence, the DNA-AgNCs emit the strongest fluorescence. Moreover, the stability of the DNA-AgNCs was affected by avidin through biotin-avidin binding, quenching the fluorescence of the DNA-AgNCs. In contrast, if free biotin is further introduced into this system, the quenching is apparently weakened by competition, leading to the restoration of fluorescence. This phenomenon can be utilized for the detection of biotin. Under the optimal conditions, the fluorescence recovery is linearly proportional to the concentration of biotin in the range of 10 nM-1.0 μM with a detection limit of 6.0 nM. This DNA-AgNCs probe with excellent fluorescent properties is sensitive and selective for the detection of biotin and has been applied for the determination of biotin in wheat flour.

  19. In vitro DNA binding, antioxidant, antimicrobial and anticancer assessment of amino acid functionalized magnetic nanoparticles

    NASA Astrophysics Data System (ADS)

    Pandya, Shivani R.; Patel, Suhani; Bakshi, Sonal; Singh, Man

    2018-09-01

    Biofunctionalized magnetic nanoparticles (FMNPs) were synthesized through in situ coprecipitations of Fe (II) and Fe (III) salts under air followed by the addition of amino acids (AA): serine (Ser), alanine (Ala), cysteine (Cys), histidine (His), and methionine (Met) via bottom-up approach without following any sophisticated route. However, the effect of amino acid side chain on the formation of γ-Fe2O3 (maghemite) and Fe3O4 (magnetite) was attained through XRD, HR-TEM, SEM, VSM, FTIR, DLS and Mercury Porosimeter (MP). Surprisingly, our study depicts that except His; Ser, Ala, Cys and Met produced more than 50% of magnetite phase and inhibited the oxidation of Fe3O4 in the presence of air. Furthermore, AA@MNPs were used for in vitro biological assessment such as salmon testes DNA (ST-DNA) binding efficiency, DPPHrad scavenging activity, antimicrobial and anticancer properties using UV-visible spectrophotometry and colorimeter respectively. The ST-DNA binding efficiency was observed at λmax 259 nm and quantitative interaction was determined using 15-125 μM AA@MNPs and 500 μg/ml DNA at physiological temperature, shows stacking interaction. The Cys@MNPs have exhibited highest DPPHrad scavenging activity with SC50 2.5 μg/mL at λmax 525 nm. Antimicrobial property of AA@MNPs was studied on gram-positive (B. subtilis), gram-negative (E. coli) bacteria and fungi (C. albicans) using disc diffusion assay by measuring zone of inhibition (ZOI) in mm, mentioned as a diameter. Alongside, minimum inhibition concentration (MIC) was estimated by the dilution method for those strains sensitive against AA@MNPs. Although, AA@MNPs showed ∼100% control growth of human lung cancer cell line (A549) with LC50, TGI and GI50 >80 μg/ml shown cells compatibility. These significant results revealed the impact of AA side chain with different surface activities of FMNPs.

  20. The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

    PubMed Central

    Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2013-01-01

    To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

  1. MD simulations of papillomavirus DNA-E2 protein complexes hints at a protein structural code for DNA deformation.

    PubMed

    Falconi, M; Oteri, F; Eliseo, T; Cicero, D O; Desideri, A

    2008-08-01

    The structural dynamics of the DNA binding domains of the human papillomavirus strain 16 and the bovine papillomavirus strain 1, complexed with their DNA targets, has been investigated by modeling, molecular dynamics simulations, and nuclear magnetic resonance analysis. The simulations underline different dynamical features of the protein scaffolds and a different mechanical interaction of the two proteins with DNA. The two protein structures, although very similar, show differences in the relative mobility of secondary structure elements. Protein structural analyses, principal component analysis, and geometrical and energetic DNA analyses indicate that the two transcription factors utilize a different strategy in DNA recognition and deformation. Results show that the protein indirect DNA readout is not only addressable to the DNA molecule flexibility but it is finely tuned by the mechanical and dynamical properties of the protein scaffold involved in the interaction.

  2. Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

    NASA Astrophysics Data System (ADS)

    Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

    2018-05-01

    Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

  3. Crystallization of bFGF-DNA Aptamer Complexes Using a Sparse Matrix Designed for Protein-Nucleic Acid Complexes

    NASA Technical Reports Server (NTRS)

    Cannone, Jaime J.; Barnes, Cindy L.; Achari, Aniruddha; Kundrot, Craig E.; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    The Sparse Matrix approach for obtaining lead crystallization conditions has proven to be very fruitful for the crystallization of proteins and nucleic acids. Here we report a Sparse Matrix developed specifically for the crystallization of protein-DNA complexes. This method is rapid and economical, typically requiring 2.5 mg of complex to test 48 conditions. The method was originally developed to crystallize basic fibroblast growth factor (bFGF) complexed with DNA sequences identified through in vitro selection, or SELEX, methods. Two DNA aptamers that bind with approximately nanomolar affinity and inhibit the angiogenic properties of bFGF were selected for co-crystallization. The Sparse Matrix produced lead crystallization conditions for both bFGF-DNA complexes.

  4. Biolayer Interferometry: A Novel Method to Elucidate Protein-Protein and Protein-DNA Interactions in the Mitochondrial DNA Replisome.

    PubMed

    Ciesielski, Grzegorz L; Hytönen, Vesa P; Kaguni, Laurie S

    2016-01-01

    A lack of effective treatment for mitochondrial diseases prompts scientists to investigate the molecular processes that underlie their development. The major cause of mitochondrial diseases is dysfunction of the sole mitochondrial DNA polymerase, DNA polymerase γ (Pol γ). The development of treatment strategies will require a detailed characterization of the molecular properties of Pol γ. A novel technique, biolayer interferometry, allows one to monitor molecular interactions in real time, thus providing an insight into the kinetics of the process. Here, we present an application of the biolayer interferometry technique to characterize the fundamental reactions that Pol γ undergoes during the initiation phase of mitochondrial DNA replication: holoenzyme formation and binding to the primer-template.

  5. Biolayer Interferometry: A Novel Method to Elucidate Protein–Protein and Protein–DNA Interactions in the Mitochondrial DNA Replisome

    PubMed Central

    Ciesielski, Grzegorz L.; Hytönen, Vesa P.; Kaguni, Laurie S.

    2015-01-01

    A lack of effective treatment for mitochondrial diseases prompts scientists to investigate the molecular processes that underlie their development. The major cause of mitochondrial diseases is dysfunction of the sole mitochondrial DNA polymerase, DNA polymerase γ (Pol γ). The development of treatment strategies will require a detailed characterization of the molecular properties of Pol γ. A novel technique, biolayer interferometry, allows one to monitor molecular interactions in real time, thus providing an insight into the kinetics of the process. Here, we present an application of the biolayer interferometry technique to characterize the fundamental reactions that Pol γ undergoes during the initiation phase of mitochondrial DNA replication: holoenzyme formation and binding to the primer-template. PMID:26530686

  6. Torsion of DNA modeled as a heterogeneous fluctuating rod

    NASA Astrophysics Data System (ADS)

    Argudo, David; Purohit, Prashant K.

    2014-01-01

    We discuss the statistical mechanics of a heterogeneous elastic rod with bending, twisting and stretching. Our model goes beyond earlier works where only homogeneous rods were considered in the limit of high forces and long lengths. Our methods allow us to consider shorter fluctuating rods for which boundary conditions can play an important role. We use our theory to study structural transitions in torsionally constrained DNA where there is coexistence of states with different effective properties. In particular, we examine whether a newly discovered left-handed DNA conformation called L-DNA is a mixture of two known states. We also use our model to investigate the mechanical effects of the binding of small molecules to DNA. For both these applications we make experimentally falsifiable predictions.

  7. Interaction of vasicine with calf thymus DNA: Molecular docking, spectroscopic and differential scanning calorimetric insights.

    PubMed

    R S, Sai Murali; R S, Sai Siddhardha; D, Rajesh Babu; S, Venketesh; R, Basavaraju; G, Nageswara Rao

    2017-06-05

    The present study brings out the interaction between vasicine, an alkaloid and Adhatoda vasica Nees with double stranded DNA. The physico-chemical interaction between small molecules and nucleic acids is a major area of focus in screening drugs against various cancers. Molecular probing in our study using Molecular Operating Environment (MOE) has revealed interaction of vasicine with DNA double helix. Here we report the interaction of vasicine with Calf thymus DNA. We present for the first time the results obtained from UV-visible, fluorescence spectroscopic and differential scanning calorimetric techniques that suggest a moderate to strong electrostatic, hydrophobic and van der Waals interactions mediating the DNA binding properties of vasicine, leading to disruption of DNA secondary structure. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. G-quadruplex induced stabilization by 2′-deoxy-2′-fluoro-d-arabinonucleic acids (2′F-ANA)

    PubMed Central

    Peng, Chang Geng; Damha, Masad J.

    2007-01-01

    The impact of 2′-deoxy-2′-fluoroarabinonucleotide residues (2′F-araN) on different G-quadruplexes derived from a thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), an anti-HIV phosphorothioate aptamer PS-d(T2G4T2) and a DNA telomeric sequence d(G4T4G4) via UV thermal melting (Tm) and circular dichroism (CD) experiments has been investigated. Generally, replacement of deoxyguanosines that adopt the anti conformation (anti-guanines) with 2′F-araG can stabilize G-quartets and maintain the quadruplex conformation, while replacement of syn-guanines with 2′F-araG is not favored and results in a dramatic switch to an alternative quadruplex conformation. It was found that incorporation of 2′F-araG or T residues into a thrombin-binding DNA G-quadruplex stabilizes the complex (ΔTm up to ∼+3°C/2′F-araN modification); 2′F-araN units also increased the half-life in 10% fetal bovine serum (FBS) up to 48-fold. Two modified thrombin-binding aptamers (PG13 and PG14) show an approximately 4-fold increase in binding affinity to thrombin, as assessed via a nitrocellulose filter binding assay, both with increased thermal stability (∼1°C/2′F-ANA modification increase in Tm) and nuclease resistance (4–7-fold) as well. Therefore, the 2′-deoxy-2′-fluoro-d-arabinonucleic acid (2′F-ANA) modification is well suited to tune (and improve) the physicochemical and biological properties of naturally occurring DNA G-quartets. PMID:17636049

  9. Formononetin, a phyto-oestrogen, and its metabolites up-regulate interleukin-4 production in activated T cells via increased AP-1 DNA binding activity

    PubMed Central

    Park, Jin; Kim, Seung H; Cho, Daeho; Kim, Tae S

    2005-01-01

    Phyto-oestrogens are polyphenolic non-steroidal plant compounds with oestrogen-like biological activity. Phyto-oestrogens have many biological effects including oestrogen agonist/antagonist properties. However, the effect of phyto-oestrogens on allergic responses remains unclear. In this study we investigated whether formononetin, a phyto-oestrogen, and its metabolites, daidzein and equol, affect production of interleukin-4 (IL-4), a pro-inflammatory cytokine closely associated with allergic immune response, in primary CD4+ T cells and EL4 T lymphoma cells. Formononetin, daidzein and equol significantly enhanced IL-4 production from both CD4+ T cells and EL4 cells in a dose-dependent manner. Formononetin, daidzein and equol also enhanced IL-4 gene promoter activity in EL4 cells transiently transfected with IL-4 gene promoter constructs, but this effect was impaired in EL4 cells transfected with an IL-4 promoter construct deleted of P4 site carrying nuclear factor of activated T cells (NF-AT) and activator protein-1 (AP-1) binding sites. In addition, formononetin, daidzein and equol increased AP-1 DNA binding activities while did not affect NF-AT DNA binding activities. The enhancing effects on IL-4 production and AP-1 DNA binding activities were abrogated by specific inhibitors for phosphatidylinositol-3-kinase (PI3K), protein kinase C (PKC) and p38 mitogen-activated protein kinase (MAPK), indicating that formononetin, daidzein and equol might enhance IL-4 production by increased activation of AP-1 through the PI3-K/PKC/p38 MAPK signalling pathway. These results suggest that phyto-oestrogens and some of their metabolites may increase allergic responses via the enhancement of IL-4 production in T cells. PMID:16108819

  10. Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

    PubMed Central

    Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

    2016-01-01

    There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

  11. Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

    PubMed

    Odell, M; Shuman, S

    1999-05-14

    The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

  12. Dpb11 may function with RPA and DNA to initiate DNA replication

    PubMed Central

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

  13. Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

    PubMed

    Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

    2018-05-22

    Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Chemotherapeutic Drug-Conjugated Microbeads Demonstrate Preferential Binding to Methylated Plasmid DNA.

