The Function of Neuroendocrine Cells in Prostate Cancer

DTIC Science & Technology

2015-06-20

Comprehensive Cancer Center and 4Broad Center for Regenerative Medicine and Stem Cell Biology, David Geffen School of Medicine at UCLA, 10833 Le Conte... Regenerative Medicine and Stem Cell Research, UCLA David Geffen School of Medicine , Los Angeles, California. 2Department of Urology, The First...progress in prostate cancer. Soochou University Annual Translational Medicine Meeting, Suzhou, China, November 2013 21. Prostate Cancer Stem Cells

Directed Differentiation of Human Embryonic Stem Cells into Prostate Organoids In Vitro and its Perturbation by Low-Dose Bisphenol A Exposure.

PubMed

Calderon-Gierszal, Esther L; Prins, Gail S

2015-01-01

Studies using rodent and adult human prostate stem-progenitor cell models suggest that developmental exposure to the endocrine disruptor Bisphenol-A (BPA) can predispose to prostate carcinogenesis with aging. Unknown at present is whether the embryonic human prostate is equally susceptible to BPA during its natural developmental window. To address this unmet need, we herein report the construction of a pioneer in vitro human prostate developmental model to study the effects of BPA. The directed differentiation of human embryonic stem cells (hESC) into prostatic organoids in a spatial system was accomplished with precise temporal control of growth factors and steroids. Activin-induced definitive endoderm was driven to prostate specification by combined exposure to WNT10B and FGF10. Matrigel culture for 20-30 days in medium containing R-Spondin-1, Noggin, EGF, retinoic acid and testosterone was sufficient for mature prostate organoid development. Immunofluorescence and gene expression analysis confirmed that organoids exhibited cytodifferentiation and functional properties of the human prostate. Exposure to 1 nM or 10 nM BPA throughout differentiation culture disturbed early morphogenesis in a dose-dependent manner with 1 nM BPA increasing and 10 nM BPA reducing the number of branched structures formed. While differentiation of branched structures to mature organoids seemed largely unaffected by BPA exposure, the stem-like cell population increased, appearing as focal stem cell nests that have not properly entered lineage commitment rather than the rare isolated stem cells found in normally differentiated structures. These findings provide the first direct evidence that low-dose BPA exposure targets hESC and perturbs morphogenesis as the embryonic cells differentiate towards human prostate organoids, suggesting that the developing human prostate may be susceptible to disruption by in utero BPA exposures.

Prostate Cancer Stem-Like Cells | Center for Cancer Research

Cancer.gov

Prostate cancer is the third leading cause of cancer-related death among men, killing an estimated 27,000 men each year in the United States. Men with advanced prostate cancer often become resistant to conventional therapies. Many researchers speculate that the emergence of resistance is due to the presence of cancer stem cells, which are believed to be a small subpopulation of tumor cells that can self-renew and give rise to more differentiated tumor cells. It is thought that these stem cells survive initial therapies (such as chemotherapy and hormone therapy) and then generate new tumor cells that are resistant to these standard treatments. If prostate cancer stem cells could be identified and characterized, it might be possible to design treatments that prevent resistance.

The many ways to make a luminal cell and a prostate cancer cell.

PubMed

Strand, Douglas W; Goldstein, Andrew S

2015-12-01

Research in the area of stem/progenitor cells has led to the identification of multiple stem-like cell populations implicated in prostate homeostasis and cancer initiation. Given that there are multiple cells that can regenerate prostatic tissue and give rise to prostate cancer, our focus should shift to defining the signaling mechanisms that drive differentiation and progenitor self-renewal. In this article, we will review the literature, present the evidence and raise important unanswered questions that will help guide the field forward in dissecting critical mechanisms regulating stem-cell differentiation and tumor initiation. © 2015 Society for Endocrinology.

Pim-1: A Molecular Target to Modulate Cellular Resistance to Therapy in Prostate Cancer

DTIC Science & Technology

2005-10-01

Reiter RE, Lilly MB: Gene expression profiling in R- flurbiprofen -treated prostate cancer: Identification of prostate stem cell antigen as a... flurbiprofen -regulated gene. (submitted, 2006). 51. Holder SL, Zemskova M, Bremner R, Neidigh J, Lilly MB: Identification of specific, cell-permeable...profiling in R- flurbiprofen - treated prostate cancer: Identification of prostate stem cell antigen as a flurbiprofen - regulated gene. (poster

Low Testosterone Alters the Activity of Mouse Prostate Stem Cells.

PubMed

Zhou, Ye; Copeland, Ben; Otto-Duessel, Maya; He, Miaoling; Markel, Susan; Synold, Tim W; Jones, Jeremy O

2017-04-01

Low serum testosterone (low T) has been repeatedly linked to worse outcomes in men with newly diagnosed prostate cancer (PC). How low T contributes to these outcomes is unknown. Here we demonstrate that exposure to low T causes significant changes in the mouse prostate and prostate stem cells. Mice were castrated and implanted with capsules to achieve castrate, normal, or sub-physiological levels of T. After 6 weeks of treatment, LC-MS/MS was used to quantify the levels of T and dihydrotestosterone (DHT) in serum and prostate tissue. FACS was used to quantify the percentages of purported prostate stem and transit amplifying (TA) cells in mouse prostates. Prostate tissues were also stained for the presence of CD68+ cells and RNA was extracted from prostate tissue or specific cell populations to measure changes in transcript levels with low T treatment. Despite having significantly different levels of T and DHT in the serum, T and DHT concentrations in prostate tissue from different T treatment groups were similar. Low T treatment resulted in significant alterations in the expression of androgen biosynthesis genes, which may be related to maintaining prostate androgen levels. Furthermore, the expression of androgen-regulated genes in the prostate was similar among all T treatment groups, demonstrating that the mouse prostate can maintain functional levels of androgens despite low serum T levels. Low T increased the frequency of prostate stem and TA cells in adult prostate tissue and caused major transcriptional changes in those cells. Gene ontology analysis suggested that low T caused inflammatory responses and immunofluorescent staining indicated that low T treatment led to the increased presence of CD68+ macrophages in prostate tissue. Low T alters the AR signaling axis which likely leads to maintenance of functional levels of prostate androgens. Low T also induces quantitative and qualitative changes in prostate stem cells which appear to lead to inflammatory macrophage infiltration. These changes are proposed to lead to an aggressive phenotype once cancers develop and may contribute to the poor outcomes in men with low T. Prostate 77:530-541, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Stem cell and neurogenic gene-expression profiles link prostate basal cells to aggressive prostate cancer

PubMed Central

Zhang, Dingxiao; Park, Daechan; Zhong, Yi; Lu, Yue; Rycaj, Kiera; Gong, Shuai; Chen, Xin; Liu, Xin; Chao, Hsueh-Ping; Whitney, Pamela; Calhoun-Davis, Tammy; Takata, Yoko; Shen, Jianjun; Iyer, Vishwanath R.; Tang, Dean G.

2016-01-01

The prostate gland mainly contains basal and luminal cells constructed as a pseudostratified epithelium. Annotation of prostate epithelial transcriptomes provides a foundation for discoveries that can impact disease understanding and treatment. Here we describe a genome-wide transcriptome analysis of human benign prostatic basal and luminal epithelial populations using deep RNA sequencing. Through molecular and biological characterizations, we show that the differential gene-expression profiles account for their distinct functional properties. Strikingly, basal cells preferentially express gene categories associated with stem cells, neurogenesis and ribosomal RNA (rRNA) biogenesis. Consistent with this profile, basal cells functionally exhibit intrinsic stem-like and neurogenic properties with enhanced rRNA transcription activity. Of clinical relevance, the basal cell gene-expression profile is enriched in advanced, anaplastic, castration-resistant and metastatic prostate cancers. Therefore, we link the cell-type-specific gene signatures to aggressive subtypes of prostate cancer and identify gene signatures associated with adverse clinical features. PMID:26924072

Stem cell and neurogenic gene-expression profiles link prostate basal cells to aggressive prostate cancer.

PubMed

Zhang, Dingxiao; Park, Daechan; Zhong, Yi; Lu, Yue; Rycaj, Kiera; Gong, Shuai; Chen, Xin; Liu, Xin; Chao, Hsueh-Ping; Whitney, Pamela; Calhoun-Davis, Tammy; Takata, Yoko; Shen, Jianjun; Iyer, Vishwanath R; Tang, Dean G

2016-02-29

The prostate gland mainly contains basal and luminal cells constructed as a pseudostratified epithelium. Annotation of prostate epithelial transcriptomes provides a foundation for discoveries that can impact disease understanding and treatment. Here we describe a genome-wide transcriptome analysis of human benign prostatic basal and luminal epithelial populations using deep RNA sequencing. Through molecular and biological characterizations, we show that the differential gene-expression profiles account for their distinct functional properties. Strikingly, basal cells preferentially express gene categories associated with stem cells, neurogenesis and ribosomal RNA (rRNA) biogenesis. Consistent with this profile, basal cells functionally exhibit intrinsic stem-like and neurogenic properties with enhanced rRNA transcription activity. Of clinical relevance, the basal cell gene-expression profile is enriched in advanced, anaplastic, castration-resistant and metastatic prostate cancers. Therefore, we link the cell-type-specific gene signatures to aggressive subtypes of prostate cancer and identify gene signatures associated with adverse clinical features.

Wnt and Notch Pathways Have Interrelated Opposing Roles on Prostate Progenitor Cell Proliferation and Differentiation

PubMed Central

Shahi, Payam; Seethammagari, Mamatha R.; Valdez, Joseph M.; Xin, Li; Spencer, David M.

2011-01-01

Tissue stem cells are capable of both self-renewal and differentiation to maintain a constant stem cell population and give rise to the plurality of cells within a tissue. Wnt signaling has been previously identified as a key mediator for the maintenance of tissue stem cells; however, possible cross-regulation with other developmentally critical signaling pathways involved in adult tissue homeostasis, such as Notch, is not well understood. By using an in vitro prostate stem cell colony (“prostasphere”) formation assay and in vivo prostate reconstitution experiments, we demonstrate that Wnt pathway induction on Sca-1+ CD49f+ basal/stem cells (B/SCs) promotes expansion of the basal epithelial compartment with noticeable increases in “triple positive” (cytokeratin [CK] 5+, CK8+, p63+) prostate progenitor cells, concomitant with upregulation of known Wnt target genes involved in cell-cycle induction. Moreover, Wnt induction affects expression of epithelial-to-mesenchymal transition signature genes, suggesting a possible mechanism for priming B/SC to act as potential tumor-initiating cells. Interestingly, induction of Wnt signaling in B/SCs results in downregulation of Notch1 transcripts, consistent with its postulated antiproliferative role in prostate cells. In contrast, induction of Notch signaling in prostate progenitors inhibits their proliferation and disrupts prostasphere formation. In vivo prostate reconstitution assays further demonstrate that induction of Notch in B/SCs disrupts proper acini formation in cells expressing the activated Notch1 allele, Notch-1 intracellular domain. These data emphasize the importance of Wnt/Notch cross-regulation in adult stem cell biology and suggest that Wnt signaling controls the proliferation and/or maintenance of epithelial progenitors via modulation of Notch signaling. PMID:21308863

Directed Differentiation of Human Embryonic Stem Cells into Prostate Organoids In Vitro and its Perturbation by Low-Dose Bisphenol A Exposure

PubMed Central

Calderon-Gierszal, Esther L.; Prins, Gail S.

2015-01-01

Studies using rodent and adult human prostate stem-progenitor cell models suggest that developmental exposure to the endocrine disruptor Bisphenol-A (BPA) can predispose to prostate carcinogenesis with aging. Unknown at present is whether the embryonic human prostate is equally susceptible to BPA during its natural developmental window. To address this unmet need, we herein report the construction of a pioneer in vitro human prostate developmental model to study the effects of BPA. The directed differentiation of human embryonic stem cells (hESC) into prostatic organoids in a spatial system was accomplished with precise temporal control of growth factors and steroids. Activin-induced definitive endoderm was driven to prostate specification by combined exposure to WNT10B and FGF10. Matrigel culture for 20–30 days in medium containing R-Spondin-1, Noggin, EGF, retinoic acid and testosterone was sufficient for mature prostate organoid development. Immunofluorescence and gene expression analysis confirmed that organoids exhibited cytodifferentiation and functional properties of the human prostate. Exposure to 1 nM or 10 nM BPA throughout differentiation culture disturbed early morphogenesis in a dose-dependent manner with 1 nM BPA increasing and 10 nM BPA reducing the number of branched structures formed. While differentiation of branched structures to mature organoids seemed largely unaffected by BPA exposure, the stem-like cell population increased, appearing as focal stem cell nests that have not properly entered lineage commitment rather than the rare isolated stem cells found in normally differentiated structures. These findings provide the first direct evidence that low-dose BPA exposure targets hESC and perturbs morphogenesis as the embryonic cells differentiate towards human prostate organoids, suggesting that the developing human prostate may be susceptible to disruption by in utero BPA exposures. PMID:26222054

Origin and Properties of Prostatic Stem Cells

DTIC Science & Technology

2007-02-01

Brinster RL. beta1- and alpha6-integrin are surface markers on mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 1999;96(10):5504-9. 14. Tsujimura ...G. R., Donjacour, A. A., Cooke, P. S., Mee, S., Bigsby, R. M., Higgins, S. J. & Sugimura, Y. (1987) Endocr. Rev. 8, 338–362. 9. Tsujimura , A...90. 4 Tsujimura A, Koikawa Y, Salm S et al. Proximal location of mouse prostate epithelial stem cells: A model of prostatic homeostasis. J Cell Biol

Bone Marrow-derived Mesenchymal Stem Cells (MSCs) as a Selective Delivery Vehicle for a PSA-Activated Protoxin for Advanced Prostate Cancer

DTIC Science & Technology

2014-04-01

other groups are seeking to develop MSCs as vectors to deliver prostate - specific antigen (PSA)-activated prodrugs (Denmeade et al. 2003) and protoxins...Denmeade SR, Jakobsen CM, Janssen S, Khan SR, Garrett ES, Lilja H, Christensen SB & Isaacs JT 2003 Prostate - specific antigen -activated thapsigargin...cells derived from benign prostatic hyperplasia specimens possess stem cell like property. Prostate 67 1265–1276. (doi:10.1002/ pros .20599) Lin G, Yang R

SHBG Is an Important Factor in Stemness Induction of Cells by DHT In Vitro and Associated with Poor Clinical Features of Prostate Carcinomas

PubMed Central

Ma, Yuanyuan; Liang, Dongming; Liu, Jian; Wen, Jian-Guo; Servoll, Einar; Waaler, Gudmund; Sæter, Thorstein; Axcrona, Karol; Vlatkovic, Ljiljana; Axcrona, Ulrika; Paus, Elisabeth; Yang, Yue; Zhang, Zhiqian; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe

2013-01-01

Androgen plays a vital role in prostate cancer development. However, it is not clear whether androgens influence stem-like properties of prostate cancer, a feature important for prostate cancer progression. In this study, we show that upon DHT treatment in vitro, prostate cancer cell lines LNCaP and PC-3 were revealed with higher clonogenic potential and higher expression levels of stemness related factors CD44, CD90, Oct3/4 and Nanog. Moreover, sex hormone binding globulin (SHBG) was also simultaneously upregulated in these cells. When the SHBG gene was blocked by SHBG siRNA knock-down, the induction of Oct3/4, Nanog, CD44 and CD90 by DHT was also correspondingly blocked in these cells. Immunohistochemical evaluation of clinical samples disclosed weakly positive, and areas negative for SHBG expression in the benign prostate tissues, while most of the prostate carcinomas were strongly positive for SHBG. In addition, higher levels of SHBG expression were significantly associated with higher Gleason score, more seminal vesicle invasions and lymph node metastases. Collectively, our results show a role of SHBG in upregulating stemness of prostate cancer cells upon DHT exposure in vitro, and SHBG expression in prostate cancer samples is significantly associated with poor clinicopathological features, indicating a role of SHBG in prostate cancer progression. PMID:23936228

Prostate Cancer Stem Cells: Viewing Signaling Cascades at a Finer Resolution.

PubMed

Lin, Xiukun; Farooqi, Ammad Ahmad; Qureshi, Muhammad Zahid; Romero, Mirna Azalea; Tabassum, Sobia; Ismail, Muhammad

2016-06-01

It is becoming characteristically more understandable that within tumor cells, there lies a sub-population of tumor cells with "stem cell" like properties and remarkable ability of self-renewal. Many features of these self-renewing cells are comparable with normal stem cells and are termed as "cancer stem cells". Accumulating experimentally verified data has started to scratch the surface of spatio-temporally dysregulated intracellular signaling cascades in the biology of prostate cancer stem cells. We partition this multicomponent review into how different signaling cascades operate in cancer stem cells and how bioactive ingredients isolated from natural sources may modulate signaling network.

Loss of miR-100 enhances migration, invasion, epithelial-mesenchymal transition and stemness properties in prostate cancer cells through targeting Argonaute 2.

PubMed

Wang, Min; Ren, Dong; Guo, Wei; Wang, Zeyu; Huang, Shuai; Du, Hong; Song, Libing; Peng, Xinsheng

2014-07-01

Evidence in literature has demonstrated that some microRNAs (miRNAs) play a pivotal role in most solid tumor metastasis. Previous studies have showed that miR-100 is downregulated in human prostate cancer tissue compared to normal prostate and also significantly decreased in bone metastatic prostate cancer samples compared with primary prostate cancer. Argonaute 2 (AGO2) is the core effector protein of the miRNA-induced silencing complex and overexpression of AGO2 might enhance tumor metastasis. However, it is unknown whether and how miR-100 and AGO2 regulates metastasis of prostate cancer. Here, we report that miR-100 negatively regulated migration, invasion, epithelial-mesenchymal transition (EMT), colony formation, spheroid formation and expression of the stemness factors c-Myc, Oct4 and Klf4 in PC-3 and DU145 cells. Furthermore, miR-100 expression was negatively correlated with bone metastasis of prostate cancer patients. Notably, luciferase assay showed that AGO2 was a direct target of miR-100. Downregulation of AGO2 repressed migration, invasion, EMT and stemness of prostate cancer cells, and reversed the effects seen with miR-100 downregulation. Downregulation of AGO2 enhanced expression of miR-34a and miR-125b which can suppress migration, invasion, EMT and stemness of cancer cells. Taken together, our findings indicate that loss of miR-100 promotes the metastatic ability of prostate cancer cells at least partially by upregulating AGO2 expression through modulating migration, invasion, EMT and stemness of cancer cells, and suggest that miR-100/AGO2 may play an important role in regulating the metastasis of prostate cancer and is a potential target of prevention and therapy.

Enhancing the Efficacy of Prostate Cancer Immunotherapy by Manipulating T-Cell Receptor Signaling in Order to Alter Peripheral Regulatory T-Cell Activity

DTIC Science & Technology

2009-07-01

27] Ross S, Spencer SD, Holcomb I, Tan C, Hongo J, Devaux B, et al. Prostate stem cell antigen as therapy target: tissue expression and in vivo...Holcomb I, Tan C, Hongo J, Devaux B, et al. Prostate stem cell antigen as therapy target: tissue expression and in vivo efficacy of an immunoconjugate

Differential requirements of androgen receptor in luminal progenitors during prostate regeneration and tumor initiation

PubMed Central

Chua, Chee Wai; Epsi, Nusrat J; Leung, Eva Y; Xuan, Shouhong; Lei, Ming; Li, Bo I; Bergren, Sarah K; Hibshoosh, Hanina; Mitrofanova, Antonina

2018-01-01

Master regulatory genes of tissue specification play key roles in stem/progenitor cells and are often important in cancer. In the prostate, androgen receptor (AR) is a master regulator essential for development and tumorigenesis, but its specific functions in prostate stem/progenitor cells have not been elucidated. We have investigated AR function in CARNs (CAstration-Resistant Nkx3.1-expressing cells), a luminal stem/progenitor cell that functions in prostate regeneration. Using genetically--engineered mouse models and novel prostate epithelial cell lines, we find that progenitor properties of CARNs are largely unaffected by AR deletion, apart from decreased proliferation in vivo. Furthermore, AR loss suppresses tumor formation after deletion of the Pten tumor suppressor in CARNs; however, combined Pten deletion and activation of oncogenic Kras in AR-deleted CARNs result in tumors with focal neuroendocrine differentiation. Our findings show that AR modulates specific progenitor properties of CARNs, including their ability to serve as a cell of origin for prostate cancer. PMID:29334357

MicroRNA Regulation of CD44+ Prostate Tumor Stem/Progenitor Cells and Prostate Cancer Development/Metastasis

DTIC Science & Technology

2013-05-01

prostate cancer stem cells. Cancer Res. 65, 10946–10951 (2005). 18 . Patrawala, L. et al. Highly purified CD44+ prostate cancer cells from xenograft ... xenograft tumors were of the human origin and morphologically epithelial with detectable cytokeratin 8 and 18 . RT-PCR analysis detected AR whereas...miR-301 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT

Targeting Prostate Cancer Stemlike Cells through Cell Surface Expressed GRP78

DTIC Science & Technology

2016-12-01

NOTES 14. ABSTRACT This study investigated a function for cell surface GRP78 in regulating prostate cancer stem -like cells . In year 1, we showed that...enrichment of cell surface GRP78+ cancer stem like cells in sphere culture. We also showed that the signaling axis activated by cell surface GRP78 is...but not the GRP78(-) cells , exhibited cancer stem -like cell behavior. Furthermore an GRP78 monoclonal antibody inhibited sphere forming ability of

Isolation and Characterization of Prostate Cancer Stem Cells

DTIC Science & Technology

2009-08-01

The Prostate Manuscript ID: PROS-09-224.R1 Wiley - Manuscript type: Original Article Date Submitted by the Author: 18-Sep-2009 Complete List of ...subpopulation of basal cells has stem cell characteristics raises some interesting questions about the cell of origin for prostate cancer. Can both basal...positively for AMACR and the retention of 7 a p63+ basal layer, the basal-derived lesions fulfill the histologic criteria used

Sox2 Is an Androgen Receptor-Repressed Gene That Promotes Castration-Resistant Prostate Cancer

PubMed Central

Kregel, Steven; Kiriluk, Kyle J.; Rosen, Alex M.; Cai, Yi; Reyes, Edwin E.; Otto, Kristen B.; Tom, Westin; Paner, Gladell P.; Szmulewitz, Russell Z.; Vander Griend, Donald J.

2013-01-01

Despite advances in detection and therapy, castration-resistant prostate cancer continues to be a major clinical problem. The aberrant activity of stem cell pathways, and their regulation by the Androgen Receptor (AR), has the potential to provide insight into novel mechanisms and pathways to prevent and treat advanced, castrate-resistant prostate cancers. To this end, we investigated the role of the embryonic stem cell regulator Sox2 [SRY (sex determining region Y)-box 2] in normal and malignant prostate epithelial cells. In the normal prostate, Sox2 is expressed in a portion of basal epithelial cells. Prostate tumors were either Sox2-positive or Sox2-negative, with the percentage of Sox2-positive tumors increasing with Gleason Score and metastases. In the castration-resistant prostate cancer cell line CWR-R1, endogenous expression of Sox2 was repressed by AR signaling, and AR chromatin-IP shows that AR binds the enhancer element within the Sox2 promoter. Likewise, in normal prostate epithelial cells and human embryonic stem cells, increased AR signaling also decreases Sox2 expression. Resistance to the anti-androgen MDV3100 results in a marked increase in Sox2 expression within three prostate cancer cell lines, and in the castration-sensitive LAPC-4 prostate cancer cell line ectopic expression of Sox2 was sufficient to promote castration-resistant tumor formation. Loss of Sox2 expression in the castration-resistant CWR-R1 prostate cancer cell line inhibited cell growth. Up-regulation of Sox2 was not associated with increased CD133 expression but was associated with increased FGF5 (Fibroblast Growth Factor 5) expression. These data propose a model of elevated Sox2 expression due to loss of AR-mediated repression during castration, and consequent castration-resistance via mechanisms not involving induction of canonical embryonic stem cell pathways. PMID:23326489

The role of sialomucin CD164 (MGC-24v or endolyn) in prostate cancer metastasis

PubMed Central

Havens, AM; Jung, Y; Sun, YX; Wang, J; Shah, RB; Bühring, HJ; Pienta, KJ; Taichman, RS

2006-01-01

Background The chemokine stromal derived factor-1 (SDF-1 or CXCL12) and its receptor CXCR4 have been demonstrated to be crucial for the homing of stem cells and prostate cancers to the marrow. While screening prostate cancers for CXCL12-responsive adhesion molecules, we identified CD164 (MGC-24) as a potential regulator of homing. CD164 is known to function as a receptor that regulates stem cell localization to the bone marrow. Results Using prostate cancer cell lines, it was demonstrated that CXCL12 induced both the expression of CD164 mRNA and protein. Functional studies demonstrated that blocking CD164 on prostate cancer cell lines reduced the ability of these cells to adhere to human bone marrow endothelial cells, and invade into extracellular matrices. Human tissue microarrays stained for CD164 demonstrated a positive correlation with prostate-specific antigen levels, while its expression was negatively correlated with the expression of androgen receptor. Conclusion Our findings suggest that CD164 may participate in the localization of prostate cancer cells to the marrow and is further evidence that tumor metastasis and hematopoietic stem cell trafficking may involve similar processes. PMID:16859559

Pyruvate dehydrogenase expression is negatively associated with cell stemness and worse clinical outcome in prostate cancers

PubMed Central

Zhong, Yali; Li, Xiaoli; Ji, Yasai; Li, Xiaoran; Li, Yaqing; Yu, Dandan; Yuan, Yuan; Liu, Jian; Li, Huixiang; Zhang, Mingzhi; Ji, Zhenyu; Fan, Dandan; Wen, Jianguo; Goscinski, Mariusz Adam; Yuan, Long; Hao, Bin; Nesland, Jahn M; Suo, Zhenhe

2017-01-01

Cells generate adenosine-5′-triphosphate (ATP), the major currency for energy-consuming reactions, through mitochondrial oxidative phosphorylation (OXPHOS) and glycolysis. One of the remarkable features of cancer cells is aerobic glycolysis, also known as the “Warburg Effect”, in which cancer cells rely preferentially on glycolysis instead of mitochondrial OXPHOS as the main energy source even in the presence of high oxygen tension. One of the main players in controlling OXPHOS is the mitochondrial gatekeeperpyruvate dehydrogenase complex (PDHc) and its major subunit is E1α (PDHA1). To further analyze the function of PDHA1 in cancer cells, it was knock out (KO) in the human prostate cancer cell line LnCap and a stable KO cell line was established. We demonstrated that PDHA1 gene KO significantly decreased mitochondrial OXPHOS and promoted anaerobic glycolysis, accompanied with higher stemness phenotype including resistance to chemotherapy, enhanced migration ability and increased expression of cancer stem cell markers. We also examined PDHA1 protein expression in prostate cancer tissues by immunohistochemistry and observed that reduced PDHA1 protein expression in clinical prostate carcinomas was significantly correlated with poor prognosis. Collectively, our results show that negative PDHA1 gene expressionis associated with significantly higher cell stemness in prostate cancer cells and reduced protein expression of this gene is associated with shorter clinical outcome in prostate cancers. PMID:28076853

Isolation and Characterization of Prostate Cancer Stem Cells

DTIC Science & Technology

2011-08-01

and ability to induce prostate tubule formation in vivo. FISH analysis of prostaspheres derived from patient specimens containing the TMPRSS-ERG...hybridization (FISH)[6]. Analysis of prostate tumor surgical cohorts have found 36-78% of prostate cancers possess the TMPRSS-ERG fusion[6]. We wondered...suggest that cancer stem/early progenitor cells can be expanded in our cultures. 6 To test the feasibility of this approach, FISH analysis was

Androgen deprivation and stem cell markers in prostate cancers

PubMed Central

Tang, Yao; Hamburger, Anne W; Wang, Linbo; Khan, Mohammad Afnan; Hussain, Arif

2010-01-01

In our previous studies using human LNCaP xenografts and TRAMP (transgenic adenocarcinoma of mouse prostate) mice, androgen deprivation therapy (ADT) resulted in a temporary cessation of prostate cancer (PCa) growth, but then tumors grew faster with more malignant behaviour. To understand whether cancer stem cells might play a role in PCa progression in these animal models, we investigated the expressions of stem cell-related markers in tumors at different time points after ADT. In both animal models, enhanced expressions of stem cell markers were observed in tumors of castrated mice, as compared to non-castrated controls. This increased cell population that expressed stem cell markers is designated as stem-like cells (SLC) in this article. We also observed that the SLC peaked at relatively early time points after ADT, before tumors resumed their growth. These results suggest that the SLC population may play a role in tumor re-growth and disease progression, and that targeting the SLC at their peak-expression time point may prevent tumor recurrence following ADT. PMID:20126580

Identification of CD166 as a Surface Marker for Enriching Prostate Stem/Progenitor and Cancer Initiating Cells

PubMed Central

Wang, Shunyou; Tran, Linh M.; Goldstein, Andrew S.; Lawson, Devon; Chen, Donghui; Li, Yunfeng; Guo, Changyong; Zhang, Baohui; Fazli, Ladan; Gleave, Martin; Witte, Owen N.; Garraway, Isla P.; Wu, Hong

2012-01-01

New therapies for late stage and castration resistant prostate cancer (CRPC) depend on defining unique properties and pathways of cell sub-populations capable of sustaining the net growth of the cancer. One of the best enrichment schemes for isolating the putative stem/progenitor cell from the murine prostate gland is Lin-;Sca1+;CD49fhi (LSChi), which results in a more than 10-fold enrichment for in vitro sphere-forming activity. We have shown previously that the LSChi subpopulation is both necessary and sufficient for cancer initiation in the Pten-null prostate cancer model. To further improve this enrichment scheme, we searched for cell surface molecules upregulated upon castration of murine prostate and identified CD166 as a candidate gene. CD166 encodes a cell surface molecule that can further enrich sphere-forming activity of WT LSChi and Pten null LSChi. Importantly, CD166 could enrich sphere-forming ability of benign primary human prostate cells in vitro and induce the formation of tubule-like structures in vivo. CD166 expression is upregulated in human prostate cancers, especially CRPC samples. Although genetic deletion of murine CD166 in the Pten null prostate cancer model does not interfere with sphere formation or block prostate cancer progression and CRPC development, the presence of CD166 on prostate stem/progenitors and castration resistant sub-populations suggest that it is a cell surface molecule with the potential for targeted delivery of human prostate cancer therapeutics. PMID:22880034

Peptide-targeted, stimuli-responsive polymersomes for delivering a cancer stemness inhibitor to cancer stem cell microtumors.

PubMed

Karandish, Fataneh; Froberg, James; Borowicz, Pawel; Wilkinson, John C; Choi, Yongki; Mallik, Sanku

2018-03-01

Often cancer relapses after an initial response to chemotherapy because of the tumor's heterogeneity and the presence of progenitor stem cells, which can renew. To overcome drug resistance, metastasis, and relapse in cancer, a promising approach is the inhibition of cancer stemness. In this study, the expression of the neuropilin-1 receptor in both pancreatic and prostate cancer stem cells was identified and targeted with a stimuli-responsive, polymeric nanocarrier to deliver a stemness inhibitor (napabucasin) to cancer stem cells. Reduction-sensitive amphiphilic block copolymers PEG 1900 -S-S-PLA 6000 and the N 3 -PEG 1900 -PLA 6000 were synthesized. The tumor penetrating iRGD peptide-hexynoic acid conjugate was linked to the N 3 -PEG 1900 -PLA 6000 polymer via a Cu 2+ catalyzed "Click" reaction. Subsequently, this peptide-polymer conjugate was incorporated into polymersomes for tumor targeting and tissue penetration. We prepared polymersomes containing 85% PEG 1900 -S-S-PLA 6000 , 10% iRGD-polymer conjugate, and 5% DPPE-lissamine rhodamine dye. The iRGD targeted polymersomes encapsulating the cancer stemness inhibitor napabucasin were internalized in both prostate and pancreatic cancer stem cells. The napabucasin encapsulated polymersomes significantly (p < .05) reduced the viability of both prostate and pancreatic cancer stem cells and decreased the stemness protein expression notch-1 and nanog compared to the control and vesicles without any drug. The napabucasin encapsulated polymersome formulations have the potential to lead to a new direction in prostate and pancreatic cancer therapy by penetrating deeply into the tumors, releasing the encapsulated stemness inhibitor, and killing cancer stem cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Prostate Cancer Stem-Like Cells | Center for Cancer Research

Cancer.gov

Prostate cancer is the third leading cause of cancer-related death among men, killing an estimated 27,000 men each year in the United States. Men with advanced prostate cancer often become resistant to conventional therapies. Many researchers speculate that the emergence of resistance is due to the presence of cancer stem cells, which are believed to be a small subpopulation

Isolation and Growth of Prostate Stem Cells and Establishing Cancer Cell Lines from Human Prostate Tumors

DTIC Science & Technology

2008-05-01

cells. J Mol Med, 2008. 20. Collins, A. T., Habib , F. K., Maitland, N. J., and Neal, D. E. Identification and isolation of human prostate...The utility and limitations of glycosylated human CD133 epitopes in defining cancer stem cells. J Mol Med 2008;86:1025–32. 20. Collins AT, Habib FK...cells. J Cell Sci 2004;117: 3539–45. 23. Litvinov IV, Vander Griend DJ, Xu Y, Antony L, Dalrymple SL , Isaacs JT. Low-calcium serum-free defined

The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44.

PubMed

Liu, Can; Kelnar, Kevin; Liu, Bigang; Chen, Xin; Calhoun-Davis, Tammy; Li, Hangwen; Patrawala, Lubna; Yan, Hong; Jeter, Collene; Honorio, Sofia; Wiggins, Jason F; Bader, Andreas G; Fagin, Randy; Brown, David; Tang, Dean G

2011-02-01

Cancer stem cells (CSCs), or tumor-initiating cells, are involved in tumor progression and metastasis. MicroRNAs (miRNAs) regulate both normal stem cells and CSCs, and dysregulation of miRNAs has been implicated in tumorigenesis. CSCs in many tumors--including cancers of the breast, pancreas, head and neck, colon, small intestine, liver, stomach, bladder and ovary--have been identified using the adhesion molecule CD44, either individually or in combination with other marker(s). Prostate CSCs with enhanced clonogenic and tumor-initiating and metastatic capacities are enriched in the CD44(+) cell population, but whether miRNAs regulate CD44(+) prostate cancer cells and prostate cancer metastasis remains unclear. Here we show, through expression analysis, that miR-34a, a p53 target, was underexpressed in CD44(+) prostate cancer cells purified from xenograft and primary tumors. Enforced expression of miR-34a in bulk or purified CD44(+) prostate cancer cells inhibited clonogenic expansion, tumor regeneration, and metastasis. In contrast, expression of miR-34a antagomirs in CD44(-) prostate cancer cells promoted tumor development and metastasis. Systemically delivered miR-34a inhibited prostate cancer metastasis and extended survival of tumor-bearing mice. We identified and validated CD44 as a direct and functional target of miR-34a and found that CD44 knockdown phenocopied miR-34a overexpression in inhibiting prostate cancer regeneration and metastasis. Our study shows that miR-34a is a key negative regulator of CD44(+) prostate cancer cells and establishes a strong rationale for developing miR-34a as a novel therapeutic agent against prostate CSCs.

Enrichment of prostate cancer stem cells from primary prostate cancer cultures of biopsy samples

PubMed Central

Wang, Shunqi; Huang, Shengsong; Zhao, Xin; Zhang, Qimin; Wu, Min; Sun, Feng; Han, Gang; Wu, Denglong

2014-01-01

This study was to enrich prostate cancer stem cells (PrCSC) from primary prostate cancer cultures (PPrCC). Primary prostate cancer cells were amplified in keratinocyte serum-free medium with epidermal growth factor (EGF) and bovine pituitary extract (BPE), supplemented with leukemia inhibitory factor (LIF), stem cell factor (SCF) and cholera toxin. After amplification, cells were transferred into ultra-low attachment dishes with serum-free DMEM/F12 medium, supplemented with EGF, basic fibroblast growth factor (bFGF), bovine serum albumin (BSA), insulin, and N2 nutrition. Expression of cell-type-specific markers was determined by RT-qPCR and immunostaining. Tumorigenicity of enriched PrCSC was determined by soft agar assay and xenograft assay in NOD/SCID mice. Biopsy samples from 19 confirmed prostate cancer patients were used for establishing PPrCC, and 18 cases (95%) succeeded. Both basal marker (CK5) and luminal markers (androgen receptor and CK8) strongly co-expressed in most of PPrCC, indicating their basal epithelial origin. After amplification under adherent culture condition in vitro, transient amplifying cells were the dominant cells. Sphere formation efficiency (SFE) of passaged PPrCC was about 0.5%, which was 27 times lower than SFE of LNCaP (13.67%) in the same condition. Compared with adherent cells from PPrCC, prostasphere from PPrCC showed up regulated stem cell markers and increased tumorigenic potential in soft-agar assay. However, spheroid cells from PPrCC prostasphere failed to initiate tumor in xenograft assay in 6 months. Thus, PPrCC can be established and amplified from prostate cancer biopsy samples. Our modified sphere culture system can enrich PrCSC from PPrCC. PMID:24427338

Novel Therapeutic Approaches Toward Treating Prostate Cancer

DTIC Science & Technology

2013-05-01

Kinases, Prostate Cancer, AKT inhibition, Mouse, Prostate Stem Cells 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES...Bearss 0, Wierda WG, Gandhi V (2009) Pim kinase inhibitor, 5GI-1776, induces apoptosis in CLL lymphocytes. Blood 114:4150--4157. 27. Grey R, et aL...PIM1 expression predict outcome in mantle cell lymphoma treated with high dose therapy, stem eel! transplantation and rituximab: a Cancer and Leukemia

ILs-3, 6 and 11 increase, but ILs-10 and 24 decrease stemness of human prostate cancer cells in vitro.

PubMed

Yu, Dandan; Zhong, Yali; Li, Xiaoran; Li, Yaqing; Li, Xiaoli; Cao, Jing; Fan, Huijie; Yuan, Yuan; Ji, Zhenyu; Qiao, Baoping; Wen, Jian-Guo; Zhang, Mingzhi; Kvalheim, Gunnar; Nesland, Jahn M; Suo, Zhenhe

2015-12-15

Cancer stem cells (CSCs) are associated with cancer recurrence and metastasis. Prostate cancer cells often metastasize to the bone with a complex microenvironment of cytokines favoring cell survival. In this study, the cell stemness influence of a group of interleukins including IL-3, 6, 10, 11 and 24 on human prostate cancer cell lines LNCaP and PC-3 was explored in vitro. Sulforhodamine B(SRB) and 5-ethynyl-2'-deoxyuridine (EdU) assays were applied to examine the effect on cell proliferation, and wound healing and transwell assays were used for migration and invasion studies, in addition to colony formation, Western blotting and flowcytometry for the expression of stemness factors and chemotherapy sensitivity. We observed that ILs-3, 6 and 11 stimulated while ILs-10 and 24 inhibited the growth, invasion and migration of both cell lines. Interestingly, ILs-3, 6 and 11 significantly promoted colony formation and increased the expression of SOX2, CD44 and ABCG2 in both prostate cancer cell lines. However, ILs-10 and 24 showed the opposite effect on the expression of these factors. In line with the above findings, treatment with either IL-3 or IL-6 or IL-11 decreased the chemosensitivity to docetaxel while treatment with either IL-10 or IL-24 increased the sensitivity of docetaxel chemotherapy. In conclusion, our results suggest that ILs-3, 6 and 11 function as tumor promoters while ILs-10 and 24 function as tumor suppressors in the prostate cancer cell lines PC-3 and LNCaP in vitro, and such differences may attribute to their different effect on the stemness of PCa cells.

ILs-3, 6 and 11 increase, but ILs-10 and 24 decrease stemness of human prostate cancer cells in vitro

PubMed Central

Yu, Dandan; Zhong, Yali; Li, Xiaoran; Li, Yaqing; Li, Xiaoli; Cao, Jing; Fan, Huijie; Yuan, Yuan; Ji, Zhenyu; Qiao, Baoping; Wen, Jian-Guo; Zhang, Mingzhi; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe

2015-01-01

Cancer stem cells (CSCs) are associated with cancer recurrence and metastasis. Prostate cancer cells often metastasize to the bone with a complex microenvironment of cytokines favoring cell survival. In this study, the cell stemness influence of a group of interleukins including IL-3, 6, 10, 11 and 24 on human prostate cancer cell lines LNCaP and PC-3 was explored in vitro. Sulforhodamine B(SRB) and 5-ethynyl-2′-deoxyuridine (EdU) assays were applied to examine the effect on cell proliferation, and wound healing and transwell assays were used for migration and invasion studies, in addition to colony formation, Western blotting and flowcytometry for the expression of stemness factors and chemotherapy sensitivity. We observed that ILs-3, 6 and 11 stimulated while ILs-10 and 24 inhibited the growth, invasion and migration of both cell lines. Interestingly, ILs-3, 6 and 11 significantly promoted colony formation and increased the expression of SOX2, CD44 and ABCG2 in both prostate cancer cell lines. However, ILs-10 and 24 showed the opposite effect on the expression of these factors. In line with the above findings, treatment with either IL-3 or IL-6 or IL-11 decreased the chemosensitivity to docetaxel while treatment with either IL-10 or IL-24 increased the sensitivity of docetaxel chemotherapy. In conclusion, our results suggest that ILs-3, 6 and 11 function as tumor promoters while ILs-10 and 24 function as tumor suppressors in the prostate cancer cell lines PC-3 and LNCaP in vitro, and such differences may attribute to their different effect on the stemness of PCa cells. PMID:26528857

Application of mitochondrial pyruvate carrier blocker UK5099 creates metabolic reprogram and greater stem-like properties in LnCap prostate cancer cells in vitro.

PubMed

Zhong, Yali; Li, Xiaoran; Yu, Dandan; Li, Xiaoli; Li, Yaqing; Long, Yuan; Yuan, Yuan; Ji, Zhenyu; Zhang, Mingzhi; Wen, Jian-Guo; Nesland, Jahn M; Suo, Zhenhe

2015-11-10

Aerobic glycolysis is one of the important hallmarks of cancer cells and eukaryotic cells. In this study, we have investigated the relationship between blocking mitochondrial pyruvate carrier (MPC) with UK5099 and the metabolic alteration as well as stemness phenotype of prostatic cancer cells. It was found that blocking pyruvate transportation into mitochondrial attenuated mitochondrial oxidative phosphorylation (OXPHOS) and increased glycolysis. The UK5099 treated cells showed significantly higher proportion of side population (SP) fraction and expressed higher levels of stemness markers Oct3/4 and Nanog. Chemosensitivity examinations revealed that the UK5099 treated cells became more resistant to chemotherapy compared to the non-treated cells. These results demonstrate probably an intimate connection between metabolic reprogram and stem-like phenotype of LnCap cells in vitro. We propose that MPC blocker (UK5099) application may be an ideal model for Warburg effect studies, since it attenuates mitochondrial OXPHOS and increases aerobic glycolysis, a phenomenon typically reflected in the Warburg effect. We conclude that impaired mitochondrial OXPHOS and upregulated glycolysis are related with stem-like phenotype shift in prostatic cancer cells.

Application of mitochondrial pyruvate carrier blocker UK5099 creates metabolic reprogram and greater stem-like properties in LnCap prostate cancer cells in vitro

PubMed Central

Zhong, Yali; Li, Xiaoran; Yu, Dandan; Li, Xiaoli; Li, Yaqing; Long, Yuan; Yuan, Yuan; Ji, Zhenyu; Zhang, Mingzhi; Wen, Jian-Guo; Nesland, Jahn M.; Suo, Zhenhe

2015-01-01

Aerobic glycolysis is one of the important hallmarks of cancer cells and eukaryotic cells. In this study, we have investigated the relationship between blocking mitochondrial pyruvate carrier (MPC) with UK5099 and the metabolic alteration as well as stemness phenotype of prostatic cancer cells. It was found that blocking pyruvate transportation into mitochondrial attenuated mitochondrial oxidative phosphorylation (OXPHOS) and increased glycolysis. The UK5099 treated cells showed significantly higher proportion of side population (SP) fraction and expressed higher levels of stemness markers Oct3/4 and Nanog. Chemosensitivity examinations revealed that the UK5099 treated cells became more resistant to chemotherapy compared to the non-treated cells. These results demonstrate probably an intimate connection between metabolic reprogram and stem-like phenotype of LnCap cells in vitro. We propose that MPC blocker (UK5099) application may be an ideal model for Warburg effect studies, since it attenuates mitochondrial OXPHOS and increases aerobic glycolysis, a phenomenon typically reflected in the Warburg effect. We conclude that impaired mitochondrial OXPHOS and upregulated glycolysis are related with stem-like phenotype shift in prostatic cancer cells. PMID:26413751

Enrichment of prostate cancer stem-like cells from human prostate cancer cell lines by culture in serum-free medium and chemoradiotherapy.

PubMed

Wang, Lei; Huang, Xing; Zheng, Xinmin; Wang, Xinghuan; Li, Shiwen; Zhang, Lin; Yang, Zhonghua; Xia, Zhiping

2013-01-01

The discovery of rare subpopulations of cancer stem cells (CSCs) has created a new focus in cancer research. As CSCs demonstrate resistance to chemoradiation therapy relative to other cancer cells, this allows the enrichment of CSC populations by killing apoptosis-susceptible cancer cells. In this study, three commonly used human prostate cancer (PCa) cell lines (DU145, PC-3 and LNCaP) were examined for their expression of the putative stem cell markers CD133 and CD44 via flow cytometric analysis. Under normal culture conditions, CD133(+)/CD44(+) cells were only present in the DU145 cell line, and comprised only a minor percentage (0.1% ± 0.01%) of the total population. However, the proportion of these CD133(+)/CD44(+) prostate CSCs could be increased in these cell lines via culture in serum-free medium (SFM), or through chemotherapy or radiotherapy. Indeed, after culture in SFM, the proportion of CD133(+)/CD44(+) cells in DU145 and PC-3 had increased to 10.3% and 3.0%, respectively. Moreover, the proportion had increased to 9.8% enriched by chemotherapy and 3.5% by radiotherapy in DU145. Colony-formation tests, cell invasion assays, and tumor xenografts in BALB/c nude mice were used to evaluate the stem cell properties of CD133(+)/CD44(+) PCa cells that were isolated via fluorescence-activated cell sorting (FACS). CD133(+)/CD44(+) cells had an enhanced colony-formation capability and invasive ability in vitro, and displayed greater tumorigenic properties in vivo. These results demonstrate the presence of CD133(+)/CD44(+) prostate CSCs in established PCa cell lines and that populations of these cells can be enriched by culture in SFM or chemoradiotherapy. Finding novel therapies to override chemoradiation resistance in the prostate CSCs is the key to improve long-term results in PCa management.

Role of interleukins, IGF and stem cells in BPH

PubMed Central

McLaren, Ian D.; Jerde, Travis J.; Bushman, Wade

2013-01-01

The condition known as benign prostatic hyperplasia may be defined as a benign enlargement of the prostate gland resulting from a proliferation of both benign epithelial and stromal elements. It might also be defined clinically as a constellation of lower urinary tract symptoms (LUTSs) in aging men. The purpose of this review is to consider the ways in which inflammatory cytokines belonging to the interleukin family, members of the IFG family, and stem cells may contribute to the development and progression of BPH-LUTS. This might occur in three mechanisms: One, interleukin signaling, IFG signaling and stem cells may contribute to reactivation of developmental growth mechanisms in the adult prostate leading to tissue growth. Two, given that epidemiologic studies indicate an increased incidence of BPH-LUTS in association with obesity and diabetes, IFG signaling may provide the mechanistic basis for the effect of diabetes and obesity on prostate growth. Three, expression of interleukins in association with inflammation in the prostate may induce sensitization of afferent fibers innervating the prostate and result in increased sensitivity to pain and noxious sensations in the prostate and bladder and heightened sensitivity to bladder filling. PMID:21864972

Contribution of Caudal Müllerian Duct Mesenchyme to Prostate Development

PubMed Central

Brechka, Hannah; McAuley, Erin M.; Lamperis, Sophia M.; Paner, Gladell P.

2016-01-01

A fundamental understanding of prostate development and tissue homeostasis has the high potential to reveal mechanisms for prostate disease initiation and identify novel therapeutic approaches for disease prevention and treatment. Our current understanding of prostate lineage specification stems from the use of developmental model systems that rely upon the embryonic preprostatic urogenital sinus mesenchyme to induce the formation of mature prostate epithelial cells. It is unclear, however, how the urogenital sinus epithelium can derive both adult urethral glands and prostate epithelia. Furthermore, the vast disparity in disease initiation between these two glands highlights key developmental factors that predispose prostate epithelia to hyperplasia and cancer. In this study we demonstrate that the caudal Müllerian duct mesenchyme (CMDM) drives prostate epithelial differentiation and is a key determinant in cell lineage specification between urethral glands and prostate epithelia. Utilizing both human embryonic stem cells and mouse embryonic tissues, we document that the CMDM is capable of inducing the specification of androgen receptor, prostate-specific antigen, NKX3.1, and Hoxb13-positive prostate epithelial cells. These results help to explain key developmental differences between prostate and urethral gland differentiation, and implicate factors secreted by the caudal Müllerian duct as novel targets for prostate disease prevention and treatment. PMID:27595922

Targeting Tumor Oct4 to Deplete Prostate Tumor and Metastasis Initiating Cells

DTIC Science & Technology

2017-12-01

Nie, POU5F1B, an OCT4 Retrogene, Suppresses Uncontrolled Tumor Growth. Keystone Meeting on Molecular and Cellular Basis of Growth and Regeneration...Daotai Nie. Cancer Stem Cells in Resistance to Cytotoxic Drugs: Implications in Chemotherapy. B. Bonavida (ed.), Molecular Mechanisms of Tumor Cell...retrogene of the master embryonic stem cell gene POU5F1 is associated with prostate cancer susceptibility. American journal of human genetics 94

Gene signatures distinguish stage-specific prostate cancer stem cells isolated from transgenic adenocarcinoma of the mouse prostate lesions and predict the malignancy of human tumors.

PubMed

Mazzoleni, Stefania; Jachetti, Elena; Morosini, Sara; Grioni, Matteo; Piras, Ignazio Stefano; Pala, Mauro; Bulfone, Alessandro; Freschi, Massimo; Bellone, Matteo; Galli, Rossella

2013-09-01

The relevant social and economic impact of prostate adenocarcinoma, one of the leading causes of death in men, urges critical improvements in knowledge of the pathogenesis and cure of this disease. These can also be achieved by implementing in vitro and in vivo preclinical models by taking advantage of prostate cancer stem cells (PCSCs). The best-characterized mouse model of prostate cancer is the transgenic adenocarcinoma of the mouse prostate (TRAMP) model. TRAMP mice develop a progressive lesion called prostatic intraepithelial neoplasia that evolves into adenocarcinoma (AD) between 24 and 30 weeks of age. ADs often metastasize to lymph nodes, lung, bones, and kidneys. Eventually, approximately 5% of the mice develop an androgen-independent neuroendocrine adenocarcinoma. Here we report the establishment of long-term self-renewing PCSC lines from the different stages of TRAMP progression by application of the neurosphere assay. Stage-specific prostate cell lines were endowed with the critical features expected from malignant bona fide cancer stem cells, namely, self-renewal, multipotency, and tumorigenicity. Notably, transcriptome analysis of stage-specific PCSCs resulted in the generation of well-defined, meaningful gene signatures, which identify distinct stages of human tumor progression. As such, TRAMP-derived PCSCs represent a novel and valuable preclinical model for elucidating the pathogenetic mechanisms leading to prostate adenocarcinoma and for the identification of molecular mediators to be pursued as therapeutic targets.

Increased Expression of ALDH1A1 in Prostate Cancer is Correlated With Tumor Aggressiveness: A Tissue Microarray Study of Iranian Patients.

PubMed

Kalantari, Elham; Saadi, Faezeh H; Asgari, Mojgan; Shariftabrizi, Ahmad; Roudi, Raheleh; Madjd, Zahra

2017-09-01

Subpopulations of prostate cancer (PCa) cells expressing putative stem cell markers possess the ability to promote tumor growth, maintenance, and progression. This study aimed to evaluate the expression patterns and clinical significance of putative stem cell marker aldehyde dehydrogenase 1 A1 (ALDH1A1) in prostate tumor tissues. ALDH1A1 expression was examined in a well-defined series of prostate tissues, including 105 (68%) samples of PCa, 21 (13%) samples of high-grade prostatic intraepithelial neoplasia, and 31 (19%) samples of benign prostate hyperplasia, which were embedded in tissue microarray blocks. The correlation of ALDH1A1 expression with clinicopathologic parameters was also assessed. There was a significant difference between the expression level of ALDH1A1 in PCa compared with the high-grade prostatic intraepithelial neoplasia and benign prostate hyperplasia samples (P<0.001). PCa cells expressing ALDH1A1 were more often seen in samples with advanced Gleason score (P=0.05) and high serum prostate specific antigen level (P=0.02). In addition, a positive correlation was found between ALDH1A1 expression and primary tumor stage and regional lymph node involvement (P=0.04 and 0.03, respectively). The significant association between ALDH1A1 expressions with Gleason score indicates the potential role of this protein in PCa tumorigenesis and aggressive behavior; therefore, this cancer stem cell marker can be used as a promising candidate for targeted therapy of PCa, especially those with high Gleason score.

Animal models relevant to human prostate carcinogenesis underlining the critical implication of prostatic stem/progenitor cells

PubMed Central

Mimeault, Murielle; Batra, Surinder K.

2012-01-01

Recent development of animal models relevant to human prostate cancer (PC) etiopathogenesis has provided important information on the specific functions provided by key gene products altered during disease initiation and progression to locally invasive, metastatic and hormone-refractory stages. Especially, the characterization of transgenic mouse models has indicated that the inactivation of distinct tumor suppressor proteins such as phosphatase tensin homolog deleted on chromosome 10 (PTEN), Nkx3.1, p27KIP1 and p53 and retinoblastoma (pRb) may cooperate for the malignant transformation of prostatic stem/progenitor cells into PC stem/progenitor cells and tumor development and metastases. Moreover, the sustained activation of diverse oncogenic signaling elements, including epidermal growth factor receptor (EGFR), sonic hedgehog, Wnt/β-catenin, c-Myc, Akt and nuclear factor-kappaB (NF-κB) also may contribute to the acquisition of more aggressive and hormone-refractory phenotypes by PC stem/progenitor cells and their progenies during disease progression. Importantly, it has also been shown that an enrichment of PC stem/progenitor cells expressing stem cell-like markers may occur after androgen deprivation therapy and docetaxel treatment in the transgenic mouse models of PC suggesting the critical implication of these immature PC cells in treatment resistance, tumor re-growth and disease recurrence. Of clinical interest, the molecular targeting of distinct gene products altered in PC cells by using different dietary compounds has also been shown to counteract PC initiation and progression in animal models supporting their potential use as chemopreventive or chemotherapeutic agents for eradicating the total tumor cell mass, improving current anti-hormonal and chemotherapies and preventing disease relapse. PMID:21396984

Sunitinib reduces tumor hypoxia and angiogenesis, and radiosensitizes prostate cancer stem-like cells.

PubMed

Diaz, Roque; Nguewa, Paul A; Redrado, Miriam; Manrique, Irene; Calvo, Alfonso

2015-08-01

The need for new treatments for advanced prostate cancer has fostered the experimental use of targeted therapies. Sunitinib is a multi-tyrosine kinase inhibitor that mainly targets membrane-bound receptors of cells within the tumor microenvironment, such as endothelial cells and pericytes. However, recent studies suggest a direct effect on tumor cells. In the present study, we have evaluated both direct and indirect effects of Sunitinib in prostate cancer and how this drug regulates hypoxia, using in vitro and in vivo models. We have used both in vitro (PC-3, DU145, and LNCaP cells) and in vivo (PC-3 xenografts) models to study the effect of Sunitinib in prostate cancer. Analysis of hypoxia based on HIF-1α expression and FMISO uptake was conducted. ALDH activity was used to analyze cancer stem cells (CSC). Sunitinib strongly reduced proliferation of PC-3 and DU-145 cells in a dose dependent manner, and decreased levels of p-Akt, p-Erk1/2, and Id-1, compared to untreated cells. A 3-fold reduction in tumor growth was also observed (P < 0.001 with respect to controls). Depletion of Hif-1α levels in vitro and a decrease in FMISO uptake in vivo showed that Sunitinib inhibits tumor hypoxia. When combined with radiotherapy, this drug enhanced cell death in vitro and in vivo, and significantly decreased CD-31, PDGFRβ, Hif-1α, Id1, and PCNA protein levels (whereas apoptosis was increased) in tumors as compared to controls or single-therapy treated mice. Moreover, Sunitinib reduced the number of ALDH + cancer stem-like cells and sensitized these cells to radiation-mediated loss of clonogenicity. Our results support the use of Sunitinib in prostate cancer and shows that both hypoxia and cancer stem cells are involved in the effect elicited by this drug. Combination of Sunitinib with radiotherapy warrants further consideration to reduce prostate cancer burden. © 2015 Wiley Periodicals, Inc.

Using Human Stem Cells to Study the Role of the Stroma in the Initiation of Prostate Cancer

DTIC Science & Technology

2011-03-01

alterations in the epithelium that drives the pr ogressive transformation of nor mal human cells into highly malignant derivatives. It is evident that...of tumor initiation, we propose to use normal human prostate epithelium generated from human embryonic stem cells (hESCs) in tissue recombination...serum free conditions for 5-8 days into endoderm in vitro. Confirm endoderm phenotype using immunohistochemistry and FACs analysis . We conducted

MiR-141-3p promotes prostate cancer cell proliferation through inhibiting kruppel-like factor-9 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jiu-zhi; Department of Urology, People's Hospital of Xinjiang Uygur Autonomous Region, Urumqi, Xinjiang, 830001; Li, Jia

Evidence has revealed that some microRNAs play a critical role in tumor proliferation. We demonstrated that miR-141-3p appears to be a novel oncogene miRNA, which promotes prostate tumorigenesis and facilitates the stemness of prostate cancer cells via suppressing a key transcription factor kruppel-like factor-9 (KLF9). KLF9 is the core effector protein that might suppress tumor growth. MiR-141-3p is upregulated in prostate cancer cells and tissues compared to non-tumorigenic prostate epithelial cells and prostate tissues. MiR-141-3p positively regulated proliferation, spheroid formation, and expression of the stemness factors OCT-4, Nanog, SOX-9, Bmil, CCND1, and CD44 in PC-3 cells. Restoration of miR-141-3p suppresses themore » expression of the transcription factor KLF9 in PC-3 and accelerates prostate tumorigenesis via targeted binding with its 3′-UTR. Downregulation of KLF9 enhances spheres formation of prostate cancer cells. Our results suggest that miR-141-3p/KLF9 may play an important role in regulating the growth of prostate cancer and is a potential target of prevention and therapy. - Highlights: • MiR-141-3p is upregulated in human prostate cancer. • MiR-141-3p induces cell proliferation and apoptosis resistance. • KLF9 is a direct and functional target of miR-141-3p.« less

Comparative characterization of stem cell marker expression, metabolic activity and resistance to doxorubicin in adherent and spheroid cells derived from the canine prostate adenocarcinoma cell line CT1258.

PubMed

Liu, Wen; Moulay, Mohammed; Willenbrock, Saskia; Roolf, Catrin; Junghanss, Christian; Ngenazahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo

2015-04-01

Canine prostate cancer represents a spontaneous animal model for the human counterpart. Cells with stem cell-like character are considered to play a major role in therapeutic resistance and tumor relapse. Thus, the identification of markers allowing for recognition and characterization of these cells is essential. Expression of 12 stem cell marker genes in the canine prostate cancer cell line CT1258 and spheroid cells generated from these was analyzed by quantitative real-time PCR. In CT1258 and the generated spheroid cells, CD44 and CD133 expression was analyzed by flow cytometry, as well as proliferation and doxorubicin resistance. Integrin alpha-6 (ITGA6) expression and metabolic activity were significantly up-regulated in CT1258-derived spheroid cells, while doxorubicin resistance remained comparable. ITGA6 de-regulation and metabolic activity appear to be characteristic of the generated spheres, indicating potential intervention targets. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Human Prostate Sphere-Forming Cells Represent a Subset of Basal Epithelial Cells Capable of Glandular Regeneration in Vivo

PubMed Central

Garraway, Isla P; Sun, Wenyi; Tran, Chau P; Perner, Sven; Zhang, Bao; Goldstein, Andrew S; Hahm, Scott A; Haider, Maahum; Head, Christian S; Reiter, Robert E; Rubin, Mark A; Witte, Owen N

2010-01-01

BACKGROUND Prostate stem/progenitor cells function in glandular development and maintenance. They may be targets for tumor initiation, so characterization of these cells may have therapeutic implications. Cells from dissociated tissues that form spheres in vitro often represent stem/progenitor cells. A subset of human prostate cells that form prostaspheres were evaluated for self-renewal and tissue regeneration capability in the present study. METHODS Prostaspheres were generated from 59 prostatectomy specimens. Lineage marker expression and TMPRSS-ERG status was determined via immunohistochemistry and fluorescence in situ hybridization (FISH). Subpopulations of prostate epithelial cells were isolated by cell sorting and interrogated for sphere-forming activity. Tissue regeneration potential was assessed by combining sphere-forming cells with rat urogenital sinus mesenchyme (rUGSM) subcutaneously in immunocompromised mice. RESULTS Prostate tissue specimens were heterogeneous, containing both benign and malignant (Gleason 3–5) glands. TMPRSS-ERG fusion was found in approximately 70% of cancers examined. Prostaspheres developed from single cells at a variable rate (0.5–4%) and could be serially passaged. A basal phenotype (CD44+CD49f+CK5+p63+CK8−AR−PSA−) was observed among sphere-forming cells. Subpopulations of prostate cells expressing tumor-associated calcium signal transducer 2 (Trop2), CD44, and CD49f preferentially formed spheres. In vivo implantation of sphere-forming cells and rUGSM regenerated tubular structures containing discreet basal and luminal layers. The TMPRSS-ERG fusion was absent in prostaspheres derived from fusion-positive tumor tissue, suggesting a survival/growth advantage of benign prostate epithelial cells. CONCLUSION Human prostate sphere-forming cells self-renew, have tissue regeneration capability, and represent a subpopulation of basal cells. Prostate 70: 491–501, 2010. © 2009 Wiley-Liss, Inc. PMID:19938015

Differentiation of Neonatal Human-Induced Pluripotent Stem Cells to Prostate Epithelial Cells: A Model to Study Prostate Cancer Development

DTIC Science & Technology

2013-06-01

38, 40, 41]. Because these “ mela - noma stem cells” (MSC) are sometimes so numerous, some have argued that the CSC model may not apply to melanoma...40]. There are data from two groups indicating that mela - noma lesions contain a CSC subset character- ized by CD271 expression [25, 26]. In a...neuronal proteins and neuron- like differentiation has been long recognized in neoplastic melanocytes [46, 47]. Certain mela - noma cell lines that

Identification of multipotent mesenchymal stromal cells in the reactive stroma of a prostate cancer xenograft by side population analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santamaria-Martinez, Albert; Universitat de Barcelona, Barcelona; Barquinero, Jordi

2009-10-15

Cancer stem cells are a distinct cellular population that is believed to be responsible for tumor initiation and maintenance. Recent data suggest that solid tumors also contain another type of stem cells, the mesenchymal stem cells or multipotent mesenchymal stromal cells (MSCs), which contribute to the formation of tumor-associated stroma. The Hoechst 33342 efflux assay has proved useful to identify a rare cellular fraction, named Side Population (SP), enriched in cells with stem-like properties. Using this assay, we identified SP cells in a prostate cancer xenograft containing human prostate cancer cells and mouse stromal cells. The SP isolation, subculture andmore » sequential sorting allowed the generation of single-cell-derived clones of murine origin that were recognized as MSC by their morphology, plastic adherence, proliferative potential, adipogenic and osteogenic differentiation ability and immunophenotype (CD45{sup -}, CD81{sup +} and Sca-1{sup +}). We also demonstrated that SP clonal cells secrete transforming growth factor {beta}1 (TGF-{beta}1) and that their inhibition reduces proliferation and accelerates differentiation. These results reveal the existence of SP cells in the stroma of a cancer xenograft, and provide evidence supporting their MSC nature and the role of TGF-{beta}1 in maintaining their proliferation and undifferentiated status. Our data also reveal the usefulness of the SP assay to identify and isolate MSC cells from carcinomas.« less

Identification of multipotent mesenchymal stromal cells in the reactive stroma of a prostate cancer xenograft by side population analysis.

PubMed

Santamaria-Martínez, Albert; Barquinero, Jordi; Barbosa-Desongles, Anna; Hurtado, Antoni; Pinós, Tomàs; Seoane, Joan; Poupon, Marie-France; Morote, Joan; Reventós, Jaume; Munell, Francina

2009-10-15

Cancer stem cells are a distinct cellular population that is believed to be responsible for tumor initiation and maintenance. Recent data suggest that solid tumors also contain another type of stem cells, the mesenchymal stem cells or multipotent mesenchymal stromal cells (MSCs), which contribute to the formation of tumor-associated stroma. The Hoechst 33342 efflux assay has proved useful to identify a rare cellular fraction, named Side Population (SP), enriched in cells with stem-like properties. Using this assay, we identified SP cells in a prostate cancer xenograft containing human prostate cancer cells and mouse stromal cells. The SP isolation, subculture and sequential sorting allowed the generation of single-cell-derived clones of murine origin that were recognized as MSC by their morphology, plastic adherence, proliferative potential, adipogenic and osteogenic differentiation ability and immunophenotype (CD45(-), CD81(+) and Sca-1(+)). We also demonstrated that SP clonal cells secrete transforming growth factor beta1 (TGF-beta1) and that their inhibition reduces proliferation and accelerates differentiation. These results reveal the existence of SP cells in the stroma of a cancer xenograft, and provide evidence supporting their MSC nature and the role of TGF-beta1 in maintaining their proliferation and undifferentiated status. Our data also reveal the usefulness of the SP assay to identify and isolate MSC cells from carcinomas.

Chemopreventive Effect of PSP Through Targeting of Prostate Cancer Stem Cell-Like Population

PubMed Central

Liu, Ji; Lee, Davy Tak-Wing; Chiu, Yung-Tuen; Ma, Stephanie; Ng, Irene Oi-Lin; Wong, Yong-Chuan; Chan, Franky Leung; Ling, Ming-Tat

2011-01-01

Recent evidence suggested that prostate cancer stem/progenitor cells (CSC) are responsible for cancer initiation as well as disease progression. Unfortunately, conventional therapies are only effective in targeting the more differentiated cancer cells and spare the CSCs. Here, we report that PSP, an active component extracted from the mushroom Turkey tail (also known as Coriolus versicolor), is effective in targeting prostate CSCs. We found that treatment of the prostate cancer cell line PC-3 with PSP led to the down-regulation of CSC markers (CD133 and CD44) in a time and dose-dependent manner. Meanwhile, PSP treatment not only suppressed the ability of PC-3 cells to form prostaspheres under non-adherent culture conditions, but also inhibited their tumorigenicity in vivo, further proving that PSP can suppress prostate CSC properties. To investigate if the anti-CSC effect of PSP may lead to prostate cancer chemoprevention, transgenic mice (TgMAP) that spontaneously develop prostate tumors were orally fed with PSP for 20 weeks. Whereas 100% of the mice that fed with water only developed prostate tumors at the end of experiment, no tumors could be found in any of the mice fed with PSP, suggesting that PSP treatment can completely inhibit prostate tumor formation. Our results not only demonstrated the intriguing anti-CSC effect of PSP, but also revealed, for the first time, the surprising chemopreventive property of oral PSP consumption against prostate cancer. PMID:21603625

Exploring the Hypersensitivity of PTEN Deleted Prostate Cancer Stem Cells to WEE1 Tyrosine Kinase Inhibitors

DTIC Science & Technology

2015-12-01

xenograft tumors. The results from these studies will reveal whether targeting PTEN-deficient human tumors with WEE1 inhibitors can induce specific... xenograft tumors formed by PTEN- PSAlo PCSCs in castrated male immunocompromised mice. What was accomplished under these goals? Aim 1. Examine...prostate cancer stem cells. Aim 3. Investigate the cytotoxicity of WEE1 inhibitors against recalcitrant xenograft tumors formed by PTEN- CSCs in

The Anti-cancer Activity of Vernonia divaricata Sw against Leukaemia, Breast and Prostate Cancers In Vitro

PubMed Central

Lowe, HIC; Daley-Beckford, D; Toyang, NJ; Watson, C; Hartley, S; Bryant, J

2014-01-01

Background: Vernonia divaricata is one of five endemic Vernonia species of Jamaica. The ethnomedicinal uses of other species have been established, however, scientific validation of this species has not yet been done and as such this paper is aimed at identifying the anti-cancer activity of V divaricata against leukaemia, breast and prostate cancer cell lines. Methods: Leaves and stems of V divaricata were dried and milled into powder. The crude hexane and methanol extracts of the leaves and stems were obtained and bio-assayed using WST-1 cell proliferation assay against leukaemia, breast and prostate cancer cell lines. Results: The crude hexane and methanol extracts of V divaricata were able to significantly retard the growth of the MCF-7 (breast), HL-60 (leukaemia) and the PC-3 (prostate) cancer cell lines. The crude methanol extract of the stem was the strongest, exhibiting anti-proliferation activity with IC50 values of 10.14, 12.63 and 9.894 μg/ml for the HL-60, MCF-7 and PC-3 cancer cell lines, respectively, with the most potent toward prostate cancer. Conclusion: The medicinal use of V divaricata as an anti-cancer agent was corroborated as the crude hexane and methanol extracts demonstrated potent anti-proliferation activity and as such hold potential for further research and development into a drug to prevent or treat various cancers. PMID:25429469

Engineering A11 Minibody-Conjugated, Polypeptide-Based Gold Nanoshells for Prostate Stem Cell Antigen (PSCA)-Targeted Photothermal Therapy.

PubMed

Mayle, Kristine M; Dern, Kathryn R; Wong, Vincent K; Chen, Kevin Y; Sung, Shijun; Ding, Ke; Rodriguez, April R; Knowles, Scott; Taylor, Zachary; Zhou, Z Hong; Grundfest, Warren S; Wu, Anna M; Deming, Timothy J; Kamei, Daniel T

2017-02-01

Currently, there is no curative treatment for advanced metastatic prostate cancer, and options, such as chemotherapy, are often nonspecific, harming healthy cells and resulting in severe side effects. Attaching targeting ligands to agents used in anticancer therapies has been shown to improve efficacy and reduce nonspecific toxicity. Furthermore, the use of triggered therapies can enable spatial and temporal control over the treatment. Here, we combined an engineered prostate cancer-specific targeting ligand, the A11 minibody, with a novel photothermal therapy agent, polypeptide-based gold nanoshells, which generate heat in response to near-infrared light. We show that the A11 minibody strongly binds to the prostate stem cell antigen that is overexpressed on the surface of metastatic prostate cancer cells. Compared to nonconjugated gold nanoshells, our A11 minibody-conjugated gold nanoshell exhibited significant laser-induced, localized killing of prostate cancer cells in vitro. In addition, we improved upon a comprehensive heat transfer mathematical model that was previously developed by our laboratory. By relaxing some of the assumptions of our earlier model, we were able to generate more accurate predictions for this particular study. Our experimental and theoretical results demonstrate the potential of our novel minibody-conjugated gold nanoshells for metastatic prostate cancer therapy.

Prostate Stem Cell Antigen DNA Vaccination Breaks Tolerance to Self-antigen and Inhibits Prostate Cancer Growth

PubMed Central

Ahmad, Sarfraz; Casey, Garrett; Sweeney, Paul; Tangney, Mark; O'Sullivan, Gerald C

2009-01-01

Prostate stem cell antigen (PSCA) is a cell surface antigen expressed in normal human prostate and over expressed in prostate cancer. Elevated levels of PSCA protein in prostate cancer correlate with increased tumor stage/grade, with androgen independence and have higher expression in bone metastases. In this study, the PSCA gene was isolated from the transgenic adenocarcinoma mouse prostate cell line (TRAMPC1), and a vaccine plasmid construct was generated. This plasmid PSCA (pmPSCA) was delivered by intramuscular electroporation (EP) and induced effective antitumor immune responses against subcutaneous TRAMPC1 tumors in male C57 BL/6 mice. The pmPSCA vaccination inhibited tumor growth, resulting in cure or prolongation in survival. Similarly, the vaccine inhibited metastases in PSCA expressing B16 F10 tumors. There was activation of Th-1 type immunity against PSCA, indicating the breaking of tolerance to a self-antigen. This immunity was tumor specific and was transferable by adoptive transfer of splenocytes. The mice remained healthy and there was no evidence of collateral autoimmune responses in normal tissues. EP-assisted delivery of the pmPSCA evoked strong specific responses and could, in neoadjuvant or adjuvant settings, provide a safe and effective immune control of prostate cancer, given that there is significant homology between human and mouse PSCA. PMID:19337234

Recent advances in prostate development and links to prostatic diseases

PubMed Central

Powers, Ginny L.

2013-01-01

The prostate is a branched ductal-acinar gland that is part of the male reproductive tract. Prostate development depends upon the integration of steroid hormone signals, paracrine interactions between the stromal and epithelial tissue layers, and the actions of cell autonomous factors. Several genes and signalling pathways are known to be required for one or more steps of prostate development including epithelial budding, duct elongation, branching morphogenesis, and/or cellular differentiation. Recent progress in the field of prostate development has included the application of genome-wide technologies including serial analysis of gene expression (SAGE), expression profiling microarrays, and other large scale approaches to identify new genes and pathways that are essential for prostate development. The aggregation of experimental results into online databases by organized multi-lab projects including the Genitourinary Developmental Molecular Atlas Project (GUDMAP) has also accelerated the understanding of molecular pathways that function during prostate development and identified links between prostate anatomy and molecular signaling. Rapid progress has also recently been made in understanding the nature and role of candidate stem cells in the developing and adult prostate. This has included the identification of putative prostate stem cell markers, lineage tracing, and organ reconstitution studies. However, several issues regarding their origin, precise nature, and possible role(s) in disease remain unresolved. Nevertheless, several links between prostatic developmental mechanisms and the pathogenesis of prostatic diseases including benign prostatic hyperplasia and prostate cancer have led to recent progress on targeting developmental pathways as therapeutic strategies for these diseases. PMID:23335485

Prostate Stem Cell Antigen: A Prospective Therapeutic and Diagnostic Target

PubMed Central

Raff, Adam B.; Gray, Andrew; Kast, W. Martin

2009-01-01

The development of novel clinical tools to combat cancer is an intense field of research and recent efforts have been directed at the identification of proteins that may provide diagnostic, prognostic and/or therapeutic applications due to their restricted expression. To date, a number of protein candidates have emerged as potential clinical tools in the treatment of prostate cancer. Discovered over ten year ago, prostate stem cell antigen (PSCA) is a cell surface antigen that belongs to the Ly-6/Thy-1 family of glycosylphosphatidylinositol-anchored proteins. PSCA is highly overexpressed in human prostate cancer, with limited expression in normal tissues, making it an ideal target for both diagnosis and therapy. Several studies have now clearly correlated the expression of PSCA with relevant clinical benchmarks, such as Gleason score and metastasis, while others have demonstrated the efficacy of PSCA targeting in treatment through various modalities. The purpose of this review is to present the current body of knowledge about PSCA and its potential role in the treatment of human prostate cancer. PMID:18838214

Enhancing Therapeutic Cellular Prostate Cancer Vaccines

DTIC Science & Technology

2012-06-01

oxygen -mediated mobilization of mesenchymal stem cell and progenitors (MSCs)”, Division of Preventive, Occupational, And Aerospace Medicine...postdoctoral fellow Completed: Tittle: Hyperbaric oxygen as mobilizer of stem cells and progenitors in senescent mice (Stanimir Vuk-Pavlovic, P.I.). Co... stem and progenitor cells (HSPCs) and mesenchymal stromal cells (MSCs) from bone marrow into circulation of old mice were explored. Specific Aims:

Associations between RNA splicing regulatory variants of stemness-related genes and racial disparities in susceptibility to prostate cancer.

PubMed

Wang, Yanru; Freedman, Jennifer A; Liu, Hongliang; Moorman, Patricia G; Hyslop, Terry; George, Daniel J; Lee, Norman H; Patierno, Steven R; Wei, Qingyi

2017-08-15

Evidence suggests that cells with a stemness phenotype play a pivotal role in oncogenesis, and prostate cells exhibiting this phenotype have been identified. We used two genome-wide association study (GWAS) datasets of African descendants, from the Multiethnic/Minority Cohort Study of Diet and Cancer (MEC) and the Ghana Prostate Study, and two GWAS datasets of non-Hispanic whites, from the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial and the Breast and Prostate Cancer Cohort Consortium (BPC3), to analyze the associations between genetic variants of stemness-related genes and racial disparities in susceptibility to prostate cancer. We evaluated associations of single-nucleotide polymorphisms (SNPs) in 25 stemness-related genes with prostate cancer risk in 1,609 cases and 2,550 controls of non-Hispanic whites (4,934 SNPs) and 1,144 cases and 1,116 controls of African descendants (5,448 SNPs) with correction by false discovery rate ≤0.2. We identified 32 SNPs in five genes (TP63, ALDH1A1, WNT1, MET and EGFR) that were significantly associated with prostate cancer risk, of which six SNPs in three genes (TP63, ALDH1A1 and WNT1) and eight EGFR SNPs showed heterogeneity in susceptibility between these two racial groups. In addition, 13 SNPs in MET and one in ALDH1A1 were found only in African descendants. The in silico bioinformatics analyses revealed that EGFR rs2072454 and SNPs in linkage with the identified SNPs in MET and ALDH1A1 (r 2  > 0.6) were predicted to regulate RNA splicing. These variants may serve as novel biomarkers for racial disparities in prostate cancer risk. © 2017 UICC.

High activity Rhenium-186 HEDP with autologous peripheral blood stem cell rescue: a phase I study in progressive hormone refractory prostate cancer metastatic to bone

PubMed Central

O'Sullivan, J M; McCready, V R; Flux, G; Norman, A R; Buffa, F M; Chittenden, S; Guy, M; Pomeroy, K; Cook, G; Gadd, J; Treleaven, J; Al-Deen, A; Horwich, A; Huddart, R A; Dearnaley, D P

2002-01-01

We tested the feasibility and toxicity of high activities Rhenium-186 hydroxyethylidene diphosphonate, with peripheral blood stem cell rescue in patients with progressive hormone refractory prostate cancer metastatic to bone. Twenty-five patients received between 2500 and 5000 MBq of Rhenium-186 hydroxyethylidene diphosphonate followed 14 days later by the return of peripheral blood peripheral blood stem cells. Activity limiting toxicity was defined as grade III haematological toxicity, lasting at least 7 days, or grade IV haematological toxicity of any duration or any serious unexpected toxicity. Activity limiting toxicity occurred in two of six who received activities of 5000 MBq and maximum tolerated activity was defined at this activity level. Prostate specific antigen reductions of 50% or more lasting at least 4 weeks were seen in five of the 25 patients (20%) all of whom received more than 3500 MBq of Rhenium-186 hydroxyethylidene diphosphonate. The actuarial survival at 1 year is 54%. Administered activities of 5000 MBq of Rhenium-186 hydroxyethylidene diphosphonate are feasible using autologous peripheral blood peripheral blood stem cell rescue in patients with progressive hormone refractory prostate cancer metastatic to bone. The main toxicity is thrombocytopaenia, which is short lasting. A statistically significant activity/prostate specific antigen response was seen. We have now commenced a Phase II trial to further evaluate response rates. British Journal of Cancer (2002) 86, 1715–1720. doi:10.1038/sj.bjc.6600348 www.bjcancer.com © 2002 Cancer Research UK PMID:12087455

Developing Novel Therapeutics Targeting Undifferentiated and Castration-Resistant Prostate Cancer Stem Cells

DTIC Science & Technology

2015-10-01

LNCaP-CRPC cells expressed AR protein and its 4 targets, i.e., PSA, FKBP5, PAP (prostate alkaline phosphatase), and PSMA (prostate-specific membrane...LNCaP GAPDH FKBP5 PSA 75 - 50 - PAP AR *** 100 - 75 - AR-V7100 -75 - PSMA 100 - 250 - 150 - 37 - 25 - 50 - 36 - A B C CDSS CDSS+Bica Re lat ive m

Mitigation of arsenic-induced acquired cancer phenotype in prostate cancer stem cells by miR-143 restoration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ngalame, Ntube N.O., E-mail: ngalamenn@niehs.nih.g

Inorganic arsenic, an environmental contaminant and a human carcinogen is associated with prostate cancer. Emerging evidence suggests that cancer stem cells (CSCs) are the driving force of carcinogenesis. Chronic arsenic exposure malignantly transforms the human normal prostate stem/progenitor cell (SC) line, WPE-stem to arsenic-cancer SCs (As-CSCs), through unknown mechanisms. MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the posttranscriptional level. In prior work, miR-143 was markedly downregulated in As-CSCs, suggesting a role in arsenic-induced malignant transformation. In the present study, we investigated whether loss of miR-143 expression is important in arsenic-induced transformation of prostate SCs. Restorationmore » of miR-143 in As-CSCs was achieved by lentivirus-mediated miR-143 overexpression. Cells were assessed bi-weekly for up to 30 weeks to examine mitigation of cancer phenotype. Secreted matrix metalloproteinase (MMP) activity was increased by arsenic-induced malignant transformation, but miR-143 restoration decreased secreted MMP-2 and MMP-9 enzyme activities compared with scramble controls. Increased cell proliferation and apoptotic resistance, two hallmarks of cancer, were decreased upon miR-143 restoration. Increased apoptosis was associated with decreased BCL2 and BCL-XL expression. miR-143 restoration dysregulated the expression of SC/CSC self-renewal genes including NOTCH-1, BMI-1, OCT4 and ABCG2. The anticancer effects of miR-143 overexpression appeared to be mediated by targeting and inhibiting LIMK1 protein, and the phosphorylation of cofilin, a LIMK1 substrate. These findings clearly show that miR-143 restoration mitigated multiple cancer characteristics in the As-CSCs, suggesting a potential role in arsenic-induced transformation of prostate SCs. Thus, miR-143 is a potential biomarker and therapeutic target for arsenic-induced prostate cancer. - Highlights: • Chronic arsenic exposure malignantly transforms human prostate stem cells (SCs) to arsenic-cancer SCs via unknown mechanisms. • miR-143 was several fold downregulated in the arsenic-cancer SCs (As-CSCs), suggesting a likely role in transformation. • miR-143 restoration reduced cancer characteristics in the As-CSC, suggesting a role in arsenic-induced SC transformation. • miR-143 appears to exert its anticancer effect by inhibiting expression and activity of LIMK1, its predicted gene target. • These findings suggest miR-143 is a potential biomarker and therapeutic target for arsenic-induced prostate cancer.« less

Therapeutic Roles of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2013-10-01

KW, Suri P, Wicha MS. Hedgehog signaling and Bmi-1 regulate self- renewal of normal and malignant human mammary stem cells. Cancer Res 66:6063-71...ID, Patel S, Ahn NS, Jackson KW, Suri P, Wicha MS. Hedgehog signaling and bmi-1 regulate self-renewal of normal and malignant human mammary stem cells

Semaphorin 3 C drives epithelial-to-mesenchymal transition, invasiveness, and stem-like characteristics in prostate cells.

PubMed

Tam, Kevin J; Hui, Daniel H F; Lee, Wilson W; Dong, Mingshu; Tombe, Tabitha; Jiao, Ivy Z F; Khosravi, Shahram; Takeuchi, Ario; Peacock, James W; Ivanova, Larissa; Moskalev, Igor; Gleave, Martin E; Buttyan, Ralph; Cox, Michael E; Ong, Christopher J

2017-09-13

Prostate cancer (PCa) is among the most commonly-occurring cancers worldwide and a leader in cancer-related deaths. Local non-invasive PCa is highly treatable but limited treatment options exist for those with locally-advanced and metastatic forms of the disease underscoring the need to identify mechanisms mediating PCa progression. The semaphorins are a large grouping of membrane-associated or secreted signalling proteins whose normal roles reside in embryogenesis and neuronal development. In this context, semaphorins help establish chemotactic gradients and direct cell movement. Various semaphorin family members have been found to be up- and down-regulated in a number of cancers. One family member, Semaphorin 3 C (SEMA3C), has been implicated in prostate, breast, ovarian, gastric, lung, and pancreatic cancer as well as glioblastoma. Given SEMA3C's roles in development and its augmented expression in PCa, we hypothesized that SEMA3C promotes epithelial-to-mesenchymal transition (EMT) and stem-like phenotypes in prostate cells. In the present study we show that ectopic expression of SEMA3C in RWPE-1 promotes the upregulation of EMT and stem markers, heightened sphere-formation, and cell plasticity. In addition, we show that SEMA3C promotes migration and invasion in vitro and cell dissemination in vivo.

Microenvironment-Programmed Metastatic Prostate Cancer Stem Cells (mPCSCs)

DTIC Science & Technology

2015-10-01

osteoblastic differentiation during aging . Rejuvenation Res 2006;9:10–9. 25] Gao FB, Raff M. Cell size control and a cell-intrinsic maturation program in...self- renewing long-term tumor-propagating cells that resist castration. Cell Stem Cell 10, 556-569 (2012). 8. Rybak, A.P., Bristow, R.G., & Kapoor, A...established clinical tumor is sustained by subpopulations of self- renewing cancer cells operationally called cancer stem cells (CSC) that can generate

The Role of Retinal Determination Gene Network (RDGN) in Hormone Signaling Transduction and Prostate Tumorigenes

DTIC Science & Technology

2014-10-01

McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. The Endogenous Cell-Fate Factor Dachshund Restrains Prostate Epithelial Cell Migration via...Loro E, Pestell RG. “Inhibition of Breast Tumor Stem Cells Expansion by the Endogenous Cell Fate Determination Factor Dachshund.” Chapter in Volume

Targeting the Adipocyte-Tumor Cell Interaction in Prostate Cancer Treatment

DTIC Science & Technology

2014-10-01

cell of origin 5, it would be of great interest to further investigate whether p62 regulates mesenchymal stem cells in PCa. To start addressing this...Signaling Promotes Inflammation and Tumorigenesis. Cancer Cell 26, 121-135 (2014). 5. Uccelli, A., Moretta, L. & Pistoia, V. Mesenchymal stem cells ...chemotherapeutic approaches. Tasks 6.7. (Aim 2.3) Determine the role of adipose- stem cells (ASC). Since fibroblasts and adipocytes have the same

Prostate cancer targeting motifs: expression of αν β3, neurotensin receptor 1, prostate specific membrane antigen, and prostate stem cell antigen in human prostate cancer cell lines and xenografts.

PubMed

Taylor, Robert M; Severns, Virginia; Brown, David C; Bisoffi, Marco; Sillerud, Laurel O

2012-04-01

Membrane receptors are frequent targets of cancer therapeutic and imaging agents. However, promising in vitro results often do not translate to in vivo clinical applications. To better understand this obstacle, we measured the expression differences in receptor signatures among several human prostate cancer cell lines and xenografts as a function of tumorigenicity. Messenger RNA and protein expression levels for integrin α(ν) β(3), neurotensin receptor 1 (NTSR1), prostate specific membrane antigen (PSMA), and prostate stem cell antigen (PSCA) were measured in LNCaP, C4-2, and PC-3 human prostate cancer cell lines and in murine xenografts using quantitative reverse transcriptase polymerase chain reaction, flow cytometry, and immunohistochemistry. Stable expression patterns were observed for integrin α(ν) and PSMA in all cells and corresponding xenografts. Integrin β(3) mRNA expression was greatly reduced in C4-2 xenografts and greatly elevated in PC-3 xenografts compared with the corresponding cultured cells. NTSR1 mRNA expression was greatly elevated in LNCaP and PC-3 xenografts. PSCA mRNA expression was elevated in C4-2 xenografts when compared with C4-2 cells cultured in vitro. Furthermore, at the protein level, PSCA was re-expressed in all xenografts compared with cells in culture. The regulation of mRNA and protein expression of the cell-surface target proteins α(ν) β(3), NTSR1, PSMA, and PSCA, in prostate cancer cells with different tumorigenic potential, was influenced by factors of the microenvironment, differing between cell cultures and murine xenotransplants. Integrin α(ν) β(3), NTRS1 and PSCA mRNA expression increased with tumorigenic potential, but mRNA expression levels for these proteins do not translate directly to equivalent expression levels of membrane bound protein. Copyright © 2011 Wiley Periodicals, Inc.

