Science.gov

Sample records for protease inhibitor-containing haart

  1. Discovery of MK-8718, an HIV Protease Inhibitor Containing a Novel Morpholine Aspartate Binding Group.

    PubMed

    Bungard, Christopher J; Williams, Peter D; Ballard, Jeanine E; Bennett, David J; Beaulieu, Christian; Bahnck-Teets, Carolyn; Carroll, Steve S; Chang, Ronald K; Dubost, David C; Fay, John F; Diamond, Tracy L; Greshock, Thomas J; Hao, Li; Holloway, M Katharine; Felock, Peter J; Gesell, Jennifer J; Su, Hua-Poo; Manikowski, Jesse J; McKay, Daniel J; Miller, Mike; Min, Xu; Molinaro, Carmela; Moradei, Oscar M; Nantermet, Philippe G; Nadeau, Christian; Sanchez, Rosa I; Satyanarayana, Tummanapalli; Shipe, William D; Singh, Sanjay K; Truong, Vouy Linh; Vijayasaradhi, Sivalenka; Wiscount, Catherine M; Vacca, Joseph P; Crane, Sheldon N; McCauley, John A

    2016-07-14

    A novel HIV protease inhibitor was designed using a morpholine core as the aspartate binding group. Analysis of the crystal structure of the initial lead bound to HIV protease enabled optimization of enzyme potency and antiviral activity. This afforded a series of potent orally bioavailable inhibitors of which MK-8718 was identified as a compound with a favorable overall profile.

  2. In vitro anti-human immunodeficiency virus (HIV) activities of transition state mimetic HIV protease inhibitors containing allophenylnorstatine.

    PubMed Central

    Kageyama, S; Mimoto, T; Murakawa, Y; Nomizu, M; Ford, H; Shirasaka, T; Gulnik, S; Erickson, J; Takada, K; Hayashi, H

    1993-01-01

    Transition state mimetic tripeptide human immunodeficiency virus (HIV) protease inhibitors containing allophenylnorstatine [(2S,3S)-3-amino-2-hydroxy-4-phenylbutyric acid] were synthesized and tested for activity against HIV in vitro. Two compounds, KNI-227 and KNI-272, which were highly potent against HIV protease with little inhibition of other aspartic proteases, showed the most potent activity against the infectivity and cytopathic effect of a wide spectrum of HIV strains. As tested in target CD4+ ATH8 cells, the 50% inhibitory concentrations of KNI-227 against HIV type 1 LAI (HIV-1LAI), HIV-1RF, HIV-1MN, and HIV-2ROD were 0.1, 0.02, 0.03, and 0.1 microM, respectively, while those of KNI-272 were 0.1, 0.02, 0.04, and 0.1 microM, respectively. Both agents completely blocked the replication of 3'-azido-2',3'-dideoxythymidine-sensitive and -insensitive clinical HIV-1 isolates at 0.08 microM as tested in target phytohemagglutinin-activated peripheral blood mononuclear cells. The ratios of 50% cytotoxic concentrations to 50% inhibitory concentrations for KNI-227 and KNI-272 were approximately 2,500 and > 4,000, respectively, as assessed in peripheral blood mononuclear cells. Both compounds blocked the posttranslational cleavage of the p55 precursor protein to generate the mature p24 Gag protein in stably HIV-1-infected cells. The n-octanol-water partition coefficients of KNI-227 and KNI-272 were high, with log Po/w values of 3.79 and 3.56, respectively. Degradation of KNI-227 and KNI-272 in the presence of pepsin (1 mg/ml, pH 2.2) at 37 degrees C for 24 h was negligible. Current data warrant further careful investigations toward possible clinical application of these two novel compounds. Images PMID:8494379

  3. Design, Synthesis, Biological Evaluation and X-ray Structural Studies of HIV-1 Protease Inhibitors Containing Substituted Fused-Tetrahydropyranyl Tetrahydrofuran as P2-Ligands

    PubMed Central

    Ghosh, Arun K.; Martyr, Cuthbert D.; Kassekert, Luke A.; Nyalapatla, Prasanth R.; Steffey, Melinda; Agniswamy, Johnson; Wang, Yuan-Fang; Weber, Irene T.; Amano, Masayuki; Mitsuya, Hiroaki

    2015-01-01

    Design, synthesis, biological and X-ray crystallographic studies of a series of potent HIV-1 protease inhibitors are described. Various polar functionalities have been incorporated on the tetrahydropyranyl-tetrahydrofuran-derived P2 ligand to interact with the backbone atoms in the S2 subsite. The majority of the inhibitors showed very potent enzyme inhibitory and antiviral activity. Two high-resolution X-ray structures of 30b- and 30j-bound HIV-1 protease provide insight into ligand-binding site interactions. In particular, the polar functionalities on the P2 ligand appear to form unique hydrogen bonds with Gly48 amide NH and amide carbonyl groups in the flap region. PMID:26462551

  4. Increased VLDL-apoB and IDL-apoB production rates in nonlipodystrophic HIV-infected patients on a protease inhibitor-containing regimen: a stable isotope kinetic study.

    PubMed

    Petit, Jean Michel; Duong, Michel; Florentin, Emmanuel; Duvillard, Laurence; Chavanet, Pascal; Brun, Jean Marcel; Portier, Henri; Gambert, Philippe; Verges, Bruno

    2003-09-01

    The aim of this study was to identify the first abnormalities of apolipoprotein B (apoB) metabolism in HIV-infected patients treated by antiretroviral therapy (ART) with protease inhibitors (PIs). The influence of ART on the metabolism of apoB in VLDL, IDL, and LDL was investigated in six patients receiving dual nucleoside reverse transcriptase inhibitors (NRTIs) and PI, and in five patients receiving NRTI and nevirapine. None of the patients had lipodystrophy. The study was performed in the fed state. Each subject received an intravenous injection of a 0.7 mg.kg-1 bolus of l-[1-13C]leucine, immediately followed by a 16 h constant infusion at 0.7 mg.kg-1.h-1. The VLDL- and IDL-apoB concentrations were significantly higher in PI-treated patients compared to non-PI-treated patients. The VLDL-apoB and IDL-apoB production rates were markedly higher in PI-treated patients compared to non-PI-treated patients (54.5 +/- 30.1 vs. 30.9 +/- 8.4 mg.kg-1.d-1, P = 0.04; and 43.5 +/- 20.0 vs. 18.7 +/- 7.8 mg.kg-1.d-1, P = 0.04, respectively). In conclusion, our study shows that patients receiving ART with PI present altered metabolism of the VLDL-IDL-LDL chain compared with patients treated without PI. These data confirm that PI therapy is associated with a physiopathological mechanism for dyslipidemia in addition to the effect of lipodystrophy on lipid metabolism.

  5. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  6. Benefit of therapeutic drug monitoring of protease inhibitors in HIV-infected patients depends on PI used in HAART regimen--ANRS 111 trial

    PubMed Central

    Duval, Xavier; Mentré, France; Rey, Elisabeth; Auleley, Solange; Peytavin, Gilles; Biour, Michel; Métro, Annie; Goujard, Cecile; Taburet, Anne-Marie; Lascoux, Cecile; Panhard, Xaviere; Tréluyer, Jean-Marc; Salmon-Céron, Dominique

    2009-01-01

    Due to high inter-patient variability, and efficacy-concentration and toxicity-concentration relationships, optimization of HIV-protease inhibitor doses based on plasma concentrations could be beneficial. During a 48-week open prospective non-randomized interventional study of 115 protease inhibitor-naïve patients initiating an indinavir/ritonavir or lopinavir/ritonavir or nelfinavir containing therapy, protease inhibitor dose was modified when plasma trough concentrations (Ctrough) at week 2, 8, 16 and 24 were outside predefined optimal concentration ranges. Failure of the strategy was defined as the proportions of patients with HIV-RNA above 200 copies/ml from week 24 to 48 and/or experiencing grade 2, 3 or 4 PI-related adverse events during the study; proportion of patients with last Ctrough measurement outside the concentration range was determined at each visit. Virological failure and/or occurrence of adverse event were observed in 37/94 assessable patients (39% CI95%: 29.4–50.0). In the on-treatment analysis, failure of the strategy was noted in 16% of indinavir/r or lopinavir/r treated patients (8/51; CI95% 7.0–28.6; virological failure: 2; adverse event: 6) but in 44% of nelfinavir-treated patients (11/25; CI95%: 24.4–65.1; virological failure: 10; adverse event: 1); Ctrough concentrations outside the range were less frequent at the last measurement than at W2 (41% versus 66%; p < 0.05) with proportions of 35% for indinavir/r or lopinavir/r treated patients, but 57% for nelfinavir treated patients. The proposed strategy of therapeutic drug monitoring may be beneficial to indinavir/r and lopinavir/r-treated patients, but for nelfinavir failed to move concentrations into the predefined range and to produce the expected virological success. PMID:19709326

  7. Premature and accelerated aging: HIV or HAART?

    PubMed Central

    Smith, Reuben L.; de Boer, Richard; Brul, Stanley; Budovskaya, Yelena; van Spek, Hans