    PubMed

    Lin, Kevin N; Grandhi, Taraka Sai Pavan; Goklany, Sheba; Rege, Kaushal

    2018-04-10

    Plasmid DNA (pDNA) is an attractive therapeutic biomolecule in several diseases including cancer, AIDS, cystic fibrosis, Parkinson's disease, and Alzheimer's disease. Increasing demand for plasmid DNA as a therapeutic biomolecule for transgene expression or vaccine applications necessitate novel approaches to bioprocessing. The synthesis, characterization and evaluation of aminoglycoside-derived hydrogel microbeads (Amikabeads) for pDNA binding is described previously. Here, the generation and evaluation of novel chemotherapeutic drug-conjugated microbeads for application in pDNA binding and recovery is described. Chemotherapeutic drug-conjugated Amikabeads demonstrate higher binding of methylated pDNA compared to unmethylated pDNA in presence of high salt concentrations. Desorption of plasmids from drug-conjugated microbeads is facilitated by the use of organic modifiers. The observed differences in binding methylated versus unmethylated DNA can make drug-conjugated microbeads useful in diagnostic as well as therapeutic applications. These results demonstrate that anti-cancer drugs represent a diverse set of ligands that may be exploited for molecular engineering of novel DNA binding materials for applications in delivery, diagnostics, and biomanufacturing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    PubMed

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  16. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    PubMed Central

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  17. DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

    DOE PAGES

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

    2014-08-23

    Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  18. A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

    PubMed

    Banasik, Michał; Sachadyn, Paweł

    2016-09-01

    A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

  19. Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

    2010-11-05

    Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

  20. Changes in conformational dynamics of basic side chains upon protein-DNA association.

    PubMed

    Esadze, Alexandre; Chen, Chuanying; Zandarashvili, Levani; Roy, Sourav; Pettitt, B Montgometry; Iwahara, Junji

    2016-08-19

    Basic side chains play major roles in recognition of nucleic acids by proteins. However, dynamic properties of these positively charged side chains are not well understood. In this work, we studied changes in conformational dynamics of basic side chains upon protein-DNA association for the zinc-finger protein Egr-1. By nuclear magnetic resonance (NMR) spectroscopy, we characterized the dynamics of all side-chain cationic groups in the free protein and in the complex with target DNA. Our NMR order parameters indicate that the arginine guanidino groups interacting with DNA bases are strongly immobilized, forming rigid interfaces. Despite the strong short-range electrostatic interactions, the majority of the basic side chains interacting with the DNA phosphates exhibited high mobility, forming dynamic interfaces. In particular, the lysine side-chain amino groups exhibited only small changes in the order parameters upon DNA-binding. We found a similar trend in the molecular dynamics (MD) simulations for the free Egr-1 and the Egr-1-DNA complex. Using the MD trajectories, we also analyzed side-chain conformational entropy. The interfacial arginine side chains exhibited substantial entropic loss upon binding to DNA, whereas the interfacial lysine side chains showed relatively small changes in conformational entropy. These data illustrate different dynamic characteristics of the interfacial arginine and lysine side chains. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

    PubMed Central

    Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

    2012-01-01

    DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

  2. Animal Mitochondrial DNA Replication

    PubMed Central

    Ciesielski, Grzegorz L.; Oliveira, Marcos T.; Kaguni, Laurie S.

    2016-01-01

    Recent advances in the field of mitochondrial DNA (mtDNA) replication highlight the diversity of both the mechanisms utilized and the structural and functional organization of the proteins at mtDNA replication fork, despite the simplicity of the animal mtDNA genome. DNA polymerase γ, mtDNA helicase and mitochondrial single-stranded DNA-binding protein- the key replisome proteins, have evolved distinct structural features and biochemical properties. These appear to be correlated with mtDNA genomic features in different metazoan taxa and with their modes of DNA replication, although a substantial integrative research is warranted to establish firmly these links. To date, several modes of mtDNA replication have been described for animals: rolling circle, theta, strand-displacement, and RITOLS/bootlace. Resolution of a continuing controversy relevant to mtDNA replication in mammals/vertebrates will have a direct impact on the mechanistic interpretation of mtDNA-related human diseases. Here we review these subjects, integrating earlier and recent data to provide a perspective on the major challenges for future research. PMID:27241933

  3. Cr(3+) Binding to DNA Backbone Phosphate and Bases: Slow Ligand Exchange Rates and Metal Hydrolysis.

    PubMed

    Zhou, Wenhu; Yu, Tianmeng; Vazin, Mahsa; Ding, Jinsong; Liu, Juewen

    2016-08-15

    The interaction between chromium ions and DNA is of great interest in inorganic chemistry, toxicology, and analytical chemistry. Most previous studies focused on in situ reduction of Cr(VI), producing Cr(3+) for DNA binding. Recently, Cr(3+) was reported to activate the Ce13d DNAzyme for RNA cleavage. Herein, the Ce13d is used to study two types of Cr(3+) and DNA interactions. First, Cr(3+) binds to the DNA phosphate backbone weakly through reversible electrostatic interactions, which is weakened by adding competing inorganic phosphate. However, Cr(3+) coordinates with DNA nucleobases forming stable cross-links that can survive denaturing gel electrophoresis condition. The binding of Cr(3+) to different nucleobases was further studied in terms of binding kinetics and affinity by exploiting carboxyfluorescein-labeled DNA homopolymers. Once binding takes place, the stable Cr(3+)/DNA complex cannot be dissociated by EDTA, attributable to the ultraslow ligand exchange rate of Cr(3+). The binding rate follows the order of G > C > T ≈ A. Finally, Cr(3+) gradually loses its DNA binding ability after being stored at neutral or high pH, attributable to hydrolysis. This hydrolysis can be reversed by lowering the pH. This work provides a deeper insight into the bioinorganic chemistry of Cr(3+) coordination with DNA, clarifies some inconsistency in the previous literature, and offers practically useful information for generating reproducible results.

  4. Energy Fluctuations Shape Free Energy of Nonspecific Biomolecular Interactions

    NASA Astrophysics Data System (ADS)

    Elkin, Michael; Andre, Ingemar; Lukatsky, David B.

    2012-01-01

    Understanding design principles of biomolecular recognition is a key question of molecular biology. Yet the enormous complexity and diversity of biological molecules hamper the efforts to gain a predictive ability for the free energy of protein-protein, protein-DNA, and protein-RNA binding. Here, using a variant of the Derrida model, we predict that for a large class of biomolecular interactions, it is possible to accurately estimate the relative free energy of binding based on the fluctuation properties of their energy spectra, even if a finite number of the energy levels is known. We show that the free energy of the system possessing a wider binding energy spectrum is almost surely lower compared with the system possessing a narrower energy spectrum. Our predictions imply that low-affinity binding scores, usually wasted in protein-protein and protein-DNA docking algorithms, can be efficiently utilized to compute the free energy. Using the results of Rosetta docking simulations of protein-protein interactions from Andre et al. (Proc. Natl. Acad. Sci. USA 105:16148, 2008), we demonstrate the power of our predictions.

  5. Anti-nucleosome antibodies complexed to nucleosomal antigens show anti-DNA reactivity and bind to rat glomerular basement membrane in vivo.

    PubMed Central

    Kramers, C; Hylkema, M N; van Bruggen, M C; van de Lagemaat, R; Dijkman, H B; Assmann, K J; Smeenk, R J; Berden, J H

    1994-01-01

    Histones can mediate the binding of DNA and anti-DNA to the glomerular basement membrane (GBM). In ELISA histone/DNA/anti-DNA complexes are able to bind to heparan sulfate (HS), an intrinsic constituent of the GBM. We questioned whether histone containing immune complexes are able to bind to the GBM, and if so, whether the ligand in the GBM is HS. Monoclonal antibodies (mAbs) complexed to nucleosomal antigens and noncomplexed mAbs were isolated from culture supernatants of four IgG anti-nuclear mAbs. All noncomplexed mAbs showed strong anti-nucleosome reactivity in ELISA. One of them showed in addition anti-DNA reactivity in noncomplexed form. The other three mAbs only showed anti-DNA reactivity when they were complexed to nucleosomal antigens. After renal perfusion a fine granular binding of complexed mAbs to the glomerular capillary wall and activation of complement was observed in immunofluorescence, whereas noncomplexed mAbs did not bind. Immuno-electron microscopy showed binding of complexes to the whole width of the GBM. When HS in the GBM was removed by renal heparinase perfusion the binding of complexed mAb decreased, but did not disappear completely. We conclude that anti-nucleosome mAbs, which do not bind DNA, become DNA reactive once complexed to nucleosomal antigens. These complexed mAbs can bind to the GBM. The binding ligand in the GBM is partly, but not solely, HS. Binding to the GBM of immune complexes containing nucleosomal material might be an important event in the pathogenesis of lupus nephritis. Images PMID:8040312

  6. Non-B-DNA structures on the interferon-beta promoter?

    PubMed

    Robbe, K; Bonnefoy, E

    1998-01-01

    The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

  7. Plant Flavone Apigenin Binds to Nucleic Acid Bases and Reduces Oxidative DNA Damage in Prostate Epithelial Cells

    PubMed Central

    Bhaskaran, Natarajan; Gupta, Sanjay

    2014-01-01

    Oxidative stress has been linked to prostate carcinogenesis as human prostate tissue is vulnerable to oxidative DNA damage. Apigenin, a dietary plant flavone, possesses anti-proliferative and anticancer effects; however, its antioxidant properties have not been fully elucidated. We investigated sub-cellular distribution of apigenin, it’s binding to DNA and protective effects against H2O2-induced DNA damage using transformed human prostate epithelial RWPE-1 cells and prostate cancer LNCaP, PC-3 and DU145 cells. Exposure of cells to apigenin exhibited higher accumulation in RWPE-1 and LNCaP cells, compared to PC-3 and DU145 cells. The kinetics of apigenin uptake in LNCaP cells was estimated with a Km value of 5 µmole/L and Vmax of 190 pmoles/million cells/h. Sub-cellular fractionation demonstrated that nuclear matrix retains the highest concentration of apigenin (45.3%), followed by cytosol (23.9%), nuclear membranes (17.9%) and microsomes (12.9%), respectively. Spectroscopic analysis of apigenin with calf-thymus DNA exhibited intercalation as the dominant binding mode to DNA duplex. Apigenin exposure resulted in significant genoprotective effects in H2O2-stressed RWPE-1 cells by reduction in reactive oxygen species levels. In addition, apigenin exposure suppressed the formation of 8-hydroxy-2′ deoxyguanosine and protected exposed cells from apoptosis. Our studies demonstrate that apigenin is readily taken up by normal prostatic epithelial cells and prostate cancer cells, and is incorporated into their nuclei, where its intercalation with nucleic acid bases may account for its antioxidant and chemopreventive activities. PMID:24614817