Prostate Cancer Stem Cell-Targeted Efficacy of a New-Generation Taxoid, SBT-1214 and Novel Polyenolic Zinc-Binding Curcuminoid, CMC2.24

PubMed Central

Botchkina, Galina I.; Zuniga, Edison S.; Rowehl, Rebecca H.; Park, Rosa; Bhalla, Rahuldev; Bialkowska, Agnieszka B.; Johnson, Francis; Golub, Lorne M.; Zhang, Yu; Ojima, Iwao; Shroyer, Kenneth R.

2013-01-01

Background Prostate cancer is the second leading cause of cancer death among men. Multiple evidence suggests that a population of tumor-initiating, or cancer stem cells (CSCs) is responsible for cancer development and exceptional drug resistance, representing a highly important therapeutic target. The present study evaluated CSC-specific alterations induced by new-generation taxoid SBT-1214 and a novel polyenolic zinc-binding curcuminoid, CMC2.24, in prostate CSCs. Principal Findings The CD133high/CD44high phenotype was isolated from spontaneously immortalized patient-derived PPT2 cells and highly metastatic PC3MM2 cells. Weekly treatment of the NOD/SCID mice bearing PPT2- and PC3MM3-induced tumors with the SBT-1214 led to dramatic suppression of tumor growth. Four of six PPT2 and 3 of 6 PC3MM2 tumors have shown the absence of viable cells in residual tumors. In vitro, SBT-1214 (100nM-1µM; for 72 hr) induced about 60% cell death in CD133high/CD44+/high cells cultured on collagen I in stem cell medium (in contrast, the same doses of paclitaxel increased proliferation of these cells). The cytotoxic effects were increased when SBT-1214 was combined with the CMC2.24. A stem cell-specific PCR array assay revealed that this drug combination mediated massive inhibition of multiple constitutively up-regulated stem cell-related genes, including key pluripotency transcription factors. Importantly, this drug combination induced expression of p21 and p53, which were absent in CD133high/CD44high cells. Viable cells that survived this treatment regimen were no longer able to induce secondary spheroids, exhibited significant morphological abnormalities and died in 2-5 days. Conclusions We report here that the SBT-1214 alone, or in combination with CMC2.24, possesses significant activity against prostate CD133high/CD44+/high tumor-initiating cells. This drug combination efficiently inhibits expression of the majority of stem cell-related genes and pluripotency transcription factors. In addition, it induces a previously absent expression of p21 and p53 (“gene wake-up”), which can potentially reverse drug resistance by increasing sensitivity to anti-cancer drugs. PMID:24086245

miRNA-regulated cancer stem cells: understanding the property and the role of miRNA in carcinogenesis.

PubMed

Chakraborty, Chiranjib; Chin, Kok-Yong; Das, Srijit

2016-10-01

Over the last few years, microRNAs (miRNA)-controlled cancer stem cells have drawn enormous attention. Cancer stem cells are a small population of tumor cells that possess the stem cell property of self-renewal. Recent data shows that miRNA regulates this small population of stem cells. In the present review, we explained different characteristics of cancer stem cells as well as miRNA regulation of self-renewal and differentiation in cancer stem cells. We also described the migration and tumor formation. Finally, we described the different miRNAs that regulate various types of cancer stem cells, such as prostate cancer stem cells, head and neck cancer stem cells, breast cancer stem cells, colorectal cancer stem cells, lung cancer stem cells, gastric cancer stem cells, pancreatic cancer stem cells, etc. Extensive research is needed in order to employ miRNA-based therapeutics to control cancer stem cell population in various cancers in the future.

Roles for the Stem Cell–Associated Intermediate Filament Nestin in Prostate Cancer Migration and Metastasis

PubMed Central

Kleeberger, Wolfram; Bova, G. Steven; Nielsen, Matthew E.; Herawi, Mehsati; Chuang, Ai-Ying; Epstein, Jonathan I.; Berman, David M.

2011-01-01

The intermediate filament protein Nestin identifies stem/progenitor cells in adult tissues, but the function of Nestin is poorly understood. We investigated Nestin expression and function in common lethal cancers. Nestin mRNA was detected in cell lines from small cell lung, and breast cancers, and particularly elevated in cell lines derived from prostate cancer metastases. Whereas the androgen-independent lines PC3, 22RV1, and DU145 all expressed Nestin transcripts under standard culture conditions, the androgen-dependent line LnCaP expressed Nestin only on androgen withdrawal. We confirmed associations of Nestin expression, androgen withdrawal, and metastatic potential by immunohistochemical analysis of samples from 254 prostate cancer patients. Cytoplasmic Nestin protein was readily identifiable in prostate cancer cells from 75% of patients with lethal androgen-independent disease, even in cancer sampled from the prostate itself. However, Nestin expression was undetectable in localized androgen-deprived tumors and in metastases without prior androgen deprivation. To address its function, we reduced Nestin levels with short hairpin RNAs, markedly inhibiting in vitro migration and invasion in prostate cancer cells but leaving cell growth intact. Nestin knockdown also diminished metastases 5-fold compared with controls despite uncompromised tumorigenicity at the site of inoculation. These results specify a function for Nestin in cell motility and identify a novel pathway for prostate cancer metastasis. Activity of this pathway may be selected by the extraprostatic environment or, as supported by our data, may originate within the prostate after androgen deprivation. Further dissection of this novel Nestin migration pathway may lead to strategies to prevent and neutralize metastatic spread. PMID:17909025

Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression.

PubMed

Forno, Irene; Ferrero, Stefano; Russo, Maria Veronica; Gazzano, Giacomo; Giangiobbe, Sara; Montanari, Emanuele; Del Nero, Alberto; Rocco, Bernardo; Albo, Giancarlo; Languino, Lucia R; Altieri, Dario C; Vaira, Valentina; Bosari, Silvano

2015-01-01

Most men diagnosed with prostate cancer will have an indolent and curable disease, whereas approximately 15% of these patients will rapidly progress to a castrate-resistant and metastatic stage with high morbidity and mortality. Therefore, the identification of molecular signature(s) that detect men at risk of progressing disease remains a pressing and still unmet need for these patients. Here, we used an integrated discovery platform combining prostate cancer cell lines, a Transgenic Adenocarcinoma of the Mouse Prostate (TRAMP) model and clinically-annotated human tissue samples to identify loss of expression of microRNA-34b as consistently associated with prostate cancer relapse. Mechanistically, this was associated with epigenetics silencing of the MIR34B/C locus and increased DNA copy number loss, selectively in androgen-dependent prostate cancer. In turn, loss of miR-34b resulted in downstream deregulation and overexpression of the "stemness" marker, Sox2. These findings identify loss of miR-34b as a robust biomarker for prostate cancer progression in androgen-sensitive tumors, and anticipate a potential role of progenitor/stem cell signaling in this stage of disease.

Reducing Toxicity of Radiation Treatment of Advanced Prostate Cancer

DTIC Science & Technology

2015-10-01

steady state hematopoiesis with normalization of the frequency of hematopoietic stem and progenitor cells. Moreover, hematopoietic stem cells from RTA...ongoing. 7 KEY RESEARCH ACCOMPLISHMENTS: • Identified radiation protection of different organ systems (GI tract, skin and hematopoiesis ) by RTA

BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

PubMed Central

Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

2016-01-01

Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

Secreted factors from metastatic prostate cancer cells stimulate mesenchymal stem cell transition to a pro-tumourigenic 'activated' state that enhances prostate cancer cell migration.

PubMed

Ridge, Sarah M; Bhattacharyya, Dibyangana; Dervan, Eoin; Naicker, Serika D; Burke, Amy J; Murphy, J M; O'leary, Karen; Greene, John; Ryan, Aideen E; Sullivan, Francis J; Glynn, Sharon A

2018-05-15

Mesenchymal stem cells (MSCs) are a heterogeneous population of multipotent cells that are capable of differentiating into osteocytes, chondrocytes and adipocytes. Recently, MSCs have been found to home to the tumour site and engraft in the tumour stroma. However, it is not yet known whether they have a tumour promoting or suppressive function. We investigated the interaction between prostate cancer cell lines 22Rv1, DU145 and PC3, and bone marrow-derived MSCs. MSCs were 'educated' for extended periods in prostate cancer cell conditioned media and PC3-educated MSCs were found to be the most responsive with a secretory profile rich in pro-inflammatory cytokines. PC3-educated MSCs secreted increased osteopontin (OPN), interleukin-8 (IL-8) and fibroblast growth factor-2 (FGF-2) and decreased soluble fms-like tyrosine kinase-1 (sFlt-1) compared to untreated MSCs. PC3-educated MSCs showed a reduced migration and proliferation capacity that was dependent on exposure to PC3-conditioned medium. Vimentin and α-smooth muscle actin (αSMA) expression was decreased in PC3-educated MSCs compared to untreated MSCs. PC3 and DU145 education of healthy donor and prostate cancer patient-derived MSCs led to a reduced proportion of FAP+ αSMA+ cells contrary to characteristics commonly associated with cancer associated fibroblasts (CAFs). The migration of PC3 cells was increased toward both PC3-educated and DU145-educated MSCs compared to untreated MSCs, while DU145 migration was only enhanced toward patient-derived MSCs. In summary, MSCs developed an altered phenotype in response to prostate cancer conditioned medium which resulted in increased secretion of pro-inflammatory cytokines, modified functional activity and the chemoattraction of prostate cancer cells. © 2017 UICC.

Enrichment of putative prostate cancer stem cells after androgen deprivation: upregulation of pluripotency transactivators concurs with resistance to androgen deprivation in LNCaP cell lines.

PubMed

Seiler, Daniel; Zheng, Junying; Liu, Gentao; Wang, Shunyou; Yamashiro, Joyce; Reiter, Robert E; Huang, Jiaoti; Zeng, Gang

2013-09-01

Prostate cancer stem cells (PCSC) offer theoretical explanations to many clinical and biological behaviors of the disease in human. In contrast to approaches of using side populations and cell-surface markers to isolate and characterize the putative PCSC, we hypothesize that androgen deprivation leads to functional enrichment of putative PCSC. Human prostate cancer lines LNCaP, LAPC4 and LAPC9 were depleted of androgen in cell cultures and in castrated SCID mice. The resultant androgen deprivation-resistant or castration-resistant populations, in particular in LNCaP and its derivative cell lines, displayed increased expression of pluripotency transactivators and significantly higher tumorigenicity. Individual tumor cell clones were isolated from castration-resistant bulk cultures of LNCaP (CR-LNCaP) and tested for tumorigenicity in male SCID mice under limiting dilution conditions. As few as 200 cells were able to form spheres in vitro, and generate tumors with similar growth kinetics as 10(6) LNCaP or 10(4) CR-LNCaP cells in vivo. These putative PCSC were CD44(+) /CD24(-) and lack the expression of prostate lineage proteins. When transplanted into the prostate of an intact male SCID mouse, these putative PCSC seemed to show limited differentiation into Ck5(+) , Ck8(+) , Ck5(+) /Ck8(+) , and AR(+) cells. On the other hand, stable transduction of LNCaP with retrovirus encoding Sox2 led to androgen-deprivation resistant growth and down-regulation of major prostate lineage gene products in vitro. Concurrence of overexpression of pluripotency transactivators and resistance to androgen deprivation supported the role of putative PCSC in the emergence of prostate cancer resistant to androgen deprivation. © 2013 Wiley Periodicals, Inc.

Engineered T cells for pancreatic cancer treatment

PubMed Central

Katari, Usha L; Keirnan, Jacqueline M; Worth, Anna C; Hodges, Sally E; Leen, Ann M; Fisher, William E; Vera, Juan F

2011-01-01

Objective Conventional chemotherapy and radiotherapy produce marginal survival benefits in pancreatic cancer, underscoring the need for novel therapies. The aim of this study is to develop an adoptive T cell transfer approach to target tumours expressing prostate stem cell antigen (PSCA), a tumour-associated antigen that is frequently expressed by pancreatic cancer cells. Methods Expression of PSCA on cell lines and primary tumour samples was confirmed by immunohistochemistry. Healthy donor- and patient-derived T cells were isolated, activated in vitro using CD3/CD28, and transduced with a retroviral vector encoding a chimeric antigen receptor (CAR) targeting PSCA. The ability of these cells to kill tumour cells was analysed by chromium-51 (Cr51) release. Results Prostate stem cell antigen was expressed on >70% of the primary tumour samples screened. Activated, CAR-modified T cells could be readily generated in clinically relevant numbers and were specifically able to kill PSCA-expressing pancreatic cancer cell lines with no non-specific killing of PSCA-negative target cells, thus indicating the potential efficacy and safety of this approach. Conclusions Prostate stem cell antigen is frequently expressed on pancreatic cancer cells and can be targeted for immune-mediated destruction using CAR-modified, adoptively transferred T cells. The safety and efficacy of this approach indicate that it deserves further study and may represent a promising novel treatment for patients with pancreatic cancer. PMID:21843265

Defined Conditions for the Isolation and Expansion of Basal Prostate Progenitor Cells of Mouse and Human Origin

PubMed Central

Höfner, Thomas; Eisen, Christian; Klein, Corinna; Rigo-Watermeier, Teresa; Goeppinger, Stephan M.; Jauch, Anna; Schoell, Brigitte; Vogel, Vanessa; Noll, Elisa; Weichert, Wilko; Baccelli, Irène; Schillert, Anja; Wagner, Steve; Pahernik, Sascha; Sprick, Martin R.; Trumpp, Andreas

2015-01-01

Summary Methods to isolate and culture primary prostate epithelial stem/progenitor cells (PESCs) have proven difficult and ineffective. Here, we present a method to grow and expand both murine and human basal PESCs long term in serum- and feeder-free conditions. The method enriches for adherent mouse basal PESCs with a Lin−SCA-1+CD49f+TROP2high phenotype. Progesterone and sodium selenite are additionally required for the growth of human Lin−CD49f+TROP2high PESCs. The gene-expression profiles of expanded basal PESCs show similarities to ESCs, and NF-kB function is critical for epithelial differentiation of sphere-cultured PESCs. When transplanted in combination with urogenital sinus mesenchyme, expanded mouse and human PESCs generate ectopic prostatic tubules, demonstrating their stem cell activity in vivo. This novel method will facilitate the molecular, genomic, and functional characterization of normal and pathologic prostate glands of mouse and human origin. PMID:25702639

Quantification of Mesenchymal Stem Cells (MSCs) at sites of human prostate cancer.

PubMed

Brennen, W Nathaniel; Chen, Shuangling; Denmeade, Samuel R; Isaacs, John T

2013-01-01

Circulating bone marrow-derived Mesenchymal Stem Cells (BM-MSCs) have an innate tropism for tumor tissue in response to the inflammatory microenvironment present in malignant lesions. The prostate is bombarded by numerous infectious and inflammatory insults over a lifetime. Chronic inflammation is associated with CXCL12, CCL5, and CCL2, which are highly overexpressed in prostate cancer. Among other cell types, these chemoattractant stimuli recruit BM-MSCs to the tumor. MSCs are minimally defined as plastic-adhering cells characterized by the expression of CD90, CD73, and CD105 in the absence of hematopoietic markers, which can differentiate into osteoblasts, chondrocytes, and adipocytes. MSCs are immunoprivileged and have been implicated in tumorigenesis through multiple mechanisms, including promoting proliferation, angiogenesis, and metastasis, in addition to the generation of an immunosuppressive microenvironment. We have demonstrated that MSCs represent 0.01-1.1% of the total cells present in core biopsies from primary human prostatectomies. Importantly, these analyses were performed on samples prior to expansion in tissue culture. MSCs in these prostatectomy samples are FAP-, CD90-, CD73-, and CD105-positive, and CD14-, CD20-, CD34-, CD45-, and HLA-DR-negative. Additionally, like BM-MSCs, these prostate cancer-derived stromal cells (PrCSCs) were shown to differentiate into osteoblasts, adipocytes and chondrocytes. In contrast to primary prostate cancer-derived epithelial cells, fluorescently-labeled PrCSCs and BM-MSCs were both shown to home to CWR22RH prostate cancer xenografts following IV injection. These studies demonstrate that not only are MSCs present in sites of prostate cancer where they may contribute to carcinogenesis, but these cells may also potentially be used to deliver cytotoxic or imaging agents for therapeutic and/or diagnostic purposes.

Genetically engineered oncolytic Newcastle disease virus mediates cytolysis of prostate cancer stem like cells.

PubMed

Raghunath, Shobana; Pudupakam, Raghavendra Sumanth; Allen, Adria; Biswas, Moanaro; Sriranganathan, Nammalwar

2017-10-20

Oncolytic virotherapy is a promising novel approach that overcomes the limitations posed by radiation and chemotherapy. In this study, the oncolytic efficacy of a recombinant Newcastle disease virus (rNDV) BC-KLQL-GFP, against prostate cancer stem-like/tumor initiating cells was evaluated. Xenograft derived prostaspheres (XPS) induced tumor more efficiently than monolayer cell derived prostaspheres (MCPS) in nude mice. Primary and secondary XPS show enhanced self-renewal and clonogenic potential compared to MCPS. XPS also expressed embryonic stem cell markers, such as Nanog, CD44 and Nestin. Further, prostate specific antigen (PSA) activated recombinant Newcastle Disease Virus (rNDV) was selectively cytotoxic to tumor derived DU145 prostaspheres. An effective concentration (EC 50 ) of 0.11-0.14 multiplicity of infection was sufficient to cause prostasphere cell death in serum free culture. DU145 tumor xenograft derived prostaspheres were used as tumor surrogates as they were enriched for a putative tumor initiating cell population. PSA activated rNDV was efficient in inducing cell death of cells and prostaspheres derived from primary xenografts ex-vivo, thus signifying a potential in vivo efficacy. The EC 50 (∼0.1 MOI) for cytolysis of tumor initiating cells was slightly higher than that was required for the parental cell line, but within the therapeutic margin for safety and efficacy. Copyright © 2017 Elsevier B.V. All rights reserved.

CRISPR/Cas9-mediated gene knockout of NANOG and NANOGP8 decreases the malignant potential of prostate cancer cells.

PubMed

Kawamura, Norihiko; Nimura, Keisuke; Nagano, Hiromichi; Yamaguchi, Sohei; Nonomura, Norio; Kaneda, Yasufumi

2015-09-08

NANOG expression in prostate cancer is highly correlated with cancer stem cell characteristics and resistance to androgen deprivation. However, it is not clear whether NANOG or its pseudogenes contribute to the malignant potential of cancer. We established NANOG- and NANOGP8-knockout DU145 prostate cancer cell lines using the CRISPR/Cas9 system. Knockouts of NANOG and NANOGP8 significantly attenuated malignant potential, including sphere formation, anchorage-independent growth, migration capability, and drug resistance, compared to parental DU145 cells. NANOG and NANOGP8 knockout did not inhibit in vitro cell proliferation, but in vivo tumorigenic potential decreased significantly. These phenotypes were recovered in NANOG- and NANOGP8-rescued cell lines. These results indicate that NANOG and NANOGP8 proteins are expressed in prostate cancer cell lines, and NANOG and NANOGP8 equally contribute to the high malignant potential of prostate cancer.

Zoledronic acid overcomes chemoresistance by sensitizing cancer stem cells to apoptosis.

PubMed

Rouhrazi, H; Turgan, N; Oktem, G

2018-01-01

Unlike low tumorigenic bulk tumor cells (non-CSCs), cancer stem cells (CSCs) are a subset of tumor cells that can self-renew and differentiate into different cancer subtypes. CSCs are considered responsible for tumor recurrence, distant metastasis, angiogenesis, and drug or radiation resistance. CSCs also are resistant to apoptosis. Zoledronic acid (ZA) is a third generation bisphosphonate that reduces cell proliferation and exhibits anti-tumor effects by inducing cell death in some malignancies; however, the effects of ZA on CSCs are unclear. We investigated the anti-cancer effects of ZA on two epithelial cancer cell lines, prostate DU-145 and breast MCF7, focusing primarily on induction and activation of apoptosis. Cluster of differentiation (CD) 133 + /CD44 + prostate CSCs and CD 44 + /CD24 breast CSCs were isolated from the DU-145 human prostate cancer and MCF-7 human breast cancer cell lines, respectively, using FACSAria flow cytometry cell sorting. CSCs and non-CSCs were exposed to increasing concentrations of ZA for 24, 48 and 72 h to determine the IC 50 dose. Annexin-V assay for detecting cell death and cell cycle was performed using the Muse™ Cell Analyzer. Prostate CSCs and non-CSCs were assayed by quantitative reverse transcription PCR (qRT-PCR) array for detecting 84 key apoptosis related genes. Gene regulation at the protein level was investigated by immunofluorescence. ZA caused a dose- and time-dependent decrease in cell viability. Treatment with ZA resulted in a concomitant increase in apoptosis and cell cycle arrest at S-phase in CSCs. Significant over/under-expressions were detected in seven of the genes of ZA-treated DU-145 CSCs cells. Expressions of CASP9, CASP4, BAX and BAD genes increased, while the expressions of BIRC3, BIRC2 and BCL2 genes decreased. In the DU-145 non-CSCs, five genes exhibited changes in gene expression after ZA treatment, two exhibited increased expression (CASP7 and BAD) and three exhibited decreased expression (BIRC3, BIRC2 and BCL2). ZA caused cell death of drug resistant breast MCF-7 and prostate DU-145 cancer stem cells by activating apoptosis. ZA can facilitate the intrinsic pathway of apoptosis in human prostate CSCs by down-regulating anti-apoptotic genes and up-regulating pro-apoptotic genes. ZA may be an effective therapeutic agent for targeting chemoresistance in CSCs.

The pluripotency factor Nanog is directly upregulated by the androgen receptor in prostate cancer cells.

PubMed

Kregel, Steven; Szmulewitz, Russell Z; Vander Griend, Donald J

2014-11-01

The Androgen Receptor (AR) is a nuclear hormone receptor that functions as a critical oncogene in all stages of prostate cancer progression, including progression to castration-resistance following androgen-deprivation therapy. Thus, identifying and targeting critical AR-regulated genes is one potential method to block castration-resistant cancer proliferation. Of particular importance are transcription factors that regulate stem cell pluripotency; many of these genes are emerging as critical oncogenes in numerous tumor cell types. Of these, Nanog has been previously shown to increase the self-renewal and stem-like properties of prostate cancer cells. Thus, we hypothesized that Nanog is a candidate AR target gene that may impart castration-resistance. We modulated AR signaling in LNCaP prostate cancer cells and assayed for Nanog expression. Direct AR binding to the NANOG promoter was tested using AR Chromatin Immunoprecipation (ChIP) and analyses of publically available AR ChIP-sequencing data-sets. Nanog over-expressing cells were analyzed for cell growth and cytotoxicity in response to the AR antagonist enzalutamide and the microtubule stabilizing agent docetaxel. AR signaling upregulates Nanog mRNA and protein. AR binds directly to the NANOG promoter, and was not identified within 75 kb of the NANOGP8 pseudogene, suggesting the NANOG gene locus was preferentially activated. Nanog overexpression in LNCaP cells increases overall growth, but does not increase resistance to enzalutamide or docetaxel. Nanog is a novel oncogenic AR target gene in prostate cancer cells, and stable expression of Nanog increases proliferation and growth of prostate cancer cells, but not resistance to enzalutamide or docetaxel. © 2014 Wiley Periodicals, Inc.

Simultaneous targeting of prostate stem cell antigen and prostate-specific membrane antigen improves the killing of prostate cancer cells using a novel modular T cell-retargeting system.

PubMed

Arndt, Claudia; Feldmann, Anja; Koristka, Stefanie; Cartellieri, Marc; Dimmel, Maria; Ehninger, Armin; Ehninger, Gerhard; Bachmann, Michael

2014-09-01

Recently, we described a novel modular platform technology in which T cell-recruitment and tumor-targeting domains of conventional bispecific antibodies are split to independent components, a universal effector module (EM) and replaceable monospecific/monovalent target modules (TMs) that form highly efficient T cell-retargeting complexes. Theoretically, our unique strategy should allow us to simultaneously retarget T cells to different tumor antigens by combining the EM with two or more different monovalent/monospecific TMs or even with bivalent/bispecific TMs, thereby overcoming limitations of a monospecific treatment such as the selection of target-negative tumor escape variants. In order to advance our recently introduced prostate stem cell antigen (PSCA)-specific modular system for a dual-targeting of prostate cancer cells, two additional TMs were constructed: a monovalent/monospecific TM directed against the prostate-specific membrane antigen (PSMA) and a bivalent/bispecific TM (bsTM) with specificity for PSMA and PSCA. The functionality of the novel dual-targeting strategies was analyzed by performing T cell activation and chromium release assays. Similar to the PSCA-specific modular system, the novel PSMA-specific modular system mediates an efficient target-dependent and -specific tumor cell lysis at low E:T ratios and picomolar Ab concentrations. Moreover, by combination of the EM with either the bispecific TM directed to PSMA and PSCA or both monospecifc TMs directed to either PSCA or PSMA, dual-specific targeting complexes were formed which allowed us to kill potential escape variants expressing only one or the other target antigen. Overall, the novel modular system represents a promising tool for multiple tumor targeting. © 2014 Wiley Periodicals, Inc.

Endocrine Disruption and Human Prostate Cancer

DTIC Science & Technology

2008-03-01

decades in men . Briefly we use rodent stroma to create a niche in which human stem cells are directed to become human prostatic epithelia. Task 1 sought to...we used our model system to study human prostate development and maturation over 8-12 weeks, comparable to the process that takes decades in men ...was 100%. The early onset of prostatitis, is comparable to the onset of non-bacterial early-onset prostatitis in younger men , and implicates the EDC

Isolation and Characterization of Prostate Cancer Stem Cells

DTIC Science & Technology

2013-10-01

et al. Targeting cancer stem cells by inhibiting Wnt, Notch, and Hedgehog pathways. Nat Rev Clin Oncol 2011;8:97–106. 26] Guise T. Examining the...Nitrogen or fixed in formalin and paraffin-embedded to evaluate anatomy and glandular architecture. The remainder of the tissue was mechan- ically and

Co-Expression of Putative Cancer Stem Cell Markers CD44 and CD133 in Prostate Carcinomas.

PubMed

Kalantari, Elham; Asgari, Mojgan; Nikpanah, Seyedehmoozhan; Salarieh, Naghme; Asadi Lari, Mohammad Hossein; Madjd, Zahra

2017-10-01

Cancer stem cells (CSCs) are the main players of prostate tumorigenesis thus; characterization of CSCs can pave the way for understanding the early detection, drug resistance, metastasis and relapse. The current study was conducted to evaluate the expression level and clinical significance of the potential CSC markers CD44 and CD133 in a series of prostate tissues. One hundred and forty eight prostate tissues composed of prostate cancer (PCa), high-grade prostatic intraepithelial neoplasia (HGPIN), and benign prostate hyperplasia (BPH) were immunostained for the putative CSC markers CD44 and CD133. Subsequently, the correlation between the expression of these markers and the clinicopathological variables was examined. A higher level of CD44 expression was observed in 42% of PCa, 57% of HGPIN, and 42% BPH tissues. In the case of CD133 expression PCa, HGPIN, and BPH samples demonstrated high immunoreactivity in 46%, 43%, and 42% of cells, respectively. Statistical analysis showed an inverse significant correlation between CD44 expression with Gleason score of PCa (P = 0.02), while no significant correlation was observed between CD133 expression and clinicopathological parameters. A significant reciprocal correlation was observed between the expression of two putative CSC markers CD44 and CD133 in PCa specimens while not indicating clinical significance. Further clinical investigation is required to consider these markers as targets of new therapeutic strategies for PCa.

Smooth muscle cell-specific knockout of androgen receptor: a new model for prostatic disease.

PubMed

Welsh, Michelle; Moffat, Lindsey; McNeilly, Alan; Brownstein, David; Saunders, Philippa T K; Sharpe, Richard M; Smith, Lee B

2011-09-01

Androgen-driven stromal-epithelial interactions play a key role in normal prostate development and function as well as in the progression of common prostatic diseases such as benign prostatic hyperplasia and prostate cancer. However, exactly how, and via which cell type, androgens mediate their effects in the adult prostate remains unclear. This study investigated the role for smooth muscle (SM) androgen signaling in normal adult prostate homeostasis and function using mice in which androgen receptor was selectively ablated from prostatic SM cells. In adulthood the knockout (KO) mice displayed a 44% reduction in prostate weight and exhibited histological abnormalities such as hyperplasia, inflammation, fibrosis, and reduced expression of epithelial, SM, and stem cell identify markers (e.g. p63 reduced by 27% and Pten by 31%). These changes emerged beyond puberty and were not explained by changes in serum hormones. Furthermore, in response to exogenous estradiol, adult KO mice displayed an 8.5-fold greater increase in prostate weight than controls and developed urinary retention. KO mice also demonstrated a reduced response to castration compared with controls. Together these results demonstrate that prostate SM cells are vital in mediating androgen-driven stromal-epithelial interactions in adult mouse prostates, determining cell identity and function and limiting hormone-dependent epithelial cell proliferation. This novel mouse model provides new insight into the possible role for SM androgen action in prostate disease.

ZEB1-mediated vasculogenic mimicry formation associates with epithelial-mesenchymal transition and cancer stem cell phenotypes in prostate cancer.

PubMed

Wang, Hua; Huang, Bin; Li, Bai Mou; Cao, Kai Yuan; Mo, Chen Qiang; Jiang, Shuang Jian; Pan, Jin Cheng; Wang, Zong Ren; Lin, Huan Yi; Wang, Dao Hu; Qiu, Shao Peng

2018-05-12

The zinc finger E-box-binding homeobox 1 (ZEB1) induced the epithelial-mesenchymal transition (EMT) and altered ZEB1 expression could lead to aggressive and cancer stem cell (CSC) phenotypes in various cancers. Tissue specimens from 96 prostate cancer patients were collected for immunohistochemistry and CD34/periodic acid-Schiff double staining. Prostate cancer cells were subjected to ZEB1 knockdown or overexpression and assessment of the effects on vasculogenic mimicry formation in vitro and in vivo. The underlying molecular events of ZEB1-induced vasculogenic mimicry formation in prostate cancer were then explored. The data showed that the presence of VM and high ZEB1 expression was associated with higher Gleason score, TNM stage, and lymph node and distant metastases as well as with the expression of vimentin and CD133 in prostate cancer tissues. Furthermore, ZEB1 was required for VM formation and altered expression of EMT-related and CSC-associated proteins in prostate cancer cells in vitro and in vivo. ZEB1 also facilitated tumour cell migration, invasion and clonogenicity. In addition, the effects of ZEB1 in prostate cancer cells were mediated by Src signalling; that is PP2, a specific inhibitor of the Src signalling, dose dependently reduced the p-Src 527 level but not p-Src 416 level, while ZEB1 knockdown also down-regulated the level of p-Src 527 in PC3 and DU-145 cells. PP2 treatment also significantly reduced the expression of VE-cadherin, vimentin and CD133 in these prostate cancer cells. Src signalling mediated the effects of ZEB1 on VM formation and gene expression. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Genetic variant as a marker for bladder cancer therapy

Cancer.gov

Patients who have inherited a specific common genetic variant develop bladder cancer tumors that strongly express a protein known as prostate stem cell antigen (PSCA), which is also expressed in many pancreatic and prostate tumors, according to research a

Keratin 13 expression reprograms bone and brain metastases of human prostate cancer cells.

PubMed

Li, Qinlong; Yin, Lijuan; Jones, Lawrence W; Chu, Gina C-Y; Wu, Jason B-Y; Huang, Jen-Ming; Li, Quanlin; You, Sungyong; Kim, Jayoung; Lu, Yi-Tsung; Mrdenovic, Stefan; Wang, Ruoxiang; Freeman, Michael R; Garraway, Isla; Lewis, Michael S; Chung, Leland W K; Zhau, Haiyen E

2016-12-20

Lethal progression of prostate cancer metastasis can be improved by developing animal models that recapitulate the clinical conditions. We report here that cytokeratin 13 (KRT13), an intermediate filament protein, plays a directive role in prostate cancer bone, brain, and soft tissue metastases. KRT13 expression was elevated in bone, brain, and soft tissue metastatic prostate cancer cell lines and in primary and metastatic clinical prostate, lung, and breast cancer specimens. When KRT13 expression was determined at a single cell level in primary tumor tissues of 44 prostate cancer cases, KRT13 level predicted bone metastasis and the overall survival of prostate cancer patients. Genetically enforced KRT13 expression in human prostate cancer cell lines drove metastases toward mouse bone, brain and soft tissues through a RANKL-independent mechanism, as KRT13 altered the expression of genes associated with EMT, stemness, neuroendocrine/neuromimicry, osteomimicry, development, and extracellular matrices, but not receptor activator NF-κB ligand (RANKL) signaling networks in prostate cancer cells. Our results suggest new inhibitors targeting RANKL-independent pathways should be developed for the treatment of prostate cancer bone and soft tissue metastases.

Sca-1 Identifies a Distinct Androgen-Independent Murine Prostatic Luminal Cell Lineage with Bipotent Potential

PubMed Central

Kwon, Oh-Joon; Zhang, Li; Xin, Li

2016-01-01

Recent lineage tracing studies support the existence of prostate luminal progenitors that possess extensive regenerative capacity, but their identity remains unknown. We show that Sca-1 (Stem Cell Antigen-1) identifies a small population of murine prostate luminal cells that reside in the proximal prostatic ducts adjacent to the urethra. Sca-1+ luminal cells do not express Nkx3.1. They do not carry the secretory function, although they express the androgen receptor. These cells are enriched in the prostates of castrated mice. In the in vitro prostate organoid assay, a small fraction of the Sca-1+ luminal cells are capable of generating budding organoids that are morphologically distinct from those derived from other cell lineages. Histologically, this type of organoid is composed of multiple inner layers of luminal cells surrounded by multiple outer layers of basal cells. When passaged, these organoids retain their morphological and histological features. Finally, the Sca-1+ luminal cells are capable of forming small prostate glands containing both basal and luminal cells in an in vivo prostate regeneration assay. Collectively, our study establishes the androgen-independent and bipotent organoid-forming Sca-1+ luminal cells as a functionally distinct cellular entity. These cells may represent a putative luminal progenitor population and serve as a cellular origin for castration resistant prostate cancer. PMID:26418304

Chemical Suppression of the Reactivated Androgen Signaling Pathway in Androgen-Independent Prostate Cancer

DTIC Science & Technology

2011-07-01

when it is ingested during pregnancy [20,21]. Aside from its role in development, Hh signaling also supports stem cells in adult tissues [22-24]. However...For the mo.~t commonly uti - lized human prostate cancer cell lines (LNCaP and derivatives, DUI45, PC3 or CWR22rvl) grown in culture, Shh, Glil/2 and

Expression of the gastrin-releasing peptide receptor, the prostate stem cell antigen and the prostate-specific membrane antigen in lymph node and bone metastases of prostate cancer.

PubMed

Ananias, Hildo J K; van den Heuvel, Marius C; Helfrich, Wijnand; de Jong, Igle J

2009-07-01

Cell membrane antigens like the gastrin-releasing peptide receptor (GRPR), the prostate stem cell antigen (PSCA), and the prostate-specific membrane antigen (PSMA), expressed in prostate cancer, are attractive targets for new therapeutic and diagnostic applications. Therefore, we investigated in this study whether these antigens are expressed in metastasized prostate cancer. Formalin-fixed, paraffin-embedded specimens of 15 patients with uni- or bilateral lymph node metastases of prostate cancer (totaling 21 cases) and 17 patient-cases of bone metastases were processed for immunohistochemistry with anti-GRPR, anti-PSCA, and anti-PSMA antibodies. A pathologist blinded to clinical and pathological data scored the immunoreactivity for these antibodies on a four-point scale (0 = no staining; 1+ = weak staining; 2+ = moderate staining; 3+ = strong staining) and documented the distribution pattern. GRPR staining in lymph node metastases was seen in 85.7% of cases (18 of 21 cases), PSCA in 95.2% (20/21), and PSMA in 100% (21/21). GRPR in bone metastases was seen in 52.9% of cases (9/17), PSCA in 94.1% (16/17), and PSMA in 100% (17/17). We have shown for the first time that GRPR is expressed in the vast majority of lymph node metastases and in 52.9% of bone metastases of prostate cancer. PSCA and PSMA are both highly expressed in lymph node and bone metastases. Although PSCA and PSMA are mostly expressed in prostate cancer metastases, GRPR offers an interesting alternative target as it can be targeted relatively easy with peptide-based (radio)pharmaceuticals. (c) 2009 Wiley-Liss, Inc.

Epithelial-to-mesenchymal transition and estrogen receptor α mediated epithelial dedifferentiation mark the development of benign prostatic hyperplasia.

PubMed

Shao, Rui; Shi, Jiandang; Liu, Haitao; Shi, Xiaoyu; Du, Xiaoling; Klocker, Helmut; Lee, Chung; Zhu, Yan; Zhang, Ju

2014-06-01

Epithelial-to-mesenchymal transition (EMT) has been reported involved in the pathogenesis of fibrotic disorders and associated with stemness characteristics. Recent studies demonstrated that human benign prostatic hyperplasia (BPH) development involves accumulation of mesenchymal-like cells derived from the prostatic epithelium. However, the inductive factors of EMT in the adult prostate and the cause-and-effect relationship between EMT and stemness characteristics are not yet resolved. EMT expression patterns were immunohistochemically identified in the human epithelia of normal/BPH prostate tissue and in a rat BPH model induced by estrogen/androgen (E2/T, ratio 1:100) alone or in the presence of the ER antagonist raloxifene. Gene expression profiles were analyzed in micro-dissected prostatic epithelia of rat stimulated by E2/T for 3 days. Two main morphological features both accompanied with EMT were observed in the epithelia of human BPH. Luminal cells undergoing EMT dedifferentiated from a cytokeratin (CK) CK18(+) /CK8(+) /CK19(+) to a CK18(-) /CK8(+) /CK19(-) phenotype and CK14 expression increased in basal epithelial cells. ERα expression was closely related to these dedifferentiated cells and the expression of EMT markers. A similar pattern of EMT events was observed in the E2/T induced rat model of BPH in comparison to the prostates of untreated rats, which could be prevented by raloxifene. Epithelial and mesenchymal phenotype switching is an important mechanism in the etiology of BPH. ERα mediated enhanced estrogenic effect is a crucial inductive factor of epithelial dedifferentiation giving rise to activation of an EMT program in prostate epithelium. © 2014 Wiley Periodicals, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, K

Purpose: Most prostate cancers are slow-growing diseases but normally require much higher doses (80Gy) with conventional fractionation radiotherapy, comparing to other more aggressive cancers. This study is to disclose the radiobiological basis of this discrepancy by proposing the concept of prostate cancer stem cells (CSCs) and examining their specific irradiation responses. Methods: There are overwhelming evidences that CSC may keep their stemness, e.g. the competency of cell differentiation, in hypoxic microenvironments and hence become radiation resistive, though the probability is tiny for aggressiveness cancers. Tumor hypoxia used to be considered as an independent reason for poor treatment outcomes, and recentmore » evidences showed that even prostate cancers were also hypoxic though they are very slow-growing. In addition, to achieve comparable outcomes to other much more aggressive cancers, much higher doses (rather than lower doses) are always needed for prostate cancers, regardless of its non-aggressiveness. All these abnormal facts can only be possibly interpreted by the irradiation responses characteristics of prostate CSCs. Results: Both normal cancer cells (NCCs) and CSCs exiting in tumors, in which NCCs are mainly for symptoms whereas killing all CSCs achieves disease-free. Since prostate cancers are slow-growing, the hypoxia in prostate cancers cannot possibly from NCCs, thus it is caused by hypoxic CSCs. However, single hypoxic cell cannot be imaged due to limitation of imaging techniques, unless a large group of hypoxic cells exist together, thus most of CSCs in prostate cancers are virtually hypoxic, i.e. not in working mode because CSCs in proliferating mode have to be normoxic, and this explains why prostate cancers are unaggressive. Conclusion: The fractional dose in conventional radiotherapy (∼2Gy) could only kill NCCs and CSCs in proliferating modes, whereas most CSCs survived fractional treatments since they were hypoxic, thus to eliminate all CSCs and achieve disease-free, much more fractionations are needed.« less

Recruitment of Mesenchymal Stem Cells Into Prostate Tumors Promotes Metastasis

PubMed Central

Jung, Younghun; Kim, Jin Koo; Shiozawa, Yusuke; Wang, Jingcheng; Mishra, Anjali; Joseph, Jeena; Berry, Janice E.; McGee, Samantha; Lee, Eunsohl; Sun, Hongli; Wang, Jianhua; Jin, Taocong; Zhang, Honglai; Dai, Jinlu; Krebsbach, Paul H.; Keller, Evan T.; Pienta, Kenneth J.; Taichman, Russell S.

2013-01-01

Tumors recruit mesenchymal stem cells (MSCs) to facilitate healing, which induces their conversion into cancer-associated fibroblasts that facilitate metastasis. However, this process is poorly understood on the molecular level. Here we show that the CXCR6 ligand CXCL16 facilitates MSC or Very Small Embryonic-Like (VSEL) cells recruitment into prostate tumors. CXCR6 signaling stimulates the conversion of MSCs into cancer-associated fibroblasts, which secrete stromal-derived factor-1, also known as CXCL12. CXCL12 expressed by cancer-associated fibroblasts then binds to CXCR4 on tumor cells and induces an epithelial to mesenchymal transition, which ultimately promotes metastasis to secondary tumor sites. Our results provide the molecular basis for MSC recruitment into tumors and how this process leads to tumor metastasis. PMID:23653207

Prostate stem cell antigen (PSCA) mRNA expression in peripheral blood in patients with benign prostatic hyperplasia and/or prostate cancer.

PubMed

Fawzy, Mohamed S; Mohamed, Randa H; Elfayoumi, Abdel-Rahman R

2015-03-01

The aim of this study was to determine whether detection of prostate stem cell antigen (PSCA) expression in BPH might be associated with the subsequent presence of Prostate cancer (PCa) and also to determine whether detection of PSCA expression has potential for prognosis in PCa. This study was comprised of 112 PCa patients, 111 BPH patients and 120 control subjects. We employed reverse-transcriptase polymerase chain reaction (RT-PCR) to detect PSCA mRNA-bearing cells in peripheral blood. PSCA mRNA was detected in the peripheral blood of 71.4% PCa patients and in 13.5% of patients with BPH by RT-PCR. PSCA was positive in 80% of high-grade diseases compared with 20% of low-grade diseases (P = 0.01). Whereas only 38.8% of prostate-confined diseases were PSCA positive, 61.2% of extraprostatic diseases were PSCA positive (P < 0.001). Patients with a lymphovascular invasion of tumor emboli tended to be PSCA positive (P = 0.02). BPH patients with RT-PCR PSCA positive were significantly more likely to develop prostate cancer (OR = 16, 95% CI = 8.1-31.6, P < 0.001). In conclusion, RT-PCR PSCA positivity is significantly associated with the Gleason score, LV tumor emboli and whether or not the tumor was organ confined. In this study, RT-PCR PSCA detection may be a promising tumor marker of diagnostic and metastasis detection for patients with prostate cancer. Also, it may be an important test for predicting BPH patients who are at high risk of subsequent cancer development.

Sensitization of Radioresistant Prostate Cancer Cells by Resveratrol Isolated from Arachis hypogaea Stems.

PubMed

Chen, Yu-An; Lien, Hsiu-Man; Kao, Min-Chuan; Lo, U-Ging; Lin, Li-Chiung; Lin, Chun-Jung; Chang, Sheau-Jiun; Chen, Chia-Chang; Hsieh, Jer-Tsong; Lin, Ho; Tang, Chih-Hsin; Lai, Chih-Ho

2017-01-01

Resveratrol (RV, 3,4',5-trihydroxystilbene) is naturally produced by a wide variety of plants including grapes and peanuts (Arachis hypogaea). However, the yield of RV from peanut stem and its potential radiosensitizing effects in prostate cancer (PCa) have not been well investigated. In this study, we characterized RV in peanut stem extract (PSE) for the first time and showed that both RV and PSE dose-dependently induced cell death in DOC-2/DAB2 interactive protein (DAB2IP)-deficient PCa cells with the radioresistant phenotype. Furthermore, the combination of radiation with either RV or PSE induced the death of radioresistant PCa cells through delayed repair of radiation-induced DNA double-strand break (DSB) and prolonged G2/M arrest, which induced apoptosis. The administration of RV and PSE effectively enhanced radiation therapy in the shDAB2IP PCa xenograft mouse model. These results demonstrate the promising synergistic effect of RV and PSE combined with radiation in the treatment of radioresistant PCa.

Rapid Selection of Mesenchymal Stem and Progenitor Cells in Primary Prostate Stromal Cultures

PubMed Central

Brennen, W. Nathaniel; Kisteman, L. Nelleke; Isaacs, John T.

2016-01-01

BACKGROUND Carcinoma-associated fibroblasts (CAFs) are a dominant component of the tumor microenvironment with pro-tumorigenic properties. Despite this knowledge, their physiologic origins remain poorly understood. Mesenchymal stem cells (MSCs) can be recruited from the bone marrow to areas of tissue damage and inflammation, including prostate cancer. MSCs can generate and have many overlapping properties with CAFs in preclinical models. METHODS Multiparameter flow cytometry and multipotent differentiation assays used to define MSCs in primary prostate stromal cultures derived from young (>25 yrs) organ donors and prostate cancer patients compared with bone marrow-derived stromal cultures. Population doubling times, population doublings, cell size, and differentiation potential determined under multiple culture conditions, including normoxia, hypoxia, and a variety of media. TGF-β measured by ELISA. RESULTS MSCs and stromal progenitors are not only present in normal and malignant prostate tissue, but are quickly selected for in primary stromal cultures derived from these tissues; becoming the dominant population within just a few passages. Growth potential inversely associated with TGF-β concentrations. All conditions generated populations with an average cell diameter >15 μm. All cultures tested had the ability to undergo osteogenic and chondrogenic differentiation, but unlike bone marrow-derived MSCs, primary stromal cultures derived from normal prostate tissue lack adipogenic differentiation potential. In contrast, a subset of stromal cultures derived from prostate cancer patients retain the ability to differentiate into adipocytes; a property that is significantly suppressed under hypoxic conditions in both bone marrow- and prostate-derived MSCs. CONCLUSIONS Primary prostate stromal cultures are highly enriched in cells with an MSC or stromal progenitor phenotype. The use of primary cultures such as these to study CAFs raises interesting implications when considering their overlapping properties. The lack of adipogenesis in stromal cultures derived from normal prostates suggests they have a lineage-restricted progenitor phenotype. The retention of adipogenic differentiation in cultures from a subset of prostate cancer patients suggests the active recruitment of less committed progenitors or MSCs from the bone marrow as a function of disease progression. This recruitment can potentially be exploited for prognostic purposes or a cell-based platform for the systemic delivery of cytotoxic agents to sites of prostate cancer. PMID:26732992

Rapid selection of mesenchymal stem and progenitor cells in primary prostate stromal cultures.

PubMed

Brennen, W Nathaniel; Kisteman, L Nelleke; Isaacs, John T

2016-05-01

Carcinoma-associated fibroblasts (CAFs) are a dominant component of the tumor microenvironment with pro-tumorigenic properties. Despite this knowledge, their physiologic origins remain poorly understood. Mesenchymal stem cells (MSCs) can be recruited from the bone marrow to areas of tissue damage and inflammation, including prostate cancer. MSCs can generate and have many overlapping properties with CAFs in preclinical models. Multiparameter flow cytometry and multipotent differentiation assays used to define MSCs in primary prostate stromal cultures derived from young (<25 yrs) organ donors and prostate cancer patients compared with bone marrow-derived stromal cultures. Population doubling times, population doublings, cell size, and differentiation potential determined under multiple culture conditions, including normoxia, hypoxia, and a variety of media. TGF-β measured by ELISA. MSCs and stromal progenitors are not only present in normal and malignant prostate tissue, but are quickly selected for in primary stromal cultures derived from these tissues; becoming the dominant population within just a few passages. Growth potential inversely associated with TGF-β concentrations. All conditions generated populations with an average cell diameter >15 µm. All cultures tested had the ability to undergo osteogenic and chondrogenic differentiation, but unlike bone marrow-derived MSCs, primary stromal cultures derived from normal prostate tissue lack adipogenic differentiation potential. In contrast, a subset of stromal cultures derived from prostate cancer patients retain the ability to differentiate into adipocytes; a property that is significantly suppressed under hypoxic conditions in both bone marrow- and prostate-derived MSCs. Primary prostate stromal cultures are highly enriched in cells with an MSC or stromal progenitor phenotype. The use of primary cultures such as these to study CAFs raises interesting implications when considering their overlapping properties. The lack of adipogenesis in stromal cultures derived from normal prostates suggests they have a lineage-restricted progenitor phenotype. The retention of adipogenic differentiation in cultures from a subset of prostate cancer patients suggests the active recruitment of less committed progenitors or MSCs from the bone marrow as a function of disease progression. This recruitment can potentially be exploited for prognostic purposes or a cell-based platform for the systemic delivery of cytotoxic agents to sites of prostate cancer. © 2016 Wiley Periodicals, Inc.

Isolation and Characterization of Prostate Cancer Stem Cells

DTIC Science & Technology

2012-08-01

guidelines. Adjacent prostate tissue was snap frozen in liquid Nitrogen or fixed in formalin and paraffin-embedded to evaluate anatomy and glandular...phenotypically normal and fertile [35]. We examined the prostate at 8 and 20 weeks of age and found no difference in gross anatomy and histology among WT...gross anatomy of the prostate of WT and CD1662/2 mice at 8 weeks of age, scale bar: 2 mm. Bottom: HE staining of DLP section from WT and CD1662/2 mice

Inhibition of human prostate cancer (PC-3) cells and targeting of PC-3-derived prostate cancer stem cells with koenimbin, a natural dietary compound from Murraya koenigii (L) Spreng.

PubMed

Kamalidehghan, Behnam; Ghafouri-Fard, Soudeh; Motevaseli, Elahe; Ahmadipour, Fatemeh

2018-01-01

Inhibition of prostate cancer stem cells (PCSCs) is an efficient curative maintenance protocol for the prevention of prostate cancer. The objectives of this study were to assess the efficiency of koenimbin, a major biologically active component of Murraya koenigii (L) Spreng, in the suppression of PC-3 cells and to target PC-3-derived cancer stem cells (CSCs) through apoptotic and CSC signaling pathways in vitro. The antiproliferative activity of koenimbin was examined using MTT, and the apoptotic detection was carried out by acridine orange/propidium iodide (AO/PI) double-staining and multiparametric high-content screening (HCS) assays. Caspase bioluminescence assay, reverse transcription polymerase chain reaction (RT-PCR), and immunoblotting were conducted to confirm the expression of apoptotic-associated proteins. Cell cycle analysis was investigated using flow cytometry. Involvement of nuclear factor-kappa B (NF-κB) was analyzed using HCS assay. Aldefluor™ and prostasphere formation examinations were used to evaluate the impact of koenimbin on PC-3 CSCs in vitro. Koenimbin remarkably inhibited cell proliferation in a dose-dependent manner. Koenimbin induced nuclear condensation, formation of apoptotic bodies, and G 0 /G 1 phase arrest of PC-3 cells. Koenimbin triggered the activation of caspase-3/7 and caspase-9 and the release of cytochrome c , decreased anti-apoptotic Bcl-2 and HSP70 proteins, increased pro-apoptotic Bax proteins, and inhibited NF-κB translocation from the cytoplasm to the nucleus, leading to the activation of the intrinsic apoptotic pathway. Koenimbin significantly ( P <0.05) reduced the aldehyde dehydrogenase-positive cell population of PC-3 CSCs and the size and number of PC-3 CSCs in primary, secondary, and tertiary prostaspheres in vitro. Koenimbin has chemotherapeutic potential that may be employed for future treatment through decreasing the recurrence of cancer, resulting in the improvement of cancer management strategies and patient survival.

Tracking and Functional Characterization of Epithelial-Mesenchymal Transition and Mesenchymal Tumor Cells During Prostate Cancer Metastasis

PubMed Central

Ruscetti, Marcus; Quach, Bill; Dadashian, Eman L.; Mulholland, David J.; Wu, Hong

2015-01-01

The epithelial-mesenchymal transition (EMT) has been postulated as a mechanism by which cancer cells acquire the invasive and stem-like traits necessary for distant metastasis. However, direct in vivo evidence for the role of EMT in the formation of cancer stem-like cells (CSC) and the metastatic cascade remains lacking. Here we report the first isolation and characterization of mesenchymal and EMT tumor cells, which harbor both epithelial and mesenchymal characteristics, in an autochthonous murine model of prostate cancer. By crossing the established Pb-Cre+/−;PtenL/L;KrasG12D/+ prostate cancer model with a vimentin-GFP reporter strain, generating CPKV mice, we were able to isolate epithelial, EMT and mesenchymal cancer cells based on expression of vimentin and EpCAM. CPKV mice (but not mice with Pten deletion alone) exhibited expansion of cells with EMT (EpCAM+/Vim-GFP+) and mesenchymal (EpCAM−/Vim-GFP+) characteristics at the primary tumor site and in circulation. These EMT and mesenchymal tumor cells displayed enhanced stemness and invasive character compared to epithelial tumor cells. Moreover, they displayed an enriched tumor-initiating capacity and could regenerate epithelial glandular structures in vivo, indicative of epithelia-mesenchyme plasticity. Interestingly, while mesenchymal tumor cells could persist in circulation and survive in the lung following intravenous injection, only epithelial and EMT tumor cells could form macrometastases. Our work extends the evidence that mesenchymal and epithelial states in cancer cells contribute differentially to their capacities for tumor initiation and metastatic seeding, respectively, and that EMT tumor cells exist with plasticity that can contribute to multiple stages of the metastatic cascade. PMID:25948589

N-Cadherin in Prostate Cancer: Downstream Pathways and Their Translational Application for Castrate-Resistant Prostate Cancer

DTIC Science & Technology

2012-09-01

with properties of stem cells. Cell 133, 704–715 (2008). 22. Mason , M.J., Fan, G ., Plath, K., Zhou, Q. & Horvath , S. Signed weighted gene co...An J, Horvath S, Gleave M, Rettig MB, Wainberg ZA, Reiter RE. Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis...N at u re A m er ic a, In c. A ll ri g h ts r es er ve d . A r t i c l e s nAture medicine VOLUME 16 | NUMBER 12 | DECEMBER 2010 1415 of in

Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2015-10-01

antitumor activity in mouse xenografts did not exert toxic effects on normal tissues. BMI-1 targeted therapy when combined with taxotere resulted in...utilizing zebrafish xenografts (Sabaawy Lab) and prostate cancer cell lines (Bertino Lab), and 3) Confirmation of the antitumor activity of C-209...in mouse xenografts alone and upon combination with taxotere (Bertino Lab). The following tasks from the approved SOW were performed to achieve the

Establishment of prostate cancer spheres from a prostate cancer cell line after phenethyl isothiocyanate treatment and discovery of androgen-dependent reversible differentiation between sphere and neuroendocrine cells.

PubMed

Chen, Yamei; Cang, Shundong; Han, Liying; Liu, Christina; Yang, Patrick; Solangi, Zeeshan; Lu, Quanyi; Liu, Delong; Chiao, J W

2016-05-03

Prostate cancer can transform from androgen-responsive to an androgen-independent phenotype. The mechanism responsible for the transformation remains unclear. We studied the effects of an epigenetic modulator, phenethyl isothiocyanate (PEITC), on the androgen-responsive LNCaP cells. After treatment with PEITC, floating spheres were formed with characteristics of prostate cancer stem cells (PCSC). These spheres were capable of self-renewal in media with and without androgen. They have been maintained in both types of media as long term cultures. Upon androgen deprivation, the adherent spheres differentiated to neuroendocrine cells (NEC) with decreased proliferation, expression of androgen receptor, and PSA. NEC reverse differentiated to spheres when androgen was replenished. The sphere cells expressed surface marker CD44 and had enhanced histone H3K4 acetylation, DNMT1 down-regulation and GSTP1 activation. We hypothesize that PEITC-mediated alteration in epigenomics of LNCaP cells may give rise to sphere cells, whereas reversible androgenomic alterations govern the shuttling between sphere PCSC and progeny NEC. Our findings identify unrecognized properties of prostate cancer sphere cells with multi-potential plasticity. This system will facilitate development of novel therapeutic agents and allow further exploration into epigenomics and androgenomics governing the transformation to hormone refractory prostate cancer.

Inhibition of Midkine Suppresses Prostate Cancer CD133+ Stem Cell Growth and Migration.

PubMed

Erdogan, Suat; Doganlar, Zeynep B; Doganlar, Oguzhan; Turkekul, Kader; Serttas, Riza

2017-09-01

Midkine (MDK) is a tumor-promoting factor that is often overexpressed in various human carcinomas, and the role of MDK has not yet been fully investigated in prostate cancer stem cells. Prostate cancer CD133 + stem cells (PCSCs) were isolated from human castration-resistant PC3 cells. PCSCs were treated with different concentrations of MDK inhibitor, iMDK, for 24-72 hours. The IC 50 values were determined by the MTT test. Endogenous MDK messenger RNA expression was knocked down by small interfering RNA. Quantitative reverse transcription polymerase chain reaction, Western blot analyses and image-based cytometry were used to investigate apoptosis and cell cycle progression as well as their underlying molecular mechanisms. Cell migration was evaluated by the wound healing test. iMDK caused dose- and time-dependent inhibition of PCSC survival. Similar growth inhibition was also obtained by small interfering RNA-mediated knockdown of endogenous MDK expression. iMDK was shown to preferentially induce cell cycle arrest at the S and G2/M phases. Suppressed PCSC growth was also accompanied by increases in p53 and the cell cycle inhibitor p21 genes. Combinatorial treatment of iMDK with docetaxel significantly inhibited cell proliferation versus either of the agents used alone. Inhibition of MDK expression strongly suppressed the migration of PCSCs compared to untreated and docetaxel-treated cells. iMDK and the knockdown of MDK decreased p-Akt and significantly upregulated the expression of PI3K/phosphatase/tensin homolog. Our data indicate that MDK plays a crucial role in controlling PCSC proliferation and migration. Therefore, suppression of endogenous expression of MDK would, in combination with traditional chemotherapy drugs, be a potential treatment for PCSCs. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

Resveratrol Improved the Progression of Chronic Prostatitis via the Downregulation of c-kit/SCF by Activating Sirt1.

PubMed

He, Yi; Zeng, Huizhi; Yu, Yang; Zhang, Jiashu; Zeng, Xiaona; Gong, Fengtao; Duan, Xingping; Liu, Qi; Yang, Bo

2017-07-19

The regulation mechanism of inflammation inducing prostate carcinogenesis remains largely unknown. Therefore, we investigated the role of the c-kit/SCF pathway, which has been associated with the control of prostate carcinogenesis, in chronic prostatitis (CP) rats and evaluated the anti-prostatitis effect of resveratrol. We performed hemolysin and eosin staining to evaluate the histopathological changes in prostates. Multiple approaches evaluated the expression levels of c-kit, stem cell factor (SCF), Sirt1, and carcinogenesis-associated proteins. The CP group exhibited severe diffuse chronic inflammation. Meanwhile, the prostate cells appeared atypia; the activity of c-kit/SCF was upregulated, and carcinogenesis-associated proteins are dysregulated significantly in CP rats. Resveratrol treatment significantly improved these factors by Sirt1 activation. In summary, CP could further cause prostate carcinogenesis, which may be associated with activated c-kit/SCF signaling. Resveratrol treatment could improve the progression of CP via the downregulation of c-kit/SCF by activating Sirt1.

Targeting Ligand Dependent and Ligand Independent Androgen Receptor Signaling in Prostate Cancer

DTIC Science & Technology

2014-10-01

3962–76. 27. Lin SP, Lee YT, Wang JY, Miller SA, Chiou SH, Hung MC, et al. Survival of cancer stem cells under hypoxia and serum depletion via...the SRC-3 coactivator in suppression of cytokine mRNA translation and inflammatory response. Mol Cell 2007;25:765–78. 26. SahuB, LaaksoM,OvaskaK...al. Targeting cancer stem cells expressing an embryonic signature with anti-proteases to decrease their tumor potential. Cell Death Dis 2013;4:e706. 29

Exosomes secreted by placental stem cells selectively inhibit growth of aggressive prostate cancer cells.

PubMed

Peak, Taylor C; Praharaj, Prakash P; Panigrahi, Gati K; Doyle, Michael; Su, Yixin; Schlaepfer, Isabel R; Singh, Ravi; Vander Griend, Donald J; Alickson, Julie; Hemal, Ashok; Atala, Anthony; Deep, Gagan

2018-05-23

The current paradigm in the development of new cancer therapies is the ability to target tumor cells while avoiding harm to noncancerous cells. Furthermore, there is a need to develop novel therapeutic options against drug-resistant cancer cells. Herein, we characterized the placental-derived stem cell (PLSC) exosomes (PLSC Exo ) and evaluated their anti-cancer efficacy in prostate cancer (PCa) cell lines. Nanoparticle tracking analyses revealed the size distribution (average size 131.4 ± 0.9 nm) and concentration of exosomes (5.23 × 10 10 ±1.99 × 10 9 per ml) secreted by PLSC. PLSC Exo treatment strongly inhibited the viability of enzalutamide-sensitive and -resistant PCa cell lines (C4-2B, CWR-R1, and LNCaP cells). Interestingly, PLSC Exo treatment had no effect on the viability of a non-neoplastic human prostate cell line (PREC-1). Mass spectrometry (MS) analyses showed that PLSC Exo are loaded with 241 proteins and mainly with saturated fatty acids. Further, Ingenuity Pathway Analysis analyses of proteins loaded in PLSC Exo suggested the role of retinoic acid receptor/liver x receptor pathways in their biological effects. Together, these results suggest the novel selective anti-cancer effects of PLSC Exo against aggressive PCa cells. Copyright © 2018 Elsevier Inc. All rights reserved.

The flavonoid apigenin reduces prostate cancer CD44(+) stem cell survival and migration through PI3K/Akt/NF-κB signaling.

PubMed

Erdogan, Suat; Doganlar, Oguzhan; Doganlar, Zeynep B; Serttas, Riza; Turkekul, Kader; Dibirdik, Ilker; Bilir, Ayhan

2016-10-01

Cancer stem cells (CSCs) are involved in drug resistance, metastasis and recurrence of cancers. The efficacy of apigenin on cell survival, apoptosis, migration and stemness properties were analyzed in CSCs. Prostate CSCs (CD44(+)) were isolated from human prostate cancer (PCa) PC3 cells using a magnetic-activated cell sorting system. PC3 and CSCs were treated with various concentrations of apigenin, docetaxel and their combinations for 48h. Apigenin dose dependently inhibited CSCs and PC3 cell survival, and this was accompanied with a significant increase of p21 and p27. Apigenin induced apoptosis via an extrinsic caspase-dependent pathway by upregulating the mRNA expressions of caspases-8, -3 and TNF-α, but failed to regulate the intrinsic pathway as determined by the Bax, cytochrome c (Cyt-c) and APAF-1 in CSCs. In contrary to CSCs, apigenin induced intrinsic apoptosis pathway as evidenced by the induction of Bax, Cyt-c and caspase-3 while caspase-8, TNF-α and Bcl-2 levels remained unchanged in PC3 cells. The flavonoid strongly suppressed the migration rate of CSCs compared to untreated cells. Significant downregulation of matrix metallopeptidases-2, -9, Snail and Slug exhibits the ability of apigenin treatment to suppress invasion. The expressions of NF-κB p105/p50, PI3K, Akt and the phosphorylation of pAkt were decreased after apigenin treatment. Moreover, apigenin treatment significantly reduced pluripotency marker Oct3/4 protein expression which might be associated with the down-regulation of PI3K/Akt/NF-κB signaling. Our data indicated that, apigenin could be a useful compound to prevent proliferation and migration of cancer cells as well as CSCs. Copyright © 2016 Elsevier Inc. All rights reserved.

Hyper-expression of PAX2 in human metastatic prostate tumors and its role as a cancer promoter in an in vitro invasion model.

PubMed

Ueda, Takashi; Ito, Saya; Shiraishi, Takumi; Kulkarni, Prakash; Ueno, Akihisa; Nakagawa, Hideo; Kimura, Yasunori; Hongo, Fumiya; Kamoi, Kazumi; Kawauchi, Akihiro; Miki, Tsuneharu

2013-09-01

Metastasis is a consequence of many biological events, during which cancer stem cells are shifted into a malignant state. Among these events, invasion of prostate cancer cells into host tissues is possible to be assessed by means of an in vitro invasion model, and is thought to be coupled to altered expression of membrane proteins. Dysregulated functions of the factors regulating organogenesis during embryogenesis are known to facilitate metastasis of many types of cancers. PAX2 (paired box 2) is a member of the PAX transcription factor family, which regulates prostatic ductal growth and branching in organogenesis of mammalian prostates. However, the role of PAX2 in prostate cancer development remains to be determined. PAX2 expression in human prostate cancers and normal prostate epithelium were examined by quantitative RT-PCR and immunohistochemistry. Matrigel invasion assay and a gene array analysis were performed using prostate cancer cell lines transfected with either control or PAX2 siRNA. In human prostate cancers, PAX2 was hyper-expressed in metastatic cancers, but was expressed at lower levels in non-metastatic cancers. Consistent with this, PAX2 knockdown repressed cell growth and invasion in a Matrigel invasion assay. Gene ontology analysis revealed that many cell membrane proteins were downregulated after PAX2 knockdown. Our data suggested that PAX2 hyper-expression promotes the development of the metastatic state in prostate cancer cells, presumably through upregulating the expression of cell membrane proteins. Copyright © 2013 Wiley Periodicals, Inc.

Sulforaphane and TRAIL induce a synergistic elimination of advanced prostate cancer stem-like cells.

PubMed

Labsch, Sabrina; Liu, Li; Bauer, Nathalie; Zhang, Yiyao; Aleksandrowicz, Ewa; Gladkich, Jury; Schönsiegel, Frank; Herr, Ingrid

2014-05-01

Advanced androgen-independent prostate cancer (AIPC) is an aggressive malignancy with a poor prognosis. Apoptosis-resistant cancer stem cells (CSCs) have been identified in AIPC and are not eliminated by current therapeutics. Novel therapeutic options, which are currently being evaluated in patient studies, include TRAIL and the broccoli-derived isothiocyanate sulforaphane. Although neither agent targets normal cells, TRAIL induces apoptosis in most cancer cells, and sulforaphane eliminates CSCs. In this study, the established AIPC cell lines DU145 and PC3, with enriched CSC features, and primary patient-derived prostate CSCs were treated with sulforaphane and recombinant soluble TRAIL. We examined the effects of these drugs on NF-κB activity, self-renewal and differentiation potential, and stem cell signaling via spheroid- and colony-forming assays, FACS and western blot analyses, immunohistochemistry, and an antibody protein array in vitro and after xenotransplantation. We largely found a stronger effect of sulforaphane on CSC properties compared to TRAIL, though the agents acted synergistically when applied in combination. This was associated with the inhibition of TRAIL-induced NF-κB binding; CXCR4, Jagged1, Notch 1, SOX 2, and Nanog expression; ALDH1 activity inhibition; and the elimination of differentiation and self-renewal potential. In vivo, tumor engraftment and tumor growth were strongly inhibited, without the induction of liver necrosis or other obvious side effects. These findings suggest that sulforaphane shifts the balance from TRAIL-induced survival signals to apoptosis and thus explains the observed synergistic effect. A nutritional strategy for high sulforaphane intake may target the cancer-specific activity of TRAIL in CSCs.

Sulforaphane and TRAIL induce a synergistic elimination of advanced prostate cancer stem-like cells

PubMed Central

LABSCH, SABRINA; LIU, LI; BAUER, NATHALIE; ZHANG, YIYAO; ALEKSANDROWICZ, EWA; GLADKICH, JURY; SCHÖNSIEGEL, FRANK; HERR, INGRID

2014-01-01

Advanced androgen-independent prostate cancer (AIPC) is an aggressive malignancy with a poor prognosis. Apoptosis-resistant cancer stem cells (CSCs) have been identified in AIPC and are not eliminated by current therapeutics. Novel therapeutic options, which are currently being evaluated in patient studies, include TRAIL and the broccoli-derived isothiocyanate sulforaphane. Although neither agent targets normal cells, TRAIL induces apoptosis in most cancer cells, and sulforaphane eliminates CSCs. In this study, the established AIPC cell lines DU145 and PC3, with enriched CSC features, and primary patient-derived prostate CSCs were treated with sulforaphane and recombinant soluble TRAIL. We examined the effects of these drugs on NF-κB activity, self-renewal and differentiation potential, and stem cell signaling via spheroid- and colony-forming assays, FACS and western blot analyses, immunohistochemistry, and an antibody protein array in vitro and after xenotransplantation. We largely found a stronger effect of sulforaphane on CSC properties compared to TRAIL, though the agents acted synergistically when applied in combination. This was associated with the inhibition of TRAIL-induced NF-κB binding; CXCR4, Jagged1, Notch 1, SOX 2, and Nanog expression; ALDH1 activity inhibition; and the elimination of differentiation and self-renewal potential. In vivo, tumor engraftment and tumor growth were strongly inhibited, without the induction of liver necrosis or other obvious side effects. These findings suggest that sulforaphane shifts the balance from TRAIL-induced survival signals to apoptosis and thus explains the observed synergistic effect. A nutritional strategy for high sulforaphane intake may target the cancer-specific activity of TRAIL in CSCs. PMID:24626333

Enrichment of the Cancer Stem Phenotype in Sphere Cultures of Prostate Cancer Cell Lines Occurs through Activation of Developmental Pathways Mediated by the Transcriptional Regulator ΔNp63α

PubMed Central

Portillo-Lara, Roberto; Alvarez, Mario Moisés

2015-01-01

Background Cancer stem cells (CSC) drive prostate cancer tumor survival and metastasis. Nevertheless, the development of specific therapies against CSCs is hindered by the scarcity of these cells in prostate tissues. Suspension culture systems have been reported to enrich CSCs in primary cultures and cell lines. However, the molecular mechanisms underlying this phenomenon have not been fully explored. Methodology/Principal Findings We describe a prostasphere assay for the enrichment of CD133+ CSCs in four commercial PCa cell lines: 22Rv1, DU145, LNCaP, and PC3. Overexpression of CD133, as determined by flow cytometric analysis, correlated with an increased clonogenic, chemoresistant, and invasive potential in vitro. This phenotype is concordant to that of CSCs in vivo. Gene expression profiling was then carried out using the Cancer Reference panel and the nCounter system from NanoString Technologies. This analysis revealed several upregulated transcripts that can be further explored as potential diagnostic markers or therapeutic targets. Furthermore, functional annotation analysis suggests that ΔNp63α modulates the activation of developmental pathways responsible for the increased stem identity of cells growing in suspension cultures. Conclusions/Significance We conclude that profiling the genetic mechanisms involved in CSC enrichment will help us to better understand the molecular pathways that underlie CSC pathophysiology. This platform can be readily adapted to enrich and assay actual patient samples, in order to design patient-specific therapies that are aimed particularly against CSCs. PMID:26110651

B lymphoma Moloney murine leukemia virus insertion region 1: An oncogenic mediator in prostate cancer.

PubMed

Liu, Qipeng; Li, Qiaqia; Zhu, Sen; Yi, Yang; Cao, Qi

2018-06-01

B lymphoma Moloney murine leukemia virus insertion region 1 (BMI1), a core member of polycomb repressive complex 1 (PRC1), has been intensely investigated in the field of cancer epigenetics for decades. Widely known as a critical regulator in cellular physiology, BMI1 is essential in self-renewal and differentiation in different lineages of stem cells. BMI1 also plays a significant role in cancer etiology for its involvement in pathological progress such as epithelial-mesenchymal transition (EMT) and cancer stem cell maintenance, propagation, and differentiation. Importantly, overexpression of BMI1 is predictive for drug resistance, tumor recurrence, and eventual therapy failure of various cancer subtypes, which renders the pharmacological targeting at BMI1 as a novel and promising therapeutic approach. The study on prostate cancer, a prevalent hormone-related cancer among men, has promoted enormous research advancements in cancer genetics and epigenetics. This review summarizes the role of BMI1 as an oncogenic and epigenetic regulator in tumor initiation, progression, and relapse of prostate cancer.

MtDNA depleted PC3 cells exhibit Warburg effect and cancer stem cell features

PubMed Central

Li, Xiaoran; Zhong, Yali; Lu, Jie; Axcrona, Karol; Eide, Lars; Syljuåsen, Randi G.; Peng, Qian; Wang, Junbai; Zhang, Hongquan; Goscinski, Mariusz Adam; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe

2016-01-01

Reducing mtDNA content was considered as a critical step in the metabolism restructuring for cell stemness restoration and further neoplastic development. However, the connections between mtDNA depletion and metabolism reprograming-based cancer cell stemness in prostate cancers are still lack of studies. Here, we demonstrated that human CRPC cell line PC3 tolerated high concentration of the mtDNA replication inhibitor ethidium bromide (EtBr) and the mtDNA depletion triggered a universal metabolic remodeling process. Failure in completing that process caused lethal consequences. The mtDNA depleted (MtDP) PC3 cells could be steadily maintained in the special medium in slow cycling status. The MtDP PC3 cells contained immature mitochondria and exhibited Warburg effect. Furthermore, the MtDP PC3 cells were resistant to therapeutic treatments and contained greater cancer stem cell-like subpopulations: CD44+, ABCG2+, side-population and ALDHbright. In conclusion, these results highlight the association of mtDNA content, mitochondrial function and cancer cell stemness features. PMID:27248169

Immunostaining of the androgen receptor and sequence analysis of its DNA-binding domain in canine prostate cancer.

PubMed

Lai, Chen-Li; van den Ham, René; Mol, Jan; Teske, Erik

2009-09-01

Prostate cancer in the dog (cPC) has many features in common with hormone refractory human prostate cancer. As cPC is seen more often in castrated dogs, the contribution of the androgen receptor (AR) to the development of prostate cancer remains questionable. The aim of the present study was to evaluate the presence of the AR by immunohistochemistry in cPC. AR staining was observed in most tumors from intact and castrated dogs, but the proportion of positive cells and the staining intensity were much lower than in the prostate of healthy, non-castrated dogs. Most of the positive staining was seen in the cytoplasm rather than in the nuclei of the tumor cells. The predominant cytoplasmic localization was not related to mutations in exon 3 of the DNA-binding domain of the AR, as shown by sequence analysis of microdissected AR positive tumor cells. Other mechanisms that lead to an impaired androgen-AR signaling or a basal/stem cell like origin may explain the low cytoplasmic AR staining in cPC.

Effects of transplantation of adipose tissue-derived stem cells on prostate tumor.

PubMed

Lin, Guiting; Yang, Rong; Banie, Lia; Wang, Guifang; Ning, Hongxiu; Li, Long-Cheng; Lue, Tom F; Lin, Ching-Shwun

2010-07-01

Obesity is a risk factor for prostate cancer development, but the underlying mechanism is unknown. The present study tested the hypothesis that stromal cells of the adipose tissue might be recruited by cancer cells to help tumor growth. PC3 prostate cancer cells were transplanted into the subcutaneous space of the right flank of athymic mice. One week later, adipose tissue-derived stromal or stem cells (ADSC) or phosphate-buffered saline (PBS, as control) was transplanted similarly to the left flank. Tumor size was monitored for the next 34 days; afterwards, the mice were sacrificed and their tumors harvested for histological examination. The ability of PC3 cells to attract ADSC was tested by migration assay. The involvement of the CXCL12/CXCR4 axis was tested by migration assay in the presence of a specific inhibitor AMD3100. Throughout the entire course, the average size of PC3 tumors in ADSC-treated mice was larger than in PBS-treated mice. ADSC were identified inside the tumors of ADSC-treated mice; CXCR4 expression was also detected. Migration assay indicated the involvement of the CXCL12/CXCR4 axis in the migration of ADSC toward PC3 cells. Capillary density was twice as high in the tumors of ADSC-treated mice than in the tumors of PBS-treated mice. VEGF expression was similar but FGF2 expression was significantly higher in tumors of ADSC-treated mice than in the tumors of PBS-tread mice. Prostate cancer cells recruited ADSC by the CXCL12/CXCR4 axis. ADSC helps tumor growth by increasing tumor vascularity, and which was mediated by FGF2.

Resveratrol Improves Cell Cycle Arrest in Chronic Prostatitis Rats, by C-kit/SCF Suppression.

PubMed

He, Yi; Zeng, Huizhi; Yu, Yang; Zhang, Jiashu; Zeng, Xiaona; Gong, Fengtao; Liu, Qi; Yang, Bo

2017-08-01

Chronic prostatitis (CP) with complex pathogenesis is difficult for treatment. c-kit has been associated with the control of cell proliferation of prostate cells. This study aims to evaluate the role of resveratrol, an activator of Sirt1, in regulating the expression of c-kit in CP and investigate the consequent effects on cell cycle. Rat model of CP was established through subcutaneous injections of diphtheria-pertussis-tetanus vaccine and subsequently treated with resveratrol. Hematoxylin and eosin staining was performed to identify the histopathological changes in prostates. Western blotting and immunohistochemical staining examined the expression level of c-kit, stem cell factor (SCF), Sirt1, and cell cycle-associated proteins. The model group exhibited severe diffuse chronic inflammation, characterized by leukocyte infiltration and papillary frond protrusion into the gland cavities, and a notable increase in prostatic epithelial height. Gland lumen diameter was also significantly smaller; the activity of c-kit/SCF in the CP rats was increased significantly compared to the control group. Meanwhile, the cell cycle proteins are dysregulated significantly in CP rats. Resveratrol treatment significantly improved these factors by Sirt1 activation. Dysregulation of cell cycle was involved in the pathological processes of CP, which was improved after resveratrol treatment by the downregulation of c-kit/SCF by activating Sirt1.

E-selectin ligand-1 controls circulating prostate cancer cell rolling/adhesion and metastasis

PubMed Central

Yasmin-Karim, Sayeda; King, Michael R.; Messing, Edward M.; Lee, Yi-Fen

2014-01-01

Circulating prostate cancer (PCa) cells preferentially roll and adhere on bone marrow vascular endothelial cells, where abundant E-selectin and stromal cell-derived factor 1 (SDF-1) are expressed, subsequently initiating a cascade of activation events that eventually lead to the development of metastases. To elucidate the roles of circulating PCa cells' rolling and adhesion behaviors in cancer metastases, we applied a dynamic cylindrical flow-based microchannel device that is coated with E-selectin and SDF-1, mimicking capillary endothelium. Using this device we captured a small fraction of rolling PCa cells. These rolling cells display higher static adhesion ability, more aggressive cancer phenotypes and stem-like properties. Importantly, mice received rolling PCa cells, but not floating PCa cells, developed cancer metastases. Genes coding for E-selectin ligands and genes associated with cancer stem cells and metastasis were elevated in rolling PCa cells. Knock down of E-selectin ligand 1(ESL-1), significantly impaired PCa cells' rolling capacity and reduced cancer aggressiveness. Moreover, ESL-1 activates RAS and MAP kinase signal cascade, consequently inducing the downstream targets. In summary, circulating PCa cells' rolling capacity contributes to PCa metastasis, and that is in part controlled by ESL-1. PMID:25301730

Glycophenotype of breast and prostate cancer stem cells treated with thieno[2,3-b]pyridine anticancer compound.

PubMed

Mastelić, Angela; Čikeš Čulić, Vedrana; Režić Mužinić, Nikolina; Vuica-Ross, Milena; Barker, David; Leung, Euphemia Y; Reynisson, Jóhannes; Markotić, Anita

2017-01-01

Tumor progression may be driven by a small subpopulation of cancer stem cells (CSCs characterized by CD44 + /CD24 - phenotype). We investigated the influence of a newly developed thienopyridine anticancer compound (3-amino-5-oxo- N -naphthyl-5,6,7, 8-tetrahydrothieno[2,3- b ]quinoline-2-carboxamide, 1 ) on the growth, survival and glycophenotype (CD15s and GM3 containing neuraminic acid substituted with acetyl residue, NeuAc) of breast and prostate cancer stem/progenitor-like cell population. MDA-MB-231 and Du-145 cells were incubated with compound 1 alone or in combination with paclitaxel. The cellular metabolic activity was determined by the 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT) assay. The type of cell death induced by 48-h treatment was assessed using a combination of Annexin-V-FITC and propidium iodide staining. Flow cytometric analysis was performed to detect the percentage of CD44 + /CD24 - cells, and GM3 and CD15s positive CSCs, as well as the expression of GM3 and CD15s per one CSC, in both cell lines. Compound 1 produces a dose- and time-dependent cytotoxicity, mediated mainly by apoptosis in breast cancer cells, and slightly (2.3%) but statistically significant lowering breast CSC subpopulation. GM3 expression per one breast CSC was increased, and the percentage of prostate GM3 + CSC subpopulation was decreased in cells treated with compound 1 compared with non-treated cells. The percentage of CD15s + CSCs was lower in both cell lines after treatment with compound 1 . Considering that triple-negative breast cancers are characterized by an increased percentage of breast CSCs and knowing their association with an increased risk of metastasis and mortality, compound 1 is a potentially effective drug for triple-negative breast cancer treatment.

Regulated proteolysis of Trop2 drives epithelial hyperplasia and stem cell self-renewal via β-catenin signaling.

PubMed

Stoyanova, Tanya; Goldstein, Andrew S; Cai, Houjian; Drake, Justin M; Huang, Jiaoti; Witte, Owen N

2012-10-15

The cell surface protein Trop2 is expressed on immature stem/progenitor-like cells and is overexpressed in many epithelial cancers. However the biological function of Trop2 in tissue maintenance and tumorigenesis remains unclear. In this study, we demonstrate that Trop2 is a regulator of self-renewal, proliferation, and transformation. Trop2 controls these processes through a mechanism of regulated intramembrane proteolysis that leads to cleavage of Trop2, creating two products: the extracellular domain and the intracellular domain. The intracellular domain of Trop2 is released from the membrane and accumulates in the nucleus. Heightened expression of the Trop2 intracellular domain promotes stem/progenitor self-renewal through signaling via β-catenin and is sufficient to initiate precursor lesions to prostate cancer in vivo. Importantly, we demonstrate that loss of β-catenin or Trop2 loss-of-function cleavage mutants abrogates Trop2-driven self-renewal and hyperplasia in the prostate. These findings suggest that heightened expression of Trop2 is selected for in epithelial cancers to enhance the stem-like properties of self-renewal and proliferation. Defining the mechanism of Trop2 function in self-renewal and transformation is essential to identify new therapeutic strategies to block Trop2 activation in cancer.

Regulated proteolysis of Trop2 drives epithelial hyperplasia and stem cell self-renewal via β-catenin signaling

PubMed Central

Stoyanova, Tanya; Goldstein, Andrew S.; Cai, Houjian; Drake, Justin M.; Huang, Jiaoti; Witte, Owen N.

2012-01-01

The cell surface protein Trop2 is expressed on immature stem/progenitor-like cells and is overexpressed in many epithelial cancers. However the biological function of Trop2 in tissue maintenance and tumorigenesis remains unclear. In this study, we demonstrate that Trop2 is a regulator of self-renewal, proliferation, and transformation. Trop2 controls these processes through a mechanism of regulated intramembrane proteolysis that leads to cleavage of Trop2, creating two products: the extracellular domain and the intracellular domain. The intracellular domain of Trop2 is released from the membrane and accumulates in the nucleus. Heightened expression of the Trop2 intracellular domain promotes stem/progenitor self-renewal through signaling via β-catenin and is sufficient to initiate precursor lesions to prostate cancer in vivo. Importantly, we demonstrate that loss of β-catenin or Trop2 loss-of-function cleavage mutants abrogates Trop2-driven self-renewal and hyperplasia in the prostate. These findings suggest that heightened expression of Trop2 is selected for in epithelial cancers to enhance the stem-like properties of self-renewal and proliferation. Defining the mechanism of Trop2 function in self-renewal and transformation is essential to identify new therapeutic strategies to block Trop2 activation in cancer. PMID:23070813

Bad seeds produce bad crops: a single stage-process of prostate tumor invasion

PubMed Central

Man, Yan-gao; Gardner, William A.

2008-01-01

It is a commonly held belief that prostate carcinogenesis is a multi-stage process and that tumor invasion is triggered by the overproduction of proteolytic enzymes. This belief is consistent with data from cell cultures and animal models, whereas is hard to interpret several critical facts, including the presence of cancer in “healthy” young men and cancer DNA phenotype in morphologically normal prostate tissues. These facts argue that alternative pathways may exist for prostate tumor invasion in some cases. Since degradation of the basal cell layer is the most distinct sign of invasion, our recent studies have attempted to identify pre-invasive lesions with focal basal cell layer alterations. Our studies revealed that about 30% of prostate cancer patients harbored normal appearing duct or acinar clusters with a high frequency of focal basal cell layer disruptions. These focally disrupted basal cell layers had significantly reduced cell proliferation and tumor suppressor expression, whereas significantly elevated degeneration, apoptosis, and infiltration of immunoreactive cells. In sharp contrast, associated epithelial cell had significantly elevated proliferation, expression of malignancy-signature markers, and physical continuity with invasive lesions. Based on these and other findings, we have proposed that these normal appearing duct or acinar clusters are derived from monoclonal proliferation of genetically damaged stem cells and could progress directly to invasion through two pathways: 1) clonal in situ transformation (CIST) and 2) multi-potential progenitor mediated “budding” (MPMB). These pathways may contribute to early onset of prostate cancer at young ages, and to clinically more aggressive prostate tumors. PMID:18725981

GE132+Natural: Novel promising dietetic supplement with antiproliferative influence on prostate, colon, and breast cancer cells.

PubMed

Okic-Djordjevic, I; Trivanovic, D; Krstic, J; Jaukovic, A; Mojsilovic, S; Santibanez, J F; Terzic, M; Vesovic, D; Bugarski, D

2013-01-01

Natural products have been investigated for promising new leads in pharmaceutical development. The purpose of this study was to analyze the biological effect of GE132+Natural, a novel supplement consisting of 5 compounds: Resveratrol, Ganoderma lucidum, Sulforaphane, Lycopene and Royal jelly. The antiproliferative activity of GE132+Natural was tested on 3 different human cancer cell lines: MCF7 (breast cancer cells), PC3 (prostate cancer cells), and SW480 (colon cancer cells), as well as on EA.hy 926 (normal human endothelial cell line). In addition, the cytotoxicity of GE132+- Natural on the proliferation of primary human mesenchymal stem cells isolated from dental pulp (DP=MSC), along with its in vitro impact on different peripheral blood parameters, was determined. The results revealed high antiproliferative activity of GE132+Natural on all tested cancer cell lines (PC3, MCF7 and SW480), as well as on the EA.hy 926 endothelial cell line in a dose-dependent manner. However, applied in a wide range of concentrations GE132+Natural did not affect both the proliferation of primary mesenchymal stem cells and the peripheral blood cells counts. The data obtained demonstrated that GE132+Natural is effective in inhibiting cancer cell proliferation, indicating its potential beneficial health effects. In addition, the results pointed that adult mesenchymal stem cells might be valuable as a test system for evaluating the toxicity and efficacy of new medicines or chemicals.

Mesenchymal stem cells as a vector for the inflammatory prostate microenvironment

PubMed Central

Brennen, W Nathaniel; Denmeade, Samuel R; Isaacs, John T

2014-01-01

Mesenchymal stem cells (MSCs) have an inherent tropism for sites of inflammation, which are frequently present in sites of cancer, including prostatic lesions. MSCs have been defined as CD73/CD90/CD105 triple-positive cells in the absence of hematopoietic lineage markers with the ability to differentiate into multiple mesodermal lineages, including osteoblasts, adipocytes, and chondrocytes. Our group has previously demonstrated that MSCs represent between 0.01 and 1.1% of the total cells present in human prostatectomy tissue. In addition to their multi-lineage differentiation potential, MSCs are immunoprivileged in nature and have a range of immunomodulatory effects on both the innate and adaptive arms of the immune system. MSCs have been detected in an increasing array of tissues, and evidence suggests that they are likely present in perivascular niches throughout the body. These observations suggest that MSCs represent critical mediators of the overall immune response during physiological homeostasis and likely contribute to pathophysiological conditions as well. Chronic inflammation has been suggested as an initiating event and progression factor in prostate carcinogenesis, a process in which the immunosuppressive properties of MSCs may play a role. MSCs have also been shown to influence malignant progression through a variety of other mechanisms, including effects on tumor proliferation, angiogenesis, survival, and metastasis. Additionally, human bone marrow-derived MSCs have been shown to traffic to human prostate cancer xenografts in immunocompromised murine hosts. The trafficking properties and immunoprivileged status of MSCs suggest that they can be exploited as an allogeneic cell-based vector to deliver cytotoxic or diagnostic agents for therapy. PMID:23975882

The Effect of a Histone Deacetylase Inhibitor (AR-42) on Canine Prostate Cancer Growth and Metastasis.