    2013-01-01

    Highly active antiretroviral therapy (HAART) has significantly increased life expectancy of the human immunodeficiency virus (HIV)-positive population. Nevertheless, the average lifespan of HIV-patients remains shorter compared to uninfected individuals. Immunosenescence, a current explanation for this difference invokes heavily on viral stimulus despite HAART efficiency in viral suppression. We propose here that the premature and accelerated aging of HIV-patients can also be caused by adverse effects of antiretroviral drugs, specifically those that affect the mitochondria. The nucleoside reverse transcriptase inhibitor (NRTI) antiretroviral drug class for instance, is known to cause depletion of mitochondrial DNA via inhibition of the mitochondrial specific DNA polymerase-γ. Besides NRTIs, other antiretroviral drug classes such as protease inhibitors also cause severe mitochondrial damage by increasing oxidative stress and diminishing mitochondrial function. We also discuss important areas for future research and argue in favor of the use of Caenorhabditis elegans as a novel model system for studying these effects. PMID:23372574

  8. Oral innate immunity in HIV infection in HAART era.

    PubMed

    Nittayananta, Wipawee; Tao, Renchuan; Jiang, Lanlan; Peng, Yuanyuan; Huang, Yuxiao

    2016-01-01

    Oral innate immunity, an important component in host defense and immune surveillance in the oral cavity, plays a crucial role in the regulation of oral health. As part of the innate immune system, epithelial cells lining oral mucosal surfaces not only provide a physical barrier but also produce different antimicrobial peptides, including human β-defensins (hBDs), secretory leukocyte protease inhibitor (SLPI), and various cytokines. These innate immune mediators help in maintaining oral homeostasis. When they are impaired either by local or systemic causes, various oral infections and malignancies may be developed. Human immunodeficiency virus (HIV) infection and other co-infections appear to have both direct and indirect effects on systemic and local innate immunity leading to the development of oral opportunistic infections and malignancies. Highly active antiretroviral therapy (HAART), the standard treatment of HIV infection, contributed to a global reduction of HIV-associated oral lesions. However, prolonged use of HAART may lead to adverse effects on the oral innate immunity resulting in the relapse of oral lesions. This review article focused on the roles of oral innate immunity in HIV infection in HAART era. The following five key questions were addressed: (i) What are the roles of oral innate immunity in health and disease?, (ii) What are the effects of HIV infection on oral innate immunity?, (iii) What are the roles of oral innate immunity against other co-infections?, (iv) What are the effects of HAART on oral innate immunity?, and (v) Is oral innate immunity enhanced by HAART?

  9. Short communication: oral lesions in HIV/AIDS patients undergoing HAART including efavirenz.

    PubMed

    Aquino-García, S I; Rivas, M A; Ceballos-Salobreña, A; Acosta-Gio, A E; Gaitán-Cepeda, L A

    2008-06-01

    Oral lesions (OL) have an important prognostic value for HIV/AIDS patients. However, the behavior of OL in HIV/AIDS patients undergoing highly active antiretroviral therapy including efavirenz (HAART/EFV) has not been documented. Our objective was to establish the prevalence of OL in HIV/AIDS patients undergoing HAART/EFV and to compare it with the prevalence of OL in patients undergoing antiretroviral therapy including a protease inhibitor (HAART/PI). Seventy-three HIV/AIDS patients undergoing antiretroviral treatment for at least for 6 months at "La Raza" Medical Center's Internal Medicine Unit (IMSS, Mexico City) were included. To detect OL, a detailed examination of oral soft tissues was performed in each patient. Patient records recorded gender, seropositivity time, route of contagion, antiretroviral therapy type and duration, CD4 lymphocyte count/ml, and viral load. Two groups were formed: 38 patients receiving HAART/EFV [two nucleoside analogue reverse transcriptase inhibitors (NARTI) plus efavirenz] and 35 patients receiving HAART/PI (two NARTIs plus one PI). OL prevalence was established in each study group. The Chi-square test was applied (p < 0.05(IC95%)). OL prevalence in the HAART/EFV group (32%) was lower (p < 0.007) than in the HAART/PI group (63%). Candidosis was the most prevalent OL in both groups. Herpes labialis, HIV-associated necrotizing periodontitis, xerostomia, hairy leukoplakia, and nonspecific oral sores were identified. The highest prevalence for all OL was found in the HAART/PI group. These findings suggest that HIV/AIDS patients undergoing HAART/EFV show a lower prevalence of oral lesions than patients undergoing HAART/PI.

  10. Oral innate immunity in HIV infection in HAART era

    PubMed Central

    Nittayananta, Wipawee; Tao, Renchuan; Jiang, Lanlan; Peng, Yuanyuan; Huang, Yuxiao

    2015-01-01

    Oral innate immunity, an important component in host defense and immune surveillance in the oral cavity, plays a crucial role in the regulation of oral health. As part of the innate immune system, epithelial cells lining oral mucosal surfaces provide not only a physical barrier but also produce different antimicrobial peptides, including human β-defensins (hBDs), secretory leukocyte protease inhibitor (SLPI), and various cytokines. These innate immune mediators help in maintaining oral homeostasis. When they are impaired either by local or systemic causes, various oral infections and malignancies may be developed. Human immunodeficiency virus (HIV) infection and other co-infections appear to have both direct and indirect effects on systemic and local innate immunity leading to the development of oral opportunistic infections and malignancies. Highly active antiretroviral therapy (HAART), the standard treatment of HIV infection contributed to a global reduction of HIV-associated oral lesions. However, prolonged treatment by HAART may lead to adverse effects on the oral innate immunity resulting in the relapse of oral lesions. This review article focused on the roles of oral innate immunity in HIV infection in HAART era. The following five key questions were addressed: 1) What are the roles of oral innate immunity in health and disease?, 2) What are the effects of HIV infection on oral innate immunity?, 3) What are the roles of oral innate immunity against other co-infections?, 4) What are the effects of HAART on oral innate immunity?, and 5) Is oral innate immunity enhanced by HAART? PMID:25639844

  11. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh

    2017-01-01

    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  12. Cardiovascular considerations in patients treated with HIV protease inhibitors.

    PubMed

    Colagreco, Joseph P

    2004-01-01

    Highly active antiretroviral therapy (HAART) has dramatically reduced mortality from HIV infection, transforming it in many cases to a chronic condition. However, protease inhibitors (PIs), which are integral components of most HAART regimens, are commonly associated with a host of metabolic disturbances that may increase the risk of cardiovascular disease in patients with HIV infection, potentially counteracting some of the positive health effects of PIs. Dyslipidemia is of particular concern. The Adult AIDS Clinical Trials Group has established preliminary guidelines to evaluate and treat PI-associated dyslipidemia. A number of strategies exist for the management of PI-based dyslipidemia in HAART recipients; their advantages and disadvantages should be considered when treating patients with HIV infection.

  13. Identification of a cell-active non-peptide sirtuin inhibitor containing N-thioacetyl lysine.

    PubMed

    Suzuki, Takayoshi; Asaba, Tomomi; Imai, Erika; Tsumoto, Hiroki; Nakagawa, Hidehiko; Miyata, Naoki

    2009-10-01

    To identify cell-active sirtuin inhibitors containing N-thioacetyl lysine, we synthesized compound 1, which was designed based on the structure of the reported N-ethoxycarbonylacetyl lysine-based sirtuin inhibitor NCS-12k. Compound 1 selectively inhibited SIRT1 in enzyme assays. Compound 1 also caused a dose-dependent increase in p53 acetylation in human colon cancer HCT116 cells, indicating the inhibition of SIRT1 in these cells.

  14. Oral manifestations in the era of HAART.

    PubMed Central

    Cherry-Peppers, Gail; Daniels, Christine O.; Meeks, Valli; Sanders, Charles F.; Reznik, David

    2003-01-01

    AIDS has reached epidemic proportions in the United States, disproportionately affecting African-Americans and other minorities. As highly active antiretroviral therapy (HAART) have improved the length and quality of life for HIV-Infected people, oral health care has made similar strides. It is important that physicians and dentists recognize the earliest signs and symptoms of HIV infection in order that a timely diagnosis and patient referral can be made for early counseling testing, and treatment. At the same time, dentists have seen themselves at considerable risk from HIV Infection. Some dentists believe that they may also be more at risk from stigma then other providers if they treat HIV patients. Images p22S-a p22S-b p24S-a p25S-a p28S-a PMID:12656429

  15. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  16. Epsilon substituted lysinol derivatives as HIV-1 protease inhibitors.

    PubMed

    Jones, Kristen L G; Holloway, M Katharine; Su, Hua-Poo; Carroll, Steven S; Burlein, Christine; Touch, Sinoeun; DiStefano, Daniel J; Sanchez, Rosa I; Williams, Theresa M; Vacca, Joseph P; Coburn, Craig A

    2010-07-15

    A series of HIV-1 protease inhibitors containing an epsilon substituted lysinol backbone was synthesized. Two novel synthetic routes using N-boc-L-glutamic acid alpha-benzyl ester and 2,6-diaminopimelic acid were developed. Incorporation of this epsilon substituent enabled access to the S2 pocket of the enzyme, affording high potency inhibitors. Modeling studies and synthetic efforts suggest the potency increase is due to both conformational bias and van der Waals interactions with the S2 pocket.