  8. Plant flavone apigenin binds to nucleic acid bases and reduces oxidative DNA damage in prostate epithelial cells.

    PubMed

    Sharma, Haripaul; Kanwal, Rajnee; Bhaskaran, Natarajan; Gupta, Sanjay

    2014-01-01

    Oxidative stress has been linked to prostate carcinogenesis as human prostate tissue is vulnerable to oxidative DNA damage. Apigenin, a dietary plant flavone, possesses anti-proliferative and anticancer effects; however, its antioxidant properties have not been fully elucidated. We investigated sub-cellular distribution of apigenin, it's binding to DNA and protective effects against H2O2-induced DNA damage using transformed human prostate epithelial RWPE-1 cells and prostate cancer LNCaP, PC-3 and DU145 cells. Exposure of cells to apigenin exhibited higher accumulation in RWPE-1 and LNCaP cells, compared to PC-3 and DU145 cells. The kinetics of apigenin uptake in LNCaP cells was estimated with a Km value of 5 µmole/L and Vmax of 190 pmoles/million cells/h. Sub-cellular fractionation demonstrated that nuclear matrix retains the highest concentration of apigenin (45.3%), followed by cytosol (23.9%), nuclear membranes (17.9%) and microsomes (12.9%), respectively. Spectroscopic analysis of apigenin with calf-thymus DNA exhibited intercalation as the dominant binding mode to DNA duplex. Apigenin exposure resulted in significant genoprotective effects in H2O2-stressed RWPE-1 cells by reduction in reactive oxygen species levels. In addition, apigenin exposure suppressed the formation of 8-hydroxy-2' deoxyguanosine and protected exposed cells from apoptosis. Our studies demonstrate that apigenin is readily taken up by normal prostatic epithelial cells and prostate cancer cells, and is incorporated into their nuclei, where its intercalation with nucleic acid bases may account for its antioxidant and chemopreventive activities.

  9. Enantioselective binding of L, D-phenylalanine to ct DNA

    NASA Astrophysics Data System (ADS)

    Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

    2009-10-01

    The enantioselective binding of L, D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of L, D-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

  10. Enantioselective binding of L,D-phenylalanine to ct DNA.

    PubMed

    Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

    2009-10-15

    The enantioselective binding of L,D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of l,d-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

  11. Titration of DnaA protein by oriC DnaA-boxes increases dnaA gene expression in Escherichia coli.

    PubMed Central

    Hansen, F G; Koefoed, S; Sørensen, L; Atlung, T

    1987-01-01

    Binding of the DnaA protein to its binding sites, the DnaA-boxes (TTATCCACA), was measured by a simple physiological approach. The presence of extra DnaA-boxes in growing cells leads to a derepression of dnaA gene expression, measured as beta-galactosidase activity of a dnaA-lacZ fusion polypeptide. Different DnaA-boxes caused different degrees of derepression indicating that the DnaA protein requires sequences in addition to the DnaA-box for efficient binding. The DnaA-boxes in oriC might act cooperatively in binding of the DnaA protein. The derepressed levels of DnaA protein obtained in a strain carrying an oriC+-pBR322 chimera were very high and sufficient to activate oriC on the chimeric plasmid, which was maintained at a copy number more than three times that of pBR322. PMID:3034578

  12. The catalytic activity of a recombinant single chain variable fragment nucleic acid-hydrolysing antibody varies with fusion tag and expression host.

    PubMed

    Lee, Joungmin; Kim, Minjae; Seo, Youngsil; Lee, Yeonjin; Park, Hyunjoon; Byun, Sung June; Kwon, Myung-Hee

    2017-11-01

    The antigen-binding properties of single chain Fv antibodies (scFvs) can vary depending on the position and type of fusion tag used, as well as the host cells used for expression. The issue is even more complicated with a catalytic scFv antibody that binds and hydrolyses a specific antigen. Herein, we investigated the antigen-binding and -hydrolysing activities of the catalytic anti-nucleic acid antibody 3D8 scFv expressed in Escherichia coli or HEK293f cells with or without additional amino acid residues at the N- and C-termini. DNA-binding activity was retained in all recombinant forms. However, the DNA-hydrolysing activity varied drastically between forms. The DNA-hydrolysing activity of E. coli-derived 3D8 scFvs was not affected by the presence of a C-terminal human influenza haemagglutinin (HA) or His tag. By contrast, the activity of HEK293f-derived 3D8 scFvs was completely lost when additional residues were included at the N-terminus and/or when a His tag was incorporated at the C-terminus, whereas a HA tag at the C-terminus did not diminish activity. Thus, we demonstrate that the antigen-binding and catalytic activities of a catalytic antibody can be separately affected by the presence of additional residues at the N- and C-termini, and by the host cell type. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. An ancient protein-DNA interaction underlying metazoan sex determination.

    PubMed

    Murphy, Mark W; Lee, John K; Rojo, Sandra; Gearhart, Micah D; Kurahashi, Kayo; Banerjee, Surajit; Loeuille, Guy-André; Bashamboo, Anu; McElreavey, Kenneth; Zarkower, David; Aihara, Hideki; Bardwell, Vivian J

    2015-06-01

    DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. Here we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are used in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.

  14. An ancient protein-DNA interaction underlying metazoan sex determination

    DOE PAGES

    Murphy, Mark W.; Lee, John K.; Rojo, Sandra; ...

    2015-05-25

    DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less

  15. An ancient protein-DNA interaction underlying metazoan sex determination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murphy, Mark W.; Lee, John K.; Rojo, Sandra

    DMRT transcription factors are deeply conserved regulators of metazoan sexual development. They share the DM DNA-binding domain, a unique intertwined double zinc-binding module followed by a C-terminal recognition helix, which binds a pseudopalindromic target DNA. In this paper, we show that DMRT proteins use a unique binding interaction, inserting two adjacent antiparallel recognition helices into a widened DNA major groove to make base-specific contacts. Versatility in how specific base contacts are made allows human DMRT1 to use multiple DNA binding modes (tetramer, trimer and dimer). Chromatin immunoprecipitation with exonuclease treatment (ChIP-exo) indicates that multiple DNA binding modes also are usedmore » in vivo. We show that mutations affecting residues crucial for DNA recognition are associated with an intersex phenotype in flies and with male-to-female sex reversal in humans. Finally, our results illuminate an ancient molecular interaction underlying much of metazoan sexual development.« less

  16. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  17. DNA Binding Mode Transitions of Escherichia coli HUαβ: Evidence for Formation of a Bent DNA – Protein Complex on Intact, Linear Duplex DNA

    PubMed Central

    Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas

    2008-01-01

    Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548

  18. Repeated administration of CGP 46381, a gamma-aminobutyric acidB antagonist, and ethosuximide suppresses seizure-associated cyclic adenosine 3'5' monophosphate response element- and activator protein-1 DNA-binding activities in lethargic (lh/lh) mice.

    PubMed

    Ishige, K; Endo, H; Saito, H; Ito, Y

    2001-01-19

    To characterize seizure-associated increases in cerebral cortical and thalamic cyclic AMP responsive element (CRE)- and activator protein 1 (AP-1) DNA-binding activities in lethargic (lh/lh) mice, a genetic model of absence seizures, we examined the effects of ethosuximide and CGP 46381 on these DNA-binding activities. Repeated administration (twice a day for 5 days) of ethosuximide (200 mg/kg) or CGP 46381 (60 mg/kg) attenuated both seizure behavior and the increased DNA-binding activities, and was more effective than a single administration of these drugs. These treatments did not affect either normal behavior or basal DNA-binding activities in non-epileptic control (+/+) mice. Gel supershift assays revealed that the increased CRE-binding activity was attributable to activation of the binding activity of CREB, and that the c-Fos-c-Jun complex was a component of the increased AP-1 DNA-binding activity.

  19. Synthesis of galactosyl compounds for targeted gene delivery.

    PubMed

    Ren, T; Zhang, G; Liu, D

    2001-11-01

    Cell-specific DNA delivery offers a great potential for targeted gene therapy. Toward this end, we have synthesized a series of compounds carrying galactose residues as a targeting ligand for asialoglycoprotein receptors of hepatocytes and primary amine groups as a functional domain for DNA binding. Biological activity of these galactosyl compounds in DNA delivery was evaluated in HepG2 and BL-6 cells and compared with respect to the number of galactose residues as well as primary amine groups in each molecule. Transfection experiments using a firefly luciferase gene as a reporter revealed that compounds with multivalent binding properties were more active in DNA delivery. An optimal transfection activity in HepG2 cells requires seven primary amine groups and a minimum of two galactose residues in each molecule. The transfection activity of compounds carrying multi-galactose residues can be inhibited by asialofetuin, a natural substrate for asialoglycoprotein receptors of hepatocytes, suggesting that gene transfer by these galactosyl compounds is asialoglycoprotein receptor-mediated. These results provide direct evidence in support of our new strategy for the use of small and synthetic compounds for cell specific and targeted gene delivery.

  20. Preparation of arginine modified PEI-conjugated chitosan copolymer for DNA delivery.

    PubMed

    Zhang, Xi; Duan, Yajing; Wang, Dongfang; Bian, Fengling

    2015-05-20

    Polyethylenimine-conjugated chitosan (CS-PEI) and arginine modified polyethylenimine-conjugated chitosan (CS-PEI-Arg) were prepared, and the copolymers were characterized by FTIR, (1)H NMR, and XRD. The properties of these copolymers like plasmid DNA (pDNA) binding capacity, complexes' size and zeta potential, cytotoxicity and transfection efficiency were also evaluated. The results show that CS-PEI-Arg derivatives can bind pDNA thoroughly, and form complexes with sizes about 170 nm. Cytotoxicity assay in HepG2 and 293T cells show that CS-PEI-Arg has lower cytotoxicity compared with CS-PEI, which is similar to CS and far below that of PEI. In vitro luciferase assay show that CS-PEI-Arg has better transfection efficiency than CS-PEI, which is superior to that of PEI. The best transfection efficiency of CS-PEI-Arg (N/P = 50) is 2.3-fold, 4.2-fold of those of CS-PEI (N/P = 20) and PEI's (N/P = 10) efficiency respectively. These results display that CS-PEI-Arg is a promising candidate as an efficient gene vector. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Engineering and Application of Zinc Finger Proteins and TALEs for Biomedical Research.

    PubMed

    Kim, Moon-Soo; Kini, Anu Ganesh

    2017-08-01

    Engineered DNA-binding domains provide a powerful technology for numerous biomedical studies due to their ability to recognize specific DNA sequences. Zinc fingers (ZF) are one of the most common DNA-binding domains and have been extensively studied for a variety of applications, such as gene regulation, genome engineering and diagnostics. Another novel DNA-binding domain known as a transcriptional activator-like effector (TALE) has been more recently discovered, which has a previously undescribed DNA-binding mode. Due to their modular architecture and flexibility, TALEs have been rapidly developed into artificial gene targeting reagents. Here, we describe the methods used to design these DNA-binding proteins and their key applications in biomedical research.