PubMed

Elshafae, Said M; Kohart, Nicole A; Altstadt, Lucas A; Dirksen, Wessel P; Rosol, Thomas J

2017-05-01

Canine prostate cancer (PCa) is an excellent preclinical model for human PCa. AR-42 is a histone deacetylase inhibitor (HDACi) developed at The Ohio State University that inhibits the proliferation of several cancers, including multiple myeloma, lung, and hepatocellular cancer. In this study, we investigated whether AR-42 would prevent or decrease. The growth and metastasis of a canine PCa (Ace-1 cells) to bone in vitro and in vivo. Proliferation, cell viability, invasion, and metastasis of a canine prostate cancer cell line (Ace-1) were measured following treatment with AR-42. Expression of anoikis resistance, epithelial-to-mesenchymal transition (EMT), and stem cell-related markers were also evaluated. To assess the efficacy of AR-42 on prevention of PCa metastasis to bone, Ace-1 cells were injected in the left cardiac ventricle of nude mice, mice were treated with AR-42, and the incidence and growth of bone metastasis were measured. Bioluminescence was performed to monitor the bone metastases in nude mice. AR-42 inhibited the in vitro proliferation of Ace-1 cells in a time- and dose-dependent manner. The IC 50 concentration of AR-42 for Ace-1 cells was 0.42 μM after 24 hr of treatment. AR-42 induced apoptosis, decreased cell migration, and increased the stem cell properties of Ace-1 cells in vitro. AR-42 downregulated E-cadherin, N-cadherin, TWIST, MYOF, anoikis resistance, and osteomimicry genes, while it upregulated SNAIL, PTEN, FAK, and ZEB1 gene expression in Ace-1 cells. Importantly, AR-42 decreased the bioluminescence and incidence of bone metastasis in nude mice. In addition, AR-42 induced apoptosis and altered the tumor cell morphology to an irregular cell phenotype with condensed chromatin in the bone metastases. AR-42 decreased PCa growth and bone metastasis, induced apoptosis, and downregulated osteomimicry genes in PCa cells in the bone microenvironment. Prostate 77:776-793, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Forced LIGHT expression in prostate tumors overcomes Treg mediated immunosuppression and synergizes with a prostate tumor therapeutic vaccine by recruiting effector T lymphocytes.

PubMed

Yan, Lisa; Da Silva, Diane M; Verma, Bhavna; Gray, Andrew; Brand, Heike E; Skeate, Joseph G; Porras, Tania B; Kanodia, Shreya; Kast, W Martin

2015-02-15

LIGHT, a ligand for lymphotoxin-β receptor (LTβR) and herpes virus entry mediator, is predominantly expressed on activated immune cells and LTβR signaling leads to the recruitment of lymphocytes. The interaction between LIGHT and LTβR has been previously shown to activate immune cells and result in tumor regression in a virally-induced tumor model, but the role of LIGHT in tumor immunosuppression or in a prostate cancer setting, where self antigens exist, has not been explored. We hypothesized that forced expression of LIGHT in prostate tumors would shift the pattern of immune cell infiltration toward an anti-tumoral milieu, would inhibit T regulatory cells (Tregs) and would induce prostate cancer tumor associated antigen (TAA) specific T cells that would eradicate tumors. Real Time PCR was used to evaluate expression of forced LIGHT and other immunoregulatory genes in prostate tumors samples. For in vivo studies, adenovirus encoding murine LIGHT was injected intratumorally into TRAMP-C2 prostate cancer cell tumor bearing mice. Chemokine and cytokine concentrations were determined by multiplex ELISA. Flow cytometry was used to phenotype tumor infiltrating lymphocytes and expression of LIGHT on the tumor cell surface. Tumor-specific lymphocytes were quantified via ELISpot assay. Treg induction and Treg suppression assays determined Treg functionality after LIGHT treatment. LIGHT in combination with a therapeutic vaccine, PSCA TriVax, reduced tumor burden. LIGHT expression peaked within 48 hr of infection, recruited effector T cells that recognized mouse prostate stem cell antigen (PSCA) into the tumor microenvironment, and inhibited infiltration of Tregs. Tregs isolated from tumor draining lymph nodes had impaired suppressive capability after LIGHT treatment. Forced LIGHT treatment combined with PSCA TriVax therapeutic vaccination delays prostate cancer progression in mice by recruiting effector T lymphocytes to the tumor and inhibiting Treg mediated immunosuppression. Prostate 75:280-291, 2015. © 2014 Wiley Periodicals, Inc. © 2014 Wiley Periodicals, Inc.

Detection and characterization of invasive circulating tumor cells derived from men with metastatic castration-resistant prostate cancer.

PubMed

Friedlander, Terence W; Ngo, Vy T; Dong, Huan; Premasekharan, Gayatri; Weinberg, Vivian; Doty, Shaun; Zhao, Qiang; Gilbert, Elizabeth G; Ryan, Charles J; Chen, Wen-Tien; Paris, Pamela L

2014-05-15

The Vitatex cell-adhesion matrix (CAM) platform allows for isolation of invasive circulating tumor cells (iCTCs). Here we sought to determine the utility of prostate-specific membrane antigen (PSMA) as a metastatic castration-resistant prostate cancer (mCRPC) iCTC biomarker, to identify solitary cells and clusters of iCTCs expressing either epithelial, mesenchymal, or stem cell markers, and to explore the feasibility of iCTC epigenomic analysis. CTCs were isolated and enumerated simultaneously using the Vitatex and CellSearch platforms in 23 men with mCRPC. CAM-avid iCTCs were identified as nucleated cells capable of CAM uptake, but without detectable expression of hematopoietic lineage (HL) markers including CD45. iCTCs were enumerated immunocytochemically (ICC) and by flow cytometry. Whole-genome methylation status was determined for iCTCs using the Illumina HumanMethylation27 BeadChip. Thirty-four samples were collected for iCTC analysis. A median of 27 (range 0-800) and 23 (range 2-390) iCTCs/mL were detected by ICC and flow, respectively. In a subset of 20 samples, a median of seven CTCs/mL (range 0-85) were detected by the CellSearch platform compared to 26 by the CAM platform. iCTC clusters were observed in 17% of samples. iCTCs expressing PSMA as well as markers of EMT and stemness were detectable. The iCTC methylation profile highly resembled mCRPC. More CTCs were recovered using the CAM platform than the CellSearch platform, and the CAM platform allowed for the detection of iCTC clusters, iCTCs expressing EMT and stem-cell markers, and characterization of the iCTC methylome. Correlation with clinical data in future studies may yield further insight into the functional significance of these findings. © 2013 UICC.

Identification of Epigenetic Changes in Prostate Cancer using Induced Pluripotent Stem Cells

DTIC Science & Technology

2014-04-01

somatic cells in human iPS cells. Nat Cell Bioi, 13: 541, 2011 5. Polo, J. M., Liu, S., Figueroa , M. E. et al.: Cell type of origin influences the...human iPS cells. Nat Cell Bioi 13: 5•1 \\ - 5•19. 18. Poloj:\\ə, Lu S, Figueroa ME, Kulalert W, Eminli S, ct a!. (20 10) Cell type of origin

Cancer stem cell-related gene expression as a potential biomarker of response for first-in-class imipridone ONC201 in solid tumors.

PubMed

Prabhu, Varun V; Lulla, Amriti R; Madhukar, Neel S; Ralff, Marie D; Zhao, Dan; Kline, Christina Leah B; Van den Heuvel, A Pieter J; Lev, Avital; Garnett, Mathew J; McDermott, Ultan; Benes, Cyril H; Batchelor, Tracy T; Chi, Andrew S; Elemento, Olivier; Allen, Joshua E; El-Deiry, Wafik S

2017-01-01

Cancer stem cells (CSCs) correlate with recurrence, metastasis and poor survival in clinical studies. Encouraging results from clinical trials of CSC inhibitors have further validated CSCs as therapeutic targets. ONC201 is a first-in-class small molecule imipridone in Phase I/II clinical trials for advanced cancer. We have previously shown that ONC201 targets self-renewing, chemotherapy-resistant colorectal CSCs via Akt/ERK inhibition and DR5/TRAIL induction. In this study, we demonstrate that the anti-CSC effects of ONC201 involve early changes in stem cell-related gene expression prior to tumor cell death induction. A targeted network analysis of gene expression profiles in colorectal cancer cells revealed that ONC201 downregulates stem cell pathways such as Wnt signaling and modulates genes (ID1, ID2, ID3 and ALDH7A1) known to regulate self-renewal in colorectal, prostate cancer and glioblastoma. ONC201-mediated changes in CSC-related gene expression were validated at the RNA and protein level for each tumor type. Accordingly, we observed inhibition of self-renewal and CSC markers in prostate cancer cell lines and patient-derived glioblastoma cells upon ONC201 treatment. Interestingly, ONC201-mediated CSC depletion does not occur in colorectal cancer cells with acquired resistance to ONC201. Finally, we observed that basal expression of CSC-related genes (ID1, CD44, HES7 and TCF3) significantly correlate with ONC201 efficacy in >1000 cancer cell lines and combining the expression of multiple genes leads to a stronger overall prediction. These proof-of-concept studies provide a rationale for testing CSC expression at the RNA and protein level as a predictive and pharmacodynamic biomarker of ONC201 response in ongoing clinical studies.

Cancer stem cell-related gene expression as a potential biomarker of response for first-in-class imipridone ONC201 in solid tumors

PubMed Central

Zhao, Dan; Kline, Christina Leah B.; Van den Heuvel, A. Pieter J.; Lev, Avital; Garnett, Mathew J.; McDermott, Ultan; Benes, Cyril H.; Batchelor, Tracy T.; Chi, Andrew S.; Elemento, Olivier; Allen, Joshua E.

2017-01-01

Cancer stem cells (CSCs) correlate with recurrence, metastasis and poor survival in clinical studies. Encouraging results from clinical trials of CSC inhibitors have further validated CSCs as therapeutic targets. ONC201 is a first-in-class small molecule imipridone in Phase I/II clinical trials for advanced cancer. We have previously shown that ONC201 targets self-renewing, chemotherapy-resistant colorectal CSCs via Akt/ERK inhibition and DR5/TRAIL induction. In this study, we demonstrate that the anti-CSC effects of ONC201 involve early changes in stem cell-related gene expression prior to tumor cell death induction. A targeted network analysis of gene expression profiles in colorectal cancer cells revealed that ONC201 downregulates stem cell pathways such as Wnt signaling and modulates genes (ID1, ID2, ID3 and ALDH7A1) known to regulate self-renewal in colorectal, prostate cancer and glioblastoma. ONC201-mediated changes in CSC-related gene expression were validated at the RNA and protein level for each tumor type. Accordingly, we observed inhibition of self-renewal and CSC markers in prostate cancer cell lines and patient-derived glioblastoma cells upon ONC201 treatment. Interestingly, ONC201-mediated CSC depletion does not occur in colorectal cancer cells with acquired resistance to ONC201. Finally, we observed that basal expression of CSC-related genes (ID1, CD44, HES7 and TCF3) significantly correlate with ONC201 efficacy in >1000 cancer cell lines and combining the expression of multiple genes leads to a stronger overall prediction. These proof-of-concept studies provide a rationale for testing CSC expression at the RNA and protein level as a predictive and pharmacodynamic biomarker of ONC201 response in ongoing clinical studies. PMID:28767654

Chondroitin sulfatases differentially regulate Wnt signaling in prostate stem cells through effects on SHP2, phospho-ERK1/2, and Dickkopf Wnt signaling pathway inhibitor (DKK3)

PubMed Central

Bhattacharyya, Sumit; Feferman, Leo; Tobacman, Joanne K.

2017-01-01

The chondroitin sulfatases N-acetylgalactosamine-4-sulfatase (ARSB) and galactosamine-N-acetyl-6-sulfatase (GALNS) remove either the 4-sulfate group at the non-reducing end of chondroitin 4-sulfate (C4S) and dermatan sulfate, or the 6-sulfate group of chondroitin 6-sulfate, chondroitin 4,6-disulfate (chondroitin sulfate E), or keratan sulfate. In human prostate cancer tissues, the ARSB activity was reduced and the GALNS activity was increased, compared to normal prostate tissue. In human prostate stem cells, when ARSB was reduced by silencing or GALNS was increased by overexpression, activity of SHP2, the ubiquitous non-receptor tyrosine phosphatase, declined, attributable to increased binding of SHP2 with C4S. This led to increases in phospho-ERK1/2, Myc/Max nuclear DNA binding, DNA methyltransferase (DNMT) activity and expression, and methylation of the Dickkopf Wnt signaling pathway inhibitor (DKK)3 promoter and to reduced DKK3 expression. Since DKK3 negatively regulates Wnt/β-catenin signaling, silencing of ARSB or overexpression of GALNS disinhibited (increased) Wnt/β-catenin signaling. These findings indicate that the chondroitin sulfatases can exert profound effects on Wnt-mediated processes, due to epigenetic effects that modulate Wnt signaling. PMID:29245974

Orphan nuclear receptor TLX contributes to androgen insensitivity in castration-resistant prostate cancer via its repression of androgen receptor transcription.

PubMed

Jia, Lin; Wu, Dinglan; Wang, Yuliang; You, Wenxing; Wang, Zhu; Xiao, Lijia; Cai, Ganhui; Xu, Zhenyu; Zou, Chang; Wang, Fei; Teoh, Jeremy Yuen-Chun; Ng, Chi-Fai; Yu, Shan; Chan, Franky L

2018-03-20

The metastatic castration-resistant prostate cancer (CRPC) is a lethal form of prostate cancer, in which the expression of androgen receptor (AR) is highly heterogeneous. Indeed, lower AR expression and attenuated AR signature activity is shown in CRPC tissues, especially in the subset of neuroendocrine prostate cancer (NEPC) and prostate cancer stem-like cells (PCSCs). However, the significance of AR downregulation in androgen insensitivity and de-differentiation of tumor cells in CRPC is poorly understood and much neglected. Our previous study shows that the orphan nuclear receptor TLX (NR2E1), which is upregulated in prostate cancer, plays an oncogenic role in prostate carcinogenesis by suppressing oncogene-induced senescence. In the present study, we further established that TLX exhibited an increased expression in metastatic CRPC. Further analyses showed that overexpression of TLX could confer resistance to androgen deprivation and anti-androgen in androgen-dependent prostate cancer cells in vitro and in vivo, whereas knockdown of endogenous TLX could potentiate the sensitivity to androgen deprivation and anti-androgen in prostate cancer cells. Our study revealed that the TLX-induced resistance to androgen deprivation and anti-androgen was mediated through its direct suppression of AR gene transcription and signaling in both androgen-stimulated and -unstimulated prostate cancer cells. We also characterized that TLX could bind directly to AR promoter and repress AR transcription by recruitment of histone modifiers, including HDAC1, HDAC3, and LSD1. Together, our present study shows, for the first time, that TLX can contribute to androgen insensitivity in CRPC via repression of AR gene transcription and signaling, and also implicates that targeting the druggable TLX may have a potential therapeutic significance in CRPC management, particularly in NEPC and PCSCs.

Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2014-10-01

Res 62:4736-45, (2002). PMC: 12183433. 14. Liu S, Dontu G, Mantle ID, Patel S, Ahn NS, Jackson KW, Suri P, Wicha MS. Hedgehog signaling and Bmi-1...Among these interacting pathways are BMI-1, OCT3/4, Hedgehog (Hh), Wnt/β-catenin, Notch signaling, Hox gene family, PTEN/Akt pathway, efflux...cancer, and cancer stem cells. Nature 414, 105-111 (2001). 50. Liu, S., et al. Hedgehog signaling and Bmi-1 regulate self-renewal of normal and

Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2014-10-01

G, Mantle ID, Patel S, Ahn NS, Jackson KW, Suri P, Wicha MS. Hedgehog signaling and Bmi-1 regulate self-renewal of normal and malignant human...1, OCT3/4, Hedgehog (Hh), Wnt/β-catenin, Notch signaling, Hox gene family, PTEN/Akt pathway, efflux transporters such as ABCG markers of self...105-111 (2001). 50. Liu, S., et al. Hedgehog signaling and Bmi-1 regulate self-renewal of normal and malignant human mammary stem cells. Cancer

Formulation of the bivalent prostate cancer vaccine with surgifoam elicits antigen-specific effector T cells in PSA-transgenic mice.

PubMed

Karan, Dev

2017-10-13

We previously developed and characterized an adenoviral-based prostate cancer vaccine for simultaneous targeting of prostate-specific antigen (PSA) and prostate stem cell antigen (PSCA). We also demonstrated that immunization of mice with the bivalent vaccine (Ad 5 -PSA+PSCA) inhibited the growth of established prostate tumors. However, there are multiple challenges hindering the success of immunological therapies in the clinic. One of the prime concerns has been to overcome the immunological tolerance and maintenance of long-term effector T cells. In this study, we further characterized the use of the bivalent vaccine (Ad 5 -PSA+PSCA) in a transgenic mouse model expressing human PSA in the mouse prostate. We demonstrated the expression of PSA analyzed at the mRNA level (by RT-PCR) and protein level (by immunohistochemistry) in the prostate lobes harvested from the PSA-transgenic (PSA-Tg) mice. We established that the administration of the bivalent vaccine in surgifoam to the PSA-Tg mice induces strong PSA-specific effector CD8 + T cells as measured by IFN-γ secretion and in vitro cytotoxic T-cell assay. Furthermore, the use of surgifoam with Ad 5 -PSA+PSCA vaccine allows multiple boosting vaccinations with a significant increase in antigen-specific CD8 + T cells. These observations suggest that the formulation of the bivalent prostate cancer vaccine (Ad 5 -PSA+PSCA) with surgifoam bypasses the neutralizing antibody response, thus allowing multiple boosting. This formulation is also helpful for inducing an antigen-specific immune response in the presence of self-antigen, and maintains long-term effector CD8 + T cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Exosomes Secreted under Hypoxia Enhance Invasiveness and Stemness of Prostate Cancer Cells by Targeting Adherens Junction Molecules

PubMed Central

Ramteke, Anand; Ting, Harold; Agarwal, Chapla; Mateen, Samiha; Somasagara, Ranganathan; Hussain, Anowar; Graner, Michael; Frederick, Barbara; Agarwal, Rajesh; Deep, Gagan

2015-01-01

Hypoxic conditions in prostate cancer (PCA) are associated with poor prognosis; however, precise mechanism/s through which hypoxia promotes malignant phenotype remains unclear. Here, we analyzed the role of exosomes from hypoxic PCA cells in enhancing the invasiveness and stemness of naïve PCA cells, as well as in promoting cancer-associated fibroblast (CAF) phenotype in prostate stromal cells (PrSC). Human PCA LNCaP and PC3 cells were exposed to hypoxic (1% O2) or normoxic (21% O2) conditions, and exosomes secreted under hypoxic (ExoHypoxic) and normoxic (ExoNormoxic) conditions were isolated from conditioned media. Nanoparticle tracking analysis revealed that ExoHypoxic have smaller average size as compared to ExoNormoxic. Immunoblotting results showed a higher level of tetraspanins (CD63 and CD81), heat shock proteins (HSP90 and HSP70) and Annexin II in ExoHypoxic compared to ExoNormoxic. Co-culturing with ExoHypoxic increased the invasiveness and motility of naïve LNCaP and PC3 cells, respectively. ExoHypoxic also promoted prostasphere formation by both LNCaP and PC3 cells, and enhanced α-SMA (a CAF biomarker) expression in PrSC. Compared to ExoNormoxic, ExoHypoxic showed higher metalloproteinases activity and increased level of diverse signaling molecules (TGF-β2, TNF1α, IL6, TSG101, Akt, ILK1, and β-catenin). Furthermore, proteome analysis revealed a higher number of proteins in ExoHypoxic (160 proteins) compared to ExoNormoxic (62 proteins), primarily associated with the remodeling of epithelial adherens junction pathway. Importantly, ExoHypoxic targeted the expression of adherens junction proteins in naïve PC3 cells. These findings suggest that ExoHypoxic are loaded with unique proteins that could enhance invasiveness, stemness and induce microenvironment changes; thereby, promoting PCA aggressiveness. PMID:24347249

The natural flavonoid apigenin sensitizes human CD44+ prostate cancer stem cells to cisplatin therapy.

PubMed

Erdogan, Suat; Turkekul, Kader; Serttas, Rıza; Erdogan, Zeynep

2017-04-01

Prostate cancer (PCa) is the second most common type of cancer and the fifth leading cause of cancer-related death among men. Development of chemoresistance, tumor relapse and metastasis remain major barriers to effective treatment and all been identified to be associated with cancer stem cells (CSCs). Natural flavonoids such as apigenin have been shown to have the ability to improve the therapeutic efficacy of common chemotherapy agents through CSCs sensitization. Thus, the aim of this study was to evaluate the combination of apigenin with cisplatin on CD44 + PCa stem cell growth and migration. Platinum-based anti-neoplastic drugs have been used to treat a number of malignancies including PCa. However, acquired resistance and side effects unfortunately have limited cisplatin's use. A CD44 + subpopulation was isolated from human androgen-independent PC3 PCa cells by using human CD44-PE antibody. IC 50 values were determined by MTT test. RT-qPCR, Western blot analyses and image-based cytometer were used to investigate apoptosis, cell cycle and their underlying molecular mechanisms. Cell migration was evaluated by wound healing test. The combination of the IC 50 doses of apigenin (15μM) and cisplatin (7.5μM) for 48h significantly enhanced cisplatin's cytotoxic and apoptotic effects through downregulation of Bcl-2, sharpin and survivin; and upregulation of caspase-8, Apaf-1 and p53 mRNA expression. The combined therapy suppressed the phosphorylation of p-PI3K and p-Akt, inhibited the protein expression of NF-κB, and downregulated the cell cycle by upregulating p21, as well as cyclin dependent kinases CDK-2, -4, and -6. Apigenin significantly increased the inhibitory effects of cisplatin on cell migration via downregulation of Snail expression. In conclusion, our study showed the possible therapeutic approach of using apigenin to potentially increase the effects of cisplatin by targeting CSCs subset in prostate cancer. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Forced LIGHT expression in prostate tumors overcomes Treg mediated immunosuppression and synergizes with a prostate tumor therapeutic vaccine by recruiting effector T lymphocytes

PubMed Central

Yan, Lisa; Da Silva, Diane M.; Verma, Bhavna; Gray, Andrew; Brand, Heike E.; Skeate, Joseph G.; Porras, Tania B.; Kanodia, Shreya; Kast, W. Martin

2014-01-01

Background LIGHT, a ligand for lymphotoxin-β receptor (LTβR) and herpes virus entry mediator, is predominantly expressed on activated immune cells and LTβR signaling leads to the recruitment of lymphocytes. The interaction between LIGHT and LTβR has been previously shown in a virus induced tumor model to activate immune cells and result in tumor regression, but the role of LIGHT in tumor immunosuppression or in a prostate cancer setting, where self antigens exist, has not been explored. We hypothesized that forced expression of LIGHT in prostate tumors would shift the pattern of immune cell infiltration, would inhibit T regulatory cells (Tregs) and would induce prostate cancer tumor associated antigen (TAA) specific T cells that would eradicate tumors. Methods Real Time PCR was used to evaluate expression of forced LIGHT and various other genes in prostate tumors samples. Adenovirus encoding murine LIGHT was injected intratumorally into TRAMP C2 prostate cancer cell tumor bearing mice for in vivo studies. Chemokine and cytokine concentrations were determined by multiplex ELISA. Flow cytometry was used to phenotype tumor infiltrating lymphocytes and expression of LIGHT on the tumor cell surface. Tumor specific lymphocytes were quantified via an ELISpot assay. Treg induction and Treg suppression assays determined Treg functionality after LIGHT treatment. Results LIGHT expression peaked within 48 hours of infection, recruited effector T cells into the tumor microenvironment that recognized mouse prostate stem cell antigen (PSCA) and inhibited the infiltration of Tregs. Tregs isolated from tumor draining lymph nodes had impaired suppressive capability after LIGHT treatment. LIGHT in combination with a therapeutic vaccine, PSCA TriVax, reduced tumor burden. Conclusion Forced LIGHT treatment combined with PSCA TriVax therapeutic vaccination delays prostate cancer progression in mice by recruiting effector T lymphocytes to the tumor and inhibiting Treg mediated immunosuppression. PMID:25399517

Correlation of mRNA and protein levels: Cell type-specific gene expression of cluster designation antigens in the prostate

PubMed Central

Pascal, Laura E; True, Lawrence D; Campbell, David S; Deutsch, Eric W; Risk, Michael; Coleman, Ilsa M; Eichner, Lillian J; Nelson, Peter S; Liu, Alvin Y

2008-01-01

Background: Expression levels of mRNA and protein by cell types exhibit a range of correlations for different genes. In this study, we compared levels of mRNA abundance for several cluster designation (CD) genes determined by gene arrays using magnetic sorted and laser-capture microdissected human prostate cells with levels of expression of the respective CD proteins determined by immunohistochemical staining in the major cell types of the prostate – basal epithelial, luminal epithelial, stromal fibromuscular, and endothelial – and for prostate precursor/stem cells and prostate carcinoma cells. Immunohistochemical stains of prostate tissues from more than 50 patients were scored for informative CD antigen expression and compared with cell-type specific transcriptomes. Results: Concordance between gene and protein expression findings based on 'present' vs. 'absent' calls ranged from 46 to 68%. Correlation of expression levels was poor to moderate (Pearson correlations ranged from 0 to 0.63). Divergence between the two data types was most frequently seen for genes whose array signals exceeded background (> 50) but lacked immunoreactivity by immunostaining. This could be due to multiple factors, e.g. low levels of protein expression, technological sensitivities, sample processing, probe set definition or anatomical origin of tissue and actual biological differences between transcript and protein abundance. Conclusion: Agreement between these two very different methodologies has great implications for their respective use in both molecular studies and clinical trials employing molecular biomarkers. PMID:18501003

Monoacylglycerol lipase exerts dual control over endocannabinoid and fatty acid pathways to support prostate cancer.

PubMed

Nomura, Daniel K; Lombardi, Donald P; Chang, Jae Won; Niessen, Sherry; Ward, Anna M; Long, Jonathan Z; Hoover, Heather H; Cravatt, Benjamin F

2011-07-29

Cancer cells couple heightened lipogenesis with lipolysis to produce fatty acid networks that support malignancy. Monoacylglycerol lipase (MAGL) plays a principal role in this process by converting monoglycerides, including the endocannabinoid 2-arachidonoylglycerol (2-AG), to free fatty acids. Here, we show that MAGL is elevated in androgen-independent versus androgen-dependent human prostate cancer cell lines, and that pharmacological or RNA-interference disruption of this enzyme impairs prostate cancer aggressiveness. These effects were partially reversed by treatment with fatty acids or a cannabinoid receptor-1 (CB1) antagonist, and fully reversed by cotreatment with both agents. We further show that MAGL is part of a gene signature correlated with epithelial-to-mesenchymal transition and the stem-like properties of cancer cells, supporting a role for this enzyme in protumorigenic metabolism that, for prostate cancer, involves the dual control of endocannabinoid and fatty acid pathways. Copyright © 2011 Elsevier Ltd. All rights reserved.

CIP2A is a candidate therapeutic target in clinically challenging prostate cancer cell populations.

PubMed

Khanna, Anchit; Rane, Jayant K; Kivinummi, Kati K; Urbanucci, Alfonso; Helenius, Merja A; Tolonen, Teemu T; Saramäki, Outi R; Latonen, Leena; Manni, Visa; Pimanda, John E; Maitland, Norman J; Westermarck, Jukka; Visakorpi, Tapio

2015-08-14

Residual androgen receptor (AR)-signaling and presence of cancer stem-like cells (SCs) are the two emerging paradigms for clinically challenging castration-resistant prostate cancer (CRPC). Therefore, identification of AR-target proteins that are also overexpressed in the cancer SC population would be an attractive therapeutic approach.Our analysis of over three hundred clinical samples and patient-derived prostate epithelial cultures (PPECs), revealed Cancerous inhibitor of protein phosphatase 2A (CIP2A) as one such target. CIP2A is significantly overexpressed in both hormone-naïve prostate cancer (HN-PC) and CRPC patients . CIP2A is also overexpressed, by 3- and 30-fold, in HN-PC and CRPC SCs respectively. In vivo binding of the AR to the intronic region of CIP2A and its functionality in the AR-moderate and AR-high expressing LNCaP cell-model systems is also demonstrated. Further, we show that AR positively regulates CIP2A expression, both at the mRNA and protein level. Finally, CIP2A depletion reduced cell viability and colony forming efficiency of AR-independent PPECs as well as AR-responsive LNCaP cells, in which anchorage-independent growth is also impaired.These findings identify CIP2A as a common denominator for AR-signaling and cancer SC functionality, highlighting its potential therapeutic significance in the most clinically challenging prostate pathology: castration-resistant prostate cancer.

Orphan nuclear receptor TLX functions as a potent suppressor of oncogene-induced senescence in prostate cancer via its transcriptional co-regulation of the CDKN1A (p21(WAF1) (/) (CIP1) ) and SIRT1 genes.

PubMed

Wu, Dinglan; Yu, Shan; Jia, Lin; Zou, Chang; Xu, Zhenyu; Xiao, Lijia; Wong, Kam-Bo; Ng, Chi-Fai; Chan, Franky L

2015-05-01

Oncogene-induced senescence is an important tumour-suppressing mechanism to prevent both premalignant transformation and cancer progression. Overcoming this process is a critical step in early cancer development. The druggable orphan nuclear receptor TLX (NR2E1) is characterized as an important regulator of neural stem cells and is also implicated in the development of some brain tumours. However, its exact functional roles in cancer growth regulation still remain unclear. Here we report that TLX can act as a promoter of tumourigenesis in prostate cancer by suppressing oncogene-induced senescence. We determined that TLX exhibited an increased expression in high-grade prostate cancer tissues and many prostate cancer cell lines. Functional studies revealed that TLX could perform an oncogenic function in prostate cancer cells, as its knockdown triggered cellular senescence and cell growth arrest in vitro and in vivo, whereas its over-expression promoted the malignant growth of prostate cancer cells. Furthermore, enhancement of TLX activity, by either ectopic expression or ligand stimulation, could potently prevent doxorubicin-induced senescence in prostate cancer cells and also allow prostatic epithelial cells to escape oncogene-induced senescence induced either by activated oncogene H-Ras(G12V) or knockdown of tumour suppressor PTEN, via a mechanism of direct but differential transcriptional regulation of two senescence-associated genes, repression of CDKN1A and transactivation of SIRT1. Together, our present study shows, for the first time, that TLX may play an important role in prostate carcinogenesis through its suppression of oncogene-induced senescence, and also suggests that targeting the senescence-regulatory TLX is of potential therapeutic significance in prostate cancer. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

PubMed

Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

2018-05-03

Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

Expression profile of undifferentiated cell transcription factor 1 in normal and cancerous human epithelia.

PubMed

Mouallif, Mustapha; Albert, Adelin; Zeddou, Mustapha; Ennaji, My Mustapha; Delvenne, Philippe; Guenin, Samuel

2014-08-01

Undifferentiated cell Transcription Factor 1 (UTF1) is a chromatin-bound protein involved in stem cell differentiation. It was initially reported to be restricted to stem cells or germinal tissues. However, recent work suggests that UTF1 is also expressed in somatic cells and that its expression may increase during carcinogenesis. To further clarify the expression profile of UTF1, we evaluated UTF1 expression levels immunohistochemically in eight normal human epithelia (from breast, prostate, endometrium, bladder, colon, oesophagus, lung and kidney) and their corresponding tumours as well as in several epithelial cell lines. We showed UTF1 staining in normal and tumour epithelial tissues, but with varying intensities according to the tissue location. In vitro analyses also revealed that UTF1 is expressed in somatic epithelial cell lines even in the absence of Oct4A and Sox2, its two main known regulators. The comparison of UTF1 levels in normal and tumoral tissues revealed significant overexpression in endometrial and prostatic adenocarcinomas, whereas lower intensity of the staining was observed in renal and colic tumours, suggesting a potential tissue-specific function of UTF1. Altogether, these results highlight a potential dual role for UTF1, acting either as an oncogene or as a tumour suppressor depending on the tissue. These findings also question its role as a specific marker for stem cells. © 2014 The Authors. International Journal of Experimental Pathology © 2014 International Journal of Experimental Pathology.

Steady advance of stem cell therapies: report from the 2011 World Stem Cell Summit, Pasadena, California, October 3-5.

PubMed

Swan, Melanie

2011-12-01

Stem cell research and related therapies (including regenerative medicine and cellular therapies) could have a significant near-term impact on worldwide public health and aging. One reason is the industry's strong linkage between policy, science, industry, and patient advocacy, as was clear in the attendance and programming at the 7(th) annual World Stem Cell Summit held in Pasadena, California, October 3-5, 2011. A special conference session sponsored by the SENS Foundation discussed how stem cell therapies are being used to extend healthy life span. Stem cells are useful not only in cell-replacement therapies, but also in disease modeling, drug discovery, and drug toxicity screening. Stem cell therapies are currently being applied to over 50 diseases, including heart, lung, neurodegenerative, and eye disease, cancer, and human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS). Dozens of companies are developing therapeutic solutions that are in different stages of clinical use and clinical trials. Some high-profile therapies include Dendreon's Provenge for prostate cancer, Geron's first-ever embryonic stem cell trials for spinal cord injury, Fibrocell's laViv cellular therapy for wrinkles, and well-established commercial skin substitutes (Organogenesis' Apligraf and Advanced BioHealing's Dermagraft). Stem cell policy issues under consideration include medical tourism, standards for large-scale stem cell manufacturing, and lingering ethical debates over the use of embryonic stem cells. Contemporary stem cell science advances include a focus on techniques for the direct reprogramming of cells from one lineage to another without returning to pluripotency as an intermediary step, improved means of generating and characterizing induced pluripotent cells, and progress in approaches to neurodegenerative disease.

Downregulation of microRNA‑574 in cancer stem cells causes recurrence of prostate cancer via targeting REL.

PubMed

Lai, Xiaodong; Guo, Yanchun; Guo, Zhitao; Liu, Ruibao; Wang, Xunguo; Wang, Fang

2016-12-01

miR‑574‑5p has been reported involved in the pathogenesis of numerous human malignancies such as colorectal and lung cancer. In this study, we aimed to explore the roles of REL and miR‑574 in the recurrence of prostate cancer (PCa) and to identify the underlying molecular mechanisms. Our literature search found that miR‑574 is regulated in cancer stem cells (CSCs), and next we used the microRNA (miRNA) database (www.mirdb.org) to find REL as a target of miR‑574. Luciferase assay was performed to verify the miRNA/target relationship. Oligo-transfection, real‑time PCR and western blot analysis were used to support the conclusions. We validated REL to be the direct gene via luciferase reporter assay system, and real‑time PCR and western blot analysis were also conducted to study the mRNA and protein expression level of REL between different groups (recurrence and non‑recurrence) or cells treated with scramble control, miR‑574 mimics, REL siRNA and miR‑574 inhibitors, indicating the negative regulatory relationship between miR‑574 and REL. We also investigated the relative viability of prostate CSCs when transfected with scramble control, miR‑574 mimics, REL siRNA and miR‑574 inhibitors to validate miR‑574 to be positively interfering with the viability of prostate CSCs. We then investigated the relative apoptosis of prostate CSCs when transfected with scramble control, miR‑574 mimics, REL siRNA and miR‑574 inhibitors. The results showed miR‑574 inhibited apoptosis. In conclusion, miR‑574 might be a novel prognostic and therapeutic target in the management of PCa recurrence.

The stem cell factor (SCF)/c-KIT signalling in testis and prostate cancer.

PubMed

Cardoso, Henrique J; Figueira, Marília I; Socorro, Sílvia

2017-12-01

The stem cell factor (SCF) is a cytokine that specifically binds the tyrosine kinase receptor c-KIT. The SCF/c-KIT interaction leads to receptor dimerization, activation of kinase activity and initiation of several signal transduction pathways that control cell proliferation, apoptosis, differentiation and migration in several tissues. The activity of SCF/c-KIT system is linked with the phosphatidylinositol 3-kinase (PI3-K), the Src, the Janus kinase/signal transducers and activators of transcription (JAK/STAT), the phospholipase-C (PLC-γ) and the mitogen-activated protein kinase (MAPK) pathways. Moreover, it has been reported that cancer cases display an overactivation of c-KIT due to the presence of gain-of-function mutations or receptor overexpression, which renders c-KIT a tempting target for cancer treatment. In the case of male cancers the most documented activated pathways are the PI3-K and Src, both enhancing abnormal cell proliferation. It is also known that the Src activity in prostate cancer cases depends on the presence of tr-KIT, the cytoplasmic truncated variant of c-KIT that is specifically expressed in tumour tissues and, thus, a very interesting target for drug development. The present review provides an overview of the signalling pathways activated by SCF/c-KIT and discusses the potential application of c-KIT inhibitors for treatment of testicular and prostatic cancers.

Prostate stem cell antigen is overexpressed in human transitional cell carcinoma.

PubMed

Amara, N; Palapattu, G S; Schrage, M; Gu, Z; Thomas, G V; Dorey, F; Said, J; Reiter, R E

2001-06-15

Prostate stem cell antigen (PSCA), a homologue of the Ly-6/Thy-1 family of cell surface antigens, is expressed by a majority of human prostate cancers and is a promising target for prostate cancer immunotherapy. In addition to its expression in normal and malignant prostate, we recently reported that PSCA is expressed at low levels in the transitional epithelium of normal bladder. In the present study, we compared the expression of PSCA in normal and malignant urothelial tissues to assess its potential as an immunotherapeutic target in transitional cell carcinoma (TCC). Immunohistochemical analysis of PSCA protein expression was performed on tissue sections from 32 normal bladder specimens, as well as 11 cases of low-grade transitional cell dysplasia, 21 cases of carcinoma in situ (CIS), 38 superficial transitional cell tumors (STCC, stages T(a)-T(1)), 65 muscle-invasive TCCs (ITCCs, stages T(2)-T(4)), and 7 bladder cancer metastases. The level of PSCA protein expression was scored semiquantitatively by assessing both the intensity and frequency (i.e., percentage of positive tumor cells) of staining. We also examined PSCA mRNA expression in a representative sample of normal and malignant human transitional cell tissues. In normal bladder, PSCA immunostaining was weak and confined almost exclusively to the superficial umbrella cell layer. Staining in CIS and STCC was more intense and uniform than that seen in normal bladder epithelium (P < 0.001), with staining detected in 21 (100%) of 21 cases of CIS and 37 (97%) of 38 superficial tumors. PSCA protein was also detected in 42 (65%) of 65 of muscle-invasive and 4 (57%) of 7 metastatic cancers, with the highest levels of PSCA expression (i.e., moderate-strong staining in >50% of tumor cells) seen in 32% of invasive and 43% of metastatic samples. Higher levels of PSCA expression correlated with increasing tumor grade for both STCCs and ITCCs (P < 0.001). Northern blot analysis confirmed the immunohistochemical data, showing a dramatic increase in PSCA mRNA expression in two of five muscle-invasive transitional cell tumors when compared with normal samples. Confocal microscopy demonstrated that PSCA expression in TCC is confined to the cell surface. These data demonstrate that PSCA is overexpressed in a majority of human TCCs, particularly CIS and superficial tumors, and may be a useful target for bladder cancer diagnosis and therapy.

[Bone marrow mesenchymal stem cells suppress E coli-induced bacterial prostatitis in rats].

PubMed

Han, Guang-wei; Liu, Cheng-cheng; Gao, Wen-hong; Cui, Dong; Yi, Shan-hong

2015-04-01

To investigate the inhibitory effect of bone marrow mesenchymal stem cells (BMSCs) on E coliinduced prostatitis in rats. BMSCs were isolated, cultured and amplified by the attached choice method. Fifty SD rats were randomized into five groups of equal number: normal control, acute bacterial prostatitis (ABP) , chronic bacterial prostatitis (CBP), ABP + BMSCs, and CBP + BMSCs, and the animals in the latter four groups were injected with E. coli into both sides of the prostate under ultrasound guidance for 1 - 14 days to induce ABP and for 4 - 12 weeks to induce CBP. The control rats were injected with the same amount of PBS. Two weeks after injection of BMSCs into the prostates, pathomorphological changes in the prostate were observed under the light microscope and the mRNA and protein levels of IL-1β and TNF-α determined by RT-PCR and ELISA, respectively, followed by statistical analysis with SPSS 18.0. Histopathological evaluation showed typical pathological inflammatory changes in the prostates of the rats in the ABP and CBP groups, including glandular structural changes, interstitial edema, inflammatory cell infiltration, and fibrous hyperplasia, which were all remarkably relieved after treated with BMSCs. The mRNA and protein levels of IL-β ([0.829 ± 0.121] and [271.75 ± 90.59] pg/ml) and TNF-α ([0.913 ± 0. 094] and [105.78 ± 19. 05] pg/ml) in the ABP and those of IL-1β ([0. 975 ± 0. 114] and [265. 31 ± 71. 34] pg/ml) and TNF-α ([0. 886 ± 0. 084] and [107. 45 ± 26. 11 ] pg/ml) in the CBP groups were significantly higher than those in the control rats ([0. 342 ± 0.087] and [45.76 17. 99] pg/ml, P <0. 05); ([0.247 ± 0.054] and ([19.42 ± 7. 75] pg/ml, P <0. 01) as well as than those in the ABP + BMSCs ([0. 433 ± 0. 072] and [51. 34 ± 22. 13] pg/ml, P < 0. 05 ) ; ( [0. 313 ± 0. 076] and [28. 38 ± 8. 78] pg/ml, P < 0. 01) and the CBP + BMSCs group ([0.396 ± 0.064] and [56.37 ± 21.22] pg/ml, P <0.05); ([0.417 ± 0.068] and [29.21 ± 10.22] pg/ml, P <0.01). Injection of BMSCs can reduce E coli-induced prostatic inflammation reaction, which.may be associated with its reduction of inflammatory cell infiltration and the expressions of IL-1β and TNF-α in the prostate tissue.

Targeting Notch signalling pathway of cancer stem cells.

PubMed

Venkatesh, Vandana; Nataraj, Raghu; Thangaraj, Gopenath S; Karthikeyan, Murugesan; Gnanasekaran, Ashok; Kaginelli, Shanmukhappa B; Kuppanna, Gobianand; Kallappa, Chandrashekrappa Gowdru; Basalingappa, Kanthesh M

2018-01-01

Cancer stem cells (CSCs) have been defined as cells within tumor that possess the capacity to self-renew and to cause the heterogeneous lineages of cancer cells that comprise the tumor. CSCs have been increasingly identified in blood cancer, prostate, ovarian, lung, melanoma, pancreatic, colon, brain and many more malignancies. CSCs have slow growth rate and are resistant to chemotherapy and radiotherapy that lead to the failure of traditional current therapy. Eradicating the CSCs and recurrence, is promising aspect for the cure of cancer. The CSCs like any other stem cells activate the signal transduction pathways that involve the development and tissue homeostasis, which include Notch signaling pathway. The new treatment targets these pathway that control stem-cell replication, survival and differentiation that are under development. Notch inhibitors either single or in combination with chemotherapy drugs have been developed to treat cancer and its recurrence. This approach of targeting signaling pathway of CSCs represents a promising future direction for the therapeutic strategy to cure cancer.

Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression

PubMed Central

Russo, Maria Veronica; Gazzano, Giacomo; Giangiobbe, Sara; Montanari, Emanuele; Del Nero, Alberto; Rocco, Bernardo; Albo, Giancarlo; Languino, Lucia R.; Altieri, Dario C.; Vaira, Valentina; Bosari, Silvano

2015-01-01

Most men diagnosed with prostate cancer will have an indolent and curable disease, whereas approximately 15% of these patients will rapidly progress to a castrate-resistant and metastatic stage with high morbidity and mortality. Therefore, the identification of molecular signature(s) that detect men at risk of progressing disease remains a pressing and still unmet need for these patients. Here, we used an integrated discovery platform combining prostate cancer cell lines, a Transgenic Adenocarcinoma of the Mouse Prostate (TRAMP) model and clinically-annotated human tissue samples to identify loss of expression of microRNA-34b as consistently associated with prostate cancer relapse. Mechanistically, this was associated with epigenetics silencing of the MIR34B/C locus and increased DNA copy number loss, selectively in androgen-dependent prostate cancer. In turn, loss of miR-34b resulted in downstream deregulation and overexpression of the “stemness” marker, Sox2. These findings identify loss of miR-34b as a robust biomarker for prostate cancer progression in androgen-sensitive tumors, and anticipate a potential role of progenitor/stem cell signaling in this stage of disease. PMID:26107383

Dietary tomato and lycopene impact androgen signaling- and carcinogenesis-related gene expression during early TRAMP prostate carcinogenesis

PubMed Central

Wan, Lei; Tan, Hsueh-Li; Thomas-Ahner, Jennifer M.; Pearl, Dennis K.; Erdman, John W.; Moran, Nancy E.; Clinton, Steven K.

2014-01-01

Consumption of tomato products containing the carotenoid lycopene is associated with a reduced risk of prostate cancer. To identify gene expression patterns associated with early testosterone-driven prostate carcinogenesis, which are impacted by dietary tomato and lycopene, wild type (WT) and transgenic adenocarcinoma of the mouse prostate (TRAMP) mice were fed control or tomato- or lycopene-containing diets from 4-10 wk-of-age. Eight-week-old mice underwent sham surgery, castration, or castration followed by testosterone-repletion (2.5 mg/kg/d initiated 1 wk after castration). Ten-wk-old intact TRAMP mice exhibit early multifocal prostatic intraepithelial neoplasia (PIN). Of the 200 prostate cancer-related genes measured by quantitative NanoString®, 189 are detectable, 164 significantly differ by genotype, 179 by testosterone status, and 30 by diet type (P<0.05). In TRAMP, expression of Birc5, Mki67, Aurkb, Ccnb2, Foxm1, and Ccne2 is greater compared to WT and is decreased by castration. In parallel, castration reduces Ki67-positive staining (P<0.0001) compared to intact and testosterone-repleted TRAMP mice. Expression of genes involved in androgen metabolism/signaling pathways are reduced by lycopene feeding (Srd5a1) and by tomato-feeding (Srd5a2, Pxn, and Srebf1). Additionally, tomato-feeding significantly reduced expression of genes associated with stem cell features, Aldh1a and Ly6a, while lycopene-feeding significantly reduced expression of neuroendocrine differentiation-related genes, Ngfr and Syp. Collectively, these studies demonstrate a profile of testosterone-regulated genes associated with early stages of prostate carcinogenesis that are potential mechanistic targets of dietary tomato components. Future studies on androgen signaling/metabolism, stem cell features, and neuroendocrine differentiation pathways may elucidate the mechanisms by which dietary tomato and lycopene impact prostate cancer risk. PMID:25315431

Automatic cell cloning assay for determining the clonogenic capacity of cancer and cancer stem-like cells.

PubMed

Fedr, Radek; Pernicová, Zuzana; Slabáková, Eva; Straková, Nicol; Bouchal, Jan; Grepl, Michal; Kozubík, Alois; Souček, Karel

2013-05-01

The clonogenic assay is a well-established in vitro method for testing the survival and proliferative capability of cells. It can be used to determine the cytotoxic effects of various treatments including chemotherapeutics and ionizing radiation. However, this approach can also characterize cells with different phenotypes and biological properties, such as stem cells or cancer stem cells. In this study, we implemented a faster and more precise method for assessing the cloning efficiency of cancer stem-like cells that were characterized and separated using a high-speed cell sorter. Cell plating onto a microplate using an automatic cell deposition unit was performed in a single-cell or dilution rank mode by the fluorescence-activated cell sorting method. We tested the new automatic cell-cloning assay (ACCA) on selected cancer cell lines and compared it with the manual approach. The obtained results were also compared with the results of the limiting dilution assay for different cell lines. We applied the ACCA to analyze the cloning capacity of different subpopulations of prostate and colon cancer cells based on the expression of the characteristic markers of stem (CD44 and CD133) and cancer stem cells (TROP-2, CD49f, and CD44). Our results revealed that the novel ACCA is a straightforward approach for determining the clonogenic capacity of cancer stem-like cells identified in both cell lines and patient samples. Copyright © 2013 International Society for Advancement of Cytometry.

Vaccine-instructed intratumoral IFN-γ enables regression of autochthonous mouse prostate cancer in allogeneic T-cell transplantation.

PubMed

Hess Michelini, Rodrigo; Manzo, Teresa; Sturmheit, Tabea; Basso, Veronica; Rocchi, Martina; Freschi, Massimo; Listopad, Joanna; Blankenstein, Thomas; Bellone, Matteo; Mondino, Anna

2013-08-01

Vaccination can synergize with transplantation of allogeneic hematopoietic stem cells to cure hematologic malignancies, but the basis for this synergy is not understood to the degree where such approaches could be effective for treating solid tumors. We investigated this issue in a transgenic mouse model of prostate cancer treated by transplantation of a nonmyeloablative MHC-matched, single Y chromosome-encoded, or multiple minor histocompatibility antigen-mismatched hematopoietic cell preparation. Here, we report that tumor-directed vaccination after allogeneic hematopoietic stem cell transplantation and donor lymphocyte infusion is essential for acute graft versus tumor responses, tumor regression, and prolonged survival. Vaccination proved essential for generation of CD8(+) IFN-γ(+) tumor-directed effector cells in secondary lymphoid organs and also for IFN-γ(+) upregulation at the tumor site, which in turn instructed local expression of proinflammatory chemokines and intratumoral recruitment of donor-derived T cells for disease regression. Omitting vaccination, transplanting IFN-γ-deficient donor T cells, or depleting alloreactive T cells all compromised intratumoral IFN-γ-driven inflammation and lymphocyte infiltration, abolishing antitumor responses and therapeutic efficacy of the combined approach. Our findings argue that posttransplant tumor-directed vaccination is critical to effectively direct donor T cells to the tumor site in cooperation with allogeneic hematopoietic cell transplantation. ©2013 AACR.

PSCA expression is associated with favorable tumor features and reduced PSA recurrence in operated prostate cancer.

PubMed

Heinrich, Marie-Christine; Göbel, Cosima; Kluth, Martina; Bernreuther, Christian; Sauer, Charlotte; Schroeder, Cornelia; Möller-Koop, Christina; Hube-Magg, Claudia; Lebok, Patrick; Burandt, Eike; Sauter, Guido; Simon, Ronald; Huland, Hartwig; Graefen, Markus; Heinzer, Hans; Schlomm, Thorsten; Heumann, Asmus

2018-05-31

Prostate Stem Cell Antigen (PSCA) is frequently expressed in prostate cancer but its exact function is unclear. To clarify contradictory findings on the prognostic role of PSCA expression, a tissue microarray containing 13,665 prostate cancers was analyzed by immunohistochemistry. PSCA staining was absent in normal epithelial and stromal cells of the prostate. Membranous and cytoplasmic PSCA staining was seen in 53.7% of 9642 interpretable tumors. Staining was weak in 22.4%, moderate in 24.5% and strong in 6.8% of tumors. PSCA expression was associated with favorable pathological and clinical tumor features: Early pathological tumor stage (p < 0.0001), low Gleason grade (p < 0.0001), absence of lymph node metastasis (p < 0.0001), low pre-operative PSA level (p = 0.0118), negative surgical margin (p < 0.0001) and reduced PSA recurrence (p < 0.0001). PSCA expression was an independent predictor of prognosis in multivariate analysis (hazard ratio 0.84, p < 0.0001). The absence of statistical relationship to TMPRSS2:ERG fusion status, chromosomal deletion or high tumor cell proliferation argues against a major role of PSCA for regulation of cell cycle or genomic integrity. PSCA expression is linked to favorable prognosis. PSCA measurement is a candidate for inclusion in multi-parametric prognostic prostate cancer tests.

Propagation of human spermatogonial stem cells in vitro.

PubMed

Sadri-Ardekani, Hooman; Mizrak, Sefika C; van Daalen, Saskia K M; Korver, Cindy M; Roepers-Gajadien, Hermien L; Koruji, Morteza; Hovingh, Suzanne; de Reijke, Theo M; de la Rosette, Jean J M C H; van der Veen, Fulco; de Rooij, Dirk G; Repping, Sjoerd; van Pelt, Ans M M

2009-11-18

Young boys treated with high-dose chemotherapy are often confronted with infertility once they reach adulthood. Cryopreserving testicular tissue before chemotherapy and autotransplantation of spermatogonial stem cells at a later stage could theoretically allow for restoration of fertility. To establish in vitro propagation of human spermatogonial stem cells from small testicular biopsies to obtain an adequate number of cells for successful transplantation. Study performed from April 2007 to July 2009 using testis material donated by 6 adult men who underwent orchidectomy as part of prostate cancer treatment. Testicular cells were isolated and cultured in supplemented StemPro medium; germline stem cell clusters that arose were subcultured on human placental laminin-coated dishes in the same medium. Presence of spermatogonia was determined by reverse transcriptase polymerase chain reaction and immunofluorescence for spermatogonial markers. To test for the presence of functional spermatogonial stem cells in culture, xenotransplantation to testes of immunodeficient mice was performed, and migrated human spermatogonial stem cells after transplantation were detected by COT-1 fluorescence in situ hybridization. The number of colonized spermatogonial stem cells transplanted at early and later points during culture were counted to determine propagation. Propagation of spermatogonial stem cells over time. Testicular cells could be cultured and propagated up to 15 weeks. Germline stem cell clusters arose in the testicular cell cultures from all 6 men and could be subcultured and propagated up to 28 weeks. Expression of spermatogonial markers on both the RNA and protein level was maintained throughout the entire culture period. In 4 of 6 men, xenotransplantation to mice demonstrated the presence of functional spermatogonial stem cells, even after prolonged in vitro culture. Spermatogonial stem cell numbers increased 53-fold within 19 days in the testicular cell culture and increased 18,450-fold within 64 days in the germline stem cell subculture. Long-term culture and propagation of human spermatogonial stem cells in vitro is achievable.

Gene Expression in Single Cells Isolated from the CWR-R1 Prostate Cancer Cell Line and Human Prostate Tissue Based on the Side Population Phenotype.

PubMed

Gangavarapu, Kalyan J; Miller, Austin; Huss, Wendy J

2016-09-01

Defining biological signals at the single cell level can identify cancer initiating driver mutations. Techniques to isolate single cells such as microfluidics sorting and magnetic capturing systems have limitations such as: high cost, labor intense, and the requirement of a large number of cells. Therefore, the goal of our current study is to identify a cost and labor effective, reliable, and reproducible technique that allows single cell isolation for analysis to promote regular laboratory use, including standard reverse transcription PCR (RT-PCR). In the current study, we utilized single prostate cells isolated from the CWR-R1 prostate cancer cell line and human prostate clinical specimens, based on the ATP binding cassette (ABC) transporter efflux of dye cycle violet (DCV), side population assay. Expression of four genes: ABCG2; Aldehyde dehydrogenase1A1 (ALDH1A1); androgen receptor (AR); and embryonic stem cell marker, Oct-4, were determined. Results from the current study in the CWR-R1 cell line showed ABCG2 and ALDH1A1 gene expression in 67% of single side population cells and in 17% or 100% of non-side population cells respectively. Studies using single cells isolated from clinical specimens showed that the Oct-4 gene is detected in only 22% of single side population cells and in 78% of single non-side population cells. Whereas, AR gene expression is in 100% single side population and non-side population cells isolated from the same human prostate clinical specimen. These studies show that performing RT-PCR on single cells isolated by FACS can be successfully conducted to determine gene expression in single cells from cell lines and enzymatically digested tissue. While these studies provide a simple yes/no expression readout, the more sensitive quantitative RT-PCR would be able to provide even more information if necessary.

Gene Expression in Single Cells Isolated from the CWR-R1 Prostate Cancer Cell Line and Human Prostate Tissue Based on the Side Population Phenotype

PubMed Central

Gangavarapu, Kalyan J; Miller, Austin; Huss, Wendy J

2016-01-01

Defining biological signals at the single cell level can identify cancer initiating driver mutations. Techniques to isolate single cells such as microfluidics sorting and magnetic capturing systems have limitations such as: high cost, labor intense, and the requirement of a large number of cells. Therefore, the goal of our current study is to identify a cost and labor effective, reliable, and reproducible technique that allows single cell isolation for analysis to promote regular laboratory use, including standard reverse transcription PCR (RT-PCR). In the current study, we utilized single prostate cells isolated from the CWR-R1 prostate cancer cell line and human prostate clinical specimens, based on the ATP binding cassette (ABC) transporter efflux of dye cycle violet (DCV), side population assay. Expression of four genes: ABCG2; Aldehyde dehydrogenase1A1 (ALDH1A1); androgen receptor (AR); and embryonic stem cell marker, Oct-4, were determined. Results from the current study in the CWR-R1 cell line showed ABCG2 and ALDH1A1 gene expression in 67% of single side population cells and in 17% or 100% of non-side population cells respectively. Studies using single cells isolated from clinical specimens showed that the Oct-4 gene is detected in only 22% of single side population cells and in 78% of single non-side population cells. Whereas, AR gene expression is in 100% single side population and non-side population cells isolated from the same human prostate clinical specimen. These studies show that performing RT-PCR on single cells isolated by FACS can be successfully conducted to determine gene expression in single cells from cell lines and enzymatically digested tissue. While these studies provide a simple yes/no expression readout, the more sensitive quantitative RT-PCR would be able to provide even more information if necessary. PMID:27785389

Establishment of a dog primary prostate cancer organoid using the urine cancer stem cells.

PubMed

Usui, Tatsuya; Sakurai, Masashi; Nishikawa, Shimpei; Umata, Koji; Nemoto, Yuki; Haraguchi, Tomoya; Itamoto, Kazuhito; Mizuno, Takuya; Noguchi, Shunsuke; Mori, Takashi; Iwai, Satomi; Nakagawa, Takayuki; Yamawaki, Hideyuki; Ohama, Takashi; Sato, Koichi

2017-12-01

Dog spontaneously develop prostate cancer (PC) like humans. Because most dogs with PC have a poor prognosis, they could be used as a translational model for advanced PC in humans. Stem cell-derived 3-D organoid culture could recapitulate organ structures and physiology. Using patient tissues, a human PC organoid culture system was established. Recent study has shown that urine cells also possess the characteristic of stem cells. However, urine cell-derived PC organoids have never been produced. Therefore, we generated PC organoids using the dog urine samples. Urine organoids were successfully generated from each dog with PC. Each organoid showed cystic structures and resembled the epithelial structures of original tissues. Expression of an epithelial cell marker, E-cadherin, and a myofibloblast marker, α-SMA, was observed in the urine organoids. The organoids also expressed a basal cell marker, CK5, and a luminal cell marker, CK8. CD49f-sorted basal cell organoids rapidly grew compared with CD24-sorted luminal cell organoids. The population of CD44-positive cells was the highest in both organoids and the original urine cells. Tumors were successfully formed with the injection of the organoids into immunodeficient mice. Treatment with a microtubule inhibitor, docetaxel, but not a cyclooxygenase inhibitor, piroxicam, and an mTOR inhibitor, rapamycin, decreased the cell viability of organoids. Treatment with a Hedgehog signal inhibitor, GANT61, increased the radiosensitivity in the organoids. These findings revealed that PC organoids using urine might become a useful tool for investigating the mechanisms of the pathogenesis and treatment of PC in dogs. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Treatment of prostate cancer cell lines and primary cells using low temperature plasma

NASA Astrophysics Data System (ADS)

O'Connell, Deborah; Hirst, Adam; Frame, Fiona F.; Maitland, Norman J.

2014-10-01

The mechanisms of cell death after plasma treatment of both benign and cancerous prostate epithelial cells are investigated. Prostate cancer tissue was obtained with patient consent from targeted needle core biopsies following radical prostatectomy. Primary cells were cultured from cancer tissue and plated onto a chamber slide at a density of 10,000 cells per well in 200 microliter of stem cell media (SCM). The treated sample was previously identified as Gleason grade 7 cancer through tissue histo-pathology. A dielectric barrier discharge (DBD) jet configuration, with helium as a carrier gas, and 0.3% O2 admixture was used for treating the cells. Reactive oxygen and nitrogen species (RONS) produced by the plasma are believed to be the main mediators of the plasma-cell interaction and response. We found the concentration of reactive oxygen species (ROS) induced inside the cells increased with plasma exposure. Exposure to the plasma for >3 minutes showed high levels of DNA damage compared to untreated and hydrogen peroxide controls. Cell viability and cellular recovery are also investigated and will be presented. All findings were common to both cell lines, suggesting the potential of LTP therapy for both benign and malignant disease.

Cancer telomeres and white crows.

PubMed

Meeker, Alan K

2018-01-01

This mini-review article discusses past and present prostate-focused research on telomere and telomerase biology conducted at Johns Hopkins, through the eyes of a Donald S Coffey trainee. Included are past discoveries of abnormalities in telomere biology in the context of prostate cancer and its pre-malignant precursor prostatic intraepithelial neoplasia (PIN); the finding that telomerase activity is androgen-regulated in the prostate, and the potential role of telomerase in prostate epithelial stem cells. Also reviewed are more recent results showing that in situ telomere length measurements in patient tissue specimens may have utility in risk assessment and as a prognostic biomarker. Highlighted throughout the article are some of the training and mentorship approaches employed by the late Dr. Coffey, former Director of Urologic Research at the Brady Urological Research Institute, which inspired new research ideas, team science, and discovery.

Developing a Novel Therapeutic Strategy Targeting Kallikrein-4 to Inhibit Prostate Cancer Growth and Metastasis

DTIC Science & Technology

2015-08-01

mesenchymal transition (EMT), animal models, cancer imaging, cancer stem cells , circulating tumor cells (CTCs), metabolomics, targeted therapeutics and...metastatic tissue, and has been reported to increase PCa cell proliferation, induce epithelial-to- mesenchymal (EMT)-like changes, and could have a role...KLK4 has been reported to increase PCa cell proliferation, induce an epithelial to mesenchymal transition (EMT)-like response in PC3 PCa cells [4

In Pursuit of Prostate Cancer Stem Cells

DTIC Science & Technology

2007-01-01

cells with different tumorigenicities and primitiveness in human PCa xenografts and cell lines. In this study, we seek to reevaluate the relevancy...us prostatospheres and establish primary xenografts in order to carry out our proposed experiments. Preliminary in vitro experiments indicate that...LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT U b. ABSTRACT U c. THIS PAGE U UU 31

The Isolation and Characterization of Human Prostate Cancer Stem Cells

DTIC Science & Technology

2015-05-01

GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance

Non-coding RNAs in Prostate Cancer: From Discovery to Clinical Applications.

PubMed

Ceder, Yvonne

2016-01-01

Prostate cancer is a heterogeneous disease for which the molecular mechanisms are still not fully elucidated. Prostate cancer research has traditionally focused on genomic and epigenetic alterations affecting the proteome, but over the last decade non-coding RNAs, especially microRNAs, have been recognized to play a key role in prostate cancer progression. A considerable number of individual microRNAs have been found to be deregulated in prostate cancer and their biological significance elucidated in functional studies. This review will delineate the current advances regarding the involvement of microRNAs and their targets in prostate cancer biology as well as their potential usage in the clinical management of the disease. The main focus will be on microRNAs contributing to initiation and progression of prostate cancer, including androgen signalling, cellular plasticity, stem cells biology and metastatic processes. To conclude, implications on potential future microRNA-based therapeutics based on the recent advances regarding the interplay between microRNAs and their targets are discussed.

Prostate tumor-induced angiogenesis is blocked by exosomes derived from menstrual stem cells through the inhibition of reactive oxygen species

PubMed Central

Alcayaga-Miranda, Francisca; González, Paz L.; Lopez-Verrilli, Alejandra; Varas-Godoy, Manuel; Aguila-Díaz, Carolina; Contreras, Luis; Khoury, Maroun

2016-01-01

Mesenchymal stem cells (MSCs) secrete exosomes that are capable of modifying the tumor environment through different mechanisms including changes in the cancer-cell secretome. This activity depends on their cargo content that is largely defined by their cellular origin. Endometrial cells are fine regulators of the angiogenic process during the menstrual cycle that includes an angiostatic condition that is associated with the end of the cycle. Hence, we studied the angiogenic activity of menstrual stem cells (MenSCs)-secreted exosomes on prostate PC3 tumor cells. Our results showed that exosomes induce a reduction in VEGF secretion and NF-κB activity. Lower reactive oxygen species (ROS) production in exosomes-treated cells was detected by the DCF method, suggesting that the inhibition of the intracellular ROS impacts both NF-κB and VEGF pathways. We confirmed using tubule formation and plug transplantation assays that MenSCs-exosomes suppress the secretion of pro-angiogenic factors by the PC3 cells in a ROS-dependent manner. The inhibition of the tumor angiogenesis and, consequently, the tumor growth was also confirmed using a xenograft mouse model. Additionally, the anti-tumoral effect was associated with a reduction of tumor hemoglobin content, vascular density and inhibition of VEGF and HIF-1α expression. Importantly, we demonstrate that the exosomes anti-angiogenic effect is specific to the menstrual cell source, as bone marrow MSCs-derived exosomes showed an opposite effect on the VEGF and bFGF expression in tumor cells. Altogether, our results indicate that MenSCs-derived exosomes acts as blockers of the tumor-induced angiogenesis and therefore could be suitable for anti-cancer therapies. PMID:27286448

Co-stimulatory signaling determines tumor antigen sensitivity and persistence of CAR T cells targeting PSCA+ metastatic prostate cancer

PubMed Central

Priceman, Saul J.; Gerdts, Ethan A.; Tilakawardane, Dileshni; Kennewick, Kelly T.; Murad, John P.; Park, Anthony K.; Jeang, Brook; Yamaguchi, Yukiko; Urak, Ryan; Weng, Lihong; Chang, Wen-Chung; Wright, Sarah; Pal, Sumanta; Reiter, Robert E.; Brown, Christine E.; Forman, Stephen J.

2018-01-01

ABSTRACT Advancing chimeric antigen receptor (CAR)-engineered adoptive T cells for the treatment of solid cancers is a major focus in the field of immunotherapy, given impressive recent clinical responses in hematological malignancies. Prostate cancer may be amenable to T cell-based immunotherapy since several tumor antigens, including prostate stem-cell antigen (PSCA), are widely over-expressed in metastatic disease. While antigen selectivity of CARs for solid cancers is crucial, it is problematic due to the absence of truly restricted tumor antigen expression and potential safety concerns with “on-target off-tumor” activity. Here, we show that the intracellular co-stimulatory signaling domain can determine a CAR's sensitivity for tumor antigen expression. A 4-1BB intracellular co-stimulatory signaling domain in PSCA-CARs confers improved selectivity for higher tumor antigen density, reduced T cell exhaustion phenotype, and equivalent tumor killing ability compared to PSCA-CARs containing the CD28 co-stimulatory signaling domain. PSCA-CARs exhibit robust in vivo anti-tumor activity in patient-derived bone-metastatic prostate cancer xenograft models, and 4-1BB-containing CARs show superior T cell persistence and control of disease compared with CD28-containing CARs. Our study demonstrates the importance of co-stimulation in defining an optimal CAR T cell, and also highlights the significance of clinically relevant models in developing solid cancer CAR T cell therapies. PMID:29308300

The Isolation and Characterization of Human Prostate Cancer Stem Cells

DTIC Science & Technology

2011-02-01

2Departmentof Pathologyand LaboratoryMedicine,DavidGeffen SchoolofMedicine, Universityof Californiaat Los Angeles, Los Angeles,California...Invitrogen, ant-pm-1) and incubated at 378C in humidified air containing 5% CO2. Due to technical issues with cultivating and maintaining rodent uro

Targeting the Prostate Cancer Microenvironment to Improve Therapeutic Outcomes

DTIC Science & Technology

2013-06-01

and Kim, S. -J. 2008. Isolation and Characterization of Mouse Mesenchymal Stem Cells . Transplantation Proceedings. 40: 2649–2654. Watson, P. A...of mesenchymal cell characteristics (epithelial to mesenchymal transition, EMT), that are known to 5 enhance resistance to growth arrest signals...Multipotential Mesenchymal Cells from the Mouse Synovium. PLoS One. 7: e45517. Gilbert, L. A. and Hemann, M. T. 2010. DNA damage-mediated induction of a

Mesenchymal Stem Cell-Based Therapy for Prostate Cancer

DTIC Science & Technology

2014-09-01

method for incubating hbMSCs with radioactive sodium chromate (51CrO4). Sodium chromate is cell permeable, but following reduction to trivalent ... chromium ion intracellularly it becomes impermeable due to crosslinking to macromolecules. Chromium -labeled cells (1x106) were then injected IV into...animals bearing CWR22 xenografts. Whole tissues were excised at the respective time points and total chromium was measured using a gamma counter, which

Epidermal Growth Factor (EGF) Receptor Intron 1 CA Repeat Polymorphisms in African-American and Caucasian Males: Influence on Prostate Cancer Risk or Disease Progression and Interaction with Androgen Receptor CAG Repeat Polymorphisms

DTIC Science & Technology

2003-09-01

Adipose Stromal Cells from Tumescent Liposuction Procedures. American Society for Dermatologic Surgery, $15,000 direct, 11/01/01 -10/31/02. 1999...stromal cells from tumescent liposuction procedures" ASDS Annual Meeting, Chicago, IL, November 1,2002."Adult Multipotent Stem Cells", Coriell

Microenvironment-Programmed Metastatic Prostate Cancer Stem Cells (mPCSCs)

DTIC Science & Technology

2014-10-01

and subsequently spread, we took 3 commonly used cell lines (PC3, Du145, and LNCaP) and 2 xenograft- derived cells (LAPC9 and LAPC4) and performed...and LAPC9 models (Table 1). It should be noted that LAPC4 and LAPC9 cells used in these experiments were not cultured cells but purified from the...injecting PC3-GFP cells into the tail vein or the heart followed by determining levels of metastasis using several different approaches. FIRST, when

Exosomes from bulk and stem cells from human prostate cancer have a differential microRNA content that contributes cooperatively over local and pre-metastatic niche.

PubMed

Sánchez, Catherine A; Andahur, Eliana I; Valenzuela, Rodrigo; Castellón, Enrique A; Fullá, Juan A; Ramos, Christian G; Triviño, Juan C

2016-01-26

The different prostate cancer (PCa) cell populations (bulk and cancer stem cells, CSCs) release exosomes that contain miRNAs that could modify the local or premetastatic niche. The analysis of the differential expression of miRNAs in exosomes allows evaluating the differential biological effect of both populations on the niche, and the identification of potential biomarkers and therapeutic targets. Five PCa primary cell cultures were established to originate bulk and CSCs cultures. From them, exosomes were purified by precipitation for miRNAs extraction to perform a comparative profile of miRNAs by next generation sequencing in an Illumina platform. 1839 miRNAs were identified in the exosomes. Of these 990 were known miRNAs, from which only 19 were significantly differentially expressed: 6 were overexpressed in CSCs and 13 in bulk cells exosomes. miR-100-5p and miR-21-5p were the most abundant miRNAs. Bioinformatics analysis indicated that differentially expressed miRNAs are highly related with PCa carcinogenesis, fibroblast proliferation, differentiation and migration, and angiogenesis. Besides, miRNAs from bulk cells affects osteoblast differentiation. Later, their effect was evaluated in normal prostate fibroblasts (WPMY-1) where transfection with miR-100-5p, miR-21-5p and miR-139-5p increased the expression of metalloproteinases (MMPs) -2, -9 and -13 and RANKL and fibroblast migration. The higher effect was achieved with miR21 transfection. As conclusion, miRNAs have a differential pattern between PCa bulk and CSCs exosomes that act collaboratively in PCa progression and metastasis. The most abundant miRNAs in PCa exosomes are interesting potential biomarkers and therapeutic targets.

Adipose Stem Cell-Based Therapeutic Targeting of Residual Androgens in African Americans With Bone-Metastatic Prostate Cancer

DTIC Science & Technology

2013-09-01

survival rate than CA males [3-7]. Socioeconomic and environmental factors, such as diet , access to care, and screening, have been cited as factors...cDNA clone coding for 3α-hydroxysteroid dehydrogenase (3α-HSD) was obtained from Origene. The 3α-HSD, also known as aldo- keto reductase family 1 member...growth of established human prostate LNCaP tumors in nude mice fed a low-fat diet . J Natl Cancer Inst 87: 1456–1462 17. Aronson WJ et al. (1999

Conditionally reprogrammed normal and primary tumor prostate epithelial cells: a novel patient-derived cell model for studies of human prostate cancer

PubMed Central

Timofeeva, Olga A.; Palechor-Ceron, Nancy; Li, Guanglei; Yuan, Hang; Krawczyk, Ewa; Zhong, Xiaogang; Liu, Geng; Upadhyay, Geeta; Dakic, Aleksandra; Yu, Songtao; Fang, Shuang; Choudhury, Sujata; Zhang, Xueping; Ju, Andrew; Lee, Myeong-Seon; Dan, Han C.; Ji, Youngmi; Hou, Yong; Zheng, Yun-Ling; Albanese, Chris; Rhim, Johng; Schlegel, Richard; Dritschilo, Anatoly; Liu, Xuefeng

2017-01-01

Our previous study demonstrated that conditional reprogramming (CR) allows the establishment of patient-derived normal and tumor epithelial cell cultures from a variety of tissue types including breast, lung, colon and prostate. Using CR, we have established matched normal and tumor cultures, GUMC-29 and GUMC-30 respectively, from a patient's prostatectomy specimen. These CR cells proliferate indefinitely in vitro and retain stable karyotypes. Most importantly, only tumor-derived CR cells (GUMC-30) produced tumors in xenografted SCID mice, demonstrating maintenance of the critical tumor phenotype. Characterization of cells with DNA fingerprinting demonstrated identical patterns in normal and tumor CR cells as well as in xenografted tumors. By flow cytometry, both normal and tumor CR cells expressed basal, luminal, and stem cell markers, with the majority of the normal and tumor CR cells expressing prostate basal cell markers, CD44 and Trop2, as well as luminal marker, CD13, suggesting a transit-amplifying phenotype. Consistent with this phenotype, real time RT-PCR analyses demonstrated that CR cells predominantly expressed high levels of basal cell markers (KRT5, KRT14 and p63), and low levels of luminal markers. When the CR tumor cells were injected into SCID mice, the expression of luminal markers (AR, NKX3.1) increased significantly, while basal cell markers dramatically decreased. These data suggest that CR cells maintain high levels of proliferation and low levels of differentiation in the presence of feeder cells and ROCK inhibitor, but undergo differentiation once injected into SCID mice. Genomic analyses, including SNP and INDEL, identified genes mutated in tumor cells, including components of apoptosis, cell attachment, and hypoxia pathways. The use of matched patient-derived cells provides a unique in vitro model for studies of early prostate cancer. PMID:28009986

Developing Novel Therapeutics Targeting Undifferentiated and Castration-Resistant Prostate Cancer Stem Cells

DTIC Science & Technology

2016-10-01

identify PCSC- specific homing peptides ; and 2) To perform unbiased drug library screening to identify novel PCSC-targeting chemicals. In the past...display library (PDL) screening in PSA-/lo PCa cells to identify PCSC- specific homing peptides ; and 2) To perform unbiased drug library screening to...Goals of the Project (SOW): Aim 1: To perform phage display library (PDL) screening in PSA-/lo PCa cells to identify PCSC- specific homing peptides

Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2015-10-01

209 induced cell senescence, G1 cell cycle arrest, and reduced intratumor BMI-1 levels, while displaying antitumor activity in mouse xenografts did...achieved from mouse xenograft studies (Bertino Lab), therefore suggesting that this compound may be further pursued for PCa therapy. We have published...confirmed the activity of C-209 in zebrafish and mouse xenografts . We will continue to collect more primary PCa tissues to study oncogenic addiction of

Effects of Radiation on Proteasome Function in Prostate Cancer Cells

DTIC Science & Technology

2012-02-01

California Breast Cancer Research Program Innovative Development and Exploratory Award (IDEA) Competitive Renewal Modulation of...Weissman IL. Establishment of a normal hemato- poietic and leukemia stem cell hierarchy. Cold Spring Harb Symp Quant Biol 2008;73:439–449. 9 Trott KR...existence of CSCs in solid cancer has been advocated by radiobiologists for decades [Withers et al., 1988; Trott , 1994]. However, until recently this

Mitochondrial pyruvate carrier function determines cell stemness and metabolic reprogramming in cancer cells

PubMed Central

Li, Xiaoran; Kan, Quancheng; Fan, Zhirui; Li, Yaqing; Ji, Yasai; Zhao, Jing; Zhang, Mingzhi; Grigalavicius, Mantas; Berge, Viktor; Goscinski, Mariusz Adam; M. Nesland, Jahn; Suo, Zhenhe

2017-01-01

One of the remarkable features of cancer cells is aerobic glycolysis, a phenomenon known as the “Warburg Effect”, in which cells rely preferentially on glycolysis instead of oxidative phosphorylation (OXPHOS) as the main energy source even in the presence of high oxygen tension. Cells with dysfunctional mitochondria are unable to generate sufficient ATP from mitochondrial OXPHOS, and then are forced to rely on glycolysis for ATP generation. Here we report our results in a prostate cancer cell line in which the mitochondrial pyruvate carrier 1 (MPC1) gene was knockout. It was discovered that the MPC1 gene knockout cells revealed a metabolism reprogramming to aerobic glycolysis with reduced ATP production, and the cells became more migratory and resistant to both chemotherapy and radiotherapy. In addition, the MPC1 knockout cells expressed significantly higher levels of the stemness markers Nanog, Hif1α, Notch1, CD44 and ALDH. To further verify the correlation of MPC gene function and cell stemness/metabolic reprogramming, MPC inhibitor UK5099 was applied in two ovarian cancer cell lines and similar results were obtained. Taken together, our results reveal that functional MPC may determine the fate of metabolic program and the stemness status of cancer cells in vitro. PMID:28624784

Preliminary experience on the use of the Adnatest® system for detection of circulating tumor cells in prostate cancer patients.

PubMed

Todenhöfer, Tilman; Hennenlotter, Jörg; Feyerabend, Susan; Aufderklamm, Stefan; Mischinger, Johannes; Kühs, Ursula; Gerber, Valentina; Fetisch, Jasmin; Schilling, David; Hauch, Siegfried; Stenzl, Arnulf; Schwentner, Christian

2012-08-01

The Adnatest® system combines immunomagnetic enrichment of epithelial cells with polymerase chain reaction for prostate cancer (PC)-specific transcripts for the detection circulating tumor cells (CTCs). We evaluated the Adnatest® in patients with castration-resistant PC receiving docetaxel chemotherapy. CTCs were assessed in 16 patients with castration-resistant PC before cycles one and three of chemotherapy. Furthermore, markers of stem cells and epithelial-mesenchymal transition were assessed. Treatment response was assessed by imaging and prostate-specific antigen measurements. Before chemotherapy, 11 patients were Adnatest®-positive whereas five patients were Adnatest®-positive before cycle three. A positive Adnatest® correlated with radiological progression (p=0.02). Rates of disease progression in epidermal growth factor receptor (EGFR)-positive and -negative patients were 100% and 7.7% (p=0.03). In this preliminary study, the Adnatest® detected CTCs in a considerable proportion of patients with castration-resistant PC. First data on certain markers (EGFR and aldehyd dehydrogenase 1) encourage future studies investigating transcripts predicting treatment response.

Granulocyte colony-stimulating factor off-target effect on nerve outgrowth promotes prostate cancer development.

PubMed

Dobrenis, Kostantin; Gauthier, Laurent R; Barroca, Vilma; Magnon, Claire

2015-02-15

The hematopoietic growth factor granulocyte colony-stimulating factor (G-CSF) has a role in proliferation, differentiation and migration of the myeloid lineage and in mobilizing hematopoietic stem and progenitor cells into the bloodstream. However, G-CSF has been newly characterized as a neurotrophic factor in the brain. We recently uncovered that autonomic nerve development in the tumor microenvironment participates actively in prostate tumorigenesis and metastasis. Here, we found that G-CSF constrains cancer to grow and progress by, respectively, supporting the survival of sympathetic nerve fibers in 6-hydroxydopamine-sympathectomized mice and also, promoting the aberrant outgrowth of parasympathetic nerves in transgenic or xenogeneic prostate tumor models. This provides insight into how neurotrophic growth factors may control tumor neurogenesis and may lead to new antineurogenic therapies for prostate cancer. © 2014 UICC.

Hypoxia-Induced Signaling Promotes Prostate Cancer Progression: Exosomes Role as Messenger of Hypoxic Response in Tumor Microenvironment

PubMed Central

Deep, Gagan; Panigrahi, Gati K.

2017-01-01

Prostate cancer (PCA) is the leading malignancy in men and the second leading cause of cancer-related deaths. Hypoxia (low O2 condition) is considered an early event in prostate carcinogenesis associated with an aggressive phenotype. In fact, clinically, hypoxia and hypoxia-related biomarkers are associated with treatment failure and disease progression. Hypoxia-inducible factor 1 (HIF-1) is the key factor that is activated under hypoxia, and mediates adaptation of cells to hypoxic conditions through regulating the expression of genes associated with angiogenesis, epithelial-to-mesenchymal transition (EMT), metastasis, survival, proliferation, metabolism, stemness, hormone-refractory progression, and therapeutic resistance. Besides HIF-1, several other signaling pathways including PI3K/Akt/mTOR, NADPH oxidase (NOX), Wnt/β-catenin, and Hedgehog are activated in cancer cells under hypoxic conditions, and also contribute in hypoxia-induced biological effects in HIF-1-dependent and -independent manners. Hypoxic cancer cells cause extensive changes in the tumor microenvironment both local and distant, and recent studies have provided ample evidence supporting the crucial role of nanosized vesicles “exosomes” in mediating hypoxia-induced tumor microenvironment remodeling. Exosomes’ role has been reported in hypoxia-induced angiogenesis, stemness, activation of cancer-associated fibroblasts (CAFs), and EMT. Together, existing literature suggests that hypoxia plays a predominant role in PCA growth and progression, and PCA could be effectively prevented and treated via targeting hypoxia/hypoxia-related signaling pathways. PMID:27279239

Strigolactone analogues induce apoptosis through activation of p38 and the stress response pathway in cancer cell lines and in conditionally reprogrammed primary prostate cancer cells.

PubMed

Pollock, Claire B; McDonough, Sara; Wang, Victor S; Lee, Hyojung; Ringer, Lymor; Li, Xin; Prandi, Cristina; Lee, Richard J; Feldman, Adam S; Koltai, Hinanit; Kapulnik, Yoram; Rodriguez, Olga C; Schlegel, Richard; Albanese, Christopher; Yarden, Ronit I

2014-03-30

Strigolactones are a novel class of plant hormones produced in roots and regulate shoot and root development. We have previously shown that synthetic strigolactone analogues potently inhibit growth of breast cancer cells and breast cancer stem cells. Here we show that strigolactone analogues inhibit the growth and survival of an array of cancer-derived cell lines representing solid and non-solid cancer cells including: prostate, colon, lung, melanoma, osteosarcoma and leukemic cell lines, while normal cells were minimally affected. Treatment of cancer cells with strigolactone analogues was hallmarked by activation of the stress-related MAPKs: p38 and JNK and induction of stress-related genes; cell cycle arrest and apoptosis evident by increased percentages of cells in the sub-G1 fraction and Annexin V staining. In addition, we tested the response of patient-matched conditionally reprogrammed primary prostate normal and cancer cells. The tumor cells exhibited significantly higher sensitivity to the two most potent SL analogues with increased apoptosis confirmed by PARP1 cleavage compared to their normal counterpart cells. Thus, Strigolactone analogues are promising candidates for anticancer therapy by their ability to specifically induce cell cycle arrest, cellular stress and apoptosis in tumor cells with minimal effects on growth and survival of normal cells.

Novel Functions of NF-kappaB2/p52 in Androgen Receptor Signaling in CRPC

DTIC Science & Technology

2015-09-01

cells . Endocr Relat Cancer 17:241–253 59. Taguchi Y, Yamamoto M, Yamate T et al (1998) Interleukin- 6-type cytokines stimulate mesenchymal progenitor... stem cells ”. Thus, it is conceivable that the benign prostate gland exhibits high expression of Lin28 in the basal cell layer. It is interesting to...Epithelial- Mesenchymal Transition in Lung Cancer Cell Lines. Cancer Research, 2010. 70(18): p. 7137-7147. 10. Kumar, M.S., et al., Impaired microRNA

Adipose Stem Cell-Based Therapeutic Targeting of Residual Androgens in African Americans with Bone-Metastatic Prostate Cancer

DTIC Science & Technology

2015-11-01

points post xenograft . We demonstrated that ADMSCs derived from African American with PC (ADMSCAA) promote LNCaP cell tumor growth in gonad-intact...Task-7: Compare the ability of ADMSCCont and ADMSCSel cells to colocalize to bone tumor xenografts in vivo. 7.1. Inject CaP cells, alone or with...construct expressing GFP (pLV-GFP). Nude mice (n=5) bearing LNCaP xenografts ( 8weeks) were injected with 2 x 105 transduced GFP-expressing ADMSCs and

Demonstration of intermediate cells during human prostate epithelial differentiation in situ and in vitro using triple-staining confocal scanning microscopy.

PubMed

van Leenders, G; Dijkman, H; Hulsbergen-van de Kaa, C; Ruiter, D; Schalken, J

2000-08-01

In human prostate epithelium, morphologically basal and luminal cells can be discriminated. The basal cell layer that putatively contains progenitor cells of the secretory epithelium is characterized by the expression of keratins (K) 5 and 14. Luminal cells represent the secretory compartment of the epithelium and express K8 and 18. We developed a technique for the simultaneous analysis of K5, 14, and 18 to identify intermediate cell stages in the prostate epithelium and to study the dynamic aspects of its differentiation in vitro. Nonmalignant prostate tissue and primary epithelial cultures were immunohistochemically characterized using triple staining with antibodies for K5, K14, and K18. Antibodies for K18 and K5 were conjugated directly with fluorochromes Alexa 488 and 546. K14 was visualized indirectly with streptavidin-Cy5. Keratin expression was analyzed by confocal scanning microscopy. The occurrence of exocrine and neuroendocrine differentiation in culture was determined via antibodies to prostate-specific antigen (PSA), chromogranin A, and serotonin. We found that basal cells expressed either K5(++)/14(++)/18+ or K5(++)/18+. The majority of luminal cells expressed K18(++), but colocalization of K5+/18(++) were recognized. Epithelial monolayer cultures predominantly revealed the basal cell phenotype K5(++)/14(++)/18+, whereas intermediate subpopulations expressing K5+/14+/18(++) and K5+/18(++) were also identified. On confluence, differentiation was induced as multicellular gland-like buds, and extensions became evident on top of the monolayer. These structures were composed of K18(++)- and K5+/18(+)-positive cell clusters surrounded by phenotypically basal cells. Few multicellular structures and cells in the monolayer showed exocrine differentiation (PSA+), but expression of chromogranin A and serotonin was absent. We conclude that simultaneous evaluation of keratin expression is useful for analyzing epithelial differentiation in the prostate. During this process, putative stem cells phenotypically resembling K5(++)/14(++)/18+ differentiate toward luminal cells (K18(++)) via intermediate cell stages, as identified by up-regulation of K18 and down-regulation of K5 and 14.

Sulforaphane increases drug-mediated cytotoxicity toward cancer stem-like cells of pancreas and prostate.

PubMed

Kallifatidis, Georgios; Labsch, Sabrina; Rausch, Vanessa; Mattern, Juergen; Gladkich, Jury; Moldenhauer, Gerhard; Büchler, Markus W; Salnikov, Alexei V; Herr, Ingrid

2011-01-01

Despite intense efforts to develop treatments against pancreatic cancer, agents that cure this highly resistant and metastasizing disease are not available. Considerable attention has focused on broccoli compound sulforaphane (SF), which is suggested as combination therapy for targeting of pancreatic cancer stem cells (CSCs). However, there are concerns that antioxidative properties of SF may interfere with cytotoxic drugs-as suggested, e.g., for vitamins. Therefore we investigated a combination therapy using established pancreatic CSCs. Although cisplatin (CIS), gemcitabine (GEM), doxorubicin, 5-flurouracil, or SF effectively induced apoptosis and prevented viability, combination of a drug with SF increased toxicity. Similarly, SF potentiated the drug effect in established prostate CSCs revealing that SF enhances drug cytotoxicity also in other tumor entities. Most importantly, combined treatment intensified inhibition of clonogenicity and spheroid formation and aldehyde dehydrogenase 1 (ALDH1) activity along with Notch-1 and c-Rel expression indicating that CSC characteristics are targeted. In vivo, combination treatment was most effective and totally abolished growth of CSC xenografts and tumor-initiating potential. No pronounced side effects were observed in normal cells or mice. Our data suggest that SF increases the effectiveness of various cytotoxic drugs against CSCs without inducing additional toxicity in mice.