  17. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes.

    PubMed

    Liu, Zhigang; Wang, Yong; Yedidi, Ravikiran S; Dewdney, Tamaria G; Reiter, Samuel J; Brunzelle, Joseph S; Kovari, Iulia A; Kovari, Ladislau C

    2013-01-18

    The success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. In addition, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  18. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    SciTech Connect

    Liu, Zhigang; Wang, Yong; Yedidi, Ravikiran S.; Dewdney, Tamaria G.; Reiter, Samuel J.; Brunzelle, Joseph S.; Kovari, Iulia A.; Kovari, Ladislau C.

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  19. PMTCT, HAART, and Childbearing in Mozambique: An Institutional Perspective

    PubMed Central

    2010-01-01

    Maternal and Child Health (MCH) units, where VCT/PMTCT/HAART have been integrated with traditional services, play a critical role in the connection between the massive HAART rollout and reproductive behavior. In this article, we use data from semi-structured interviews with MCH workers and ethnographic observations carried out in southern Mozambique to explore this role from the institutional perspective. We find that, along with logistical and workload problems, the de facto segregation of PMTCT/HAART clients within the “integrated” MCH system and the simplistic and uncompromising message discouraging further fertility and stressing condom-based contraception, may pose serious challenges to a successful formulation and implementation of reproductive goals among seropositive clients. Although the recency of PMTCT/HAART services may partly explain these challenges, we argue that they are due largely to cultural miscommunication between providers and clients. We show how the cultural gap between the two is bridged by community activists and peer interactions among clients. PMID:19326206

  20. Adipokines in the HIV/HAART-associated lipodystrophy syndrome.

    PubMed

    Paruthi, Jason; Gill, Natasha; Mantzoros, Christos S

    2013-09-01

    The use of highly active antiretroviral therapy (HAART) in the treatment of human immunodeficiency virus has dramatically altered both the landscape of this disease and the prognosis for those affected. With more patients now receiving HAART, adverse effects such as lipodystrophy and metabolic syndrome have emerged. In HIV/HAART-associated lipodystrophy syndrome (HALS), patients demonstrate fat maldistribution with dyslipidemia, insulin resistance, and other metabolic complications. Recent studies have contributed to the elucidation of the pathophysiological abnormalities seen in this syndrome and have provided guidance for the study and use of potential treatments for these patients, but widely accepted guidelines have not yet been established. Two adipokines, leptin and adiponectin, are decreased in patients with HALS and lipoatrophy or lipodystrophy. Further, recent proof-of-concept clinical trials have proven the efficacy of leptin replacement and medications that increase circulating adiponectin levels in improving the metabolic profile of HALS patients. This review article highlights recent evidence on leptin replacement and compares leptin's efficacy to that of other treatments, including metformin and thiazolidinediones, on metabolic abnormalities such as impaired insulin-glucose homeostasis associated with lipodystrophy in patients receiving HAART. It is hoped that forthcoming large phase III clinical trials will allow the addition of leptin to our therapeutic armamentarium for use in patients suffering from this disease state.

  1. Cohort Profile: HAART Observational Medical Evaluation and Research (HOMER) cohort.

    PubMed

    Patterson, Sophie; Cescon, Angela; Samji, Hasina; Cui, Zishan; Yip, Benita; Lepik, Katherine J; Moore, David; Lima, Viviane D; Nosyk, Bohdan; Harrigan, P Richard; Montaner, Julio S G; Shannon, Kate; Wood, Evan; Hogg, Robert S

    2015-02-01

    Since 1986, antiretroviral therapy (ART) has been available free of charge to individuals living with HIV in British Columbia (BC), Canada, through the BC Centre of Excellence in HIV/AIDS (BC-CfE) Drug Treatment Program (DTP). The Highly Active Antiretroviral Therapy (HAART) Observational Medical Evaluation and Research (HOMER) cohort was established in 1996 to maintain a prospective record of clinical measurements and medication profiles of a subset of DTP participants initiating HAART in BC. This unique cohort provides a comprehensive data source to investigate mortality, prognostic factors and treatment response among people living with HIV in BC from the inception of HAART. Currently over 5000 individuals are enrolled in the HOMER cohort. Data captured include socio-demographic characteristics (e.g. sex, age, ethnicity, health authority), clinical variables (e.g. CD4 cell count, plasma HIV viral load, AIDS-defining illness, hepatitis C co-infection, mortality) and treatment variables (e.g. HAART regimens, date of treatment initiation, treatment interruptions, adherence data, resistance testing). Research findings from the HOMER cohort have featured in numerous high-impact peer-reviewed journals. The HOMER cohort collaborates with other HIV cohorts on both national and international scales to answer complex HIV-specific research questions, and welcomes input from external investigators regarding potential research proposals or future collaborations. For further information please contact the principal investigator, Dr Robert Hogg (robert_hogg@sfu.ca).

  2. PDT in periodontal disease of HAART resistance patients

    NASA Astrophysics Data System (ADS)

    Giovani, Elcio M.; Noro-Filho, Gilberto A.; Caputo, Bruno V.; Casarin, Renato; Costa, Claudio; Salgado, Daniela; Santos, Camila C.

    2016-03-01

    HIV/Aids patients present a change of microbiota associated with host immunodeficiency. Photodynamic therapy (PDT) showed as a promising and viable alternative in reducing microbiota. Present study evaluate effectiveness of photodynamic therapy in periodontal disease of AIDS patients with highly activity antiretroviral therapy (HAART) failure, measuring the clinical periodontal parameters and periodontal microbiota. Twelve patients with HARRT resistance (R group) divided into two groups (control and PDT) and 12 patients with no HAART resistance (NR group) divided into two groups (control and PDT). The results show the difference in baseline of CD4 cells count, NR group 640.0 +/- 176.2 cells/mm3 R group and 333.3 +/- 205.8 cells / mm3 (p<0.05), and in 8.3% detectable viral load in NR group and 75% detectable (p <0.001) in R group. As clinical periodontal parameters (PD and CAL), PDT was more effective than the control group only in the NR group (p <0.05%), moreover, there was no difference in the evaluation of clinical periodontal parameters between the both R groups (p>0.05%). Microbiological evaluation in R group presents a general reduction in the Aa at 3 and 6 months. Furthermore, demonstrated a reduction of Pg in all groups at 6 months and in R group at 3 months. The impact assessment of photodynamic therapy in patients with different levels of immunosuppression determined that the combination of mechanical periodontal treatment with photodynamic therapy in patients with HAART failure did not cause additional benefits. Therefore, PDT in this study could not been indicated in HAART resistance patients.

  3. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  4. Adherence discourse among African-American women taking HAART

    PubMed Central

    Sankar, A.; Luborsky, M.; Schuman, P.; Roberts, G.

    2014-01-01

    Low adherence is the single most important challenge to controlling HIV through the use of high acting anti-retrovirals (HAART). Non-adherence poses an immediate threat to individuals who develop resistant forms of the virus as well as a public health threat if those individuals pass on treatment-resistant forms of the virus. To understand the concerns and perceptions that promote or deter adherence to antiretroviral medication by HIV-positive African-American women, we conducted in-depth interviews with 15 African-American women taking HAART. We focused on the discourse and narratives women use in talking about their adherence practice. Discourse analysis was utilized to identify and explore the sources of influence used by these women in describing their adherence practice. Roughly a third of the sample fell into each of the three self-assessed adherence categories: always adherent, mostly adherent and somewhat adherent. Among the ‘always adherent’, 80% of the sources of influence cited supported adherence, while only 48% and 47% of the authoritative sources cited by women in the ‘mostly’ and ‘somewhat’ categories supported adherence. Each self-assessed adherence group was characterized by its own distinctive discourse style. Findings suggest that adherence to HAART among African-American HIV-positive women would be improved by identifying those influences undermining adherence. Focused study of the ‘always adherent’ types is recommended. PMID:11940279

  5. Relationship between oral Kaposi 's sarcoma and HAART: contribution of two case reports.

    PubMed

    Campo-Trapero, Julián; Del Romero-Guerrero, Jorge; Cano-Sánchez, Jorge; Rodríguez-Martín, Carmen; Martínez-González, José Ma; Bascones-Martínez, Antonio

    2008-11-01

    Two HIV infected patients not receiving Highly Active Antiretroviral Treatment (HAART) presented with epidemic Kaposi's sarcoma of the oral cavity. One patient initially refused HAART, but when the lesion became large enough to be noticeable he agreed to HAART associated with excision of the intraoral lesion by CO2 laser. The other patient developed KS and progressed to AIDS at two years after ceasing HAART due to adverse effects; he was referred to hospital for renewed administration of HAART. In both cases, the lesions observed in the oral cavity were the first clinical manifestation of AIDS. These reports underline the close relationship between the use of HAART and the control of KS lesions, highlighting the important role of the dentist in the identification and early diagnosis of these oral lesions.