  2. Spectroscopic and molecular docking studies on the interaction of antiviral drug nevirapine with calf thymus DNA.

    PubMed

    Moghadam, Neda Hosseinpour; Salehzadeh, Sadegh; Shahabadi, Nahid

    2017-09-02

    The interaction of calf thymus DNA with nevirapine at physiological pH was studied by using absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, salt effect studies and computational methods. The drug binds to ct-DNA in a groove binding mode, as shown by slight variation in the viscosity of ct-DNA. Furthermore, competitive fluorimetric studies with Hoechst 33258 indicate that nevirapine binds to DNA via groove binding. Moreover, the structure of nevirapine was optimized by DFT calculations and was used for the molecular docking calculations. The molecular docking results suggested that nevirapine prefers to bind on the minor groove of ct-DNA.

  3. Insulator protein Su(Hw) recruits SAGA and Brahma complexes and constitutes part of Origin Recognition Complex-binding sites in the Drosophila genome

    PubMed Central

    Vorobyeva, Nadezhda E.; Mazina, Marina U.; Golovnin, Anton K.; Kopytova, Daria V.; Gurskiy, Dmitriy Y.; Nabirochkina, Elena N.; Georgieva, Sofia G.; Georgiev, Pavel G.; Krasnov, Aleksey N.

    2013-01-01

    Despite increasing data on the properties of replication origins, molecular mechanisms underlying origin recognition complex (ORC) positioning in the genome are still poorly understood. The Su(Hw) protein accounts for the activity of best-studied Drosophila insulators. Here, we show that Su(Hw) recruits the histone acetyltransferase complex SAGA and chromatin remodeler Brahma to Su(Hw)-dependent insulators, which gives rise to regions with low nucleosome density and creates conditions for ORC binding. Depletion in Su(Hw) leads to a dramatic drop in the levels of SAGA, Brahma and ORC subunits and a significant increase in nucleosome density on Su(Hw)-dependent insulators, whereas artificial Su(Hw) recruitment itself is sufficient for subsequent SAGA, Brahma and ORC binding. In contrast to the majority of replication origins that associate with promoters of active genes, Su(Hw)-binding sites constitute a small proportion (6%) of ORC-binding sites that are localized preferentially in transcriptionally inactive chromatin regions termed BLACK and BLUE chromatin. We suggest that the key determinants of ORC positioning in the genome are DNA-binding proteins that constitute different DNA regulatory elements, including insulators, promoters and enhancers. Su(Hw) is the first example of such a protein. PMID:23609538

  4. Synthesis and evaluation of 7-substituted-5,6-dihydrobenzo[c]acridine derivatives as new c-KIT promoter G-quadruplex binding ligands.

    PubMed

    Guo, Qian-Liang; Su, Hua-Fei; Wang, Ning; Liao, Sheng-Rong; Lu, Yu-Ting; Ou, Tian-Miao; Tan, Jia-Heng; Li, Ding; Huang, Zhi-Shu

    2017-04-21

    It has been shown that treatment of cancer cells with c-KIT G-quadruplex binding ligands can reduce their c-KIT expression levels thus inhibiting cell proliferation and inducing cell apoptosis. Herein, a series of new 7-substituted-5,6-dihydrobenzo[c]acridine derivatives were designed and synthesized. Subsequent biophysical evaluation demonstrated that the derivatives could effectively bind to and stabilize c-KIT G-quadruplex with good selectivity against duplex DNA. It was found that 12-N-methylated derivatives with a positive charge introduced at 12-position of 5,6-dihydrobenzo[c]acridine ring had similar binding affinity but lower stabilizing ability to c-KIT G-quadruplex DNA, compared with those of nonmethylated derivatives. Further molecular modeling studies showed possible binding modes of G-quadruplex with the ligands. RT-PCR assay and Western blot showed that compound 2b suppressed transcription and translation of c-KIT gene in K562 cells, which was consistent with the property of an effective G-quadruplex binding ligand targeting c-KIT oncogene promoter. Further biological evaluation showed that compound 2b could induce apoptosis through activation of the caspase-3 cascade pathway. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Synthesis, characterization, DNA/protein interaction and cytotoxicity studies of Cu(II) and Co(II) complexes derived from dipyridyl triazole ligands

    NASA Astrophysics Data System (ADS)

    Zhang, Wei; Yao, Di; Wei, Yi; Tang, Jie; Bian, He-Dong; Huang, Fu-Ping; Liang, Hong

    2016-06-01

    Four different transition metal complexes containing dipyridyl triazole ligands, namely [Cu(abpt)2Cl2]·2H2O (1), [Cu(abpt)2(ClO4)2] (2), [Co2(abpt)2(H2O)2Cl2]·Cl2·4H2O (3) and [Co2(Hbpt)2(CH3OH)2(NO3)2] (4) have been designed, synthesized and further structurally characterized by X-ray crystallography, ESI-MS, elemental analysis, IR and Raman spectroscopy. In these complexes, the both ligands act as bidentate ligands with N, N donors. DNA binding interactions with calf thymus DNA (ct-DNA) of the ligand and its complexes 1 ~ 4 were investigated via electronic absorption, fluorescence quenching, circular dichroism and viscosity measurements as well as confocal Laser Raman spectroscopy. The results show these complexes are able to bind to DNA via the non-covalent mode i.e. intercalation and groove binding or electrostatic interactions. The interactions with bovine serum albumin (BSA) were also studied using UV-Vis and fluorescence spectroscopic methods which indicated that fluorescence quenching of BSA by these compounds was the presence of both static and dynamic quenching. Moreover, the in vitro cytotoxic effects of the complexes against four cell lines SK-OV-3, HL-7702, BEL7404 and NCI-H460 showed the necessity of the coordination action on the biological properties on the respective complex and that all four complexes exhibited substantial cytotoxic activity.

  6. Discovery of DNA dyes Hoechst 34580 and 33342 as good candidates for inhibiting amyloid beta formation: in silico and in vitro study

    NASA Astrophysics Data System (ADS)

    Thai, Nguyen Quoc; Tseng, Ning-Hsuan; Vu, Mui Thi; Nguyen, Tin Trung; Linh, Huynh Quang; Hu, Chin-Kun; Chen, Yun-Ru; Li, Mai Suan

    2016-08-01

    Combining Lipinski's rule with the docking and steered molecular dynamics simulations and using the PubChem data base of about 1.4 million compounds, we have obtained DNA dyes Hoechst 34580 and Hoechst 33342 as top-leads for the Alzheimer's disease. The binding properties of these ligands to amyloid beta (Aβ) fibril were thoroughly studied by in silico and in vitro experiments. Hoechst 34580 and Hoechst 33342 prefer to locate near hydrophobic regions with binding affinity mainly governed by the van der Waals interaction. By the Thioflavin T assay, it was found that the inhibition constant IC50 ≈ 0.86 and 0.68 μM for Hoechst 34580 and Hoechst 33342, respectively. This result qualitatively agrees with the binding free energy estimated using the molecular mechanic-Poisson Boltzmann surface area method and all-atom simulations with the AMBER-f99SB-ILDN force field and water model TIP3P. In addition, DNA dyes have the high capability to cross the blood brain barrier. Thus, both in silico and in vitro experiments have shown that Hoechst 34580 and 33342 are good candidates for treating the Alzheimer's disease by inhibiting Aβ formation.

  7. Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsodikov, Oleg V.; Biswas, Tapan

    An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

  8. Characterization of human translesion DNA synthesis across a UV-induced DNA lesion

    PubMed Central

    Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

    2016-01-01

    Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570

  9. Sequence-dependent DNA flexibility mediates DNase I cleavage.

    PubMed

    Heddi, Brahim; Abi-Ghanem, Josephine; Lavigne, Marc; Hartmann, Brigitte

    2010-01-08

    Understanding the preference of nonspecific proteins for certain DNA structural features requires an accurate description of the properties of free DNA, especially regarding their possible predisposition to adopt a conformation that favors the formation of a complex. Exploiting previous exhaustive NMR studies performed on free DNA oligomers, we investigated the molecular basis of DNase I sensitivity under conditions where DNase I binding limits the probability of cleavage. We showed that cleavage intensity was correlated with adjacent 3' phosphate linkage flexibility, monitored by (31)P chemical shifts. Examining NMR-refined DNA structures highlighted that sequence-dependent flexible phosphates were associated with large minor groove variations that may promote the affinity of DNase I, according to relevant DNA-protein complexes. In sum, this work demonstrates that specificity in DNA-DNase I interaction is mediated by DNA flexibility, which influences the induced-fit transitions required to form productive complexes.

  10. Binding Linkage in a Telomere DNA–Protein Complex at the Ends of Oxytricha nova Chromosomes

    PubMed Central

    Buczek, Pawel; Orr, Rochelle S.; Pyper, Sean R.; Shum, Mili; Ota, Emily Kimmel Irene; Gerum, Shawn E.; Horvath, Martin P.

    2005-01-01

    Alpha and beta protein subunits of the telomere end binding protein from Oxytricha nova (OnTEBP) combine with telomere single strand DNA to form a protective cap at the ends of chromosomes. We tested how protein–protein interactions seen in the co-crystal structure relate to DNA binding through use of fusion proteins engineered as different combinations of domains and subunits derived from OnTEBP. Joining alpha and beta resulted in a protein that bound single strand telomere DNA with high affinity (KD-DNA=1.4 nM). Another fusion protein, constructed without the C-terminal protein–protein interaction domain of alpha, bound DNA with 200-fold diminished affinity (KD-DNA=290 nM) even though the DNA-binding domains of alpha and beta were joined through a peptide linker. Adding back the alpha C-terminal domain as a separate protein restored high-affinity DNA binding. The binding behaviors of these fusion proteins and the native protein subunits are consistent with cooperative linkage between protein-association and DNA-binding equilibria. Linking DNA–protein stability to protein–protein contacts at a remote site may provide a trigger point for DNA–protein disassembly during telomere replication when the single strand telomere DNA must exchange between a very stable OnTEBP complex and telomerase. PMID:15967465

  11. Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.

    PubMed

    Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C

    2017-03-21

    A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.

  12. DNA Charge Transport: From Chemical Principles to the Cell

    PubMed Central

    Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.

    2016-01-01

    The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

  13. Modeling the interactions of the nucleotide excision repair UvrA(2) dimer with DNA.

    PubMed

    Gantchev, Tsvetan G; Hunting, Darel J

    2010-12-28

    The UvrA protein initiates the DNA damage recognition process by the bacterial nucleotide excision repair (NER) system. Recently, crystallographic structures of holo-UvrA(2) dimers from two different microorganisms have been released (Protein Data Bank entries 2r6f , 2vf7 , and 2vf8 ). However, the details of the DNA binding by UvrA(2) and other peculiarities involved in the damage recognition process remain unknown. We have undertaken a molecular modeling approach to appraise the possible modes of DNA-UvrA(2) interaction using molecular docking and short-scale guided molecular dynamics [continuum field, constrained, and/or unrestricted simulated annealing (SA)], taking into account the three-dimensional location of a series of mutation-identified UvrA residues implicated in DNA binding. The molecular docking was based on the assumptions that the UvrA(2) dimer is preformed prior to DNA binding and that no major protein conformational rearrangements, except moderate domain reorientations, are required for binding of undamaged DNA. As a first approximation, DNA was treated as a rigid ligand. From the electrostatic relief of the ventral surface of UvrA(2), we initially identified three, noncollinear DNA binding paths. Each of the three resulting nucleoprotein complexes (C1, C2, and C3) was analyzed separately, including calculation of binding energies, the number and type of interaction residues (including mutated ones), and the predominant mode of translational and rotational motion of specific protein domains after SA to ensure improved DNA binding. The UvrA(2) dimer can accommodate DNA in all three orientations, albeit with different binding strengths. One of the UvrA(2)-DNA complexes (C1) fulfilled most of the requirements (high interaction energy, proximity of DNA to mutated residues, etc.) expected for a natural, high-affinity DNA binding site. This nucleoprotein presents a structural organization that is designed to clamp and bend double-stranded DNA. We examined the binding site in more detail by docking DNAs of significantly different (AT- vs CG-enriched) sequences and by submitting the complexes to DNA-unrestricted SA. It was found that in a manner independent of the DNA sequence and applied MD protocols, UvrA(2) favors binding of a bent and unwound undamaged DNA, with a kink positioned in the proximity of the Zn3 hairpins, anticollinearly aligned at the bottom of the ventral protein surface. It is further hypothesized that the Zn3 modules play an essential role in the damage recognition process and that the apparent existence of a family of DNA binding sites might be biologically relevant. Our data should prove to be useful in rational (structure-based) mutation studies.