Targeting IκB kinase β/NF-κB signaling in human prostate cancer by a novel IκB kinase β inhibitor CmpdA

PubMed Central

Zhang, Yanting; Lapidus, Rena G.; Liu, Peiyan; Choi, Eun Yong; Adediran, Samusi; Hussain, Arif; Wang, Xinghuan; Liu, Xuefeng; Dan, Han C.

2016-01-01

NF-κB plays an important role in many types of cancer, including prostate cancer (PCa), but the role of the upstream kinase of NF-κB, IKKβ, in PCa has not been fully documented, nor are there any effective IKKβ inhibitors used in clinical settings. Here, we have shown that IKKβ activity is mediated by multiple kinases including IKKα in human PCa cell lines that express activated IKKβ. Immunohistochemical analysis (IHC) of human PCa tissue microarrays (TMA) demonstrates that phosphorylation of IKKα/β within its activation loop gradually increases in low to higher stage tumors as compared to normal tissue. The expression of cell proliferation and survival markers (Ki67, Survivin), epithelial-to-mesenchymal transition (EMT) markers (Slug, Snail), as well as cancer stem cell (CSC) related transcription factors (Nanog, Sox2, Oct-4), also increase in parallel among the respective TMA samples analyzed. IKKβ, but not NF-κB, is found to regulate Nanog, which, in turn, modulates the levels of Oct4, Sox2, Snail and Slug, indicating an essential role of IKKβ in regulating cancer stem cells and EMT. The novel IKKβ inhibitor CmpdA inhibits constitutively activated IKKβ/NF-κB signaling, leading to induction of apoptosis and inhibition of proliferation, migration and stemness in these cells. CmpdA also significantly inhibits tumor growth in xenografts without causing apparent in vivo toxicity. Furthermore, CmpdA and docetaxel act synergistically to inhibit proliferation of PCa cells. These results indicate that IKKβ plays a pivotal role in PCa, and targeting IKKβ, including in combination with docetaxel, may be a potentially useful strategy for treating advanced PCa. PMID:27196761

Amino Acid Profiling of Zinc Resistant Prostate Cancer Cell Lines: Associations With Cancer Progression.

PubMed

Kratochvilova, Monika; Raudenska, Martina; Heger, Zbynek; Richtera, Lukas; Cernei, Natalia; Adam, Vojtech; Babula, Petr; Novakova, Marie; Masarik, Michal; Gumulec, Jaromir

2017-05-01

Failure in intracellular zinc accumulation is a key process in prostate carcinogenesis. Nevertheless, epidemiological studies of zinc administration have provided contradicting results. In order to examine the impact of the artificial intracellular increase of zinc(II) ions on prostate cancer metabolism, PNT1A, 22Rv1, and PC-3 prostatic cell lines-depicting different stages of cancer progression-and their zinc-resistant counterparts were used. To determine "benign" and "malignant" metabolic profiles, amino acid patterns, gene expression, and antioxidant capacity of these cell lines were assessed. Amino acid profiles were examined using an ion-exchange liquid chromatography. Intracellular zinc content was measured by atomic absorption spectrometry. Metallothionein was quantified using differential pulse voltammetry. The content of reduced glutathione was determined using high performance liquid chromatography coupled with an electrochemical detector. Cellular antioxidant capacity was determined by the ABTS test and gene expression analysis was performed by qRT-PCR. Long-term zinc treatment was shown to reroute cell metabolism from benign to more malignant type. Long-term application of high concentration of zinc(II) significantly enhanced cisplatin resistance, invasiveness, cellular antioxidant capacity, synthesis of glutathione, and expression of treatment resistance- and stemness-associated genes (SOX2, POU5F1, BIRC5). Tumorous cell lines universally displayed high accumulation of aspartate and sarcosine and depletion of essential amino acids. Increased aspartate/threonine, aspartate/methionine, and sarcosine/serine ratios were associated with cancer phenotype with high levels of sensitivity and specificity. Prostate 77: 604-616, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Cancer stem cell research in Iran: potentials and challenges.

PubMed

Roudi, Raheleh; Ebrahimi, Marzieh; Shariftabrizi, Ahmad; Madjd, Zahra

2017-08-01

Treatment modalities can reduce cancer-related mortality; however, a majority of patients develop drug resistance, metastasis and relapse. It has been proposed that tumorigenic characteristics of tumors are related to a proportion of cancer cells, termed cancer stem cells (CSCs). Following the first evidence regarding the existence of CSC population in acute myeloid leukemia in 1997, publications in CSCs field showed an explosive trend in all cancer types around the world. First research paper in the field of CSCs in Iran was published in 2004 on prostate cancer. Subsequently, an annual number of publications in the field of CSCs displayed a rapidly growing trend. Therefore, in the current review, we have presented a comprehensive evaluation of the CSCs research in Iran.

The Isolation and Characterization of Human Prostate Cancer Stem Cells

DTIC Science & Technology

2009-08-01

GCGGTGGAAG AGCCATCAT-30 and 50-TCTGTGGCTTCACCACTT TTCTC-30; for b-actin, 50-GCGGGAAATCGTGCGT GACATT-30 and 50-GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was...Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance protein-mediated efflux of androgen

Brachyury as a potential modulator of androgen receptor activity and a key player in therapy resistance in prostate cancer

PubMed Central

Pinto, Filipe; Pértega-Gomes, Nelma; Vizcaíno, José R.; Andrade, Raquel P.; Cárcano, Flavio M.; Reis, Rui Manuel

2016-01-01

Prostate cancer (PCa) is the most commonly diagnosed neoplasm and the second leading cause of cancer-related deaths in men. Acquisition of resistance to conventional therapy is a major problem for PCa patient management. Several mechanisms have been described to promote therapy resistance in PCa, such as androgen receptor (AR) activation, epithelial-to-mesenchymal transition (EMT), acquisition of stem cell properties and neuroendocrine transdifferentiation (NEtD). Recently, we identified Brachyury as a new biomarker of PCa aggressiveness and poor prognosis. In the present study we aimed to assess the role of Brachyury in PCa therapy resistance. We showed that Brachyury overexpression in prostate cancer cells lines increased resistance to docetaxel and cabazitaxel drugs, whereas Brachyury abrogation induced decrease in therapy resistance. Through ChiP-qPCR assays we further demonstrated that Brachyury is a direct regulator of AR expression as well as of the biomarker AMACR and the mesenchymal markers Snail and Fibronectin. Furthermore, in vitro Brachyury was also able to increase EMT and stem properties. By in silico analysis, clinically human Brachyury-positive PCa samples were associated with biomarkers of PCa aggressiveness and therapy resistance, including PTEN loss, and expression of NEtD markers, ERG and Bcl-2. Taken together, our results indicate that Brachyury contributes to tumor chemotherapy resistance, constituting an attractive target for advanced PCa patients. PMID:27049720

Induction of murine embryonic stem cell differentiation by medicinal plant extracts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reynertson, Kurt A.; Department of Pharmacology, Weill Cornell Medical College, 1300 York Avenue, New York, NY 10065; Charlson, Mary E.

Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extractsmore » for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from 12 species of ethnomedically utilized plants, we found fractions from 3 species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells.« less

Induction of murine embryonic stem cell differentiation by medicinal plant extracts

PubMed Central

Reynertson, Kurt A.; Charlson, Mary E.; Gudas, Lorraine J.

2010-01-01

Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly-cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extracts for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from twelve species of ethnomedically utilized plants, we found fractions from three species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells. PMID:20955699

SOX2 plays a critical role in EGFR-mediated self-renewal of human prostate cancer stem-like cells.

PubMed

Rybak, Adrian P; Tang, Damu

2013-12-01

SOX2 is an essential transcription factor for stem cells and plays a role in tumorigenesis, however its role in prostate cancer stem cells (PCSCs) remains unclear. We report here a significant upregulation of SOX2 at both mRNA and protein levels in DU145 PCSCs propagated as suspension spheres in vitro. The expression of SOX2 in DU145 PCSCs is positively regulated by epidermal growth factor receptor (EGFR) signaling. Activation of EGFR signaling, following the addition of epidermal growth factor (EGF) or ectopic expression of a constitutively-active EGFR mutant (EGFRvIII), increased SOX2 expression and the self-renewal of DU145 PCSCs. Conversely, a small molecule EGFR inhibitor (AG1478) blocked EGFR activation, reduced SOX2 expression and inhibited PCSC self-renewal activity, implicating SOX2 in mediating EGFR-dependent self-renewal of PCSCs. In line with this notion, ectopic SOX2 expression enhanced EGF-induced self-renewal of DU145 PCSCs, while SOX2 knockdown reduced PCSC self-renewal with EGF treatment no longer capable of enhancing their propagation. Furthermore, SOX2 knockdown reduced the capacity of DU145 PCSCs to grow under anchorage-independent conditions. Finally, DU145 PCSCs generated xenograft tumors more aggressively with elevated levels of SOX2 expression compared to xenograft tumors derived from non-PCSCs. Collectively, we provide evidence that SOX2 plays a critical role in EGFR-mediated self-renewal of DU145 PCSCs. © 2013.

The PSA−/lo prostate cancer cell population harbors self-renewing long-term tumor-propagating cells that resist castration

PubMed Central

Qin, Jichao; Liu, Xin; Laffin, Brian; Chen, Xin; Choy, Grace; Jeter, Collene; Calhoun-Davis, Tammy; Li, Hangwen; Palapattu, Ganesh S.; Pang, Shen; Lin, Kevin; Huang, Jiaoti; Ivanov, Ivan; Li, Wei; Suraneni, Mahipal V.; Tang, Dean G.

2012-01-01

SUMMARY Prostate cancer (PCa) is heterogeneous and contains both differentiated and undifferentiated tumor cells, but the relative functional contribution of these two cell populations remains unclear. Here we report distinct molecular, cellular, and tumor-propagating properties of PCa cells that express high (PSA+) and low (PSA−/lo) levels of the differentiation marker PSA. PSA−/lo PCa cells are quiescent and refractory to stresses including androgen deprivation, exhibit high clonogenic potential, and possess long-term tumor-propagating capacity. They preferentially express stem cell genes and can undergo asymmetric cell division generating PSA+ cells. Importantly, PSA−/lo PCa cells can initiate robust tumor development and resist androgen ablation in castrated hosts, and harbor highly tumorigenic castration-resistant PCa cells that can be prospectively enriched using ALDH+CD44+α2β1+ phenotype. In contrast, PSA+ PCa cells possess more limited tumor-propagating capacity, undergo symmetric division and are sensitive to castration. Together, our study suggests PSA−/lo cells may represent a critical source of castration-resistant PCa cells. PMID:22560078

Systemic and Gene Modified Mesenchymal Stem Cell Therapy for Metastatic Prostate Cancer

DTIC Science & Technology

2009-05-01

downregulate the expression of growth factors , receptor tyrosine kinases, proteases, and AR both in vitro and in vivo only when the cells express high... growth , and apoptosis as shown in Figure 1A. Downregulation of growth factors , FGF, Mdk, PDGF, Ptn, TGFb1 and TGFb3, tyrosine kinase receptors Ffgr3 and... growth factors and receptor tyrosine kinases mainly in andro- gen-sensitive and AR-overexpressing cells. The effect was more pronounced in Erk, Ras, and

Disrupting Androgen Receptor Signaling Induces Snail-Mediated Epithelial-Mesenchymal Plasticity in Prostate Cancer.

PubMed

Miao, Lu; Yang, Lin; Li, Rui; Rodrigues, Daniel N; Crespo, Mateus; Hsieh, Jer-Tsong; Tilley, Wayne D; de Bono, Johann; Selth, Luke A; Raj, Ganesh V

2017-06-01

Epithelial-to-mesenchymal plasticity (EMP) has been linked to metastasis, stemness, and drug resistance. In prostate cancer, EMP has been associated with both suppression and activation of the androgen receptor (AR) signaling. Here we investigated the effect of the potent AR antagonist enzalutamide on EMP in multiple preclinical models of prostate cancer and patient tissues. Enzalutamide treatment significantly enhanced the expression of EMP drivers (ZEB1, ZEB2, Snail, Twist, and FOXC2) and mesenchymal markers (N-cadherin, fibronectin, and vimentin) in prostate cancer cells, enhanced prostate cancer cell migration, and induced prostate cancer transformation to a spindle, fibroblast-like morphology. Enzalutamide-induced EMP required concomitant suppression of AR signaling and activation of the EMP-promoting transcription factor Snail, as evidenced by both knockdown and overexpression studies. Supporting these findings, AR signaling and Snail expression were inversely correlated in C4-2 xenografts, patient-derived castration-resistant metastases, and clinical samples. For the first time, we elucidate a mechanism explaining the inverse relationship between AR and Snail. Specifically, we found that AR directly repressed SNAI1 gene expression by binding to specific AR-responsive elements within the SNAI1 promoter. Collectively, our findings demonstrate that de-repression of Snail and induction of EMP is an adaptive response to enzalutamide with implications for therapy resistance. Cancer Res; 77(11); 3101-12. ©2017 AACR . ©2017 American Association for Cancer Research.

Targeting proapoptotic protein BAD inhibits survival and self-renewal of cancer stem cells.

PubMed

Sastry, K S R; Al-Muftah, M A; Li, Pu; Al-Kowari, M K; Wang, E; Ismail Chouchane, A; Kizhakayil, D; Kulik, G; Marincola, F M; Haoudi, A; Chouchane, L

2014-12-01

Emerging evidence suggests that the resistance of cancer stem cells (CSC) to many conventional therapies is one of the major limiting factors of cancer therapy efficacy. Identification of mechanisms responsible for survival and self-renewal of CSC will help design new therapeutic strategies that target and eliminate both differentiated cancer cells and CSC. Here we demonstrated the potential role of proapoptotic protein BAD in the biology of CSC in melanoma, prostate and breast cancers. We enriched CD44(+)/CD24(-) cells (CSC) by tumorosphere formation and purified this population by FACS. Both spheres and CSC exhibited increased potential for proliferation, migration, invasion, sphere formation, anchorage-independent growth, as well as upregulation of several stem cell-associated markers. We showed that the phosphorylation of BAD is essential for the survival of CSC. Conversely, ectopic expression of a phosphorylation-deficient mutant BAD induced apoptosis in CSC. This effect was enhanced by treatment with a BH3-mimetic, ABT-737. Both pharmacological agents that inhibit survival kinases and growth factors that are involved in drug resistance delivered their respective cytotoxic and protective effects by modulating the BAD phosphorylation in CSC. Furthermore, the frequency and self-renewal capacity of CSC was significantly reduced by knocking down the BAD expression. Consistent with our in vitro results, significant phosphorylation of BAD was found in CD44(+) CSC of 83% breast tumor specimens. In addition, we also identified a positive correlation between BAD expression and disease stage in prostate cancer, suggesting a role of BAD in tumor advancement. Our studies unveil the role of BAD in the survival and self-renewal of CSC and propose BAD not only as an attractive target for cancer therapy but also as a marker of tumor progression.

Graphene oxide selectively targets cancer stem cells, across multiple tumor types: Implications for non-toxic cancer treatment, via “differentiation-based nano-therapy”

PubMed Central

Fiorillo, Marco; Verre, Andrea F.; Iliut, Maria; Peiris-Pagés, Maria; Ozsvari, Bela; Gandara, Ricardo; Cappello, Anna Rita; Sotgia, Federica; Vijayaraghavan, Aravind; Lisanti, Michael P.

2015-01-01

Tumor-initiating cells (TICs), a.k.a. cancer stem cells (CSCs), are difficult to eradicate with conventional approaches to cancer treatment, such as chemo-therapy and radiation. As a consequence, the survival of residual CSCs is thought to drive the onset of tumor recurrence, distant metastasis, and drug-resistance, which is a significant clinical problem for the effective treatment of cancer. Thus, novel approaches to cancer therapy are needed urgently, to address this clinical need. Towards this end, here we have investigated the therapeutic potential of graphene oxide to target cancer stem cells. Graphene and its derivatives are well-known, relatively inert and potentially non-toxic nano-materials that form stable dispersions in a variety of solvents. Here, we show that graphene oxide (of both big and small flake sizes) can be used to selectively inhibit the proliferative expansion of cancer stem cells, across multiple tumor types. For this purpose, we employed the tumor-sphere assay, which functionally measures the clonal expansion of single cancer stem cells under anchorage-independent conditions. More specifically, we show that graphene oxide effectively inhibits tumor-sphere formation in multiple cell lines, across 6 different cancer types, including breast, ovarian, prostate, lung and pancreatic cancers, as well as glioblastoma (brain). In striking contrast, graphene oxide is non-toxic for “bulk” cancer cells (non-stem) and normal fibroblasts. Mechanistically, we present evidence that GO exerts its striking effects on CSCs by inhibiting several key signal transduction pathways (WNT, Notch and STAT-signaling) and thereby inducing CSC differentiation. Thus, graphene oxide may be an effective non-toxic therapeutic strategy for the eradication of cancer stem cells, via differentiation-based nano-therapy. PMID:25708684

A differential role for CXCR4 in the regulation of normal versus malignant breast stem cell activity.

PubMed

Ablett, Matthew P; O'Brien, Ciara S; Sims, Andrew H; Farnie, Gillian; Clarke, Robert B

2014-02-15

C-X-C chemokine receptor type 4 (CXCR4) is known to regulate lung, pancreatic and prostate cancer stem cells. In breast cancer, CXCR4 signalling has been reported to be a mediator of metastasis, and is linked to poor prognosis. However its role in normal and malignant breast stem cell function has not been investigated. Anoikis resistant (AR) cells were collected from immortalised (MCF10A, 226L) and malignant (MCF7, T47D, SKBR3) breast cell lines and assessed for stem cell enrichment versus unsorted cells. AR cells had significantly higher mammosphere forming efficiency (MFE) than unsorted cells. The AR normal cells demonstrated increased formation of 3D structures in Matrigel compared to unsorted cells. In vivo, SKBR3 and T47D AR cells had 7- and 130-fold enrichments for tumour formationrespectively, compared with unsorted cells. AR cells contained significantly elevated CXCR4 transcript and protein levels compared to unsorted cells. Importantly, CXCR4 mRNA was higher in stem cell-enriched CD44+/CD24- patient-derived breast cancer cells compared to non-enriched cells. CXCR4 stimulation by its ligand SDF-1 reduced MFE of the normal breast cells lines but increased the MFE in T47D and patient-derived breast cancer cells. CXCR4 inhibition by AMD3100 increased stem cell activity but reduced the self-renewal capacity of the malignant breast cell line T47D. CXCR4+ FACS sorted MCF7 cells demonstrated a significantly increased MFE compared with CXCR4- cells. This significant increase in MFE was further demonstrated in CXCR4 over-expressing MCF7 cells which also had an increase in self-renewal compared to parental cells. A greater reduction in self-renewal following CXCR4 inhibition in the CXCR4 over-expressing cells compared with parental cells was also observed. Our data establish for the first time that CXCR4 signalling has contrasting effects on normal and malignant breast stem cell activity. Here, we demonstrate that CXCR4 signalling specifically regulates breast cancer stem cell activities and may therefore be important in tumour formation at the sites of metastases.

BMP7 Induces Dormancy of Prostatic Tumor Stem Cell in Bone

DTIC Science & Technology

2013-07-01

Watabe, Shigeru Hirota, Sudha K. Pai, Wen Liu, Koji Fukuda, Christopher Chambers, Andrew Wilber and Kounosuke Watabe “Bone Figure 7. Expression of BMP7...Hiroshi Okuda,1 Fei Xing,1 Puspa R. Pandey,1 Misako Watabe,1 Shigeru Hirota,2 Sudha K. Pai,1 Wen Liu,1 Koji Fukuda,1 Christopher Chambers,1 Andrew

Exploring the Hypersensitivity of PTEN Deleted Prostate Cancer Stem Cells to WEE1 Tyrosine Kinase Inhibitors

DTIC Science & Technology

2015-12-01

enter replica- tive senescence or undergo mitotic arrest in the presence of broken chromosomes and shortened telomeres (25–27). However, cancer cells...Cell death during crisis is mediated by mitotic telomere deprotection. Nature, 522, 492–496. 27. Herbig,U., Jobling,W.A., Chen,B.P., Chen,D.J. and...Sedivy,J.M. (2004) Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21(CIP1), but not p16(INK4a).Mol

A prodrug-doped cellular Trojan Horse for the potential treatment of prostate cancer.

PubMed

Levy, Oren; Brennen, W Nathaniel; Han, Edward; Rosen, David Marc; Musabeyezu, Juliet; Safaee, Helia; Ranganath, Sudhir; Ngai, Jessica; Heinelt, Martina; Milton, Yuka; Wang, Hao; Bhagchandani, Sachin H; Joshi, Nitin; Bhowmick, Neil; Denmeade, Samuel R; Isaacs, John T; Karp, Jeffrey M

2016-06-01

Despite considerable advances in prostate cancer research, there is a major need for a systemic delivery platform that efficiently targets anti-cancer drugs to sites of disseminated prostate cancer while minimizing host toxicity. In this proof-of-principle study, human mesenchymal stem cells (MSCs) were loaded with poly(lactic-co-glycolic acid) (PLGA) microparticles (MPs) that encapsulate the macromolecule G114, a thapsigargin-based prostate specific antigen (PSA)-activated prodrug. G114-particles (∼950 nm in size) were internalized by MSCs, followed by the release of G114 as an intact prodrug from loaded cells. Moreover, G114 released from G114 MP-loaded MSCs selectively induced death of the PSA-secreting PCa cell line, LNCaP. Finally, G114 MP-loaded MSCs inhibited tumor growth when used in proof-of-concept co-inoculation studies with CWR22 PCa xenografts, suggesting that cell-based delivery of G114 did not compromise the potency of this pro-drug in-vitro or in-vivo. This study demonstrates a potentially promising approach to assemble a cell-based drug delivery platform, which inhibits cancer growth in-vivo without the need of genetic engineering. We envision that upon achieving efficient homing of systemically infused MSCs to cancer sites, this MSC-based platform may be developed into an effective, systemic 'Trojan Horse' therapy for targeted delivery of therapeutic agents to sites of metastatic PCa. Copyright © 2016 Elsevier Ltd. All rights reserved.

Prostate cancer stem-like cells proliferate slowly and resist etoposide-induced cytotoxicity via enhancing DNA damage response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, Judy; Father Sean O'Sullivan Research Institute, Hamilton, Ontario, Canada L8N 4A6; The Hamilton Centre for Kidney Research

Despite the development of chemoresistance as a major concern in prostate cancer therapy, the underlying mechanisms remain elusive. In this report, we demonstrate that DU145-derived prostate cancer stem cells (PCSCs) progress slowly with more cells accumulating in the G1 phase in comparison to DU145 non-PCSCs. Consistent with the important role of the AKT pathway in promoting G1 progression, DU145 PCSCs were less sensitive to growth factor-induced activation of AKT in comparison to non-PCSCs. In response to etoposide (one of the most commonly used chemotherapeutic drugs), DU145 PCSCs survived significantly better than non-PCSCs. In addition to etoposide, PCSCs demonstrated increased resistancemore » to docetaxel, a taxane drug that is commonly used to treat castration-resistant prostate cancer. Etoposide produced elevated levels of γH2AX and triggered a robust G2/M arrest along with a coordinated reduction of the G1 population in PCSCs compared to non-PCSCs, suggesting that elevated γH2AX plays a role in the resistance of PCSCs to etoposide-induced cytotoxicity. We have generated xenograft tumors from DU145 PCSCs and non-PCSCs. Consistent with the knowledge that PCSCs produce xenograft tumors with more advanced features, we were able to demonstrate that PCSC-derived xenograft tumors displayed higher levels of γH2AX and p-CHK1 compared to non-PCSC-produced xenograft tumors. Collectively, our research suggests that the elevation of DNA damage response contributes to PCSC-associated resistance to genotoxic reagents. - Highlights: • Increased survival in DU145 PCSCs following etoposide-induced cytotoxicity. • PCSCs exhibit increased sensitivity to etoposide-induced DDR. • Resistance to cytotoxicity may be due to slower proliferation in PCSCs. • Reduced kinetics to growth factor induced activation of AKT in PCSCs.« less

Maternal Embryonic Leucine-zipper Kinase: Key Kinase for Stem Cell Phenotype in Glioma and Other Cancers

PubMed Central

Ganguly, Ranjit; Hong, Christopher; Smith, Luke; Kornblum, Harley I; Nakano, Ichiro

2014-01-01

Maternal embryonic leucine zipper kinase (MELK) is a member of the snf1/AMPK family of protein Serine/Threonine kinases that has recently gained significant attention in the stem cell and cancer biology field. Recent studies suggest that activation of this kinase is tightly associated with extended survival and accelerated proliferation of cancer stem cells (CSCs) in various organs. Overexpression of MELK has been noted in various cancers, including colon, breast, ovaries, pancreas, prostate, and brain, making the inhibition of MELK an attractive therapeutic strategy for a variety of cancers. In the experimental cancer models, depletion of MELK by RNA interference or small molecule inhibitors induces apoptotic cell death of cancer stem cells derived from glioblastoma and breast cancer, both in vitro and in vivo. Mechanism of action of MELK includes, yet may not be restricted to, direct binding and activation of the oncogenic transcription factors c-JUN and FOXM1 in cancer cells but not in the normal counterparts. Following these pre-clinical studies, the Phase I clinical trial for advanced cancers with OTS167 started in 2013, as the first-in-class MELK inhibitor. This review summarizes the current molecular understanding of MELK and the recent pre-clinical studies about MELK as a cancer therapeutic target. PMID:24795222

Sulforaphane Increases Drug-mediated Cytotoxicity Toward Cancer Stem-like Cells of Pancreas and Prostate

PubMed Central

Kallifatidis, Georgios; Labsch, Sabrina; Rausch, Vanessa; Mattern, Juergen; Gladkich, Jury; Moldenhauer, Gerhard; Büchler, Markus W.; Salnikov, Alexei V.; Herr, Ingrid

2011-01-01

Despite intense efforts to develop treatments against pancreatic cancer, agents that cure this highly resistant and metastasizing disease are not available. Considerable attention has focused on broccoli compound sulforaphane (SF), which is suggested as combination therapy for targeting of pancreatic cancer stem cells (CSCs). However, there are concerns that antioxidative properties of SF may interfere with cytotoxic drugs—as suggested, e.g., for vitamins. Therefore we investigated a combination therapy using established pancreatic CSCs. Although cisplatin (CIS), gemcitabine (GEM), doxorubicin, 5-flurouracil, or SF effectively induced apoptosis and prevented viability, combination of a drug with SF increased toxicity. Similarly, SF potentiated the drug effect in established prostate CSCs revealing that SF enhances drug cytotoxicity also in other tumor entities. Most importantly, combined treatment intensified inhibition of clonogenicity and spheroid formation and aldehyde dehydrogenase 1 (ALDH1) activity along with Notch-1 and c-Rel expression indicating that CSC characteristics are targeted. In vivo, combination treatment was most effective and totally abolished growth of CSC xenografts and tumor-initiating potential. No pronounced side effects were observed in normal cells or mice. Our data suggest that SF increases the effectiveness of various cytotoxic drugs against CSCs without inducing additional toxicity in mice. PMID:20940707

A Novel Chimeric Antigen Receptor Against Prostate Stem Cell Antigen Mediates Tumor Destruction in a Humanized Mouse Model of Pancreatic Cancer

PubMed Central

Lagisetty, Kiran H.; Tran, Eric; Zheng, Zhili; Gattinoni, Luca; Yu, Zhiya; Burns, William R.; Miermont, Anne M.; Teper, Yaroslav; Rudloff, Udo; Restifo, Nicholas P.; Feldman, Steven A.; Rosenberg, Steven A.; Morgan, Richard A.

2014-01-01

Abstract Despite advances in the understanding of its molecular pathophysiology, pancreatic cancer remains largely incurable, highlighting the need for novel therapies. We developed a chimeric antigen receptor (CAR) specific for prostate stem cell antigen (PSCA), a glycoprotein that is overexpressed in pancreatic cancer starting at early stages of malignant transformation. To optimize the CAR design, we used antigen-recognition domains derived from mouse or human antibodies, and intracellular signaling domains containing one or two T cell costimulatory elements, in addition to CD3zeta. Comparing multiple constructs established that the CAR based on human monoclonal antibody Ha1-4.117 had the greatest reactivity in vitro. To further analyze this CAR, we developed a human pancreatic cancer xenograft model and adoptively transferred CAR-engineered T cells into animals with established tumors. CAR-engineered human lymphocytes induced significant antitumor activity, and unlike what has been described for other CARs, a second-generation CAR (containing CD28 cosignaling domain) induced a more potent antitumor effect than a third-generation CAR (containing CD28 and 41BB cosignaling domains). While our results provide evidence to support PSCA as a target antigen for CAR-based immunotherapy of pancreatic cancer, the expression of PSCA on selected normal tissues could be a source of limiting toxicity. PMID:24694017

Induction of murine embryonic stem cell differentiation by medicinal plant extracts.

PubMed

Reynertson, Kurt A; Charlson, Mary E; Gudas, Lorraine J

2011-01-01

Epidemiological evidence indicates that diets high in fruits and vegetables provide a measure of cancer chemoprevention due to phytochemical constituents. Natural products are a rich source of cancer chemotherapy drugs, and primarily target rapidly cycling tumor cells. Increasing evidence indicates that many cancers contain small populations of resistant, stem-like cells that have the capacity to regenerate tumors following chemotherapy and radiation, and have been linked to the initiation of metastases. Our goal is to discover natural product-based clinical or dietary interventions that selectively target cancer stem cells, inducing differentiation. We adapted an alkaline phosphatase (AP) stain to assay plant extracts for the capacity to induce differentiation in embryonic stem (ES) cells. AP is a characteristic marker of undifferentiated ES cells, and this represents a novel approach to screening medicinal plant extracts. Following a survey of approximately 100 fractions obtained from 12 species of ethnomedically utilized plants, we found fractions from 3 species that induced differentiation, decreasing AP and transcript levels of pluripotency markers (Nanog, Oct-4, Rex-1). These fractions affected proliferation of murine ES, and human embryonal, prostate, and breast carcinoma cells in a dose-dependent manner. Several phytochemical constituents were isolated; the antioxidant phytochemicals ellagic acid and gallic acid were shown to affect viability of cultured breast carcinoma cells. Copyright © 2010 Elsevier Inc. All rights reserved.

Systematic dissection of phenotypic, functional, and tumorigenic heterogeneity of human prostate cancer cells

PubMed Central

Chao, Hsueh-Ping; Deng, Qu; Jeter, Collene; Liu, Can; Honorio, Sofia; Li, Hangwen; Davis, Tammy; Suraneni, Mahipal; Laffin, Brian; Qin, Jichao; Li, Qiuhui; Yang, Tao; Whitney, Pamela; Shen, Jianjun; Huang, Jiaoti; Tang, Dean G.

2015-01-01

Human cancers are heterogeneous containing stem-like cancer cells operationally defined as cancer stem cells (CSCs) that possess great tumor-initiating and long-term tumor-propagating properties. In this study, we systematically dissect the phenotypic, functional and tumorigenic heterogeneity in human prostate cancer (PCa) using xenograft models and >70 patient tumor samples. In the first part, we further investigate the PSA−/lo PCa cell population, which we have recently shown to harbor self-renewing long-term tumor-propagating cells and present several novel findings. We show that discordant AR and PSA expression in both untreated and castration-resistant PCa (CRPC) results in AR+PSA+, AR+PSA−, AR−PSA−, and AR−PSA+ subtypes of PCa cells that manifest differential sensitivities to therapeutics. We further demonstrate that castration leads to a great enrichment of PSA−/lo PCa cells in both xenograft tumors and CRPC samples and systemic androgen levels dynamically regulate the relative abundance of PSA+ versus PSA−/lo PCa cells that impacts the kinetics of tumor growth. We also present evidence that the PSA−/lo PCa cells possess distinct epigenetic profiles. As the PSA−/lo PCa cell population is heterogeneous, in the second part, we employ two PSA− (Du145 and PC3) and two PSA+ (LAPC9 and LAPC4) PCa models as well as patient tumor cells to further dissect the clonogenic and tumorigenic subsets. We report that different PCa models possess distinct tumorigenic subpopulations that both commonly and uniquely express important signaling pathways that could represent therapeutic targets. Our results have important implications in understanding PCa cell heterogeneity, response to clinical therapeutics, and cellular mechanisms underlying CRPC. PMID:26246472

Bone Marrow-derived Mesenchymal Stem Cells (MSCs) as a Selective Delivery Vehicle for a PSA-Activated Protoxin for Advanced Prostate Cancer

DTIC Science & Technology

2013-03-01

tissue have been optimized • Optimization of flow cytometry-based analyses to characterize co- incident expression of multiple MSC-related markers on a...CA). Mouse anti-human vimentin (clone LN-6) was purchased from Sigma-Aldrich (St. Louis, MO). Goat anti-mouse Alexa Fluor 488, Roswell Park

Metabolic reprogramming and dependencies associated with epithelial cancer stem cells independent of the epithelial-mesenchymal transition program

PubMed Central

Aguilar, Esther; de Mas, Igor Marin; Zodda, Erika; Marin, Silvia; Morrish, Fionnuala; Selivanov, Vitaly; Meca-Cortés, Óscar; Delowar, Hossain; Pons, Mònica; Izquierdo, Inés; Celià-Terrassa, Toni; de Atauri, Pedro; Centelles, Josep J; Hockenbery, David; Thomson, Timothy M; Cascante, Marta

2016-01-01

In solid tumors, cancer stem cells (CSCs) can arise independently of epithelial-mesenchymal transition (EMT). In spite of recent efforts, the metabolic reprogramming associated with CSC phenotypes uncoupled from EMT is poorly understood. Here, by using metabolomic and fluxomic approaches, we identify major metabolic profiles that differentiate metastatic prostate epithelial CSCs (e-CSCs) from non-CSCs expressing a stable EMT. We have found that the e-CSC program in our cellular model is characterized by a high plasticity in energy substrate metabolism, including an enhanced Warburg effect, a greater carbon and energy source flexibility driven by fatty acids and amino acid metabolism and an essential reliance on the proton buffering capacity conferred by glutamine metabolism. An analysis of transcriptomic data yielded a metabolic gene signature for our e-CSCs consistent with the metabolomics and fluxomics analysis that correlated with tumor progression and metastasis in prostate cancer and in 11 additional cancer types. Interestingly, an integrated metabolomics, fluxomics and transcriptomics analysis allowed us to identify key metabolic players regulated at the post-transcriptional level, suggesting potential biomarkers and therapeutic targets to effectively forestall metastasis. PMID:27146024

Loss of insulin-like growth factor II imprinting is a hallmark associated with enhanced chemo/radiotherapy resistance in cancer stem cells.

PubMed

Zhao, Xin; Liu, Xiaoliang; Wang, Guanjun; Wen, Xue; Zhang, Xiaoying; Hoffman, Andrew R; Li, Wei; Hu, Ji-Fan; Cui, Jiuwei

2016-08-09

Insulin-like growth factor II (IGF2) is maternally imprinted in most tissues, but the epigenetic regulation of the gene in cancer stem cells (CSCs) has not been defined. To study the epigenetic mechanisms underlying self-renewal, we isolated CSCs and non-CSCs from colon cancer (HT29, HRT18, HCT116), hepatoma (Hep3B), breast cancer (MCF7) and prostate cancer (ASPC) cell lines. In HT29 and HRT18 cells that show loss of IGF2 imprinting (LOI), IGF2 was biallelically expressed in the isolated CSCs. Surprisingly, we also found loss of IGF2 imprinting in CSCs derived from cell lines HCT116 and ASPC that overall demonstrate maintenance of IGF2 imprinting. Using chromatin conformation capture (3C), we found that intrachromosomal looping between the IGF2 promoters and the imprinting control region (ICR) was abrogated in CSCs, in parallel with loss of IGF2 imprinting in these CSCs. Loss of imprinting led to increased IGF2 expression in CSCs, which have a higher rate of colony formation and greater resistance to chemotherapy and radiotherapy in vitro. These studies demonstrate that IGF2 LOI is a common feature in CSCs, even when the stem cells are derived from a cell line in which the general population of cells maintain IGF2 imprinting. This finding suggests that aberrant IGF2 imprinting may be an intrinsic epigenetic control mechanism that enhances stemness, self-renewal and chemo/radiotherapy resistance in cancer stem cells.

Neuronal activity in ontogeny and oncology

PubMed Central

Venkatesh, Humsa; Monje, Michelle

2017-01-01

The nervous system plays a central role in regulating the stem cell niche in many organs and thereby critically modulates development, homeostasis and plasticity. A similarly powerful role for neural regulation of the cancer microenvironment is emerging. Neurons promote the growth of cancers of the brain, skin, prostate, pancreas and stomach. Parallel mechanisms shared in development and cancer suggest that neural modulation of the tumor microenvironment may prove a universal theme, although the mechanistic details of such modulation remain to be discovered for many malignancies. Here, we review what is known about the influences of active neurons on stem cell and cancer microenvironments across a broad range of tissues and discuss emerging principles of neural regulation of development and cancer. PMID:28718448

Validation and Interrogation of Differentially Expressed and Alternatively Spliced Genes in African American Prostate Cancer

DTIC Science & Technology

2016-10-01

These analyses have led to two submitted manuscripts. The first manuscript, “Variants of stemness -related genes predicted to regulate RNA splicing...and Table 1-3 at the end of this progress report. The second manuscript, “Single nucleotide polymorphisms of stemness pathway genes predicted to...cancer and support a contribution of the stemness pathway to prostate cancer patient outcome. Please see Figure 5-7 and Table 4-6 at the end of this

Curcumin Suppresses In Vitro Proliferation and Invasion of Human Prostate Cancer Stem Cells by Modulating DLK1-DIO3 Imprinted Gene Cluster MicroRNAs.

PubMed

Zhang, Hu; Zheng, Jiajia; Shen, Hongliang; Huang, Yongyi; Liu, Te; Xi, Hao; Chen, Chuan

2018-01-01

Curcumin can suppress human prostate cancer (HuPCa) cell proliferation and invasion. However, it is not known whether curcumin can inhibit HuPCa stem cell (HuPCaSC) proliferation and invasion. We used methyl thiazolyl tetrazolium and Transwell assays to examine the proliferation and invasion of the HuPCaSC lines DU145 and 22Rv1 following curcumin or dimethyl sulfoxide (control) treatment. The microRNA (miRNA) expression levels in the DLK1-DIO3 imprinted genomic region in the cells and in tumor tissues from patients with PCa were examined using microarray and quantitative PCR. The median inhibitory concentration of curcumin for HuPCa cells significantly inhibited HuPCaSC proliferation and invasion in vitro. The miR-770-5p and miR-1247 expression levels in the DLK1-DIO3 imprinted gene cluster were significantly different between the curcumin-treated and control HuPCaSCs. Overexpression of these positive miRNAs significantly increased the inhibition rates of miR-770-5p- and miR-1247-transfected HuPCaSCs compared to the control miR-Mut-transfected HuPCaSCs. Lastly, low-tumor grade PCa tissues had higher miR-770-5p and miR-1247 expression levels than high-grade tumor tissues. Curcumin can suppress HuPCaSC proliferation and invasion in vitro by modulating specific miRNAs in the DLK1-DIO3 imprinted gene cluster.

Alpha-adrenergic blocker mediated osteoblastic stem cell differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Yoon Jung; Lee, Jue Yeon; Research Center, Nano Intelligent Biomedical Engineering Corporation

Highlights: Black-Right-Pointing-Pointer Doxazocin directly up-regulated bone metabolism at a low dose. Black-Right-Pointing-Pointer Doxazocin induced osteoblastic stem cell differentiation without affecting cell proliferation. Black-Right-Pointing-Pointer This osteogenic stem cell differentiation is mediated by ERK-signal dependent pathway. -- Abstract: Recent researches have indicated a role for antihypertensive drugs including alpha- or beta-blockers in the prevention of bone loss. Some epidemiological studies reported the protective effects of those agents on fracture risk. However, there is limited information on the association with those agents especially at the mechanism of action. In the present study, we investigated the effects of doxazosin, an alpha-blocker that is clinicallymore » used for the treatment of benign prostatic hyperplasia (BPH) along with antihypertensive medication, on the osteogenic stem cell differentiation. We found that doxazosin increased osteogenic differentiation of human mesenchymal stem cells, detected by Alizarin red S staining and calcein. Doxazosin not only induced expression of alkaline phosphatase, type I collagen, osteopontin, and osteocalcin, it also resulted in increased phosphorylation of extracellular signal-regulated kinase (ERK1/2), a MAP kinase involved in osteoblastic differentiation. Treatment with U0126, a MAP kinase inhibitor, significantly blocked doxazosin-induced osteoblastic differentiation. Unrelated to activation of osteogenic differentiation by doxazosin, we found that there were no significant changes in adipogenic differentiation or in the expression of adipose-specific genes, including peroxisome proliferator-activated receptor {gamma}, aP2, or LPL. In this report, we suggest that doxazosin has the ability to increase osteogenic cell differentiation via ERK1/2 activation in osteogenic differentiation of adult stem cells, which supports the protective effects of antihypertensive drug on fracture risk and according to our data doxazosin might be useful for application in the field of bone metabolism.« less

BMP7 Induces Dormancy of Prostatic Tumor Stem Cell in Bone

DTIC Science & Technology

2012-10-01

the upper back of nude mice. Recombinant human BMP7 was peritumorally injected daily after implantation. Tumor growth was monitored weekly by...of BMP7 was administrated daily through i.v. after intracardiac injection of CSCs from PC3mm or C4-2B cells to the mice. As shown in Figure 5A...mice, and then BMP7 was administrated daily . BLI of representative mice in each group six weeks after implantation (A). Normalized BLI signals

Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2013-10-01

collagen-adherent α2β1hi/CD44hi cells2 (see appendix). Recent experimental and clinical studies have identified BMI-1 as a member of the polycomb family of...next phase of studies will examine BMI-1 targeted therapy in combination with Taxotere and other recently approved therapies. These studies will...project, we are on track for determining which BMI-1 inhibitor(s) to be used for in vivo studies in NOD-SCID mice and fish during the second and third

Molecular imaging of prostate cancer: translating molecular biology approaches into the clinical realm.

PubMed

Vargas, Hebert Alberto; Grimm, Jan; F Donati, Olivio; Sala, Evis; Hricak, Hedvig

2015-05-01

The epidemiology of prostate cancer has dramatically changed since the introduction of prostate-specific antigen (PSA) screening in the 1980's. Most prostate cancers today are detected at early stages of the disease and are considered 'indolent'; however, some patients' prostate cancers demonstrate a more aggressive behaviour which leads to rapid progression and death. Increasing understanding of the biology underlying the heterogeneity that characterises this disease has led to a continuously evolving role of imaging in the management of prostate cancer. Functional and metabolic imaging techniques are gaining importance as the impact on the therapeutic paradigm has shifted from structural tumour detection alone to distinguishing patients with indolent tumours that can be managed conservatively (e.g., by active surveillance) from patients with more aggressive tumours that may require definitive treatment with surgery or radiation. In this review, we discuss advanced imaging techniques that allow direct visualisation of molecular interactions relevant to prostate cancer and their potential for translation to the clinical setting in the near future. The potential use of imaging to follow molecular events during drug therapy as well as the use of imaging agents for therapeutic purposes will also be discussed. • Advanced imaging techniques allow direct visualisation of molecular interactions in prostate cancer. • MRI/PET, optical and Cerenkov imaging facilitate the translation of molecular biology. • Multiple compounds targeting PSMA expression are currently undergoing clinical translation. • Other targets (e.g., PSA, prostate-stem cell antigen, GRPR) are in development.

Zika Virus Selectively Kills Aggressive Human Embryonal CNS Tumor Cells In Vitro and In Vivo.

PubMed

Kaid, Carolini; Goulart, Ernesto; Caires-Júnior, Luiz C; Araujo, Bruno H S; Soares-Schanoski, Alessandra; Bueno, Heloisa M S; Telles-Silva, Kayque A; Astray, Renato M; Assoni, Amanda F; Júnior, Antônio F R; Ventini, Daniella C; Puglia, Ana L P; Gomes, Roselane P; Zatz, Mayana; Okamoto, Oswaldo K

2018-06-15

Zika virus (ZIKV) is largely known for causing brain abnormalities due to its ability to infect neural progenitor stem cells during early development. Here, we show that ZIKV is also capable of infecting and destroying stem-like cancer cells from aggressive human embryonal tumors of the central nervous system (CNS). When evaluating the oncolytic properties of Brazilian Zika virus strain (ZIKV BR ) against human breast, prostate, colorectal, and embryonal CNS tumor cell lines, we verified a selective infection of CNS tumor cells followed by massive tumor cell death. ZIKV BR was more efficient in destroying embryonal CNS tumorspheres than normal stem cell neurospheres. A single intracerebroventricular injection of ZIKV BR in BALB/c nude mice bearing orthotopic human embryonal CNS tumor xenografts resulted in a significantly longer survival, decreased tumor burden, fewer metastasis, and complete remission in some animals. Tumor cells closely resembling neural stem cells at the molecular level with activated Wnt signaling were more susceptible to the oncolytic effects of ZIKV BR Furthermore, modulation of Wnt signaling pathway significantly affected ZIKV BR -induced tumor cell death and viral shedding. Altogether, these preclinical findings indicate that ZIKV BR could be an efficient agent to treat aggressive forms of embryonal CNS tumors and could provide mechanistic insights regarding its oncolytic effects. Significance: Brazilian Zika virus strain kills aggressive metastatic forms of human CNS tumors and could be a potential oncolytic agent for cancer therapy. Cancer Res; 78(12); 3363-74. ©2018 AACR . ©2018 American Association for Cancer Research.

Mechanisms of Reactive Stroma-Induced Tumorigenesis in Prostate Cancer

DTIC Science & Technology

2016-11-01

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION STATEMENT: Approved for Public... Research and Materiel Command Fort Detrick, Maryland 21702-5012 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT...and co-culture models. We have found that RUNX1 is critical mediator of TGF-beta action in mesenchymal stem /progenitor cells. RUNX1 is critical for

Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

DTIC Science & Technology

2014-10-01

15 Preprint of Bansal et al., Nature Comm., in revision. (Manuscript, supplemental material and...established, treatment with C-209 resulted in a significant antitumor activity (See Figs. 7 of Bansal et al., Nature Comm. manuscript in revision that is...combination therapy. (See Fig. 7e-g of Bansal et al., Nature Comm. manuscript in revision that is attached in the Appendix). Task #5. We selected

Inorganic Arsenic–Related Changes in the Stromal Tumor Microenvironment in a Prostate Cancer Cell–Conditioned Media Model

PubMed Central

Shearer, Joseph J.; Wold, Eric A.; Umbaugh, Charles S.; Lichti, Cheryl F.; Nilsson, Carol L.; Figueiredo, Marxa L.

2015-01-01

Background: The tumor microenvironment plays an important role in the progression of cancer by mediating stromal–epithelial paracrine signaling, which can aberrantly modulate cellular proliferation and tumorigenesis. Exposure to environmental toxicants, such as inorganic arsenic (iAs), has also been implicated in the progression of prostate cancer. Objective: The role of iAs exposure in stromal signaling in the tumor microenvironment has been largely unexplored. Our objective was to elucidate molecular mechanisms of iAs-induced changes to stromal signaling by an enriched prostate tumor microenvironment cell population, adipose-derived mesenchymal stem/stromal cells (ASCs). Results: ASC-conditioned media (CM) collected after 1 week of iAs exposure increased prostate cancer cell viability, whereas CM from ASCs that received no iAs exposure decreased cell viability. Cytokine array analysis suggested changes to cytokine signaling associated with iAs exposure. Subsequent proteomic analysis suggested a concentration-dependent alteration to the HMOX1/THBS1/TGFβ signaling pathway by iAs. These results were validated by quantitative reverse transcriptase–polymerase chain reaction (RT-PCR) and Western blotting, confirming a concentration-dependent increase in HMOX1 and a decrease in THBS1 expression in ASC following iAs exposure. Subsequently, we used a TGFβ pathway reporter construct to confirm a decrease in stromal TGFβ signaling in ASC following iAs exposure. Conclusions: Our results suggest a concentration-dependent alteration of stromal signaling: specifically, attenuation of stromal-mediated TGFβ signaling following exposure to iAs. Our results indicate iAs may enhance prostate cancer cell viability through a previously unreported stromal-based mechanism. These findings indicate that the stroma may mediate the effects of iAs in tumor progression, which may have future therapeutic implications. Citation: Shearer JJ, Wold EA, Umbaugh CS, Lichti CF, Nilsson CL, Figueiredo ML. 2016. Inorganic arsenic–related changes in the stromal tumor microenvironment in a prostate cancer cell–conditioned media model. Environ Health Perspect 124:1009–1015; http://dx.doi.org/10.1289/ehp.1510090 PMID:26588813

Cancer Stem Cells: Cellular Plasticity, Niche, and its Clinical Relevance.

PubMed

Lee, Gina; Hall, Robert R; Ahmed, Atique U

2016-10-01

Cancer handles an estimated 7.6 million deaths worldwide per annum. A recent theory focuses on the role Cancer Stem Cells (CSCs) in driving tumorigenesis and disease progression. This theory hypothesizes that a population of the tumor cell with similar functional and phenotypic characteristics as normal tissue stem cells are responsible for formation and advancement of many human cancers. The CSCs subpopulation can differentiate into non-CSC tumor cells and promote phenotypic and functional heterogeneity within the tumor. The presence of CSCs has been reported in a number of human cancers including blood, breast, brain, colon, lung, pancreas prostate and liver. Although the origin of CSCs remains a mystery, recent reports suggest that the phenotypic characteristics of CSCs may be plastic and are influenced by the microenvironment specific for the individual tumor. Such factors unique to each tumor preserve the dynamic balance between CSCs to non-CSCs cell fate, as well as maintain the proper equilibrium. Alternating such equilibrium via dedifferentiation can result in aggressiveness, as CSCs are considered to be more resistant to the conventional cancer treatments of chemotherapy and radiation. Understanding how the tumoral microenvironment affects the plasticity driven CSC niche will be critical for developing a more effective treatment for cancer by eliminating its aggressive and recurring nature that now is believed to be perpetuated by CSCs.

Chronic bacterial prostatitis in men with spinal cord injury.

PubMed

Krebs, Jörg; Bartel, Peter; Pannek, Jürgen

2014-12-01

Recurrent urinary tract infections (UTI) are a major problem affecting spinal cord injury (SCI) patients and may stem from chronic bacterial prostatitis. We have therefore investigated the presence of chronic bacterial prostatitis and its role in the development of recurrent symptomatic UTI in SCI men. This study is a prospective cross-sectional investigation of bacterial prostatitis in SCI men in a single SCI rehabilitation center. In 50 men with chronic SCI presenting for a routine urologic examination, urine samples before and after prostate massage were taken for microbiologic investigation and white blood cell counting. Furthermore, patient characteristics, bladder diary details, and the annual rate of symptomatic UTI were collected retrospectively. No participant reported current symptoms of UTI or prostatitis. In most men (39/50, 78 %), the microbiologic analysis of the post-massage urine sample revealed growth of pathogenic bacteria. The majority of these men (32/39, 82 %) also presented with mostly (27/39, 69 %) the same pathogenic bacteria in the pre-massage sample. There was no significant (p = 0.48) difference in the number of symptomatic UTI in men with a positive post-massage culture compared with those with a negative culture. No significant (p = 0.67) difference in the frequency distribution of positive versus negative post-massage cultures was detected between men with recurrent and sporadic UTI. Most SCI men are affected by asymptomatic bacterial prostatitis; however, bacterial prostatitis does not play a major role in the development of recurrent UTI. The indication for antibiotic treatment of chronic bacterial prostatitis in asymptomatic SCI men with recurrent UTI is questionable.

PTEN expression and function in adult cancer stem cells and prospects for therapeutic targeting.

PubMed

Ciuffreda, Ludovica; Falcone, Italia; Incani, Ursula Cesta; Del Curatolo, Anais; Conciatori, Fabiana; Matteoni, Silvia; Vari, Sabrina; Vaccaro, Vanja; Cognetti, Francesco; Milella, Michele

2014-09-01

Phosphatase and tensin homolog deleted on chromosome ten (PTEN) is a non-redundant lipid phosphatase that restrains and fine tunes the phosphatidylinositol-3-kinase (PI3K) signaling pathway. PTEN is involved in inherited syndromes, which predispose to different types of cancers and is among the most frequently inactivated tumor suppressor genes in sporadic cancers. Indeed, loss of PTEN function occurs in a wide spectrum of human cancers through a variety of mechanisms, including mutations, deletions, transcriptional silencing, or protein instability. PTEN prevents tumorigenesis through multiple mechanisms and regulates a plethora of cellular processes, including survival, proliferation, energy metabolism and cellular architecture. Moreover, recent studies have demonstrated that PTEN is able to exit, exist, and function outside the cell, allowing for inhibition of the PI3K pathway in neighboring cells in a paracrine fashion. Most recently, studies have shown that PTEN is also critical for stem cell maintenance and that PTEN loss can lead to the emergence and proliferation of cancer stem cell (CSC) clones. Depending on the cellular and tissue context of origin, PTEN deletion may result in increased self-renewal capacity or normal stem cell exhaustion and PTEN-defìcient stem and progenitor cells have been reported in prostate, lung, intestinal, and pancreatic tissues before tumor formation; moreover, reversible or irreversible PTEN loss is frequently observed in CSC from a variety of solid and hematologic malignancies, where it may contribute to the functional phenotype of CSC. In this review, we will focus on the role of PTEN expression and function and downstream pathway activation in cancer stem cell biology and regulation of the tumorigenic potential; the emerging role of PTEN in mediating the crosstalk between the PI3K and MAPK pathways will also be discussed, together with prospects for the therapeutic targeting of tumors lacking PTEN expression. Copyright © 2014 Elsevier Ltd. All rights reserved.

Minority Undergraduate Research in Prostate Cancer: Bridging Opportunities for Postbaccalaureate Education

DTIC Science & Technology

2012-03-01

students  were  assigned  to  read  both  popular  and   scientific  literature  regarding  the   genetic ,  socio...Biochemistry, Soma Jobbagy, BS Biochemistry, and Erica Boetefuer, Biological Sciences Judging Rubrics for the ASBMB Undergraduate Poster Competition 2007...Bruce Boman, Biological Sciences Role of miRNAs in Regulating Colon Cancer Stem Cells 37) Carrie Barnum and Jennifer Sabatino, Genetics Zohra Ali-Khan

TRAF4 and Castration Resistant Prostate Cancer

DTIC Science & Technology

2016-10-01

Generation of TRAF4 mouse This minigene was then inserted into the Rosa 26 locus in the mouse embryonic stem cells. After embryo injection, we...were delayed in the Major Task 3 subtask 2 and 3. The problem was we did not get germline transmission after embryo injection. The embryo injection...was performed in the Genetically Engineered Mouse Core at Baylor College of Medicine. Similar problem was also reported with other PIs’ embryo

Hydrogel microstructure live-cell array for multiplexed analyses of cancer stem cells, tumor heterogeneity and differential drug response at single-element resolution.

PubMed

Afrimzon, E; Botchkina, G; Zurgil, N; Shafran, Y; Sobolev, M; Moshkov, S; Ravid-Hermesh, O; Ojima, I; Deutsch, M

2016-03-21

Specific phenotypic subpopulations of cancer stem cells (CSCs) are responsible for tumor development, production of heterogeneous differentiated tumor mass, metastasis, and resistance to therapies. The development of therapeutic approaches based on targeting rare CSCs has been limited partially due to the lack of appropriate experimental models and measurement approaches. The current study presents new tools and methodologies based on a hydrogel microstructure array (HMA) for identification and multiplex analyses of CSCs. Low-melt agarose integrated with type I collagen, a major component of the extracellular matrix (ECM), was used to form a solid hydrogel array with natural non-adhesive characteristics and high optical quality. The array contained thousands of individual pyramidal shaped, nanoliter-volume micro-chambers (MCs), allowing concomitant generation and measurement of large populations of free-floating CSC spheroids from single cells, each in an individual micro-chamber (MC). The optical live cell platform, based on an imaging plate patterned with HMA, was validated using CSC-enriched prostate and colon cancer cell lines. The HMA methodology and quantitative image analysis at single-element resolution clearly demonstrates several levels of tumor cell heterogeneity, including morphological and phenotypic variability, differences in proliferation capacity and in drug response. Moreover, the system facilitates real-time examination of single stem cell (SC) fate, as well as drug-induced alteration in expression of stemness markers. The technology may be applicable in personalized cancer treatment, including multiplex ex vivo analysis of heterogeneous patient-derived tumor specimens, precise detection and characterization of potentially dangerous cell phenotypes, and for representative evaluation of drug sensitivity of CSCs and other types of tumor cells.

Opposite regulation of MDM2 and MDMX expression in acquisition of mesenchymal phenotype in benign and cancer cells.

PubMed

Slabáková, Eva; Kharaishvili, Gvantsa; Smějová, Monika; Pernicová, Zuzana; Suchánková, Tereza; Remšík, Ján; Lerch, Stanislav; Straková, Nicol; Bouchal, Jan; Král, Milan; Culig, Zoran; Kozubík, Alois; Souček, Karel

2015-11-03

Plasticity of cancer cells, manifested by transitions between epithelial and mesenchymal phenotypes, represents a challenging issue in the treatment of neoplasias. Both epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET) are implicated in the processes of metastasis formation and acquisition of stem cell-like properties. Mouse double minute (MDM) 2 and MDMX are important players in cancer progression, as they act as regulators of p53, but their function in EMT and metastasis may be contradictory. Here, we show that the EMT phenotype in multiple cellular models and in clinical prostate and breast cancer samples is associated with a decrease in MDM2 and increase in MDMX expression. Modulation of EMT-accompanying changes in MDM2 expression in benign and transformed prostate epithelial cells influences their migration capacity and sensitivity to docetaxel. Analysis of putative mechanisms of MDM2 expression control demonstrates that in the context of defective p53 function, MDM2 expression is regulated by EMT-inducing transcription factors Slug and Twist. These results provide an alternative context-specific role of MDM2 in EMT, cell migration, metastasis, and therapy resistance.

Concepts of epigenetics in prostate cancer development.

PubMed

Cooper, C S; Foster, C S

2009-01-27

Substantial evidence now supports the view that epigenetic changes have a role in the development of human prostate cancer. Analyses of the patterns of epigenetic alteration are providing important insights into the origin of this disease and have identified specific alterations that may serve as useful diagnostic and prognostic biomarkers. Examination of cancer methylation patterns supports a stem cell origin of prostate cancer. It is well established that methylation of GSTpi is a marker of prostate cancer, and global patterns of histone marking appear to be linked to cancer prognosis with levels of acetylated histones H3K9, H3K18, and H4K12, and of dimethylated H4R3 and H3K4, dividing low-grade prostate cancer (Gleason 6 or less) into two prognostically separate groups. Elevated levels of several components of the polycomb group protein complex, EZH2, BMI1, and RING1, can also act as biomarkers of poor clinical outcome. Many components of the epigenetic machinery, including histone deacetylase (whose expression level is linked to the TMPRSS2:ERG translocation) and the histone methylase EZH2, are potential therapeutic targets. The recent discovery of the role of small RNAs in governing the epigenetic status of individual genes offers exciting new possibilities in therapeutics and chemoprevention.

Human spermatogonial stem cells display limited proliferation in vitro under mouse spermatogonial stem cell culture conditions.

PubMed

Medrano, Jose V; Rombaut, Charlotte; Simon, Carlos; Pellicer, Antonio; Goossens, Ellen

2016-11-01

To study the ability of human spermatogonial stem cells (hSSCs) to proliferate in vitro under mouse spermatogonial stem cell (mSSC) culture conditions. Experimental basic science study. Reproductive biology laboratory. Cryopreserved testicular tissue with normal spermatogenesis obtained from three donors subjected to orchiectomy due to a prostate cancer treatment. Testicular cells used to create in vitro cell cultures corresponding to the following groups: [1] unsorted human testicular cells, [2] differentially plated human testicular cells, and [3] cells enriched with major histocompatibility complex class 1 (HLA - )/epithelial cell surface antigen (EPCAM + ) in coculture with inactivated testicular feeders from the same patient. Analyses and characterization including immunocytochemistry and quantitative reverse-transcription polymerase chain reaction for somatic and germ cell markers, testosterone and inhibin B quantification, and TUNEL assay. Putative hSSCs appeared in singlets, doublets, or small groups of up to four cells in vitro only when testicular cells were cultured in StemPro-34 medium supplemented with glial cell line-derived neurotrophic factor (GDNF), leukemia inhibitory factor (LIF), basic fibroblast growth factor (bFGF), and epidermal growth factor (EGF). Fluorescence-activated cell sorting with HLA - /EPCAM + resulted in an enrichment of 27% VASA + /UTF1 + hSSCs, compared to 13% in unsorted controls. Coculture of sorted cells with inactivated testicular feeders gave rise to an average density of 112 hSSCs/cm 2 after 2 weeks in vitro compared with unsorted cells (61 hSSCs/cm 2 ) and differentially plated cells (49 hSSCS/cm 2 ). However, putative hSSCs rarely stained positive for the proliferation marker Ki67, and their presence was reduced to the point of almost disappearing after 4 weeks in vitro. We found that hSSCs show limited proliferation in vitro under mSSC culture conditions. Coculture of HLA - /EPCAM + sorted cells with testicular feeders improved the germ cell/somatic cell ratio. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

[High dosage therapy with stem cell transplantation in neuroendocrine carcinoma].

PubMed

Buxhofer, V; Ruckser, R; Kier, P; Habertheuer, K H; Zelenka, P; Tatzreiter, G; Dorner, S; Vedovelli, H; Sebesta, C; Hinterberger, W

2000-01-01

Neuroendocrine carcinoma and small-cell lung cancer (SCLC) are highly responsive to chemo- and radiotherapy. Nevertheless, most patients (pts.) experience relapse. At the 2nd department of medicine in the Donauspital, 4 pts. with neuroendocrine carcinomas of different primary sites underwent high-dose chemotherapy with autologous stem-cell transplantation (ASTx). Pt. 1 suffered from neuroendocrine lung cancer, pt. 2 from a small-cell carcinoma of the pancreas. Pt. 3 had a metastatic small-cell abdominal bulky tumor and pt. 4 presented with neuroendocrine carcinoma of the prostate. After 4-6 cycles induction chemotherapy pts. were consolidated with 1 cycle of HDCht and ASTx. Prior to HDCht pt. 1 and pt. 2 were in complete remission (CR) and pt. 3 and pt. 4 in partial remission. Pt. 3 converted in CR after HDCht. He is still in CR with a disease-free survival of 23 month after ASTx and 30 month after diagnosis. Pt. 1, 2 and 4 died from relapse 10, 16 and 5 month after ASTx and 16, 22 and 9 month after diagnosis. Pts. with neuroendocrine carcinomas might be suitable candidates for HDCht and ASTx.

Nanodiamond-DGEA peptide conjugates for enhanced delivery of doxorubicin to prostate cancer

PubMed Central

Hwang, Patrick; McIntosh, Roberus; Green, Hadiyah N; Jun, Ho-Wook; Dean, Derrick

2014-01-01

Summary The field of nanomedicine has emerged as an approach to enhance the specificity and efficacy of cancer treatments as stand-alone therapies and in combination with standard chemotherapeutic treatment regimens. The current standard of care for metastatic cancer, doxorubicin (DOX), is presented with challenges, namely toxicity due to a lack of specificity and targeted delivery. Nano-enabled targeted drug delivery systems can provide an avenue to overcome these issues. Nanodiamonds (ND), in particular, have been researched over the past five years for use in various drug delivery systems but minimal work has been done that incorporates targeting capability. In this study, a novel targeted drug delivery system for bone metastatic prostate cancer was developed, characterized, and evaluated in vitro. NDs were conjugated with the Asp–Gly–Glu–Ala (DGEA) peptide to target α2β1 integrins over-expressed in prostate cancers during metastasis. To facilitate drug delivery, DOX was adsorbed to the surface of the ND-DGEA conjugates. Successful preparation of the ND-DGEA conjugates and the ND-DGEA+DOX system was confirmed with transmission electron microscopy, hydrodynamic size, and zeta potential measurements. Since traditional DOX treatment regimens lack specificity and increased toxicity to normal tissues, the ND-DGEA conjugates were designed to distinguish between cells that overexpress α2β1 integrin, bone metastatic prostate cancers cells (PC3), and cells that do not, human mesenchymal stem cells (hMSC). Utilizing the ND-DGEA+DOX system, the efficacy of 1 µg/mL and 2 µg/mL DOX doses increased from 2.5% to 12% cell death and 11% to 34% cell death, respectively. These studies confirmed that the delivery and efficacy of DOX were enhanced by ND-DGEA conjugates. Thus, the targeted ND-DGEA+DOX system provides a novel approach for decreasing toxicity and drug doses. PMID:25161829

Lapatinib-resistant cancer cells possessing epithelial cancer stem cell properties develop sensitivity during sphere formation by activation of the ErbB/AKT/cyclin D2 pathway.

PubMed

Ohnishi, Yuichi; Yasui, Hiroki; Kakudo, Kenji; Nozaki, Masami

2016-11-01

Lapatinib, a dual inhibitor of epidermal growth factor receptor (EGFR)/ErbB2, has antiproliferative effects and is used to treat patients with ErbB2-positive metastatic breast cancer. In the present study, we examined the effects of lapatinib on growth of oral and prostate cancer cells. Oral squamous cell carcinoma (OSCC) cell lines HSC3, HSC4 and Ca9-22 were sensitive to the antiproliferative effects of lapatinib in anchorage-dependent culture, but the OSCC cell lines KB and SAS and the prostate cancer cell line DU145 were resistant to lapatinib. Phosphorylation levels of EGFR in all cell lines decreased during lapatinib treatment in anchorage‑dependent culture. Furthermore, the phosphorylation levels of ErbB2, ErbB3 and Akt and the protein levels of cyclin D1 were decreased by lapatinib treatment of HSC3, HSC4 and Ca9-22 cells. ErbB3 was not expressed and cyclin D1 protein levels were not altered by lapatinib treatment in KB, DU145 and SAS cells. The phosphorylation of ErbB2 and AKT was not affected by lapatinib in SAS cells and was not detected in KB and DU145 cells. Lapatinib-resistant cell lines exhibited sphere-forming ability, and SAS cells developed sensitivity to lapatinib during sphere formation. The phosphorylation levels of ErbB2 and AKT and protein levels of cyclin D2 increased during sphere formation of SAS cells and decreased with lapatinib treatment. In addition, sphere formation of SAS cells was inhibited by the AKT inhibitor MK2206. AKT phosphorylation and cyclin D2 levels in SAS spheres were decreased by MK2206 treatment. SAS cells expressed E-cadherin, but not vimentin and KB cells expressed vimentin, but not E-cadherin. DU145 cells expressed vimentin and E-cadherin. These results suggested that phosphorylation of EGFR and ErbB2 by cell detachment from the substratum induces the AKT pathway/cyclin D2-dependent sphere growth in SAS epithelial cancer stem-like cells, thereby rendering SAS spheres sensitive to lapatinib treatment.

Microenvironment -Programmed Metastatic Prostate Cancer Stem Cells (mPCSCs)

DTIC Science & Technology

2016-10-01

accomplished all goals in Aims 1 and 2. Our lab recently relocated from the MD Anderson Cancer Center to Roswell Park Cancer Institute in Buffalo. We ...G. Tang, M.D., Ph.D. CONTRACTING ORGANIZATION: University of Texas MD Anderson Cancer Center Houston, TX 77030 REPORT DATE: October 2016 TYPE OF... Anderson Cancer Center Houston, TX 77030 9. SPONSORING / MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S) U.S. Army Medical

Clonal Evaluation of Prostate Cancer by ERG/SPINK1 Status to Improve Prognosis Prediction

DTIC Science & Technology

2015-10-01

waiting for case numbers to increase. Significant changes in use or care of human subjects, vertebrate animals , biohazards, and/or select agents...IHC at UM is no longer with the University. He has been replaced by Connie Brenke, who is now performing the staining which is ongoing (as shown in...and genomics. Institutional partners include the FHCRC and the UW Institute of Stem Cell Sciences. Core A: Tissues/ Sera /Models The major function

Adipose Stem Cell-Based Therapeutic Targeting of Residual Androgens in African Americans With Bone-Metastatic Prostate Cancer

DTIC Science & Technology

2014-09-01

protein diet with isoflavones. Nutr Cancer 35: 130–136 18. MacInnis RJ and English DR (2006) Body size and composition and prostate cancer risk...outgrowth of ‘castration-adapted’ tumors under androgen deprivation therapy (ADT). Evidence exists for direct correlation between increased obesity and body ...4 Body ……………………………………………………………………………………………………………. 4 Discussion……………………………………………………………………….. 9 Key Research Accomplishments

The impact of low-dose carcinogens and environmental disruptors on tissue invasion and metastasis

PubMed Central

Ochieng, Josiah; Nangami, Gladys N.; Ogunkua, Olugbemiga; Miousse, Isabelle R.; Koturbash, Igor; Odero-Marah, Valerie; McCawley, Lisa; Nangia-Makker, Pratima; Ahmed, Nuzhat; Luqmani, Yunus; Chen, Zhenbang; Papagerakis, Silvana; Wolf, Gregory T.; Dong, Chenfang; Zhou, Binhua P.; Brown, Dustin G.; Colacci, Annamaria; Hamid, Roslida A.; Mondello, Chiara; Raju, Jayadev; Ryan, Elizabeth P.; Woodrick, Jordan; Scovassi, Ivana; Singh, Neetu; Vaccari, Monica; Roy, Rabindra; Forte, Stefano; Memeo, Lorenzo; Salem, Hosni K.; Amedei, Amedeo; Al-Temaimi, Rabeah; Al-Mulla, Fahd; Bisson, William H.; Eltom, Sakina E.

2015-01-01

The purpose of this review is to stimulate new ideas regarding low-dose environmental mixtures and carcinogens and their potential to promote invasion and metastasis. Whereas a number of chapters in this review are devoted to the role of low-dose environmental mixtures and carcinogens in the promotion of invasion and metastasis in specific tumors such as breast and prostate, the overarching theme is the role of low-dose carcinogens in the progression of cancer stem cells. It is becoming clearer that cancer stem cells in a tumor are the ones that assume invasive properties and colonize distant organs. Therefore, low-dose contaminants that trigger epithelial–mesenchymal transition, for example, in these cells are of particular interest in this review. This we hope will lead to the collaboration between scientists who have dedicated their professional life to the study of carcinogens and those whose interests are exclusively in the arena of tissue invasion and metastasis. PMID:26106135

Role of miR-452-5p in the tumorigenesis of prostate cancer: A study based on the Cancer Genome Atl(TCGA), Gene Expression Omnibus (GEO), and bioinformatics analysis.

PubMed

Gao, Li; Zhang, Li-Jie; Li, Sheng-Hua; Wei, Li-Li; Luo, Bin; He, Rong-Quan; Xia, Shuang

2018-03-06

MiR-452-5p has been reported to be down-regulated in prostate cancer, affecting the development of this type of cancer. However, the molecular mechanism of miR-452-5p in prostate cancer remains unclear. Therefore, we investigated the network of target genes of miR-452-5p in prostate cancer using bioinformatics analyses. We first analyzed the expression profiles and prognostic value of miR-452-5p in prostate cancer tissues from a public database. Gene Ontology (GO), the Kyoto Encyclopedia of Genes and Genomes (KEGG), PANTHER pathway analyses, and a disease ontology (DG) analysis were performed to find the molecular functions of the target genes from GSE datasets and miRWalk. Finally, we validated hub genes from the protein-protein interaction (PPI) networks of the target genes in the Human Protein Atlas (HPA) database and Gene Expression Profiling Interactive Analysis (GEPIA). Narrowing down the optimal target genes was conducted by seeking the common parts of up-regulated genes from GEPIA, down-regulated genes from GSE datasets, and predicted genes in miRWalk. Based on mining of GEO and ArrayExpress microarray chips and miRNA-Seq data in the TCGA database, which includes 1007 prostate cancer samples and 387 non-cancer samples, miR-452-5p is shown to be down-regulated in prostate cancer. GO, KEGG, and PANTHER pathway analyses suggested that the target genes might participate in important biological processes, such as transforming growth factor beta signaling and the positive regulation of brown fat cell differentiation and mesenchymal cell differentiation, as well as the Ras signaling pathway and pathways regulating the pluripotency of stem cells and arrhythmogenic right ventricular cardiomyopathy (ARVC). Nine genes-GABBR, PNISR, NTSR1, DOCK1, EREG, SFRP1, PTGS2, LEF1, and BMP2-were defined as hub genes in the PPI network. Three genes-FAM174B, SLC30A4, and SLIT1-were jointly shared by GEPIA, the GSE datasets, and miRWalk. Down-regulated miR-452-5p might play an essential role in the tumorigenesis of prostate cancer. Copyright © 2018. Published by Elsevier GmbH.

Reactive stroma in the prostate during late life: The role of microvasculature and antiangiogenic therapy influences.

PubMed

Montico, Fabio; Kido, Larissa Akemi; San Martin, Rebeca; Rowley, David R; Cagnon, Valéria H A

2015-10-01

Prostate cancer is associated to a reactive stroma microenvironment characterized by angiogenic processes that are favorable for tumor progression. Senescence has been identified as a predisposing factor for prostate malignancies. In turn, the relationships between aging, reactive stroma, and the mechanisms that induce this phenotype are largely unknown. Thus, we investigated the occurrence of reactive stroma in the mouse prostate during advanced age as well as the effects of antiangiogenic and androgen ablation therapies on reactive stroma recruitment. Male mice (52-week-old FVB) were treated with two classes of angiogenesis inhibitors: direct (TNP-470; 15 mg/kg; s.c.) and/or indirect (SU5416; 6 mg/kg; i.p.). Androgen ablation was carried out by finasteride administration (20 mg/kg; s.c.), alone or in association to both inhibitors. The Transgenic Adenocarcinoma of the Mouse Prostate (TRAMP) model was used as a paradigm of cancer-associated reactive stroma. The dorsolateral prostate was collected for α-actin (αSMA), vimentin (VIM), and transforming growth factor-beta (TGF-β) immunohistochemical and Western blotting analyses as well as for CD34/αSMA and CD34/VIM colocalization. Senescence was associated with increased αSMA, VIM, and TGF-β expression as well as with the recruitment of CD34/αSMA and CD34/VIM dual-positive fibroblasts. These observations were similar to those verified in TRAMP mice. Antiangiogenic treatment promoted the recovery of senescence-associated stromal changes. Hormonal ablation, despite having led to impaired CD34/αSMA and CD34/VIM dual-positive cell recruitment, did not result in decreased stimulus to reactive stroma development, due to enhanced TGF-β expression in relation to the aged controls. Reactive stroma develops in the prostate of non-transgenic mice as a result of aging. The periacinar microvasculature is a candidate source for the recruitment of reactive stroma-associated cells, which may be derived either from perivascular-resident mesenchymal stem cells (MSCs) or from an endothelial-to-mesenchymal transition (EndMT) process. Thus, antiangiogenic therapy is a promising approach for preventing age-associated prostate malignancies by means of its negative interference in the development of reactive stroma phenotype from the vascular wall. © 2015 Wiley Periodicals, Inc.

Manumycin A suppresses exosome biogenesis and secretion via targeted inhibition of Ras/Raf/ERK1/2 signaling and hnRNP H1 in castration-resistant prostate cancer cells.

PubMed

Datta, Amrita; Kim, Hogyoung; Lal, Madhu; McGee, Lauren; Johnson, Adedoyin; Moustafa, Ahmed A; Jones, Jennifer C; Mondal, Debasis; Ferrer, Marc; Abdel-Mageed, Asim B

2017-11-01

Emerging evidence links exosomes to cancer progression by the trafficking of oncogenic factors and neoplastic reprogramming of stem cells. This necessitates identification and integration of functionally validated exosome-targeting therapeutics into current cancer management regimens. We employed quantitative high throughput screen on two libraries to identify exosome-targeting drugs; a commercially available collection of 1280 pharmacologically active compounds and a collection of 3300 clinically approved compounds. Manumycin-A (MA), a natural microbial metabolite, was identified as an inhibitor of exosome biogenesis and secretion by castration-resistant prostate cancer (CRPC) C4-2B, but not the normal RWPE-1, cells. While no effect was observed on cell growth, MA attenuated ESCRT-0 proteins Hrs, ALIX and Rab27a and exosome biogenesis and secretion by CRPC cells. The MA inhibitory effect is primarily mediated via targeted inhibition of the Ras/Raf/ERK1/2 signaling. The Ras-dependent MA suppression of exosome biogenesis and secretion is partly mediated by ERK-dependent inhibition of the oncogenic splicing factor hnRNP H1. Our findings suggest that MA is a potential drug candidate to suppress exosome biogenesis and secretion by CRPC cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Role of monocyte-lineage cells in prostate cancer cell invasion and tissue factor expression.

PubMed

Lindholm, Paul F; Lu, Yi; Adley, Brian P; Vladislav, Tudor; Jovanovic, Borko; Sivapurapu, Neela; Yang, Ximing J; Kajdacsy-Balla, André

2010-11-01

Tissue factor (TF) is a cell surface glycoprotein intricately related to blood coagulation and inflammation. This study was performed to investigate the role of monocyte-lineage cells in prostate cancer cell TF expression and cell invasion. Prostate cancer cell invasion was tested with and without added peripheral blood monocytes or human monocyte-lineage cell lines. TF neutralizing antibodies were used to determine the TF requirement for prostate cancer cell invasion activity. Immunohistochemistry was performed to identify prostate tissue CD68 positive monocyte-derived cells and prostate epithelial TF expression. Co-culture of PC-3, DU145, and LNCaP cells with isolated human monocytes significantly stimulated prostate cancer cell invasion activity. TF expression was greater in highly invasive prostate cancer cells and was induced in PC-3, DU145, and LNCaP cells by co-culture with U-937 cells, but not with THP-1 cells. TF neutralizing antibodies inhibited PC-3 cell invasion in co-cultures with monocyte-lineage U-937 or THP-1 cells. Prostate cancer tissues contained more CD68 positive cells in the stroma and epithelium (145 ± 53/mm(2)) than benign prostate (108 ± 31/mm(2)). Samples from advanced stage prostate cancer tended to contain more CD68 positive cells when compared with lower stage lesions. Prostatic adenocarcinoma demonstrated significantly increased TF expression compared with benign prostatic epithelium. This study shows that co-culture with monocyte-lineage cells induced prostate cancer cell invasion activity. PC-3 invasion and TF expression was induced in co-culture with U-937 cells and partially inhibited with TF neutralizing antibodies.

Transgenic overexpression of NanogP8 in the mouse prostate is insufficient to initiate tumorigenesis but weakly promotes tumor development in the Hi-Myc mouse model.

PubMed

Liu, Bigang; Gong, Shuai; Li, Qiuhui; Chen, Xin; Moore, John; Suraneni, Mahipal V; Badeaux, Mark D; Jeter, Collene R; Shen, Jianjun; Mehmood, Rashid; Fan, Qingxia; Tang, Dean G

2017-08-08

This project was undertaken to address a critical cancer biology question: Is overexpression of the pluripotency molecule Nanog sufficient to initiate tumor development in a somatic tissue? Nanog1 is critical for the self-renewal and pluripotency of ES cells, and its retrotransposed homolog, NanogP8 is preferentially expressed in somatic cancer cells. Our work has shown that shRNA-mediated knockdown of NanogP8 in prostate, breast, and colon cancer cells inhibits tumor regeneration whereas inducible overexpression of NanogP8 promotes cancer stem cell phenotypes and properties. To address the key unanswered question whether tissue-specific overexpression of NanogP8 is sufficient to promote tumor development in vivo , we generated a NanogP8 transgenic mouse model, in which the ARR 2 PB promoter was used to drive NanogP8 cDNA. Surprisingly, the ARR 2 PB-NanogP8 transgenic mice were viable, developed normally, and did not form spontaneous tumors in >2 years. Also, both wild type and ARR 2 PB-NanogP8 transgenic mice responded similarly to castration and regeneration and castrated ARR 2 PB-NanogP8 transgenic mice also did not develop tumors. By crossing the ARR 2 PB-NanogP8 transgenic mice with ARR 2 PB-Myc (i.e., Hi-Myc) mice, we found that the double transgenic (i.e., ARR 2 PB-NanogP8; Hi-Myc) mice showed similar tumor incidence and histology to the Hi-Myc mice. Interestingly, however, we observed white dots in the ventral lobes of the double transgenic prostates, which were characterized as overgrown ductules/buds featured by crowded atypical Nanog-expressing luminal cells. Taken together, our present work demonstrates that transgenic overexpression of NanogP8 in the mouse prostate is insufficient to initiate tumorigenesis but weakly promotes tumor development in the Hi-Myc mouse model.

Exosomal microRNA profiling to identify hypoxia-related biomarkers in prostate cancer

PubMed Central

Panigrahi, Gati K.; Ramteke, Anand; Birks, Diane; Abouzeid Ali, Hamdy E.; Venkataraman, Sujatha; Agarwal, Chapla; Vibhakar, Rajeev; Miller, Lance D.; Agarwal, Rajesh; Abd Elmageed, Zakaria Y.; Deep, Gagan

2018-01-01

Hypoxia and expression of hypoxia-related biomarkers are associated with disease progression and treatment failure in prostate cancer (PCa). We have reported that exosomes (nanovesicles of 30-150 nm in diameter) secreted by human PCa cells under hypoxia promote invasiveness and stemness in naïve PCa cells. Here, we identified the unique microRNAs (miRNAs) loaded in exosomes secreted by PCa cells under hypoxia. Using TaqMan® array microRNA cards, we analyzed the miRNA profile in exosomes secreted by human PCa LNCaP cells under hypoxic (ExoHypoxic) and normoxic (ExoNormoxic) conditions. We identified 292 miRNAs loaded in both ExoHypoxic and ExoNormoxic. The top 11 miRNAs with significantly higher level in ExoHypoxic compared to ExoNormoxic were miR-517a, miR-204, miR-885, miR-143, miR-335, miR-127, miR-542, miR-433, miR-451, miR-92a and miR-181a; and top nine miRNA with significantly lower expression level in ExoHypoxic compared to ExoNormoxic were miR-521, miR-27a, miR-324, miR-579, miR-502, miR-222, miR-135b, miR-146a and miR-491. Importantly, the two differentially expressed miRNAs miR-885 (increased expression) and miR-521 (decreased expression) showed similar expression pattern in exosomes isolated from the serum of PCa patients compared to healthy individuals. Additionally, miR-204 and miR-222 displayed correlated expression patterns in prostate tumors (Pearson R = 0.66, p < 0.0001) by The Cancer Genome Atlas (TCGA) prostate adenocarcinoma (PRAD) genomic dataset analysis. Overall, the present study identified unique miRNAs with differential expression in exosomes secreted from hypoxic PCa cells and suggests their potential usefulness as a biomarker of hypoxia in PCa patients. PMID:29568403

Cell and tissue engineering and clinical applications: an overview.

PubMed

Stoltz, J F; Bensoussan, D; Decot, V; Ciree, A; Netter, P; Gillet, P

2006-01-01

Most human tissues do not regenerate spontaneously; this is why cell therapies and tissue engineering are promising alternatives. The principle is simple: cells are collected in a patient and introduced in the damaged tissue or in a tridimentional porous support and harvested in a bioreactor in which the physico-chemical and mechanical parameters are controlled. Once the tissues (or the cells) are mature they may be implanted. In parallel, the development of biotherapies with stem cells is a field of research in turmoil given the hopes for clinical applications that it brings up. Embryonic stem cells are potentially more interesting since they are totipotent, but they can only be obtained at the very early stages of the embryo. The potential of adult stem cells is limited but isolating them induces no ethical problem and it has been known for more than 40 years that bone marrow does possess the regenerating functions of blood cells. Finally, the properties of foetal stem cells (blood cells from the umbilical cord) are forerunners of the haematopoietic system but the ability of these cells to participate to the formation of other tissues is more problematic. Another field for therapeutic research is that of dendritic cells, antigen presenting cells. Their efficiency in cell therapy relies on the initiation of specific immune responses. They represent a promising tool in the development of a protective immune response against antigens which the host is usually unable to generate an efficient response (melanomas, breast against cancer, prostate cancer, ..). Finally, gene therapy, has been nourishing high hopes but few clinical applications can be envisaged in the short term, although potential applications are multiple (haemophilia, myopathies, ..). A large number of clinical areas stand as candidates for clinical applications: leukaemia and cancers, cardiac insufficiency and vascular diseases, cartilage and bone repair, ligaments and tendons, liver diseases, ophthalmology, diabetes, neurological diseases (Parkinson, Huntington disease, ..), .. Various aspects of this new regenerative therapeutic medicine are developed in this work.

Evaluating the Potential of Adipose Tissue-Derived MSCs as Anticancer Gene Delivery Vehicles to Bone-Metastasized Prostate Cancer

DTIC Science & Technology

2010-04-01

Isolation of  human adipose‐derived stem cells from biopsies and  liposuction  specimens. Methods Mol Biol. 2008;449:69‐79.  PMID: 18370084.  6:   Ricks DM...may already be in circulation in the bone marrow. Human adipose derived MSCs (AT-MSCs) on the other hand are easy to procure from liposuction

Adipose Stem Cell-Based Therapeutic Targeting of Residual Androgens in African Americans with Metastatic Prostate Cancer

DTIC Science & Technology

2012-09-01

report are those of the author( s ) and should not be construed as an official Department of the Army position, policy or decision unless so designated...that notwithstanding any other provision of law, no person shall be subject to any penalty for failing to comply with a collection of information if...it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE 1 September 2012 2

T CELLS LOCALIZED TO THE ANDROGEN-DEPRIVED PROSTATE ARE TH1 AND TH17 BIASED

PubMed Central

Morse, Matthew D.; McNeel, Douglas G.

2013-01-01

BACKGROUND T cells infiltrate the prostates of prostate cancer patients undergoing neoadjuvant androgen deprivation. These prostate-infiltrating T cells have an oligoclonal phenotype, suggesting the development of an antigen-specific T-cell response. We hypothesized that androgen deprivation might elicit a prostate tissue-specific T-cell response that could potentially be combined with other immune-active therapies, and consequently sought to investigate the nature and timing of this T-cell response following castration. METHODS We investigated the phenotype and cytokine expression of T cells at various time points in the prostates of Lewis rats following surgical castration, and used adoptive transfer of prostate-infiltrating lymphocytes to determine whether the infiltration by T cells was mediated by effects of castration on the prostate or lymphocytes. RESULTS Prostate T-cell infiltration shortly after castration was TH1 biased up to approximately 30 days, followed by a predominance of TH17-type cells, which persisted until at least 90 days post castration. Prostate-infiltrating lymphocytes from sham-treated or castrate rats localized to the prostates of castrate animals. CONCLUSIONS These observations suggest castration elicits a time-dependent prostate-specific T-cell infiltration, and this infiltration is likely mediated by effects of castration on prostate tissue rather than T cells. These findings have implications for the timing of immunotherapies combined with androgen deprivation as treatments for prostate cancer. PMID:22213030

Antigen specific T-cell responses against tumor antigens are controlled by regulatory T cells in patients with prostate cancer.

PubMed

Hadaschik, Boris; Su, Yun; Huter, Eva; Ge, Yingzi; Hohenfellner, Markus; Beckhove, Philipp

2012-04-01

Immunotherapy is a promising approach in an effort to control castration resistant prostate cancer. We characterized tumor antigen reactive T cells in patients with prostate cancer and analyzed the suppression of antitumor responses by regulatory T cells. Peripheral blood samples were collected from 57 patients with histologically confirmed prostate cancer, 8 patients with benign prostatic hyperplasia and 16 healthy donors. Peripheral blood mononuclear cells were isolated and antigen specific interferon-γ secretion of isolated T cells was analyzed by enzyme-linked immunospot assay. T cells were functionally characterized and T-cell responses before and after regulatory T-cell depletion were compared. As test tumor antigens, a panel of 11 long synthetic peptides derived from a total of 8 tumor antigens was used, including prostate specific antigen and prostatic acid phosphatase. In patients with prostate cancer we noted a 74.5% effector T-cell response rate compared with only 25% in patients with benign prostatic hyperplasia and 31% in healthy donors. In most patients 2 or 3 tumor antigens were recognized. Comparing various disease stages there was a clear increase in the immune response against prostate specific antigens from intermediate to high risk tumors and castration resistant disease. Regulatory T-cell depletion led to a significant boost in effector T-cell responses against prostate specific antigen and prostatic acid phosphatase. Tumor specific effector T cells were detected in most patients with prostate cancer, especially those with castration resistant prostate cancer. Since effector T-cell responses against prostate specific antigens strongly increased after regulatory T-cell depletion, our results indicate that immunotherapy efficacy could be enhanced by decreasing regulatory T cells. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Characterization of adenoviral transduction profile in prostate cancer cells and normal prostate tissue.