  6. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  7. Design of HIV Protease Inhibitors Targeting Protein Backbone: An Effective Strategy for Combating Drug Resistance

    SciTech Connect

    Ghosh, Arun K.; Chapsal, Bruno D.; Weber, Irene T.; Mitsuya, Hiroaki

    2008-06-03

    The discovery of human immunodeficiency virus (HIV) protease inhibitors (PIs) and their utilization in highly active antiretroviral therapy (HAART) have been a major turning point in the management of HIV/acquired immune-deficiency syndrome (AIDS). However, despite the successes in disease management and the decrease of HIV/AIDS-related mortality, several drawbacks continue to hamper first-generation protease inhibitor therapies. The rapid emergence of drug resistance has become the most urgent concern because it renders current treatments ineffective and therefore compels the scientific community to continue efforts in the design of inhibitors that can efficiently combat drug resistance.

  8. Development of novel dipeptide-like rhodesain inhibitors containing the 3-bromoisoxazoline warhead in a constrained conformation.

    PubMed

    Ettari, Roberta; Pinto, Andrea; Previti, Santo; Tamborini, Lucia; Angelo, Ilenia C; La Pietra, Valeria; Marinelli, Luciana; Novellino, Ettore; Schirmeister, Tanja; Zappalà, Maria; Grasso, Silvana; De Micheli, Carlo; Conti, Paola

    2015-11-01

    Novel dipeptide-like rhodesain inhibitors containing the 3-bromoisoxazoline warhead in a constrained conformation were developed; some of them possess K(i) values in the micromolar range. We studied the structure-activity relationship of these derivatives and we performed docking studies, which allowed us to find out the key interactions established by the inhibitors with the target enzyme. Biological results indicate that the nature of the P2 and P3 substituents and their binding to the S2/S3 pockets is strictly interdependent.

  9. A randomized controlled trial of HAART versus HAART and chemotherapy in therapy-naïve patients with HIV-associated Kaposi sarcoma in South Africa

    PubMed Central

    Mosam, Anisa; Shaik, Fahmida; Uldrick, Thomas S.; Esterhuizen, Tonya; Friedland, Gerald H.; Scadden, David T.; Aboobaker, Jamila; Coovadia, Hoosen M.

    2012-01-01

    Background The optimal approach to HIV-associated KS (HIV-KS) in sub-Saharan Africa is unknown. With large-scale rollout of highly active antiretroviral therapy (HAART) in South Africa, we hypothesized survival in HIV-KS would improve and administration of chemotherapy in addition to HAART would be feasible and improve KS-specific outcomes. Methods We conducted a randomized, controlled, open-label trial with intention-to-treat analysis. Treatment-naïve patients from King Edward VIII Hospital, Durban, South Africa, a public-sector tertiary referral center, with HIV-KS, but no symptomatic visceral disease or fungating lesions requiring urgent chemotherapy, were randomized to HAART alone or HAART and chemotherapy (CXT). HAART arm received stavudine, lamivudine and nevirapine (Triomune®); CXT arm received Triomune® plus bleomycin, doxorubicin, and vincristine (ABV) every 3 weeks. When ABV was not available, oral etoposide (50-100 mg days 1-21 of a 28 day cycle) was substituted. Primary outcome was overall KS response using AIDS Clinical Trial Group criteria 12 months after HAART initiation. Secondary comparisons included: time to response, progression-free survival, overall survival, adverse events, HIV control, CD4 reconstitution, adherence and quality-of-life. Results 59 subjects were randomized to HAART, 53 to CXT. 12-month overall KS response was 39% in the HAART arm and 66% in the CXT arm (difference 27%; 95% CI 9%-43%, p=0.005). At 12 months, 77% were alive (no survival difference between arms, p=0.49), 82% had HIV viral load <50 copies/mL without difference between arms, (p=0.47); CD4 counts and QOL measures improved in all patients. Conclusions HAART with chemotherapy produced higher overall KS response over 12 months, while HAART alone provided similar improvement in survival and select measures of morbidity. In Africa, with high prevalence of HIV and HHV-8 and limited resources, HAART alone provides important benefit in patients with HIV-KS. PMID:22395672

  10. Design and synthesis of new tripeptide-type SARS-CoV 3CL protease inhibitors containing an electrophilic arylketone moiety.

    PubMed

    Konno, Sho; Thanigaimalai, Pillaiyar; Yamamoto, Takehito; Nakada, Kiyohiko; Kakiuchi, Rie; Takayama, Kentaro; Yamazaki, Yuri; Yakushiji, Fumika; Akaji, Kenichi; Kiso, Yoshiaki; Kawasaki, Yuko; Chen, Shen-En; Freire, Ernesto; Hayashi, Yoshio

    2013-01-15

    We describe here the design, synthesis and biological evaluation of a series of molecules toward the development of novel peptidomimetic inhibitors of SARS-CoV 3CL(pro). A docking study involving binding between the initial lead compound 1 and the SARS-CoV 3CL(pro) motivated the replacement of a thiazole with a benzothiazole unit as a warhead moiety at the P1' site. This modification led to the identification of more potent derivatives, including 2i, 2k, 2m, 2o, and 2p, with IC(50) or K(i) values in the submicromolar to nanomolar range. In particular, compounds 2i and 2p exhibited the most potent inhibitory activities, with K(i) values of 4.1 and 3.1 nM, respectively. The peptidomimetic compounds identified through this process are attractive leads for the development of potential therapeutic agents against SARS. The structural requirements of the peptidomimetics with potent inhibitory activities against SARS-CoV 3CL(pro) may be summarized as follows: (i) the presence of a benzothiazole warhead at the S1'-position; (ii) hydrogen bonding capabilities at the cyclic lactam of the S1-site; (iii) appropriate stereochemistry and hydrophobic moiety size at the S2-site and (iv) a unique folding conformation assumed by the phenoxyacetyl moiety at the S4-site.

  11. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  12. Metropolitan Social Environments and Pre-HAART/HAART Era Changes in Mortality Rates (per 10,000 Adult Residents) among Injection Drug Users Living with AIDS

    PubMed Central

    Friedman, Samuel R.; West, Brooke S.; Pouget, Enrique R.; Hall, H. Irene; Cantrell, Jennifer; Tempalski, Barbara; Chatterjee, Sudip; Hu, Xiaohong; Cooper, Hannah L. F.; Galea, Sandro; Des Jarlais, Don C.

    2013-01-01

    Background Among the largest US metropolitan areas, trends in mortality rates for injection drug users (IDUs) with AIDS vary substantially. Ecosocial, risk environment and dialectical theories suggest many metropolitan areas characteristics that might drive this variation. We assess metropolitan area characteristics associated with decline in mortality rates among IDUs living with AIDS (per 10,000 adult MSA residents) after highly active antiretroviral therapy (HAART) was developed. Methods This is an ecological cohort study of 86 large US metropolitan areas from 1993–2006. The proportional rate of decline in mortality among IDUs diagnosed with AIDS (as a proportion of adult residents) from 1993–1995 to 2004–2006 was the outcome of interest. This rate of decline was modeled as a function of MSA-level variables suggested by ecosocial, risk environment and dialectical theories. In multiple regression analyses, we used 1993–1995 mortality rates to (partially) control for pre-HAART epidemic history and study how other independent variables affected the outcomes. Results In multivariable models, pre-HAART to HAART era increases in ‘hard drug’ arrest rates and higher pre-HAART income inequality were associated with lower relative declines in mortality rates. Pre-HAART per capita health expenditure and drug abuse treatment rates, and pre- to HAART-era increases in HIV counseling and testing rates, were weakly associated with greater decline in AIDS mortality. Conclusions Mortality among IDUs living with AIDS might be decreased by reducing metropolitan income inequality, increasing public health expenditures, and perhaps increasing drug abuse treatment and HIV testing services. Given prior evidence that drug-related arrest rates are associated with higher HIV prevalence rates among IDUs and do not seem to decrease IDU population prevalence, changes in laws and policing practices to reduce such arrests while still protecting public order should be considered

  13. Therapeutic effects of Nigella sativa on chronic HAART-induced hyperinsulinemia in rats.

    PubMed

    Chandra, Surabhi; Murthy, Subramanyam N; Mondal, Debasis; Agrawal, Krishna C

    2009-04-01

    Prolonged use of highly active antiretroviral therapy (HAART) is associated with insulin resistance in HIV-1-positive patients. Small animal models that recapitulate the long-term effects of HAART may facilitate the identification of therapeutic agents to suppress these side effects. We investigated the protective effects of black seed oil (BSO) from Nigella sativa in Sprague-Dawley rats treated with a daily HAART regimen for 7 months. The antiretroviral drugs, consisting of nelfinavir (200 mg/kg), zidovudine (50 mg/kg), and efavirenz (20 mg/kg), were mixed with diet with or without BSO (400 microL/kg) supplementation. Significant increases in insulin and C-peptide levels were observed in HAART-treated groups, and concomitant BSO treatment reduced this hyperinsulinemia. Interestingly, HAART-treated rats showed reduced size of pancreatic islets that was not seen in BSO-exposed rats. In vitro studies showed that nelfinavir, alone and in combination with HAART, induced oxidative stress and decreased glucose-induced insulin production in INS-1 cells. Suppressed insulin production was restored in cells coexposed to either BSO or thymoquinone. Our findings demonstrated that chronic HAART may increase serum insulin levels by dysregulating both insulin production by beta cells and insulin action at the periphery. These deleterious effects may be prevented by dietary supplementation with BSO.