  14. Pre-steady-state Kinetic Analysis of a Family D DNA Polymerase from Thermococcus sp. 9°N Reveals Mechanisms for Archaeal Genomic Replication and Maintenance*

    PubMed Central

    Schermerhorn, Kelly M.; Gardner, Andrew F.

    2015-01-01

    Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179

  15. DNA sensing by a Eu-binding peptide containing a proflavine unit.

    PubMed

    Ancel, Laetitia; Gateau, Christelle; Lebrun, Colette; Delangle, Pascale

    2013-01-18

    Synthesis of a lanthanide-binding peptide (LBP) for the detection of double-stranded DNA is presented. A proflavine moiety was introduced into a high affinity LBP involving two unnatural chelating amino acids in the Ln ion coordination. The Eu(3+)-LBP complex is demonstrated to bind to ct-DNA and to sensitize Eu luminescence. The DNA binding process is effectively detected via the Eu-centered luminescence thanks to the intimate coupling between the LBP scaffold and DNA intercalating unit.

  16. Thermodynamic characterization of binding Oxytricha nova single strand telomere DNA with the alpha protein N-terminal domain.

    PubMed

    Buczek, Pawel; Horvath, Martin P

    2006-06-23

    The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.

  17. Redesigning the specificity of protein-DNA interactions with Rosetta.

    PubMed

    Thyme, Summer; Baker, David

    2014-01-01

    Building protein tools that can selectively bind or cleave specific DNA sequences requires efficient technologies for modifying protein-DNA interactions. Computational design is one method for accomplishing this goal. In this chapter, we present the current state of protein-DNA interface design with the Rosetta macromolecular modeling program. The LAGLIDADG endonuclease family of DNA-cleaving enzymes, under study as potential gene therapy reagents, has been the main testing ground for these in silico protocols. At this time, the computational methods are most useful for designing endonuclease variants that can accommodate small numbers of target site substitutions. Attempts to engineer for more extensive interface changes will likely benefit from an approach that uses the computational design results in conjunction with a high-throughput directed evolution or screening procedure. The family of enzymes presents an engineering challenge because their interfaces are highly integrated and there is significant coordination between the binding and catalysis events. Future developments in the computational algorithms depend on experimental feedback to improve understanding and modeling of these complex enzymatic features. This chapter presents both the basic method of design that has been successfully used to modulate specificity and more advanced procedures that incorporate DNA flexibility and other properties that are likely necessary for reliable modeling of more extensive target site changes.

  18. Structural basis for DNA binding by replication initiator Mcm10

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warren, Eric M.; Vaithiyalingam, Sivaraja; Haworth, Justin

    2009-06-30

    Mcm10 is an essential eukaryotic DNA replication protein required for assembly and progression of the replication fork. The highly conserved internal domain (Mcm10-ID) has been shown to physically interact with single-stranded (ss) DNA, DNA polymerase alpha, and proliferating cell nuclear antigen (PCNA). The crystal structure of Xenopus laevis Mcm10-ID presented here reveals a DNA binding architecture composed of an oligonucleotide/oligosaccharide-fold followed in tandem by a variant and highly basic zinc finger. NMR chemical shift perturbation and mutational studies of DNA binding activity in vitro reveal how Mcm10 uses this unique surface to engage ssDNA. Corresponding mutations in Saccharomyces cerevisiae resultmore » in increased sensitivity to replication stress, demonstrating the functional importance of DNA binding by this region of Mcm10 to replication. In addition, mapping Mcm10 mutations known to disrupt PCNA, polymerase alpha, and DNA interactions onto the crystal structure provides insight into how Mcm10 might coordinate protein and DNA binding within the replisome.« less

  19. Non-B-Form DNA Is Enriched at Centromeres

    PubMed Central

    Henikoff, Steven

    2018-01-01

    Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

  20. Cdc45-induced loading of human RPA onto single-stranded DNA

    PubMed Central

    Tessmer, Ingrid; Prus, Piotr; Schlott, Bernhard; Pospiech, Helmut

    2017-01-01

    Abstract Cell division cycle protein 45 (Cdc45) is an essential component of the eukaryotic replicative DNA helicase. We found that human Cdc45 forms a complex with the single-stranded DNA (ssDNA) binding protein RPA. Moreover, it actively loads RPA onto nascent ssDNA. Pull-down assays and surface plasmon resonance studies revealed that Cdc45-bound RPA complexed with ssDNA in the 8–10 nucleotide binding mode, but dissociated when RPA covered a 30-mer. Real-time analysis of RPA-ssDNA binding demonstrated that Cdc45 catalytically loaded RPA onto ssDNA. This placement reaction required physical contacts of Cdc45 with the RPA70A subdomain. Our results imply that Cdc45 controlled stabilization of the 8-nt RPA binding mode, the subsequent RPA transition into 30-mer mode and facilitated an ordered binding to ssDNA. We propose that a Cdc45-mediated loading guarantees a seamless deposition of RPA on newly emerging ssDNA at the nascent replication fork. PMID:28100698

  1. Rapid and simple method for purification of nucleic acids.

    PubMed

    Boom, R; Sol, C J; Salimans, M M; Jansen, C L; Wertheim-van Dillen, P M; van der Noordaa, J

    1990-03-01

    We have developed a simple, rapid, and reliable protocol for the small-scale purification of DNA and RNA from, e.g., human serum and urine. The method is based on the lysing and nuclease-inactivating properties of the chaotropic agent guanidinium thiocyanate together with the nucleic acid-binding properties of silica particles or diatoms in the presence of this agent. By using size-fractionated silica particles, nucleic acids (covalently closed circular, relaxed circular, and linear double-stranded DNA; single-stranded DNA; and rRNA) could be purified from 12 different specimens in less than 1 h and were recovered in the initial reaction vessel. Purified DNA (although significantly sheared) was a good substrate for restriction endonucleases and DNA ligase and was recovered with high yields (usually over 50%) from the picogram to the microgram level. Copurified rRNA was recovered almost undegraded. Substituting size-fractionated silica particles for diatoms (the fossilized cell walls of unicellular algae) allowed for the purification of microgram amounts of genomic DNA, plasmid DNA, and rRNA from cell-rich sources, as exemplified for pathogenic gram-negative bacteria. In this paper, we show representative experiments illustrating some characteristics of the procedure which may have wide application in clinical microbiology.

  2. The large terminase DNA packaging motor grips DNA with its ATPase domain for cleavage by the flexible nuclease domain

    PubMed Central

    Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang

    2017-01-01

    Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398

  3. Histamine monolith versatility to purify supercoiled plasmid deoxyribonucleic acid from Escherichia coli lysate.

    PubMed

    Sousa, A; Almeida, A M; Černigoj, U; Sousa, F; Queiroz, J A

    2014-08-15

    Preparation of high quantities of supercoiled plasmid DNA of pharmaceutical grade purity is a research area where intensive investigation is being performed. From this standpoint, several downstream methods have been proposed, among them the monolithic chromatographic strategies owing to excellent mass transfer properties of monolithic supports and their high binding capacity for large biomolecules. The present study explores the physicochemical properties of histamine ligand in a supercoiled plasmid DNA purification process from an Escherichia coli clarified lysate, where the emphasis is given to the elution strategy that allows higher selectivity and efficient removal of other impurities besides the open circular isoform. The combination of high NaCl concentration and acidic pH allowed the elimination of 89% of RNA during the preparative loading of the lysate sample. The results of the purification strategy with ascending sodium chloride gradient revealed that 97% of supercoiled plasmid DNA was recovered with a purity degree of 99%. In addition, using a combined purification strategy with ascending sodium chloride (capture step) and then descending ammonium sulfate (polishing step) gradient, it was achieved a lower supercoiled plasmid DNA recovery yield of 79% with a purity degree of 92%, although the dynamic binding capacity under these conditions was higher than in the previous strategy. A significant reduction of host contents, such as proteins, RNA and genomic DNA, was obtained in both purification strategies. Accordingly, histamine is a useful and versatile ligand that allows the desirable supercoiled plasmid purification with high yield and purity level. Copyright © 2014. Published by Elsevier B.V.

  4. CyDNA: synthesis and replication of highly Cy-dye substituted DNA by an evolved polymerase.

    PubMed

    Ramsay, Nicola; Jemth, Ann-Sofie; Brown, Anthony; Crampton, Neal; Dear, Paul; Holliger, Philipp

    2010-04-14

    DNA not only transmits genetic information but can also serve as a versatile supramolecular scaffold. Here we describe a strategy for the synthesis and replication of DNA displaying hundreds of substituents using directed evolution of polymerase function by short-patch compartmentalized self-replication (spCSR) and the widely used fluorescent dye labeled deoxinucleotide triphosphates Cy3-dCTP and Cy5-dCTP as substrates. In just two rounds of spCSR selection, we have isolated a polymerase that allows the PCR amplification of double stranded DNA fragments up to 1kb, in which all dC bases are substituted by its fluorescent dye-labeled equivalent Cy3- or Cy5-dC. The resulting "CyDNA" displays hundreds of aromatic heterocycles on the outside of the DNA helix and is brightly colored and highly fluorescent. CyDNA also exhibits significantly altered physicochemical properties compared to standard B-form DNA, including loss of silica and intercalating dye binding, resistance to cleavage by some endonucleases, an up to 40% increased apparent diameter as judged by atomic force microscopy and organic phase partitioning during phenol extraction. CyDNA also displays very bright fluorescence enabling significant signal gains in microarray and microfluidic applications. CyDNA represents a step toward a long-term goal of the encoded synthesis of DNA-based polymers of programmable and evolvable sequence and properties.

  5. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    PubMed

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  6. DNA immobilization and detection on cellulose paper using a surface grown cationic polymer via ATRP.

    PubMed

    Aied, Ahmed; Zheng, Yu; Pandit, Abhay; Wang, Wenxin

    2012-02-01

    Cationic polymers with various structures have been widely investigated in the areas of medical diagnostics and molecular biology because of their unique binding properties and capability to interact with biological molecules in complex biological environments. In this work, we report the grafting of a linear cationic polymer from an atom transfer radical polymerization (ATRP) initiator bound to cellulose paper surface. We show successful binding of ATRP initiator onto cellulose paper and grafting of polymer chains from the immobilized initiator with ATRP. The cellulose paper grafted polymer was used in combination with PicoGreen (PG) to demonstrate detection of nucleic acids in the nanogram range in homogeneous solution and in a biological sample (serum). The results showed specific identification of hybridized DNA after addition of PG in both solutions.