PubMed

Ai, Jianzhong; Tai, Phillip W L; Lu, Yi; Li, Jia; Ma, Hong; Su, Qin; Wei, Qiang; Li, Hong; Gao, Guangping

2017-09-01

Prostate diseases are common in males worldwide with high morbidity. Gene therapy is an attractive therapeutic strategy for prostate diseases, however, it is currently underdeveloped. As well known, adeno virus (Ad) is the most widely used gene therapy vector. The aims of this study are to explore transduction efficiency of Ad in prostate cancer cells and normal prostate tissue, thus further providing guidance for future prostate pathophysiological studies and therapeutic development of prostate diseases. We produced Ad expressing enhanced green fluorescence protein (EGFP), and characterized the transduction efficiency of Ad in both human and mouse prostate cancer cell lines in vitro, as well as prostate tumor xenograft, and wild-type mouse prostate tissue in vivo. Ad transduction efficiency was determined by EGFP fluorescence using microscopy and flow cytometry. Cell type-specific transduction was examined by immunofluorescence staining of cell markers. Our data showed that Ad efficiently transduced human and mouse prostate cancer cells in vitro in a dose dependent manner. Following intratumoral and intraprostate injection, Ad could efficiently transduce prostate tumor xenograft and the major prostatic cell types in vivo, respectively. Our findings suggest that Ad can efficiently transduce prostate tumor cells in vitro as well as xenograft and normal prostate tissue in vivo, and further indicate that Ad could be a potentially powerful toolbox for future gene therapy of prostate diseases. © 2017 Wiley Periodicals, Inc.

Tumor Cells Surviving Exposure to Proton or Photon Radiation Share a Common Immunogenic Modulation Signature, Rendering Them More Sensitive to T Cell–Mediated Killing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gameiro, Sofia R.; Malamas, Anthony S.; Bernstein, Michael B.

Purpose: To provide the foundation for combining immunotherapy to induce tumor antigen–specific T cells with proton radiation therapy to exploit the activity of those T cells. Methods and Materials: Using cell lines of tumors frequently treated with proton radiation, such as prostate, breast, lung, and chordoma, we examined the effect of proton radiation on the viability and induction of immunogenic modulation in tumor cells by flow cytometric and immunofluorescent analysis of surface phenotype and the functional immune consequences. Results: These studies show for the first time that (1) proton and photon radiation induced comparable up-regulation of surface molecules involved in immune recognition (histocompatibilitymore » leukocyte antigen, intercellular adhesion molecule 1, and the tumor-associated antigens carcinoembryonic antigen and mucin 1); (2) proton radiation mediated calreticulin cell-surface expression, increasing sensitivity to cytotoxic T-lymphocyte killing of tumor cells; and (3) cancer stem cells, which are resistant to the direct cytolytic activity of proton radiation, nonetheless up-regulated calreticulin after radiation in a manner similar to non-cancer stem cells. Conclusions: These findings offer a rationale for the use of proton radiation in combination with immunotherapy, including for patients who have failed radiation therapy alone or have limited treatment options.« less

Effects and Mechanisms of Low-Intensity Pulsed Ultrasound for Chronic Prostatitis and Chronic Pelvic Pain Syndrome

PubMed Central

Lin, Guiting; Reed-Maldonado, Amanda B.; Lin, Maofan; Xin, Zhongcheng; Lue, Tom F.

2016-01-01

Chronic Prostatitis/Chronic Pelvic Pain Syndrome (CP/CPPS) is one of the most common urologic diseases, and no curative treatments have been identified. Low-intensity pulsed ultrasound (LIPUS) has been successfully used in promoting tissue healing, inhibiting inflammation and pain, differentiating stem cells, and stimulating nerve regeneration/muscle regeneration, as well as enhancing angiogenesis. Very recently, LIPUS has been proven an effective approach for CP/CPPS. This review summarizes the possible mechanisms responsible for the therapeutic effect of LIPUS for CP/CPPS. To search publications relevant to the topics of this review, the search engine for life sciences of Entrez was used. We reviewed the available evidence from 1954 through 2015 concerning LIPUS for CP/CPPS. According to the literature, both transrectal and transperineal approaches of LIPUS are effective for CP/CPPS. PMID:27376284

Effects and Mechanisms of Low-Intensity Pulsed Ultrasound for Chronic Prostatitis and Chronic Pelvic Pain Syndrome.

PubMed

Lin, Guiting; Reed-Maldonado, Amanda B; Lin, Maofan; Xin, Zhongcheng; Lue, Tom F

2016-07-01

Chronic Prostatitis/Chronic Pelvic Pain Syndrome (CP/CPPS) is one of the most common urologic diseases, and no curative treatments have been identified. Low-intensity pulsed ultrasound (LIPUS) has been successfully used in promoting tissue healing, inhibiting inflammation and pain, differentiating stem cells, and stimulating nerve regeneration/muscle regeneration, as well as enhancing angiogenesis. Very recently, LIPUS has been proven an effective approach for CP/CPPS. This review summarizes the possible mechanisms responsible for the therapeutic effect of LIPUS for CP/CPPS. To search publications relevant to the topics of this review, the search engine for life sciences of Entrez was used. We reviewed the available evidence from 1954 through 2015 concerning LIPUS for CP/CPPS. According to the literature, both transrectal and transperineal approaches of LIPUS are effective for CP/CPPS.

STEAP: A prostate-specific cell-surface antigen highly expressed in human prostate tumors

PubMed Central

Hubert, Rene S.; Vivanco, Igor; Chen, Emily; Rastegar, Shiva; Leong, Kahan; Mitchell, Steve C.; Madraswala, Rashida; Zhou, Yanhong; Kuo, James; Raitano, Arthur B.; Jakobovits, Aya; Saffran, Douglas C.; Afar, Daniel E. H.

1999-01-01

In search of novel genes expressed in metastatic prostate cancer, we subtracted cDNA isolated from benign prostatic hypertrophic tissue from cDNA isolated from a prostate cancer xenograft model that mimics advanced disease. One novel gene that is highly expressed in advanced prostate cancer encodes a 339-amino acid protein with six potential membrane-spanning regions flanked by hydrophilic amino- and carboxyl-terminal domains. This structure suggests a potential function as a channel or transporter protein. This gene, named STEAP for six-transmembrane epithelial antigen of the prostate, is expressed predominantly in human prostate tissue and is up-regulated in multiple cancer cell lines, including prostate, bladder, colon, ovarian, and Ewing sarcoma. Immunohistochemical analysis of clinical specimens demonstrates significant STEAP expression at the cell–cell junctions of the secretory epithelium of prostate and prostate cancer cells. Little to no staining was detected at the plasma membranes of normal, nonprostate human tissues, except for bladder tissue, which expressed low levels of STEAP at the cell membrane. Protein analysis located STEAP at the cell surface of prostate-cancer cell lines. Our results support STEAP as a cell-surface tumor-antigen target for prostate cancer therapy and diagnostic imaging. PMID:10588738

Prostate-Specific Natural Health Products (Dietary Supplements) Radiosensitize Normal Prostate Cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hasan, Yasmin; Schoenherr, Diane; Martinez, Alvaro A.

Purpose: Prostate-specific health products (dietary supplements) are taken by cancer patients to alleviate the symptoms linked with poor prostate health. However, the effect of these agents on evidence-based radiotherapy practice is poorly understood. The present study aimed to determine whether dietary supplements radiosensitized normal prostate or prostate cancer cell lines. Methods and Materials: Three well-known prostate-specific dietary supplements were purchased from commercial sources available to patients (Trinovin, Provelex, and Prostate Rx). The cells used in the study included normal prostate lines (RWPE-1 and PWR-1E), prostate tumor lines (PC3, DU145, and LNCaP), and a normal nonprostate line (HaCaT). Supplement toxicity wasmore » assessed using cell proliferation assays [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] and cellular radiosensitivity using conventional clonogenic assays (0.5-4Gy). Cell cycle kinetics were assessed using the bromodeoxyuridine/propidium iodide pulse-labeling technique, apoptosis by scoring caspase-3 activation, and DNA repair by assessing gammaH2AX. Results: The cell growth and radiosensitivity of the malignant PC3, DU145, and LNcaP cells were not affected by any of the dietary prostate supplements (Provelex [2mug/mL], Trinovin [10mug/mL], and Prostate Rx [50 mug/mL]). However, both Trinovin (10mug/mL) and Prostate Rx (6mug/mL) inhibited the growth rate of the normal prostate cell lines. Prostate Rx increased cellular radiosensitivity of RWPE-1 cells through the inhibition of DNA repair. Conclusion: The use of prostate-specific dietary supplements should be discouraged during radiotherapy owing to the preferential radiosensitization of normal prostate cells.« less

Racial disparity in colorectal cancer: Gut microbiome and cancer stem cells.

PubMed

Goyal, Sachin; Nangia-Makker, Pratima; Farhana, Lulu; Yu, Yingjie; Majumdar, Adhip Pn

2016-09-26

Over the past two decades there has been remarkable progress in cancer diagnosis, treatment and screening. The basic mechanisms leading to pathogenesis of various types of cancers are also understood better and some patients, if diagnosed at a particular stage go on to lead a normal pre-diagnosis life. Despite these achievements, racial disparity in some cancers remains a mystery. The higher incidence, aggressiveness and mortality of breast, prostate and colorectal cancers (CRCs) in African-Americans as compared to Caucasian-Americans are now well documented. The polyp-carcinoma sequence in CRC and easy access to colonic epithelia or colonic epithelial cells through colonoscopy/colonic effluent provides the opportunity to study colonic stem cells early in course of natural history of the disease. With the advent of metagenomic sequencing, uncultivable organisms can now be identified in stool and their numbers correlated with the effects on colonic epithelia. It would be expected that these techniques would revolutionize our understanding of the racial disparity in CRC and pave a way for the same in other cancers as well. Unfortunately, this has not happened. Our understanding of the underlying factors responsible in African-Americans for higher incidence and mortality from colorectal carcinoma remains minimal. In this review, we aim to summarize the available data on role of microbiome and cancer stem cells in racial disparity in CRC. This will provide a platform for further research on this topic.

An inducible model of abacterial prostatitis induces antigen specific inflammatory and proliferative changes in the murine prostate

PubMed Central

Haverkamp, Jessica M.; Charbonneau, Bridget; Meyerholz, David K.; Cohen, Michael B.; Snyder, Paul W.; Svensson, Robert U.; Henry, Michael D.; Wang, Hsing- Hui

2011-01-01

Background Prostatitis is a poorly understood disease and increasing evidence suggests inflammation is involved in other prostatic diseases, including prostate cancer. Methods The ability of pre-activated CD8 T cells to induce prostatitis was examined by adoptive transfer into POET-3 mice or POET-3/Luc/Pten−/+ mice. Characterization of the inflammatory response was determined by examining leukocyte infiltration by histological analysis, flow cytometry and by evaluating cytokine and chemokine levels in prostate tissue. The impact of inflammation on the prostate was evaluated by monitoring epithelial cell proliferation over time. Results Initiation of inflammation by ovalbumin specific CD8+ T cells (OT-I cells) resulted in development of acute prostatitis in the anterior, dorsolateral and anterior prostate of POET-3 and POET-3/Luc/Pten−/+ mice. Acute prostatitis was characterized by recruitment of adoptively transferred OT-I cells and importantly, autologous CD4+ and CD8+ T cells, myeloid-derived suppressor cells (MDSC) and regulatory T cells (Treg). In concert with leukocyte infiltration elevated levels of pro-inflammatory cytokines and chemokines were observed. Inflammation also resulted in marked epithelial cell proliferation that was sustained up to 80 days post adoptive-transfer of OT-I cells. Conclusions The POET-3 model represents a novel mouse model to study both acute and chronic prostate inflammation in an antigen-specific system. Further, the POET-3 mouse model can be crossed with other genetic models of disease such as the C57/Luc/Pten−/− model of prostate cancer, allowing the impact of prostatitis on other prostatic diseases to be evaluated. PMID:21656824

The role of CD133 in the identification and characterisation of tumour-initiating cells in non-small-cell lung cancer.

PubMed

Tirino, Virginia; Camerlingo, Rosa; Franco, Renato; Malanga, Donatella; La Rocca, Antonello; Viglietto, Giuseppe; Rocco, Gaetano; Pirozzi, Giuseppe

2009-09-01

Emerging evidence suggests that specific sub-populations of cancer cells with stem cell characteristics within the bulk of tumours are implicated in the pathogenesis of heterogeneous malignant tumours. The cells that drive tumour growth have been denoted cancer-initiating cells or cancer stem cells (hereafter CSCs). CSCs have been isolated initially from leukaemias and subsequently from several solid tumours including brain, breast, prostate, colon and lung cancer. This study aimed at isolating and characterising the population of tumour-initiating cells in non-small-cell lung cancer (NSCLC). Specimens of NSCLC obtained from 89 patients undergoing tumour resection at the Cancer National Institute of Naples were analysed. Three methods to isolate the tumour-initiating cells were used: (1) flow cytometry analysis for identification of positive cells for surface markers such as CD24, CD29, CD31, CD34, CD44, CD133 and CD326; (2) Hoechst 33342 dye exclusion test for the identification of a side-population characteristic for the presence of stem cells; (3) non-adherent culture condition able to form spheres with stem cell-like characteristics. Definition of the tumourigenic potential of the cells through soft agar assay and injection into NOD/SCID mice were used to functionally define (in vitro and in vivo) putative CSCs isolated from NSCLC samples. Upon flow cytometry analysis of NSCLC samples, CD133-positive cells were found in 72% of 89 fresh specimens analysed and, on average, represented 6% of the total cells. Moreover, the number of CD133-positive cells increased markedly when the cells, isolated from NSCLC specimens, were grown as spheres in non-adherent culture conditions. Cells from NSCLC, grown as spheres, when assayed in soft agar, give rise to a 3.8-fold larger number of colonies in culture and are more tumourigenic in non-obese diabetic (NOD)/severe combined immunodeficiency (SCID) mice compared with the corresponding adherent cells. We have isolated and characterised a population of CD133-positive cells from NSCLC that is able to give rise to spheres and can act as tumour-initiating cells.

Targeting Btk/Etk of prostate cancer cells by a novel dual inhibitor

PubMed Central

Guo, W; Liu, R; Bhardwaj, G; Yang, J C; Changou, C; Ma, A-H; Mazloom, A; Chintapalli, S; Xiao, K; Xiao, W; Kumaresan, P; Sanchez, E; Yeh, C-T; Evans, C P; Patterson, R; Lam, K S; Kung, H-J

2014-01-01

Btk and Etk/BMX are Tec-family non-receptor tyrosine kinases. Btk has previously been reported to be expressed primarily in B cells and has an important role in immune responses and B-cell malignancies. Etk has been shown previously to provide a strong survival and metastasis signal in human prostate cancer cells, and to confer androgen independence and drug resistance. While the role of Etk in prostate carcinogenesis is well established, the functions of Btk in prostate cancer have never been investigated, likely due to the perception that Btk is a hematopoietic, but not epithelial, kinase. Herein, we found that Btk is overexpressed in prostate cancer tissues and prostate cancer cells. The level of Btk in prostate cancer tissues correlates with cancer grades. Knockdown of Btk expression selectively inhibits the growth of prostate cancer cells, but not that of the normal prostate epithelial cells, which express very little Btk. Dual inhibition of Btk and Etk has an additive inhibitory effect on prostate cancer cell growth. To explore Btk and Etk as targets for prostate cancer, we developed a small molecule dual inhibitor of Btk and Etk, CTN06. Treatment of PC3 and other prostate cancer cells, but not immortalized prostate epithelial cells with CTN06 resulted in effective cell killing, accompanied by the attenuation of Btk/Etk signals. The killing effect of CTN06 is more potent than that of commonly used inhibitors against Src, Raf/VEGFR and EGFR. CTN06 induces apoptosis as well as autophagy in human prostate cancer cells, and is a chemo-sensitizer for docetaxel (DTX), a standard of care for metastatic prostate cancer patients. CTN06 also impeded the migration of human prostate cancer cells based on a ‘wound healing' assay. The anti-cancer effect of CTN06 was further validated in vivo in a PC3 xenograft mouse model. PMID:25188519

Targeting Btk/Etk of prostate cancer cells by a novel dual inhibitor.

PubMed

Guo, W; Liu, R; Bhardwaj, G; Yang, J C; Changou, C; Ma, A-H; Mazloom, A; Chintapalli, S; Xiao, K; Xiao, W; Kumaresan, P; Sanchez, E; Yeh, C-T; Evans, C P; Patterson, R; Lam, K S; Kung, H-J

2014-09-04

Btk and Etk/BMX are Tec-family non-receptor tyrosine kinases. Btk has previously been reported to be expressed primarily in B cells and has an important role in immune responses and B-cell malignancies. Etk has been shown previously to provide a strong survival and metastasis signal in human prostate cancer cells, and to confer androgen independence and drug resistance. While the role of Etk in prostate carcinogenesis is well established, the functions of Btk in prostate cancer have never been investigated, likely due to the perception that Btk is a hematopoietic, but not epithelial, kinase. Herein, we found that Btk is overexpressed in prostate cancer tissues and prostate cancer cells. The level of Btk in prostate cancer tissues correlates with cancer grades. Knockdown of Btk expression selectively inhibits the growth of prostate cancer cells, but not that of the normal prostate epithelial cells, which express very little Btk. Dual inhibition of Btk and Etk has an additive inhibitory effect on prostate cancer cell growth. To explore Btk and Etk as targets for prostate cancer, we developed a small molecule dual inhibitor of Btk and Etk, CTN06. Treatment of PC3 and other prostate cancer cells, but not immortalized prostate epithelial cells with CTN06 resulted in effective cell killing, accompanied by the attenuation of Btk/Etk signals. The killing effect of CTN06 is more potent than that of commonly used inhibitors against Src, Raf/VEGFR and EGFR. CTN06 induces apoptosis as well as autophagy in human prostate cancer cells, and is a chemo-sensitizer for docetaxel (DTX), a standard of care for metastatic prostate cancer patients. CTN06 also impeded the migration of human prostate cancer cells based on a 'wound healing' assay. The anti-cancer effect of CTN06 was further validated in vivo in a PC3 xenograft mouse model.

High SRPX2 protein expression predicts unfavorable clinical outcome in patients with prostate cancer

PubMed Central

Zhang, Meng; Li, Xiaoli; Fan, Zhirui; Zhao, Jing; Liu, Shuzheng; Zhang, Mingzhi; Li, Huixiang; Goscinski, Mariusz Adam; Fan, Huijie; Suo, Zhenhe

2018-01-01

Background Sushi repeat-containing protein X-linked 2 (SRPX2) is overexpressed in a variety of different tumor tissues and correlated with poor prognosis in patients. Little research focuses on the role of SRPX2 expression in prostate cancer (PCa), and the clinicopathological significance of the protein expression in this tumor is relatively unknown. However, our previous transcriptome data from those cancer stem-like cells indicated the role of SRPX2 in PCa. Materials and methods In this study, RT-PCR and Western blotting were firstly used to examine the SRPX2 expression in three PCa cell lines including LNCaP, DU145, and PC3, and then SRPX2 protein expression was immunohistochemically investigated and statistically analyzed in a series of 106 paraffin-embedded PCa tissue specimens. Results Significantly lower levels of SRPX2 expression were verified in the LNCaP cells, compared with the expression in the aggressive DU145 and PC3 cells, in both mRNA and protein levels. Immunohistochemically, there were variable SRPX2 protein expressions in the clinical samples. Moreover, high levels of SRPX2 expression in the PCa tissues were significantly associated with Gleason score (P=0.008), lymph node metastasis (P=0.009), and distant metastasis (P=0.021). Furthermore, higher levels of SRPX2 expression in the PCa tissues were significantly associated with shorter overall survival (OS) (P<0.001). Conclusion Our results demonstrate that SRPX2 is highly expressed in aggressive PCa cells in vitro, and its protein expression in PCa is significantly associated with malignant clinical features and shorter OS, strongly indicating its prognostic value in prostate cancers. PMID:29881288

The impact of low-dose carcinogens and environmental disruptors on tissue invasion and metastasis.

PubMed

Ochieng, Josiah; Nangami, Gladys N; Ogunkua, Olugbemiga; Miousse, Isabelle R; Koturbash, Igor; Odero-Marah, Valerie; McCawley, Lisa J; Nangia-Makker, Pratima; Ahmed, Nuzhat; Luqmani, Yunus; Chen, Zhenbang; Papagerakis, Silvana; Wolf, Gregory T; Dong, Chenfang; Zhou, Binhua P; Brown, Dustin G; Colacci, Anna Maria; Hamid, Roslida A; Mondello, Chiara; Raju, Jayadev; Ryan, Elizabeth P; Woodrick, Jordan; Scovassi, A Ivana; Singh, Neetu; Vaccari, Monica; Roy, Rabindra; Forte, Stefano; Memeo, Lorenzo; Salem, Hosni K; Amedei, Amedeo; Al-Temaimi, Rabeah; Al-Mulla, Fahd; Bisson, William H; Eltom, Sakina E

2015-06-01

The purpose of this review is to stimulate new ideas regarding low-dose environmental mixtures and carcinogens and their potential to promote invasion and metastasis. Whereas a number of chapters in this review are devoted to the role of low-dose environmental mixtures and carcinogens in the promotion of invasion and metastasis in specific tumors such as breast and prostate, the overarching theme is the role of low-dose carcinogens in the progression of cancer stem cells. It is becoming clearer that cancer stem cells in a tumor are the ones that assume invasive properties and colonize distant organs. Therefore, low-dose contaminants that trigger epithelial-mesenchymal transition, for example, in these cells are of particular interest in this review. This we hope will lead to the collaboration between scientists who have dedicated their professional life to the study of carcinogens and those whose interests are exclusively in the arena of tissue invasion and metastasis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Bone marrow-derived cells contribute to regeneration of injured prostate epithelium and stroma.

PubMed

Nakata, Wataru; Nakai, Yasutomo; Yoshida, Takahiro; Sato, Mototaka; Hatano, Koji; Nagahara, Akira; Fujita, Kazutoshi; Uemura, Motohide; Nonomura, Norio

2015-06-01

Recent studies have reported that bone marrow-derived cells (BMDCs), which are recruited to sites of tissue injury and inflammation, can differentiate into epithelial cells, such as liver, lung, gastrointestinal tract, and skin cells. We investigated the role of BMDCs in contributing to regeneration of injured prostate epithelium. Using chimera rats that received allogenic bone marrow grafts from green fluorescent protein (GFP) transgenic rats after lethal whole-body irradiation, we investigated the existence of epithelial marker-positive BMDCs in injured prostate tissue caused by transurethral injection of lipopolysaccharide. Prostate tissues were harvested 2 weeks after transurethral lipopolysaccharide injection. Immunofluorescence staining showed that some cells in the stroma co-expressed GFP and pan-cytokeratin, which suggested the existence of epithelial marker-positive BMDCs. To confirm the existence of such cells, we collected bone marrow-derived non-hematopoietic cells (GFP+/CD45- cells) from the prostate by fluorescence-activated cell sorter analysis and analyzed the characteristics of the GFP+/CD45- cells. The number of cells in this population significantly increased from 0.042% to 0.492% compared with normal prostate tissue. We found by immunofluorescent analysis and RT-PCR that GFP+/CD45- cells expressed cytokeratin, which suggested that these cells have some features of epithelial cells. In the prostate obtained from the chimera rats 34 weeks after lipopolysaccharide injection, GFP- and cytokeratin-positive cells were observed in the prostate gland, which suggested that some of the cells in the prostate gland regenerated after prostate inflammation derived from bone marrow. BMDCs might be able to differentiate into prostate epithelial cells after prostatic injury. © 2015 Wiley Periodicals, Inc.

PCOTH, a novel gene overexpressed in prostate cancers, promotes prostate cancer cell growth through phosphorylation of oncoprotein TAF-Ibeta/SET.

PubMed

Anazawa, Yoshio; Nakagawa, Hidewaki; Furihara, Mutsuo; Ashida, Shingo; Tamura, Kenji; Yoshioka, Hiroki; Shuin, Taro; Fujioka, Tomoaki; Katagiri, Toyomasa; Nakamura, Yusuke

2005-06-01

Through genome-wide cDNA microarray analysis coupled with microdissection of prostate cancer cells, we identified a novel gene, prostate collagen triple helix (PCOTH), showing overexpression in prostate cancer cells and its precursor cells, prostatic intraepithelial neoplasia (PIN). Immunohistochemical analysis using polyclonal anti-PCOTH antibody confirmed elevated expression of PCOTH, a 100-amino-acid protein containing collagen triple-helix repeats, in prostate cancer cells and PINs. Knocking down PCOTH expression by small interfering RNA (siRNA) resulted in drastic attenuation of prostate cancer cell growth, and concordantly, LNCaP derivative cells that were designed to constitutively express exogenous PCOTH showed higher growth rate than LNCaP cells transfected with mock vector, suggesting the growth-promoting effect of PCOTH on prostate cancer cell. To investigate the biological mechanisms of this growth-promoting effect, we applied two-dimensional differential gel electrophoresis (2D-DIGE) to analyze the phospho-protein fractions in LNCaP cells transfected with PCOTH. We found that the phosphorylation level of oncoprotein TAF-Ibeta/SET was significantly elevated in LNCaP cells transfected with PCOTH than control LNCaP cells, and these findings were confirmed by Western blotting and in-gel kinase assay. Furthermore, knockdown of endogenous TAF-Ibeta expression by siRNA also attenuated viability of prostate cancer cells as well. These findings suggest that PCOTH is involved in growth and survival of prostate cancer cells thorough, in parts, the TAF-Ibeta pathway, and that this molecule should be a promising target for development of new therapeutic strategies for prostate cancers.

Prostate stromal cells express the progesterone receptor to control cancer cell mobility.

PubMed

Yu, Yue; Lee, Jennifer Suehyun; Xie, Ning; Li, Estelle; Hurtado-Coll, Antonio; Fazli, Ladan; Cox, Michael; Plymate, Stephen; Gleave, Martin; Dong, Xuesen

2014-01-01

Reciprocal interactions between epithelium and stroma play vital roles for prostate cancer development and progression. Enhanced secretions of cytokines and growth factors by cancer associated fibroblasts in prostate tumors create a favorable microenvironment for cancer cells to grow and metastasize. Our previous work showed that the progesterone receptor (PR) was expressed specifically in prostate stromal fibroblasts and smooth muscle cells. However, the expression levels of PR and its impact to tumor microenvironment in prostate tumors are poorly understood. Immunohistochemistry assays are applied to human prostate tissue biopsies. Cell migration, invasion and proliferation assays are performed using human prostate cells. Real-time PCR and ELISA are applied to measure gene expression at molecular levels. Immunohistochemistry assays showed that PR protein levels were decreased in cancer associated stroma when compared with paired normal prostate stroma. Using in vitro prostate stromal cell models, we showed that conditioned media collected from PR positive stromal cells inhibited prostate cancer cell migration and invasion, but had minor suppressive impacts on cancer cell proliferation. PR suppressed the secretion of stromal derived factor-1 (SDF-1) and interlukin-6 (IL-6) by stromal cells independent to PR ligands. Blocking PR expression by siRNA or supplementation of exogenous SDF-1 or IL-6 to conditioned media from PR positive stromal cells counteracted the inhibitory effects of PR to cancer cell migration and invasion. Decreased expression of the PR in cancer associated stroma may contribute to the elevated SDF-1 and IL-6 levels in prostate tumors and enhance prostate tumor progression.

Regucalcin is an androgen-target gene in the rat prostate modulating cell-cycle and apoptotic pathways.

PubMed

Vaz, Cátia V; Maia, Cláudio J; Marques, Ricardo; Gomes, Inês M; Correia, Sara; Alves, Marco G; Cavaco, José E; Oliveira, Pedro F; Socorro, Sílvia

2014-09-01

Regucalcin (RGN) is a calcium (Ca(2+) )-binding protein underexpressed in prostate adenocarcinoma comparatively to non-neoplastic prostate or benign prostate hyperplasia cases. Moreover, RGN expression is negatively associated with the cellular differentiation of prostate adenocarcinoma, suggesting that loss of RGN may be associated with tumor onset and progression. However, the RGN actions over the control of prostate cell growth have not been investigated. Androgens are implicated in the promotion of prostate cell proliferation, thus we studied the in vivo effect of androgens on RGN expression in rat prostate. The role of RGN modulating cell proliferation and apoptotic pathways in rat prostate was investigated using transgenic animals (Tg-RGN) overexpressing the protein. In vivo stimulation with 5α-dihydrotestosterone (DHT) down-regulated RGN expression in rat prostate. Cell proliferation index and prostate weight were reduced in Tg-RGN, which was concomitant with altered expression of cell-cycle regulators. Tg-RGN presented diminished expression of the oncogene H-ras and increased expression of cell-cycle inhibitor p21. Levels of anti-apoptotic Bcl-2, as well as the Bcl-2/Bax protein ratio were increased in prostates overexpressing RGN. Both caspase-3 expression and enzyme activity were decreased in the prostates of Tg-RGN. Overexpression of RGN resulted in inhibition of cell proliferation and apoptotic pathways, which demonstrated its role maintaining prostate growth balance. Thus, deregulation of RGN expression may be an important event favoring the development of prostate cancer. Moreover, the DHT effect down-regulating RGN expression in rat prostate highlighted for the importance of this protein in prostatic physiology. © 2014 Wiley Periodicals, Inc.

GPRC6A regulates prostate cancer progression

PubMed Central

Pi, Min; Quarles, L. Darryl

2011-01-01

BACKGROUND GPRC6A is a nutrient sensing GPCR that is activated in vitro by a variety of ligands, including amino acids, calcium, zinc, osteocalcin (OC) and testosterone. The association between nutritional factors and risk of prostate cancer, the finding of increased expression of OC in prostate cancer cells and the association between GPRC6A and risk of prostate cancer in Japanese men implicates a role of GPRC6A in prostate cancer. METHODS We examined if GPRC6A is expressed in human prostate cancer cell lines and used siRNA-mediated knockdown GPRC6A expression in prostate cancer cells to explore the function of GPRC6A in vitro. To assess the role GPRC6A in prostate cancer progression in vivo we intercrossed Gprc6a−/− mice onto the TRAMP mouse prostate cancer model. RESULTS GPRC6A transcripts were markedly increased in prostate cancer cell lines 22Rv1, PC-3 and LNCaP, compared to the normal prostate RWPE-1 cell line. In addition, a panel of GPRC6A ligands, including calcium, OC, and arginine, exhibited in prostate cancer cell lines a dose-dependent stimulation of ERK activity, cell proliferation, chemotaxis, and prostate specific antigen and Runx 2 gene expression. These responses were inhibited by siRNA-mediated knockdown of GPRC6A. Finally, transfer of Gprc6a deficiency onto a TRAMP mouse model of prostate cancer significantly retarded prostate cancer progression and improved survival of compound Gprc6a−/−/TRAMP mice. CONCLUSIONS GPRC6A is a novel molecular target for regulating prostate growth and cancer progression. Increments in GPRC6A may augment the ability of prostate cancer cells to proliferate in response to dietary and bone derived ligands. PMID:21681779

Gene therapy strategies for urological dysfunction.

PubMed

Chancellor, M B; Yoshimura, N; Pruchnic, R; Huard, J

2001-07-01

Novel molecular techniques such as conventional and ex vivo gene therapy, and tissue engineering have only recently been introduced to the field of urology. The lower urinary tract is ideally suited for minimally invasive therapy, and also ex vivo approaches would limit the risk of systemic side effects. Muscle-derived stem cells have been used successfully to treat stress incontinence, and rats with diabetic bladder dysfunction benefited from nerve growth factor (NGF)-based gene therapy. Nitric oxide synthase and capase-7 might provide suitable gene therapy targets for erectile dysfunction and benign prostatic hyperplasia, respectively.

Evaluation of a novel label-free photonic-crystal biosensor imaging system for the detection of prostate cancer cells

NASA Astrophysics Data System (ADS)

DeLuna, Frank; Ding, XiaoFie; Sun, Lu-Zhe; Ye, Jing Yong

2017-02-01

Biomarker screening for prostate-specific antigen (PSA) is the current clinical standard for detection of prostate cancer. However this method has shown many limitations, mainly in its specificity, which can lead to a high false positive rate. Thus, there is a growing need in developing a more specific detection system for prostate cancer. Using a Photonic- Crystal-based biosensor in a Total-Internal-Reflection (PC-TIR) configuration, we demonstrate the use of refractive index (RI) to accomplish label-free detection of prostate cancer cells against non-cancerous prostate epithelial cells. The PC-TIR biosensor possesses an open microcavity, which in contrast to traditional closed microcavities, allows for easier access of analyte molecules or cells to interact with its sensing surface. In this study, an imaging system was designed using the PC-TIR biosensor to quantify cell RI as the contrast parameter for prostate cancer detection. Non-cancerous BPH-1 prostate epithelial cells and prostate cancer PC-3 cells were placed on a single biosensor and measured concurrently. Recorded image data was then analyzed through a home-built MatLab program. Results demonstrate that RI is a suitable variable for differentiation between prostate cancer cells and non-cancerous prostate epithelial cells. Our study shows clinical potential in utilizing RI test for the detection of prostate cancer.

Definition of molecular determinants of prostate cancer cell bone extravasation.

PubMed

Barthel, Steven R; Hays, Danielle L; Yazawa, Erika M; Opperman, Matthew; Walley, Kempland C; Nimrichter, Leonardo; Burdick, Monica M; Gillard, Bryan M; Moser, Michael T; Pantel, Klaus; Foster, Barbara A; Pienta, Kenneth J; Dimitroff, Charles J

2013-01-15

Advanced prostate cancer commonly metastasizes to bone, but transit of malignant cells across the bone marrow endothelium (BMEC) remains a poorly understood step in metastasis. Prostate cancer cells roll on E-selectin(+) BMEC through E-selectin ligand-binding interactions under shear flow, and prostate cancer cells exhibit firm adhesion to BMEC via β1, β4, and αVβ3 integrins in static assays. However, whether these discrete prostate cancer cell-BMEC adhesive contacts culminate in cooperative, step-wise transendothelial migration into bone is not known. Here, we describe how metastatic prostate cancer cells breach BMEC monolayers in a step-wise fashion under physiologic hemodynamic flow. Prostate cancer cells tethered and rolled on BMEC and then firmly adhered to and traversed BMEC via sequential dependence on E-selectin ligands and β1 and αVβ3 integrins. Expression analysis in human metastatic prostate cancer tissue revealed that β1 was markedly upregulated compared with expression of other β subunits. Prostate cancer cell breaching was regulated by Rac1 and Rap1 GTPases and, notably, did not require exogenous chemokines as β1, αVβ3, Rac1, and Rap1 were constitutively active. In homing studies, prostate cancer cell trafficking to murine femurs was dependent on E-selectin ligand, β1 integrin, and Rac1. Moreover, eliminating E-selectin ligand-synthesizing α1,3 fucosyltransferases in transgenic adenoma of mouse prostate mice dramatically reduced prostate cancer incidence. These results unify the requirement for E-selectin ligands, α1,3 fucosyltransferases, β1 and αVβ3 integrins, and Rac/Rap1 GTPases in mediating prostate cancer cell homing and entry into bone and offer new insight into the role of α1,3 fucosylation in prostate cancer development.

Applications of immunoPET: Using 124I-anti-PSCA A11 minibody for imaging disease progression and response to therapy in mouse xenograft models of prostate cancer

DOE PAGES

Knowles, Scott M.; Tavare, Richard; Zettlitz, Kirstin A.; ...

2014-10-17

Here, prostate stem cell antigen (PSCA) is highly expressed in local prostate cancers and prostate cancer bone metastases and its expression correlates with androgen receptor activation and a poor prognosis. Here in this study, we investigate the potential clinical applications of immunoPET with the anti-PSCA A11 minibody, an antibody fragment optimized for use as an imaging agent. We compare A11 minibody immunoPET to 18F-Fluoride PET bone scans for detecting prostate cancer bone tumors and evaluate the ability of the A11 minibody to image tumor response to androgen deprivation. Osteoblastic, PSCA expressing, LAPC-9 intratibial xenografts were imaged with serial 124I-anti-PSCA A11more » minibody immunoPET and 18F-Fluoride bone scans. Mice bearing LAPC-9 subcutaneous xenografts were treated with either vehicle or MDV-3100 and imaged with A11 minibody immunoPET/CT scans pre- and post-treatment. Ex vivo flow cytometry measured the change in PSCA expression in response to androgen deprivation. A11 minibody demonstrated improved sensitivity and specificity over 18F-Fluoride bone scans for detecting LAPC-9 intratibial xenografts at all time points. Finally, LAPC-9 subcutaneous xenografts showed downregulation of PSCA when treated with MDV-3100 which A11 minibody immunoPET was able to detect in vivo.« less

Radioligand therapy of metastatic castration-resistant prostate cancer: current approaches.

PubMed

Awang, Zool Hilmi; Essler, Markus; Ahmadzadehfar, Hojjat

2018-05-23

Prostate Cancer is the forth most common type of cancer. Prostate-specific membrane antigen (PSMA) is anchored in the cell membrane of prostate epithelial cells. PSMA is highly expressed on prostate epithelial cells and strongly up-regulated in prostate cancer. Therefore it is an appropriate target for diagnostic and therapy of prostate cancer and its metastases. This article discusses several articles on radionuclide treatments in prostate cancer and the results on PSMA therapy with either beta or alpha emitters as a salvage therapy.

Elevated phospholipase D activity in androgen-insensitive prostate cancer cells promotes both survival and metastatic phenotypes.

PubMed

Utter, Matthew; Chakraborty, Sohag; Goren, Limor; Feuser, Lucas; Zhu, Yuan-Shan; Foster, David A

2018-06-01

Prostate cells are hormonally driven to grow and divide. Typical treatments for prostate cancer involve blocking activation of the androgen receptor by androgens. Androgen deprivation therapy can lead to the selection of cancer cells that grow and divide independently of androgen receptor activation. Prostate cancer cells that are insensitive to androgens commonly display metastatic phenotypes and reduced long-term survival of patients. In this study we provide evidence that androgen-insensitive prostate cancer cells have elevated PLD activity relative to the androgen-sensitive prostate cancer cells. PLD activity has been linked with promoting survival in many human cancer cell lines; and consistent with the previous studies, suppression of PLD activity in the prostate cancer cells resulted in apoptotic cell death. Of significance, suppressing the elevated PLD activity in androgen resistant prostate cancer lines also blocked the ability of these cells to migrate and invade Matrigel™. Since survival signals are generally an early event in tumorigenesis, the apparent coupling of survival and metastatic phenotypes implies that metastasis is an earlier event in malignant prostate cancer than generally thought. This finding has implications for screening strategies designed to identify prostate cancers before dissemination. Copyright © 2018 Elsevier B.V. All rights reserved.

Genome-wide Search of Oncogenic Pathways Cooperating with ETS Fusions in Prostate Cancer

DTIC Science & Technology

2013-07-01

luminal cells cannot engraft well in this assay), and although both luminal and basal cells could serve as cells of origin of prostate cancer, luminal ...was the need for them to differentiate into luminal cells first [27]. Thus, it appears that prostate luminal cells may serve as the major cellular...origin for prostate cancer. We therefore more favor a strategy to search for ETS-cooperating mutations in prostate luminal cells. Furthermore

Ghrelin O-acyltransferase (GOAT) is expressed in prostate cancer tissues and cell lines and expression is differentially regulated in vitro by ghrelin.

PubMed

Seim, Inge; Jeffery, Penny L; de Amorim, Laura; Walpole, Carina M; Fung, Jenny; Whiteside, Eliza J; Lourie, Rohan; Herington, Adrian C; Chopin, Lisa K

2013-07-23

Ghrelin is a 28 amino acid peptide hormone that is expressed in the stomach and a range of peripheral tissues, where it frequently acts as an autocrine/paracrine growth factor. Ghrelin is modified by a unique acylation required for it to activate its cognate receptor, the growth hormone secretagogue receptor (GHSR), which mediates many of the actions of ghrelin. Recently, the enzyme responsible for adding the fatty acid residue (octanoyl/acyl group) to the third amino acid of ghrelin, GOAT (ghrelin O-acyltransferase), was identified. We used cell culture, quantitative real-time reverse transcription (RT)-PCR and immunohistochemistry to demonstrate the expression of GOAT in prostate cancer cell lines and tissues from patients. Real-time RT-PCR was used to demonstrate the expression of prohormone convertase (PC)1/3, PC2 and furin in prostate cancer cell lines. Prostate-derived cell lines were treated with ghrelin and desacyl ghrelin and the effect on GOAT expression was measured using quantitative RT-PCR. We have demonstrated that GOAT mRNA and protein are expressed in the normal prostate and human prostate cancer tissue samples. The RWPE-1 and RWPE-2 normal prostate-derived cell lines and the LNCaP, DU145, and PC3 prostate cancer cell lines express GOAT and at least one other enzyme that is necessary to produce mature, acylated ghrelin from proghrelin (PC1/3, PC2 or furin). Finally, ghrelin, but not desacyl ghrelin (unacylated ghrelin), can directly regulate the expression of GOAT in the RWPE-1 normal prostate derived cell line and the PC3 prostate cancer cell line. Ghrelin treatment (100nM) for 6 hours significantly decreased GOAT mRNA expression two-fold (P < 0.05) in the PC3 prostate cancer cell line, however, ghrelin did not regulate GOAT expression in the DU145 and LNCaP prostate cancer cell lines. This study demonstrates that GOAT is expressed in prostate cancer specimens and cell lines. Ghrelin regulates GOAT expression, however, this is likely to be cell-type specific. The expression of GOAT in prostate cancer supports the hypothesis that the ghrelin axis has autocrine/paracrine roles. We propose that the RWPE-1 prostate cell line and the PC3 prostate cancer cell line may be useful for investigating GOAT regulation and function.

The role of Cajal cells in chronic prostatitis.

PubMed

Haki Yuksel, Ozgur; Urkmez, Ahmet; Verit, Ayhan

2016-07-04

Types of prostatitis can be defined as groups of syndromes in adult men associated with infectious and noninfectious causes characterized frequently by lower abdominal and perineal signs and diverse clinical symptoms and complications. Etiopathogenesis of chronic prostatitis is not well defined. Moreover, its treatment outcomes are not satisfactory. Presence of c-kit positive interstitial cells in human prostate is already known. It has been demonstrated that these cells can be pacemaker cells which trigger spontaneous slow-wave electrical activity in the prostate and can be responsible for the transport of glandular secretion from acinar cells into major and minor prostatic ducts and finally into urethra. In the light of all these data, when presence of a possible inflammatory pathology is thought to involve prostate that secretes and has a reservoir which drains its secretion (for prostate, prostatic urethra), two points are worth mentioning. Impairment of secretion mechanism and collection of secretion within the organ with reflux of the microbial material from its reservoir back into prostate gland. Both of these potential conditions can be explained by ductal neuromuscular mechanism, which induces secretion. We think that in this neuromuscular mechanism interstitial Cajal cells have an important role in chronic prostatitis. Our hypothesis is that curability of prostatitis is correlated with the number of Cajal cells not subjected to apoptosis.

Inhibitory effect of Disulfiram/copper complex on non-small cell lung cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duan, Lincan; Shen, Hongmei; Zhao, Guangqiang

2014-04-18

Highlights: • Disulfiram and copper synergistically inhibit lung cancer cell proliferation. • Lung cancer cell colony formation ability is inhibited by Disulfiram/copper. • Disulfiram/copper increases the sensitivity of cisplatin to lung cancer cells. • Lung cancer stem cells are specifically targeted by Disulfiram/copper complex. - Abstract: Non-small cell lung cancer (NSCLC) is the most common cause of cancer-related death in both men and women worldwide. Recently, Disulfiram has been reported to be able to inhibit glioblastoma, prostate, or breast cancer cell proliferation. In this study, the synergistic effect of Disulfiram and copper on NSCLC cell growth was investigated. Inhibition ofmore » cancer cell proliferation was detected by 1-(4,5-Dimethylthiazol-2-yl)-3,5-diphenylformazan (MTT) assay and cell cycle analysis. Liquid colony formation and tumor spheroid formation assays were used to evaluate their effect on cancer cell clonogenicity. Real-time PCR was performed to test the mRNA level of cancer stem cell related genes. We found that Disulfiram or copper alone did not potently inhibit NSCLC cell proliferation in vitro. However, the presence of copper significantly enhanced inhibitory effect of Disulfiram on NSCLC cell growth, indicating a synergistic effect between Disulfiram and copper. Cell cycle analysis showed that Disulfiram/copper complex caused NSCLC cell cycle arrest in G2/M phase. Furthermore, Disulfiram/copper significantly increased the sensitivity of cisplatin in NSCLC cells tested by MTT assay. Liquid colony formation assay revealed that copper dramatically increased the inhibitory effect of Disulfiram on NSCLC cell colony forming ability. Disulfiram combined with copper significantly attenuated NSCLC cell spheroid formation and recuded the mRNA expression of lung cancer stem cell related genes. Our data suggest that Disulfiram/copper complex alone or combined with other chemotherapy is a potential therapeutic strategy for NSCLC patients.« less

Overexpression of LLT1 (OCIL, CLEC2D) on prostate cancer cells inhibits NK cell-mediated killing through LLT1-NKRP1A (CD161) interaction.

PubMed

Mathew, Stephen O; Chaudhary, Pankaj; Powers, Sheila B; Vishwanatha, Jamboor K; Mathew, Porunelloor A

2016-10-18

Prostate cancer is the most common type of cancer diagnosed and the second leading cause of cancer-related death in American men. Natural Killer (NK) cells are the first line of defense against cancer and infections. NK cell function is regulated by a delicate balance between signals received through activating and inhibitory receptors. Previously, we identified Lectin-like transcript-1 (LLT1/OCIL/CLEC2D) as a counter-receptor for the NK cell inhibitory receptor NKRP1A (CD161). Interaction of LLT1 expressed on target cells with NKRP1A inhibits NK cell activation. In this study, we have found that LLT1 was overexpressed on prostate cancer cell lines (DU145, LNCaP, 22Rv1 and PC3) and in primary prostate cancer tissues both at the mRNA and protein level. We further showed that LLT1 is retained intracellularly in normal prostate cells with minimal cell surface expression. Blocking LLT1 interaction with NKRP1A by anti-LLT1 mAb on prostate cancer cells increased the NK-mediated cytotoxicity of prostate cancer cells. The results indicate that prostate cancer cells may evade immune attack by NK cells by expressing LLT1 to inhibit NK cell-mediated cytolytic activity through LLT1-NKRP1A interaction. Blocking LLT1-NKRP1A interaction will make prostate cancer cells susceptible to killing by NK cells and therefore may be a new therapeutic option for treatment of prostate cancer.

Rare expression of high-molecular-weight cytokeratin in adenocarcinoma of the prostate gland: a study of 100 cases of metastatic and locally advanced prostate cancer.

PubMed

Yang, X J; Lecksell, K; Gaudin, P; Epstein, J I

1999-02-01

Immunohistochemistry with antibodies for high-molecular-weight cytokeratin labels basal cells and is used as an ancillary study in diagnosing prostate carcinoma, which reportedly lacks expression of high-molecular-weight cytokeratin. A recent report questioned the specificity of this marker, describing immunopositivity for high-molecular-weight cytokeratin in a small series of metastatic prostate cancer. We have also noted rare cases of prostate lesions on biopsy with typical histological features of adenocarcinoma showing immunopositivity for high-molecular-weight cytokeratin, either in tumor cells or in patchy cells with the morphology of basal cells. In some of these cases, it was difficult to distinguish cancer from out-pouching of high-grade prostatic intraepithelial neoplasia. To investigate whether prostate cancer cells express high-molecular-weight cytokeratin, we studied 100 cases of metastatic prostate carcinoma and 10 cases of prostate cancer invading the seminal vesicles from surgical specimens. Metastatic sites included regional lymph nodes (n = 67), bone (n = 19), and miscellaneous (n = 14). Cases with any positivity for high-molecular-weight cytokeratin antibody (34betaE12) were verified as being of prostatic origin with immunohistochemistry for prostate-specific antigen and prostate-specific acid phosphatase. Only four cases were detected positive for high-molecular-weight cytokeratin. In two cases (one metastasis, one seminal vesicle invasion) there was weakly diffuse positivity above background level. Two metastases in lymph nodes showed scattered strong staining of clusters of tumor cells, which represented <0.2% of tumor cells in the metastatic deposits. These positive cells did not have the morphology of basal cells. We conclude that prostate cancer, even high grade, only rarely expresses high-molecular-weight cytokeratin. This marker remains a very useful adjunct in the diagnosis of prostate cancer.

Bruton's tyrosine kinase is a potential therapeutic target in prostate cancer

PubMed Central

Kokabee, Leila; Wang, Xianhui; Sevinsky, Christopher J; Wang, Wei Lin Winnie; Cheu, Lindsay; Chittur, Sridar V; Karimipoor, Morteza; Tenniswood, Martin; Conklin, Douglas S

2015-01-01

Bruton's tyrosine kinase (BTK) is a non-receptor tyrosine kinase that has mainly been studied in haematopoietic cells. We have investigated whether BTK is a potential therapeutic target in prostate cancer. We find that BTK is expressed in prostate cells, with the alternate BTK-C isoform predominantly expressed in prostate cancer cells and tumors. This isoform is transcribed from an alternative promoter and results in a protein with an amino-terminal extension. Prostate cancer cell lines and prostate tumors express more BTK-C transcript than the malignant NAMALWA B-cell line or human lymphomas. BTK protein expression is also observed in tumor tissue from prostate cancer patients. Down regulation of this protein with RNAi or inhibition with BTK-specific inhibitors, Ibrutinib, AVL-292 or CGI-1746 decrease cell survival and induce apoptosis in prostate cancer cells. Microarray results show that inhibiting BTK under these conditions increases expression of apoptosis related genes, while overexpression of BTK-C is associated with elevated expression of genes with functions related to cell adhesion, cytoskeletal structure and the extracellular matrix. These results are consistent with studies that show that BTK signaling is important for adhesion and migration of B cells and suggest that BTK-C may confer similar properties to prostate cancer cells. Since BTK-C is a survival factor for these cells, it represents both a potential biomarker and novel therapeutic target for prostate cancer. PMID:26383180

Bruton's tyrosine kinase is a potential therapeutic target in prostate cancer.

PubMed

Kokabee, Leila; Wang, Xianhui; Sevinsky, Christopher J; Wang, Wei Lin Winnie; Cheu, Lindsay; Chittur, Sridar V; Karimipoor, Morteza; Tenniswood, Martin; Conklin, Douglas S

2015-01-01

Bruton's tyrosine kinase (BTK) is a non-receptor tyrosine kinase that has mainly been studied in haematopoietic cells. We have investigated whether BTK is a potential therapeutic target in prostate cancer. We find that BTK is expressed in prostate cells, with the alternate BTK-C isoform predominantly expressed in prostate cancer cells and tumors. This isoform is transcribed from an alternative promoter and results in a protein with an amino-terminal extension. Prostate cancer cell lines and prostate tumors express more BTK-C transcript than the malignant NAMALWA B-cell line or human lymphomas. BTK protein expression is also observed in tumor tissue from prostate cancer patients. Down regulation of this protein with RNAi or inhibition with BTK-specific inhibitors, Ibrutinib, AVL-292 or CGI-1746 decrease cell survival and induce apoptosis in prostate cancer cells. Microarray results show that inhibiting BTK under these conditions increases expression of apoptosis related genes, while overexpression of BTK-C is associated with elevated expression of genes with functions related to cell adhesion, cytoskeletal structure and the extracellular matrix. These results are consistent with studies that show that BTK signaling is important for adhesion and migration of B cells and suggest that BTK-C may confer similar properties to prostate cancer cells. Since BTK-C is a survival factor for these cells, it represents both a potential biomarker and novel therapeutic target for prostate cancer.

ERBB2 Increases Metastatic Potentials Specifically in Androgen-Insensitive Prostate Cancer Cells

PubMed Central

Tome-Garcia, Jessica; Li, Dan; Ghazaryan, Seda; Shu, Limin; Wu, Lizhao

2014-01-01

Despite all the blood-based biomarkers used to monitor prostate cancer patients, prostate cancer remains as the second common cause of cancer mortality in men in the United States. This is largely due to a lack of understanding of the molecular pathways that are responsible for the aggressive forms of prostate cancers, the castrate-resistant prostate cancer and the metastatic prostate cancer. Cell signaling pathways activated by the ERBB2 oncogene or the RAS oncogene are frequently found to be altered in metastatic prostate cancers. To evaluate and define the role of the ERBB2/RAS pathway in prostate cancer metastasis, we have evaluated the impact of ERBB2- or RAS-overexpression on the metastatic potentials for four prostate cancer cell lines derived from tumors with different androgen sensitivities. To do so, we transfected the human DU145, LnCaP, and PC3 prostate cancer cells and the murine Myc-CaP prostate cancer cells with the activated form of ERBB2 or H-RAS and assessed their metastatic potentials by three complementary assays, a wound healing assay, a transwell motility assay, and a transwell invasion assay. We showed that while overexpression of ERBB2 increased the metastatic potential of the androgen-insensitive prostate cancer cells (i.e. PC3 and DU145), it did not affect metastatic potentials of the androgen-sensitive prostate cancer cells (i.e. LnCaP and Myc-CaP). In contrast, overexpression of H-RAS only increased the cell motility of Myc-CaP cells, which overexpress the human c-MYC oncogene. Our data suggest that ERBB2 collaborates with androgen signaling to promote prostate cancer metastasis, and that although RAS is one of the critical downstream effectors of ERBB2, it does not phenocopy ERBB2 for its impact on the metastatic potentials of prostate cancer cell lines. PMID:24937171

Expression and Function of the Progesterone Receptor in Human Prostate Stroma Provide Novel Insights to Cell Proliferation Control

PubMed Central

Yu, Yue; Liu, Liangliang; Xie, Ning; Xue, Hui; Fazli, Ladan; Buttyan, Ralph; Wang, Yuzhuo; Gleave, Martin

2013-01-01

Context: Like other tissues, the prostate is an admixture of many different cell types that can be segregated into components of the epithelium or stroma. Reciprocal interactions between these 2 types of cells are critical for maintaining prostate homeostasis, whereas aberrant stromal cell proliferation can disrupt this balance and result in diseases such as benign prostatic hyperplasia. Although the androgen and estrogen receptors are relatively well studied for their functions in controlling stromal cell proliferation and differentiation, the role of the progesterone receptor (PR) remains unclear. Objective: The aim of the study was to investigate the expression and function of the PR in the prostate. Design and Setting: Human prostate biopsies, renal capsule xenografts, and prostate stromal cells were used. Immunohistochemistry, Western blotting, real-time quantitative PCR, cell proliferation, flow cytometry, and gene microarray analyses were performed. Results: Two PR isoforms, PRA and PRB, are expressed in prostate stromal fibroblasts and smooth muscle cells, but not in epithelial cells. Both PR isoforms suppress prostate stromal cell proliferation through inhibition of the expression of cyclinA, cyclinB, and cdc25c, thus delaying cell cycling through S and M phases. Gene microarray analyses further demonstrated that PRA and PRB regulated different transcriptomes. However, one of the major gene groups commonly regulated by both PR isoforms was the one associated with regulation of cell proliferation. Conclusion: PR plays an inhibitory role in prostate stromal cell proliferation. PMID:23666965

TLR7 expression is decreased during tumour progression in transgenic adenocarcinoma of mouse prostate mice and its activation inhibits growth of prostate cancer cells.

PubMed

Han, Ju-Hee; Park, Shin-Young; Kim, Jin-Bum; Cho, Sung-Dae; Kim, Bumseok; Kim, Bo-Yeon; Kang, Min-Jung; Kim, Dong-Jae; Park, Jae-Hak; Park, Jong-Hwan

2013-10-01

Although various Toll-like receptors (TLRs) have been associated with immune response and tumorigenesis in the prostate cells, little is known about the role of TLR7. Accordingly, we examined the expression of TLR7 during tumour progression of TRMAP (transgenic mouse model for prostate cancer) mice and its role on cell growth. Toll-like receptor7 expression was examined by RT-polymerase chain reaction (PCR), Western blot, and immunohistochemistry. Cell growth was examined by MTT assay. Colony formation was investigated by crystal violet staining. Strong expression of TLR7 was detected in the normal prostate epithelia of Wild-type (WT) mice, but not in TLR7-deficient mice. In contrast, TLR7 expression was weak in transgenic adenocarcinoma of mouse prostate (TRAMP)-C2 cells, as compared with murine bone marrow-derived macrophages (BMDMs). Moreover, TLR7 mRNA was markedly expressed in RWPE-1 cells (non-cancerous prostate epithelial cells), but not in PC3 and DU145 (prostate cancer cells). Immunohistochemically, TLR7 expression gradually decreased in TRAMP mice depending on the pathologic grade of the prostate cells. TLR7 agonists increased both the gene and protein expression of TLR7 and promoted production of proinflammatory cytokines/chemokines and IFN-β gene expression in prostate cancer cell lines. Moreover, loxoribine inhibited the growth and colony formation of TRAMP-C2 cells dependent of TLR7. These findings suggest that TLR7 may participate in tumour suppression in the prostate cells. © 2013 John Wiley & Sons Ltd.

Immortalization of human prostate epithelial cells by HPV 16 E6/E7 open reading frames.

PubMed

Choo, C K; Ling, M T; Chan, K W; Tsao, S W; Zheng, Z; Zhang, D; Chan, L C; Wong, Y C

1999-08-01

The exact pathogenesis for prostate cancer is not known. Progress made in prostate cancer research has been slow, largely due to the lack of suitable in vitro models. Here, we report our work on the immortalization of a human prostate epithelial cell line and show that it can be used as a model to study prostate tumorigenesis. Replication-defective retrovirus harboring the human papillomavirus (HPV) type 16 E6 and E7 open reading frames was used to infect primary human prostate epithelial cells. Polymerase chain reaction, followed by Southern hybridization for the HPV 16 E6/E7, Western blot for prostatic acid phosphatase, telomeric repeat amplification protocol assay for telomerase activity, two-dimensional gels for cytokeratins, and cytogenetic analysis were undertaken to characterized the infected cells. The retrovirus-infected cell line, HPr-1, continued to grow in culture for more than 80 successive passages. Normal primary cells failed to proliferate after passage 6. HPr-1 cells bore close resemblance to normal primary prostate epithelial cells, both morphologically and biochemically. However, they possessed telomerase activity and proliferated indefinitely. Cytogenetic analysis of HPr-1 cells revealed a human male karyotype with clonal abnormalities and the appearance of multiple double minutes. The HPr-1 cells expressed prostatic acid phosphatase and cytokeratins K8 and K18, proving that they were prostate epithelial cells. They were benign in nude mice tumor formation and soft agar colony formation assay. The HPr-1 cell line is an in vitro representation of early prostate neoplastic progression. Copyright 1999 Wiley-Liss, Inc.

Study of NGEP expression in androgen sensitive prostate cancer cells: A potential target for immunotherapy

PubMed Central

Mohsenzadegan, Monireh; Tajik, Nader; Madjd, Zahra; Shekarabi, Mehdi; Farajollahi, Mohammad M

2015-01-01

Background: Prostate cancer is one of the leading causes of cancer deaths among men. New gene expressed in prostate (NGEP), is a prostate-specific gene expressed only in normal prostate and prostate cancer tissue. Because of its selective expression in prostate cancer cell surface, NGEP is a potential immunotherapeutic target. To target the NGEP in prostate cancer, it is essential to investigate its expression in prostate cancer cells. Methods: In the present study, we investigated NGEP expression in LNCaP and DU145 cells by real time and RT-PCR, flow cytometric and immunocytochemical analyses. Results: Real time and RT-PCR analyses of NGEP expression showed that NGEP was expressed in the LNCaP cells but not in DU145 cells. The detection of NGEP protein by flow cytometric and immunocytochemistry analyses indicated that NGEP protein was weakly expressed only in LNCaP cell membrane. Conclusion: Our results demonstrate that LNCaP cell line is more suitable than DU145 for NGEP expression studies; however, its low-level expression is a limiting issue. NGEP expression may be increased by androgen supplementation of LNCaP cell culture medium. PMID:26000254

SMAD signaling and redox imbalance cooperate to induce prostate cancer cell dormancy.

PubMed

Bui, Anh Thu; Laurent, Fanny; Havard, Maryline; Dautry, François; Tchénio, Thierry

2015-01-01

Metastasis involves the dissemination of single or small clumps of cancer cells through blood or lymphatic vessels and their extravasation into distant organs. Despite the strong regulation of metastases development by a cell dormancy phenomenon, the dormant state of cancer cells remains poorly characterized due to the difficulty of in vivo studies. We have recently shown in vitro that clonogenicity of prostate cancer cells is regulated by a dormancy phenomenon that is strongly induced when cells are cultured both at low cell density and in a slightly hypertonic medium. Here, we characterized by RT-qPCR a genetic expression signature of this dormant state which combines the presence of both stemness and differentiation markers. We showed that both TFGβ/BMP signaling and redox imbalance are required for the full induction of this dormancy signature and cell quiescence. Moreover, reconstruction experiments showed that TFGβ/BMP signaling and redox imbalance are sufficient to generate a pattern of genetic expression displaying all characteristic features of the dormancy signature. Finally, we observed that low cell density was sufficient to activate TGFβ/BMP signaling and to generate a slight redox imbalance thus priming cells for dormancy that can be attained with a co-stimulus like hypertonicity, most likely through an increased redox imbalance. The identification of a dual regulation of dormancy provides a framework for the interpretation of previous reports showing a restricted ability of BMP signaling to regulate cancer cell dormancy in vivo and draws attention on the role of oxidative stress in the metastatic process.

Cell-autonomous intracellular androgen receptor signaling drives the growth of human prostate cancer initiating cells.

PubMed

Vander Griend, Donald J; D'Antonio, Jason; Gurel, Bora; Antony, Lizamma; Demarzo, Angelo M; Isaacs, John T

2010-01-01

The lethality of prostate cancer is due to the continuous growth of cancer initiating cells (CICs) which are often stimulated by androgen receptor (AR) signaling. However, the underlying molecular mechanism(s) for such AR-mediated growth stimulation are not fully understood. Such mechanisms may involve cancer cell-dependent induction of tumor stromal cells to produce paracrine growth factors or could involve cancer cell autonomous autocrine and/or intracellular AR signaling pathways. We utilized clinical samples, animal models and a series of AR-positive human prostate cancer cell lines to evaluate AR-mediated growth stimulation of prostate CICs. The present studies document that stromal AR expression is not required for prostate cancer growth, since tumor stroma surrounding AR-positive human prostate cancer metastases (N = 127) are characteristically AR-negative. This lack of a requirement for AR expression in tumor stromal cells is also documented by the fact that human AR-positive prostate cancer cells grow equally well when xenografted in wild-type versus AR-null nude mice. AR-dependent growth stimulation was documented to involve secretion, extracellular binding, and signaling by autocrine growth factors. Orthotopic xenograft animal studies documented that the cellautonomous autocrine growth factors which stimulate prostate CIC growth are not the andromedins secreted by normal prostate stromal cells. Such cell autonomous and extracellular autocrine signaling is necessary but not sufficient for the optimal growth of prostate CICs based upon the response to anti-androgen plus/or minus preconditioned media. AR-induced growth stimulation of human prostate CICs requires AR-dependent intracellular pathways. The identification of such AR-dependent intracellular pathways offers new leads for the development of effective therapies for prostate cancer. (c) 2009 Wiley-Liss, Inc.

Overexpression of HepaCAM inhibits cell viability and motility through suppressing nucleus translocation of androgen receptor and ERK signaling in prostate cancer.

PubMed

Song, Xuedong; Wang, Yin; Du, Hongfei; Fan, Yanru; Yang, Xue; Wang, Xiaorong; Wu, Xiaohou; Luo, Chunli

2014-07-01

HepaCAM is suppressed in a variety of human cancers, and involved in cell adhesion, growth, migration, invasion, and survival. However, the expression and function of HepaCAM in prostate cancer are still unknown. HepaCAM expression has been detected by RT-PCR, Western blotting and immunohistochemistry staining in prostate cell lines RWPE-1, LNCap, DU145, PC3, and in 75 human prostate tissue specimens, respectively. Meanwhile, the cell proliferation ability was detected by WST-8 assay. The role of HepaCAM in prostate cancer cell migration and invasion was examined by wound healing and transwell assay. And flow cytometry was used to observe the apoptosis of prostate cancer cells. Then we detected changes of Androgen Receptor translocation and ERK signaling using immunofluorescence staining and western blot after overexpression of HepaCAM. The HepaCAM expression was significantly down-regulated in prostate cancer tissues and undetected in prostate cancer cells. However, the low HepaCAM expression was not statistically associated with clinicopathological characteristics of prostate cancer. Overexpression of HepaCAM in prostate cancer cells decreased the cell proliferation, migration and invasion, and induced the cell apoptosis. Meanwhile, HepaCAM prevented the androgen receptor translocation from the cytoplasm to the nucleus and down-regulated the MAPK/ERK signaling. Our results suggested that HepaCAM acted as a tumor suppressor in prostate cancer. HepaCAM inhibited cell viability and motility which might be through suppressing the nuclear translocation of Androgen Receptor and down-regulating the ERK signaling. Therefore, it was indicated that HepaCAM may be a potential therapeutic target for prostate cancer. © 2014 Wiley Periodicals, Inc.

Proliferation of Prostate Stromal Cell Induced by Benign Prostatic Hyperplasia Epithelial Cell Stimulated With Trichomonas vaginalis via Crosstalk With Mast Cell.

PubMed

Kim, Jung-Hyun; Kim, Sang-Su; Han, Ik-Hwan; Sim, Seobo; Ahn, Myoung-Hee; Ryu, Jae-Sook

2016-11-01

Chronic inflammation has a role in the pathogenesis of benign prostatic hyperplasia (BPH) and prostate cancer. Mast cells have been detected in chronic inflammatory infiltrate of the prostate, and it is possible that the interaction between prostate epithelial cells and Trichomonas vaginalis influences the activity of mast cells in the prostate stroma. Activated mast cells might influence the biological functions of nearby tissues and cells. In this study, we investigated whether mast cells reacted with the culture supernatant of BPH epithelial cells infected with T. vaginalis may induce the proliferation of prostate stromal cells. To measure the proliferation of prostate stromal cells in response to chronic inflammation caused by the infection of BPH-1 cells with T. vaginalis, the CCK-8 assay and wound healing assay were used. ELISAs, quantitative real-time PCR, western blotting and immunofluorescence were used to measure the production and expression of inflammatory cytokine and cytokine receptor. BPH-1 cells incubated with live trichomonads produced increased levels of CCL2, IL-1β, IL-6, and CXCL8, and induced the migration of mast cells and monocytes. When the culture supernatant of BPH-1 cells stimulated with trichomonads (TCM) was added to mast cells, they became activated, as confirmed by release of β-hexosaminidase and CXCL8. Prostate stromal cells incubated with the culture supernatant of mast cells activated with TCM (M-TCM) proliferated and expressed increased levels of CXCL8, CCL2, and the cytokine receptors CXCR1 and CCR2. Blocking the chemokine receptors reduced the proliferation of stromal cells and also decreased the production of CXCL8 and CCL2. Moreover, the expression of FGF2, cyclin D1, and Bcl-2 was increased in the proliferated stromal cells stimulated with M-TCM. Additionally, the M-TCM-treated stromal cells were more invasive than control cells. The inflammatory mediators released by BPH epithelial cells in response to infection by trichomonads induce the migration and activation of mast cells. The activated mast cells induce the proliferation of prostate stromal cells via CXCL8-CXCR1 and CCL2-CCR2 signaling. Our results therefore show that the inflammatory response by BPH epithelial cells stimulated with T. vaginalis induce the proliferation of prostate stromal cells via crosstalk with mast cells. Prostate 76:1431-1444, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

sEphB4-HSA Before Surgery in Treating Patients With Bladder Cancer, Prostate Cancer, or Kidney Cancer

ClinicalTrials.gov

2018-06-08

Infiltrating Bladder Urothelial Carcinoma; Recurrent Bladder Carcinoma; Stage I Prostate Cancer; Stage I Renal Cell Cancer; Stage II Bladder Urothelial Carcinoma; Stage II Renal Cell Cancer; Stage IIA Prostate Cancer; Stage IIB Prostate Cancer; Stage III Prostate Cancer; Stage III Renal Cell Cancer

Estrogen and estrogen receptor alpha promotes malignancy and osteoblastic tumorigenesis in prostate cancer.

PubMed

Mishra, Sweta; Tai, Qin; Gu, Xiang; Schmitz, James; Poullard, Ashley; Fajardo, Roberto J; Mahalingam, Devalingam; Chen, Xiaodong; Zhu, Xueqiong; Sun, Lu-Zhe

2015-12-29

The role of estrogen signaling in regulating prostate tumorigenesis is relatively underexplored. Although, an increasing body of evidence has linked estrogen receptor beta (ERß) to prostate cancer, the function of estrogen receptor alpha (ERα) in prostate cancer is not very well studied. We have discovered a novel role of ERα in the pathogenesis of prostate tumors. Here, we show that prostate cancer cells express ERα and estrogen induces oncogenic properties in prostate cancer cells through ERα. Importantly, ERα knockdown in the human prostate cancer PacMetUT1 cells as well as pharmacological inhibition of ERα with ICI 182,780 inhibited osteoblastic lesion formation and lung metastasis in vivo. Co-culture of pre-osteoblasts with cancer cells showed a significant induction of osteogenic markers in the pre-osteoblasts, which was attenuated by knockdown of ERα in cancer cells suggesting that estrogen/ERα signaling promotes crosstalk between cancer and osteoblastic progenitors to stimulate osteoblastic tumorigenesis. These results suggest that ERα expression in prostate cancer cells is essential for osteoblastic lesion formation and lung metastasis. Thus, inhibition of ERα signaling in prostate cancer cells may be a novel therapeutic strategy to inhibit the osteoblastic lesion development as well as lung metastasis in patients with advanced prostate cancer.

Regulation of androgen receptor transactivity and mTOR-S6 kinase pathway by Rheb in prostate cancer cell proliferation.

PubMed

Kobayashi, Takashi; Shimizu, Yosuke; Terada, Naoki; Yamasaki, Toshinari; Nakamura, Eijiro; Toda, Yoshinobu; Nishiyama, Hiroyuki; Kamoto, Toshiyuki; Ogawa, Osamu; Inoue, Takahiro

2010-06-01

Ras homolog-enriched in brain (Rheb), a small GTP-binding protein, is associated with prostate carcinogenesis through activating mammalian target of rapamycin (mTOR) signaling pathway. This study aimed to elucidate whether Rheb promotes proliferation of prostate cancer cells and can act as a potent therapeutic target in prostate cancer. Prostate cancer cell lines and human prostatic tissues were examined for the expression of Rheb. The effects of forced expression or knockdown of Rheb on cell proliferation were also examined. Semi-quantitative and quantitative RT-PCR were performed to evaluate mRNA expression. Western blotting was used to examine protein expression. Cell count and WST-1 assay were used to measure cell proliferation. Fluorescence-activated cell sorting was used to assess the cell cycle. Rheb mRNA and protein expression was higher in more aggressive, androgen-independent prostate cancer cell lines PC3, DU145, and C4-2, compared with the less aggressive LNCaP. Rheb expression was higher in cancer tissues than in benign prostatic epithelia. Forced expression of Rheb in LNCaP cells accelerated proliferation without enhancing androgen receptor transactivity. Attenuation of Rheb expression or treatment with the mTOR inhibitor rapamycin decreased proliferation of PC3 and DU145 cells, with a decrease in the activated form of p70S6 kinase, one of the main targets of mTOR. Rheb potentiates proliferation of prostate cancer cells and inhibition of Rheb or mTOR can lead to suppressed proliferation of aggressive prostate cancer cell lines in vitro. Rheb and the mTOR pathway are therefore probable targets for suppressing prostate cancer.

Inhibition of microRNA-500 has anti-cancer effect through its conditional downstream target of TFPI in human prostate cancer.

PubMed

Cai, Bing; Chen, Wei; Pan, Yue; Chen, Hongde; Zhang, Yirong; Weng, Zhiliang; Li, Yeping

2017-07-01

We investigated the prognostic potential and regulatory mechanism of microRNA-500 (miR-500), and human gene of tissue factor pathway inhibitor (TFPI) in prostate cancer. MiR-500 expression was assessed by qRT-PCR in prostate cancer cell lines and primary tumors. Cancer patients' clinicopathological factors and overall survival were analyzed according to endogenous miR-500 level. MiR-500 was downregulated in DU145 and VCaP cells. Its effect on prostate cancer proliferation, invasion in vitro, and tumorigenicity in vivo, were probed. Possible downstream target of miR-500, TFPI was assessed by luciferase assay and qRT-PCR in prostate cancer cells. In miR-500-downregulated DU145 and VCaP cells, TFPI was silenced to see whether it was directly involved in the regulation of miR-500 in prostate cancer. TFPI alone was either upregulated or downregulated in DU145 and VCaP cells. Their effect on prostate cancer development was further evaluated. MiR-500 is upregulated in both prostate cancer cells and primary tumors. In prostate cancer patients, high miR-500 expression is associated with poor prognosis and overall survival. In DU145 and VCaP cells, miR-500 downregulation inhibited cancer proliferation, invasion in vitro, and explant growth in vivo. TFPI was verified to be associated with miR-500 in prostate cancer. Downregulation of TFPI reversed anti-cancer effects of miR-500 downregulation in prostate cancer cells. However, neither TFPI upregulation nor downregulation alone had any functional impact on prostate cancer development. MiR-500 may be a potential biomarker and molecular target in prostate cancer. TFPI may conditionally regulate prostate cancer in miR-500-downregualted prostate cancer cells. © 2017 Wiley Periodicals, Inc.

A subset of high Gleason grade prostate carcinomas contain a large burden of prostate cancer syndecan-1 positive stromal cells.

PubMed

Sharpe, Benjamin; Alghezi, Dhafer A; Cattermole, Claire; Beresford, Mark; Bowen, Rebecca; Mitchard, John; Chalmers, Andrew D

2017-05-01

There is a pressing need to identify prognostic and predictive biomarkers for prostate cancer to aid treatment decisions in both early and advanced disease settings. Syndecan-1, a heparan sulfate proteoglycan, has been previously identified as a potential prognostic biomarker by multiple studies at the tissue and serum level. However, other studies have questioned its utility. Anti-Syndecan-1 immunohistochemistry was carried out on 157 prostate tissue samples (including cancerous, adjacent normal tissue, and non-diseased prostate) from three independent cohorts of patients. A population of Syndecan-1 positive stromal cells was identified and the number and morphological parameters of these cells quantified. The identity of the Syndecan-1-positive stromal cells was assessed by multiplex immunofluorescence using a range of common cell lineage markers. Finally, the burden of Syndecan-1 positive stromal cells was tested for association with clinical parameters. We identified a previously unreported cell type which is marked by Syndecan-1 expression and is found in the stroma of prostate tumors and adjacent normal tissue but not in non-diseased prostate. We call these cells Prostate Cancer Syndecan-1 Positive (PCSP) cells. Immunofluorescence analysis revealed that the PCSP cell population did not co-stain with markers of common prostate epithelial, stromal, or immune cell populations. However, morphological analysis revealed that PCSP cells are often elongated and displayed prominent lamellipodia, suggesting they are an unidentified migratory cell population. Analysis of clinical parameters showed that PCSP cells were found with a frequency of 20-35% of all tumors evaluated, but were not present in non-diseased normal tissue. Interestingly, a subset of primary Gleason 5 prostate tumors had a high burden of PCSP cells. The current study identifies PCSP cells as a novel, potentially migratory cell type, which is marked by Syndecan-1 expression and is found in the stroma of prostate carcinomas, adjacent normal tissue, but not in non-diseased prostate. A subset of poor prognosis high Gleason grade 5 tumors had a particularly high PCSP cell burden, suggesting an association between this unidentified cell type and tumor aggressiveness. © 2017 Wiley Periodicals, Inc.

Mitochondrial β-Carotene 9',10' Oxygenase Modulates Prostate Cancer Growth via NF-κB Inhibition: A Lycopene-Independent Function.

PubMed

Gong, Xiaoming; Marisiddaiah, Raju; Zaripheh, Susan; Wiener, Doris; Rubin, Lewis P

2016-10-01

Despite numerous inquiries into protective roles of lycopene in prostate cancer prevention or therapy, little is known about mechanisms by which lycopene or its metabolites inhibit prostate cancer. The enzyme β-carotene 9',10'-oxygenase (BCO2), which catalyzes asymmetric cleavage of several carotenoids, is the principal regulator of lycopene metabolism, but the range of BCO2 biological functions is incompletely understood. This study investigated expression and functional roles of BCO2 in human prostate cancer. Expression of the bco2 gene is dramatically decreased in prostate cancer tissue and in a range of prostate cancer cell lines as compared with nonneoplastic prostate tissue and normal prostatic epithelial cells, respectively. Inhibition of DNA methyltransferase activity restored bco2 expression in prostate cancer cell lines tested. Treatment with lycopene or its metabolite, apo-10-lycopenal, also increased bco2 expression and reduced cell proliferation in androgen-sensitive cell lines, but lycopene neither altered bco2 expression nor cell growth in androgen-resistant cells. Notably, restoring bco2 expression in prostate cancer cells inhibited cell proliferation and colony formation, irrespective of lycopene exposure. Exogenous expression of either wild-type BCO2 or a mutant (enzymatically inactive) BCO2 in prostate cancer cells reduced NF-κB activity and decreased NF-κB nuclear translocation and DNA binding. Together, these results indicate epigenetic loss of BCO2 expression is associated with prostate cancer progression. Moreover, these findings describe previously unanticipated functions of BCO2 that are independent of its enzymatic role in lycopene metabolism. This study identifies BCO2 as a tumor suppressor in prostate cancer. BCO2-mediated inhibition of NF-κB signaling implies BCO2 status is important in prostate cancer progression. Mol Cancer Res; 14(10); 966-75. ©2016 AACR. ©2016 American Association for Cancer Research.

Ghrelin O-acyltransferase (GOAT) is expressed in prostate cancer tissues and cell lines and expression is differentially regulated in vitro by ghrelin

PubMed Central

2013-01-01

Background Ghrelin is a 28 amino acid peptide hormone that is expressed in the stomach and a range of peripheral tissues, where it frequently acts as an autocrine/paracrine growth factor. Ghrelin is modified by a unique acylation required for it to activate its cognate receptor, the growth hormone secretagogue receptor (GHSR), which mediates many of the actions of ghrelin. Recently, the enzyme responsible for adding the fatty acid residue (octanoyl/acyl group) to the third amino acid of ghrelin, GOAT (ghrelin O-acyltransferase), was identified. Methods We used cell culture, quantitative real-time reverse transcription (RT)-PCR and immunohistochemistry to demonstrate the expression of GOAT in prostate cancer cell lines and tissues from patients. Real-time RT-PCR was used to demonstrate the expression of prohormone convertase (PC)1/3, PC2 and furin in prostate cancer cell lines. Prostate-derived cell lines were treated with ghrelin and desacyl ghrelin and the effect on GOAT expression was measured using quantitative RT-PCR. Results We have demonstrated that GOAT mRNA and protein are expressed in the normal prostate and human prostate cancer tissue samples. The RWPE-1 and RWPE-2 normal prostate-derived cell lines and the LNCaP, DU145, and PC3 prostate cancer cell lines express GOAT and at least one other enzyme that is necessary to produce mature, acylated ghrelin from proghrelin (PC1/3, PC2 or furin). Finally, ghrelin, but not desacyl ghrelin (unacylated ghrelin), can directly regulate the expression of GOAT in the RWPE-1 normal prostate derived cell line and the PC3 prostate cancer cell line. Ghrelin treatment (100nM) for 6 hours significantly decreased GOAT mRNA expression two-fold (P < 0.05) in the PC3 prostate cancer cell line, however, ghrelin did not regulate GOAT expression in the DU145 and LNCaP prostate cancer cell lines. Conclusions This study demonstrates that GOAT is expressed in prostate cancer specimens and cell lines. Ghrelin regulates GOAT expression, however, this is likely to be cell-type specific. The expression of GOAT in prostate cancer supports the hypothesis that the ghrelin axis has autocrine/paracrine roles. We propose that the RWPE-1 prostate cell line and the PC3 prostate cancer cell line may be useful for investigating GOAT regulation and function. PMID:23879975

Tumor-associated myeloid cells promote tumorigenesis of non-tumorigenic human and murine prostatic epithelial cell lines.

PubMed

Sass, Stephanie N; Ramsey, Kimberley D; Egan, Shawn M; Wang, Jianmin; Cortes Gomez, Eduardo; Gollnick, Sandra O

2018-06-01

The etiology of prostate cancer is poorly understood, but it is a multi-step process that has been linked to environmental factors that induce inflammation within the gland. Glands of prostate cancer patients frequently contain multiple zones of disease at various stages of progression. The factors that drive disease progression from an indolent benign stage to aggressive disease are not well-defined. Prostate inflammation and carcinoma are associated with high levels of myeloid cell infiltration; these cells are linked to disease progression in other cancers, but their role in prostate cancer is unclear. To determine whether myeloid cells contribute to prostate cancer progression, the ability of prostate tumor-associated CD11b + cells (TAMC) to drive prostate epithelial cell tumorigenesis was tested. Co-culture of CD11b + TAMC with non-tumorigenic genetically primed prostate epithelial cells resulted in stable transformation and induction of tumorigenesis. RNA sequencing identified the IL-1α pathway as a potential molecular mechanism responsible for tumor promotion by TAMC. Inhibition of IL-1α delayed growth of TAMC-induced tumors. Further analysis showed that IL-1α inhibition led to decreased angiogenesis within tumors, suggesting that IL-1α promotes prostate tumor progression, potentially through augmentation of angiogenesis.

MLF1 interacting protein: a potential gene therapy target for human prostate cancer?

PubMed

Zhang, Lei; Ji, Guoqing; Shao, Yuzhang; Qiao, Shaoyi; Jing, Yuming; Qin, Rongliang; Sun, Huiming; Shao, Chen

2015-02-01

Here, we investigated the role of one gene that has been previously associated with human prostate carcinoma cells-myelodysplasia/myeloid leukemia factor 1 interacting protein (MLF1IP)-in order to better ascertain its role in human prostate carcinogenesis. The prostate cancer cell line PC-3 was lentivirally transfected to silence endogenous MLF1IP gene expression, which was confirmed by real-time quantitative PCR (RT-qPCR). Cellomics ArrayScan VTI imaging and MTT assays were conducted to assess cell proliferation. Cell cycle phase arrest and apoptosis were assayed by flow cytometry. Colony formation was assessed by fluorescence microscopy. MLF1IP gene expression was also analyzed by RT-qPCR in sixteen prostate cancer tissue samples and six healthy control prostate tissue samples from human patients. Cell proliferation was significantly inhibited in MLF1IP-silenced cells relative to control cells. G1 phase, S and G2/M phase cell counts were not significantly changed in MLF1IP-silenced cells relative to control cells. Apoptosis was significantly increased in MLF1IP-silenced cells, while MLF1IP-silenced cells displayed a significantly reduced number of cell colonies, compared to control cells. The 16 human prostate cancer tissue samples revealed no clear upregulation or downregulation in MLF1IP gene expression. MLF1IP significantly promotes prostate cancer cell proliferation and colony formation and significantly inhibits apoptosis without affecting cell cycle phase arrest. Further study is required to conclusively determine whether MLF1IP is upregulated in human prostate cancer tumors and to determine the precise cellular mechanism(s) for MLF1IP in prostate carcinogenesis.

O-Glycosylation-mediated signaling circuit drives metastatic castration-resistant prostate cancer.

PubMed

Tzeng, Sheue-Fen; Tsai, Chin-Hsien; Chao, Tai-Kuang; Chou, Yu-Ching; Yang, Yu-Chih; Tsai, Mong-Hsun; Cha, Tai-Lung; Hsiao, Pei-Wen

2018-06-15

Disseminated castration-resistant prostate cancer (CRPC) is a common disease in men that is characterized by limited survival and resistance to androgen-deprivation therapy. The increase in human epidermal growth factor receptor 2 (HER2) signaling contributes to androgen receptor activity in a subset of patients with CRPC; however, enigmatically, HER2-targeted therapies have demonstrated a lack of efficacy in patients with CRPC. Aberrant glycosylation is a hallmark of cancer and involves key processes that support cancer progression. Using transcriptomic analysis of prostate cancer data sets, histopathologic examination of clinical specimens, and in vivo experiments of xenograft models, we reveal in this study a coordinated increase in glycan-binding protein, galectin-4, specific glycosyltransferases of core 1 synthase, glycoprotein- N-acetylgalactosamine 3-β-galactosyltransferase 1 (C1GALT1) and ST3 beta-galactoside α-2,3-sialyltransferase 1 (ST3GAL1), and resulting mucin-type O-glycans during the progression of CRPC. Furthermore, galectin-4 engaged with C1GALT1-dependent O-glycans to promote castration resistance and metastasis by activating receptor tyrosine kinase signaling and cancer cell stemness properties mediated by SRY-box 9 (SOX9). This galectin-glycan interaction up-regulated the MYC-dependent expression of C1GALT1 and ST3GAL1, which altered cellular mucin-type O-glycosylation to allow for galectin-4 binding. In clinical prostate cancer, high-level expression of C1GALT1 and galectin-4 together predict poor overall survival compared with low-level expression of C1GALT1 and galectin-4. In summary, MYC regulates abnormal O-glycosylation, thus priming cells for binding to galectin-4 and downstream signaling, which promotes castration resistance and metastasis.-Tzeng, S.-F., Tsai, C.-H., Chao, T.-K., Chou, Y.-C., Yang, Y.-C., Tsai, M.-H., Cha, T.-L., Hsiao, P.-W. O-Glycosylation-mediated signaling circuit drives metastatic castration-resistant prostate cancer.

AZD1152-HQPA induces growth arrest and apoptosis in androgen-dependent prostate cancer cell line (LNCaP) via producing aneugenic micronuclei and polyploidy.

PubMed

Zekri, Ali; Ghaffari, Seyed H; Ghanizadeh-Vesali, Samad; Yaghmaie, Marjan; Salmaninejad, Arash; Alimoghaddam, Kamran; Modarressi, Mohammad H; Ghavamzadeh, Ardeshir

2015-02-01

Prostate cancer is the frequent non-cutaneous tumor with high mortality in men. Prostate tumors contain cells with different status of androgen receptor. Androgen receptor plays important roles in progression and treatment of prostate cancer. Aurora B kinase, with oncogenic potential, is involved in chromosome segregation and cytokinesis, and its inhibition is a promising anti-cancer therapy. In the present study, we aimed to investigate the effects of Aurora B inhibitor, AZD1152-HQPA, on survival and proliferation of androgen receptor (AR)-positive prostate cancer cells. LNCaP was used as androgen-dependent prostate cancer cell line. We explored the effects of AZD1152-HQPA on cell viability, DNA content, micronuclei formation, and expression of genes involved in apoptosis and cell cycle. Moreover, the expression of Aurora B and AR were investigated in 23 benign prostatic hyperplasia and 38 prostate cancer specimens. AZD1152-HQPA treatment induced defective cell survival, polyploidy, and cell death in LNCaP cell line. Centromeric labeling with fluorescence in situ hybridization (FISH) showed that the loss of whole chromosomes is the origin of micronuclei, indicating on aneugenic action of AZD1152-HQPA. Treatment of AZD1152-HQPA decreased expression of AR. Moreover, we found weak positive correlations between the expression of Aurora B and AR in both benign prostatic hyperplasia and prostate cancer specimens (r = 0.25, r = 0.41). This is the first time to show that AZD1152-HQPA can be a useful therapeutic strategy for the treatment of androgen-dependent prostate cancer cell line. AZD1152-HQPA induces aneugenic mechanism of micronuclei production. Taken together, this study provides new insight into the direction to overcome the therapeutic impediments against prostate cancer.

SOCS3 Modulates the Response to Enzalutamide and Is Regulated by Androgen Receptor Signaling and CpG Methylation in Prostate Cancer Cells.