  14. Drug interactions associated with HAART: focus on treatments for addiction and recreational drugs.

    PubMed

    Faragon, John J; Piliero, Peter J

    2003-09-01

    The advent of HAART has improved survival in patients infected with HIV; however, treatment is complicated by potential drug interactions. The risk of drug interactions is compounded by the use of additional therapies for comorbid conditions, such as substance abuse, and by the use of recreational drugs. HIV health care providers should be aware of the potential interaction of recreational drugs and addiction treatments with HAART because of the potential for significant adverse effects for their HIV-infected patients. This article provides a review of the literature on drug interactions among addiction therapies, recreational drugs, and HAART.

  15. Effects of long-term use of HAART on oral health status of HIV-infected subjects

    PubMed Central

    Nittayananta, Wipawee; Talungchit, Sineepat; Jaruratanasirikul, Sutep; Silpapojakul, Kachornsakdi; Chayakul, Panthip; Nilmanat, Ampaipith; Pruphetkaew, Nannapat

    2011-01-01

    BACKGROUND The aim of this study was to determine the effects of long-term use of highly active antiretroviral therapy (HAART) on oral health status of HIV-infected subjects. METHODS Oral examination and measurement of saliva flow rate of both unstimulated and wax-stimulated whole saliva were performed in HIV-infected subjects with and without HAART, and in non-HIV individuals. The following data were recorded; duration and risk of HIV infection, type and duration of HAART, CD4 cell count, viral load, presence of orofacial pain, oral dryness, oral burning sensation, oral lesions, cervical caries, and periodontal pocket. Multiple logistic regression analysis was performed to determine the effects of long-term use of HAART on oral health status of HIV-infected subjects. RESULTS: One hundred and fifty-seven HIV-infected subjects – 99 on HAART (age range 23–57 years, mean 39 years) and 58 not on HAART (age range 20–59 years, mean 34 years) – and 50 non-HIV controls (age range 19–59 years, mean 36 years) were enrolled. The most common HAART regimen was 2 NRTI + 2 NNRTI. HIV-infected subjects without HAART showed greater risks of having orofacial pain, oral dryness, oral lesions, and periodontal pockets than those with short-term HAART (P < 0.01). The subjects with long-term HAART were found to have a greater risk of having oral lesions than those with short-term HAART (P < 0.05). The unstimulated and stimulated salivary flow rates of the subjects with HAART were significantly lower than in those without HAART (P < 0.05). CONCLUSION We conclude that long-term HAART has adverse effects on oral health status of HIV-infected subjects. PMID:20202089

  16. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  17. Response to hepatitis A vaccine in HIV patients in the HAART era.

    PubMed

    Rimland, David; Guest, Jodie L

    2005-10-14

    We evaluated the development of hepatitis A antibody after vaccination in a large cohort of patients studied in a clinical setting after the introduction of HAART. Overall, 130 of 214 vaccinated individuals developed hepatitis A antibody. In a multivariate analysis, only the CD4 cell count at the time of vaccination was associated with an absence of response. The lack of association with the nadir CD4 cell count suggests that patients will respond to vaccine after immunological reconstitution in response to HAART.

  18. Relationship between Body Mass Index and Mortality in HIV-Infected HAART Users in the Women's Interagency HIV Study

    PubMed Central

    Sharma, Anjali; Hoover, Donald R.; Shi, Qiuhu; Gustafson, Deborah; Plankey, Michael W.; Hershow, Ronald C.; Tien, Phyllis C.; Golub, Elizabeth T.; Anastos, Kathryn

    2015-01-01

    Background Early HIV studies suggested protective associations of overweight against mortality, yet data are lacking for the era of potent highly active antiretroviral therapy (HAART). We evaluated associations of pre-HAART initiation body mass index (BMI) with mortality among HAART-using women. Methods Prospective study of time to death after HAART initiation among continuous HAART users in the Women’s Interagency HIV Study. Unadjusted Kaplan–Meier and adjusted proportional hazards survival models assessed time to AIDS and non-AIDS death by last measured pre-HAART BMI. Results Of 1428 continuous HAART users 39 (2.7%) were underweight, 521 (36.5%) normal weight, 441 (30.9%) overweight, and 427 (29.9%) obese at time of HAART initiation. A total of 322 deaths occurred during median follow-up of 10.4 years (IQR 5.9–14.6). Censoring at non-AIDS death, the highest rate of AIDS death was observed among underweight women (p = 0.0003 for all 4 categories). In multivariate models, women underweight prior to HAART died from AIDS more than twice as rapidly vs. normal weight women (aHR 2.04, 95% CI 1.03, 4.04); but being overweight or obese (vs. normal weight) was not independently associated with AIDS death. Cumulative incidence of non-AIDS death was similar across all pre-HAART BMI categories. Conclusions Among continuous HAART-using women, being overweight prior to initiation was not associated with lower risk of AIDS or non-AIDS death. Being underweight prior to HAART was associated with over double the rate of AIDS death in adjusted analyses. Although overweight and obesity may be associated with many adverse health conditions, neither was predictive of mortality among the HAART-using women. PMID:26699870

  19. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  20. HIV/AIDS Patients’ Medical and Psychosocial Needs in the Era of HAART: A Cross-sectional Study among HIV/AIDS Patients Receiving HAART in Yunnan, China

    PubMed Central

    Wen, Yi; Shi, Yun; Jiang, Chengqin; Detels, Roger; Wu, Di

    2012-01-01

    Background Since the launch of China’s Free Antiretroviral Therapy (ART) Program in 2002, more than 100,000 HIV/AIDS patients have been treated with highly actively antiretroviral therapy (HAART). However, the current evaluation system for this program mainly focused on its medical outcomes. This study aims to evaluate the medical and psychosocial needs of HIV/AIDS patients after initiating HAART. Methods A cross-sectional study was conducted among 499 HIV/AIDS patients who were currently being treated with HAART in three designated hospitals in Luxi City, Yunnan Province. A questionnaire was used to collect information about participants’ demographic characteristics, perceived HIV-related stigma, physician-patient relationship, quality of life, family functioning, etc. Patients’ medical records in the National HIV Information System were linked with their questionnaire by their ART identification number. Results Patients on HAART who were infected with HIV through injection drug use and were current smokers typically had poorer physical health than other participants on HAART. Better financial status and better physician-patient relationship were associated with both physical and psychological well-being. Family awareness of the patient’s HIV status was negatively associated with the patient’s psychological well-being. Higher levels of perceived HIV-related stigma were associated with poorer psychological health and poorer family functioning. Conclusion This study emphasizes the importance of assuring a caring environment in China’s AIDS treatment program and re-enforces the need to combat the stigma encountered with health providers and the public. PMID:23061980

  1. Magnitude of cytopenias among HIV-infected children in Bahir Dar, northwest Ethiopia: a comparison of HAART-naïve and HAART-experienced children

    PubMed Central

    Tsegay, Yakob Gebregziabher; Tadele, Agerie; Addis, Zelalem; Alemu, Agersew; Melku, Mulugeta

    2017-01-01

    Background AIDS, caused by HIV, is a multisystem disease that affects hematopoiesis. The aim of this study was to assess cytopenias among HIV-infected children who had a follow-up at Felege Hiwot Referral Hospital, Bahir Dar, northwest Ethiopia. Methods An institution-based cross-sectional study was conducted between April and May 2013. Systematic random sampling method was used to select the study participants. Descriptive statistics, independent t-test as well as chi-square and logistic regression were used for analysis. A p-value <0.05 was considered as statistically significant. Results A total of 224 children (112 highly active antiretroviral therapy [HAART]-naïve and 112 HAART-experienced) participated in the study. The magnitude of anemia, thrombocytopenia, neutropenia, leukopenia and pancytopenia among HAART-naïve HIV-infected children were 30.4%, 9.8%, 8%, 4.5% and 1.8%, respectively. The overall prevalence of anemia, neutropenia, thrombocytopenia, leukopenia and pancytopenia were 29.5%, 8.9%, 8%, 4.5% and 1.4%, respectively. Cluster of differentiation-4 percentage and mean corpuscular volume were significantly different between HAART-experienced and HAART-naïve children. Being of younger age and severely immunosuppressed were risk factors of anemia. Conclusion Anemia was the most common cytopenia, followed by neutropenia. Severe immunosuppression and younger age were significantly associated with anemia. Therefore, emphasis should be given for investigation and management of cytopenias in HIV-infected children, particularly for those who are immunosuppressed and of younger age. PMID:28260948

  2. Evidence for Reduced Drug Susceptibility without Emergence of Major Protease Mutations following Protease Inhibitor Monotherapy Failure in the SARA Trial

    PubMed Central

    Sutherland, Katherine A.; Parry, Chris M.; McCormick, Adele; Kapaata, Anne; Lyagoba, Fred; Kaleebu, Pontiano; Gilks, Charles F.; Goodall, Ruth; Spyer, Moira; Kityo, Cissy; Pillay, Deenan; Gupta, Ravindra K.