  7. Conjugation of Benzylvanillin and Benzimidazole Structure Improves DNA Binding with Enhanced Antileukemic Properties

    PubMed Central

    Al-Mudarris, Ban A.; Chen, Shih-Hsun; Liang, Po-Huang; Osman, Hasnah; Jamal Din, Shah Kamal Khan; Abdul Majid, Amin M. S.

    2013-01-01

    Benzyl-o-vanillin and benzimidazole nucleus serve as important pharmacophore in drug discovery. The benzyl vanillin (2-(benzyloxy)-3-methoxybenzaldehyde) compound shows anti-proliferative activity in HL60 leukemia cancer cells and can effect cell cycle progression at G2/M phase. Its apoptosis activity was due to disruption of mitochondrial functioning. In this study, we have studied a series of compounds consisting of benzyl vanillin and benzimidazole structures. We hypothesize that by fusing these two structures we can produce compounds that have better anticancer activity with improved specificity particularly towards the leukemia cell line. Here we explored the anticancer activity of three compounds namely 2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2MP, N-1-(2-benzyloxy-3-methoxybenzyl)-2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2XP, and (R) and (S)-1-(2-benzyloxy-3-methoxyphenyl)-2, 2, 2-trichloroethyl benzenesulfonate, 3BS and compared their activity to 2-benzyloxy-3-methoxybenzaldehyde, (Bn1), the parent compound. 2XP and 3BS induces cell death of U937 leukemic cell line through DNA fragmentation that lead to the intrinsic caspase 9 activation. DNA binding study primarily by the equilibrium binding titration assay followed by the Viscosity study reveal the DNA binding through groove region with intrinsic binding constant 7.39 µM/bp and 6.86 µM/bp for 3BS and 2XP respectively. 2XP and 3BS showed strong DNA binding activity by the UV titration method with the computational drug modeling showed that both 2XP and 3BS failed to form any electrostatic linkages except via hydrophobic interaction through the minor groove region of the nucleic acid. The benzylvanillin alone (Bn1) has weak anticancer activity even after it was combined with the benzimidazole (2MP), but after addition of another benzylvanillin structure (2XP), stronger activity was observed. Also, the combination of benzylvanillin with benzenesulfonate (3BS) significantly improved the anticancer activity of Bn1. The present study provides a new insight of benzyl vanillin derivatives as potential anti-leukemic agent. PMID:24260527

  8. Effect of Fe3+ on Curcumin-DNA Complex Studied by FT-Raman Spectroscopy

    NASA Astrophysics Data System (ADS)

    Senthil, K.; Sarojini, R.

    2008-11-01

    Curcumin is a non toxic and natural antioxidant. The interaction of curcumin with DNA is widely used in clinical treatment of a variety of different forms of cancer, but its antioxidant property turns into proxidant in the presence of high Fe3+ concentrations. However, the relevance of the pro-oxidant nature of curcumin at molecular level is not clearly determined. Thus, in the present study the interaction of Fe(III) on Curcumin DNA complexes were investigated at physiological pH with Fe(III)/drug/DNA (Phosphate) molar ratios (r) 1:10:50, 1:5:25, 1:2:10 and 1:1:5. FT-Raman Spectroscopy was used to establish correlation between spectral changes and drug binding mode, sequence selectivity, DNA Conformation and Structural properties of Fe(III)/drug/DNA complexes in aqueous solution. Spectroscopic results showed that the major spectral changes were observed at 688 cm-1(G), 835 cm-1 (O-P-O), 1092 cm-1 (PO2-), 1485 cm-1 (G,A,T) and 1683 cm-1 (T), 1723 cm-1 (G) in Fe(III)/drug/DNA complex indicating affinity of Fe(III)/drug with the phosphate and DNA base pairs. The present result showed that the combination of Fe-curcumin induced significant DNA damage in a concentration dependent manner.

  9. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

    PubMed

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

    2014-11-01

    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. Loop L1 governs the DNA-binding specificity and order for RecA-catalyzed reactions in homologous recombination and DNA repair

    PubMed Central

    Shinohara, Takeshi; Ikawa, Shukuko; Iwasaki, Wakana; Hiraki, Toshiki; Hikima, Takaaki; Mikawa, Tsutomu; Arai, Naoto; Kamiya, Nobuo; Shibata, Takehiko

    2015-01-01

    In all organisms, RecA-family recombinases catalyze homologous joint formation in homologous genetic recombination, which is essential for genome stability and diversification. In homologous joint formation, ATP-bound RecA/Rad51-recombinases first bind single-stranded DNA at its primary site and then interact with double-stranded DNA at another site. The underlying reason and the regulatory mechanism for this conserved binding order remain unknown. A comparison of the loop L1 structures in a DNA-free RecA crystal that we originally determined and in the reported DNA-bound active RecA crystals suggested that the aspartate at position 161 in loop L1 in DNA-free RecA prevented double-stranded, but not single-stranded, DNA-binding to the primary site. This was confirmed by the effects of the Ala-replacement of Asp-161 (D161A), analyzed directly by gel-mobility shift assays and indirectly by DNA-dependent ATPase activity and SOS repressor cleavage. When RecA/Rad51-recombinases interact with double-stranded DNA before single-stranded DNA, homologous joint-formation is suppressed, likely by forming a dead-end product. We found that the D161A-replacement reduced this suppression, probably by allowing double-stranded DNA to bind preferentially and reversibly to the primary site. Thus, Asp-161 in the flexible loop L1 of wild-type RecA determines the preference for single-stranded DNA-binding to the primary site and regulates the DNA-binding order in RecA-catalyzed recombinase reactions. PMID:25561575

  11. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    PubMed Central

    Niskanen, Einari A; Hytönen, Vesa P; Grapputo, Alessandro; Nordlund, Henri R; Kulomaa, Markku S; Laitinen, Olli H

    2005-01-01

    Background A chicken egg contains several biotin-binding proteins (BBPs), whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins. PMID:15777476

  12. The prolyl isomerase FKBP25 regulates microtubule polymerization impacting cell cycle progression and genomic stability

    PubMed Central

    Dilworth, David; Gudavicius, Geoff; Xu, Xiaoxue; Boyce, Andrew K J; O’Sullivan, Connor; Serpa, Jason J; Bilenky, Misha; Petrochenko, Evgeniy V; Borchers, Christoph H; Hirst, Martin; Swayne, Leigh Anne; Howard, Perry; Nelson, Christopher J

    2018-01-01

    Abstract FK506 binding proteins (FKBPs) catalyze the interconversion of cis-trans proline conformers in proteins. Importantly, FK506 drugs have anti-cancer and neuroprotective properties, but the effectors and mechanisms underpinning these properties are not well understood because the cellular function(s) of most FKBP proteins are unclear. FKBP25 is a nuclear prolyl isomerase that interacts directly with nucleic acids and is associated with several DNA/RNA binding proteins. Here, we show the catalytic FKBP domain binds microtubules (MTs) directly to promote their polymerization and stabilize the MT network. Furthermore, FKBP25 associates with the mitotic spindle and regulates entry into mitosis. This interaction is important for mitotic spindle dynamics, as we observe increased chromosome instability in FKBP25 knockdown cells. Finally, we provide evidence that FKBP25 association with chromatin is cell-cycle regulated by Protein Kinase C phosphorylation. This disrupts FKBP25–DNA contacts during mitosis while maintaining its interaction with the spindle apparatus. Collectively, these data support a model where FKBP25 association with chromatin and MTs is carefully choreographed to ensure faithful genome duplication. Additionally, they highlight that FKBP25 is a MT-associated FK506 receptor and potential therapeutic target in MT-associated diseases. PMID:29361176

  13. Modulation of FadR Binding Capacity for Acyl-CoA Fatty Acids Through Structure-Guided Mutagenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacik, John-Paul; Yeager, Chris M.; Twary, Scott N.

    FadR is a versatile global regulator in Escherichia coli that controls fatty acid metabolism and thereby modulates the ability of this bacterium to grow using fatty acids or acetate as the sole carbon source. FadR regulates fatty acid metabolism in response to intra-cellular concentrations of acyl-CoA lipids. The ability of FadR to bind acyl-CoA fatty acids is hence of significant interest for the engineering of biosynthetic pathways for the production of lipid-based biofuels and commodity chemicals. Based on the available crystal structure of E. coli bound to myristoyl- CoA, we predicted amino acid positions within the effector binding pocket thatmore » would alter the ability of FadR to bind acyl-CoA fatty acids without affecting DNA binding. We utilized fluorescence polarization to characterize the in-vitro binding properties of wild type and mutant FadR. We found that a Leu102Ala mutant enhanced binding of the effector, likely by increasing the size of the binding pocket for the acyl moiety of the molecule. Conversely, the elimination of the guanidine side chain (Arg213Ala and Arg213Met mutants) of the CoA moiety binding site severely diminished the ability of FadR to bind the acyl-CoA effector. These results demonstrate the ability to fine tune FadR binding capacity. The validation of an efficient method to fully characterize all the binding events involved in the specific activity (effector and DNA operator binding) of FadR has allowed us to increase our understanding of the role of specific amino acids in the binding and recognition of acyl-CoA fatty acids and will greatly facilitate efforts aimed at engineering tunable FadR regulators for synthetic biology.« less

  14. Modulation of FadR Binding Capacity for Acyl-CoA Fatty Acids Through Structure-Guided Mutagenesis

    DOE PAGES

    Bacik, John-Paul; Yeager, Chris M.; Twary, Scott N.; ...

    2015-09-18

    FadR is a versatile global regulator in Escherichia coli that controls fatty acid metabolism and thereby modulates the ability of this bacterium to grow using fatty acids or acetate as the sole carbon source. FadR regulates fatty acid metabolism in response to intra-cellular concentrations of acyl-CoA lipids. The ability of FadR to bind acyl-CoA fatty acids is hence of significant interest for the engineering of biosynthetic pathways for the production of lipid-based biofuels and commodity chemicals. Based on the available crystal structure of E. coli bound to myristoyl- CoA, we predicted amino acid positions within the effector binding pocket thatmore » would alter the ability of FadR to bind acyl-CoA fatty acids without affecting DNA binding. We utilized fluorescence polarization to characterize the in-vitro binding properties of wild type and mutant FadR. We found that a Leu102Ala mutant enhanced binding of the effector, likely by increasing the size of the binding pocket for the acyl moiety of the molecule. Conversely, the elimination of the guanidine side chain (Arg213Ala and Arg213Met mutants) of the CoA moiety binding site severely diminished the ability of FadR to bind the acyl-CoA effector. These results demonstrate the ability to fine tune FadR binding capacity. The validation of an efficient method to fully characterize all the binding events involved in the specific activity (effector and DNA operator binding) of FadR has allowed us to increase our understanding of the role of specific amino acids in the binding and recognition of acyl-CoA fatty acids and will greatly facilitate efforts aimed at engineering tunable FadR regulators for synthetic biology.« less

  15. Single DNA molecules on freestanding and supported cationic lipid bilayers: diverse conformational dynamics controlled by the local bilayer properties

    NASA Astrophysics Data System (ADS)

    Herold, Christoph; Schwille, Petra; Petrov, Eugene P.

    2016-02-01

    We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.