PubMed

Handle, Florian; Erb, Holger H H; Luef, Birgit; Hoefer, Julia; Dietrich, Dimo; Parson, Walther; Kristiansen, Glen; Santer, Frédéric R; Culig, Zoran

2016-06-01

The proinflammatory cytokine IL6 is associated with bad prognosis in prostate cancer and implicated in progression to castration resistance. Suppressor of cytokine signaling 3 (SOCS3) is an IL6-induced negative feedback regulator of the IL6/Janus kinase (JAK)/STAT3 pathway. This study reveals that the SOCS3 promoter is hypermethylated in cancerous regions compared with adjacent benign tissue in prostate cancer using methylation-specific qPCR. A series of in vitro experiments was performed to assess the functional impact of low SOCS3 expression during anti-androgen treatment. Using lentivirus-mediated knockdown, it was demonstrated for the first time that SOCS3 regulates IL6/JAK/STAT3 signaling in androgen receptor-positive LNCaP cells. In addition, SOCS3 mRNA is upregulated by the anti-androgens bicalutamide and enzalutamide. This effect is caused by androgen receptor-mediated suppression of IL6ST and JAK1 expression, which leads to altered STAT3 signaling. Functionally, knockdown of SOCS3 led to enhanced androgen receptor activity after 3 weeks of enzalutamide treatment in an inflammatory setting. Furthermore, the stemness/self-renewal associated genes SOX2 and NANOG were strongly upregulated by the long-term treatment, and modulation of SOCS3 expression was sufficient to counteract this effect. These findings prove that SOCS3 plays an important role during anti-androgen treatment in an inflammatory environment. SOCS3 is frequently inactivated by promoter hypermethylation in prostate cancer, which disrupts the feedback regulation of IL6 signaling and leads to reduced efficacy of enzalutamide in the presence of inflammatory cytokines. Mol Cancer Res; 14(6); 574-85. ©2016 AACR. ©2016 American Association for Cancer Research.

Proliferative activity and branching morphogenesis in the human prostate: a closer look at pre- and postnatal prostate growth.

PubMed

Xue, Y; Sonke, G; Schoots, C; Schalken, J; Verhofstad, A; de la Rosette, J; Smedts, F

2001-10-01

To gain further insight into the molecular cell biologic features of prostate development, we investigated the proliferative activity of prostate epithelial and stromal cells and their topographic relationship with neuroendocrine (NE) cell distribution and regional heterogeneity. Consecutive sections from 43 prostates taken during autopsy representing fetuses (12-38 weeks of gestation), infants, prepubertal males and adults were double stained for chromogranin A and MIB-1. MIB-1 labeling index (LI) was calculated in the budding tips, forming acini, major collecting ducts, adjacent and non-adjacent stromal compartments. Furthermore, the topographic relationship between proliferating cells and NE cells was evaluated. In the first half of gestation, cell proliferation as revealed by MIB-1 LI was significantly higher in epithelial structures and stroma than in older fetuses and other age groups. MIB-1 LI was higher in budding tips than in other epithelial regions. MIB-1 LI in stroma adjacent to budding tips was not higher than that adjacent to other epithelial branching segments. Co-expression of chromogranin A and MIB-1 staining was not observed. MIB-1 LI was lower in cells in the direct vicinity of chromogranin A positive NE cells than at a distance from NE cells. Prostate development in the first half of gestation is explosive. Thereafter, the prostate basically is a slow-growing organ. Budding tips are the major growth foci during early prostate development, while stromal growth is evenly distributed throughout the prostate, probably indicating that stromal-epithelial interactions do not manifest in enhanced proliferation at their interface. NE cells may have an inhibitory effect on proliferation of exocrine epithelial cells and are probably only associated with differentiation of prostate exocrine cells in the prostate. Copyright 2001 Wiley-Liss, Inc.

Polyprenylated polycyclic acylphloroglucinol: Angiogenesis inhibitor from Garcinia multiflora.

PubMed

Cheng, Lin-Yang; Chen, Chun-Lin; Kuo, Yueh-Hsiung; Chang, Tsung-Hsien; Lin, I-Wei; Wang, Shih-Wei; Chung, Mei-Ing; Chen, Jih-Jung

2018-06-01

A new polyprenylated polycyclic acylphloroglucinol, garcimultiflorone K (1), has been isolated from the stems of Garcinia multiflora, together with two known compounds, garcimultiflorone A (2) and garcimultiflorone B (3). The structure of new compound 1 was determined through spectroscopic methods including 1D and 2D NMR and MS analyses. The anti-angiogenic and anti-cancer effects of compounds 1-3 were evaluated in human endothelial progenitor cells (EPCs) and cancer cells. Of these, garcimultiflorone K (1) displayed the most potent anti-angiogenic property by suppressing cell growth and tube formation of EPCs. Compound 1 also exhibited growth-inhibitory activities against human hepatocellular carcinoma cell line SK-Hep-1 and hormone refractory prostate cancer cell line PC-3 with GI 50 values of 4.3 ± 1.6 and 6.6 ± 0.4 μM, respectively. Copyright © 2018 Elsevier Ltd. All rights reserved.

DNA methylome changes by estradiol benzoate and bisphenol A links early-life environmental exposures to prostate cancer risk

PubMed Central

Cheong, Ana; Zhang, Xiang; Cheung, Yuk-Yin; Tang, Wan-yee; Chen, Jing; Ye, Shu-Hua; Medvedovic, Mario; Leung, Yuet-Kin; Prins, Gail S.; Ho, Shuk-Mei

2016-01-01

ABSTRACT Developmental exposure to endocrine-disrupting chemicals (EDCs), 17β-estradiol-3-benzoate (EB) and bisphenol A (BPA), increases susceptibility to prostate cancer (PCa) in rodent models. Here, we used the methylated-CpG island recovery assay (MIRA)-assisted genomic tiling and CpG island arrays to identify treatment-associated methylome changes in the postnatal day (PND)90 dorsal prostate tissues of Sprague-Dawley rats neonatally (PND1, 3, and 5) treated with 25 µg/pup or 2,500 µg EB/kg body weight (BW) or 0.1 µg BPA/pup or 10 µg BPA/kg BW. We identified 111 EB-associated and 86 BPA-associated genes, with 20 in common, that have significant differentially methylated regions. Pathway analysis revealed cancer as the top common disease pathway. Bisulfite sequencing validated the differential methylation patterns observed by array analysis in 15 identified candidate genes. The methylation status of 7 (Pitx3, Wnt10b, Paqr4, Sox2, Chst14, Tpd52, Creb3l4) of these 15 genes exhibited an inverse correlation with gene expression in tissue samples. Cell-based assays, using 5-aza-cytidine-treated normal (NbE-1) and cancerous (AIT) rat prostate cells, added evidence of DNA methylation-mediated gene expression of 6 genes (exception: Paqr4). Functional connectivity of these genes was linked to embryonic stem cell pluripotency. Furthermore, clustering analyses using the dataset from The Cancer Genome Atlas revealed that expression of this set of 7 genes was associated with recurrence-free survival of PCa patients. In conclusion, our study reveals that gene-specific promoter methylation changes, resulting from early-life EDC exposure in the rat, may serve as predictive epigenetic biomarkers of PCa recurrence, and raises the possibility that such exposure may impact human disease. PMID:27415467

DNA methylome changes by estradiol benzoate and bisphenol A links early-life environmental exposures to prostate cancer risk.

PubMed

Cheong, Ana; Zhang, Xiang; Cheung, Yuk-Yin; Tang, Wan-Yee; Chen, Jing; Ye, Shu-Hua; Medvedovic, Mario; Leung, Yuet-Kin; Prins, Gail S; Ho, Shuk-Mei

2016-09-01

Developmental exposure to endocrine-disrupting chemicals (EDCs), 17β-estradiol-3-benzoate (EB) and bisphenol A (BPA), increases susceptibility to prostate cancer (PCa) in rodent models. Here, we used the methylated-CpG island recovery assay (MIRA)-assisted genomic tiling and CpG island arrays to identify treatment-associated methylome changes in the postnatal day (PND)90 dorsal prostate tissues of Sprague-Dawley rats neonatally (PND1, 3, and 5) treated with 25 µg/pup or 2,500 µg EB/kg body weight (BW) or 0.1 µg BPA/pup or 10 µg BPA/kg BW. We identified 111 EB-associated and 86 BPA-associated genes, with 20 in common, that have significant differentially methylated regions. Pathway analysis revealed cancer as the top common disease pathway. Bisulfite sequencing validated the differential methylation patterns observed by array analysis in 15 identified candidate genes. The methylation status of 7 (Pitx3, Wnt10b, Paqr4, Sox2, Chst14, Tpd52, Creb3l4) of these 15 genes exhibited an inverse correlation with gene expression in tissue samples. Cell-based assays, using 5-aza-cytidine-treated normal (NbE-1) and cancerous (AIT) rat prostate cells, added evidence of DNA methylation-mediated gene expression of 6 genes (exception: Paqr4). Functional connectivity of these genes was linked to embryonic stem cell pluripotency. Furthermore, clustering analyses using the dataset from The Cancer Genome Atlas revealed that expression of this set of 7 genes was associated with recurrence-free survival of PCa patients. In conclusion, our study reveals that gene-specific promoter methylation changes, resulting from early-life EDC exposure in the rat, may serve as predictive epigenetic biomarkers of PCa recurrence, and raises the possibility that such exposure may impact human disease.

Expression of membrane-type 1 matrix metalloproteinase (MT1-MMP) on prostate cancer cell lines.

PubMed

Nagakawa, O; Murakami, K; Yamaura, T; Fujiuchi, Y; Murata, J; Fuse, H; Saiki, I

2000-07-31

Membrane-type metalloproteinase-1 (MT1-MMP) is a transmembrane metalloproteinase, which activates proMMP-2 and expressed on the cell surface in many invasive cancer cells. We investigated the expression of MT1-MMP in prostate cancer cell lines. MT1-MMP protein and mRNA were expressed in PC-3, DU-145 and TSU-pr1 cells (androgen-independent prostate cancer cell lines), but in LNCaP cells (androgen-dependent prostate cancer cell line). MT1-MMP protein was negative and mRNA was low to detect by RT-PCR. Cell lysate of PC-3 cleaved proMMP-2 to the active form. In addition, both hepatocyte growth factor (HGF) and gastrin-releasing peptide (GRP) increased Matrigel invasion and induced the expression of MT1-MMP protein in DU-145 prostate cancer cells. These results suggest that MT1-MMP is indeed the tumor-specific activator of proMMP-2 in androgen-independent prostate cancer cells and plays an important role in the invasive properties of prostate cancer cells.

Characterization of neuroendocrine differentiation in human benign prostate and prostatic adenocarcinoma.

PubMed

Aprikian, A G; Cordon-Cardo, C; Fair, W R; Reuter, V E

1993-06-15

This report describes an immunohistopathologic analysis characterizing the incidence, pattern of distribution, and hormonal content of neuroendocrine (NE) cells in human benign prostate and prostatic adenocarcinoma. Formaldehyde-fixed, paraffin-embedded material from 15 benign prostates, 31 primary prostatic adenocarcinomas, 16 metastatic lesions, 21 primary tumors treated with short-course diethylstilbestrol (DES), and 10 specimens from hormone-refractory patients were examined. NE cells were identified using silver histochemistry and a panel of immunohistochemical NE markers (chromogranin-A, serotonin, neuron-specific enolase), and specific peptide hormone antibodies. NE cells were identified in all benign prostates. NE cells were identified in 77% of primary untreated adenocarcinomas with no significant differences with respect to pathologic stage. NE cells were found isolated and dispersed in the tumor, composing the minority of malignant cells. Double-labeling and serial section immunohistochemistry demonstrated the coexpression of prostate-specific antigen (PSA) in NE cells. In addition to serotonin, some tumors expressed multiple hormone immunoreactivities. NE cells were identified in 56% of metastatic deposits, with a similar pattern of distribution. In DES-treated cases, NE cells were found consistently in the adjacent benign epithelium, whereas 52% of tumors contained NE cells. Hormone-refractory tumors contained NE cells in 60% of cases. This analysis demonstrates that a significant proportion of primary and metastatic prostatic adenocarcinomas contain a subpopulation of NE cells, the expression of which does not appear to be suppressed with androgen ablation and does not correlate with pathologic stage. Furthermore, NE cells coexpress PSA, suggesting a common precursor cell of origin. The elaboration of biogenic amines and neuropeptides suggests that NE cells dispersed in prostatic carcinoma may play a paracrine growth-regulatory role.

GTI-2040 and Docetaxel in Treating Patients With Recurrent, Metastatic, or Unresectable Locally Advanced Non-Small Cell Lung Cancer, Prostate Cancer, or Other Solid Tumors

ClinicalTrials.gov

2013-01-23

Recurrent Non-small Cell Lung Cancer; Recurrent Prostate Cancer; Stage III Prostate Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Non-small Cell Lung Cancer; Stage IV Prostate Cancer; Unspecified Adult Solid Tumor, Protocol Specific

Phenotypic characterization of telomerase-immortalized primary non-malignant and malignant tumor-derived human prostate epithelial cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu Yongpeng; Li Hongzhen; Miki, Jun

2006-04-01

In vitro human prostate cell culture models are critical for clarifying the mechanism of prostate cancer progression and for testing preventive and therapeutic agents. Cell lines ideal for the study of human primary prostate tumors would be those derived from spontaneously immortalized tumor cells; unfortunately, explanted primary prostate cells survive only short-term in culture, and rarely immortalize spontaneously. Therefore, we recently have generated five immortal human prostate epithelial cell cultures derived from both the benign and malignant tissues of prostate cancer patients with telomerase, a gene that prevents cellular senescence. Examination of these cell lines for their morphologies and proliferativemore » capacities, their abilities to grow in low serum, to respond to androgen stimulation, to grow above the agar layer, to form tumors in SCID mice, suggests that they may serve as valid, useful tools for the elucidation of early events in prostate tumorigenesis. Furthermore, the chromosome alterations observed in these immortalized cell lines expressing aspects of the malignant phenotypes imply that these cell lines accurately recapitulate the genetic composition of primary tumors. These novel in vitro models may offer unique models for the study of prostate carcinogenesis and also provide the means for testing both chemopreventive and chemotherapeutic agents.« less

Modulation of AKR1C2 by curcumin decreases testosterone production in prostate cancer.

PubMed

Ide, Hisamitsu; Lu, Yan; Noguchi, Takahiro; Muto, Satoru; Okada, Hiroshi; Kawato, Suguru; Horie, Shigeo

2018-04-01

Intratumoral androgen biosynthesis has been recognized as an essential factor of castration-resistant prostate cancer. The present study investigated the effects of curcumin on the inhibition of intracrine androgen synthesis in prostate cancer. Human prostate cancer cell lines, LNCaP and 22Rv1 cells were incubated with or without curcumin after which cell proliferation was measured at 0, 24, 48 and 72 hours, respectively. Prostate tissues from the transgenic adenocarcinoma of the mouse prostate (TRAMP) model were obtained after 1-month oral administration of 200 mg/kg/d curcumin. Testosterone and dihydrotestosterone concentrations in LNCaP prostate cancer cells were determined through LC-MS/MS assay. Curcumin inhibited cell proliferation and induced apoptosis of prostate cancer cells in a dose-dependent manner. Curcumin decreased the expression of steroidogenic acute regulatory proteins, CYP11A1 and HSD3B2 in prostate cancer cell lines, supporting the decrease of testosterone production. After 1-month oral administration of curcumin, Aldo-Keto reductase 1C2 (AKR1C2) expression was elevated. Simultaneously, decreased testosterone levels in the prostate tissues were observed in the TRAMP mice. Meanwhile, curcumin treatments considerably increased the expression of AKR1C2 in prostate cancer cell lines, supporting the decrease of dihydrotestosterone. Taken together, these results suggest that curcumin's natural bioactive compounds could have potent anticancer properties due to suppression of androgen production, and this could have therapeutic effects on prostate cancer. © 2018 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Overexpression and knock-down studies highlight that a disintegrin and metalloproteinase 28 controls proliferation and migration in human prostate cancer.

PubMed

Rudnicka, Caroline; Mochizuki, Satsuki; Okada, Yasunori; McLaughlin, Claire; Leedman, Peter J; Stuart, Lisa; Epis, Michael; Hoyne, Gerard; Boulos, Sherif; Johnson, Liam; Schlaich, Markus; Matthews, Vance

2016-10-01

Prostate cancer is one of the most prevalent cancers in men. It is critical to identify and characterize oncogenes that drive the pathogenesis of human prostate cancer. The current study builds upon previous research showing that a disintegrin and metallproteinase (ADAM)28 is involved in the pathogenesis of numerous cancers. Our novel study used overexpression, pharmacological, and molecular approaches to investigate the biological function of ADAM28 in human prostate cancer cells, with a focus on cell proliferation and migration. The results of this study provide important insights into the role of metalloproteinases in human prostate cancer.The expression of ADAM28 protein levels was assessed within human prostate tumors and normal adjacent tissue by immunohistochemistry. Immunocytochemistry and western blotting were used to assess ADAM28 protein expression in human prostate cancer cell lines. Functional assays were conducted to assess proliferation and migration in human prostate cancer cells in which ADAM28 protein expression or activity had been altered by overexpression, pharmacological inhibition, or by siRNA gene knockdown.The membrane bound ADAM28 was increased in human tumor biopsies and prostate cancer cell lines. Pharmacological inhibition of ADAM28 activity and/or knockdown of ADAM28 significantly reduced proliferation and migration of human prostate cancer cells, while overexpression of ADAM28 significantly increased proliferation and migration.ADAM28 is overexpressed in primary human prostate tumor biopsies, and it promotes human prostate cancer cell proliferation and migration. This study supports the notion that inhibition of ADAM28 may be a potential novel therapeutic strategy for human prostate cancer.

Expression of proinflammatory cytokine interleukin-6 in tissue samples of human prostate obtained by needle biopsy.

PubMed

Miličević, Nevenka; Mrčela, Milanka; Galić, Josip; Marjanović, Ksenija

2015-11-01

Interleukin-6 (IL-6) has been associated with the development of prostate cancer. The aim of the study was to clarify whether IL-6 expression in prostate tissue could be a useful marker in differentiation of prostate diseases in small foci by pathologist visual scoring. Archival paraffin-embedded specimens of benign prostate hyperplasia (BPH), high-grade prostatic intraepithelial neoplasia (PIN), prostatitis and prostate adenocarcinoma were studied by immunohistochemistry with a mouse monoclonal antibody IL-6 using the streptavidin-biotin method. Significantly, lower IL-6 immunoreactivity was observed in normal epithelial cells (p=0.000) and basal cells (p=0.000) in the samples of prostate adenocarcinoma in comparison to the samples with BPH, PIN and prostatitis. There was no significant difference in IL-6 expression in malignant and premalignant cells (p=0.814) as well as in stromal cells among the four diagnoses (p=0.22). IL-6 was expressed in normal epithelial cells, premalignant epithelial cells and malignant epithelial cells as well as in stromal cells. However, in our research IL-6 was of limited utility as a single marker for differential diagnosis of the prostate diseases in small foci needle biopsy by pathologist visual scoring. The standardization of immunohistochemical (IHC) staining protocol for IL-6 is required to determine IL-6 expression in order to avoid possible misinterpretation of the IHC results. Copyright © 2015 Elsevier GmbH. All rights reserved.

Adipose-derived stromal cells inhibit prostate cancer cell proliferation inducing apoptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahara, Kiyoshi; Ii, Masaaki, E-mail: masaii@art.osaka-med.ac.jp; Inamoto, Teruo

2014-04-18

Highlights: • AdSC transplantation exhibits inhibitory effect on tumor progressions of PCa cells. • AdSC-induced PCa cell apoptosis may occur via the TGF-β signaling pathway. • High expression of the TGF-β1 gene in AdSCs. - Abstract: Mesenchymal stem cells (MSCs) have generated a great deal of interest in the field of regenerative medicine. Adipose-derived stromal cells (AdSCs) are known to exhibit extensive proliferation potential and can undergo multilineage differentiation, sharing similar characteristics to bone marrow-derived MSCs. However, as the effect of AdSCs on tumor growth has not been studied sufficiently, we assessed the degree to which AdSCs affect the proliferationmore » of prostate cancer (PCa) cell. Human AdSCs exerted an inhibitory effect on the proliferation of androgen-responsive (LNCaP) and androgen-nonresponsive (PC3) human PCa cells, while normal human dermal fibroblasts (NHDFs) did not, and in fact promoted PCa cell proliferation to a degree. Moreover, AdSCs induced apoptosis of LNCaP cells and PC3 cells, activating the caspase3/7 signaling pathway. cDNA microarray analysis suggested that AdSC-induced apoptosis in both LNCaP and PC3 cells was related to the TGF-β signaling pathway. Consistent with our in vitro observations, local transplantation of AdSCs delayed the growth of tumors derived from both LNCaP- and PC3-xenografts in immunodeficient mice. This is the first preclinical study to have directly demonstrated that AdSC-induced PCa cell apoptosis may occur via the TGF-β signaling pathway, irrespective of androgen-responsiveness. Since autologous AdSCs can be easily isolated from adipose tissue without any ethical concerns, we suggest that therapy with these cells could be a novel approach for patients with PCa.« less

TGF-Beta Induction of PMEPA1: Role in Bone Metastasis Due to Prostate Cancer

DTIC Science & Technology

2009-01-01

expresses renilla luciferase, in PC-3 (prostate cancer cells), and HepG2 ( hepatocarcinoma ) and A459 (lung cancer cells) known for their sensitivity to...bound PMEPA1 in prostate, breast, lung cancer cells and hepatocarcinoma cells. Prostate (PC-3, DU-145), breast (MDA-MB-231) and lung (A549) cancer...cells and hepatocarcinoma cells (HepG2) were grown until reaching cell layer reached near confluency. Cells were serum-starved for 4 hours and further

Interaction between tumor cell surface receptor RAGE and proteinase 3 mediates prostate cancer metastasis to bone

PubMed Central

Kolonin, Mikhail G.; Sergeeva, Anna; Staquicini, Daniela I.; Smith, Tracey L.; Tarleton, Christy A.; Molldrem, Jeffrey J.; Sidman, Richard L.; Marchiò, Serena; Pasqualini, Renata; Arap, Wadih

2017-01-01

Human prostate cancer often metastasizes to bone, but the biological basis for such site-specific tropism remains largely unresolved. Recent work led us to hypothesize that this tropism may reflect pathogenic interactions between RAGE, a cell surface receptor expressed on malignant cells in advanced prostate cancer, and proteinase 3 (PR3), a serine protease present in inflammatory neutrophils and hematopoietic cells within the bone marrow microenvironment. In this study, we establish that RAGE-PR3 interaction mediates homing of prostate cancer cells to the bone marrow. PR3 bound to RAGE on the surface of prostate cancer cells in vitro, inducing tumor cell motility through a non-proteolytic signal transduction cascade involving activation and phosphorylation of ERK1/2 and JNK1. In preclinical models of experimental metastasis, ectopic expression of RAGE on human prostate cancer cells was sufficient to promote bone marrow homing within a short time frame. Our findings demonstrate how RAGE-PR3 interactions between human prostate cancer cells and the bone marrow microenvironment mediate bone metastasis during prostate cancer progression, with potential implications for prognosis and therapeutic intervention. PMID:28428279

Tunable cytotoxic aptamer-drug conjugates for the treatment of prostate cancer.

PubMed

Powell Gray, Bethany; Kelly, Linsley; Ahrens, Douglas P; Barry, Ashley P; Kratschmer, Christina; Levy, Matthew; Sullenger, Bruce A

2018-05-01

Therapies that can eliminate both local and metastatic prostate tumor lesions while sparing normal organ tissue are desperately needed. With the goal of developing an improved drug-targeting strategy, we turned to a new class of targeted anticancer therapeutics: aptamers conjugated to highly toxic chemotherapeutics. Cell selection for aptamers with prostate cancer specificity yielded the E3 aptamer, which internalizes into prostate cancer cells without targeting normal prostate cells. Chemical conjugation of E3 to the drugs monomethyl auristatin E (MMAE) and monomethyl auristatin F (MMAF) yields a potent cytotoxic agent that efficiently kills prostate cancer cells in vitro but does not affect normal prostate epithelial cells. Importantly, the E3 aptamer targets tumors in vivo and treatment with the MMAF-E3 conjugate significantly inhibits prostate cancer growth in mice, demonstrating the in vivo utility of aptamer-drug conjugates. Additionally, we report the use of antidotes to block E3 aptamer-drug conjugate cytotoxicity, providing a safety switch in the unexpected event of normal cell killing in vivo.

Regulation of Prostate Development and Benign Prostatic Hyperplasia by Autocrine Cholinergic Signaling via Maintaining the Epithelial Progenitor Cells in Proliferating Status.

PubMed

Wang, Naitao; Dong, Bai-Jun; Quan, Yizhou; Chen, Qianqian; Chu, Mingliang; Xu, Jin; Xue, Wei; Huang, Yi-Ran; Yang, Ru; Gao, Wei-Qiang

2016-05-10

Regulation of prostate epithelial progenitor cells is important in prostate development and prostate diseases. Our previous study demonstrated a function of autocrine cholinergic signaling (ACS) in promoting prostate cancer growth and castration resistance. However, whether or not such ACS also plays a role in prostate development is unknown. Here, we report that ACS promoted the proliferation and inhibited the differentiation of prostate epithelial progenitor cells in organotypic cultures. These results were confirmed by ex vivo lineage tracing assays and in vivo renal capsule recombination assays. Moreover, we found that M3 cholinergic receptor (CHRM3) was upregulated in a large subset of benign prostatic hyperplasia (BPH) tissues compared with normal tissues. Activation of CHRM3 also promoted the proliferation of BPH cells. Together, our findings identify a role of ACS in maintaining prostate epithelial progenitor cells in the proliferating state, and blockade of ACS may have clinical implications for the management of BPH. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Auraptene Induces Apoptosis via Myeloid Cell Leukemia 1-Mediated Activation of Caspases in PC3 and DU145 Prostate Cancer Cells.

PubMed

Lee, Jae Chul; Shin, Eun Ah; Kim, Bonglee; Kim, Bo-Im; Chitsazian-Yazdi, Mahsa; Iranshahi, Mehrdad; Kim, Sung-Hoon

2017-06-01

Although auraptene, a prenyloxy coumarin from Citrus species, was known to have anti-oxidant, anti-bacterial, antiinflammatory, and anti-tumor activities, the underlying anti-tumor mechanism of auraptene in prostate cancers is not fully understood to date. Thus, in the present study, we have investigated the anti-tumor mechanism of auraptene mainly in PC3 and DU145 prostate cancer cells, because auraptene suppressed the viability of androgen-independent PC3 and DU145 prostate cancer cells better than androgen-sensitive LNCaP cells. Also, auraptene notably increased sub-G1 cell population and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells as features of apoptosis in two prostate cancer cells compared with untreated control. Consistently, auraptene cleaved poly(ADP-ribose) polymerase, activated caspase-9 and caspase-3, suppressed the expression of anti-apoptotic proteins, including Bcl-2 and myeloid cell leukemia 1 (Mcl-1), and also activated pro-apoptotic protein Bax in both prostate cancer cells. However, Mcl-1 overexpression reversed the apoptotic effect of auraptene to increase sub-G1 population and induce caspase-9/3 in both prostate cancer cells. Taken together, the results support scientific evidences that auraptene induces apoptosis in PC3 and DU145 prostate cancer cells via Mcl-1-mediated activation of caspases as a potent chemopreventive agent for prostate cancer prevention and treatment. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Protein profile of basal prostate epithelial progenitor cells--stage-specific embryonal antigen 4 expressing cells have enhanced regenerative potential in vivo.

PubMed

Höfner, Thomas; Klein, Corinna; Eisen, Christian; Rigo-Watermeier, Teresa; Haferkamp, Axel; Sprick, Martin R

2016-04-01

The long-term propagation of basal prostate progenitor cells ex vivo has been very difficult in the past. The development of novel methods to expand prostate progenitor cells in vitro allows determining their cell surface phenotype in greater detail. Mouse (Lin(-)Sca-1(+) CD49f(+) Trop2(high)-phenotype) and human (Lin(-) CD49f(+) TROP2(high)) basal prostate progenitor cells were expanded in vitro. Human and mouse cells were screened using 242 anti-human or 176 antimouse monoclonal antibodies recognizing the cell surface protein profile. Quantitative expression was evaluated at the single-cell level using flow cytometry. Differentially expressed cell surface proteins were evaluated in conjunction with the known CD49f(+)/TROP2(high) phenotype of basal prostate progenitor cells and characterized by in vivo sandwich-transplantation experiments using nude mice. The phenotype of basal prostate progenitor cells was determined as CD9(+)/CD24(+)/CD29(+)/CD44(+)/CD47(+)/CD49f(+)/CD104(+)/CD147(+)/CD326(+)/Trop2(high) of mouse as well as human origin. Our analysis revealed several proteins, such as CD13, Syndecan-1 and stage-specific embryonal antigens (SSEAs), as being differentially expressed on murine and human CD49f(+) TROP2(+) basal prostate progenitor cells. Transplantation experiments suggest that CD49f(+) TROP2(high) SSEA-4(high) human prostate basal progenitor cells to be more potent to regenerate prostate tubules in vivo as compared with CD49f(+) TROP2(high) or CD49f(+) TROP2(high) SSEA-4(low) cells. Determination of the cell surface protein profile of functionally defined murine and human basal prostate progenitor cells reveals differentially expressed proteins that may change the potency and regenerative function of epithelial progenitor cells within the prostate. SSEA-4 is a candidate cell surface marker that putatively enables a more accurate identification of the basal PESC lineage. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Expression and localization of GLUT1 and GLUT12 in prostate carcinoma.

PubMed

Chandler, Jenalle D; Williams, Elizabeth D; Slavin, John L; Best, James D; Rogers, Suzanne

2003-04-15

Increased glucose consumption is a characteristic of malignant cells and in prostate carcinoma is associated with the proliferation of both androgen-dependent and independent cells. Transport of polar glucose across the nonpolar membrane relies on glucose transporter proteins, known as GLUTs. Increased expression of GLUT1 is a characteristic of many malignant cells. The authors characterized and cloned the cDNA for a novel glucose transporter, GLUT12, which was identified initially in malignant breast epithelial cells. To the authors' knowledge, there have been no reports on the expression of glucose transporters in the human prostate or human prostate carcinoma cells. The authors evaluated GLUT1 and GLUT12 expression in human prostate carcinoma cells. Reverse transcription-polymerase chain reaction was performed on total RNA extracted from cultured prostate carcinoma cells LNCaP, C4, C4-2, and C4-2B using primers to amplify GLUT1, GLUT12, or the housekeeping gene, 36B4. Total protein extracted from prostate carcinoma cell lines was assessed for GLUT12 protein by Western blot analysis. Cultured cell monolayers were incubated with antibodies to GLUT1 or GLUT12 and a peripheral Golgi protein, Golgi 58K, for detection by immunofluorescent confocal microscopy. Sections of benign prostatic hyperplasia and human prostate carcinoma were stained for immunohistochemical detection of GLUT1 and GLUT12. GLUT1 and GLUT12 mRNA and protein were detected in all cell lines evaluated. Immunofluorescence staining demonstrated both GLUT1 and GLUT12 on the plasma membrane and in the cytoplasm in all cultured prostate carcinoma cell lines, with GLUT1 but not GLUT12 appearing to colocalize with the Golgi. Immunohistochemical staining of benign prostatic hyperplasia indicated expression of GLUT1 but not GLUT12. Malignant tissue stained for GLUT12 but was negative for GLUT1. GLUT1 and GLUT12 are expressed in human prostate carcinoma cells. One possible rationale for the GLUT1 Golgi association is that it may supply glucose to the Golgi for byproduct incorporation into the prostatic secretory fluid. Further work will investigate the importance of glucose transport and GLUT1 and GLUT12 in prostate carcinoma cell growth. Copyright 2003 American Cancer Society.

Inhibition of prostate smooth muscle contraction and prostate stromal cell growth by the inhibitors of Rac, NSC23766 and EHT1864.

PubMed

Wang, Y; Kunit, T; Ciotkowska, A; Rutz, B; Schreiber, A; Strittmatter, F; Waidelich, R; Liu, C; Stief, C G; Gratzke, C; Hennenberg, M

2015-06-01

Medical therapy of lower urinary tract symptoms (LUTS) suggestive of benign prostatic hyperplasia (BPH) targets smooth muscle contraction in the prostate, or prostate growth. However, current therapeutic options are insufficient. Here, we investigated the role of Rac in the control of smooth muscle tone in human prostates and growth of prostate stromal cells. Experiments were performed using human prostate tissues from radical prostatectomy and cultured stromal cells (WPMY-1). Expression of Rac was examined by Western blot and fluorescence staining. Effects of Rac inhibitors (NSC23766 and EHT1864) on contractility were assessed in the organ bath. The effects of Rac inhibitors were assessed by pull-down, cytotoxicity using a cell counting kit, cytoskeletal organization by phalloidin staining and cell growth using an 5-ethynyl-2'-deoxyuridine assay. Expression of Rac1-3 was observed in prostate samples from each patient. Immunoreactivity for Rac1-3 was observed in the stroma, where it colocalized with the smooth muscle marker, calponin. NSC23766 and EHT1864 significantly reduced contractions of prostate strips induced by noradrenaline, phenylephrine or electrical field stimulation. NSC23766 and EHT1864 inhibited Rac activity in WPMY-1 cells. Survival of WPMY-1 cells ranged between 64 and 81% after incubation with NSC23766 (50 or 100 μM) or EHT1864 (25 μM) for 24 h. NSC23766 and EHT1864 induced cytoskeletal disorganization in WPMY-1 cells. Both inhibitors impaired the growth of WPMY-1 cells. Rac may be a link connecting the control of prostate smooth muscle tone with proliferation of smooth muscle cells. Improvements in LUTS suggestive of BPH by Rac inhibitors appears possible. © 2015 The British Pharmacological Society.

The role of PIM1/PIM2 kinases in tumors of the male reproductive system.

PubMed

Jiménez-García, Manuel Pedro; Lucena-Cacace, Antonio; Robles-Frías, María José; Narlik-Grassow, Maja; Blanco-Aparicio, Carmen; Carnero, Amancio

2016-11-30

The PIM family of serine/threonine kinases has three highly conserved isoforms (PIM1, PIM2 and PIM3). PIM proteins are regulated through transcription and stability by JAK/STAT pathways and are overexpressed in hematological malignancies and solid tumors. The PIM kinases possess weak oncogenic abilities, but enhance other genes or chemical carcinogens to induce tumors. We generated conditional transgenic mice that overexpress PIM1 or PIM2 in male reproductive organs and analyzed their contribution to tumorigenesis. We found an increase in alterations of sexual organs and hyperplasia in the transgenic mice correlating with inflammation. We also found that PIM1/2 are overexpressed in a subset of human male germ cells and prostate tumors correlating with inflammatory features and stem cell markers. Our data suggest that PIM1/2 kinase overexpression is a common feature of male reproductive organs tumors, which provoke tissue alterations and a large inflammatory response that may act synergistically during the process of tumorigenesis. There is also a correlation with markers of cancer stem cells, which may contribute to the therapy resistance found in tumors overexpressing PIM kinases.

Inhibition of CHOP accentuates the apoptotic effect of α-mangostin from the mangosteen fruit (Garcinia mangostana) in 22Rv1 prostate cancer cells.

PubMed

Li, Gongbo; Petiwala, Sakina M; Nonn, Larisa; Johnson, Jeremy J

2014-10-10

The mangosteen (Garcinia mangostana) fruit has been a popular food in Southeast Asia for centuries and is increasing in popularity in Western countries. We identified α-Mangostin as a primary phytochemical modulating ER stress proteins in prostate cancer cells and propose that α-Mangostin is responsible for exerting a biological effect in prostate cancer cells. Two human prostate cancer cell lines, 22Rv1 and LNCaP, and prostate epithelial cells procured from two patients undergoing radical prostatectomy were treated with α-Mangostin and evaluated by RT-PCR, Western blot, fluorescent microscopy and siRNA transfection to evaluate ER stress. Next, we evaluated α-Mangostin for microsomal stability, pharmacokinetic parameters, and anti-cancer activity in nude mice. α-Mangostin significantly upregulated ER stress markers in prostate cancer cells. Interestingly, α-Mangostin did not promote ER stress in prostate epithelial cells (PrECs) from prostate cancer patients. CHOP knockdown enhanced α-Mangostin-induced apoptosis in prostate cancer cells. α-Mangostin significantly suppressed tumor growth in a xenograft tumor model without obvious toxicity. Our study suggests that α-Mangostin is not the only active constituent from the mangosteen fruit requiring further work to understand the complex chemical composition of the mangosteen. Copyright © 2014 Elsevier Inc. All rights reserved.

Inflammatory response of a prostate stromal cell line induced by Trichomonas vaginalis.

PubMed

Im, S J; Han, I H; Kim, J H; Gu, N Y; Seo, M Y; Chung, Y H; Ryu, J S

2016-04-01

While Trichomonas vaginalis, a cause of sexually transmitted infection, is known as a surface-dwelling protozoa, trichomonads have been detected in prostatic tissue from benign prostatic hyperplasia and prostatitis by immunoperoxidase assay or PCR. However, the immune response of prostate stromal cells infected with T. vaginalis has not been investigated. Our objective was to investigate whether T. vaginalis could induce an inflammatory response in prostate stromal cells. Incubation of a human prostate stromal myofibroblast cells (WPMY-1) with live T. vaginalis T016 increased expression of the inflammatory chemokines CXCL8 and CCL2. In addition, TLR4, ROS, MAPK and NF-κB expression increased, while inhibitors of TLR4, ROS, MAPKs and NF-κB reduced CXCL8 and CCL2 production. Medium conditioned by incubation of WPMY-1 cells with T. vaginalis stimulated the migration of human neutrophils and monocytes (THP-1 cells). We conclude that T. vaginalis increases CXCL8 and CCL2 production by human prostate stromal cells by activating TLR4, ROS, MAPKs and NF-κB, and this in turn attracts neutrophils and monocytes and leads to an inflammatory response. This study is the first attempt to demonstrate an inflammatory reaction in prostate stromal cells caused by T. vaginalis. © 2016 John Wiley & Sons Ltd.

Studying circulating prostate cancer cells by in-vivo flow cytometer

NASA Astrophysics Data System (ADS)

Guo, Jin; Gu, Zhengqin; Chen, Tong; Wang, Cheng; Wei, Xunbin

2012-03-01

Prostate cancer is the most common malignancy in American men and the second leading cause of deaths from cancer, after lung cancer. The tumor usually grows slowly and remains confined to the gland for many years. As the cancer advances, however, it can metastasize throughout other areas of the body, such as the bones, lungs, and liver. Surgical resection, hormonal therapy, chemotherapy and radiation therapy are the foundation of current prostate cancer therapies. Treatments for prostate cause both short- and long-term side effects that may be difficult to accept. Molecular mechanisms of prostate cancer metastasis need to be understood better and new therapies must be developed to selectively target to unique characteristics of cancer cell growth and metastasis. We have developed the "in vivo microscopy" to study the mechanisms that govern prostate cancer cell spread through the microenvironment in vivo in real-time confocal near-infrared fluorescence imaging. A recently developed "in vivo flow cytometer" and optical imaging are used to assess prostate cancer cell spreading and the circulation kinetics of prostate cancer cells. We have measured the depletion kinetics of cancer cells with different metastatic potential. Interestingly, more invasive PC-3 prostate cancer cells are depleted faster from the circulation than LNCaP cells.

Label-free in vitro prostate cancer cell detection via photonic-crystal biosensor

NASA Astrophysics Data System (ADS)

DeLuna, Frank; Ding, XiaoFei; Sagredo, Ismael; Bustamante, Gilbert; Sun, Lu-Zhe; Ye, Jing Yong

2018-02-01

Prostate-specific antigen (PSA) biomarker assays are the current clinical method for mass screening of prostate cancer. However, high false-positive rates are often reported due to PSA's low specificity, leading to an urgent need for the development of a more specific detection system independent of PSA levels. In our previous research, we demonstrated the feasibility of using cellular refractive indices (RI) as a unique contrast parameter to accomplish label-free detection of prostate cancer cells via variance testing, but were unable to determine if a specific cell was cancerous or noncancerous. In this paper, we report the use of our Photonic-Crystal biosensor in a Total-Internal-Reflection (PC-TIR) configuration to construct a label-free imaging system, which allows for the detection of individual prostate cancer cells utilizing cellular RI as the only contrast parameter. Noncancerous prostate (BPH-1) cells and prostate cancer (PC-3) cells were mixed at varied ratios and measured concurrently. Additionally, we isolated and induced PC-3 cells to undergo epithelial-mesenchymal transition (EMT) by exposing these cells to soluble factors such as TGF-β1. The biophysical characteristics of the cellular RI were quantified extensively in comparison to non-induced PC-3 cells as well as BPH-1 cells. EMT is a crucial mechanism for the invasion and metastasis of epithelial tumors characterized by the loss of cell-cell adhesion and increased cell mobility. Our study shows promising clinical potential in utilizing the PC-TIR biosensor imaging system to not only detect prostate cancer cells, but also evaluate prostate cancer progression.

Novel In Vivo Model for Combinatorial Fluorescence Labeling in Mouse Prostate

PubMed Central

Fang, Xiaolan; Gyabaah, Kenneth; Nickkholgh, Bita; Cline, J. Mark; Balaji, K.C.

2015-01-01

BACKGROUND The epithelial layer of prostate glands contains several types of cells, including luminal and basal cells. Yet there is paucity of animal models to study the cellular origin of normal or neoplastic development in the prostate to facilitate the treatment of heterogenous prostate diseases by targeting individual cell lineages. METHODS We developed a mouse model that expresses different types of fluorescent proteins (XFPs) specifically in prostatic cells. Using an in vivo stochastic fluorescent protein combinatorial strategy, XFP signals were expressed specifically in prostate of Protein Kinase D1 (PKD1) knock-out, K-RasG12D knock-in, and Phosphatase and tensin homolog (PTEN) and PKD1 double knock-out mice under the control of PB-Cre promoter. RESULTS In vivo XFP signals were observed in prostate of PKD1 knock-out, K-RasG12D knock-in, and PTEN PKD1 double knock-out mice, which developed normal, hyperplastic, and neoplastic prostate, respectively. The patchy expression pattern of XFPs in neoplasia tissue indicated the clonal origin of cancer cells in the prostate. CONCLUSIONS The transgenic mouse models demonstrate combinatorial fluorescent protein expression in normal and cancerous prostatic tissues. This novel prostate-specific fluorescent labeled mouse model, which we named Prorainbow, could be useful in studying benign and malignant pathology of prostate. PMID:25753731

Novel In Vivo model for combinatorial fluorescence labeling in mouse prostate.

PubMed

Fang, Xiaolan; Gyabaah, Kenneth; Nickkholgh, Bita; Cline, J Mark; Balaji, K C

2015-06-15

The epithelial layer of prostate glands contains several types of cells, including luminal and basal cells. Yet there is paucity of animal models to study the cellular origin of normal or neoplastic development in the prostate to facilitate the treatment of heterogenous prostate diseases by targeting individual cell lineages. We developed a mouse model that expresses different types of fluorescent proteins (XFPs) specifically in prostatic cells. Using an in vivo stochastic fluorescent protein combinatorial strategy, XFP signals were expressed specifically in prostate of Protein Kinase D1 (PKD1) knock-out, K-Ras(G) (12) (D) knock-in, and Phosphatase and tensin homolog (PTEN) and PKD1 double knock-out mice under the control of PB-Cre promoter. In vivo XFP signals were observed in prostate of PKD1 knock-out, K-Ras(G) (12) (D) knock-in, and PTEN PKD1 double knock-out mice, which developed normal, hyperplastic, and neoplastic prostate, respectively. The patchy expression pattern of XFPs in neoplasia tissue indicated the clonal origin of cancer cells in the prostate. The transgenic mouse models demonstrate combinatorial fluorescent protein expression in normal and cancerous prostatic tissues. This novel prostate-specific fluorescent labeled mouse model, which we named Prorainbow, could be useful in studying benign and malignant pathology of prostate. © 2015 Wiley Periodicals, Inc.

Androgen-independent proliferation of LNCaP prostate cancer cells infected by xenotropic murine leukemia virus-related virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kakoki, Katsura; Department of AIDS Research, Institute of Tropical Medicine, G-COE, Nagasaki University, Nagasaki 852-8523; Department of Urology, Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8523

Highlights: • XMRV infection induces androgen-independent growth in LNCaP cells. • XMRV infection reduces expression of androgen receptor. • XMRV promotes appearance of androgen blocker-resistant prostate cancer cells. - Abstract: Xenotropic murine leukemia virus-related virus (XMRV) is a novel gammaretrovirus that was originally isolated from human prostate cancer. It is now believed that XMRV is not the etiologic agent of prostate cancer. An analysis of murine leukemia virus (MLV) infection in various human cell lines revealed that prostate cancer cell lines are preferentially infected by XMRV, and this suggested that XMRV infection may confer some sort of growth advantage tomore » prostate cancer cell lines. To examine this hypothesis, androgen-dependent LNCaP cells were infected with XMRV and tested for changes in certain cell growth properties. We found that XMRV-infected LNCaP cells can proliferate in the absence of the androgen dihydrotestosterone. Moreover, androgen receptor expression is significantly reduced in XMRV-infected LNCaP cells. Such alterations were not observed in uninfected and amphotropic MLV-infected LNCaP cells. This finding explains why prostate cancer cell lines are preferentially infected with XMRV.« less

CD8+ T-cell responses rapidly select for antigen-negative tumor cells in the prostate.

PubMed

Bak, S Peter; Barnkob, Mike Stein; Wittrup, K Dane; Chen, Jianzhu

2013-12-01

Stimulation of patients' immune systems for the treatment of solid tumors is an emerging therapeutic paradigm. The use of enriched autologous T cells for adoptive cell therapy or vaccination with antigen-loaded dendritic cells have shown clinical efficacy in melanoma and prostate cancer, respectively. However, the long-term effects of immune responses on selection and outgrowth of antigen-negative tumor cells in specific tumor types must be determined to understand and achieve long-term therapeutic effects. In this study, we have investigated the expression of a tumor-specific antigen in situ after treatment with tumor-specific CD8(+) T cells in an autochthonous mouse model of prostate cancer. After T-cell treatment, aggregates of dead antigen-positive tumor cells were concentrated in the lumen of the prostate gland and were eventually eliminated from the prostate tissue. Despite the elimination of antigen-positive tumor cells, prostate tumor continued to grow in T-cell-treated mice. Interestingly, the remaining tumor cells were antigen negative and downregulated MHC class I expression. These results show that CD8(+) T cells are effective in eliminating antigen-bearing prostate tumor cells but they also can select for the outgrowth of antigen-negative tumor cells. These findings provide insights into the requirements for an effective cancer immunotherapy within the prostate that not only induces potent immune responses but also avoids selection and outgrowth of antigen-negative tumor cells. ©2013 AACR.

Hypoexpression and epigenetic regulation of candidate tumor suppressor gene CADM-2 in human prostate cancer.

PubMed

Chang, Guimin; Xu, Shuping; Dhir, Rajiv; Chandran, Uma; O'Keefe, Denise S; Greenberg, Norman M; Gingrich, Jeffrey R

2010-11-15

Cell adhesion molecules (CADM) comprise a newly identified protein family whose functions include cell polarity maintenance and tumor suppression. CADM-1, CADM-3, and CADM-4 have been shown to act as tumor suppressor genes in multiple cancers including prostate cancer. However, CADM-2 expression has not been determined in prostate cancer. The CADM-2 gene was cloned and characterized and its expression in human prostatic cell lines and cancer specimens was analyzed by reverse transcription-PCR and an immunohistochemical tissue array, respectively. The effects of adenovirus-mediated CADM-2 expression on prostate cancer cells were also investigated. CADM-2 promoter methylation was evaluated by bisulfite sequencing and methylation-specific PCR. We report the initial characterization of CADM-2 isoforms: CADM-2a and CADM-2b, each with separate promoters, in human chromosome 3p12.1. Prostate cancer cell lines, LNCaP and DU145, expressed negligible CADM-2a relative to primary prostate tissue and cell lines, RWPE-1 and PPC-1, whereas expression of CADM-2b was maintained. Using immunohistochemistry, tissue array results from clinical specimens showed statistically significant decreased expression in prostate carcinoma compared with normal donor prostate, benign prostatic hyperplasia, prostatic intraepithelial neoplasia, and normal tissue adjacent to tumor (P < 0.001). Adenovirus-mediated CADM-2a expression suppressed DU145 cell proliferation in vitro and colony formation in soft agar. The decrease in CADM-2a mRNA in cancer cell lines correlated with promoter region hypermethylation as determined by bisulfite sequencing and methylation-specific PCR. Accordingly, treatment of cells with the demethylating agent 5-aza-2'-deoxycytidine alone or in combination with the histone deacetylase inhibitor trichostatin A resulted in the reactivation of CADM-2a expression. CADM-2a protein expression is significantly reduced in prostate cancer. Its expression is regulated in part by promoter methylation and implicates CADM-2 as a previously unrecognized tumor suppressor gene in a proportion of human prostate cancers. ©2010 AACR.

AICAR induces AMPK-independent programmed necrosis in prostate cancer cells.

PubMed

Guo, Feng; Liu, Shuang-Qing; Gao, Xing-Hua; Zhang, Long-Yang

2016-05-27

AICAR (5-Aminoimidazole-4-carboxamide riboside or acadesine) is an AMP-activated protein kinase (AMPK) agonist, which induces cytotoxic effect to several cancer cells. Its potential activity in prostate cancer cells and the underlying signaling mechanisms have not been extensively studied. Here, we showed that AICAR primarily induced programmed necrosis, but not apoptosis, in prostate cancer cells (LNCaP, PC-3 and PC-82 lines). AICAR's cytotoxicity to prostate cancer cells was largely attenuated by the necrosis inhibitor necrostatin-1. Mitochondrial protein cyclophilin-D (CYPD) is required for AICAR-induced programmed necrosis. CYPD inhibitors (cyclosporin A and sanglifehrin A) as well as CYPD shRNAs dramatically attenuated AICAR-induced prostate cancer cell necrosis and cytotoxicity. Notably, AICAR-induced cell necrosis appeared independent of AMPK, yet requiring reactive oxygen species (ROS) production. ROS scavengers (N-acetylcysteine and MnTBAP), but not AMPKα shRNAs, largely inhibited prostate cancer cell necrosis and cytotoxicity by AICAR. In summary, the results of the present study demonstrate mechanistic evidences that AMPK-independent programmed necrosis contributes to AICAR's cytotoxicity in prostate cancer cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Dendritic Cells Program Non-Immunogenic Prostate-Specific T Cell Responses Beginning at Early Stages of Prostate Tumorigenesis

PubMed Central

Mihalyo, Marianne A.; Hagymasi, Adam T.; Slaiby, Aaron M.; Nevius, Erin E.; Adler, Adam J.

2010-01-01

BACKGROUND Prostate cancer promotes the development of T cell tolerance towards prostatic antigens, potentially limiting the efficacy of prostate cancer vaccines targeting these antigens. Here, we sought to determine the stage of disease progression when T cell tolerance develops, as well as the role of steady state dendritic cells (DC) and CD4+CD25+ T regulatory cells (Tregs) in programming tolerance. METHODS The response of naïve HA-specific CD4+ T cells were analyzed following adoptive transfer into Pro-HA × TRAMP transgenic mice harboring variably-staged HA-expressing prostate tumors on two genetic backgrounds that display different patterns and kinetics of tumorigenesis. The role of DC and Tregs in programming HA-specific CD4 cell responses were assessed via depletion. RESULTS HA-specific CD4 cells underwent non-immunogenic responses at all stages of tumorigenesis in both genetic backgrounds. These responses were completely dependent on DC, but not appreciably influenced by Tregs. CONCLUSIONS These results suggest that tolerogenicity is an early and general property of prostate tumors. PMID:17221844

Smooth muscle contraction and growth of stromal cells in the human prostate are both inhibited by the Src family kinase inhibitors, AZM475271 and PP2.

PubMed

Wang, Yiming; Gratzke, Christian; Tamalunas, Alexander; Rutz, Beata; Ciotkowska, Anna; Strittmatter, Frank; Herlemann, Annika; Janich, Sophie; Waidelich, Raphaela; Liu, Chunxiao; Stief, Christian G; Hennenberg, Martin

2016-12-01

In benign prostatic hyperplasia, increased prostate smooth muscle tone and prostate volume may contribute alone or together to urethral obstruction and voiding symptoms. Consequently, it is assumed there is a connection between smooth muscle tone and growth in the prostate, but any molecular basis for this is poorly understood. Here, we examined effects of Src family kinase (SFK) inhibitors on prostate contraction and growth of stromal cells. SFK inhibitors, AZM475271 and PP2, were applied to human prostate tissues to assess effects on smooth muscle contraction, and to cultured stromal (WPMY-1) and c-Src-deficient cells to examine effects on proliferation, actin organization and viability. SFKs were detected by real time PCR, western blot and immunofluorescence in human prostate tissues, some being located to smooth muscle cells. AZM475271 (10 μM) and PP2 (10 μM) inhibited SFK in prostate tissues and WPMY-1 cells. Both inhibitors reduced α 1 -adrenoceptor-mediated and neurogenic contraction of prostate strips. This may result from cytoskeletal deorganization, which was observed in response to AZM475271 and PP2 in WPMY-1 cells by staining of actin filaments with phalloidin. This was paralleled by reduced proliferation of wildtype but not of c-Src-deficient cells; cytotoxicity was mainly observed at higher concentrations (>50 μM). In human prostate, smooth muscle tone and growth are both controlled by an SFK-dependent process, which may explain their common role in bladder outlet obstruction. Targeting prostate smooth muscle tone and prostate growth simultaneously by a single compound may, in principal, be possible. © 2016 The British Pharmacological Society.

Smooth muscle contraction and growth of stromal cells in the human prostate are both inhibited by the Src family kinase inhibitors, AZM475271 and PP2

PubMed Central

Wang, Yiming; Tamalunas, Alexander; Rutz, Beata; Ciotkowska, Anna; Strittmatter, Frank; Herlemann, Annika; Janich, Sophie; Waidelich, Raphaela; Liu, Chunxiao; Stief, Christian G; Hennenberg, Martin

2016-01-01

Background and Purpose In benign prostatic hyperplasia, increased prostate smooth muscle tone and prostate volume may contribute alone or together to urethral obstruction and voiding symptoms. Consequently, it is assumed there is a connection between smooth muscle tone and growth in the prostate, but any molecular basis for this is poorly understood. Here, we examined effects of Src family kinase (SFK) inhibitors on prostate contraction and growth of stromal cells. Experimental Approach SFK inhibitors, AZM475271 and PP2, were applied to human prostate tissues to assess effects on smooth muscle contraction, and to cultured stromal (WPMY‐1) and c‐Src‐deficient cells to examine effects on proliferation, actin organization and viability. Key Results SFKs were detected by real time PCR, western blot and immunofluorescence in human prostate tissues, some being located to smooth muscle cells. AZM475271 (10 μM) and PP2 (10 μM) inhibited SFK in prostate tissues and WPMY‐1 cells. Both inhibitors reduced α1‐adrenoceptor‐mediated and neurogenic contraction of prostate strips. This may result from cytoskeletal deorganization, which was observed in response to AZM475271 and PP2 in WPMY‐1 cells by staining of actin filaments with phalloidin. This was paralleled by reduced proliferation of wildtype but not of c‐Src‐deficient cells; cytotoxicity was mainly observed at higher concentrations (>50 μM). Conclusions and Implications In human prostate, smooth muscle tone and growth are both controlled by an SFK‐dependent process, which may explain their common role in bladder outlet obstruction. Targeting prostate smooth muscle tone and prostate growth simultaneously by a single compound may, in principal, be possible. PMID:27638545

Progesterone receptor expression during prostate cancer progression suggests a role of this receptor in stromal cell differentiation.

PubMed

Yu, Yue; Yang, Ou; Fazli, Ladan; Rennie, Paul S; Gleave, Martin E; Dong, Xuesen

2015-07-01

The progesterone receptor, like the androgen receptor, belongs to the steroid receptor superfamily. Our previous studies have reported that the PR is expressed specifically in prostate stroma. PR inhibits proliferation of, and regulates cytokine secretion by stromal cells. However, PR protein expression in cancer-associated stroma during prostate cancer progression has not been profiled. Since the phenotypes of prostate stromal cells change dynamically as tumors progress, whether the PR plays a role in regulating stromal cell differentiation needs to be investigated. Immunohistochemistry assays measured PR protein levels on human prostate tissue microarrays containing 367 tissue cores from benign prostate, prostate tumors with different Gleason scores, tumors under various durations of castration therapy, and tumors at the castration-resistant stage. Immunoblotting assays determined whether PR regulated the expression of alpha smooth muscle actin (α-SMA), vimentin, and fibroblast specific protein (FSP) in human prostate stromal cells. PR protein levels decreased in cancer-associated stroma when compared with that in benign prostate stroma. This reduction in PR expression was not correlated with Gleason scores. PR protein levels were elevated by castration therapy, but reduced to pre-castration levels when tumors progressed to the castration-resistant stage. Enhanced PR expression in human prostate stromal cells increased α-SMA, but decreased vimentin and FSP protein levels ligand-independently. These results suggest that PR plays an active role in regulating stromal cell phenotypes during prostate cancer progression. © 2015 Wiley Periodicals, Inc.

Investigation of c-KIT and Ki67 expression in normal, preneoplastic and neoplastic canine prostate.

PubMed

Fonseca-Alves, Carlos Eduardo; Kobayashi, Priscilla Emiko; Palmieri, Chiara; Laufer-Amorim, Renée

2017-12-06

c-KIT expression has been related to bone metastasis in human prostate cancer, but whether c-KIT expression can be similarly classified in canine prostatic tissue is unknown. This study assessed c-KIT and Ki67 expression in canine prostate cancer (PC). c-KIT gene and protein expression and Ki67 expression were evaluated in forty-four canine prostatic tissues by immunohistochemistry, RT-qPCR and western blot. Additionally, we have investigated c-KIT protein expression by immunoblotting in two primary canine prostate cancer cell lines. Eleven normal prostates, 12 proliferative inflammatory atrophy (PIA) prostates, 18 PC, 3 metastatic lesions and two prostate cancer cell cultures (PC1 and PC2) were analysed. The prostatic tissue exhibited varying degrees of membranous, cytoplasmic or membranous/cytoplasmic c-KIT staining. Four normal prostates, 4 PIA and 5 prostatic carcinomas showed positive c-KIT expression. No c-KIT immunoexpression was observed in metastases. Canine prostate cancer and PIA samples contained a higher number of Ki67-positive cells compared to normal samples. The median relative quantification (RQ) for c-KIT expression in normal, PIA and prostate cancer and metastatic samples were 0.6 (0.1-2.5), 0.7 (0.09-2.1), 0.7 (0.09-5.1) and 0.1 (0.07-0.6), respectively. A positive correlation between the number of Ki67-positive cells and c-KIT transcript levels was observed in prostate cancer samples. In the cell line, PC1 was negative for c-KIT protein expression, while PC2 was weakly positive. The present study identified a strong correlation between c-KIT expression and proliferative index, suggesting that c-KIT may influence cell proliferation. Therefore, c-KIT heterogeneous protein expression among the samples (five positive and thirteen negative prostate cancer samples) indicates a personalized approach for canine prostate cancer.

Contribution of Adipose Tissue to Development of Cancer

PubMed Central

Cozzo, Alyssa J.; Fuller, Ashley M.; Makowski, Liza

2018-01-01

Solid tumor growth and metastasis require the interaction of tumor cells with the surrounding tissue, leading to a view of tumors as tissue-level phenomena rather than exclusively cell-intrinsic anomalies. Due to the ubiquitous nature of adipose tissue, many types of solid tumors grow in proximate or direct contact with adipocytes and adipose-associated stromal and vascular components, such as fibroblasts and other connective tissue cells, stem and progenitor cells, endothelial cells, innate and adaptive immune cells, and extracellular signaling and matrix components. Excess adiposity in obesity both increases risk of cancer development and negatively influences prognosis in several cancer types, in part due to interaction with adipose tissue cell populations. Herein, we review the cellular and noncellular constituents of the adipose “organ,” and discuss the mechanisms by which these varied microenvironmental components contribute to tumor development, with special emphasis on obesity. Due to the prevalence of breast and prostate cancers in the United States, their close anatomical proximity to adipose tissue depots, and their complex epidemiologic associations with obesity, we particularly highlight research addressing the contribution of adipose tissue to the initiation and progression of these cancer types. Obesity dramatically modifies the adipose tissue microenvironment in numerous ways, including induction of fibrosis and angiogenesis, increased stem cell abundance, and expansion of proinflammatory immune cells. As many of these changes also resemble shifts observed within the tumor microenvironment, proximity to adipose tissue may present a hospitable environment to developing tumors, providing a critical link between adiposity and tumorigenesis. PMID:29357128

Androgen Receptor Expression in Epithelial and Stromal Cells of Prostatic Carcinoma and Benign Prostatic Hyperplasia.

PubMed

Filipovski, Vanja; Kubelka-Sabit, Katerina; Jasar, Dzengis; Janevska, Vesna

2017-08-15

Prostatic carcinoma (PCa) derives from prostatic epithelial cells. However stromal microenvironment, associated with malignant epithelium, also plays a role in prostatic carcinogenesis. Alterations in prostatic stromal cells contribute to the loss of growth control in epithelial cells that lead to progression of PCa. To analyse the differences between Androgen Receptor (AR) expression in both epithelial and stromal cells in PCa and the surrounding benign prostatic hyperplasia (BPH) and to compare the results with tumour grade. Samples from 70 cases of radical prostatectomy specimens were used. The expression and intensity of the signal for AR was analysed in the epithelial and stromal cells of PCa and BPH, and the data was quantified using histological score (H-score). AR showed significantly lower expression in both epithelial and stromal cells of PCa compared to BPH. In PCa a significant positive correlation of AR expression was found between stromal and epithelial cells of PCa. AR expression showed a correlation between the stromal cells of PCa and tumour grade. AR expression is reduced in epithelial and stromal cells of PCa. Expression of AR in stromal cells of PCa significantly correlates with tumour grade.

Gastrin-releasing peptide receptor (GRPr) promotes EMT, growth, and invasion in canine prostate cancer.

PubMed

Elshafae, Said M; Hassan, Bardes B; Supsavhad, Wachiraphan; Dirksen, Wessel P; Camiener, Rachael Y; Ding, Haiming; Tweedle, Michael F; Rosol, Thomas J

2016-06-01

The gastrin-releasing peptide receptor (GRPr) is upregulated in early and late-stage human prostate cancer (PCa) and other solid tumors of the mammary gland, lung, head and neck, colon, uterus, ovary, and kidney. However, little is known about its role in prostate cancer. This study examined the effects of a heterologous GRPr agonist, bombesin (BBN), on growth, motility, morphology, gene expression, and tumor phenotype of an osteoblastic canine prostate cancer cell line (Ace-1) in vitro and in vivo. The Ace-1 cells were stably transfected with the human GRPr and tumor cells were grown in vitro and as subcutaneous and intratibial tumors in nude mice. The effect of BBN was measured on cell proliferation, cell migration, tumor growth (using bioluminescence), tumor cell morphology, bone tumor phenotype, and epithelial-mesenchymal transition (EMT) and metastasis gene expression (quantitative RT-PCR). GRPr mRNA expression was measured in primary canine prostate cancers and normal prostate glands. Bombesin (BBN) increased tumor cell proliferation and migration in vitro and tumor growth and invasion in vivo. BBN upregulated epithelial-to-mesenchymal transition (EMT) markers (TWIST, SNAIL, and SLUG mRNA) and downregulated epithelial markers (E-cadherin and β-catenin mRNA), and modified tumor cell morphology to a spindle cell phenotype. Blockade of GRPr upregulated E-cadherin and downregulated VIMENTIN and SNAIL mRNA. BBN altered the in vivo tumor phenotype in bone from an osteoblastic to osteolytic phenotype. Primary canine prostate cancers had increased GRPr mRNA expression compared to normal prostates. These data demonstrated that the GRPr is important in prostate cancer growth and progression and targeting GRPr may be a promising strategy for treatment of prostate cancer. Prostate 76:796-809, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Oncogenic LINE-1 Retroelements Sustain Prostate Tumor Cells and Promote Metastatic Progression

DTIC Science & Technology

2015-10-01

elements in prostate cancer contribute to its progression by activating oncogenic DNA sequences, or silencing tumor suppressor like sequences. We have...prostate cancer cells. Experiments are ongoing to determine if PIWIL-1 expression in prostate cancer cells will reduce their growth, thereby providing...proof of principle for future gene-based therapeutics for this cancer . 15. SUBJECT TERMS Prostate cancer , LINE-1, PIWIL-1, retrotransposons 16

Intracrine prostaglandin E2 pro-tumoral actions in prostate epithelial cells originate from non-canonical pathways.

PubMed

Madrigal-Martínez, Antonio; Fernández-Martínez, Ana B; Lucio Cazaña, Francisco J

2018-04-01

Prostaglandin E 2 (PGE 2 ) increases cell proliferation and stimulates migratory and angiogenic abilities in prostate cancer cells. However, the effects of PGE 2 on non-transformed prostate epithelial cells are unknown, despite the fact that PGE 2 overproduction has been found in benign hyperplastic prostates. In the present work we studied the effects of PGE 2 in immortalized, non-malignant prostate epithelial RWPE-1 cells and found that PGE 2 increased cell proliferation, cell migration, and production of vascular endothelial growth factor-A, and activated in vitro angiogenesis. These actions involved a non-canonic intracrine mechanism in which the actual effector was intracellular PGE 2 (iPGE 2 ) instead of extracellular PGE 2 : inhibition of the prostaglandin uptake transporter (PGT) or antagonism of EP receptors prevented the effects of PGE 2 , which indicated that PGE 2 activity depended on its carrier-mediated translocation from the outside to the inside of cells and that EP receptors located intracellularly (iEP) mediated the effects of PGE 2 . iPGE 2 acted through transactivation of epidermal growth factor-receptor (EGFR) by iEP, leading to increased expression and activity of hypoxia-inducible factor-1α (HIF-1α). Interestingly, iPGE 2 also mediates the effects of PGE 2 on prostate cancer PC3 cells through the axis iPGE 2 -iEP receptors-EGFR-HIF-1α. Thus, this axis might be responsible for the growth-stimulating effects of PGE 2 on prostate epithelial cells, thereby contributing to prostate proliferative diseases associated with chronic inflammation. Since this PGT-dependent non-canonic intracrine mechanism of PGE 2 action operates in both benign and malignant prostate epithelial cells, PGT inhibitors should be tested as a novel therapeutic modality to treat prostate proliferative disease. © 2017 Wiley Periodicals, Inc.

Effects of Fluid Shear Stress on Cancer Stem Cell Viability

NASA Astrophysics Data System (ADS)

Sunday, Brittney; Triantafillu, Ursula; Domier, Ria; Kim, Yonghyun

2014-11-01

Cancer stem cells (CSCs), which are believed to be the source of tumor formation, are exposed to fluid shear stress as a result of blood flow within the blood vessels. It was theorized that CSCs would be less susceptible to cell death than non-CSCs after both types of cell were exposed to a fluid shear stress, and that higher levels of fluid shear stress would result in lower levels of cell viability for both cell types. To test this hypothesis, U87 glioblastoma cells were cultured adherently (containing smaller populations of CSCs) and spherically (containing larger populations of CSCs). They were exposed to fluid shear stress in a simulated blood flow through a 125-micrometer diameter polyetheretherketone (PEEK) tubing using a syringe pump. After exposure, cell viability data was collected using a BioRad TC20 Automated Cell Counter. Each cell type was tested at three physiological shear stress values: 5, 20, and 60 dynes per centimeter squared. In general, it was found that the CSC-enriched U87 sphere cells had higher cell viability than the CSC-depleted U87 adherent cancer cells. Interestingly, it was also observed that the cell viability was not negatively affected by the higher fluid shear stress values in the tested range. In future follow-up studies, higher shear stresses will be tested. Furthermore, CSCs from different tumor origins (e.g. breast tumor, prostate tumor) will be tested to determine cell-specific shear sensitivity. National Science Foundation Grant #1358991 supported the first author as an REU student.

Withanolides from the stems and leaves of Physalis pubescens and their cytotoxic activity.

PubMed

Xia, Guiyang; Li, Yang; Sun, Jiawen; Wang, Liqing; Tang, Xiaolong; Lin, Bin; Kang, Ning; Huang, Jian; Chen, Lixia; Qiu, Feng

2016-11-01

A phytochemical study of Physalis pubescens L. afforded twelve compounds, including six new withanolides (1, 4, and 6i-9), four new withanolide glucosides (2, 3, 5, and 6), and two known withanolides (10 and 11). Their structures were established via extensive spectroscopic analysis. The absolute configuration of 3 was assigned using X-ray crystallography, and the absolute configurations of the 1,2-diol moiety in 1 were determined using the in situ dimolybdenum electronic circular dichroism method. Compounds 7, 9, and 10 exhibited significant cytotoxicity against human prostate cancer cells (C4-2B and 22Rvl), human renal carcinoma cells (786-O, A-498, Caki-2, and ACHN), human melanoma cells (A375 and A375-S2), and human normal hepatic cell line (L02) with IC 50 values in the range of 0.17-5.30μM. Copyright © 2016 Elsevier Inc. All rights reserved.

EphA2 enhances the proliferation and invasion ability of LNCaP prostate cancer cells.

PubMed

Chen, Peijie; Huang, Yan; Zhang, Bo; Wang, Qiuquan; Bai, Peiming

2014-07-01

EphA2 is persistently overexpressed and functionally changed in numerous human cancers. However, to the best of our knowledge, the role that EphA2 plays in prostate cancer is not entirely clear. To investigate the roles of EphA2 in the development and progression of prostate cancer, the present study initially evaluated the roles of the EphA2 protein in LNCaP prostate cancer cells using recombinant plasmid, western blot analysis, flow cytometry, Matrigel invasion chamber and the cell counting kit-8 assay. An immunohistochemistry assay was also conducted to observe the effects of EphA2 in prostate cancer tissues. The results demonstrated that the LNCaP human prostate cancer cells that were transfected with pcDNA3.1(+) plasmid-mediated pcDNA3.1(+)-EphA2, markedly enhanced the cell growth and invasion in vitro . Additionally, EphA2 was overexpressed in prostate cancer specimens and the expression of EphA2 was significantly associated with Gleason grade, total prostate-specific antigen, advanced clinical stage and lymph node metastasis. Collectively, these results demonstrate that EphA2 is involved in malignant cell behavior and is a potential therapeutic target in human prostate cancer.

Differential expression and regulation of vitamin D hydroxylases and inflammatory genes in prostate stroma and epithelium by 1,25-dihydroxyvitamin D in men with prostate cancer and an in vitro model.

PubMed

Giangreco, Angeline A; Dambal, Shweta; Wagner, Dennis; Van der Kwast, Theodorus; Vieth, Reinhold; Prins, Gail S; Nonn, Larisa

2015-04-01

Previous work on vitamin D in the prostate has focused on the prostatic epithelium, from which prostate cancer arises. Prostatic epithelial cells are surrounded by stroma, which has well-established regulatory control over epithelial proliferation, differentiation, and the inflammatory response. Here we examined the regulation of vitamin D-related genes and inflammatory genes by 1α,25-dihydroxyvitamin D3 (1,25(OH)2D) in laser-capture microdissected prostate tissue from a vitamin D3 clinical trial and in an in vitro model that facilitates stromal-epithelial crosstalk. Analysis of the trial tissues showed that VDR was present in both cell types, whereas expression of the hydroxylases was the highest in the epithelium. Examination of gene expression by prostatic (1,25(OH)2D) concentrations showed that VDR was significantly lower in prostate tissues with the highest concentration of 1,25(OH)2D, and down-regulation of VDR by 1,25(OH) 2D was confirmed in the primary cell cultures. Analysis of inflammatory genes in the patient tissues revealed that IL-6 expression was the highest in the prostate stroma while PTGS2 (COX2) levels were lowest in the prostate cancer tissues from men in the highest tertile of prostatic 1,25(OH)2D. In vitro, TNF-α, IL-6 and IL-8 were suppressed by 1,25 (OH)2D in the primary epithelial cells, whereas TNF-α and PTGS2 were suppressed by 1,25(OH) 2D in the stromal cells. Importantly, the ability of 1,25(OH)2D to alter pro-inflammatory-induced changes in epithelial cell growth were dependent on the presence of the stromal cells. In summary, whereas both stromal and epithelial cells of the prostate express VDR and can presumably respond to 1,25(OH)2D, the prostatic epithelium appears to be the main producer of 1,25(OH)2D. Further, while the prostate epithelium was more responsive to the anti-inflammatory activity of 1,25 (OH)2D than stromal cells, stroma-epithelial crosstalk enhanced the phenotypic effects of 1,25(OH)2D and the inflammatory process in the prostate gland. Copyright © 2014 Elsevier Ltd. All rights reserved.

Overcoming Drug Resistant Prostate Cancer with APE1/Ref 1 Blockade

DTIC Science & Technology

2016-10-01

prostate cancer specimens. Genetic knockdown of APE1/Ref-1 disrupts prostate cancer cell growth and survival in cell culture. In addition...inhibition of the redox function selectively of Ref-1 results in cell growth inhibition, with this therapy preferentially inhibiting prostate cancer cell... growth above that in non-cancerous cells. Specific blockade of Ref-1 redox activity in tumors is a novel concept in tumor therapy. If we are successful

Influence of zinc deficiency on AKT-MDM2-P53 signaling axes in normal and malignant human prostate cells

USDA-ARS?s Scientific Manuscript database

With prostate being the highest zinc-accumulating tissue before the onset of cancer, the effects of physiologic levels of zinc on Akt-Mdm2-p53 and Akt-p21 signaling axes in human normal prostate epithelial cells (PrEC) and malignant prostate LNCaP cells were examined. Cells were cultured for 6 d in...

Glycosylation potential of human prostate cancer cell lines

PubMed Central

Gao, Yin; Chachadi, Vishwanath B.; Cheng, Pi-Wan

2014-01-01

Altered glycosylation is a universal feature of cancer cells and altered glycans can help cancer cells escape immune surveillance, facilitate tumor invasion, and increase malignancy. The goal of this study was to identify specific glycoenzymes, which could distinguish prostate cancer cells from normal prostatic cells. We investigated enzymatic activities and gene expression levels of key glycosyl- and sulfotransferases responsible for the assembly of O- and N-glycans in several prostatic cells. These cells included immortalized RWPE-1 cells derived from normal prostatic tissues, and prostate cancer cells derived from metastasis in bone (PC-3), brain (DU145), lymph node (LNCaP), and vertebra (VCaP). We found that all cells were capable of synthesizing complex N-glycans and O-glycans with the core 1 structure, and each cell line had characteristic bio-synthetic pathways to modify these structures. The in vitro measured activities corresponded well to the mRNA levels of glycosyltransferases and sulfotransferases. Lectin and antibody binding to whole cells supported these results, which form the basis for the development of tumor cell-specific targeting strategies. PMID:22843320

Androgen receptor-negative human prostate cancer cells induce osteogenesis in mice through FGF9-mediated mechanisms.

PubMed

Li, Zhi Gang; Mathew, Paul; Yang, Jun; Starbuck, Michael W; Zurita, Amado J; Liu, Jie; Sikes, Charles; Multani, Asha S; Efstathiou, Eleni; Lopez, Adriana; Wang, Jing; Fanning, Tina V; Prieto, Victor G; Kundra, Vikas; Vazquez, Elba S; Troncoso, Patricia; Raymond, Austin K; Logothetis, Christopher J; Lin, Sue-Hwa; Maity, Sankar; Navone, Nora M

2008-08-01

In prostate cancer, androgen blockade strategies are commonly used to treat osteoblastic bone metastases. However, responses to these therapies are typically brief, and the mechanism underlying androgen-independent progression is not clear. Here, we established what we believe to be the first human androgen receptor-negative prostate cancer xenografts whose cells induced an osteoblastic reaction in bone and in the subcutis of immunodeficient mice. Accordingly, these cells grew in castrated as well as intact male mice. We identified FGF9 as being overexpressed in the xenografts relative to other bone-derived prostate cancer cells and discovered that FGF9 induced osteoblast proliferation and new bone formation in a bone organ assay. Mice treated with FGF9-neutralizing antibody developed smaller bone tumors and reduced bone formation. Finally, we found positive FGF9 immunostaining in prostate cancer cells in 24 of 56 primary tumors derived from human organ-confined prostate cancer and in 25 of 25 bone metastasis cases studied. Collectively, these results suggest that FGF9 contributes to prostate cancer-induced new bone formation and may participate in the osteoblastic progression of prostate cancer in bone. Androgen receptor-null cells may contribute to the castration-resistant osteoblastic progression of prostate cancer cells in bone and provide a preclinical model for studying therapies that target these cells.

Androgen receptor–negative human prostate cancer cells induce osteogenesis in mice through FGF9-mediated mechanisms

PubMed Central

Li, Zhi Gang; Mathew, Paul; Yang, Jun; Starbuck, Michael W.; Zurita, Amado J.; Liu, Jie; Sikes, Charles; Multani, Asha S.; Efstathiou, Eleni; Lopez, Adriana; Wang, Jing; Fanning, Tina V.; Prieto, Victor G.; Kundra, Vikas; Vazquez, Elba S.; Troncoso, Patricia; Raymond, Austin K.; Logothetis, Christopher J.; Lin, Sue-Hwa; Maity, Sankar; Navone, Nora M.

2008-01-01

In prostate cancer, androgen blockade strategies are commonly used to treat osteoblastic bone metastases. However, responses to these therapies are typically brief, and the mechanism underlying androgen-independent progression is not clear. Here, we established what we believe to be the first human androgen receptor–negative prostate cancer xenografts whose cells induced an osteoblastic reaction in bone and in the subcutis of immunodeficient mice. Accordingly, these cells grew in castrated as well as intact male mice. We identified FGF9 as being overexpressed in the xenografts relative to other bone-derived prostate cancer cells and discovered that FGF9 induced osteoblast proliferation and new bone formation in a bone organ assay. Mice treated with FGF9-neutralizing antibody developed smaller bone tumors and reduced bone formation. Finally, we found positive FGF9 immunostaining in prostate cancer cells in 24 of 56 primary tumors derived from human organ-confined prostate cancer and in 25 of 25 bone metastasis cases studied. Collectively, these results suggest that FGF9 contributes to prostate cancer–induced new bone formation and may participate in the osteoblastic progression of prostate cancer in bone. Androgen receptor–null cells may contribute to the castration-resistant osteoblastic progression of prostate cancer cells in bone and provide a preclinical model for studying therapies that target these cells. PMID:18618013

Adoptive Immunotherapy Combined with Hematopoietic Cell Transplantation as a Therapeutic Approach to Treatment of Prostate Cancer

DTIC Science & Technology

2008-10-01

NOTES 14. ABSTRACT We determined that cell lysates prepared from canine prostate tissue was immunogenic when injected in female dogs. In addition...to the known prostate antigen, canine prostate specific esterase (CPSE), we identified by molecular weight several other proteins against which the...appeared to be superior to prostate lysate antigen-loaded canine autologous dendritic cells when both were injected subcutaneously near the popliteal lymph

Involvement of Novel Multifunction Steroid Hormone Receptor Coactivator, E6-Associated Protein, in Prostate Gland Tumorigenesis

DTIC Science & Technology

2009-01-01

HPV infection in cervical carcinoma cells . However, this effect is E6 dependent, as p53 could only be degraded by the formation of E6 and E6-AP...and prostate cancer cell proliferation. E6-AP by itself can modulate p53 levels in prostate cancer cells independent of E6. Our data also indicates...p53 levels in prostate glands and prostate cancer cells : E6-AP was initially identified as an E3 ligase which promotes the degradation of p53 during

Protocols for Migration and Invasion Studies in Prostate Cancer.

PubMed

van de Merbel, Arjanneke F; van der Horst, Geertje; Buijs, Jeroen T; van der Pluijm, Gabri

2018-01-01

Prostate cancer is the most common malignancy diagnosed in men in the western world. The development of distant metastases and therapy resistance are major clinical problems in the management of prostate cancer patients. In order for prostate cancer to metastasize to distant sites in the human body, prostate cancer cells have to migrate and invade neighboring tissue. Cancer cells can acquire a migratory and invasive phenotype in several ways, including single cell and collective migration. As a requisite for migration, epithelial prostate cancer cells often need to acquire a motile, mesenchymal-like phenotype. This way prostate cancer cells often lose polarity and epithelial characteristics (e.g., expression of E-cadherin homotypic adhesion receptor), and acquire mesenchymal phenotype (for example, cytoskeletal rearrangements, enhanced expression of proteolytic enzymes and other repertory of integrins). This process is referred to as epithelial-to-mesenchymal transition (EMT). Cellular invasion, one of the hallmarks of cancer, is characterized by the movement of cells through a three-dimensional matrix, resulting in remodeling of the cellular environment. Cellular invasion requires adhesion, proteolysis of the extracellular matrix, and migration of cells. Studying the migratory and invasive ability of cells in vitro represents a useful tool to assess the aggressiveness of solid cancers, including those of the prostate.This chapter provides a comprehensive description of the Transwell migration assay, a commonly used technique to investigate the migratory behavior of prostate cancer cells in vitro. Furthermore, we will provide an overview of the adaptations to the Transwell migration protocol to study the invasive capacity of prostate cancer cells, i.e., the Transwell invasion assay. Finally, we will present a detailed description of the procedures required to stain the Transwell filter inserts and quantify the migration and/or invasion.

Therapeutic targeting of SPINK1-positive prostate cancer.

PubMed

Ateeq, Bushra; Tomlins, Scott A; Laxman, Bharathi; Asangani, Irfan A; Cao, Qi; Cao, Xuhong; Li, Yong; Wang, Xiaoju; Feng, Felix Y; Pienta, Kenneth J; Varambally, Sooryanarayana; Chinnaiyan, Arul M

2011-03-02

Gene fusions involving ETS (erythroblastosis virus E26 transformation-specific) family transcription factors are found in ~50% of prostate cancers and as such can be used as a basis for the molecular subclassification of prostate cancer. Previously, we showed that marked overexpression of SPINK1 (serine peptidase inhibitor, Kazal type 1), which encodes a secreted serine protease inhibitor, defines an aggressive molecular subtype of ETS fusion-negative prostate cancers (SPINK1+/ETS⁻, ~10% of all prostate cancers). Here, we examined the potential of SPINK1 as an extracellular therapeutic target in prostate cancer. Recombinant SPINK1 protein (rSPINK1) stimulated cell proliferation in benign RWPE as well as cancerous prostate cells. Indeed, RWPE cells treated with either rSPINK1 or conditioned medium from 22RV1 prostate cancer cells (SPINK1+/ETS⁻) significantly increased cell invasion and intravasation when compared with untreated cells. In contrast, knockdown of SPINK1 in 22RV1 cells inhibited cell proliferation, cell invasion, and tumor growth in xenograft assays. 22RV1 cell proliferation, invasion, and intravasation were attenuated by a monoclonal antibody (mAb) to SPINK1 as well. We also demonstrated that SPINK1 partially mediated its neoplastic effects through interaction with the epidermal growth factor receptor (EGFR). Administration of antibodies to SPINK1 or EGFR (cetuximab) in mice bearing 22RV1 xenografts attenuated tumor growth by more than 60 and 40%, respectively, or ~75% when combined, without affecting PC3 xenograft (SPINK1⁻/ETS⁻) growth. Thus, this study suggests that SPINK1 may be a therapeutic target in a subset of patients with SPINK1+/ETS⁻ prostate cancer. Our results provide a rationale for both the development of humanized mAbs to SPINK1 and evaluation of EGFR inhibition in SPINK1+/ETS⁻ prostate cancers.

SSeCKS/AKAP12 induces repulsion between human prostate cancer and microvessel endothelial cells through the activation of Semaphorin 3F.

PubMed

Xie, Wen; Su, Wei; Zhang, Lijuan; Shang, Qingkun; Su, Bing

2017-09-02

Metastasis remains the primary cause of prostate cancer related death. Cancer cells need to contact endothelial cells and disrupt endothelial junctions to cross the endothelium for invasion and metastasis. The suppression of heterotypic repulsion between cancer and endothelial cells allows cancer cells to invade into the surrounding tissue. Here, we demonstrate that SSeCKS/AKAP12 induced repulsion between human prostate cancer and microvessel endothelial cells, which was mediated by an angiogenesis inhibitor Semaphorin 3F. Moreover, we examined AKAP12 and Semaphorin 3F mRNA expression in 42 prostate cancer and 30 benign prostatic hyperplasia tissue samples, and found that the expression of AKAP12 and Semaphorin 3F mRNA was inversely associated with the degree of aggressiveness of prostate cancer cells and tissues. An ordinal logistic regression analysis indicates that there is a positive association between the expression of AKAP12 and Semaphorin 3F in prostate cancer, suggesting that the activation of Semaphorin 3F by SSeCKS/AKAP12 may be involved in prostate cancer progression and metastasis. Copyright © 2017 Elsevier Inc. All rights reserved.

Activation of β-catenin signaling in androgen receptor-negative prostate cancer cells.

PubMed

Wan, Xinhai; Liu, Jie; Lu, Jing-Fang; Tzelepi, Vassiliki; Yang, Jun; Starbuck, Michael W; Diao, Lixia; Wang, Jing; Efstathiou, Eleni; Vazquez, Elba S; Troncoso, Patricia; Maity, Sankar N; Navone, Nora M

2012-02-01

To study Wnt/β-catenin in castrate-resistant prostate cancer (CRPC) and understand its function independently of the β-catenin-androgen receptor (AR) interaction. We carried out β-catenin immunocytochemical analysis, evaluated TOP-flash reporter activity (a reporter of β-catenin-mediated transcription), and sequenced the β-catenin gene in MDA prostate cancer 118a, MDA prostate cancer 118b, MDA prostate cancer 2b, and PC-3 prostate cancer cells. We knocked down β-catenin in AR-negative MDA prostate cancer 118b cells and carried out comparative gene-array analysis. We also immunohistochemically analyzed β-catenin and AR in 27 bone metastases of human CRPCs. β-Catenin nuclear accumulation and TOP-flash reporter activity were high in MDA prostate cancer 118b but not in MDA prostate cancer 2b or PC-3 cells. MDA prostate cancer 118a and MDA prostate cancer 118b cells carry a mutated β-catenin at codon 32 (D32G). Ten genes were expressed differently (false discovery rate, 0.05) in MDA prostate cancer 118b cells with downregulated β-catenin. One such gene, hyaluronan synthase 2 (HAS2), synthesizes hyaluronan, a core component of the extracellular matrix. We confirmed HAS2 upregulation in PC-3 cells transfected with D32G-mutant β-catenin. Finally, we found nuclear localization of β-catenin in 10 of 27 human tissue specimens; this localization was inversely associated with AR expression (P = 0.056, Fisher's exact test), suggesting that reduced AR expression enables Wnt/β-catenin signaling. We identified a previously unknown downstream target of β-catenin, HAS2, in prostate cancer, and found that high β-catenin nuclear localization and low or no AR expression may define a subpopulation of men with bone metastatic prostate cancer. These findings may guide physicians in managing these patients.

Identification of miR-133b and RB1CC1 as independent predictors for biochemical recurrence and potential therapeutic targets for prostate cancer.

PubMed

Li, Xia; Wan, Xuechao; Chen, Hongbing; Yang, Shu; Liu, Yiyang; Mo, Wenjuan; Meng, Delong; Du, Wenting; Huang, Yan; Wu, Hai; Wang, Jingqiang; Li, Tao; Li, Yao

2014-05-01

We aimed to investigate the contribution of microRNA-133b (miR-133b) in prostate cancer cell proliferation, cell cycle, and apoptosis. We also examined expression of miR-133b in prostate cancer tissues, and evaluated the prognostic significance of miR-133b, as well as its target gene RB1CC1 in patients with prostate cancer after radical prostatectomy. miR-133b mimics (miR-133bm) and anti-miR-133b were transfected into LNCaP and PC-3 cells. CCK-8 was used to look at cell proliferation, flow cytometric analysis was carried out to study cell cycle, and apoptosis was determined by caspase-3 activity. miR-133b expression was assessed by real-time reverse transcription PCR and in situ hybridization in prostatic cell lines and 178 prostate tissue samples, respectively. The protein level of RB1CC1 was examined by Western blot and immunohistochemistry in prostatic cell lines and prostate tissue samples, respectively. Overexpression of miR-133b in LNCaP cells boosted cell proliferation and cell-cycle progression, but inhibited apoptosis; in contrast, miR-133bm promoted cell apoptosis, but suppressed cell proliferation and cell-cycle progression in PC-3 cells. In LNCaP cells, silencing of RB1CC1, a target of miR-133b, inhibited cell apoptosis, and promoted cell-cycle progression. Moreover, miR-133b expression was significantly inversely correlated with RB1CC1 expression in prostate cancer tissues. Multivariate Cox analysis indicated that miR-133b and RB1CC1 might be two independent prognostic factors of biochemical recurrence. miR-133b might enhance tumor-promoting properties in less aggressive LNCaP cells, whereas this miR may act as a tumor suppressor in more aggressive PC-3 cells. miR-133b and RB1CC1 were independent prognostic indicators for prostate cancer. ©2014 AACR.