    2015-01-01

    Background Major protease mutations are rarely observed following failure with protease inhibitors (PI), and other viral determinants of failure to PI are poorly understood. We therefore characterized Gag-Protease phenotypic susceptibility in subtype A and D viruses circulating in East Africa following viral rebound on PIs. Methods Samples from baseline and treatment failure in patients enrolled in the second line LPV/r trial SARA underwent phenotypic susceptibility testing. Data were expressed as fold-change in susceptibility relative to a LPV-susceptible reference strain. Results We cloned 48 Gag-Protease containing sequences from seven individuals and performed drug resistance phenotyping from pre-PI and treatment failure timepoints in seven patients. For the six patients where major protease inhibitor resistance mutations did not emerge, mean fold-change EC50 to LPV was 4.07 fold (95% CI, 2.08–6.07) at the pre-PI timepoint. Following viral failure the mean fold-change in EC50 to LPV was 4.25 fold (95% CI, 1.39–7.11, p = 0.91). All viruses remained susceptible to DRV. In our assay system, the major PI resistance mutation I84V, which emerged in one individual, conferred a 10.5-fold reduction in LPV susceptibility. One of the six patients exhibited a significant reduction in susceptibility between pre-PI and failure timepoints (from 4.7 fold to 9.6 fold) in the absence of known major mutations in protease, but associated with changes in Gag: V7I, G49D, R69Q, A120D, Q127K, N375S and I462S. Phylogenetic analysis provided evidence of the emergence of genetically distinct viruses at the time of treatment failure, indicating ongoing viral evolution in Gag-protease under PI pressure. Conclusions Here we observe in one patient the development of significantly reduced susceptibility conferred by changes in Gag which may have contributed to treatment failure on a protease inhibitor containing regimen. Further phenotype-genotype studies are required to elucidate genetic

  3. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  4. Nutritional status changes in HIV-infected children receiving combined antiretroviral therapy including protease inhibitors.

    PubMed

    Fiore, P; Donelli, E; Boni, S; Pontali, E; Tramalloni, R; Bassetti, D

    2000-11-01

    Maintaining linear growth and weight gain in HIV-infected children is often difficult. Nutritional evaluation and support are recognised as important factors to improve their quality of life. Combination antiretroviral therapy including protease inhibitors (HAART) reduces HIV-viral load and improves survival, quality of life and nutritional status. Our study aimed to determine changes in nutrional status based on body weight, height and nutritional habits, of HIV-infected children receiving HAART. Possible side effects of lipid metabolism were also studied. Twenty five children, 13 treated with HAART (group B) were followed up for 12 months. We did not observe statistically significant differences in nutritional status over that time or between groups A and B. Inadequate energy intake was more common in patients with advanced HIV-disease. Hyperlipidemia was found in 70% of children receiving ritonavir and in approximately 50% of children receiving nelfinavir. We observed an important although not statistically significative modification in the height of those in group B.

  5. [Cerebrospinal fluid viral load in HIV-1 positive hemophilic patients treated with HAART].

    PubMed

    Corti, M E; Villafañe, M F; Baré, P; Alves Rosa, F; Cermelj, M; Candela, M; Pérez Bianco, R; Tezanos Pinto, M

    2001-01-01

    As HIV seropositive patients with undetectable CSF viral load have a lower likelihood of developing neurologic disease, the determination of CSF viral load levels may be useful to evaluate the efficacy of HAART. We compared plasma viral load levels with HIV-1 RNA CSF levels in 18 hemophilic patients without neurocognitive involvement under HAART. We detected a significant correlation between plasma viral load levels and CSF viral load levels. Fourteen patients with undetectable plasma viral load had undetectable RNA HIV-1 CSF levels as well. Four patients with detectable plasma viral load had detectable HIV-RNA in CSF, but the latter were significantly lower. Viral load is usually lower in non-blood fluids and HAART decreases the viral load in CSF as well as in blood.

  6. [Historical Review of Kaposi sarcoma in pre-HAART era: evolution with different chemotherapy schedules and remission with ganciclovir use].

    PubMed

    Volkow, Patricia; Jacquemin, Benedicte; Zinser, Juan W; Pérez-Padilla, Rogelio

    2016-10-01

    Ganciclovir has shown in vitro anti-human herpesvirus-8 activity, Kaposi sarcoma agent. We analyzed all Kaposi sarcoma patients from 1985 to 1996 pre-HAART era and identified Kaposi sarcoma/AIDS patients who achieved complete remission prior to HAART use.

  7. HIV-1 protease inhibitor induced oxidative stress suppresses glucose stimulated insulin release: protection with thymoquinone.

    PubMed

    Chandra, Surabhi; Mondal, Debasis; Agrawal, Krishna C

    2009-04-01

    The highly active anti-retroviral therapy (HAART) regimen has considerably reduced the mortality rate in HIV-1 positive patients. However, long-term exposure to HAART is associated with a metabolic syndrome manifesting cardiovascular dysfunction, lipodystrophy, and insulin resistance syndrome (IRS). The inclusion of HIV-1 protease inhibitors (PIs) in HAART has been linked to the induction of IRS. Although several molecular mechanisms of PI-induced effects on insulin action have been postulated, the deleterious effects of PIs on insulin production by pancreatic beta-cells have not been fully investigated and therapeutic strategies to ameliorate insulin dysregulation at this level have not been targeted. The present study showed that exposure to several different PIs, nelfinavir (5-10 microM), saquinavir (5-10 microM) and atazanavir (8-20 microM), decreases glucose stimulated insulin secretion from rat pancreatic beta-cells (INS-1). Nelfinavir significantly increased reactive oxygen species (ROS) generation and suppressed cytosolic, but not mitochondrial superoxide dismutase (SOD) levels. Nelfinvair also decreased both glutathione and ATP and increased UCP2 levels in these cells. Simultaneous treatment with thymoquinone (TQ) (2.5 microM), an active ingredient of black seed oil, significantly inhibited the effect of nelfinavir on augmented ROS production and suppressed SOD levels. Both TQ and black seed oil exposure increased glucose stimulated insulin secretion and ameliorated the suppressive effect of nelfinavir. The present findings imply a direct role of ROS in PI induced deleterious effects on pancreatic beta-cells. Our findings also suggest that TQ may be used as a potential therapeutic agent to normalize the dysregulated insulin production observed in HAART treated patients.

  8. Plasma cholesterol efflux capacity from human THP-1 macrophages is reduced in HIV-infected patients: impact of HAART[S

    PubMed Central

    El Khoury, Petra; Ghislain, Mathilde; Villard, Elise F.; Le Goff, Wilfried; Lascoux-Combe, Caroline; Yeni, Patrick; Meyer, Laurence; Vigouroux, Corinne; Goujard, Cécile; Guerin, Maryse

    2015-01-01

    The capacity of HDL to remove cholesterol from macrophages is inversely associated with the severity of angiographic coronary artery disease. The effect of human immunodeficiency virus (HIV) infection or its treatment on the ability of HDL particles to stimulate cholesterol efflux from human macrophages has never been studied. We evaluated the capacity of whole plasma and isolated HDL particles from HIV-infected subjects (n = 231) and uninfected controls (n = 200), as well as in a subset of 41 HIV subjects receiving highly active antiretroviral therapy (HAART) to mediate cholesterol efflux from human macrophages. Plasma cholesterol efflux capacity was reduced (−12%; P = 0.001) in HIV patients as compared with controls. HIV infection reduced by 27% (P < 0.05) the capacity of HDL subfractions to promote cholesterol efflux from macrophages. We observed a reduced ABCA1-dependent efflux capacity of plasma (−27%; P < 0.0001) from HIV-infected subjects as a result of a reduction in the efflux capacity of HDL3 particles. HAART administration restored the capacity of plasma from HIV patients to stimulate cholesterol efflux from human macrophages (9.4%; P = 0.04). During HIV infection, the capacity of whole plasma to remove cholesterol from macrophages is reduced, thus potentially contributing to the increased coronary heart disease in the HIV population. HAART administration restored the removal of cholesterol from macrophages by increasing HDL functionality. PMID:25573889

  9. Aboriginal status is a prognostic factor for mortality among antiretroviral naïve HIV-positive individuals first initiating HAART

    PubMed Central

    Lima, Viviane D; Kretz, Patricia; Palepu, Anita; Bonner, Simon; Kerr, Thomas; Moore, David; Daniel, Mark; Montaner, Julio SG; Hogg, Robert S