  16. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

    2013-11-20

    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

  17. Steroids and the scientist.

    PubMed

    Gustafsson, Jan-Ake

    2005-06-01

    Our interest in nuclear receptors (NRs) originated from early studies on hepatic steroid metabolism. We discovered a new hypothalamo-pituitary-liver axis, imprinted neonatally by androgens and operating through sexually differentiated GH secretory patterns. Male and female patterns have opposite effects on sexually differentiated hepatic genes, explaining sexually dimorphic liver patterns. To further understand steroid action, we purified the glucocorticoid receptor (GR) leading to our discovery of the NR three-domain structure, with separable DNA binding domain and ligand binding domains and a third domain now known to have transcriptional regulatory properties. Knowledge of this domain structure has been immensely important for deciphering NR actions. Using this first purified NR, we collaborated with Keith Yamamoto and first demonstrated specific NR binding to DNA. This also was the first demonstration of a mammalian transcription factor, a breakthrough that led to discovery of NR response elements. In further collaboration with Yamamoto, we cloned the first NR cDNA sequences, leading to cloning of the superfamily of NR genes. With Yamamoto and Kaptein, we determined the first three-dimensional NR structure, that of DNA binding domain. Later work on orphan receptors resulted in the first discovery of: 1) endogenous ligands for an orphan receptor (fatty acids as activators of peroxisomal proliferator-activated receptor alpha); 2) liver X receptor beta (OR-1) and its role in central nervous system cholesterol homeostasis; and 3) estrogen receptor beta, leading to a paradigm shift in understanding of estrogen signaling, of importance in endocrinology, immunology, and oncology and to development of estrogen receptor beta agonists for treatment of autoimmune diseases, prostate disease, depression, and ovulatory dysfunction.

  18. Inhibition of Oncogenic Transcription Factor REL by the Natural Product Derivative Calafianin Monomer 101 Induces Proliferation Arrest and Apoptosis in Human B-Lymphoma Cell Lines.

    PubMed

    Yeo, Alan T; Chennamadhavuni, Spandan; Whitty, Adrian; Porco, John A; Gilmore, Thomas D

    2015-04-23

    Increased activity of transcription factor NF-κB has been implicated in many B-cell lymphomas. We investigated effects of synthetic compound calafianin monomer (CM101) on biochemical and biological properties of NF-κB. In human 293 cells, CM101 selectively inhibited DNA binding by overexpressed NF-κB subunits REL (human c-Rel) and p65 as compared to NF-κB p50, and inhibition of REL and p65 DNA binding by CM101 required a conserved cysteine residue. CM101 also inhibited DNA binding by REL in human B-lymphoma cell lines, and the sensitivity of several B-lymphoma cell lines to CM101-induced proliferation arrest and apoptosis correlated with levels of cellular and nuclear REL. CM101 treatment induced both phosphorylation and decreased expression of anti-apoptotic protein Bcl-XL, a REL target gene product, in sensitive B-lymphoma cell lines. Ectopic expression of Bcl-XL protected SUDHL-2 B-lymphoma cells against CM101-induced apoptosis, and overexpression of a transforming mutant of REL decreased the sensitivity of BJAB B-lymphoma cells to CM101-induced apoptosis. Lipopolysaccharide-induced activation of NF-κB signaling upstream components occurred in RAW264.7 macrophages at CM101 concentrations that blocked NF-κB DNA binding. Direct inhibitors of REL may be useful for treating B-cell lymphomas in which REL is active, and may inhibit B-lymphoma cell growth at doses that do not affect some immune-related responses in normal cells.

  19. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  20. The prion protein has RNA binding and chaperoning properties characteristic of nucleocapsid protein NCP7 of HIV-1.

    PubMed

    Gabus, C; Derrington, E; Leblanc, P; Chnaiderman, J; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W K; Marc, D; Nandi, P; Darlix, J L

    2001-06-01

    Transmissible spongiform encephalopathies are fatal neurodegenerative diseases associated with the accumulation of a protease-resistant form of the prion protein (PrP). Although PrP is conserved in vertebrates, its function remains to be identified. In vitro PrP binds large nucleic acids causing the formation of nucleoprotein complexes resembling human immunodeficiency virus type 1 (HIV-1) nucleocapsid-RNA complexes and in vivo MuLV replication accelerates the scrapie infectious process, suggesting possible interactions between retroviruses and PrP. Retroviruses, including HIV-1 encode a major nucleic acid binding protein (NC protein) found within the virus where 2000 NC protein molecules coat the dimeric genome. NC is required in virus assembly and infection to chaperone RNA dimerization and packaging and in proviral DNA synthesis by reverse transcriptase (RT). In HIV-1, 5'-leader RNA/NC interactions appear to control these viral processes. This prompted us to compare and contrast the interactions of human and ovine PrP and HIV-1 NCp7 with HIV-1 5'-leader RNA. Results show that PrP has properties characteristic of NCp7 with respect to viral RNA dimerization and proviral DNA synthesis by RT. The NC-like properties of huPrP map to the N-terminal region of huPrP. Interestingly, PrP localizes in the membrane and cytoplasm of PrP-expressing cells. These findings suggest that PrP is a multifunctional protein possibly participating in nucleic acid metabolism.

  1. Biological evaluation of omega-(dialkylamino)alkyl derivatives of 6H-indolo[2,3-b]quinoline--novel cytotoxic DNA topoisomerase II inhibitors.

    PubMed

    Godlewska, Joanna; Luniewski, Wojciech; Zagrodzki, Bogdan; Kaczmarek, Lukasz; Bielawska-Pohl, Aleksandra; Dus, Danuta; Wietrzyk, Joanna; Opolski, Adam; Siwko, Magdalena; Jaromin, Anna; Jakubiak, Anna; Kozubek, Arkadiusz; Peczyñska-Czoch, Wanda

    2005-01-01

    A series of novel 6H-indolo[2,3-b]quinoline derivatives, substituted at C-2, C-9 or N-6 position with dialkyl(alkylamino)alkyl chains differing in the number of methylene groups, was prepared. These compounds were evaluated in vitro for their antimicrobial and cytotoxic activity against several cell lines of different origin and tested for their ability to influence the cell cycle and inhibit topoisomerase II activity. Liphophilic and calf thymus DNA-binding properties of these compounds were also investigated. All the compounds tested inhibited the growth of Gram-positive bacteria and fungi at MIC values ranging between 0.25 and 1 mM. They also showed cytotoxic activity against KB (human cervix carcinoma) cells (ID50 varied from 2.1 to 9.0 microM) and were able to overcome multidrug resistance in colorectal adenocarcinoma LoVo/DX, uterine sarcoma MES-SA/DX5 and promyelocytic leukemia HL-60/MX2 cells (the values of the resistance index RI fell between 0.54 and 2.4). The compounds induced G2M-phase cell cycle arrest in Jurkat T-cell leukemia cells, revealed DNA-binding properties and inhibited topoisomerase II activity.

  2. Dissection of combinatorial control by the Met4 transcriptional complex.

    PubMed

    Lee, Traci A; Jorgensen, Paul; Bognar, Andrew L; Peyraud, Caroline; Thomas, Dominique; Tyers, Mike

    2010-02-01

    Met4 is the transcriptional activator of the sulfur metabolic network in Saccharomyces cerevisiae. Lacking DNA-binding ability, Met4 must interact with proteins called Met4 cofactors to target promoters for transcription. Two types of DNA-binding cofactors (Cbf1 and Met31/Met32) recruit Met4 to promoters and one cofactor (Met28) stabilizes the DNA-bound Met4 complexes. To dissect this combinatorial system, we systematically deleted each category of cofactor(s) and analyzed Met4-activated transcription on a genome-wide scale. We defined a core regulon for Met4, consisting of 45 target genes. Deletion of both Met31 and Met32 eliminated activation of the core regulon, whereas loss of Met28 or Cbf1 interfered with only a subset of targets that map to distinct sectors of the sulfur metabolic network. These transcriptional dependencies roughly correlated with the presence of Cbf1 promoter motifs. Quantitative analysis of in vivo promoter binding properties indicated varying levels of cooperativity and interdependency exists between members of this combinatorial system. Cbf1 was the only cofactor to remain fully bound to target promoters under all conditions, whereas other factors exhibited different degrees of regulated binding in a promoter-specific fashion. Taken together, Met4 cofactors use a variety of mechanisms to allow differential transcription of target genes in response to various cues.

  3. Investigations of vibrational spectra and bioactivity of novel anticancer drug N-(6-ferrocenyl-2-naphthoyl)-gamma-amino butyric acid ethyl ester

    NASA Astrophysics Data System (ADS)

    Sudhi, Geethu; Rajina, S. R.; Praveen, S. G.; Xavier, T. S.; Kenny, Peter T. M.; Jaiswal-Nagar, D.; Binoy, J.

    2017-10-01

    The bioactivity of compounds is mainly dependent on molecular structure and the present work aims to explore the bonding features responsible for biological activity of novel anticancer drug N-(6-ferrocenyl-2-naphthoyl)-gamma-amino butyric acid ethyl ester (FNGABEE). In the present study, we investigate the molecular structural properties of newly synthesized title compound through experimental and quantum chemical studies. The detailed vibrational analysis has been performed using FT IR and FT Raman spectrum, aided by DFT computed geometry, vibrational spectrum, Eigen vector distribution and PED, at B3LYP/6-311 ++G(d,p) level. The resonance structure of naphthalene, different from that of benzene, revealed by molecular structure has been investigated using Csbnd C and Cdbnd C stretching modes. The proton transfer in amide has been analyzed to obtain spectral distinction between different carbonyl and Csbnd N groups which point to the reactive sites responsible for binding with DNA and bovine serum albumin (BSA). The spectral distinction between eclipsed and staggered form of ferrocene has been analyzed. The molecular docking of FNGABEE with BSA and DNA has been performed to find the strength of binding and the moieties responsible for the interactions. The experimental binding studies of FNGABEE with BSA and DNA has been performed using UV absorption spectroscopy and fluorometric assay, to find the nature and strength of binding.

  4. DNA glycosylases search for and remove oxidized DNA bases.

    PubMed

    Wallace, Susan S

    2013-12-01

    This review article presents, an overview of the DNA glycosylases that recognize oxidized DNA bases using the Fpg/Nei family of DNA glycosylases as models for how structure can inform function. For example, even though human NEIL1 and the plant and fungal orthologs lack the zinc finger shown to be required for binding, DNA crystal structures revealed a "zincless finger" with the same properties. Moreover, the "lesion recognition loop" is not involved in lesion recognition, rather, it stabilizes 8-oxoG in the active site pocket. Unlike the other Fpg/Nei family members, Neil3 lacks two of the three void-filling residues that stabilize the DNA duplex and interact with the opposite strand to the damage which may account for its preference for lesions in single-stranded DNA. Also single-molecule approaches show that DNA glycosylases search for their substrates in a sea of undamaged DNA by using a wedge residue that is inserted into the DNA helix to probe for the presence of damage. Copyright © 2013 Wiley Periodicals, Inc.

  5. Determination of the DNA-binding characteristics of ethidium bromide, proflavine, and cisplatin by flow injection analysis: usefulness in studies on antitumor drugs.

    PubMed

    Alonso, A; Almendral, M J; Curto, Y; Criado, J J; Rodríguez, E; Manzano, J L

    2006-08-15

    Flow injection analysis was used to study the reactions occurring between DNA and certain compounds that bind to its double helix, deforming this and even breaking it, such that some of them (e.g., cisplatin) are endowed with antitumoral activity. Use of this technique in the merging zones and stopped-flow modes afforded data on the binding parameters and the kinetic characteristics of the process. The first compound studied was ethidium bromide (EtdBr), used as a fluorescent marker because its fluorescence is enhanced when it binds to DNA. The DNA-EtdBr binding parameters, the apparent intrinsic binding constant (0.31+/-0.02 microM(-1)), and the maximum number of binding sites per nucleotide (0.327+/-0.009) were determined. The modification introduced in these parameters by the presence of proflavine (Prf), a classic competitive inhibitor of the binding of EtdBr to the DNA double helix, was also studied, determining the value of the intrinsic binding constant of Prf (K(Prf) = 0.119+/-9x10(-3) microM(-1)). Finally, we determined the binding parameters between DNA and EtdBr in the presence of the antitumor agent cisplatin, a noncompetitive inhibitor of such binding. This provided information about the binding mechanism as well as the duration and activity of the binding of the compound in its pharmacological use.