Cytokeratin characterization of human prostatic carcinoma and its derived cell lines.

PubMed

Nagle, R B; Ahmann, F R; McDaniel, K M; Paquin, M L; Clark, V A; Celniker, A

1987-01-01

Two murine monoclonal anti-cytokeratin antibodies with defined specificity were shown to distinguish between basal cells and luminal cells in human prostate tissue. Forty-one biopsies or transurethral resection specimens were characterized using these two antibodies. In cases of benign prostatic hyperplasia, focal loss of the basal cell layer was noted in areas of glandular proliferation. Ten cases of adenocarcinoma of the prostate, varying in Gleason's histological grade from 2 to 4, were also studied. In each case the carcinoma was shown to represent the luminal cell phenotype with no evidence of involvement of the basal cell phenotype. An analysis of three established metastatic prostatic carcinoma cell lines (DU-145, PC-3, and LNCaP) using two-dimensional electrophoresis showed that the cytokeratin complement of each cell line was slightly different but retained the phenotype of the luminal cell. It was concluded that during both hyperplasia and neoplastic transformation of the prostate, the luminal cell phenotype is primarily involved and that the basal cell phenotype does not appear to contribute to either intraluminal proliferation or invasive cell populations.

Virus Delivery of CRISPR Guides to the Murine Prostate for Gene Alteration.

PubMed

Riedel, Maria; Berthelsen, Martin F; Bakiri, Latifa; Wagner, Erwin F; Thomsen, Martin K

2018-04-27

With an increasing incidence of prostate cancer, identification of new tumor drivers or modulators is crucial. Genetically engineered mouse models (GEMM) for prostate cancer are hampered by tumor heterogeneity and its complex microevolution dynamics. Traditional prostate cancer mouse models include, amongst others, germline and conditional knockouts, transgenic expression of oncogenes, and xenograft models. Generation of de novo mutations in these models is complex, time-consuming, and costly. In addition, most of traditional models target the majority of the prostate epithelium, whereas human prostate cancer is well known to evolve as an isolated event in only a small subset of cells. Valuable models need to simulate not only prostate cancer initiation, but also progression to advanced disease. Here we describe a method to target a few cells in the prostate epithelium by transducing cells by viral particles. The delivery of an engineered virus to the murine prostate allows alteration of gene expression in the prostate epithelia. Virus type and quantity will hereby define the number of targeted cells for gene alteration by transducing a few cells for cancer initiation and many cells for gene therapy. Through surgery-based injection in the anterior lobe, distal from the urinary track, the tumor in this model can expand without impairing the urinary function of the animal. Furthermore, by targeting only a subset of prostate epithelial cells the technique enables clonal expansion of the tumor, and therefore mimics human tumor initiation, progression, as well as invasion through the basal membrane. This novel technique provides a powerful prostate cancer model with improved physiological relevance. Animal suffering is limited, and since no additional breeding is required, overall animal count is reduced. At the same time, analysis of new candidate genes and pathways is accelerated, which in turn is more cost efficient.

Prostate-specific membrane antigen-targeted liposomes specifically deliver the Zn(2+) chelator TPEN inducing oxidative stress in prostate cancer cells.

PubMed

Stuart, Christopher H; Singh, Ravi; Smith, Thomas L; D'Agostino, Ralph; Caudell, David; Balaji, K C; Gmeiner, William H

2016-05-01

To evaluate the potential use of zinc chelation for prostate cancer therapy using a new liposomal formulation of the zinc chelator, N,N,N',N'-tetrakis(2-pyridylmethyl)-ethylenediamine (TPEN). TPEN was encapsulated in nontargeted liposomes or liposomes displaying an aptamer to target prostate cancer cells overexpression prostate-specific membrane antigen. The prostate cancer selectivity and therapeutic efficacy of liposomal (targeted and nontargeted) and free TPEN were evaluated in vitro and in tumor-bearing mice. TPEN chelates zinc and results in reactive oxygen species imbalance leading to cell death. Delivery of TPEN using aptamer-targeted liposomes results in specific delivery to targeted cells. In vivo experiments show that TPEN-loaded, aptamer-targeted liposomes reduce tumor growth in a human prostate cancer xenograft model.

Formononetin promotes cell cycle arrest via downregulation of Akt/Cyclin D1/CDK4 in human prostate cancer cells.

PubMed

Li, Tianyu; Zhao, Xinge; Mo, Zengnan; Huang, Weihua; Yan, Haibiao; Ling, Zhian; Ye, Yu

2014-01-01

Formononetin is an O-methylated isoflavone isolated from the root of Astragalus membranaceus. It has already been reported that formononetin could inhibit cell proliferation and induce cell apoptosis in several cancers, including prostate cancer. This study aimed to further investigate whether cell cycle arrest is involved in formononetin-mediated antitumor effect in human prostate cancer cells, along with the underlying molecular mechanism. Human prostate cancer cells PC-3 and DU145 were respectively treated with various concentrations of formononetin. The inhibitory effect of formononetin on proliferation of prostate cancer cells was determined using MTT assays and flow cytometry. Next, formononetin-induced alterations in cyclin D1, CDK4 and Akt expression in PC-3 cells were detected by real-time PCR and western blot. Formononetin dose-dependently inhibited prostate cancer cell proliferation via the induction of cell cycle arrest at G0/G1 phase in vitro, which was more evident in PC-3 cells. Meanwhile, concomitant with reduced phosphorylation of Akt in PC-3 cells, formononetin remarkably downregulated expression levels of cyclin D1 and CDK4 in a dose-dependent manner. More interestingly, in the in vivo studies, formononetin showed a noticeable inhibition of tumor growth in recipient mice. Formononetin could exhibit inhibitory activity against human prostate cancer cells in vivo and in vitro, which is associated with G1 cell cycle arrest by inactivation of Akt/cyclin D1/CDK4. Therefore, formononetin may be used as a candidate agent for clinical treatment of prostate cancer in the future.

Neurotensin is an autocrine trophic factor stimulated by androgen withdrawal in human prostate cancer.

PubMed Central

Sehgal, I; Powers, S; Huntley, B; Powis, G; Pittelkow, M; Maihle, N J

1994-01-01

After therapeutic hormone deprivation, prostate cancer cells often develop androgen-insensitive growth through mechanisms thus far undefined. Neuropeptides have been previously implicated as growth factors in some prostate cancers. Here, we demonstrate that androgen-sensitive LNCaP human prostate cancer cells produce and secrete neurotensin following androgen withdrawal. We show that while LNCaP cells express the neurotensin receptor, only androgen-deprived cells exhibit a growth response to exogenous neurotensin. We further demonstrate that androgen-stimulated cells may be refractory to exogenous neurotensin due to androgen induction of a metalloprotease active toward neurotensin. Thus, prostate cancer cells deprived of androgen develop an alternative autocrine growth mechanism involving neurotensin. Images PMID:8197117

EMMPRIN Regulates Cytoskeleton Reorganization and Cell Adhesion in Prostate Cancer

PubMed Central

Zhu, Haining; Zhao, Jun; Zhu, Beibei; Collazo, Joanne; Gal, Jozsef; Shi, Ping; Liu, Li; Ström, Anna-Lena; Lu, Xiaoning; McCann, Richard O.; Toborek, Michal; Kyprianou, Natasha

2011-01-01

Background Proteins on cell surface play important roles during cancer progression and metastasis via their ability to mediate cell-to-cell interactions and navigate the communication between cells and the microenvironment. Methods In this study a targeted proteomic analysis was conducted to identify the differential expression of cell surface proteins in human benign (BPH-1) vs. malignant (LNCaP and PC-3) prostate epithelial cells. We identified EMMPRIN (extracellular matrix metalloproteinase inducer) as a key candidate and shRNA functional approaches were subsequently applied to determine the role of EMMPRIN in prostate cancer cell adhesion, migration, invasion as well as cytoskeleton organization. Results EMMPRIN was found to be highly expressed on the surface of prostate cancer cells compared to BPH-1 cells, consistent with a correlation between elevated EMMPRIN and metastasis found in other tumors. No significant changes in cell proliferation, cell cycle progression or apoptosis were detected in EMMPRIN knockdown cells compared to the scramble controls. Furthermore, EMMPRIN silencing markedly decreased the ability of PC-3 cells to form filopodia, a critical feature of invasive behavior, while it increased expression of cell-cell adhesion and gap junction proteins. Conclusions Our results suggest that EMMPRIN regulates cell adhesion, invasion and cytoskeleton reorganization in prostate cancer cells. This study identifies a new function for EMMPRIN as a contributor to prostate cancer cell-cell communication and cytoskeleton changes towards metastatic spread, and suggests its potential value as a marker of prostate cancer progression to metastasis. PMID:21563192

EMMPRIN regulates cytoskeleton reorganization and cell adhesion in prostate cancer.

PubMed

Zhu, Haining; Zhao, Jun; Zhu, Beibei; Collazo, Joanne; Gal, Jozsef; Shi, Ping; Liu, Li; Ström, Anna-Lena; Lu, Xiaoning; McCann, Richard O; Toborek, Michal; Kyprianou, Natasha

2012-01-01

Proteins on cell surface play important roles during cancer progression and metastasis via their ability to mediate cell-to-cell interactions and navigate the communication between cells and the microenvironment. In this study a targeted proteomic analysis was conducted to identify the differential expression of cell surface proteins in human benign (BPH-1) versus malignant (LNCaP and PC-3) prostate epithelial cells. We identified EMMPRIN (extracellular matrix metalloproteinase inducer) as a key candidate and shRNA functional approaches were subsequently applied to determine the role of EMMPRIN in prostate cancer cell adhesion, migration, invasion as well as cytoskeleton organization. EMMPRIN was found to be highly expressed on the surface of prostate cancer cells compared to BPH-1 cells, consistent with a correlation between elevated EMMPRIN and metastasis found in other tumors. No significant changes in cell proliferation, cell cycle progression, or apoptosis were detected in EMMPRIN knockdown cells compared to the scramble controls. Furthermore, EMMPRIN silencing markedly decreased the ability of PC-3 cells to form filopodia, a critical feature of invasive behavior, while it increased expression of cell-cell adhesion and gap junction proteins. Our results suggest that EMMPRIN regulates cell adhesion, invasion, and cytoskeleton reorganization in prostate cancer cells. This study identifies a new function for EMMPRIN as a contributor to prostate cancer cell-cell communication and cytoskeleton changes towards metastatic spread, and suggests its potential value as a marker of prostate cancer progression to metastasis. Copyright © 2011 Wiley Periodicals, Inc.

Radiation Effects on the Immune Response to Prostate Cancer

DTIC Science & Technology

2008-02-01

as an alternative treatment since the discovery of prostate tumor-associated antigens (TAA) and of corresponding tumor-specific T cells in prostate...class I and co-stimulatory molecules, which could promote T cell filtration into tumors and T cell activation. On the other hand, we recently showed...immunotherapy (IT) has gained in popularity by finding some patients have specific T cell response to prostate tumor-associated antigens such as

[Overexpression of miR-519d-3p inhibits the proliferation of DU-145 prostate cancer cells by reducing TRAF4].

PubMed

Li, Xiaohui; Han, Xingtao; Yang, Jinhui; Sun, Jiantao; Wei, Pengtao

2018-01-01

Objective To observe the effect of microRNA-519d-3p (miR-519d-3p) on the proliferation of prostate cancer cells and explore the possible molecular mechanism. Methods The expression level of miR-519d-3p in PC-3, DU-145, 22RV1, PC-3M, LNCaP human prostate cancer cells and RWPE-1 human normal prostate epithelial cells was detected by real-time quantitative PCR. miR-519d-3p mimics or negative control microRNAs (miR-NC) was transfected into the prostate cancer cells with the lowest level of miR-519d-3p expression. Transfection efficiency was examined. The effect of miR-519d-3p on the cell cycle of prostate cancer was detected by flow cytometry. MTT assay and plate clone formation assay were used to detect its effect on the proliferation of prostate cancer cells. Bioinformatics software was used to predict and dual luciferase reporter assay was used to validate the target gene of miR-519d-3p. Real-time quantitative PCR was used to detect the expression of miR-519d-3p target gene. Western blot analysis was used to detect the expression of target gene protein and downstream protein. Results The expression of miR-519d-3p in normal prostate epithelial cells was significantly higher than that in prostate cancer cells, and the lowest was found in DU-145 cells. After transfected with miR-519d-3p mimics, the expression level of miR-519d-3p in DU-145 cells increased significantly. Bioinformatics prediction and dual luciferase reporter gene confirmed that tumor necrosis factor receptor associated factor 4 (TRAF4) was the target gene of miR-519d-3p. Overexpression of miR-519d-3p significantly reduced the expression of TRAF4 gene and its downstream TGF-β signaling pathway proteins in the prostate cancer cells. Conclusion The expression of miR-519d-3p is down-regulated in prostate cancer cells. Overexpression of miR-519d-3p can inhibit the proliferation of prostate cancer cells. The possible mechanism is that miR-519d-3p inhibits the expression of TRAF4.

Paucity of PD-L1 expression in prostate cancer: innate and adaptive immune resistance.

PubMed

Martin, A M; Nirschl, T R; Nirschl, C J; Francica, B J; Kochel, C M; van Bokhoven, A; Meeker, A K; Lucia, M S; Anders, R A; DeMarzo, A M; Drake, C G

2015-12-01

Primary prostate cancers are infiltrated with programmed death-1 (PD-1) expressing CD8+ T-cells. However, in early clinical trials, men with metastatic castrate-resistant prostate cancer did not respond to PD-1 blockade as a monotherapy. One explanation for this unresponsiveness could be that prostate tumors generally do not express programmed death ligand-1 (PD-L1), the primary ligand for PD-1. However, lack of PD-L1 expression in prostate cancer would be surprising, given that phosphatase and tensin homolog (PTEN) loss is relatively common in prostate cancer and several studies have shown that PTEN loss correlates with PD-L1 upregulation--constituting a mechanism of innate immune resistance. This study tested whether prostate cancer cells were capable of expressing PD-L1, and whether the rare PD-L1 expression that occurs in human specimens correlates with PTEN loss. Human prostate cancer cell lines were evaluated for PD-L1 expression and loss of PTEN by flow cytometry and western blotting, respectively. Immunohistochemical (IHC) staining for PTEN was correlated with PD-L1 IHC using a series of resected human prostate cancer samples. In vitro, many prostate cancer cell lines upregulated PD-L1 expression in response to inflammatory cytokines, consistent with adaptive immune resistance. In these cell lines, no association between PTEN loss and PD-L1 expression was apparent. In primary prostate tumors, PD-L1 expression was rare, and was not associated with PTEN loss. These studies show that some prostate cancer cell lines are capable of expressing PD-L1. However, in human prostate cancer, PTEN loss is not associated with PD-L1 expression, arguing against innate immune resistance as a mechanism that mitigates antitumor immune responses in this disease.

miR-888 is an expressed prostatic secretions-derived microRNA that promotes prostate cell growth and migration

PubMed Central

Lewis, Holly; Lance, Raymond; Troyer, Dean; Beydoun, Hind; Hadley, Melissa; Orians, Joseph; Benzine, Tiffany; Madric, Kenya; Semmes, O John; Drake, Richard; Esquela-Kerscher, Aurora

2014-01-01

microRNAs (miRNAs) are a growing class of small non-coding RNAs that exhibit widespread dysregulation in prostate cancer. We profiled miRNA expression in syngeneic human prostate cancer cell lines that differed in their metastatic potential in order to determine their role in aggressive prostate cancer. miR-888 was the most differentially expressed miRNA observed in human metastatic PC3-ML cells relative to non-invasive PC3-N cells, and its levels were higher in primary prostate tumors from cancer patients, particularly those with seminal vesicle invasion. We also examined a novel miRNA-based biomarker source called expressed prostatic secretions in urine (EPS urine) for miR-888 expression and found that its levels were preferentially elevated in prostate cancer patients with high-grade disease. These expression studies indicated a correlation for miR-888 in disease progression. We next tested how miR-888 regulated cancer-related pathways in vitro using human prostate cancer cell lines. Overexpression of miR-888 increased proliferation and migration, and conversely inhibition of miR-888 activity blocked these processes. miR-888 also increased colony formation in PC3-N and LNCaP cells, supporting an oncogenic role for this miRNA in the prostate. Our data indicates that miR-888 functions to promote prostate cancer progression and can suppress protein levels of the tumor suppressor genes RBL1 and SMAD4. This miRNA holds promise as a diagnostic tool using an innovative prostatic fluid source as well as a therapeutic target for aggressive prostate cancer. PMID:24200968

Losartan sensitizes selectively prostate cancer cell to ionizing radiation.

PubMed

Yazdannejat, H; Hosseinimehr, S J; Ghasemi, A; Pourfallah, T A; Rafiei, A

2016-01-11

Losartan is an angiotensin II receptor (AT-II-R) blocker that is widely used by human for blood pressure regulation. Also, it has antitumor property. In this study, we investigated the radiosensitizing effect of losartan on cellular toxicity induced by ionizing radiation on prostate cancer and non-malignant fibroblast cells. Human prostate cancer (DU-145) and human non-malignant fibroblast cells (HFFF2) were treated with losartan at different concentrations (0.5, 1, 10, 50 and 100 µM) and then these cells were exposed to ionizing radiation. The cell proliferation was determined using MTT assay. Our results showed that losartan exhibited antitumor effect on prostate cancer cells; it was reduced cell survival to 66% at concentration 1 µM. Losartan showed an additive killing effect in combination with ionizing radiation on prostate cancer cell. The cell proliferation was reduced to 54% in the prostate cancer cells treated with losartan at concentration 1 µM in combination with ionizing radiation. Losartan did not exhibit any toxicity on HFFF2 cell. This result shows a promising effect of losartan on enhancement of therapeutic effect of ionizing radiation in patients during therapy.

Inflammatory Responses in a Benign Prostatic Hyperplasia Epithelial Cell Line (BPH-1) Infected with Trichomonas vaginalis.

PubMed

Kim, Sang-Su; Kim, Jung-Hyun; Han, Ik-Hwan; Ahn, Myoung-Hee; Ryu, Jae-Sook

2016-04-01

Trichomonas vaginalis causes the most prevalent sexually transmitted infection worldwide. Trichomonads have been detected in prostatic tissues from prostatitis, benign prostatic hyperplasia (BPH), and prostate cancer. Chronic prostatic inflammation is known as a risk factor for prostate enlargement, benign prostatic hyperplasia symptoms, and acute urinary retention. Our aim was to investigate whether T. vaginalis could induce inflammatory responses in cells of a benign prostatic hyperplasia epithelial cell line (BPH-1). When BPH-1 cells were infected with T. vaginalis, the protein and mRNA of inflammatory cytokines, such as CXCL8, CCL2, IL-1β, and IL-6, were increased. The activities of TLR4, ROS, MAPK, JAK2/STAT3, and NF-κB were also increased, whereas inhibitors of ROS, MAPK, PI3K, NF-κB, and anti-TLR4 antibody decreased the production of the 4 cytokines although the extent of inhibition differed. However, a JAK2 inhibitor inhibited only IL-6 production. Culture supernatants of the BPH-1 cells that had been incubated with live T. vaginalis (trichomonad-conditioned medium, TCM) contained the 4 cytokines and induced the migration of human monocytes (THP-1 cells) and mast cells (HMC-1 cells). TCM conditioned by BPH-1 cells pretreated with NF-κB inhibitor showed decreased levels of cytokines and induced less migration. Therefore, it is suggested that these cytokines are involved in migration of inflammatory cells. These results suggest that T. vaginalis infection of BPH patients may cause inflammation, which may induce lower urinary tract symptoms (LUTS).

TMPRSS2-ERG gene fusion in small cell carcinoma of the prostate.

PubMed

Guo, Charles C; Dancer, Jane Y; Wang, Yan; Aparicio, Ana; Navone, Nora M; Troncoso, Patricia; Czerniak, Bogdan A

2011-01-01

Recent studies have shown that most prostate cancers carry the TMPRSS2-ERG gene fusion. Here we evaluated the TMPRSS2-ERG gene fusion in small cell carcinoma of the prostate (n = 12) in comparison with small cell carcinoma of the urinary bladder (n = 12) and lung (n = 11). Fluorescence in situ hybridization demonstrated rearrangement of the ERG gene in 8 cases of prostatic small cell carcinoma (67%), and the rearrangement was associated with deletion of the 5' ERG gene in 7 cases, but rearrangement of the ERG gene was not present in any small cell carcinoma of the urinary bladder or lung. Next we evaluated the TMPRSS2-ERG gene fusion in nude mouse xenografts that were derived from 2 prostatic small cell carcinomas carrying the TMPRSS2-ERG gene fusion. Two transcripts encoded by the TMPRSS2-ERG gene fusion were detected by reverse transcriptase polymerase chain reaction, and DNA sequencing demonstrated that the 2 transcripts were composed of fusions of exon 1 of the TMPRSS2 gene to exon 4 or 5 of the ERG gene. Our study demonstrates the specific presence of TMPRSS2-ERG gene fusion in prostatic small cell carcinoma, which may be helpful in distinguishing small cell carcinoma of prostatic origin from nonprostatic origins. The high prevalence of the TMPRSS2-ERG gene fusion in prostatic small cell carcinoma as well as adenocarcinoma implies that small cell carcinoma may share a common pathogenic pathway with adenocarcinoma in the prostate. Copyright © 2011 Elsevier Inc. All rights reserved.

Inflammatory Responses in a Benign Prostatic Hyperplasia Epithelial Cell Line (BPH-1) Infected with Trichomonas vaginalis

PubMed Central

Kim, Sang-Su; Kim, Jung-Hyun; Han, Ik-Hwan; Ahn, Myoung-Hee; Ryu, Jae-Sook

2016-01-01

Trichomonas vaginalis causes the most prevalent sexually transmitted infection worldwide. Trichomonads have been detected in prostatic tissues from prostatitis, benign prostatic hyperplasia (BPH), and prostate cancer. Chronic prostatic inflammation is known as a risk factor for prostate enlargement, benign prostatic hyperplasia symptoms, and acute urinary retention. Our aim was to investigate whether T. vaginalis could induce inflammatory responses in cells of a benign prostatic hyperplasia epithelial cell line (BPH-1). When BPH-1 cells were infected with T. vaginalis, the protein and mRNA of inflammatory cytokines, such as CXCL8, CCL2, IL-1β, and IL-6, were increased. The activities of TLR4, ROS, MAPK, JAK2/STAT3, and NF-κB were also increased, whereas inhibitors of ROS, MAPK, PI3K, NF-κB, and anti-TLR4 antibody decreased the production of the 4 cytokines although the extent of inhibition differed. However, a JAK2 inhibitor inhibited only IL-6 production. Culture supernatants of the BPH-1 cells that had been incubated with live T. vaginalis (trichomonad-conditioned medium, TCM) contained the 4 cytokines and induced the migration of human monocytes (THP-1 cells) and mast cells (HMC-1 cells). TCM conditioned by BPH-1 cells pretreated with NF-κB inhibitor showed decreased levels of cytokines and induced less migration. Therefore, it is suggested that these cytokines are involved in migration of inflammatory cells. These results suggest that T. vaginalis infection of BPH patients may cause inflammation, which may induce lower urinary tract symptoms (LUTS). PMID:27180569

Coordinated induction of cell survival signaling in the inflamed microenvironment of the prostate.

PubMed

McIlwain, David W; Zoetemelk, Marloes; Myers, Jason D; Edwards, Marshé T; Snider, Brandy M; Jerde, Travis J

2016-06-01

Both prostate cancer and benign prostatic hyperplasia are associated with inflammatory microenvironments. Inflammation is damaging to tissues, but it is unclear how the inflammatory microenvironment protects specialized epithelial cells that function to proliferate and repair the tissue. The objective of this study is to characterize the cell death and cell survival response of the prostatic epithelium in response to inflammation. We assessed induction of cell death (TNF, TRAIL, TWEAK, FasL) and cell survival factors (IGFs, hedgehogs, IL-6, FGFs, and TGFs) in inflamed and control mouse prostates by ELISA. Cell death mechanisms were determined by immunoblotting and immunofluorescence for cleavage of caspases and TUNEL. Survival pathway activation was assessed by immunoblotting and immunofluorescence for Mcl-1, Bcl-2, Bcl-XL, and survivin. Autophagy was determined by immunoblotting and immunofluorescence for free and membrane associated light chain 3 (LC-3). Cleavage of all four caspases was significantly increased during the first 2 days of inflammation, and survival protein expression was substantially increased subsequently, maximizing at 3 days. By 5 days of inflammation, 50% of prostatic epithelial cells expressed survivin. Autophagy was also evident during the recovery phase (3 days). Finally, immunofluorescent staining of human specimens indicates strong activation of survival proteins juxtaposed to inflammation in inflamed prostate specimens. The prostate responds to deleterious inflammation with induction of cell survival mechanisms, most notably survivin and autophagy, demonstrating a coordinated induction of survival factors that protects and expands a specialized set of prostatic epithelial cells as part of the repair and recovery process during inflammation. © 2016 Wiley Periodicals, Inc.

Tumor formation of prostate cancer cells influenced by stromal cells from the transitional or peripheral zones of the normal prostate

PubMed Central

Zhao, Fu-Jun; Han, Bang-Min; Yu, Sheng-Qiang; Xia, Shu-Jie

2009-01-01

This study was designed to investigate the different involvements of prostatic stromal cells from the normal transitional zone (TZ) or peripheral zone (PZ) in the carcinogenesis of prostate cancer (PCa) epithelial cells (PC-3) in vitro and in vivo co-culture models. Ultra-structures and gene expression profiles of primary cultures of human prostatic stromal cells from the normal TZ or PZ were analyzed by electron microscopy and microarray analysis. In vitro and in vivo co-culture models composed of normal TZ or PZ stromal cells and human PCa PC-3 cells were established. We assessed tumor growth and weight in the in vivo nude mice model. There are morphological and ultra-structural differences in stromal cells from TZ and PZ of the normal prostate. In all, 514 differentially expressed genes were selected by microarray analysis; 483 genes were more highly expressed in stromal cells from TZ and 31 were more highly expressed in those from PZ. Co-culture with PZ stromal cells and transforming growth factor-β1 (TGF-β1) increased the tumor growth of PC-3 cells in vitro and in vivo, as well as Bcl-2 expression. On the other hand, stromal cells of TZ suppressed PC-3 cell tumor growth in the mouse model. We conclude that ultra-structures and gene expression differ between the stromal cells from TZ or PZ of the normal prostate, and stroma–epithelium interactions from TZ or PZ might be responsible for the distinct zonal localization of prostate tumor formation. PMID:19122679

Quantitative Proteomic Profiling of Prostate Cancer Reveals a Role for miR-128 in Prostate Cancer*

PubMed Central

Khan, Amjad P.; Poisson, Laila M.; Bhat, Vadiraja B.; Fermin, Damian; Zhao, Rong; Kalyana-Sundaram, Shanker; Michailidis, George; Nesvizhskii, Alexey I.; Omenn, Gilbert S.; Chinnaiyan, Arul M.; Sreekumar, Arun

2010-01-01

Multiple, complex molecular events characterize cancer development and progression. Deciphering the molecular networks that distinguish organ-confined disease from metastatic disease may lead to the identification of biomarkers of cancer invasion and disease aggressiveness. Although alterations in gene expression have been extensively quantified during neoplastic progression, complementary analyses of proteomic changes have been limited. Here we interrogate the proteomic alterations in a cohort of 15 prostate-derived tissues that included five each from adjacent benign prostate, clinically localized prostate cancer, and metastatic disease from distant sites. The experimental strategy couples isobaric tags for relative and absolute quantitation with multidimensional liquid phase peptide fractionation followed by tandem mass spectrometry. Over 1000 proteins were quantified across the specimens and delineated into clinically localized and metastatic prostate cancer-specific signatures. Included in these class-specific profiles were both proteins that were known to be dysregulated during prostate cancer progression and new ones defined by this study. Enrichment analysis of the prostate cancer-specific proteomic signature, to gain insight into the functional consequences of these alterations, revealed involvement of miR-128-a/b regulation during prostate cancer progression. This finding was validated using real time PCR analysis for microRNA transcript levels in an independent set of 15 clinical specimens. miR-128 levels were elevated in benign prostate epithelial cell lines compared with invasive prostate cancer cells. Knockdown of miR-128 induced invasion in benign prostate epithelial cells, whereas its overexpression attenuated invasion in prostate cancer cells. Taken together, our profiles of the proteomic alterations of prostate cancer progression revealed miR-128 as a potentially important negative regulator of prostate cancer cell invasion. PMID:19955085

miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.

PubMed

Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie

2015-05-01

Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Curcumin Attenuates β-catenin Signaling in Prostate Cancer Cells through Activation of Protein Kinase D1

PubMed Central

Sundram, Vasudha; Chauhan, Subhash C.; Ebeling, Mara; Jaggi, Meena

2012-01-01

Prostate cancer is the most commonly diagnosed cancer affecting 1 in 6 males in the US. Understanding the molecular basis of prostate cancer progression can serve as a tool for early diagnosis and development of novel treatment strategies for this disease. Protein Kinase D1 (PKD1) is a multifunctional kinase that is highly expressed in normal prostate. The decreased expression of PKD1 has been associated with the progression of prostate cancer. Therefore, synthetic or natural products that regulate this signaling pathway can serve as novel therapeutic modalities for prostate cancer prevention and treatment. Curcumin, the active ingredient of turmeric, has shown anti-cancer properties via modulation of a number of different molecular pathways. Herein, we have demonstrated that curcumin activates PKD1, resulting in changes in β-catenin signaling by inhibiting nuclear β-catenin transcription activity and enhancing the levels of membrane β-catenin in prostate cancer cells. Modulation of these cellular events by curcumin correlated with decreased cell proliferation, colony formation and cell motility and enhanced cell-cell aggregation in prostate cancer cells. In addition, we have also revealed that inhibition of cell motility by curcumin is mediated by decreasing the levels of active cofilin, a downstream target of PKD1. The potent anti-cancer effects of curcumin in vitro were also reflected in a prostate cancer xenograft mouse model. The in vivo inhibition of tumor growth also correlated with enhanced membrane localization of β-catenin. Overall, our findings herein have revealed a novel molecular mechanism of curcumin action via the activation of PKD1 in prostate cancer cells. PMID:22523587

Biomolecular characterization of exosomes released from cancer stem cells: Possible implications for biomarker and treatment of cancer.

PubMed

Kumar, Dhruv; Gupta, Dwijendra; Shankar, Sharmila; Srivastava, Rakesh K

2015-02-20

Cancer recognized as one of the leading irrepressible health issues is contributing to increasing mortality-rate day-by-day. The tumor microenvironment is an important field of cancer to understand the detection, treatment and prevention of cancer. Recently, cancer stem cell (CSC) research has shown promising results aiming towards cancer diagnostics and treatment. Here, we found that prostate and breast cancer stem cells secreted vesicles of endosomal origin, called exosomes showed strong connection between autophagy and exosomes released from CSCs. Exosomes may serve as vesicles to communicate with neoplastic cells (autocrine and paracrine manner) and normal cells (paracrine and endocrine manner) and thereby suppress immune systems and regulate neoplastic growth, and metastasis. They can also be used as biomarkers for various cancers. We detected tetraspanin proteins (CD9, CD63, CD81), Alix and tumor susceptibility gene-101 (TSG101) of exosomal markers from rotenone treated CSCs. We have also detected the induction of autophagy genes, Atg7 and conversion of autophagy marker (LC3-I to LC3-II), and tetraspanin proteins (CD9, CD63, CD81) in rotenone treated CSCs by western blotting. The mRNA expression of CD9, CD63, CD81 and TSG101 analyzed by qRT-PCR showed that the rotenone induced the expression of CD9, CD63, CD81 and TSG101 in CSCs. Electron microscopy of rotenone treated CSCs showed the mitochondrial damage of CSCs as confirmed by the release of exosomes from CSCs. The constituents of exosomes may be useful to understand the mechanism of exosomes formation, release and function, and also serve as a useful biomarker and provide novel therapeutic strategies for the treatment and prevention of cancer.

Targeting Androgen Receptor to Suppress Macrophage-induced EMT and Benign Prostatic Hyperplasia (BPH) Development

PubMed Central

Lu, Tianjing; Lin, Wen-Jye; Izumi, Kouji; Wang, Xiaohai; Xu, Defeng; Fang, Lei-Ya; Li, Lei; Jiang, Qi

2012-01-01

Early studies suggested macrophages might play roles in inflammation-associated benign prostatic hyperplasia (BPH) development, yet the underlying mechanisms remain unclear. Here we first showed that CD68+ macrophages were identified in both epithelium and the stromal area of human BPH tissues. We then established an in vitro co-culture model with prostate epithelial and macrophage cell lines to study the potential impacts of infiltrating macrophages in the BPH development and found that co-culturing prostate epithelial cells with macrophages promoted migration of macrophages. In a three-dimensional culture system, the sphere diameter of BPH-1 prostate cells was significantly increased during coculture with THP-1 macrophage cells. Mechanism dissection suggested that expression levels of epithelial-mesenchymal transition (EMT) markers, such as N-cadherin, Snail, and TGF-β2, were increased, and administration of anti-TGF-β2 neutralizing antibody during co-culture suppressed the EMT and THP-1-mediated growth of BPH-1 cells, suggesting THP-1 might go through EMT to influence the BPH development and progression. Importantly, we found that modulation of androgen receptor (AR) in BPH-1 and mPrE cells significantly increased THP-1 and RAW264.7 cell migration, respectively, and enhanced expression levels of EMT markers, suggesting that AR in prostate epithelial cells might play a role in promoting macrophage-mediated EMT in prostate epithelial cells. Silencing AR function via an AR degradation enhancer, ASC-J9, decreased the macrophage migration to BPH-1 cells and suppressed EMT marker expression. Together, these results provide the first evidence to demonstrate that prostate epithelial AR function is important for macrophage-mediated EMT and proliferation of prostate epithelial cells, which represents a previously unrecognized role of AR in the cross-talk between macrophages and prostate epithelial cells. These results may provide new insights for a new therapeutic approach to battle BPH via targeting AR and AR-mediated inflammatory signaling pathways. PMID:22915828

Targeting androgen receptor to suppress macrophage-induced EMT and benign prostatic hyperplasia (BPH) development.

PubMed

Lu, Tianjing; Lin, Wen-Jye; Izumi, Kouji; Wang, Xiaohai; Xu, Defeng; Fang, Lei-Ya; Li, Lei; Jiang, Qi; Jin, Jie; Chang, Chawnshang

2012-10-01

Early studies suggested macrophages might play roles in inflammation-associated benign prostatic hyperplasia (BPH) development, yet the underlying mechanisms remain unclear. Here we first showed that CD68(+) macrophages were identified in both epithelium and the stromal area of human BPH tissues. We then established an in vitro co-culture model with prostate epithelial and macrophage cell lines to study the potential impacts of infiltrating macrophages in the BPH development and found that co-culturing prostate epithelial cells with macrophages promoted migration of macrophages. In a three-dimensional culture system, the sphere diameter of BPH-1 prostate cells was significantly increased during coculture with THP-1 macrophage cells. Mechanism dissection suggested that expression levels of epithelial-mesenchymal transition (EMT) markers, such as N-cadherin, Snail, and TGF-β2, were increased, and administration of anti-TGF-β2 neutralizing antibody during co-culture suppressed the EMT and THP-1-mediated growth of BPH-1 cells, suggesting THP-1 might go through EMT to influence the BPH development and progression. Importantly, we found that modulation of androgen receptor (AR) in BPH-1 and mPrE cells significantly increased THP-1 and RAW264.7 cell migration, respectively, and enhanced expression levels of EMT markers, suggesting that AR in prostate epithelial cells might play a role in promoting macrophage-mediated EMT in prostate epithelial cells. Silencing AR function via an AR degradation enhancer, ASC-J9, decreased the macrophage migration to BPH-1 cells and suppressed EMT marker expression. Together, these results provide the first evidence to demonstrate that prostate epithelial AR function is important for macrophage-mediated EMT and proliferation of prostate epithelial cells, which represents a previously unrecognized role of AR in the cross-talk between macrophages and prostate epithelial cells. These results may provide new insights for a new therapeutic approach to battle BPH via targeting AR and AR-mediated inflammatory signaling pathways.

EphA2 enhances the proliferation and invasion ability of LNCaP prostate cancer cells

PubMed Central

CHEN, PEIJIE; HUANG, YAN; ZHANG, BO; WANG, QIUQUAN; BAI, PEIMING

2014-01-01

EphA2 is persistently overexpressed and functionally changed in numerous human cancers. However, to the best of our knowledge, the role that EphA2 plays in prostate cancer is not entirely clear. To investigate the roles of EphA2 in the development and progression of prostate cancer, the present study initially evaluated the roles of the EphA2 protein in LNCaP prostate cancer cells using recombinant plasmid, western blot analysis, flow cytometry, Matrigel invasion chamber and the cell counting kit-8 assay. An immunohistochemistry assay was also conducted to observe the effects of EphA2 in prostate cancer tissues. The results demonstrated that the LNCaP human prostate cancer cells that were transfected with pcDNA3.1(+) plasmid-mediated pcDNA3.1(+)-EphA2, markedly enhanced the cell growth and invasion in vitro. Additionally, EphA2 was overexpressed in prostate cancer specimens and the expression of EphA2 was significantly associated with Gleason grade, total prostate-specific antigen, advanced clinical stage and lymph node metastasis. Collectively, these results demonstrate that EphA2 is involved in malignant cell behavior and is a potential therapeutic target in human prostate cancer. PMID:24959216

Depletion kinetics of circulating prostate cancer cells studied by in vivo flow cytometer

NASA Astrophysics Data System (ADS)

Liu, Guangda; Guo, Jin; Li, Yan; Chen, Yun; Gu, Zhengqin; Chen, Tong; Wang, Cheng; Wei, Xunbin

2010-11-01

Prostate cancer is the most common malignancy in American men and the second leading cause of deaths from cancer, after lung cancer. The tumor usually grows slowly and remains confined to the gland for many years. During this time, the tumor produces little or no symptoms or outward signs. As the cancer advances, however, it can metastasize throughout other areas of the body, such as the bones, lungs, and liver. Surgical resection, hormonal therapy, chemotherapy and radiation therapy are the foundation of current prostate cancer therapies. Treatments for prostate cause both short- and long-term side effects that may be difficult to accept. Molecular mechanisms of prostate cancer metastasis need to be understood better and new therapies must be developed to selectively target to unique characteristics of cancer cell growth and metastasis. We have developed the "in vivo microscopy" to study the mechanisms that govern prostate cancer cell spread through the microenvironment in vivo in real-time confocal nearinfrared fluorescence imaging. A recently developed "in vivo flow cytometer" and optical imaging are used to assess prostate cancer cell spreading and the circulation kinetics of prostate cancer cells. A real- time quantitative monitoring of circulating prostate cancer cells by the in vivo flow cytometer will be useful to assess the effectiveness of the potential therapeutic interventions.

Studying depletion kinetics of circulating prostate cancer cells by in vivo flow cytometer

NASA Astrophysics Data System (ADS)

Liu, Guangda; Gu, Zhengqin; Guo, Jin; Li, Yan; Chen, Yun; Chen, Tong; Wang, Cheng; Wei, Xunbin

2011-03-01

Prostate cancer is the most common malignancy in American men and the second leading cause of deaths from cancer, after lung cancer. The tumor usually grows slowly and remains confined to the gland for many years. During this time, the tumor produces little or no symptoms or outward signs. As the cancer advances, however, it can metastasize throughout other areas of the body, such as the bones, lungs, and liver. Surgical resection, hormonal therapy, chemotherapy and radiation therapy are the foundation of current prostate cancer therapies. Treatments for prostate cause both short- and long-term side effects that may be difficult to accept. Molecular mechanisms of prostate cancer metastasis need to be understood better and new therapies must be developed to selectively target to unique characteristics of cancer cell growth and metastasis. We have developed the "in vivo microscopy" to study the mechanisms that govern prostate cancer cell spread through the microenvironment in vivo in real-time confocal near-infrared fluorescence imaging. A recently developed "in vivo flow cytometer" and optical imaging are used to assess prostate cancer cell spreading and the circulation kinetics of prostate cancer cells. A real- time quantitative monitoring of circulating prostate cancer cells by the in vivo flow cytometer will be useful to assess the effectiveness of the potential therapeutic interventions.

TGFβ1 alters androgenic metabolites and hydroxysteroid dehydrogenase enzyme expression in human prostate reactive stromal primary cells: Is steroid metabolism altered by prostate reactive stromal microenvironment?

PubMed Central

Piao, Yun-shang; Wiesenfeld, Paddy; Sprando, Robert; Arnold, Julia T.

2013-01-01

The inflammatory tissue microenvironment can be an active promoter in preneoplastic cancer lesions. Altered steroid hormone metabolism as induced by the inflammatory microenvironment may contribute to epithelial cancer progression. Dehydroepiandrosterone sulfate (DHEAS) is the most abundant endogenous steroid hormone present in human serum and can be metabolized to DHEA, androgens and/or estrogens in peripheral tissues. We have previously reported that TGFβ1-induced reactive prostate stromal cells increase DHEA metabolism to active androgens and alter prostate cancer cell gene expression. While much of the focus on mechanisms of prostate cancer and steroid metabolism is in the epithelial cancer cells, this study focuses on TGFβ1-induced effects on DHEA metabolic pathways and enzymes in human prostate stromal cells. In DHEA-treated primary prostate stromal cells, TGFβ1 produced time- and dose-dependent increases in metabolism of DHEA to androstenedione and testosterone. Also TGFβ1-treated prostate stromal cells exhibited changes in the gene expression of enzymes involved in steroid metabolism including up-regulation of 3β hydroxysteroid dehydrogenase (HSD), and down-regulation of 17βHSD5, and 17βHSD2. These studies suggest that reactive prostate stroma and the inflammatory microenvironment may contribute to altered steroid metabolism and increased intratumoral androgens. PMID:23770322

TGFβ1 alters androgenic metabolites and hydroxysteroid dehydrogenase enzyme expression in human prostate reactive stromal primary cells: Is steroid metabolism altered by prostate reactive stromal microenvironment?

PubMed

Piao, Yun-shang; Wiesenfeld, Paddy; Sprando, Robert; Arnold, Julia T

2013-11-01

The inflammatory tissue microenvironment can be an active promoter in preneoplastic cancer lesions. Altered steroid hormone metabolism as induced by the inflammatory microenvironment may contribute to epithelial cancer progression. Dehydroepiandrosterone sulfate (DHEAS) is the most abundant endogenous steroid hormone present in human serum and can be metabolized to DHEA, androgens and/or estrogens in peripheral tissues. We have previously reported that TGFβ1-induced reactive prostate stromal cells increase DHEA metabolism to active androgens and alter prostate cancer cell gene expression. While much of the focus on mechanisms of prostate cancer and steroid metabolism is in the epithelial cancer cells, this study focuses on TGFβ1-induced effects on DHEA metabolic pathways and enzymes in human prostate stromal cells. In DHEA-treated primary prostate stromal cells, TGFβ1 produced time- and dose-dependent increases in metabolism of DHEA to androstenedione and testosterone. Also TGFβ1-treated prostate stromal cells exhibited changes in the gene expression of enzymes involved in steroid metabolism including up-regulation of 3β hydroxysteroid dehydrogenase (HSD), and down-regulation of 17βHSD5, and 17βHSD2. These studies suggest that reactive prostate stroma and the inflammatory microenvironment may contribute to altered steroid metabolism and increased intratumoral androgens. Published by Elsevier Ltd.

The effect of Nullomer-derived peptides 9R, 9S1R and 124R on the NCI-60 panel and normal cell lines.

PubMed

Alileche, Abdelkrim; Hampikian, Greg

2017-08-09

Nullomer peptides are the smallest sequences absent from databases of natural proteins. We first began compiling a list of absent 5-amino acid strings in 2006 (1). We report here the effects of Nullomer-derived peptides 9R, 9S1R and 124R on the NCI-60 panel, derived from human cancers of 9 organs (kidney, ovary, skin melanoma, lung, brain, lung, colon, prostate and the hematopoietic system), and four normal cell lines (endothelial HUVEC, skin fibroblasts BJ, colon epithelial FHC and normal prostate RWPE-1). NCI-60 cancer cell panel and four normal cell lines were cultured in vitro in RPMI1640 supplemented with 10% Hyclone fetal bovine serum and exposed for 48 h to 5 μM, 25 μM and 50 μM of peptides 9R, 9S1R and 124R. Viability was assessed by CCK-8 assay. For peptide ATP depletion effects, one cell line representing each organ in the NCI-60 panel, and four normal cell lines were exposed to 50 μM of peptides 9R, 9S1R and 124R for 3 h. The ATP content was assessed in whole cells, and their supernatants. Peptides 9S1R and 9R are respectively lethal to 95 and 81.6% of the 60 cancer cell lines tested. Control peptide 124R has no effect on the growth of these cells. Especially interesting the fact that peptides 9R and 9S1R are capable of killing drug-resistant and hormone-resistant cell lines, and even cancer stem cells. Peptides 9R and 9S1R have a broader activity spectrum than many cancer drugs in current use, can completely deplete cellular ATP within 3 h, and are less toxic to 3 of the 4 normal cell lines tested than they are to several cancers. Nullomer peptides 9R and 9S1R have a large broad lethal effect on cancer cell lines derived from nine organs represented in the NCI-60 panel. This broad activity crosses many of the categorical divisions used in the general classification of cancers: solid vs liquid cancers, drug sensitive vs drug resistant, hormone sensitive vs hormone resistant, cytokine sensitive vs cytokine non sensitive, slow growing vs rapid growing, differentiated vs dedifferentiated cancers. Furthermore peptides 9R and 9S1R are lethal to cancer stem cells and breast canrcinosarcoma.

Expression and role of the angiotensin II AT2 receptor in human prostate tissue: in search of a new therapeutic option for prostate cancer.

PubMed

Guimond, Marie-Odile; Battista, Marie-Claude; Nikjouitavabi, Fatemeh; Carmel, Maude; Barres, Véronique; Doueik, Alexandre A; Fazli, Ladan; Gleave, Martin; Sabbagh, Robert; Gallo-Payet, Nicole

2013-07-01

Evidence shows that angiotensin II type 1 receptor (AT1R) blockers may be associated with improved outcome in prostate cancer patients. It has been proposed that part of this effect could be due to angiotensin II type 2 receptor (AT2R) activation, the only active angiotensin II receptor in this situation. This study aimed to characterize the localization and expression of AT2R in prostate tissues and to assess its role on cell morphology and number in prostatic epithelial cells in primary culture. AT2R and its AT2R-interacting protein (ATIP) expression were assessed on non-tumoral and tumoral human prostate using tissue microarray immunohistochemistry, binding assay, and Western blotting. AT2R effect on cell number was measured in primary cultures of epithelial cells from non-tumoral human prostate. AT2R was localized at the level of the acinar epithelial layer and its expression decreased in cancers with a Gleason score 6 or higher. In contrast, ATIP expression increased with cancer progression. Treatment of primary cell cultures from non-tumoral prostate tissues with C21/M024, a selective AT2R agonist, alone or in co-incubation with losartan, an AT1R antagonist, significantly decreased cell number compared to untreated cells. AT2R and ATIP are present in non-tumoral human prostate tissues and differentially regulated according to Gleason score. The decrease in non-tumoral prostate cell number upon selective AT2R stimulation suggests that AT2R may have a protective role against prostate cancer development. Treatment with a selective AT2R agonist could represent a new approach for prostate cancer prevention or for patients on active surveillance. Copyright © 2013 Wiley Periodicals, Inc.

Apoptosis-Dependent and Apoptosis-Independent Functions Bim in Prostate Cancer Cells

DTIC Science & Technology

2004-03-01

AD_ Award Number: DAMD17-03-1-0146 TITLE: Apoptosis-Dependent and Apoptosis-Independent Functions of Bim in Prostate Cancer Cells PRINCIPAL...FUNDING NUMBERS Apoptosis-Dependent and Apoptosis-Independent Functions of DAMD17-03-1-0146 Bim in Prostate Cancer Cells 6. A UTHORs) Junwei Liu, M.D...extended cell survival have been implicated in prostate cancer (PCa) development and progression. We recently found that Bim , a BH3-only pro

Cadherin Switching and Activation of β-Catenin Signaling Underlie Proinvasive Actions of Calcitonin-Calcitonin Receptor Axis in Prostate Cancer*S⃞

PubMed Central

Shah, Girish V.; Muralidharan, Anbalagan; Gokulgandhi, Mitan; Soan, Kamal; Thomas, Shibu

2009-01-01

Calcitonin, a neuroendocrine peptide, and its receptor are localized in the basal epithelium of benign prostate but in the secretory epithelium of malignant prostates. The abundance of calcitonin and calcitonin receptor mRNA displays positive correlation with the Gleason grade of primary prostate cancers. Moreover, calcitonin increases tumorigenicity and invasiveness of multiple prostate cancer cell lines by cyclic AMP-dependent protein kinase-mediated actions. These actions include increased secretion of matrix metalloproteinases and urokinase-type plasminogen activator and an increase in prostate cancer cell invasion. Activation of calcitonin-calcitonin receptor autocrine loop in prostate cancer cell lines led to the loss of cell-cell adhesion, destabilization of tight and adherens junctions, and internalization of key integral membrane proteins. In addition, the activation of calcitonin-calcitonin receptor axis induced epithelial-mesenchymal transition of prostate cancer cells as characterized by cadherin switch and the expression of the mesenchymal marker, vimentin. The activated calcitonin receptor phosphorylated glycogen synthase kinase-3, a key regulator of cytosolic β-catenin degradation within the WNT signaling pathway. This resulted in the accumulation of intracellular β-catenin, its translocation in the nucleus, and transactivation of β-catenin-responsive genes. These results for the first time identify actions of calcitonin-calcitonin receptor axis on prostate cancer cells that lead to the destabilization of cell-cell junctions, epithelial-to-mesenchymal transition, and activation of WNT/β-catenin signaling. The results also suggest that cyclic AMP-dependent protein kinase plays a key role in calcitonin receptor-induced destabilization of cell-cell junctions and activation of WNT-β-catenin signaling. PMID:19001380

Implications of pleiotrophin in human PC3 prostate cancer cell growth in vivo.

PubMed

Tsirmoula, Sotiria; Dimas, Kostas; Hatziapostolou, Maria; Lamprou, Margarita; Ravazoula, Panagiota; Papadimitriou, Evangelia

2012-10-01

Pleiotrophin (PTN) is a heparin-binding growth factor with diverse functions related to tumor growth, angiogenesis, and metastasis. Pleiotrophin seems to have a significant role in prostate cancer cell growth and to mediate the stimulatory actions of other factors that affect prostate cancer cell functions. However, all studies carried out up to date are in vitro, using different types of human prostate cancer cell lines. The aim of the present work was to study the role of endogenous PTN in human prostate cancer growth in vivo. For this purpose, human prostate cancer PC3 cells were stably transfected with a plasmid vector, bearing the antisense PTN sequence, in order to inhibit PTN expression (AS-PC3). Migration, apoptosis, and adhesion on osteoblastic cells were measured in vitro. In vivo, PC3 cells were s.c. injected into male NOD/SCID mice, and tumor growth, survival rates, angiogenesis, apoptosis, and the number of metastasis were estimated. Pleiotrophin depletion resulted in a decreased migration capability of AS-PC3 cells compared with the corresponding mock-transfected or the non-transfected PC3 cells, as well as increased apoptosis and decreased adhesiveness to osteoblastic cells in vitro. In prostate cancer NOD/SCID mouse xenografts, PTN depletion significantly suppressed tumor growth and angiogenesis and induced apoptosis of cancer cells. In addition, PTN depletion decreased the number of metastases, providing a survival benefit for the animals bearing AS-PC3 xenografts. Our data suggest that PTN is implicated in human prostate cancer growth in vivo and could be considered a potential target for the development of new therapeutic approaches for prostate cancer. © 2012 Japanese Cancer Association.

Miz1, a Novel Target of ING4, Can Drive Prostate Luminal Epithelial Cell Differentiation.

PubMed

Berger, Penny L; Winn, Mary E; Miranti, Cindy K

2017-01-01

How prostate epithelial cells differentiate and how dysregulation of this process contributes to prostate tumorigenesis remain unclear. We recently identified a Myc target and chromatin reader protein, ING4, as a necessary component of human prostate luminal epithelial cell differentiation, which is often lost in primary prostate tumors. Furthermore, loss of ING4 in the context of oncogenic mutations is required for prostate tumorigenesis. Identifying the gene targets of ING4 can provide insight into how its loss disrupts differentiation and leads to prostate cancer. Using a combination of RNA-Seq, a best candidate approach, and chromatin immunoprecipitation (ChIP), we identified Miz1 as a new ING4 target. ING4 or Miz1 overexpression, shRNA knock-down, and a Myc-binding mutant were used in a human in vitro differentiation assay to assess the role of Miz1 in luminal cell differentiation. ING4 directly binds the Miz1 promoter and is required to induce Miz1 mRNA and protein expression during luminal cell differentiation. Miz1 mRNA was not induced in shING4 expressing cells or tumorigenic cells in which ING4 is not expressed. Miz1 dependency on ING4 was unique to differentiating luminal cells; Miz1 mRNA expression was not induced in basal cells. Although Miz1 is a direct target of ING4, and its overexpression can drive luminal cell differentiation, Miz1 was not required for differentiation. Miz1 is a newly identified ING4-induced target gene which can drive prostate luminal epithelial cell differentiation although it is not absolutely required. Prostate 77:49-59, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Organoid culture systems for prostate epithelial tissue and prostate cancer tissue

PubMed Central

Drost, Jarno; Karthaus, Wouter R.; Gao, Dong; Driehuis, Else; Sawyers, Charles L.; Chen, Yu; Clevers, Hans

2016-01-01

Summary This protocol describes a recently developed strategy to generate 3D prostate organoid cultures from healthy mouse and human prostate (either bulk or FAC-sorted single luminal and basal cells), metastatic prostate cancer lesions and circulating tumour cells. Organoids derived from healthy material contain the differentiated luminal and basal cell types, whereas organoids derived from prostate cancer tissue mimic the histology of the tumour. The stepwise establishment of these cultures and the fully defined serum-free conditioned medium that is required to sustain organoid growth are outlined. Organoids established using this protocol can be used to study many different aspects of prostate biology, including homeostasis, tumorigenesis and drug discovery. PMID:26797458

Prostate stromal cell telomere shortening is associated with risk of prostate cancer in the placebo arm of the Prostate Cancer Prevention Trial*

PubMed Central

Heaphy, Christopher M.; Gaonkar, Gaurav; Peskoe, Sarah B.; Joshu, Corinne E.; De Marzo, Angelo M.; Lucia, M. Scott; Goodman, Phyllis J.; Lippman, Scott M.; Thompson, Ian M.; Platz, Elizabeth A.; Meeker, Alan K.

2015-01-01

Background Telomeres are repetitive nucleoproteins that help maintain chromosomal stability by inhibiting exonucleolytic degradation, prohibiting inappropriate homologous recombination, and preventing chromosomal fusions by suppressing double-strand break signals. We recently observed that men treated for clinically localized prostate cancer with shorter telomeres in their cancer-associated stromal cells, in combination with greater variation in cancer cell telomere lengths, were significantly more likely to progress to distant metastases and die from their disease. Here, we hypothesized that shorter stromal cell telomere length would be associated with prostate cancer risk at time of biopsy. Methods Telomere-specific fluorescence in situ hybridization (FISH) analysis was performed in normal-appearing stromal, basal epithelial, and luminal epithelial cells in biopsies from men randomized to the placebo arm of the Prostate Cancer Prevention Trial. Prostate cancer cases (N=32) were either detected on a biopsy performed for cause or at the end of the study per trial protocol, and controls (N=50), defined as negative for cancer on an end-of-study biopsy performed per trial protocol (e.g. irrespective of indication), were sampled. Logistic regression was used to estimate the association between mean telomere length of the particular cell populations, cell-to-cell telomere length variability, and risk of prostate cancer. Results Men with short stromal cell telomere lengths (below median) had 2.66 (95% CI 1.04-3.06; p=0.04) times the odds of prostate cancer compared with men who had longer lengths (at or above median). Conversely, we did not observe statistically significant associations for short telomere lengths in normal-appearing basal (OR=2.15, 95% CI 0.86-5.39; p=0.10) or luminal (OR=1.15, 95% CI 0.47-2.80; p=0.77) cells. Conclusions These findings suggest that telomere shortening in normal stromal cells is associated with prostate cancer risk. It is essential to extend and validate these findings, while also identifying the cellular milieu that comprises the subset of cells with short telomeres within the prostate tumor microenvironment. PMID:25893825

Prostate stromal cell telomere shortening is associated with risk of prostate cancer in the placebo arm of the Prostate Cancer Prevention Trial.

PubMed

Heaphy, Christopher M; Gaonkar, Gaurav; Peskoe, Sarah B; Joshu, Corinne E; De Marzo, Angelo M; Lucia, M Scott; Goodman, Phyllis J; Lippman, Scott M; Thompson, Ian M; Platz, Elizabeth A; Meeker, Alan K

2015-08-01

Telomeres are repetitive nucleoproteins that help maintain chromosomal stability by inhibiting exonucleolytic degradation, prohibiting inappropriate homologous recombination, and preventing chromosomal fusions by suppressing double-strand break signals. We recently observed that men treated for clinically localized prostate cancer with shorter telomeres in their cancer-associated stromal cells, in combination with greater variation in cancer cell telomere lengths, were significantly more likely to progress to distant metastases, and die from their disease. Here, we hypothesized that shorter stromal cell telomere length would be associated with prostate cancer risk at time of biopsy. Telomere-specific fluorescence in situ hybridization (FISH) analysis was performed in normal-appearing stromal, basal epithelial, and luminal epithelial cells in biopsies from men randomized to the placebo arm of the Prostate Cancer Prevention Trial. Prostate cancer cases (N = 32) were either detected on a biopsy performed for cause or at the end of the study per trial protocol, and controls (N = 50), defined as negative for cancer on an end-of-study biopsy performed per trial protocol (e.g., irrespective of indication), were sampled. Logistic regression was used to estimate the association between mean telomere length of the particular cell populations, cell-to-cell telomere length variability, and risk of prostate cancer. Men with short stromal cell telomere lengths (below median) had 2.66 (95% CI 1.04-3.06; P = 0.04) times the odds of prostate cancer compared with men who had longer lengths (at or above median). Conversely, we did not observe statistically significant associations for short telomere lengths in normal-appearing basal (OR = 2.15, 95% CI 0.86-5.39; P= 0 .10) or luminal (OR = 1.15, 95% CI 0.47-2.80; P = 0.77) cells. These findings suggest that telomere shortening in normal stromal cells is associated with prostate cancer risk. It is essential to extend and validate these findings, while also identifying the cellular milieu that comprises the subset of cells with short telomeres within the prostate tumor microenvironment. © 2015 Wiley Periodicals, Inc.

[Neuroendocrine differentiation in prostate adenocarcinoma].

PubMed

Ramírez-Balderrama, Lázaro; López-Briones, Sergio; Daza-Benítez, Leonel; Macías, Maciste H; López-Gaytán, Teresa; Pérez-Vázquez, Victoriano

2013-01-01

The human prostate is a gland composed of many types of cells and extracellular components with specific functions. The stromal compartment includes nerve tissue, fibroblasts, lymphocytes, macrophages, endothelial cells, and smooth muscular cells. The epithelial compartment is composed of luminal epithelial cells, basal cells, and a lesser number of neuroendocrine cells, which are transcendental in growth regulation, differentiation, and secretory function. In prostate cancer, neuroendocrine cells replicate especially in high grade and advanced stage, and hormonally treated tumoral cells adopt characteristics that make them resistant to hormonal deprivation. Androgen receptors have a crucial role in tumorigenesis of prostate adenocarcinoma. Deprivation hormone therapy blocks the expression of androgen receptors in the prostatic epithelial cells. Neuroendocrine cells lack androgen receptors; their growth is hormonally independent and that is why deprivation hormonal therapy does not eliminate the neoplasic neuroendocrine cells. In contrast, these types of cells proliferate after therapy and make a paracrine network, stimulating the proliferation of androgen-independent neoplastic cells, which finally lead to tumoral recurrence. In this work we describe the neuroendocrine function in normal tissue and in prostatic adenocarcinoma, including neoplasic proliferation stimulation, invasion, apoptosis resistance, and angiogenesis, and describe some molecular pathways involved in this neuroendocrine differentiation.

C-C motif ligand 5 promotes migration of prostate cancer cells in the prostate cancer bone metastasis microenvironment.

PubMed

Urata, Satoko; Izumi, Kouji; Hiratsuka, Kaoru; Maolake, Aerken; Natsagdorj, Ariunbold; Shigehara, Kazuyoshi; Iwamoto, Hiroaki; Kadomoto, Suguru; Makino, Tomoyuki; Naito, Renato; Kadono, Yoshifumi; Lin, Wen-Jye; Wufuer, Guzailinuer; Narimoto, Kazutaka; Mizokami, Atsushi

2018-03-01

Chemokines and their receptors have key roles in cancer progression. The present study investigated chemokine activity in the prostate cancer bone metastasis microenvironment. Growth and migration of human prostate cancer cells were assayed in cocultures with bone stromal cells. The migration of LNCaP cells significantly increased when co-cultured with bone stromal cells isolated from prostate cancer bone metastases. Cytokine array analysis of conditioned medium from bone stromal cell cultures identified CCL5 as a concentration-dependent promoter of LNCaP cell migration. The migration of LNCaP cells was suppressed when C-C motif ligand 5 (CCL5) neutralizing antibody was added to cocultures with bone stromal cells. Knockdown of androgen receptor with small interfering RNA increased the migration of LNCaP cells compared with control cells, and CCL5 did not promote the migration of androgen receptor knockdown LNCaP. Elevated CCL5 secretion in bone stromal cells from metastatic lesions induced prostate cancer cell migration by a mechanism consistent with CCL5 activity upstream of androgen receptor signaling. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Lipid degradation promotes prostate cancer cell survival.

PubMed

Itkonen, Harri M; Brown, Michael; Urbanucci, Alfonso; Tredwell, Gregory; Ho Lau, Chung; Barfeld, Stefan; Hart, Claire; Guldvik, Ingrid J; Takhar, Mandeep; Heemers, Hannelore V; Erho, Nicholas; Bloch, Katarzyna; Davicioni, Elai; Derua, Rita; Waelkens, Etienne; Mohler, James L; Clarke, Noel; Swinnen, Johan V; Keun, Hector C; Rekvig, Ole P; Mills, Ian G

2017-06-13

Prostate cancer is the most common male cancer and androgen receptor (AR) is the major driver of the disease. Here we show that Enoyl-CoA delta isomerase 2 (ECI2) is a novel AR-target that promotes prostate cancer cell survival. Increased ECI2 expression predicts mortality in prostate cancer patients (p = 0.0086). ECI2 encodes for an enzyme involved in lipid metabolism, and we use multiple metabolite profiling platforms and RNA-seq to show that inhibition of ECI2 expression leads to decreased glucose utilization, accumulation of fatty acids and down-regulation of cell cycle related genes. In normal cells, decrease in fatty acid degradation is compensated by increased consumption of glucose, and here we demonstrate that prostate cancer cells are not able to respond to decreased fatty acid degradation. Instead, prostate cancer cells activate incomplete autophagy, which is followed by activation of the cell death response. Finally, we identified a clinically approved compound, perhexiline, which inhibits fatty acid degradation, and replicates the major findings for ECI2 knockdown. This work shows that prostate cancer cells require lipid degradation for survival and identifies a small molecule inhibitor with therapeutic potential.

Expression of single-chain Fv gene specific for gamma-seminoprotein by RTS and its biological activity identification.

PubMed

Han, Yuedong; Haun, Yi; Deng, Jinlan; Gao, Feng; Pan, Bifeng; Cui, Daxiang

2006-01-01

Fabricating a single-chain variable fragment specific for human seminoprotein is very important in antibody-directed enzyme prodrug therapy and NMR imaging for prostate cancer. Here a single-chain Fv specific for gamma-seminoprotein was expressed by RTS. Its activity and the efficiency of entry into prostate cancer cells are investigated by immunoprecipitation and Western blotting and immunofluorescent staining, as well as entry of conjugated magnetic beads into cells. Results showed that ScFv peptides specific for gamma-seminoprotein were successfully prepared, which can bind with the prostate cells specifically and can bring magnetic beads into prostate cancer cells within 15 min, the amount of magnetic beads inside prostate cancer cells increased as the culture time prolonged. ScFv-conjugated magnetic beads did not enter into control cells. In conclusion, the ScFv peptide against human gamma-seminoprotein with biological activity was successfully fabricated, which can take magnetic beads to prostate cancer cells specifically and not to the control cells. This ScFv peptide against human gamma-seminoprotein should be useful in improving the detection and therapy of prostate cancer at early stages and NMR imaging.

NPM1 Silencing Reduces Tumour Growth and MAPK Signalling in Prostate Cancer Cells

PubMed Central

Loubeau, Gaëlle; Boudra, Rafik; Maquaire, Sabrina; Lours-Calet, Corinne; Beaudoin, Claude; Verrelle, Pierre; Morel, Laurent

2014-01-01

The chaperone nucleophosmin (NPM1) is over-expressed in the epithelial compartment of prostate tumours compared to adjacent healthy epithelium and may represent one of the key actors that support the neoplastic phenotype of prostate adenocarcinoma cells. Yet, the mechanisms that underlie NPM1 mediated phenotype remain elusive in the prostate. To better understand NPM1 functions in prostate cancer cells, we sought to characterize its impact on prostate cancer cells behaviour and decipher the mechanisms by which it may act. Here we show that NPM1 favors prostate tumour cell migration, invasion and colony forming. Furthermore, knockdown of NPM1 leads to a decrease in the growth of LNCaP-derived tumours grafted in Nude mice in vivo. Such oncogenic-like properties are found in conjunction with a positive regulation of NPM1 on the ERK1/2 (Extracellular signal-Regulated Kinases 1/2) kinase phosphorylation in response to EGF (Epidermal Growth Factor) stimulus, which is critical for prostate cancer progression following the setting of an autonomous production of the growth factor. NPM1 could then be a target to switch off specifically ERK1/2 pathway activation in order to decrease or inhibit cancer cell growth and migration. PMID:24796332

Expression of the cancer-testis antigen BORIS correlates with prostate cancer.

PubMed

Cheema, Zubair; Hari-Gupta, Yukti; Kita, Georgia-Xanthi; Farrar, Dawn; Seddon, Ian; Corr, John; Klenova, Elena

2014-02-01

BORIS, a paralogue of the transcription factor CTCF, is a member of the cancer-testis antigen (CT) family. BORIS is normally present at high levels in the testis; however it is aberrantly expressed in various tumors and cancer cell lines. The main objectives of this study were to investigate BORIS expression together with sub-cellular localization in both prostate cell lines and tumor tissues, and assess correlations between BORIS and clinical/pathological characteristics. We examined BORIS mRNA expression, protein levels and cellular localization in a panel of human prostate tissues, cancer and benign, together with a panel prostate cell lines. We also compared BORIS levels and localization with clinical/pathological characteristics in prostate tumors. BORIS was detected in all inspected prostate cancer cell lines and tumors, but was absent in benign prostatic hyperplasia. Increased levels of BORIS protein positively correlated with Gleason score, T-stage and androgen receptor (AR) protein levels in prostate tumors. The relationship between BORIS and AR was further highlighted in prostate cell lines by the ability of ectopically expressed BORIS to activate the endogenous AR mRNA and protein. BORIS localization in the nucleus plus cytoplasm was also associated with higher BORIS levels and Gleason score. Detection of BORIS in prostate tumors suggests potential applications of BORIS as a biomarker for prostate cancer diagnosis, as an immunotherapy target and, potentially, a prognostic marker of more aggressive prostate cancer. The ability of BORIS to activate the AR gene indicates BORIS involvement in the growth and development of prostate tumors. © 2013 Wiley Periodicals, Inc.

TRPM8 ion channels differentially modulate proliferation and cell cycle distribution of normal and cancer prostate cells.

PubMed

Valero, María Ll; Mello de Queiroz, Fernanda; Stühmer, Walter; Viana, Félix; Pardo, Luis A

2012-01-01

Overexpression of the cation-permeable channel TRPM8 in prostate cancers might represent a novel opportunity for their treatment. Inhibitors of TRPM8 reduce the growth of prostate cancer cells. We have used two recently described and highly specific blockers, AMTB and JNJ41876666, and RNAi to determine the relevance of TRPM8 expression in the proliferation of non-tumor and tumor cells. Inhibition of the expression or function of the channel reduces proliferation rates and proliferative fraction in all tumor cells tested, but not of non-tumor prostate cells. We observed no consistent acceleration of growth after stimulation of the channel with menthol or icilin, indicating that basal TRPM8 expression is enough to sustain growth of prostate cancer cells.

Adoptive cell therapy of prostate cancer using female mice-derived T cells that react with prostate antigens

PubMed Central

Yi, Huanfa; Yu, Xiaofei; Guo, Chunqing; Manjili, Masoud H.; Repasky, Elizabeth A.; Wang, Xiang-Yang

2011-01-01

In this study, we report a novel treatment strategy that could potentially be used to improve efficacy of adoptive cell therapy for patients with prostate cancer. We show that female C57BL/6 mice are able to effectively reject two syngeneic prostate tumors (TRAMP-C2 and RM1) in a T cell-dependent manner. The protective antitumor immunity appears to primarily involve T cell responses reactive against general prostate tumor/tissue antigens, rather than simply to male-specific H-Y antigen. For the first time we show that adoptive transfer of lymphocytes from TRAMP-C2-primed or naive female mice effectively control prostate tumor growth in male mice, when combined with host pre-conditioning (i.e., non-myeloablative lymphodepletion) and IL-2 administration. No pathological autoimmune response was observed in the treated tumor-bearing male mice. Our studies provide new insights regarding the immune-mediated recognition of male-specific tissue, such as the prostate, and may offer new immunotherapy treatment strategies for advanced prostate cancer. PMID:21088965

Cyclin K dependent regulation of Aurora B affects apoptosis and proliferation by induction of mitotic catastrophe in prostate cancer.

PubMed

Schecher, Sabrina; Walter, Britta; Falkenstein, Michael; Macher-Goeppinger, Stephan; Stenzel, Philipp; Krümpelmann, Kristina; Hadaschik, Boris; Perner, Sven; Kristiansen, Glen; Duensing, Stefan; Roth, Wilfried; Tagscherer, Katrin E

2017-10-15

Cyclin K plays a critical role in transcriptional regulation as well as cell development. However, the role of Cyclin K in prostate cancer is unknown. Here, we describe the impact of Cyclin K on prostate cancer cells and examine the clinical relevance of Cyclin K as a biomarker for patients with prostate cancer. We show that Cyclin K depletion in prostate cancer cells induces apoptosis and inhibits proliferation accompanied by an accumulation of cells in the G2/M phase. Moreover, knockdown of Cyclin K causes mitotic catastrophe displayed by multinucleation and spindle multipolarity. Furthermore, we demonstrate a Cyclin K dependent regulation of the mitotic kinase Aurora B and provide evidence for an Aurora B dependent induction of mitotic catastrophe. In addition, we show that Cyclin K expression is associated with poor biochemical recurrence-free survival in patients with prostate cancer treated with an adjuvant therapy. In conclusion, targeting Cyclin K represents a novel, promising anti-cancer strategy to induce cell cycle arrest and apoptotic cell death through induction of mitotic catastrophe in prostate cancer cells. Moreover, our results indicate that Cyclin K is a putative predictive biomarker for clinical outcome and therapy response for patients with prostate cancer. © 2017 UICC.

The therapeutic effects of docosahexaenoic acid on oestrogen/androgen-induced benign prostatic hyperplasia in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chao; Luo, Fei; Zhou, Ying

Benign prostatic hyperplasia (BPH) is one of the major disorders of the urinary system in elderly men. Docosahexaenoic acid (DHA) is the main component of n-3 polyunsaturated fatty acids (n-3 PUFAs) and has nerve protective, anti-inflammatory and tumour-growth inhibitory effects. Here, the therapeutic potential of DHA in treating BPH was investigated. Seal oil effectively prevented the development of prostatic hyperplasia induced by oestradiol/testosterone in a rat model by suppressing the increase of the prostatic index (PI), reducing the thickness of the peri-glandular smooth muscle layer, inhibiting the proliferation of both prostate epithelial and stromal cells, and downregulating the expression ofmore » androgen receptor (AR) and oestrogen receptor α (ERα). An in vitro study showed that DHA inhibited the growth of the human prostate stromal cell line WPMY-1 and the epithelial cell line RWPE-1 in a dose- and time-dependent manner. In both cell lines, the DHA arrested the cell cycle in the G2/M phase. In addition, DHA also reduced the expression of ERα and AR in the WPMY-1 and RWPE-1 cells. These results indicate that DHA inhibits the multiplication of prostate stromal and epithelial cells through a mechanism that may involve cell cycle arrest and the downregulation of ERα and AR expression. - Highlights: • Seal oil prevents oestradiol/testosterone (E2/T)-induced BPH in castrated rats. • Seal oil downregulates the expression of oestrogen receptor α(ERα) and androgen receptor (AR) in rat BPH tissues. • DHA inhibits the growth of human prostate stromal and epithelial cells in vitro. • DHA arrests human prostate stromal and epithelial cells in the G2/M phase and downregulates the expression of cyclin B1. • DHA inhibits the expression of ERα and AR in human prostate stromal and epithelial cells.« less

An immunohistochemical identification key for cell types in adult mouse prostatic and urethral tissue sections

PubMed Central

Turco, Anne E.; Gottschalk, Adam; Halberg, Richard B.; Guo, Jinjin; McMahon, Jill A.; McMahon, Andrew P.

2017-01-01

Though many methods can be used to identify cell types contained in complex tissues, most require cell disaggregation and destroy information about where cells reside in relation to their microenvironment. Here, we describe a polytomous key for cell type identification in intact sections of adult mouse prostate and prostatic urethra. The key is organized as a decision tree and initiates with one round of immunostaining for nerve, epithelial, fibromuscular/hematolymphoid, or vascular associated cells. Cell identities are recursively eliminated by subsequent staining events until the remaining pool of potential cell types can be distinguished by direct comparison to other cells. We validated our identification key using wild type adult mouse prostate and urethra tissue sections and it currently resolves sixteen distinct cell populations which include three nerve fiber types as well as four epithelial, five fibromuscular/hematolymphoid, one nerve-associated, and three vascular-associated cell types. We demonstrate two uses of this novel identification methodology. We first used the identification key to characterize prostate stromal cell type changes in response to constitutive phosphatidylinositide-3-kinase activation in prostate epithelium. We then used the key to map cell lineages in a new reporter mouse strain driven by Wnt10aem1(cre/ERT2)Amc. The identification key facilitates rigorous and reproducible cell identification in prostate tissue sections and can be expanded to resolve additional cell types as new antibodies and other resources become available. PMID:29145476

High activity of mitochondrial glycerophosphate dehydrogenase and glycerophosphate-dependent ROS production in prostate cancer cell lines.

PubMed

Chowdhury, Subir K R; Gemin, Adam; Singh, Gurmit

2005-08-12

Most malignant cells are highly glycolytic and produce high levels of reactive oxygen species (ROS) compared to normal cells. Mitochondrial glycerophosphate dehydrogenase (mGPDH) participates in the reoxidation of cytosolic NADH by delivering reducing equivalents from this molecule into the electron transport chain, thus sustaining glycolysis. Here, we investigate the role of mGPDH in maintaining an increased rate of glycolysis and evaluate glycerophosphate-dependent ROS production in prostate cancer cell lines (LNCaP, DU145, PC3, and CL1). Immunoblot, polarographic, and spectrophotometric analyses revealed that mGPDH abundance and activity was significantly elevated in prostate cancer cell lines when compared to the normal prostate epithelial cell line PNT1A. Furthermore, both the glycolytic capacity and glycerophosphate-dependent ROS production was increased 1.68- to 4.44-fold and 5- to 7-fold, respectively, in prostate cancer cell lines when compared to PNT1A cells. Overall, these data demonstrate that mGPDH is involved in maintaining a high rate of glycolysis and is an important site of electron leakage leading to ROS production in prostate cancer cells.

Effects of homeopathic preparations on human prostate cancer growth in cellular and animal models.

PubMed

MacLaughlin, Brian W; Gutsmuths, Babett; Pretner, Ewald; Jonas, Wayne B; Ives, John; Kulawardane, Don Victor; Amri, Hakima

2006-12-01

The use of dietary supplements for various ailments enjoys unprecedented popularity. As part of this trend, Sabal serrulata (saw palmetto) constitutes the complementary treatment of choice with regard to prostate health. In homeopathy, Sabal serrulata is commonly prescribed for prostate problems ranging from benign prostatic hyperplasia to prostate cancer. The authors' work assessed the antiproliferative effects of homeopathic preparations of Sabal serrulata, Thuja occidentalis, and Conium maculatum, in vivo, on nude mouse xenografts, and in vitro, on PC-3 and DU-145 human prostate cancer as well as MDA-MB-231 human breast cancer cell lines. Treatment with Sabal serrulata in vitro resulted in a 33% decrease of PC-3 cell proliferation at 72 hours and a 23% reduction of DU-145 cell proliferation at 24 hours (P<.01). The difference in reduction is likely due to the specific doubling time of each cell line. No effect was observed on MDA-MB-231 human breast cancer cells. Thuja occidentalis and Conium maculatum did not have any effect on human prostate cancer cell proliferation. In vivo, prostate tumor xenograft size was significantly reduced in Sabal serrulata-treated mice compared to untreated controls (P=.012). No effect was observed on breast tumor growth. Our study clearly demonstrates a biologic response to homeopathic treatment as manifested by cell proliferation and tumor growth. This biologic effect was (i)significantly stronger to Sabal serrulata than to controls and (ii)specific to human prostate cancer. Sabal serrulata should thus be further investigated as a specific homeopathic remedy for prostate pathology.

Hyaluronan in aged collagen matrix increases prostate epithelial cell proliferation

PubMed Central

Damodarasamy, Mamatha; Vernon, Robert B.; Chan, Christina K.; Plymate, Stephen R.; Wight, Thomas N.

2015-01-01

The extracellular matrix (ECM) of the prostate, which is comprised primarily of collagen, becomes increasingly disorganized with age, a property that may influence the development of hyperplasia and cancer. Collageous ECM extracted from the tails of aged mice exhibits many characteristics of collagen in aged tissues, including the prostate. When polymerized into a 3-dimensional (3D) gel, these collagen extracts can serve as models for the study of specific cell-ECM interactions. In the present study, we examined the behaviors of human prostatic epithelial cell lines representing normal prostate epithelial cells (PEC), benign prostatic hyperplasia (BPH-1), and adenocarcinoma (LNCaP) cultured in contact with 3D gels made from collagen extracts of young and aged mice. We found that proliferation of PEC, BPH-1, and LNCaP cells were all increased by culture on aged collagen gels relative to young collagen gels. In examining age-associated differences in the composition of the collagen extracts, we found that aged and young collagen had a similar amount of several collagen-associated ECM components, but aged collagen had a much greater content of the glycosaminoglycan hyaluronan (HA) than young collagen. The addition of HA (of similar size and concentration to that found in aged collagen extracts) to cells placed in young collagen elicited significantly increased proliferation in BPH-1 cells, but not in PEC or LNCaP cells, relative to controls not exposed to HA. Of note, histochemical analyses of human prostatic tissues showed significantly higher expression of HA in BPH and prostate cancer stroma relative to stroma of normal prostate. Collectively, these results suggest that changes in ECM involving increased levels of HA contribute to the growth of prostatic epithelium with aging. PMID:25124870

Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.

PubMed

Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke

2014-12-01

Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. © 2014 UICC.

Comprehensive Evaluation of the Role of EZH2 in the Growth, Invasion, and Aggression of a Panel of Prostate Cancer Cell Lines

PubMed Central

Karanikolas, Breanne D.W.; Figueiredo, Marxa L.; Wu, Lily

2010-01-01

Background Although most prostate cancers respond well to initial treatments, a fraction of prostate cancers are more aggressive and will recur and metastasize. At that point, there are few treatment options available. Significant efforts have been made to identify biomarkers that will identify these more aggressive cancers to tailor a more vigorous treatment in order to improve outcome. Polycomb Group protein Enhancer of Zeste 2 (EZH2) was found to be overexpressed in metastatic prostate tumors, and is considered an excellent candidate for such a biomarker. Scattered studies have found that EZH2 overexpression causes neoplastic transformation, invasion, and growth of prostate cells. However, these studies utilized different systems and cell lines, and so are difficult to correlate with one another. Methods In this study, a comprehensive evaluation of the phenotypic effects of EZH2 in a panel of five prostate cancer cell lines was performed. By using multiple cell lines, and examining overexpression and knockdown of EZH2 concurrently, a broad view of EZH2's role in prostate cancer was achieved. Results Overexpression of EZH2 led to more aggressive behaviors in all prostate cell lines tested. In contrast, downregulation of EZH2 reduced invasion and tumorigenicity of androgen-independent cell lines CWR22Rv1, PC3, and DU145, but not of androgen-dependent cell lines LAPC4 and LNCaP. Conclusions Findings from this study suggest androgen-independent prostate tumors are more dependent on EZH2 expression than androgen-dependent tumors. Our observations provide an explanation for the strong correlation between EZH2 overexpression and advanced stage, aggressive prostate cancers. PMID:20087897

A case of robot-assisted laparoscopic radical prostatectomy in primary small cell prostate cancer.

PubMed

Kim, Ki Hong; Park, Sang Un; Jang, Jee Young; Park, Won Kyu; Oh, Chul Kyu; Rha, Koon Ho

2010-12-01

Primary small cell carcinoma of the prostate is a rare and very aggressive disease with a poor prognosis, even in its localized form. We managed a case of primary small cell carcinoma of the prostate. The patient was treated with robot-assisted laparoscopic radical prostatectomy and adjuvant chemotherapy. Herein we report this first case of robot-assisted laparoscopic radical prostatectomy performed in a patient with primary small cell carcinoma of the prostate.

Potential Prognostic Markers for Human Prostate Cancer

DTIC Science & Technology

2001-03-01

thymosin 0315 gene. The gene appears to exist as a single copy in the rat genome and is comprised of 3 exons distributed over 3 kilobases. The...metastatic prostate cancer cells. Autocrine motility factor ( AMF ), a prostate tumor G low low cell secreted factor [13], also affects motility of...prostate H low low carcinoma cells. Tumor cell migration in response to HIF low low ATI low low AMF has been associated with metastatic potential. AT2 low

Protective effect of zinc on N-methyl-N-nitrosourea and testosterone-induced prostatic intraepithelial neoplasia in the dorsolateral prostate of Sprague Dawley rats.

PubMed

Banudevi, Sivanantham; Elumalai, Perumal; Sharmila, Govindaraj; Arunkumar, Ramachandran; Senthilkumar, Kalimuthu; Arunakaran, Jagadeesan

2011-09-01

Previous studies have suggested that zinc exerts anticarcinogenic and antiproliferative effects against prostate cancer both in vitro and in rat ventral prostate. Zinc accumulation diminishes early in the course of prostate malignancy and it inhibits the growth of several carcinoma cells through induction of cell cycle arrest and apoptosis. In this study, we have investigated the influence of zinc on N-methyl-N-nitrosourea (MNU) and testosterone (T)-induced prostatic intraepithelial neoplasia in the dorsolateral prostate of Sprague Dawley (SD) rats. The results indicate that zinc plays an important role in prostate carcinogenesis. Increased tumor incidence was accompanied by a decrease in prostatic acid phosphatase activity, citrate, zinc, glutathione-S-transferase, reduced glutathione, p53, B-cell lymphoma protein (Bcl-2)-associated X protein and caspase-3 levels in MNU + T-treated rats. On the contrary, significantly increased phase I drug metabolizing enzyme activities, lipid peroxide, hydrogen peroxide, proliferating cell nuclear antigen, Bcl-2 and Bcl-X(L) protein levels were observed in the dorsolateral prostate of MNU + T-treated rats. Simultaneous zinc supplementation significantly reversed these effects in MNU + T-treated rats. Signs of dysplasia, a characteristic of prostatic intraepithelial neoplasia, were evident in the dorsolateral prostatic tissue sections by MNU + T administration. However, zinc supplementation has reversed these effects in the dorsolateral prostatic histoarchitecture. These results suggest that zinc may act as an essential trace element against MNU and testosterone-induced prostatic preneoplastic progression in SD rats.

Matrix-Dependent Regulation of AKT in Hepsin-Overexpressing PC3 Prostate Cancer Cells12

PubMed Central

Wittig-Blaich, Stephanie M; Kacprzyk, Lukasz A; Eismann, Thorsten; Bewerunge-Hudler, Melanie; Kruse, Petra; Winkler, Eva; Strauss, Wolfgang S L; Hibst, Raimund; Steiner, Rudolf; Schrader, Mark; Mertens, Daniel; Sültmann, Holger; Wittig, Rainer

2011-01-01

The serine-protease hepsin is one of the most prominently overexpressed genes in human prostate carcinoma. Forced expression of the enzyme in mice prostates is associated with matrix degradation, invasive growth, and prostate cancer progression. Conversely, hepsin overexpression in metastatic prostate cancer cell lines was reported to induce cell cycle arrest and reduction of invasive growth in vitro. We used a system for doxycycline (dox)-inducible target gene expression in metastasis-derived PC3 cells to analyze the effects of hepsin in a quantitative manner. Loss of viability and adhesion correlated with hepsin expression levels during anchorage-dependent but not anchorage-independent growth. Full expression of hepsin led to cell death and detachment and was specifically associated with reduced phosphorylation of AKT at Ser473, which was restored by growth on matrix derived from RWPE1 normal prostatic epithelial cells. In the chorioallantoic membrane xenograft model, hepsin overexpression in PC3 cells reduced the viability of tumors but did not suppress invasive growth. The data presented here provide evidence that elevated levels of hepsin interfere with cell adhesion and viability in the background of prostate cancer as well as other tissue types, the details of which depend on the microenvironment provided. Our findings suggest that overexpression of the enzyme in prostate carcinogenesis must be spatially and temporally restricted for the efficient development of tumors and metastases. PMID:21750652

Phenotypic analysis of prostate-infiltrating lymphocytes reveals TH17 and Treg skewing.

PubMed

Sfanos, Karen Sandell; Bruno, Tullia C; Maris, Charles H; Xu, Lauren; Thoburn, Christopher J; DeMarzo, Angelo M; Meeker, Alan K; Isaacs, William B; Drake, Charles G

2008-06-01

Pathologic examination of prostate glands removed from patients with prostate cancer commonly reveals infiltrating CD4+ and CD8+ T cells. Little is known about the phenotype of these cells, despite accumulating evidence suggesting a potential role for chronic inflammation in the etiology of prostate cancer. We developed a technique that samples the majority of the peripheral prostate through serial needle aspirates. CD4+ prostate-infiltrating lymphocytes (PIL) were isolated using magnetic beads and analyzed for subset skewing using both flow cytometry and quantitative reverse transcription-PCR. The transcriptional profile of fluorescence-activated cell sorted prostate-infiltrating regulatory T cells (CD4+, CD25+, GITR+) was compared with naïve, peripheral blood T cells using microarray analysis. CD4+ PIL showed a paucity of TH2 (interleukin-4-secreting) cells, a surprising finding given the generally accepted association of these cells with chronic, smoldering inflammation. Instead, CD4+ PIL seemed to be skewed towards a regulatory Treg phenotype (FoxP3+) as well as towards the TH17 phenotype (interleukin-17+). We also found that a preponderance of TH17-mediated inflammation was associated with a lower pathologic Gleason score. These protein level data were reflected at the message level, as analyzed by quantitative reverse transcription-PCR. Microarray analysis of pooled prostate-infiltrating T(reg) revealed expected Treg-associated transcripts (FoxP3, CTLA-4, GITR, LAG-3) as well as a number of unique cell surface markers that may serve as additional Treg markers. Taken together, these data suggest that TH17 and/or Treg CD4+ T cells (rather than TH2 T cells) may be involved in the development or progression of prostate cancer.

Increased choline uptake in macrophages and prostate cancer cells does not allow for differentiation between benign and malignant prostate pathologies.