    2006-01-01

    Background Although the impact of Aboriginal status on HIV incidence, HIV disease progression, and access to treatment has been investigated previously, little is known about the relationship between Aboriginal ethnicity and outcomes associated with highly active antiretroviral therapy (HAART). We undertook the present analysis to determine if Aboriginal and non-Aboriginal persons respond differently to HAART by measuring HIV plasma viral load response, CD4 cell response and time to all-cause mortality. Methods A population-based analysis of a cohort of antiretroviral therapy naïve HIV-positive Aboriginal men and women 18 years or older in British Columbia, Canada. Participants were antiretroviral therapy naïve, initiated triple combination therapy between August 1, 1996 and September 30, 1999. Participants had to complete a baseline questionnaire as well as have at least two follow-up CD4 and HIV plasma viral load measures. The primary endpoints were CD4 and HIV plasma viral load response and all cause mortality. Cox proportional hazards models were used to determine the association between Aboriginal status and CD4 cell response, HIV plasma viral load response and all-cause mortality while controlling for several confounder variables. Results A total of 622 participants met the study criteria. Aboriginal status was significantly associated with no AIDS diagnosis at baseline (p = 0.0296), having protease inhibitor in the first therapy (p = 0.0209), lower baseline HIV plasma viral load (p < 0.001), less experienced HIV physicians (P = 0.0133), history of IDU (p < 0.001), not completing high school (p = 0.0046), and an income of less than $10,000 per year (p = 0.0115). Cox proportional hazards models controlling for clinical characteristics found that Aboriginal status had an increased hazard of mortality (HR = 3.12, 95% CI: 1.77–5.48) but did not with HIV plasma viral load response (HR = 1.15, 95% CI: 0.89–1.48) or CD4 cell response (HR = 0.95, 95% CI: 0.73

  10. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  11. Effect of HAART on brain organization and function in HIV-negative subjects

    PubMed Central

    Brier, Matthew R.; Wu, Qian; Tannenbaum, Aaron B.; Westerhaus, Elizabeth; Kharasch, Evan; Ances, Beau M.

    2015-01-01

    HIV causes neural dysfunction in infected individuals. This dysfunction often manifests as cognitive symptoms and can be detected using neuroimaging. Highly active anti-retroviral therapy (HAART), in addition to providing virologic control, has reduced the number of profoundly impaired individuals but more mild forms of neurocognitive disorders remains prevalent. A potential confound in previous studies of HIV-associated cognitive dysfunction is that HAART may be neurotoxic. Thus, observed effects, attributed to HIV, may be in part due to HAART. It is unclear whether and to what extent current medications contribute to observed brain dysfunction. We studied changes in functional connectivity and cerebral blood flow in HIV uninfected (HIV−) individuals before and after being given two common antiretroviral medications: efavirenz and ritonavir. Neither drug was associated with significant changes in functional connectivity or cerebral blood flow. Our results suggests that previous changes in functional connectivity and cerebral blood flow in HIV infected individuals receiving HAART may largely due to the virus and remaining reservoirs and less due to toxic action of these anti-retroviral medications. PMID:26446778

  12. Association of Y chromosome haplogroup I with HIV progression, and HAART outcome.

    PubMed

    Sezgin, Efe; Lind, Joanne M; Shrestha, Sadeep; Hendrickson, Sher; Goedert, James J; Donfield, Sharyne; Kirk, Gregory D; Phair, John P; Troyer, Jennifer L; O'Brien, Stephen J; Smith, Michael W

    2009-04-01

    The host genetic basis of differential outcomes in HIV infection, progression, viral load set point and highly active retroviral therapy (HAART) responses was examined for the common Y haplogroups in European Americans and African Americans. Accelerated progression to acquired immune deficiency syndrome (AIDS) and related death in European Americans among Y chromosome haplogroup I (Y-I) subjects was discovered. Additionally, Y-I haplogroup subjects on HAART took a longer time to HIV-1 viral suppression and were more likely to fail HAART. Both the accelerated progression and longer time to viral suppression results observed in haplogroup Y-I were significant after false-discovery-rate corrections. A higher frequency of AIDS-defining illnesses was also observed in haplogroup Y-I. These effects were independent of the previously identified autosomal AIDS restriction genes. When the Y-I haplogroup subjects were further subdivided into six I subhaplogroups, no one subhaplogroup accounted for the effects on HIV progression, viral load or HAART response. Adjustment of the analyses for population stratification found significant and concordant haplogroup Y-I results. The Y chromosome haplogroup analyses of HIV infection and progression in African Americans were not significant. Our results suggest that one or more loci on the Y chromosome found on haplogroup Y-I have an effect on AIDS progression and treatment responses in European Americans.

  13. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  14. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  15. Increase in sexually transmitted infections among homosexual men in Amsterdam in relation to HAART

    PubMed Central

    Stolte, I.; Dukers, N.; de Wit, J. B F; Fennema, J.; Coutinho, R.

    2001-01-01

    Objectives: We investigated if a rise in rectal gonorrhoea and early syphilis among men who have sex with men (MSM) in Amsterdam coincided with the introduction of highly active antiretroviral therapies (HAART) in July 1996 and determined risk factors for these sexually transmitted infections (STI). Methods: Subjects were patients of the STI clinic of the municipal health service in Amsterdam. Surveillance data (1994–9) represented consultations (n=11 240) of MSM (n=6103). For analyses we used logistic regression. Results: Comparing the periods before and after the introduction of HAART, the infection rate for rectal gonorrhoea increased from 4% to 5.4% (p=.001) and for syphilis, from 0.5% to 0.8% (p = 0.050). Independent risk factors for rectal gonorrhoea (younger age, western nationality, and concurrent infection with another STI) and for early syphilis (non-western nationality and concurrent infection with rectal gonorrhoea) did not change after HAART became available. For rectal gonorrhoea, however, the infection rate increased only among men who had exclusively homosexual contacts (OR 1.38, p<0.01), compared with bisexual men. For early syphilis, the infection rate increased only among men of western nationality (OR 3.38, p<0.01) compared to men of non-western nationality. Conclusions: Infection rates of rectal gonorrhoea and early syphilis increased, indicating a change in sexual behaviour, possibly as a result of the introduction of HAART. For now, it is important to find out how sexual behaviour is changing and to keep monitoring trends in STIs (including HIV) among MSM in Amsterdam. Key Words: rectal gonorrhoea; syphilis; HAART; high risk sexual behaviour; MSM PMID:11402225

  16. Identification of Semicarbazones, Thiosemicarbazones and Triazine Nitriles as Inhibitors of Leishmania mexicana Cysteine Protease CPB

    PubMed Central

    Schröder, Jörg; Noack, Sandra; Marhöfer, Richard J.; Mottram, Jeremy C.; Coombs, Graham H.; Selzer, Paul M.

    2013-01-01

    Cysteine proteases of the papain superfamily are present in nearly all eukaryotes. They play pivotal roles in the biology of parasites and inhibition of cysteine proteases is emerging as an important strategy to combat parasitic diseases such as sleeping sickness, Chagas’ disease and leishmaniasis. Homology modeling of the mature Leishmania mexicana cysteine protease CPB2.8 suggested that it differs significantly from bovine cathepsin B and thus could be a good drug target. High throughput screening of a compound library against this enzyme and bovine cathepsin B in a counter assay identified four novel inhibitors, containing the warhead-types semicarbazone, thiosemicarbazone and triazine nitrile, that can be used as leads for antiparasite drug design. Covalent docking experiments confirmed the SARs of these lead compounds in an effort to understand the structural elements required for specific inhibition of CPB2.8. This study has provided starting points for the design of selective and highly potent inhibitors of L. mexicana cysteine protease CPB that may also have useful efficacy against other important cysteine proteases. PMID:24146999

  17. Time to HAART Initiation after Diagnosis and Treatment of Opportunistic Infections in Patients with AIDS in Latin America

    PubMed Central

    Crabtree-Ramírez, Brenda; Caro-Vega, Yanink; Shepherd, Bryan E.; Grinsztejn, Beatriz; Wolff, Marcelo; Cortes, Claudia P.; Padgett, Denis; Carriquiry, Gabriela; Fink, Valeria; Jayathilake, Karu; Person, Anna K.; McGowan, Catherine; Sierra-Madero, Juan

    2016-01-01

    Background Since 2009, earlier initiation of highly active antiretroviral therapy (HAART) after an opportunistic infection (OI) has been recommended based on lower risks of death and AIDS-related progression found in clinical trials. Delay in HAART initiation after OIs may be an important barrier for successful outcomes in patients with advanced disease. Timing of HAART initiation after an OI in “real life” settings in Latin America has not been evaluated. Methods Patients in the Caribbean, Central and South America network for HIV Epidemiology (CCASAnet) ≥18 years of age at enrolment, from 2001–2012 who had an OI before HAART initiation were included. Patients were divided in an early HAART (EH) group (those initiating within 4 weeks of an OI) and a delayed HAART (DH) group (those initiating more than 4 weeks after an OI). All patients with an AIDS-defining OI were included. In patients with more than one OI the first event reported was considered. Calendar trends in the proportion of patients in the EH group (before and after 2009) were estimated by site and for the whole cohort. Factors associated with EH were estimated using multivariable logistic regression models. Results A total of 1457 patients had an OI before HAART initiation and were included in the analysis: 213 from Argentina, 686 from Brazil, 283 from Chile, 119 from Honduras and 156 from Mexico. Most prevalent OI were Tuberculosis (31%), followed by Pneumocystis pneumonia (24%), Invasive Candidiasis (16%) and Toxoplasmosis (9%). Median time from OI to HAART initiation decreased significantly from 5.7 (interquartile range [IQR] 2.8–12.1) weeks before 2009 to 4.3 (IQR 2.0–7.1) after 2009 (p<0.01). Factors associated with starting HAART within 4 weeks of OI diagnosis were lower CD4 count at enrolment (p-<0.001), having a non-tuberculosis OI (p<0.001), study site (p<0.001), and more recent years of OI diagnosis (p<0.001). Discussion The time from diagnosis of an OI to HAART initiation has

  18. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  19. Laundry performance of subtilisin proteases.