  6. Thermodynamic Characterization of Binding Oxytricha nova Single Strand Telomere DNA with the Alpha Protein N-terminal Domain

    PubMed Central

    Buczek, Pawel; Horvath, Martin P.

    2010-01-01

    The Oxytricha nova telomere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (ΔH), entropy (ΔS), and dissociation constant (KD-DNA) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T2G4), d(T4G4), d(G3T4G4), and d(G4T4G4) each formed monovalent protein complexes. In the case of d(T4G4T4G4), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity “A site” has a dissociation constant, KD-DNA(A)=13(±4) nM, while the low-affinity “B site” is characterized by KD-DNA(B)=5600(±600) nM at 25 °C. Nucleotide substitution variants verified that the A site corresponds principally with the 3′-terminal portion of d(T4G4T4G4). The relative contributions of entropy (ΔS) and enthalpy (ΔH) for binding reactions were DNA length-dependent as was heat capacity (ΔCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA–protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology. PMID:16678852

  7. The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

    Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

  8. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

    PubMed

    Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

    2018-05-01

    The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akabayov, B.; Akabayov, S; Lee , S

    Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

  10. Deinococcus radiodurans RecA nucleoprotein filaments characterized at the single-molecule level with optical tweezers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pobegalov, Georgii, E-mail: george.pobegalov@nanobio.spbstu.ru; Cherevatenko, Galina; Alekseev, Aleksandr

    2015-10-23

    Deinococcus radiodurans can survive extreme doses of ionizing radiation due to the very efficient DNA repair mechanisms that are able to cope even with hundreds of double-strand breaks. RecA, the critical protein of homologous recombination in bacteria, is one of the key components of the DNA-repair system. Repair of double-strand breaks requires RecA binding to DNA and assembly of the RecA nucleoprotein helical filaments. The Escherichia coli RecA protein (EcRecA) and its interactions with DNA have been extensively studied using various approaches including single-molecule techniques, while the D. radiodurans RecA (DrRecA) remains much less characterized. However, DrRecA shows some remarkable differencesmore » from E. coli homolog. Here we combine microfluidics and single-molecule DNA manipulation with optical tweezers to follow the binding of DrRecA to long double-stranded DNA molecules and probe the mechanical properties of DrRecA nucleoprotein filaments at physiological pH. Our data provide a direct comparison of DrRecA and EcRecA binding to double-stranded DNA under identical conditions. We report a significantly faster filaments assembly as well as lower values of persistence length and contour length for DrRecA nucleoprotein filaments compared to EcRecA. Our results support the existing model of DrRecA forming more frequent and less continuous filaments relative to those of EcRecA. - Highlights: • We investigate Deinococcus radiodurans RecA interactions with long double-stranded DNA at the single-molecule level. • At physiological pH D. radiodurans RecA forms nucleoprotein filaments significantly faster relative to Escherichia coli RecA. • D. radiodurans RecA-dsDNA nucleoprotein filaments are more flexible and slightly shorter compared to those of E. coli RecA.« less

  11. Synthesis of novel coumarin nucleus-based DPA drug-like molecular entity: In vitro DNA/Cu(II) binding, DNA cleavage and pro-oxidant mechanism for anticancer action

    PubMed Central

    Khan, Saman; Malla, Ali Mohammed; Zafar, Atif

    2017-01-01

    Despite substantial research on cancer therapeutics, systemic toxicity and drug-resistance limits the clinical application of many drugs like cisplatin. Therefore, new chemotherapeutic strategies against different malignancies are needed. Targeted cancer therapy is a new paradigm for cancer therapeutics which targets pathways or chemical entities specific to cancer cells than normal ones. Unlike normal cells, cancer cells contain elevated copper which plays an integral role in angiogenesis. Copper is an important metal ion associated with chromatin DNA, particularly with guanine. Thus, targeting copper via copper-specific chelators in cancer cells can serve as an effective anticancer strategy. New pharmacophore di(2-picolyl)amine (DPA)-3(bromoacetyl) coumarin (ligand-L) was synthesized and characterized by IR, ESI-MS, 1H- and 13C-NMR. Binding ability of ligand-L to DNA/Cu(II) was evaluated using a plethora of biophysical techniques which revealed ligand-L-DNA and ligand-L-Cu(II) interaction. Competitive displacement assay and docking confirmed non-intercalative binding mode of ligand-L with ctDNA. Cyclic voltammetry confirmed ligand-L causes quasi reversible Cu(II)/Cu(I) conversion. Further, acute toxicity studies revealed no toxic effects of ligand-L on mice. To evaluate the chemotherapeutic potential and anticancer mechanism of ligand-L, DNA damage via pBR322 cleavage assay and reactive oxygen species (ROS) generation were studied. Results demonstrate that ligand-L causes DNA cleavage involving ROS generation in the presence of Cu(II). In conclusion, ligand-L causes redox cycling of Cu(II) to generate ROS which leads to oxidative DNA damage and pro-oxidant cancer cell death. These findings will establish ligand-L as a lead molecule to synthesize new molecules with better copper chelating and pro-oxidant properties against different malignancies. PMID:28763458

  12. Resolution of the diadenosine 5',5"'-P1,P4-tetraphosphate binding subunit from a multiprotein form of HeLa cell DNA polymerase alpha.

    PubMed Central

    Baril, E; Bonin, P; Burstein, D; Mara, K; Zamecnik, P

    1983-01-01

    A diadenosine 5',5"'-P1,P4-tetraphosphate (Ap4A) binding subunit has been resolved from a high molecular weight (640,000) multiprotein form of DNA polymerase alpha [deoxynucleoside triphosphate:DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7] from HeLa cells [DNA polymerase alpha 2 of Lamothe, P., Baril, B., Chi, A., Lee, L. & Baril, E. (1981) Proc. Natl. Acad. Sci. USA 78, 4723-4727]. The Ap4A binding activity copurifies with the DNA polymerizing activity during the course of purification. Hydrophobic chromatography on butylagarose resolves the Ap4A binding activity from the DNA polymerase. The Ap4A binding activity is protein in nature since the binding of Ap4A is abolished by treatment of the isolated binding activity with proteinase K but is insensitive to treatment with DNase or RNase. The molecular weight of the Ap4A binding protein, as determined by polyacrylamide gel electrophoresis under nondenaturing conditions or by NaDodSO4/polyacrylamide gel electrophoresis after photoaffinity labeling of the protein with [32P]Ap4A is 92,000 or 47,000. The binding activity of this protein is highly specific for Ap4A. Images PMID:6576366

  13. Mutations altering the cleavage specificity of a homing endonuclease

    PubMed Central

    Seligman, Lenny M.; Chisholm, Karen M.; Chevalier, Brett S.; Chadsey, Meggen S.; Edwards, Samuel T.; Savage, Jeremiah H.; Veillet, Adeline L.

    2002-01-01

    The homing endonuclease I-CreI recognizes and cleaves a particular 22 bp DNA sequence. The crystal structure of I-CreI bound to homing site DNA has previously been determined, leading to a number of predictions about specific protein–DNA contacts. We test these predictions by analyzing a set of endonuclease mutants and a complementary set of homing site mutants. We find evidence that all structurally predicted I-CreI/DNA contacts contribute to DNA recognition and show that these contacts differ greatly in terms of their relative importance. We also describe the isolation of a collection of altered specificity I-CreI derivatives. The in vitro DNA-binding and cleavage properties of two such endonucleases demonstrate that our genetic approach is effective in identifying homing endonucleases that recognize and cleave novel target sequences. PMID:12202772

  14. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    NASA Astrophysics Data System (ADS)

    Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

    2008-10-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  15. The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

    PubMed Central

    Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

    2006-01-01

    As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

  16. Molecular dynamics studies on the DNA-binding process of ERG.

    PubMed

    Beuerle, Matthias G; Dufton, Neil P; Randi, Anna M; Gould, Ian R

    2016-11-15

    The ETS family of transcription factors regulate gene targets by binding to a core GGAA DNA-sequence. The ETS factor ERG is required for homeostasis and lineage-specific functions in endothelial cells, some subset of haemopoietic cells and chondrocytes; its ectopic expression is linked to oncogenesis in multiple tissues. To date details of the DNA-binding process of ERG including DNA-sequence recognition outside the core GGAA-sequence are largely unknown. We combined available structural and experimental data to perform molecular dynamics simulations to study the DNA-binding process of ERG. In particular we were able to reproduce the ERG DNA-complex with a DNA-binding simulation starting in an unbound configuration with a final root-mean-square-deviation (RMSD) of 2.1 Å to the core ETS domain DNA-complex crystal structure. This allowed us to elucidate the relevance of amino acids involved in the formation of the ERG DNA-complex and to identify Arg385 as a novel key residue in the DNA-binding process. Moreover we were able to show that water-mediated hydrogen bonds are present between ERG and DNA in our simulations and that those interactions have the potential to achieve sequence recognition outside the GGAA core DNA-sequence. The methodology employed in this study shows the promising capabilities of modern molecular dynamics simulations in the field of protein DNA-interactions.

  17. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans.

    PubMed

    Biggar, Kyle K; Storey, Kenneth B

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans . Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G 1 arrest for the duration of stress survival.

  18. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans

    PubMed Central

    Biggar, Kyle K.

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans. Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G1 arrest for the duration of stress survival. PMID:29770276

  19. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    PubMed

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Polyethyleneimine grafted short halloysite nanotubes for gene delivery.

    PubMed

    Long, Zheru; Zhang, Jun; Shen, Yan; Zhou, Changren; Liu, Mingxian

    2017-12-01

    Inorganic nanoparticles have attracted much attentions in gene delivery because of their desirable characteristics including low toxicity, well-controlled characteristics, high gene delivery efficiency, and multi-functionalities. Here, natural occurred halloysite nanotubes (HNTs) were developed as a novel non-viral gene vector. To increase the efficiency of endocytosis, HNTs were firstly shortened into an appropriate size (~200nm). Then polyethyleneimine (PEI) was grafted onto HNTs to bind green fluorescence protein (GFP) labeled pDNA. The structure and physical-chemical properties of PEI grafted HNTs (PEI-g-HNTs) were characterized by various methods. PEI-g-HNTs show lower cytotoxicity than PEI. PEI-g-HNTs are positively charged and can bind DNA tightly at designed N/P ratio from 5:1 to 40:1. PEI-g-HNTs/pDNA complexes show much higher transfection efficiency towards both 293T and HeLa cells compared with PEI/pDNA complexes at the equivalent N/P ratio. The transfection efficiencies of PEI-g-HNTs/pDNA complex towards HeLa cell can reach to 44.4% at N/P ratio of 20. PEI-g-HNTs/pDNA complexes possess a higher GFP protein expression than PEI/pDNA from simple western immunoblots. So, PEI-g-HNTs are potential gene vectors with good biocompatibility and high transfection efficiency, which have promising applications in cancer gene therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

Top