PubMed

Schwarz, Timo; Seidl, Christof; Schiemann, Matthias; Senekowitsch-Schmidtke, Reingard; Krause, Bernd Joachim

2016-06-01

Inflammatory cells may contribute to the choline uptake in different prostate pathologies. The aim of this study was (i) to assess if inflammatory cells incorporate choline and (ii) to potentially detect differences compared to FDG uptake. Therefore we investigated the uptake of [(3)H]choline and [(18)F]FDG in human prostate carcinoma cells and human inflammatory cells. Macrophages were cultured from isolated mononuclear cells, gained by density gradient centrifugation of human buffy coats. T-lymphocytes, B-lymphocytes and granulocytes were enriched by density gradient centrifugation before cell sorting by means of flow cytometry was performed. [(3)H]choline and [(18)F]FDG uptake of isolated inflammatory cells as well as of LNCaP and PC-3 human prostate carcinoma cells was assessed simultaneously in dual tracer uptake experiments. Macrophages showed highest [(3)H]choline and [(18)F]FDG uptake compared to the tracer uptake rates of leukocytes. [(3)H]choline uptake of macrophages was in the same range as in prostate cancer cells. Lipopolysaccharide stimulation of macrophages resulted in an increase of [(18)F]FDG uptake in macrophages, but not in an increased [(3)H]choline uptake. The high [(3)H]choline uptake in macrophages may be a source of false-positive PET results in diagnosis of prostate cancer by choline-PET/CT. As already known from FDG-PET, discrimination between tumor and inflammation in prostate cancer patients is not possible via choline-PET. The application of choline-PET for reliable primary prostate cancer detection and delineation has to be queried. Copyright © 2016 Elsevier Inc. All rights reserved.

Fulvestrant (ICI 182,780) down-regulates androgen receptor expression and diminishes androgenic responses in LNCaP human prostate cancer cells.

PubMed

Bhattacharyya, Rumi S; Krishnan, Aruna V; Swami, Srilatha; Feldman, David

2006-06-01

The androgen receptor (AR) plays a key role in the development and progression of prostate cancer. Targeting the AR for down-regulation would be a useful strategy for treating prostate cancer, especially hormone-refractory or androgen-independent prostate cancer. In the present study, we showed that the antiestrogen fulvestrant [ICI 182,780 (ICI)] effectively suppressed AR expression in several human prostate cancer cells, including androgen-independent cells. In LNCaP cells, ICI (10 micromol/L) treatment decreased AR mRNA expression by 43% after 24 hours and AR protein expression by approximately 50% after 48 hours. We further examined the mechanism of AR down-regulation by ICI in LNCaP cells. ICI did not bind to the T877A-mutant AR present in the LNCaP cells nor did it promote proteasomal degradation of the AR. ICI did not affect AR mRNA or protein half-life. However, ICI decreased the activity of an AR promoter-luciferase reporter plasmid transfected into LNCaP cells, suggesting a direct repression of AR gene transcription. As a result of AR down-regulation by ICI, androgen induction of prostate-specific antigen mRNA and protein expression were substantially attenuated. Importantly, LNCaP cell proliferation was significantly inhibited by ICI treatment. Following 6 days of ICI treatment, a 70% growth inhibition was seen in androgen-stimulated LNCaP cells. These data show that the antiestrogen ICI is a potent AR down-regulator that causes significant inhibition of prostate cancer cell growth. Our study suggests that AR down-regulation by ICI would be an effective strategy for the treatment of all prostate cancer, especially AR-dependent androgen-independent prostate cancer.

Phenotypic Analysis of Prostate-Infiltrating Lymphocytes Reveals TH17 and Treg Skewing

PubMed Central

Sfanos, Karen Sandell; Bruno, Tullia C.; Maris, Charles H.; Xu, Lauren; Thoburn, Christopher J.; DeMarzo, Angelo M.; Meeker, Alan K.; Isaacs, William B.; Drake, Charles G.

2011-01-01

Purpose Pathologic examination of prostate glands removed from patients with prostate cancer commonly reveals infiltrating CD4+ and CD8+ T cells. Little is known about the phenotype of these cells, despite accumulating evidence suggesting a potential role for chronic inflammation in the etiology of prostate cancer. Experimental Design We developed a technique that samples the majority of the peripheral prostate through serial needle aspirates. CD4+ prostate-infiltrating lymphocytes (PIL) were isolated using magnetic beads and analyzed for subset skewing using both flow cytometry and quantitative reverse transcription-PCR. The transcriptional profile of fluorescence-activated cell sorted prostate-infiltrating regulatory T cells (CD4+, CD25+, GITR+) was compared with naïve, peripheral blood T cells using microarray analysis. Results CD4+ PIL showed a paucity of TH2 (interleukin-4– secreting) cells, a surprising finding given the generally accepted association of these cells with chronic, smoldering inflammation. Instead, CD4+ PIL seemed to be skewed towards a regulatory Treg phenotype (FoxP3+) as well as towards the TH17 phenotype (interleukin-17+). We also found that a preponderance of TH17-mediated inflammation was associated with a lower pathologic Gleason score. These protein level data were reflected at the message level, as analyzed by quantitative reverse transcription-PCR. Microarray analysis of pooled prostate-infiltrating Treg revealed expected Treg-associated transcripts (FoxP3, CTLA-4, GITR, LAG-3) as well as a number of unique cell surface markers that may serve as additional Treg markers. Conclusion Taken together, these data suggest that TH17 and/or Treg CD4+ T cells (rather than TH2 T cells) may be involved in the development or progression of prostate cancer. PMID:18519750

Proposed morphologic classification of prostate cancer with neuroendocrine differentiation.

PubMed

Epstein, Jonathan I; Amin, Mahul B; Beltran, Himisha; Lotan, Tamara L; Mosquera, Juan-Miguel; Reuter, Victor E; Robinson, Brian D; Troncoso, Patricia; Rubin, Mark A

2014-06-01

On July 31, 2013, the Prostate Cancer Foundation assembled a working committee on the molecular biology and pathologic classification of neuroendocrine (NE) differentiation in prostate cancer. New clinical and molecular data emerging from prostate cancers treated by contemporary androgen deprivation therapies, as well as primary lesions, have highlighted the need for refinement of diagnostic terminology to encompass the full spectrum of NE differentiation. The classification system consists of: Usual prostate adenocarcinoma with NE differentiation; 2) Adenocarcinoma with Paneth cell NE differentiation; 3) Carcinoid tumor; 4) Small cell carcinoma; 5) Large cell NE carcinoma; and 5) Mixed NE carcinoma - acinar adenocarcinoma. The article also highlights "prostate carcinoma with overlapping features of small cell carcinoma and acinar adenocarcinoma" and "castrate-resistant prostate cancer with small cell cancer-like clinical presentation". It is envisioned that specific criteria associated with the refined diagnostic terminology will lead to clinically relevant pathologic diagnoses that will stimulate further clinical and molecular investigation and identification of appropriate targeted therapies.

Essential Roles of Epithelial Bone Morphogenetic Protein Signaling During Prostatic Development

PubMed Central

Omori, Akiko; Miyagawa, Shinichi; Ogino, Yukiko; Harada, Masayo; Ishii, Kenichiro; Sugimura, Yoshiki; Ogino, Hajime; Nakagata, Naomi

2014-01-01

Prostate is a male sex-accessory organ. The prostatic epithelia consist primarily of basal and luminal cells that differentiate from embryonic urogenital sinus epithelia. Prostate tumors are believed to originate in the basal and luminal cells. However, factors that promote normal epithelial differentiation have not been well elucidated, particularly for bone morphogenetic protein (Bmp) signaling. This study shows that Bmp signaling prominently increases during prostatic differentiation in the luminal epithelia, which is monitored by the expression of phosphorylated Smad1/5/8. To elucidate the mechanism of epithelial differentiation and the function of Bmp signaling during prostatic development, conditional male mutant mouse analysis for the epithelial-specific Bmp receptor 1a (Bmpr1a) was performed. We demonstrate that Bmp signaling is indispensable for luminal cell maturation, which regulates basal cell proliferation. Expression of the prostatic epithelial regulatory gene Nkx3.1 was significantly reduced in the Bmpr1a mutants. These results indicate that Bmp signaling is a key factor for prostatic epithelial differentiation, possibly by controlling the prostatic regulatory gene Nkx3.1. PMID:24731097

Analysis of autophagic flux in response to sulforaphane in metastatic prostate cancer cells

PubMed Central

Watson, Gregory W; Wickramasekara, Samanthi; Fang, Yufeng; Palomera-Sanchez, Zoraya; Maier, Claudia S; Williams, David E; Dashwood, Roderick H; Perez, Viviana I; Ho, Emily

2015-01-01

Scope The phytochemical sulforaphane has been shown to decrease prostate cancer metastases in a genetic mouse model of prostate carcinogenesis, though the mechanism of action is not fully known. Sulforaphane has been reported to stimulate autophagy, and modulation of autophagy has been proposed to influence sulforaphane cytotoxicity; however, no conclusions about autophagy can be drawn without assessing autophagic flux, which has not been characterized in prostate cancer cells following sulforaphane treatment. Methods and Results We conducted an investigation to assess the impact of sulforaphane on autophagic flux in two metastatic prostate cancer cell lines at a concentration shown to decrease metastasis in vivo. Autophagic flux was assessed by multiple autophagy related proteins and substrates. We found that sulforaphane can stimulate autophagic flux and cell death only at high concentrations, above what has been observed in vivo. Conclusion These results suggest that sulforaphane does not directly stimulate autophagy or cell death in metastatic prostate cancer cells under physiologically relevant conditions, but instead supports the involvement of in vivo factors as important effectors of sulforaphane- mediated prostate cancer suppression. PMID:26108801

Over-expression of lipocalin 2 promotes cell migration and invasion through activating ERK signaling to increase SLUG expression in prostate cancer.

PubMed

Ding, Guanxiong; Fang, Jie; Tong, Shijun; Qu, Lianxi; Jiang, Haowen; Ding, Qiang; Liu, Jun

2015-06-15

Metastasis is the primary cause of prostate cancer (PCa) lethality and poses a huge clinical obstacle. Lipocalin 2 (LCN2), a member of the lipocalin family, is aberrantly expressed in some human cancers and has been implicated in the progression of some tumors. However, the role of LCN2 in the metastatic capacity of prostate cancer (PCa) is poorly understood. LCN2 expression was examined by RT-qPCR and/or immunoblotting in human prostate tissue specimens and prostate cancer cell lines LNCaP, C4-2, 22RV1, PC3, DU-145, and PC3MM2. LCN2 protein level in human serum samples was determined by ELISA. Lentiviruses-mediated over-expression of LCN2 and knockdown of LCN2 was conducted to evaluate the role of LCN2 in cell migratory and invasive capacities of prostate cancer cells. Cell migration and invasion was examined by transwell chamber assay. Knockdown of SLUG by lentivirus was performed to investigate its role in LCN2-promoted cell migration and invasion in vitro (22RV1 cell line) and metastasis in vivo (tail vein metastasis assay in nude mice). Role of ERK signaling in LCN2-mediated up-regulation of SLUG was assayed by using ERK inhibitor U0126. We confirmed that LCN2 levels were correlated positively with invasive prostate cancer in human tissue and serum samples, and were also consistently associated with the invasive capacity of prostate cancer cell lines. The over-expression of LCN2 in 22RV1 cells (not highly invasive) promoted the epithelial-mesenchymal transition (EMT), increasing cell motility and invasiveness, while the knockdown of LCN2 in PC3 cells (highly invasive) inhibited EMT, decreasing cell motility and invasiveness. Among the multiple EMT transcription factors, LCN2 specifically induces the expression of SLUG, which was shown here to be required for the LCN2-induced increase in the invasive capacity of prostate cancer cells both in vitro and in vivo. Mechanistically, LCN2 promoted SLUG expression via activating ERK signaling pathway. LCN2 plays an important role in promoting cell migration and invasion of prostate cancer by inducing EMT through the ERK/SLUG axis. Therefore, targeted inhibition of LCN2 may represent a therapeutic strategy to prevent the metastasis of prostate cancer. © 2015 Wiley Periodicals, Inc.

(-)-Gossypol reduces invasiveness in metastatic prostate cancer cells

USDA-ARS?s Scientific Manuscript database

Acquisition of metastatic ability by prostatic cancer cells is the most lethal aspect of prostatic cancer progression. (-)-Gossypol, a polyphenolic compound present in cottonseeds, possesses anti-proliferation and pro-apoptotic effects in various cancer cells. In this study, the differences betwee...

Selective modulation of endoplasmic reticulum stress markers in prostate cancer cells by a standardized mangosteen fruit extract.

PubMed

Li, Gongbo; Petiwala, Sakina M; Pierce, Dana R; Nonn, Larisa; Johnson, Jeremy J

2013-01-01

The increased proliferation of cancer cells is directly dependent on the increased activity of the endoplasmic reticulum (ER) machinery which is responsible for protein folding, assembly, and transport. In fact, it is so critical that perturbations in the endoplasmic reticulum can lead to apoptosis. This carefully regulated organelle represents a unique target of cancer cells while sparing healthy cells. In this study, a standardized mangosteen fruit extract (MFE) was evaluated for modulating ER stress proteins in prostate cancer. Two human prostate cancer cell lines, 22Rv1 and LNCaP, and prostate epithelial cells (PrECs) procured from two patients undergoing radical prostatectomy were treated with MFE. Flow cytometry, MTT, BrdU and Western blot were used to evaluate cell apoptosis, viability, proliferation and ER stress. Next, we evaluated MFE for microsomal stability and anti-cancer activity in nude mice. MFE induced apoptosis, decreased viability and proliferation in prostate cancer cells. MFE increased the expression of ER stress proteins. Interestingly, MFE selectively promotes ER stress in prostate cancer cells while sparing PrECs. MFE suppressed tumor growth in a xenograft tumor model without obvious toxicity. Mangosteen fruit extract selectively promotes endoplasmic reticulum stress in cancer cells while sparing non-tumorigenic prostate epithelial cells. Furthermore, in an in vivo setting mangosteen fruit extract significantly reduces xenograft tumor formation.

Selective Modulation of Endoplasmic Reticulum Stress Markers in Prostate Cancer Cells by a Standardized Mangosteen Fruit Extract

PubMed Central

Li, Gongbo; Petiwala, Sakina M.; Pierce, Dana R.; Nonn, Larisa; Johnson, Jeremy J.

2013-01-01

The increased proliferation of cancer cells is directly dependent on the increased activity of the endoplasmic reticulum (ER) machinery which is responsible for protein folding, assembly, and transport. In fact, it is so critical that perturbations in the endoplasmic reticulum can lead to apoptosis. This carefully regulated organelle represents a unique target of cancer cells while sparing healthy cells. In this study, a standardized mangosteen fruit extract (MFE) was evaluated for modulating ER stress proteins in prostate cancer. Two human prostate cancer cell lines, 22Rv1 and LNCaP, and prostate epithelial cells (PrECs) procured from two patients undergoing radical prostatectomy were treated with MFE. Flow cytometry, MTT, BrdU and Western blot were used to evaluate cell apoptosis, viability, proliferation and ER stress. Next, we evaluated MFE for microsomal stability and anti-cancer activity in nude mice. MFE induced apoptosis, decreased viability and proliferation in prostate cancer cells. MFE increased the expression of ER stress proteins. Interestingly, MFE selectively promotes ER stress in prostate cancer cells while sparing PrECs. MFE suppressed tumor growth in a xenograft tumor model without obvious toxicity. Mangosteen fruit extract selectively promotes endoplasmic reticulum stress in cancer cells while sparing non-tumorigenic prostate epithelial cells. Furthermore, in an in vivo setting mangosteen fruit extract significantly reduces xenograft tumor formation. PMID:24367485

Cell type specific gene expression analysis of prostate needle biopsies resolves tumor tissue heterogeneity

PubMed Central

Krönig, Malte; Walter, Max; Drendel, Vanessa; Werner, Martin; Jilg, Cordula A.; Richter, Andreas S.; Backofen, Rolf; McGarry, David; Follo, Marie; Schultze-Seemann, Wolfgang; Schüle, Roland

2015-01-01

A lack of cell surface markers for the specific identification, isolation and subsequent analysis of living prostate tumor cells hampers progress in the field. Specific characterization of tumor cells and their microenvironment in a multi-parameter molecular assay could significantly improve prognostic accuracy for the heterogeneous prostate tumor tissue. Novel functionalized gold-nano particles allow fluorescence-based detection of absolute mRNA expression levels in living cells by fluorescent activated flow cytometry (FACS). We use of this technique to separate prostate tumor and benign cells in human prostate needle biopsies based on the expression levels of the tumor marker alpha-methylacyl-CoA racemase (AMACR). We combined RNA and protein detection of living cells by FACS to gate for epithelial cell adhesion molecule (EPCAM) positive tumor and benign cells, EPCAM/CD45 double negative mesenchymal cells and CD45 positive infiltrating lymphocytes. EPCAM positive epithelial cells were further sub-gated into AMACR high and low expressing cells. Two hundred cells from each population and several biopsies from the same patient were analyzed using a multiplexed gene expression profile to generate a cell type resolved profile of the specimen. This technique provides the basis for the clinical evaluation of cell type resolved gene expression profiles as pre-therapeutic prognostic markers for prostate cancer. PMID:25514598

The role of epithelial plasticity in prostate cancer dissemination and treatment resistance

PubMed Central

Bitting, Rhonda L.; Schaeffer, Daneen; Somarelli, Jason A.; Garcia-Blanco, Mariano A.

2014-01-01

Nearly 30,000 men die annually in the USA of prostate cancer, nearly uniformly from metastatic dissemination. Despite recent advances in hormonal, immunologic, bone-targeted, and cytotoxic chemotherapies, treatment resistance and further dissemination are inevitable in men with metastatic disease. Emerging data suggests that the phenomenon of epithelial plasticity, encompassing both reversible mesenchymal transitions and acquisition of stemness traits, may underlie this lethal biology of dissemination and treatment resistance. Understanding the molecular underpinnings of this cellular plasticity from preclinical models of prostate cancer and from biomarker studies of human metastatic prostate cancer has provided clues to novel therapeutic approaches that may delay or prevent metastatic disease and lethality over time. This review will discuss the preclinical and clinical evidence for epithelial plasticity in this rapidly changing field and relate this to clinical phenotype and resistance in prostate cancer while suggesting novel therapeutic approaches. PMID:24414193

Pharmacologic inhibition of Pim kinases alters prostate cancer cell growth and resensitizes chemoresistant cells to taxanes.

PubMed

Mumenthaler, Shannon M; Ng, Patricia Y B; Hodge, Amanda; Bearss, David; Berk, Gregory; Kanekal, Sarath; Redkar, Sanjeev; Taverna, Pietro; Agus, David B; Jain, Anjali

2009-10-01

The serine/threonine family of Pim kinases function as oncogenes and have been implicated in prostate cancer progression, particularly in hormone-refractory prostate disease, as a result of their antiapoptotic function. In this study, we used a pharmacologic inhibitor targeting the Pim family members, SGI-1776, to determine whether modulation of Pim kinase activity could alter prostate cancer cell survival and modulate chemotherapy resistance. Extensive biochemical characterization of SGI-1776 confirmed its specificity for the three isoforms of the Pim family. Treatment of prostate cancer cells with SGI-1776 resulted in a dose-dependent reduction in phosphorylation of known Pim kinase substrates that are involved in cell cycle progression and apoptosis (p21(Cip1/WAF1) and Bad). Consequently, SGI-1776 compromised overall cell viability by inducing G(1) cell cycle arrest and triggering apoptosis. Overexpression of recombinant Pim-1 markedly increased sensitivity of SGI-1776-mediated prostate cancer cell apoptosis and p21(Cip1/WAF1) phosphorylation inhibition, reinforcing the specificity of SGI-1776. An additional cytotoxic effect was observed when SGI-1776 was combined with taxane-based chemotherapy agents. SGI-1776 was able to reduce cell viability in a multidrug resistance 1 protein-based taxane-refractory prostate cancer cell line. In addition, SGI-1776 treatment was able to resensitize chemoresistant cells to taxane-based therapies by inhibiting multidrug resistance 1 activity and inducing apoptosis. These findings support the idea that inhibiting Pim kinases, in combination with a chemotherapeutic agent, could play an important role in prostate cancer treatment by targeting the clinical problem of chemoresistance.

Elevation of SHARPIN Protein Levels in Prostate Adenocarcinomas Promotes Metastasis and Impairs Patient Survivals.

PubMed

Huang, Hai; Du, Tao; Zhang, Yiming; Lai, Yiming; Li, Kaiwen; Fan, Xinxing; Zhu, Dingjun; Lin, Tianxin; Xu, Kewei; Huang, Jian; Liu, Leyuan; Guo, Zhenghui

2017-05-01

SHARPIN, SHANK-associated RH domain interacting protein, associates with a linear ubiquitin chain assembly complex (LUBAC) to regulate inflammation and immunity. It has been reported that SHARPIN is highly expressed in several human tumors including ovarian cancer and liver cancer. We found that SHARPIN is also highly expressed in prostate cancer cell lines of DU145, LNCAP, and PC-3. Suppression of SHARPIN caused an inhibition of NF-κB signal and decreases in tumorigenesis of cultured cells in NOD/SCID mouse model. Overexpression of SHARPIN in prostate cancer cells promoted cell growth and reduced apoptosis through NF-kB/ERK/Akt pathway and apoptosis-associated proteins. We analyzed the expression of SHARPIN in prostate cancer tissues from 95 patients and its relationship with other clinical characteristics associated with PCA malignancies and patient survivals, and examined the impacts of SHARPIN suppression with siRNA on proliferation, angiogenesis, invasion, and expression levels of MMP-9 of prostate cancer cells and metastasis to lung by these cells in nude mice. High levels of SHARPIN were associated with high malignancies of PCA and predicted shorter survivals of PCA patients. Suppression of SHARPIN impaired cell proliferation, angiogenesis, and invasion and reduced levels of MMP-9 in prostate cancer cells and reduced the size of metastatic lung tumors induced by these cells in mice. SHARPIN enhances the metastasis of prostate cancer and impair patient survivals. Prostate 77:718-728, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Activation of NF-kappa B Signaling Promotes Growth of Prostate Cancer Cells in Bone

PubMed Central

Jin, Renjie; Sterling, Julie A.; Edwards, James R.; DeGraff, David J.; Lee, Changki; Park, Serk In; Matusik, Robert J.

2013-01-01

Patients with advanced prostate cancer almost invariably develop osseous metastasis. Although many studies indicate that the activation of NF-κB signaling appears to be correlated with advanced cancer and promotes tumor metastasis by influencing tumor cell migration and angiogenesis, the influence of altered NF-κB signaling in prostate cancer cells within boney metastatic lesions is not clearly understood. While C4-2B and PC3 prostate cancer cells grow well in the bone, LNCaP cells are difficult to grow in murine bone following intraskeletal injection. Our studies show that when compared to LNCaP, NF-κB activity is significantly higher in C4-2B and PC3, and that the activation of NF-κB signaling in prostate cancer cells resulted in the increased expression of the osteoclast inducing genes PTHrP and RANKL. Further, conditioned medium derived from NF-κB activated LNCaP cells induce osteoclast differentiation. In addition, inactivation of NF-κB signaling in prostate cancer cells inhibited tumor formation in the bone, both in the osteolytic PC3 and osteoblastic/osteoclastic mixed C4-2B cells; while the activation of NF-κB signaling in LNCaP cells promoted tumor establishment and proliferation in the bone. The activation of NF-κB in LNCaP cells resulted in the formation of an osteoblastic/osteoclastic mixed tumor with increased osteoclasts surrounding the new formed bone, similar to metastases commonly seen in patients with prostate cancer. These results indicate that osteoclastic reaction is required even in the osteoblastic cancer cells and the activation of NF-κB signaling in prostate cancer cells increases osteoclastogenesis by up-regulating osteoclastogenic genes, thereby contributing to bone metastatic formation. PMID:23577181

Expression of a hyperactive androgen receptor leads to androgen-independent growth of prostate cancer cells.

PubMed

Hsieh, Chen-Lin; Cai, Changmeng; Giwa, Ahmed; Bivins, Aaronica; Chen, Shao-Yong; Sabry, Dina; Govardhan, Kumara; Shemshedini, Lirim

2008-07-01

Cellular changes that affect the androgen receptor (AR) can cause prostate cancer to transition from androgen dependent to androgen independent, which is usually lethal. One common change in prostate tumors is overexpression of the AR, which has been shown to lead to androgen-independent growth of prostate cancer cells. This led us to hypothesize that expression of a hyperactive AR would be sufficient for androgen-independent growth of prostate cancer cells. To test this hypothesis, stable lune cancer prostate (LNCaP) cell lines were generated, which express a virion phosphoprotein (VP)16-AR hybrid protein that contains full-length AR fused to the strong viral transcriptional activation domain VP16. This fusion protein elicited as much as a 20-fold stronger transcriptional activity than the natural AR. Stable expression of VP16-AR in LNCaP cells yielded androgen-independent cell proliferation, while under the same growth conditions the parental LNCaP cells exhibited only androgen-dependent growth. These results show that expression of a hyperactive AR is sufficient for androgen-independent growth of prostate cancer cells. To study the molecular basis of this enhanced growth, we measured the expression of soluble guanylyl cyclase-alpha1 (sGCalpha1), a subunit of the sGC, an androgen-regulated gene that has been shown to be involved in prostate cancer cell growth. Interestingly, the expression of sGCalpha1 is androgen independent in VP16-AR-expressing cells, in contrast to its androgen-induced expression in control LNCaP cells. RNA(I)-dependent inhibition of sGCalpha1 expression resulted in significantly reduced proliferation of VP16-AR cells, implicating an important role for sGCalpha1 in the androgen-independent growth of these cells.

Differential role of Sloan–Kettering Institute (Ski) protein in Nodal and transforming growth factor-beta (TGF-β)-induced Smad signaling in prostate cancer cells

PubMed Central

Khan, Shafiq A.

2012-01-01

Transforming growth factor-beta (TGF-β) signaling pathways contain both tumor suppressor and tumor promoting activities. We have demonstrated that Nodal, another member of the TGF-β superfamily, and its receptors are expressed in prostate cancer cells. Nodal and TGF-β exerted similar biological effects on prostate cells; both inhibited proliferation in WPE, RWPE1 and DU145 cells, whereas neither had any effect on the proliferation of LNCaP or PC3 cells. Interestingly, Nodal and TGF-β induced migration in PC3 cells, but not in DU145 cells. TGF-β induced predominantly phosphorylation of Smad3, whereas Nodal induced phosphorylation of only Smad2. We also determined the expression and differential role of Ski, a corepressor of Smad2/3, in Nodal and TGF-β signaling in prostate cancer cells. Similar levels of Ski mRNA were found in several established prostate cell lines; however, high levels of Ski protein were only detected in prostate cancer cells and prostate cancer tissue samples. Exogenous Nodal and TGF-β had no effects on Ski mRNA levels. On the other hand, TGF-β induced a rapid degradation of Ski protein mediated by the proteasomal pathway, whereas Nodal had no effect on Ski protein. Reduced Ski levels correlated with increased basal and TGF-β-induced Smad2/3 phosphorylation. Knockdown of endogenous Ski reduced proliferation in DU145 cells and enhanced migration of PC3 cells. We conclude that high levels of Ski expression in prostate cancer cells may be responsible for repression of TGF-β and Smad3 signaling, but Ski protein levels do not influence Nodal and Smad2 signaling. PMID:22843506

The potential role of free chitosan in bone trauma and bone cancer management.

PubMed

Tan, Mei L; Shao, Peng; Friedhuber, Anna M; van Moorst, Mallory; Elahy, Mina; Indumathy, Sivanjah; Dunstan, Dave E; Wei, Yongzhong; Dass, Crispin R

2014-09-01

Bone defects caused by fractures or cancer-mediated destruction are debilitating. Chitosan is commonly used in scaffold matrices for bone healing, but rarely as a free drug. We demonstrate that free chitosan promotes osteoblast proliferation and osteogenesis in mesenchymal stem cells, increases osteopontin and collagen I expression, and reduces osteoclastogenesis. Chitosan inhibits invasion of endothelial cells, downregulating uPA/R, MT1-MMP, cdc42 and Rac1. Better healing of bone fractures with greater trabecular bone formation was observed in mice treated with chitosan. Chitosan induces apoptosis in osteotropic prostate and breast cancer cells via caspase-2 and -3 activation, and reduces their establishment in bone. Chitosan is pro-apoptotic in osteosarcoma cells, but not their normal counterpart, osteoblasts, or chondrosarcoma cells. Systemic delivery of chitosan does not perturb angiogenesis, bone volume or instinctive behaviour in pregnant mice, but decreases foetal length and changes pancreatic secretory acini. With certain controls in place, chitosan could be useful for bone trauma management. Copyright © 2014 Elsevier Ltd. All rights reserved.

Identification and Targeting of Candidate Preexisting Lurker Cells That Give Rise to Castration-Resistant Prostate Cancer

DTIC Science & Technology

2016-10-01

cells as the pre-existing “lurker” cells in primary prostate tumors, to evaluate potential therapeutic targets in intermediate luminal progenitor cells...intermediate luminal progenitor cells as the pre-existing “lurker” cells in primary prostate tumors, to evaluate potential therapeutic targets in...candidate target expressed in CD38-lo cells and evaluated the role of CD38 in cell proliferation. No prior Hormonal *** No prior therapy

Alterations in gene expression profiles during prostate cancer progression: functional correlations to tumorigenicity and down-regulation of selenoprotein-P in mouse and human tumors.

PubMed

Calvo, Alfonso; Xiao, Nianqing; Kang, Jason; Best, Carolyn J M; Leiva, Isabel; Emmert-Buck, Michael R; Jorcyk, Cheryl; Green, Jeffrey E

2002-09-15

To identify molecular changes that occur during prostate tumor progression, we have characterized a series of prostate cancer cell lines isolated at different stages of tumorigenesis from C3(1)/Tag transgenic mice. Cell lines derived from low- and high-grade prostatic intraepithelial neoplasia, invasive carcinoma, and a lung metastasis exhibited significant differences in cell growth, tumorigenicity, invasiveness, and angiogenesis. cDNA microarray analysis of 8700 features revealed correlations between the tumorigenicity of the C3(1)/Tag-Pr cells and changes in the expression levels of genes regulating cell growth, angiogenesis, and invasion. Many changes observed in transcriptional regulation in this in vitro system are similar to those reported for human prostate cancer, as well as other types of human tumors. This analysis of expression patterns has also identified novel genes that may be involved in mechanisms of prostate oncogenesis or serve as potential biomarkers or therapeutic targets for prostate cancer. Examples include the L1-cell adhesion molecule, metastasis-associated gene (MTA-2), Rab-25, tumor-associated signal transducer-2 (Trop-2), and Selenoprotein-P, a gene that binds selenium and prevents oxidative stress. Many genes identified in the Pr-cell line model have been shown to be altered in human prostate cancer. The comprehensive microarray data provides a rational basis for using this model system for studies where alterations of specific genes or pathways are of particular interest. Quantitative real-time reverse transcription-PCR for Selenoprotein-P demonstrated a similar down-regulation of the transcript of this gene in a subset of human prostate tumors, mouse tumors, and prostate carcinoma cell lines. This work demonstrates that expression profiling in animal models may lead to the identification of novel genes involved in human prostate cancer biology.

Characterization of Desmoglein Expression in the Normal Prostatic Gland. Desmoglein 2 Is an Independent Prognostic Factor for Aggressive Prostate Cancer

PubMed Central

Barber, Alison G.; Castillo-Martin, Mireia; Bonal, Dennis M.; Rybicki, Benjamin A.; Christiano, Angela M.; Cordon-Cardo, Carlos

2014-01-01

Purpose The expression of desmogleins (DSGs), which are known to be crucial for establishing and maintaining the cell-cell adhesion required for tissue integrity, has been well characterized in the epidermis and hair follicle; however, their expression in other epithelial tissues such as prostate is poorly understood. Although downregulation of classical cadherins, such as E-cadherin, has been described in prostate cancer tissue samples, the expression of desmogleins has only been previously reported in prostate cancer cell lines. In this study we characterized desmoglein expression in normal prostate tissues, and further investigated whether Desmoglein 2 (DSG2) expression specifically can serve as a potential clinical prognostic factor for patients diagnosed with primary prostate cancer. Experimental Design We utilized immunofluorescence to examine DSG2 expression in normal prostate (n = 50) and in a clinically well-characterized cohort of prostate cancer patients (n = 414). Correlation of DSG2 expression with clinico-pathological characteristics and biochemical recurrence was analyzed to assess its clinical significance. Results These studies revealed that DSG2 and DSG4 were specifically expressed in prostatic luminal cells, whereas basal cells lack their expression. In contrast, DSG1 and DSG3 were not expressed in normal prostate epithelium. Further analyses of DSG2 expression in prostate cancer revealed that reduced levels of this biomarker were a significant independent marker of poor clinical outcome. Conclusion Here we report for the first time that a low DSG2 expression phenotype is a useful prognostic biomarker of tumor aggressiveness and may serve as an aid in identifying patients with clinically significant prostate cancer. PMID:24896103

Altered prostate epithelial development in mice lacking the androgen receptor in stromal fibroblasts.

PubMed

Yu, Shengqiang; Yeh, Chiuan-Ren; Niu, Yuanjie; Chang, Hong-Chiang; Tsai, Yu-Chieh; Moses, Harold L; Shyr, Chih-Rong; Chang, Chawnshang; Yeh, Shuyuan

2012-03-01

Androgens and the androgen receptor (AR) play important roles in the development of male urogenital organs. We previously found that mice with total AR knockout (ARKO) and epithelial ARKO failed to develop normal prostate with loss of differentiation. We have recently knocked out AR gene in smooth muscle cells and found the reduced luminal infolding and IGF-1 production in the mouse prostate. However, AR roles of stromal fibroblasts in prostate development remain unclear. To further probe the stromal fibroblast AR roles in prostate development, we generated tissue-selective knockout mice with the AR gene deleted in stromal fibroblasts (FSP-ARKO). We also used primary culture stromal cells to confirm the in vivo data and investigate mechanisms related to prostate development. The results showed cellular alterations in the FSP-ARKO mouse prostate with decreased epithelial proliferation, increased apoptosis, and decreased collagen composition. Further mechanistic studies demonstrated that FSP-ARKO mice have defects in the expression of prostate stromal growth factors. To further confirm these in vivo findings, we prepared primary cultured mouse prostate stromal cells and found knocking down the stromal AR could result in growth retardation of prostate stromal cells and co-cultured prostate epithelial cells, as well as decrease of some stromal growth factors. Our FSP-ARKO mice not only provide the first in vivo evidence in Cre-loxP knockout system for the requirement of stromal fibroblast AR to maintain the normal development of the prostate, but may also suggest the selective knockdown of stromal AR might become a potential therapeutic approach to battle prostate hyperplasia and cancer. Copyright © 2011 Wiley Periodicals, Inc.

Pomegranate Polyphenols Downregulate Expression of Androgen Synthesizing Genes in Human Prostate Cancer Cells Overexpressing the Androgen Receptor

PubMed Central

Hong, Mee Young; Seeram, Navindra P.; Heber, David

2008-01-01

Prostate cancer is dependent on circulating testosterone in its early stages and is treatable with radiation and surgery. However, recurrent prostate tumors advance to an androgen-independent state where they progress in the absence of circulating testosterone leading to metastasis and death. During the development of androgen independence, prostate cancer cells are known to increase intracellular testosterone synthesis which maintains cancer cell growth in the absence of significant amounts of circulating testosterone. Overexpression of the androgen receptor (AR) occurs in androgen-independent prostate cancer and has been proposed as another mechanism promoting the development of androgen independence. The LNCaP-AR cell line is engineered to overexpress AR but is otherwise similar to the widely studied LNCaP cell line. We have previously shown that pomegranate extracts inhibit both androgen-dependent and androgen-independent prostate cancer cell growth. In the present study, we examined the effects of pomegranate polyphenols, ellagitannin-rich extract and whole juice extract on the expression of genes for key androgen synthesizing enzymes and the AR. We measured expression of the HSD3B2, AKR1C3 and SRD5A1 genes for the respective androgen synthesizing enzymes in LNCaP, LNCaP-AR, and DU-145 human prostate cancer cells. A two-fold suppression of gene expression was considered statistically significant. Pomegranate polyphenols inhibited gene expression and AR most consistently in the LNCaP-AR cell line (P =.05). Therefore, inhibition by pomegranate polyphenols of gene expression involved in androgen synthesis enzymes and the AR may be of particular importance in androgen-independent prostate cancer cells and the subset of human prostate cancers where AR is upregulated. PMID:18479901

Myofibroblast androgen receptor expression determines cell survival in co-cultures of myofibroblasts and prostate cancer cells in vitro.

PubMed

Palethorpe, Helen M; Leach, Damien A; Need, Eleanor F; Drew, Paul A; Smith, Eric

2018-04-10

Fibroblasts express androgen receptor (AR) in the normal prostate and during prostate cancer development. We have reported that loss of AR expression in prostate cancer-associated fibroblasts is a poor prognostic indicator. Here we report outcomes of direct and indirect co-cultures of immortalised AR-positive (PShTert-AR) or AR-negative (PShTert) myofibroblasts with prostate cancer cells. In the initial co-cultures the AR-negative PC3 cell line was used so AR expression and signalling were restricted to the myofibroblasts. In both direct and indirect co-culture with PShTert-AR myofibroblasts, paracrine signalling to the PC3 cells slowed proliferation and induced apoptosis. In contrast, PC3 cells proliferated with PShTert myofibroblasts irrespective of the co-culture method. In direct co-culture PC3 cells induced apoptosis in and destroyed PShTerts by direct signalling. Similar results were seen in direct co-cultures with AR-negative DU145 and AR-positive LNCaP and C4-2B prostate cancer cell lines. The AR ligand 5α-dihydrotestosterone (DHT) inhibited the proliferation of the PShTert-AR myofibroblasts, thereby reducing the extent of their inhibitory effect on cancer cell growth. These results suggest loss of stromal AR would favour prostate cancer cell growth in vivo , providing an explanation for the clinical observation that reduced stromal AR is associated with a poorer outcome.

Myofibroblast androgen receptor expression determines cell survival in co-cultures of myofibroblasts and prostate cancer cells in vitro

PubMed Central

Palethorpe, Helen M.; Leach, Damien A.; Need, Eleanor F.; Drew, Paul A.; Smith, Eric

2018-01-01

Fibroblasts express androgen receptor (AR) in the normal prostate and during prostate cancer development. We have reported that loss of AR expression in prostate cancer-associated fibroblasts is a poor prognostic indicator. Here we report outcomes of direct and indirect co-cultures of immortalised AR-positive (PShTert-AR) or AR-negative (PShTert) myofibroblasts with prostate cancer cells. In the initial co-cultures the AR-negative PC3 cell line was used so AR expression and signalling were restricted to the myofibroblasts. In both direct and indirect co-culture with PShTert-AR myofibroblasts, paracrine signalling to the PC3 cells slowed proliferation and induced apoptosis. In contrast, PC3 cells proliferated with PShTert myofibroblasts irrespective of the co-culture method. In direct co-culture PC3 cells induced apoptosis in and destroyed PShTerts by direct signalling. Similar results were seen in direct co-cultures with AR-negative DU145 and AR-positive LNCaP and C4-2B prostate cancer cell lines. The AR ligand 5α-dihydrotestosterone (DHT) inhibited the proliferation of the PShTert-AR myofibroblasts, thereby reducing the extent of their inhibitory effect on cancer cell growth. These results suggest loss of stromal AR would favour prostate cancer cell growth in vivo, providing an explanation for the clinical observation that reduced stromal AR is associated with a poorer outcome. PMID:29721186

Distinct function of estrogen receptor α in smooth muscle and fibroblast cells in prostate development.

PubMed

Vitkus, Spencer; Yeh, Chiuan-Ren; Lin, Hsiu-Hsia; Hsu, Iawen; Yu, Jiangzhou; Chen, Ming; Yeh, Shuyuan

2013-01-01

Estrogen signaling, through estrogen receptor (ER)α, has been shown to cause hypertrophy in the prostate. Our recent report has shown that epithelial ERα knockout (KO) will not affect the normal prostate development or homeostasis. However, it remains unclear whether ERα in different types of stromal cells has distinct roles in prostate development. This study proposed to elucidate how KO of ERα in the stromal smooth muscle or fibroblast cells may interrupt cross talk between prostate stromal and epithelial cells. Smooth muscle ERαKO (smERαKO) mice showed decreased glandular infolding with the proximal area exhibiting a significant decrease. Fibroblast ERαKO mouse prostates did not exhibit this phenotype but showed a decrease in the number of ductal tips. Additionally, the amount of collagen observed in the basement membrane was reduced in smERαKO prostates. Interestingly, these phenotypes were found to be mutually exclusive among smERαKO or fibroblast ERαKO mice. Compound KO of ERα in both fibroblast and smooth muscle showed combined phenotypes from each of the single KO. Further mechanistic studies showed that IGF-I and epidermal growth factor were down-regulated in prostate smooth muscle PS-1 cells lacking ERα. Together, our results indicate the distinct functions of fibroblast vs. smERα in prostate development.

Epithelial architectural destruction is necessary for bone marrow derived cell contribution to regenerating prostate epithelium.

PubMed

Palapattu, Ganesh S; Meeker, Alan; Harris, Timothy; Collector, Michael I; Sharkis, Saul J; DeMarzo, Angelo M; Warlick, Christopher; Drake, Charles G; Nelson, William G

2006-08-01

Using various nonphysiological tissue injury/repair models numerous studies have demonstrated the capacity of bone marrow derived cells to contribute to the repopulation of epithelial tissues following damage. To investigate whether this phenomenon might also occur during periods of physiological tissue degeneration/regeneration we compared the ability of bone marrow derived cells to rejuvenate the prostate gland in mice that were castrated and then later treated with dihydrotestosterone vs mice with prostate epithelium that had been damaged by lytic virus infection. Using allogenic bone marrow grafts from female donor transgenic mice expressing green fluorescent protein transplanted into lethally irradiated males we were able to assess the contributions of bone marrow derived cells to recovery of the prostatic epithelium in 2 distinct systems, including 1) surgical castration followed 1 week later by dihydrotestosterone replacement and 2) intraprostatic viral injection. Eight to 10-week-old male C57/Bl6 mice were distributed among bone marrow donor-->recipient/prostate injury groups, including 5 with C57/Bl6-->C57/Bl6/no injury, 3 with green fluorescent protein-->C57/Bl6/no injury, 3 with green fluorescent protein-->C57/Bl6/vehicle injection, 4 with green fluorescent protein-->C57/Bl6/virus injection and 3 each with green fluorescent protein-->C57/Bl6/castration without and with dihydrotestosterone, respectively. Prostate tissues were harvested 3 weeks after dihydrotestosterone replacement or 14 days following intraprostatic viral injection. Prostate tissue immunofluorescence was performed with antibodies against the epithelial marker cytokeratin 5/8, the hematopoietic marker CD45 and green fluorescent protein. Mice that sustained prostate injury from vaccinia virus infection with concomitant severe inflammation and glandular disruption showed evidence of bone marrow derived cell reconstitution of prostate epithelium, that is approximately 4% of all green fluorescent protein positive cells in the epithelial compartment 14 days after injury expressed cytokeratin 5/8, similar to the proportion of green fluorescent protein positive cells in the prostate that no longer expressed the hematopoietic marker CD45. When prostatic degeneration/regeneration was triggered by androgen deprivation and reintroduction, no green fluorescent protein positive prostate epithelial cells were detected. These findings are consistent with a requirement for inflammation associated architectural destruction for the bone marrow derived cell contribution to the regeneration of prostate epithelium.

Tectonic-1 contributes to the growth and migration of prostate cancer cells in vitro

PubMed Central

WANG, ZHIJUN; GAO, YI; LIU, YUSHAN; CHEN, JIE; WANG, JUNKAI; GAN, SISHUN; XU, DANFENG; CUI, XINGANG

2015-01-01

Tectonic-1 (TCTN1) is an upstream gene involved in embryonic development. The aim of the present study was to investigate the effect of the TCTN1 gene on the viability and migration of prostate cancer cells. Lentivirus-mediated short hairpin RNA (shRNA) was constructed to silence the expression of TCTN1 in PC-3 and DU145 prostate cancer cells. Cell viability and proliferation were measured using MTT and colony formation assays, and the distribution of cells in phases of the cell cycle was determined using flow cytometry. Cell migration was detected using a Transwell assay. The results demonstrated that TCTN1 was widely expressed in several human prostate cancer cell lines. Knockdown of the TCTN1 gene by RNA interference markedly suppressed cell viability and colony formation in the PC-3 and DU145 cell lines. Cell cycle progression was also arrested by TCTN1 silencing. In addition, knockdown of the TCTN1 gene led to the inhibition of cell migration in the two cell lines. These findings confirmed the direct association between the TCTN1 gene and prostate cancer growth in vitro. With further understanding and clinical investigation, this indicates the potential for future development of a novel marker for early detection and gene therapy for prostate cancer. PMID:26310786

Senescence-Induced Alterations of Laminin Chain Expression Modulate Tumorigenicity of Prostate Cancer Cells1

PubMed Central

Sprenger, Cynthia C T; Drivdahl, Rolf H; Woodke, Lillie B; Eyman, Daniel; Reed, May J; Carter, William G; Plymate, Stephen R

2008-01-01

Prostate cancer is an age-associated epithelial cancer, and as such, it contributes significantly to the mortality of the elderly. Senescence is one possible mechanism by which the body defends itself against various epithelial cancers. Senescent cells alter the microenvironment, in part, through changes to the extracellular matrix. Laminins (LMs) are extracellular proteins important to both the structure and function of the microenvironment. Overexpression of the senescence-associated gene mac25 in human prostate cancer cells resulted in increased mRNA levels of the LM α4 and β2 chains compared to empty vector control cells. The purpose of this study was to examine the effects of these senescence-induced LM chains on tumorigenicity of prostate cancer cells. We created stable M12 human prostate cancer lines overexpressing either the LM α4 or β2 chain or both chains. Increased expression of either the LM α4 or β2 chain resulted in increased in vitro migration and in vivo tumorigenicity of those cells, whereas high expression of both chains led to decreased in vitro proliferation and in vivo tumorigenicity compared to M12 control cells. This study demonstrates that senescent prostate epithelial cells can alter the microenvironment and that these changes modulate progression of prostate cancer. PMID:19048114

Centrosome-Based Mechanisms, Prognostics and Therapeutics in Prostate Cancer

DTIC Science & Technology

2006-12-01

progression of prostate carcinomas. The specific aims of the original proposal were designed to test several features of this model . 1. Are centrosome...features of this model . 1. Are centrosome defects present in early prostate cancer and can they predict aggressive disease? 2. Do pericentrin’s...cells, supports this model . The ability to block the cell cycle in prostate cells by depletion of any of 14 centrosome proteins identifies several

Telomerase reverse transcriptase (TERT) is a therapeutic target of oleanane triterpenoid CDDO-Me in prostate cancer.

PubMed

Liu, Yongbo; Gao, Xiaohua; Deeb, Dorrah; Arbab, Ali S; Gautam, Subhash C

2012-12-11

Methyl-2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oate (CDDO-Me) is an synthetic oleanane triterpenoid with strong antiprolifertive and proapoptotic activities in cancer cells. However, the effect of CDDO-Me on human telomerase reverse transcriptase (hTERT) and its telomerase activity in prostate cancer cells has not been studied. We investigated the role of hTERT in mediating the anticancer activity of CDDO-Me in prostate cancer cells in vitro and in vivo. The inhibition of cell proliferation and induction of apoptosis by CDDO-Me in LNCaP and PC-3 prostate cancer cell lines was associated with the inhibition of hTERT gene expression, hTERT telomerase activity and a number of proteins that regulate hTERT transcriptionally and post-translationally. Furthermore, ablation of hTERT protein increased the sensitivity of cancer cells to CDDO-Me, whereas its overexpression rendered them resistant to CDDO-Me. In addition, inhibition of progression of preneoplastic lesions (i.e., low and high-grade prostate intraepithelial neoplasms, PINs) to adenocarcinoma of the prostate by CDDO-Me in TRAMP mice was associated with significant decrease in TERT and its regulatory proteins in the prostate gland. These data provide evidence that telomerase is a potential target of CDDO-Me for the prevention and treatment of prostate cancer.

New therapy with ASC-J9® to suppress the prostatitis via altering the cytokine CCL2 signals

PubMed Central

Lin, Shin-Jen; Chou, Fu-Ju; Lin, Chang-Yi; Chang, Hong-Chiang; Yeh, Shuyuan; Chang, Chawnshang

2016-01-01

Prostatitis is a common disease contributing to 8% of all urologist visits. Yet the etiology and effective treatment remain to be further elucidated. Using a non-obese diabetes mouse model that can be induced by autoimmune response for the spontaneous development of prostatitis, we found that injection of the ASC-J9® at 75 mg/Kg body weight/48 hours led to significantly suppressed prostatitis that was accompanied with reduction of lymphocyte infiltration with reduced CD4+ T cells in prostate. In vitro studies with a co-culture system also confirmed that ASC-J9® treatment could suppress the CD4+ T cell migration to prostate stromal cells. Mechanisms dissection indicated that ASC-J9® can suppress CD4+ T cell migration via decreasing the cytokine CCL2 in vitro and in vivo, and restoring CCL2 could interrupt the ASC-J9® suppressed CD4+ T cell migration. Together, results from in vivo and in vitro studies suggest that ASC-J9® can suppress prostatitis by altering the autoimmune response induced by CD4+ T cell recruitment, and using ASC-J9® may help us to develop a potential new therapy to battle the prostatitis with little side effects. PMID:27564257

New therapy with ASC-J9® to suppress the prostatitis via altering the cytokine CCL2 signals.

PubMed

Lin, Shin-Jen; Chou, Fu-Ju; Lin, Chang-Yi; Chang, Hong-Chiang; Yeh, Shuyuan; Chang, Chawnshang

2016-10-11

Prostatitis is a common disease contributing to 8% of all urologist visits. Yet the etiology and effective treatment remain to be further elucidated. Using a non-obese diabetes mouse model that can be induced by autoimmune response for the spontaneous development of prostatitis, we found that injection of the ASC-J9® at 75 mg/Kg body weight/48 hours led to significantly suppressed prostatitis that was accompanied with reduction of lymphocyte infiltration with reduced CD4+ T cells in prostate. In vitro studies with a co-culture system also confirmed that ASC-J9® treatment could suppress the CD4+ T cell migration to prostate stromal cells. Mechanisms dissection indicated that ASC-J9® can suppress CD4+ T cell migration via decreasing the cytokine CCL2 in vitro and in vivo, and restoring CCL2 could interrupt the ASC-J9® suppressed CD4+ T cell migration. Together, results from in vivo and in vitro studies suggest that ASC-J9® can suppress prostatitis by altering the autoimmune response induced by CD4+ T cell recruitment, and using ASC-J9® may help us to develop a potential new therapy to battle the prostatitis with little side effects.

Prostate Cancer Cell Telomere Length Variability and Stromal Cell Telomere Length as Prognostic Markers for Metastasis and Death

PubMed Central

Heaphy, Christopher M.; Yoon, Ghil Suk; Peskoe, Sarah B.; Joshu, Corinne E.; Lee, Thomas K.; Giovannucci, Edward; Mucci, Lorelei A.; Kenfield, Stacey A.; Stampfer, Meir J.; Hicks, Jessica L.; De Marzo, Angelo M.; Platz, Elizabeth A.; Meeker, Alan K.

2013-01-01

Current prognostic indicators are imperfect predictors of outcome in men with clinicallylocalized prostate cancer. Thus, tissue-based markers are urgently needed to improve treatment and surveillance decision-making. Given that shortened telomeres enhance chromosomal instability and such instability is a hallmark of metastatic lesions, we hypothesized that alterations in telomere length in the primary cancer would predict risk of progression to metastasis and prostate cancer death. To test this hypothesis, we conducted a prospective cohort study of 596 surgically treated men who participated in the ongoing Health Professionals Follow-up Study. Men who had the combination of more variable telomere length among prostate cancer cells (cell-to-cell) and shorter telomere length in prostate cancer-associated stromal cells were substantially more likely to progress to metastasis or die of their prostate cancer. These findings point to the translational potential of this telomere biomarker for prognostication and risk stratification for individualized therapeutic and surveillance strategies. PMID:23779129

Cyproterone acetate enhances TRAIL-induced androgen-independent prostate cancer cell apoptosis via up-regulation of death receptor 5.

PubMed

Chen, Linjie; Wolff, Dennis W; Xie, Yan; Lin, Ming-Fong; Tu, Yaping

2017-03-07

Virtually all prostate cancer deaths occur due to obtaining the castration-resistant phenotype after prostate cancer cells escaped from apoptosis and/or growth suppression initially induced by androgen receptor blockade. TNF-related apoptosis-inducing ligand (TRAIL) was an attractive cancer therapeutic agent due to its minimal toxicity to normal cells and remarkable apoptotic activity in tumor cells. However, most localized cancers including prostate cancer are resistant to TRAIL-induced apoptosis, thereby creating a therapeutic challenge of inducing TRAIL sensitivity in cancer cells. Herein the effects of cyproterone acetate, an antiandrogen steroid, on the TRAIL-induced apoptosis of androgen receptor-negative prostate cancer cells are reported. Cell apoptosis was assessed by both annexin V/propidium iodide labeling and poly (ADP-ribose) polymerase cleavage assays. Gene and protein expression changes were determined by quantitative real-time PCR and western blot assays. The effect of cyproterone acetate on gene promoter activity was determined by luciferase reporter assay. Cyproterone acetate but not AR antagonist bicalutamide dramatically increased the susceptibility of androgen receptor-negative human prostate cancer PC-3 and DU145 cells to TRAIL-induced apoptosis but no effects on immortalized human prostate stromal PS30 cells and human embryonic kidney HEK293 cells. Further investigation of the TRAIL-induced apoptosis pathway revealed that cyproterone acetate exerted its effect by selectively increasing death receptor 5 (DR5) mRNA and protein expression. Cyproterone acetate treatment also increased DR5 gene promoter activity, which could be abolished by mutation of a consensus binding domain of transcription factor CCAAT-enhancer-binding protein homologous protein (CHOP) in the DR5 gene promoter. Cyproterone acetate increases CHOP expression in a concentration and time-dependent manner and endoplasmic reticulum stress reducer 4-phenylbutyrate could block cyproterone acetate-induced CHOP and DR5 up-regulation. More importantly, siRNA silencing of CHOP significantly reduced cyproterone acetate-induced DR5 up-regulation and TRAIL sensitivity in prostate cancer cells. Our study shows a novel effect of cyproterone acetate on apoptosis pathways in prostate cancer cells and raises the possibility that a combination of TRAIL with cyproterone acetate could be a promising strategy for treating castration-resistant prostate cancer.

Role of androgen and vitamin D receptors in endothelial cells from benign and malignant human prostate

PubMed Central

Chung, Ivy; Montecinos, Viviana P.; Buttyan, Ralph; Johnson, Candace S.; Smith, Gary J.

2013-01-01

Forty years ago, Judah Folkman (Folkman. N Engl J Med 285: 1182–1186, 1971) proposed that tumor growth might be controlled by limiting formation of new blood vessels (angiogenesis) needed to supply a growing tumor with oxygen and nutrients. To this end, numerous “antiangiogenic” agents have been developed and tested for therapeutic efficacy in cancer patients, including prostate cancer (CaP) patients, with limited success. Despite the lack of clinical efficacy of lead anti-angiogenic therapeutics in CaP patients, recent published evidence continues to support the idea that prostate tumor vasculature provides a reasonable target for development of new therapeutics. Particularly relevant to antiangiogenic therapies targeted to the prostate is the observation that specific hormones can affect the survival and vascular function of prostate endothelial cells within normal and malignant prostate tissues. Here, we review the evidence demonstrating that both androgen(s) and vitamin D significantly impact the growth and survival of endothelial cells residing within prostate cancer and that systemic changes in circulating androgen or vitamin D drastically affect blood flow and vascularity of prostate tissue. Furthermore, recent evidence will be discussed about the expression of the receptors for both androgen and vitamin D in prostate endothelial cells that argues for direct effects of these hormone-activated receptors on the biology of endothelial cells. Based on this literature, we propose that prostate tumor vasculature represents an unexplored target for modulation of tumor growth. A better understanding of androgen and vitamin D effects on prostate endothelial cells will support development of more effective angiogenesis-targeting therapeutics for CaP patients. PMID:23548616

Tocotrienol-rich fraction of palm oil induces cell cycle arrest and apoptosis selectively in human prostate cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Janmejai K.; Department of Urology, University Hospitals of Cleveland, Cleveland, OH 44106; Gupta, Sanjay

2006-07-28

One of the requisite of cancer chemopreventive agent is elimination of damaged or malignant cells through cell cycle inhibition or induction of apoptosis without affecting normal cells. In this study, employing normal human prostate epithelial cells (PrEC), virally transformed normal human prostate epithelial cells (PZ-HPV-7), and human prostate cancer cells (LNCaP, DU145, and PC-3), we evaluated the growth-inhibitory and apoptotic effects of tocotrienol-rich fraction (TRF) extracted from palm oil. TRF treatment to PrEC and PZ-HPV-7 resulted in almost identical growth-inhibitory responses of low magnitude. In sharp contrast, TRF treatment resulted in significant decreases in cell viability and colony formation inmore » all three prostate cancer cell lines. The IC{sub 5} values after 24 h TRF treatment in LNCaP, PC-3, and DU145 cells were in the order 16.5, 17.5, and 22.0 {mu}g/ml. TRF treatment resulted in significant apoptosis in all the cell lines as evident from (i) DNA fragmentation (ii) fluorescence microscopy, and (iii) cell death detection ELISA, whereas the PrEC and PZ-HPV-7 cells did not undergo apoptosis, but showed modestly decreased cell viability only at a high dose of 80 {mu}g/ml. In cell cycle analysis, TRF (10-40 {mu}g/ml) resulted in a dose-dependent G0/G1 phase arrest and sub G1 accumulation in all three cancer cell lines but not in PZ-HPV-7 cells. These results suggest that the palm oil derivative TRF is capable of selectively inhibiting cellular proliferation and accelerating apoptotic events in prostate cancer cells. TRF offers significant promise as a chemopreventive and/or therapeutic agent against prostate cancer.« less

Comparison of the Walz Nomogram and Presence of Secondary Circulating Prostate Cells for Predicting Early Biochemical Failure after Radical Prostatectomy for Prostate Cancer in Chilean Men.

PubMed

Murray, Nigel P; Reyes, Eduardo; Orellana, Nelson; Fuentealba, Cynthia; Jacob, Omar

2015-01-01

To determine the utility of secondary circulating prostate cells for predicting early biochemical failure after radical prostatectomy for prostate cancer and compare the results with the Walz nomagram. A single centre, prospective study of men with prostate cancer treated with radical prostatectomy between 2004 and 2014 was conducted, with registration of clinical-pathological details, total serum PSA pre-surgery, Gleason score, extracapsular extension, positive surgical margins, infiltration of lymph nodes, seminal vesicles and pathological stage. Secondary circulating prostate cells were obtained using differential gel centrifugation and assessed using standard immunocytochemistry with anti-PSA. Biochemical failure was defined as a PSA >0.2ng/ml, predictive values werecalculated using the Walz nomagram and CPC detection. A total of 326 men participated, with a median follow up of 5 years; 64 had biochemical failure within two years. Extracapsular extension, positive surgical margins, pathological stage, Gleason score ≥ 8, infiltration of seminal vesicles and lymph nodes were all associated with higher risk of biochemical failure. The discriminative value for the nomogram and circulating prostate cells was high (AUC >0.80), predictive values were higher for circulating prostate cell detection, with a negative predictive value of 99%, sensitivity of 96% and specificity of 75%. The nomagram had good predictive power to identify men with a high risk of biochemical failure within two years. The presence of circulating prostate cells had the same predictive power, with a higher sensitivity and negative predictive value. The presence of secondary circulating prostate cells identifies a group of men with a high risk of early biochemical failure. Those negative for secondary CPCs have a very low risk of early biochemical failure.

Flaxseed suppressed prostatic epithelial proliferation in a rat model of benign prostatic hyperplasia.

PubMed

Said, Mahmoud M; Hassan, Nahla S; Schlicht, Michael J; Bosland, Maarten C

2015-01-01

Benign prostatic hyperplasia (BPH), a disease occurring frequently among elderly males, is a slow progressive enlargement of the fibromuscular and epithelial structures of the prostate gland. Dietary factors may influence the prostate and exert an influence on prostatic growth and disease. The current study was undertaken to investigate the protective effect of dietary flaxseed supplementation against testosterone-induced prostatic hyperplasia in male rats. Forty male Wistar rats were divided into 5 groups: (1) untreated control; (2) treatment with testosterone propionate (TP) to induce prostate enlargement; (3) TP-treated group fed a diet containing 5% milled flaxseed; (4) TP-treated group fed a diet containing 10% milled flaxseed; and (5) TP-treated group fed a diet containing 20 ppm finasteride. Treatment with TP significantly increased the absolute and relative weights of different prostatic lobes, serum testosterone (T), and testosterone/estradiol ratio, as well as prostatic vascular endothelial growth factor (VEGF) expression, RNA synthesis per cell, and epithelial cell proliferation, detected as Ki67 labeling. Histopathological examination did not reveal marked differences in acinar morphology in ventral prostate, whereas morphometric analysis showed significantly increased epithelial cell height. Co-administration of flaxseed or finasteride with TP significantly reduced prostatic VEFG, epithelial cell proliferation, and RNA/DNA ratio, along with a significant increase in serum T and testosterone/estradiol ratio compared with TP-only-treated rats. Our results indicate that flaxseed, similar to the 5α-reductase inhibitor finasteride, blocked TP-induced prostate enlargement in a rat model of BPH, likely through suppression of prostatic VEFG and cellular proliferation.

Heteronemin Is a Novel c-Met/STAT3 Inhibitor Against Advanced Prostate Cancer Cells.

PubMed

Wu, Jian-Ching; Wang, Chiang-Ting; Hung, Han-Chun; Wu, Wen-Jeng; Wu, Deng-Chyang; Chang, Min-Chi; Sung, Ping-Jyun; Chou, Yu-Wei; Wen, Zhi-Hong; Tai, Ming-Hong

2016-12-01

Prostate cancer is one of the most prevalent cancers in men worldwide. Aberrant activation of c-Met/signal transducer and activator of transcription-3 (STAT3) signaling is involved in prostate carcinogenesis, underscoring the demand for developing c-Met/STAT3-targeting drugs. Thus, we first utilized virtual screening strategy to identify STAT3-inhibiting marine compound, heteronemin, and then validated the STAT3-inhibiting function of heteronemin in prostate cancer cells. Human prostate cancer LNCaP, DU145, and PC-3 cell lines were treated with heteronemin for 24 hr, then the cell viability was evaluated by MTT assay. Flow cytometry was performed to analyze the apoptosis in heteronemin-treated cells. Western blot and quantitative real-time PCR were executed to further confirm the c-Met/STAT3 signaling inhibition by heteronemin in DU145 and PC-3 cells. In this study, we employed the virtual screening strategy to identify heteronemin, a spongean sesterterpene, as a potential STAT3 inhibitor from Taiwan marine drugs library. Application of heteronemin potently suppressed the viability and anchorage-independent growth of human prostate cancer cells. Besides, heteronemin induced apoptosis in prostate cancer cells by activation of both intrinsic (caspase-9) and extrinsic (caspase-8) apoptotic pathways. By luciferase assay and expression analysis, it was confirmed that heteronemin inhibited the phosphorylation of c-Met/src/STAT3 signaling axis, STAT3-driven luciferase activities and expression of STAT3-regulated genes including Bcl-xL, Bcl-2, and Cyclin D1. Finally, heteronemin effectively antagonized the hepatocyte growth factor (HGF)-stimulated c-Met/STAT3 activation as well as the proliferation and colonies formation in refractory prostate cancer cells. These findings suggest that heteronemin may constitute a novel c-Met/STAT3-targeting agent for prostate cancer. Prostate 76:1469-1483, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Adoptive Immunotherapy Combined with Hematopoietic Cell Transplantation as a Therapeutic Treatment of Prostate Cancer

DTIC Science & Technology

2009-07-01

prostate lysate (0.1 to 10 ug/ml) hemocyanin (0.1 to 1 ug/ml) MDCK (1 ug/ml) or canine vaccine (Parvo, rabies, and distemper at a 1:500 dilution of...We determined that a prostate cell lysate prepared from canine prostate tissue was immunogenic when injected in female dogs. In addition to the...known prostate antigen, canine prostate specific esterase (CPSE), we identified by molecular weight several other proteins against which the dog made IgG

Osteoblast-Secreted Factors Mediate Dormancy of Metastatic Prostate Cancer in the Bone via Activation of the TGFβRIII-p38MAPK-pS249/T252RB Pathway.

PubMed

Yu-Lee, Li-Yuan; Yu, Guoyu; Lee, Yu-Chen; Lin, Song-Chang; Pan, Jing; Pan, Tianhong; Yu, Kai-Jie; Liu, Bin; Creighton, Chad J; Rodriguez-Canales, Jaime; Villalobos, Pamela A; Wistuba, Ignacio I; de Nadal, Eulalia; Posas, Francesc; Gallick, Gary E; Lin, Sue-Hwa

2018-06-01

Bone metastasis from prostate cancer can occur years after prostatectomy, due to reactivation of dormant disseminated tumor cells (DTC) in the bone, yet the mechanism by which DTCs are initially induced into a dormant state in the bone remains to be elucidated. We show here that the bone microenvironment confers dormancy to C4-2B4 prostate cancer cells, as they become dormant when injected into mouse femurs but not under the skin. Live-cell imaging of dormant cells at the single-cell level revealed that conditioned medium from differentiated, but not undifferentiated, osteoblasts induced C4-2B4 cellular quiescence, suggesting that differentiated osteoblasts present locally around the tumor cells in the bone conferred dormancy to prostate cancer cells. Gene array analyses identified GDF10 and TGFβ2 among osteoblast-secreted proteins that induced quiescence of C4-2B4, C4-2b, and PC3-mm2, but not 22RV1 or BPH-1 cells, indicating prostate cancer tumor cells differ in their dormancy response. TGFβ2 and GDF10 induced dormancy through TGFβRIII to activate phospho-p38MAPK, which phosphorylates retinoblastoma (RB) at the novel N-terminal S249/T252 sites to block prostate cancer cell proliferation. Consistently, expression of dominant-negative p38MAPK in C4-2b and C4-2B4 prostate cancer cell lines abolished tumor cell dormancy both in vitro and in vivo Lower TGFβRIII expression in patients with prostate cancer correlated with increased metastatic potential and decreased survival rates. Together, our results identify a dormancy mechanism by which DTCs are induced into a dormant state through TGFβRIII-p38MAPK-pS249/pT252-RB signaling and offer a rationale for developing strategies to prevent prostate cancer recurrence in the bone. Significance: These findings provide mechanistic insights into the dormancy of metastatic prostate cancer in the bone and offer a rationale for developing strategies to prevent prostate cancer recurrence in the bone. Cancer Res; 78(11); 2911-24. ©2018 AACR . ©2018 American Association for Cancer Research.

Up-Regulation of Follistatin-Like 1 By the Androgen Receptor and Melanoma Antigen-A11 in Prostate Cancer.

PubMed

Su, Shifeng; Parris, Amanda B; Grossman, Gail; Mohler, James L; Wang, Zengjun; Wilson, Elizabeth M

2017-04-01

High affinity androgen binding to the androgen receptor (AR) activates genes required for male sex differentiation and promotes the development and progression of prostate cancer. Human AR transcriptional activity involves interactions with coregulatory proteins that include primate-specific melanoma antigen-A11 (MAGE-A11), a coactivator that increases AR transcriptional activity during prostate cancer progression to castration-resistant/recurrent prostate cancer (CRPC). Microarray analysis and quantitative RT-PCR were performed to identify androgen-regulated MAGE-A11-dependent genes in LAPC-4 prostate cancer cells after lentivirus shRNA knockdown of MAGE-A11. Chromatin immunoprecipitation was used to assess androgen-dependent AR recruitment, and immunocytochemistry to localize an androgen-dependent protein in prostate cancer cells and tissue and in the CWR22 human prostate cancer xenograft. Microarray analysis of androgen-treated LAPC-4 prostate cancer cells indicated follistatin-like 1 (FSTL1) is up-regulated by MAGE-A11. Androgen-dependent up-regulation of FSTL1 was inhibited in LAPC-4 cells by lentivirus shRNA knockdown of AR or MAGE-A11. Chromatin immunoprecipitation demonstrated AR recruitment to intron 10 of the FSTL1 gene that contains a classical consensus androgen response element. Increased levels of FSTL1 protein in LAPC-4 cells correlated with higher levels of MAGE-A11 relative to other prostate cancer cells. FSTL1 mRNA levels increased in CRPC and castration-recurrent CWR22 xenografts in association with predominantly nuclear FSTL1. Increased nuclear localization of FSTL1 in prostate cancer was suggested by predominantly cytoplasmic FSTL1 in benign prostate epithelial cells and predominantly nuclear FSTL1 in epithelial cells in CRPC tissue and the castration-recurrent CWR22 xenograft. AR expression studies showed nuclear colocalization of AR and endogenous FSTL1 in response to androgen. AR and MAGE-A11 cooperate in the up-regulation of FSTL1 to promote growth and progression of CRPC. Prostate 77:505-516, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Interaction between Trichomonas vaginalis and the Prostate Epithelium.

PubMed

Kim, Jung-Hyun; Han, Ik-Hwan; Kim, Sang-Su; Park, Soon-Jung; Min, Duk-Young; Ahn, Myoung-Hee; Ryu, Jae-Sook

2017-04-01

Most men infected with Trichomonas vaginalis are asymptomatic and can remain undiagnosed and untreated. This has been hypothesized to result in chronic persistent prostatic infection. Adhesion of the protozoan organisms to mucosal cells is considered a first and prerequisite step for T. vaginalis infection. Adhesion of T. vaginalis to prostate epithelial cells has not yet been observed; however, there are several reports about inflammation of prostate epithelial cells induced by T. vaginalis . The aim of this study was to investigate whether adhesion and cytotoxicity of T. vaginalis are involved in inflammation of prostate epithelial cells. When RWPE-1 cells were infected with T. vaginalis (1:0.4 or 1:4), adhesion of T. vaginalis continuously increased for 24 hr or 3 hr, respectively. The cytotoxicity of prostate epithelial cells infected with T. vaginalis (RWPE-1: T. vaginalis =1:0.4) increased at 9 hr; at an infection ratio of 1:4, cytotoxicity increased after 3 hr. When the RWPE-1 to T. vaginalis ratio was 1:0.4 or 1:4, production of IL-1β, IL-6, CCL2, and CXCL8 also increased. Epithelial-mesenchymal transition (EMT) was verified by measuring decreased E-cadherin and increased vimentin expression at 24 hr and 48 hr. Taken together, the results indicate that T. vaginalis adhered to prostate epithelial cells, causing cytotoxicity, pro-inflammatory cytokine production, and EMT. Our findings suggest for the first time that T. vaginalis may induce inflammation via adhesion to normal prostate epithelial cells.

The effect of LHRH antagonist cetrorelix in crossover conditioned media from epithelial (BPH-1) and stromal (WPMY-1) prostate cells.

PubMed

Siejka, A; Schally, A V; Barabutis, N

2014-01-01

Stromal cells strictly modulate the differentiation of the normal prostate epithelium. In benign prostatic hyperplasia (BPH) tissue, the ratio of stromal to epithelial cells reaches a 5:1 ratio. In this study, we evaluated the effects of crossover conditioned media (CM) of stromal and epithelial prostate cells before and after treatment with LHRH antagonist Cetrorelix. WPMY-1 human prostate stromal cells and BPH-1 human benign prostatic hyperplasia cells were cultured in vitro and the effects of crossover conditioned media (CM) from those cells were studied. We evaluated the effect of Cetrorelix on the expression of PCNA and p53 in those cells. We then studied the effect of Cetrorelix on BPH-1 cells cultured with the CM from WPMY-1 cells, as well as the mechanisms which govern these interactions. CM from WPMY-1 cells strongly stimulated the proliferation of BPH-1 cells in a dose dependent manner, while CM from BPH-1 cells only slightly increased the proliferation of WPMY-1 cells. Cetrorelix inhibited the proliferation of both cell lines and the expression of PCNA, while the expression of p53 was increased. Cetrorelix also inhibited the proliferation of BPH-1 cells stimulated with the CM from WPMY-1 cells. In the crossover experiment, conditioned media from WPMY-1 and BPH-1 cells increased the expression of phosphorylated ERK1/2 and STAT3. Our results support previous observations on the bidirectional stromal-epithelial interactions in prostate gland and shed more light on the mechanistic action of those effects. Our study strongly supports the hypothesis that LHRH antagonists may be beneficial for BPH prevention and treatment. © Georg Thieme Verlag KG Stuttgart · New York.

Molecular Validation of PACE4 as a Target in Prostate Cancer12

PubMed Central

D'Anjou, François; Routhier, Sophie; Perreault, Jean-Pierre; Latil, Alain; Bonnel, David; Fournier, Isabelle; Salzet, Michel; Day, Robert

2011-01-01

Prostate cancer remains the single most prevalent cancer in men. Standard therapies are still limited and include androgen ablation that initially causes tumor regression. However, tumor cells eventually relapse and develop into a hormone-refractory prostate cancer. One of the current challenges in this disease is to define new therapeutic targets, which have been virtually unchanged in the past 30 years. Recent studies have suggested that the family of enzymes known as the proprotein convertases (PCs) is involved in various types of cancers and their progression. The present study examined PC expression in prostate cancer and validates one PC, namely PACE4, as a target. The evidence includes the observed high expression of PACE4 in all different clinical stages of human prostate tumor tissues. Gene silencing studies targeting PACE4 in the DU145 prostate cancer cell line produced cells (cell line 4-2) with slower proliferation rates, reduced clonogenic activity, and inability to grow as xenografts in nude mice. Gene expression and proteomic profiling of the 4-2 cell line reveals an increased expression of known cancer-related genes (e.g., GJA1, CD44, IGFBP6) that are downregulated in prostate cancer. Similarly, cancer genes whose expression is decreased in the 4-2 cell line were upregulated in prostate cancer (e.g., MUC1, IL6). The direct role of PACE4 in prostate cancer is most likely through the upregulated processing of growth factors or through the aberrant processing of growth factors leading to sustained cancer progression, suggesting that PACE4 holds a central role in prostate cancer. PMID:21633671

Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

PubMed

Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

2011-10-01

Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

Epidermal Growth Factor Increases LRF/Pokemon Expression in Human Prostate Cancer Cells

PubMed Central

Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K.

2011-01-01

Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. PMID:21640721

A receptor tyrosine kinase, UFO/Axl, and other genes isolated by a modified differential display PCR are overexpressed in metastatic prostatic carcinoma cell line DU145.

PubMed

Jacob, A N; Kalapurakal, J; Davidson, W R; Kandpal, G; Dunson, N; Prashar, Y; Kandpal, R P

1999-01-01

We have used a modified differential display PCR protocol for isolating 3' restriction fragments of cDNAs specifically expressed or overexpressed in metastatic prostate carcinoma cell line DU145. Several cDNA fragments were identified that matched to milk fat globule protein, UFO/Axl, a receptor tyrosine kinase, human homologue of a Xenopus maternal transcript, laminin and laminin receptor, human carcinoma-associated antigen, and some expressed sequence tags. The transcript for milk fat globule protein, a marker protein shown to be overexpressed in breast tumors, was elevated in DU145 cells. The expression of UFO/Axl, a receptor tyrosine kinase, was considerably higher in DU145 cells as compared to normal prostate cells and prostatic carcinoma cell line PC-3. The overexpression of UFO oncogene in DU145 cells is discussed in the context of prostate cancer metastasis.

Carprofen Induction of p75NTR Dependent Apoptosis via the p38 MAPK Pathway in Prostate Cancer Cells

PubMed Central

Khwaja, Fatima S.; Quann, Emily J.; Pattabiraman, Nagarajan; Wynne, Shehla; Djakiew, Daniel

2008-01-01

The p75NTR functions as a tumor suppressor in prostate epithelial cells, where its expression declines with progression to malignant cancer. Previously, we demonstrated that treatment with R-flurbiprofen or ibuprofen induced p75NTR expression in several prostate cancer cell lines leading to p75NTR mediated decreased survival. Utilizing the 2-phenyl propionic acid moiety of these profens as a pharmacophore, we screened an in silico data base of 30 million compounds and identified carprofen as having an order of magnitude greater activity for induction of p75NTR levels and inhibition of cell survival. Prostate (PC-3, DU-145) and bladder (T24) cancer cells were more sensitive to carprofen induction of p75NTR associated loss of survival than breast (MCF7) and fibroblast (3T3) cells. Transfection of prostate cell lines with a dominant negative form of p75NTR prior to carprofen treatment partially rescued cell survival demonstrating a cause and effect relationship between carprofen induction of p75NTR levels and inhibition of survival. Carprofen induced apoptotic nuclear fragmentation in prostate but not in MCF7 and 3T3 cells. Furthermore, siRNA knockdown of the p38 MAPK protein prevented induction of p75NTR by carprofen in both prostate cell lines. Carprofen treatment induced phosphorylation of p38 MAPK as early as within 1 minute. Expression of a dominant negative form of MK2, the kinase downstream of p38 MAPK frequently associated with signaling cascades leading to apoptosis, prevented carprofen induction of the p75NTR protein. Collectively, we identify carprofen as a highly potent profen capable of inducing p75NTR dependent apoptosis via the p38 MAPK pathway in prostate cancer cells. PMID:18974393

Synthesis of magnetic molecularly imprinted polymers with excellent biocompatibility for the selective separation and inhibition of testosterone in prostate cancer cells.

PubMed

Tang, Xiaoshuang; Li, Feng; Jia, Jing; Yang, Chao; Liu, Wei; Jin, Ben; Wang, Xinyang; Gao, Ruixia; He, Dalin; Guo, Peng

2017-01-01

Androgen plays an important role in the progression of prostate cancer. In the present study, novel magnetic molecularly imprinted polymers (MMIPs) with good biocompatibility were produced for the selective separation and inhibition of testosterone in prostate cancer cells. MMIPs were prepared by using magnetic nanospheres, gelatin, and testosterone as the supporting materials, functional monomer, and the template molecule, respectively. The characterization of the resultant products was investigated by transmission electron microscopy, X-ray diffraction, and vibrating sample magnetometry. To test whether MMIPs can remove testosterone in biologic samples, human LNCaP (androgen-dependent) and C4-2 (androgen-independent) prostate cancer cells were selected as cell models. The translocation of androgen receptor (AR) was detected by immunofluorescence assay, and the expression of PSA mRNA was detected by real-time quantitative polymerase chain reaction analysis. Cell flow cytometry analysis was performed to detect cell cycle arrest. The synthesized nanomaterials (MMIPs) possessed high crystallinity, satisfactory superparamagnetic properties, and uniform imprinted shell, and exhibited high adsorption capacity, fast kinetics, and high selectivity for testosterone. Moreover, the obtained imprinted nanomaterials could selectively enrich and detect testosterone in the LNCaP cell samples as a solid-phase extractant coupled with high-performance liquid chromatography. In addition, the MMIPs could freely enter prostate cancer cells and suppress the translocation of AR into the cell nucleus. We further found that MMIPs inhibited upregulation of AR downstream target genes in LNCaP and C4-2 cells; also, MMIPs inhibited cell growth and induced obvious cell cycle arrest in androgen-dependent LNCaP cells, but had no obvious effect on androgen-independent C4-2 cells. Our results indicate that the obtained imprinted nanomaterials can specifically and effectively bind testosterone and recover it from prostate cancer cells. Moreover, the MMIPs can freely enter prostate cancer cells and block the activation of testosterone-AR pathway. Thus, the MMIPs may be a new option for antiandrogen therapy in prostate cancer.

Total triterpenoids from Ganoderma Lucidum suppresses prostate cancer cell growth by inducing growth arrest and apoptosis.

PubMed

Wang, Tao; Xie, Zi-ping; Huang, Zhan-sen; Li, Hao; Wei, An-yang; Di, Jin-ming; Xiao, Heng-jun; Zhang, Zhi-gang; Cai, Liu-hong; Tao, Xin; Qi, Tao; Chen, Di-ling; Chen, Jun

2015-10-01

In this study, one immortalized human normal prostatic epithelial cell line (BPH) and four human prostate cancer cell lines (LNCaP, 22Rv1, PC-3, and DU-145) were treated with Ganoderma Lucidum triterpenoids (GLT) at different doses and for different time periods. Cell viability, apoptosis, and cell cycle were analyzed using flow cytometry and chemical assays. Gene expression and binding to DNA were assessed using real-time PCR and Western blotting. It was found that GLT dose-dependently inhibited prostate cancer cell growth through induction of apoptosis and cell cycle arrest at G1 phase. GLT-induced apoptosis was due to activation of Caspases-9 and -3 and turning on the downstream apoptotic events. GLT-induced cell cycle arrest (mainly G1 arrest) was due to up-regulation of p21 expression at the early time and down-regulation of cyclin-dependent kinase 4 (CDK4) and E2F1 expression at the late time. These findings demonstrate that GLT suppresses prostate cancer cell growth by inducing growth arrest and apoptosis, which might suggest that GLT or Ganoderma Lucidum could be used as a potential therapeutic drug for prostate cancer.

High activity of mitochondrial glycerophosphate dehydrogenase and glycerophosphate-dependent ROS production in prostate cancer cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chowdhury, Subir K.R.; Department of Pathology and Molecular Medicine, McMaster University, 1200 Main St. West, Hamilton, Ont., L8N 3Z5; Gemin, Adam

Most malignant cells are highly glycolytic and produce high levels of reactive oxygen species (ROS) compared to normal cells. Mitochondrial glycerophosphate dehydrogenase (mGPDH) participates in the reoxidation of cytosolic NADH by delivering reducing equivalents from this molecule into the electron transport chain, thus sustaining glycolysis. Here, we investigate the role of mGPDH in maintaining an increased rate of glycolysis and evaluate glycerophosphate-dependent ROS production in prostate cancer cell lines (LNCaP, DU145, PC3, and CL1). Immunoblot, polarographic, and spectrophotometric analyses revealed that mGPDH abundance and activity was significantly elevated in prostate cancer cell lines when compared to the normal prostate epithelialmore » cell line PNT1A. Furthermore, both the glycolytic capacity and glycerophosphate-dependent ROS production was increased 1.68- to 4.44-fold and 5- to 7-fold, respectively, in prostate cancer cell lines when compared to PNT1A cells. Overall, these data demonstrate that mGPDH is involved in maintaining a high rate of glycolysis and is an important site of electron leakage leading to ROS production in prostate cancer cells.« less

Prevalence of Prostate Cancer Metastases after Intravenous Inoculation Provides Clues into the Molecular Basis of Dormancy in the Bone Marrow Microenvironment1

PubMed Central

Jung, Younghun; Shiozawa, Yusuke; Wang, Jingcheng; McGregor, Natalie; Dai, Jinlu; Park, Serk In; Berry, Janice E; Havens, Aaron M; Joseph, Jeena; Kim, Jin Koo; Patel, Lalit; Carmeliet, Peter; Daignault, Stephanie; Keller, Evan T; McCauley, Laurie K; Pienta, Kenneth J; Taichman, Russell S

2012-01-01

Bone is the preferred metastasis site of advanced prostate cancer (PCa). Using an in vivo murine model of human PCa cell metastasis to bone, we noted that the majority of animals that develop skeletal metastasis have either spinal lesions or lesions in the bones of the hindlimb. Much less frequently, lesions develop in the bones of the forelimb. We therefore speculated whether the environment of the forelimb bones is not permissive for the growth of PCa. Consequently, data on tumor prevalence were normalized to account for the number of PCa cells arriving after intravascular injection, marrow cellularity, and number of hematopoietic stem cell niches. None of these factors were able to account for the observed differences in tumor prevalence. An analysis of differential gene and protein levels identified that growth arrest specific-6 (GAS6) levels were significantly greater in the forelimb versus hindlimb bone marrow. When murine RM1 cells were implanted into subcutaneous spaces in immune competent animals, tumor growth in the GAS6-/- animals was greater than in GAS6+/+ wild-type animals. In an osseous environment, the human PC3 cell line grew significantly better in vertebral body transplants (vossicles) derived from GAS6-/- animals than in vossicles derived from GAS6+/+ animals. Together, these data suggest that the differences in tumor prevalence after intravascular inoculation are a useful model to study the molecular basis of tumor dormancy. Importantly, these data suggest that therapeutic manipulation of GAS6 levels may prove useful as a therapy for metastatic disease. PMID:22745589

Berberine-induced apoptosis in human prostate cancer cells is initiated by reactive oxygen species generation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meeran, Syed M.; Katiyar, Suchitra; Katiyar, Santosh K.

2008-05-15

Phytochemicals show promise as potential chemopreventive or chemotherapeutic agents against various cancers. Here we report the chemotherapeutic effects of berberine, a phytochemical, on human prostate cancer cells. The treatment of human prostate cancer cells (PC-3) with berberine induced dose-dependent apoptosis but this effect of berberine was not seen in non-neoplastic human prostate epithelial cells (PWR-1E). Berberine-induced apoptosis was associated with the disruption of the mitochondrial membrane potential, release of apoptogenic molecules (cytochrome c and Smac/DIABLO) from mitochondria and cleavage of caspase-9,-3 and PARP proteins. This effect of berberine on prostate cancer cells was initiated by the generation of reactive oxygenmore » species (ROS) irrespective of their androgen responsiveness, and the generation of ROS was through the increased induction of xanthine oxidase. Treatment of cells with allopurinol, an inhibitor of xanthine oxidase, inhibited berberine-induced oxidative stress in cancer cells. Berberine-induced apoptosis was blocked in the presence of antioxidant, N-acetylcysteine, through the prevention of disruption of mitochondrial membrane potential and subsequently release of cytochrome c and Smac/DIABLO. In conclusion, the present study reveals that the berberine-mediated cell death of human prostate cancer cells is regulated by reactive oxygen species, and therefore suggests that berberine may be considered for further studies as a promising therapeutic candidate for prostate cancer.« less

[Bushen Huoxue Fang promotes the apoptosis of epithelial cells in the prostatic ductal system of rats with benign prostatic hyperplasia].

PubMed

Sun, Jie; Li, Qiu-Fen; Tian, Dai-Zhi; Jiang, Shao-Bo; Wu, Xian-De; Qiu, Shun-An; Ren, Xiao-Gang; Li, Yu-Bing

2014-09-01

To investigate the effects of Bushen Huoxue Fang (BSHX) on the apoptosis of epithelial cells in the prostatic ductal system of rats with benign prostatic hyperplasia (BPH) and its possible action mechanism. One hundred 3- month-old male Wistar rats were randomly divided into four groups of equal number (control, castrated, BPH model, and BSHX). BPH models were made by subcutaneous injection of testosterone following castration; the rats in the BSHX group were treated intragastrically with BSHX at 2.34 g/ml after modeling, while those in the other two groups with equal volume of saline, all for 37 days. On the 38th day, all the rats were sacrificed and their prostates harvested for detection of the distribution of TGF-beta1 and alpha-actin and the count of positive cells in the prostatic ductal system by immunohistochemical staining. The apoptosis rate of epithelial cells in the prostatic ductal system was determined by TUNEL assay. The expression of TGF-beta1 was significantly increased in the rats of the BSHX group as compared with the BPH models in both the proximal prostatic duct ([15.28 +/- 4.30]% vs [36.42 +/- 8.10]%, P < 0.01) and the distal prostatic duct ([4.42 +/- 2.07]% vs [8.71 +/- 2.28 ]%, P < 0.05), while the expression of alpha-actin in the proximal duct was remarkably higher in the BSHX-treated rats than in the models ([28.14 +/- 7.43]% vs [18.28 +/- 4.07]%, P < 0.01), but lower than in the control animals ([33.57 +/- 6.85]%, P < 0.05). Compared with the control group, the BPH models and BSHX-treated rats both exhibited markedly decreased apoptosis of epithelial cells in the proximal prostatic duct ([39.42 +/- 9.20]% vs [3.86 +/- 1.34]%, P < 0.01, and [31.14 +/- 5.64]%, P < 0.01) and distal prostatic duct ([17.60 +/- 4.86]% vs [3.07 +/- 1.14]%, P < 0.01, and [12.37 +/- 2.25]%, P < 0.05). The apoptosis rate of epithelial cells in the prostatic ductal system was significantly higher in the BSHX-treated rats than in the BPH models (P < 0.01). By upregulating the expression of TGF-beta, BSHX can suppress the reduction of smooth muscle cells in the proximal prostatic duct, promote the apoptosis of prostatic epithelial cells, and thus effectively inhibit benign prostatic hyperplasia.