    PubMed

    Wolff, A M; Showell, M S; Venegas, M G; Barnett, B L; Wertz, W C

    1996-01-01

    Effective laundry protease performance against susceptible stains depends upon both the enzyme itself and the environment in which it must work. In order to technically design superior laundry proteases, a model for protease's mechanism of action in detergents was developed which has been substantiated through-the-wash. While evaluation of this model and/or a given protease's effectiveness could be judged by a variety of methods, the utility of using visual wash performance comparisons, analytical, and stain characterization studies is described. Finally, data comparing the performance of wild type Subtilisin proteases with mutants designed via the projected model are given, demonstrating possible utility of the system.

  20. Clinical, Demographic and Laboratory Parameters at HAART Initiation Associated with Decreased Post-HAART Survival in a U.S. Military Prospective HIV Cohort

    DTIC Science & Technology

    2012-02-10

    Rai RM, et al: The natural history of hepatitis C virus infection: host, viral , and environmental factors. JAMA 2000, 284:450-6. 15 25...greater HIV RNA level (HR=1.36 per one log10 increase), hepatitis C antibody or chronic hepatitis B (HR=1.96), and HIV diagnosis before 1996 (HR=2.44...AIDS events before HAART (HR=1.93), ≤50 CD4+ cells/mm3 (vs. CD4+ ≥500, HR=2.97), greater HIV RNA level (HR=1.36 per one log10 increase), hepatitis

  1. Informal care and reciprocity of support are associated with HAART adherence among men in Baltimore, MD, USA.

    PubMed

    Knowlton, Amy R; Yang, Cui; Bohnert, Amy; Wissow, Lawrence; Chander, Geetanjali; Arnsten, Julia A

    2011-10-01

    Research suggests gender differences in interpersonal relationship factors important to health. This study examined relationship factors associated with HAART adherence among men. The sample (n = 154) comprised 95% African Americans and 48% current illicit drug users; 83% reported HAART adherence. Results revealed adherence was associated with comfort level taking HAART in the presence of close friends, and the interaction between informal care (having someone to care for oneself when sick in bed) and reciprocity of support. Among those with informal care, higher reciprocity of support to caregivers was associated with greater adherence. Promoting men's reciprocity of support to their caregivers and enhancing peer norms of medication taking are important strategies for improving men's adherence. The findings complement previous findings on relationship factors adversely associated with women's adherence. Results suggest the merit of interventions targeting men and their informal caregivers, particularly main partners, and gender-specific, contextually tailored strategies to promote HAART adherence.

  2. Informal Care and Reciprocity of Support are Associated with HAART Adherence among Men in Baltimore, MD, USA

    PubMed Central

    Knowlton, Amy R.; Yang, Cui; Bohnert, Amy; Wissow, Lawrence; Chander, Geetanjali; A. Arnsten, Julia

    2010-01-01

    Research suggests gender differences in interpersonal relationship factors important to health. This study examined relationship factors associated with HAART adherence among men. The sample (n=154) comprised 95% African Americans and 48% current illicit drug users; 83% reported HAART adherence. Results revealed adherence was associated with comfort level taking HAART in the presence of close friends, and the interaction between informal care (having someone to care for oneself when sick in bed) and reciprocity of support. Among those with informal care, higher reciprocity of support to caregivers was associated with greater adherence. Promoting men’s reciprocity of support to their caregivers and enhancing peer norms of medication taking are important strategies for improving men’s adherence. The findings complement previous findings on relationship factors adversely associated with women’s adherence. Results suggest the merit of interventions targeting men and their informal caregivers, particularly main partners, and gender-specific, contextually tailored strategies to promote HAART adherence. PMID:20632081

  3. A Reduction Grade of Lipodystrophy and Limited Side Effects after HAART Regimen with Raltegravir, Lamivudine, Darunavir and Ritonavir in an HIV-1 Infected Patient after Six Years of Antiretroviral Therapy

    PubMed Central

    Antoni, A Degli; Weimer, LE; Fragola, V; Giacometti, A; Sozio, F

    2015-01-01

    ABSTRACT HIV-associated lipodystrophy commonly presents with fat loss in the face, buttocks, arms and legs, hypocomplementaemia, glomerulonephritis and autoimmune disorders. The exact mechanism of HIV-associated lipodystrophy is not fully elucidated. There is evidence indicating that it can be caused by both antiretroviral medications and HIV infection in the absence of antiretroviral medication. Lipodystrophy seems to be mainly due to HIV-1 protease inhibitors. Interference with lipid metabolism is postulated as pathophysiology. Also, the development of lipodystrophy is associated with specific nucleoside reverse transcriptase inhibitors (NRTI). Mitochondrial toxicity is postulated to be involved in the pathogenesis associated with NRTI. Here, we analyse the side effects and examine the impact of the highly active antiretroviral therapy (HAART) regimen including raltegravir, lamivudine, darunavir and ritonavir in an HIV-1 infected patient with severe lipodystrophy after six years of antiretroviral therapy. PMID:26426188

  4. Prognosis of HIV-1-infected patients up to 5 years after initiation of HAART: collaborative analysis of prospective studies

    PubMed Central

    2012-01-01

    Objective To estimate the prognosis over 5 years of HIV-1-infected, treatment-naive patients starting HAART, taking into account the immunological and virological response to therapy. Design A collaborative analysis of data from 12 cohorts in Europe and north America on 20 379 adults who started HAART between 1995 and 2003. Methods Parametric survival models were used to predict the cumulative incidence at 5 years of a new AIDS-defining event or death, and death alone, first from the start of HAART and second from 6 months after the start of HAART. Data were analysed by intention-to-continue-treatment, ignoring treatment changes and interruptions. Results During 61 798 person-years of follow-up, 1005 patients died and an additional 1303 developed AIDS. A total of 10 046 (49%) patients started HAART either with a CD4 cell count of less than 200 cells/μl or with a diagnosis of AIDS. The 5-year risk of AIDS or death (death alone) from the start of HAART ranged from 5.6 to 77% (1.8–65%), depending on age, CD4 cell count, HIV-1-RNA level, clinical stage, and history of injection drug use. From 6 months the corresponding figures were 4.1–99% for AIDS or death and 1.3–96% for death alone. Conclusion On the basis of data collected routinely in HIV care, prognostic models with high discriminatory power over 5 years were developed for patients starting HAART in industrialized countries. A risk calculator that produces estimates for progression rates at years 1 to 5 after starting HAART is available from www.art-cohort-collaboration.org. PMID:17502729

  5. [Recurrent diarrhea due to Cystoisopora belli in HIV/AIDS patients receiving HAART].

    PubMed

    Montalvo, Raúl; Ticona, Eduardo; Ñavincopa, Marcos; García, Yuri; Chávez, Gonzalo; Chávez, Víctor; Arévalo, Jorge; Soria, Jaime; Huiza, Alina

    2013-04-01

    The Cystoisospora belli, before denominated as Isospora belli, is the etiologic agent of cystoisosoporiasis, an opportunistic infection affecting immunocompromised patients, characterized by chronic diarrhea and weight loss. The incidence of chronic diarrhea for this agent, in HIV patients, has decreased considerably. This thanks to the advent of highly active antiretroviral therapy (HAART), which has improved the patient's immune response and decrease viral load. We present six cases of cystoisosoporiasis recurrent and refractory to treatment in HIV patients, who was being treated with with trimethoprim / sulfamethoxazole (TMP / SMX) orally as a prophylaxis. Five of these patients passed away due to the infection, despite of the fact that they had a good response to HAART (adequate increase in CD4 and viral load undetectable) and they had been treated with second line drugs.

  6. Toxoplasmic encephalitis in an AIDS cohort at Puerto Rico before and after highly active antiretroviral therapy (HAART).

    PubMed

    Mayor, Angel M; Fernández Santos, Diana M; Dworkin, Mark S; Ríos-Olivares, Eddy; Hunter-Mellado, Robert F

    2011-05-01

    Highly active antiretroviral therapy (HAART) significantly reduced the toxoplasmic encephalitis (TE) incidence in acquired immunodeficiency syndrome (AIDS) patients. The TE incidence and mortality were evaluated in an AIDS cohort followed in Puerto Rico before, during, and after HAART implementation in the Island. Of the 2,431 AIDS studied patients 10.9% had TE diagnosis, with an incidence density that decreased from 5.9/100 person-years to 1.1/100 person-years after HAART. Cox proportional hazard analysis showed substantial mortality reduction among TE cases who received HAART. No mortality reduction was seen in those cases who received TE prophylaxis. Although this study shows a TE incidence and mortality reduction in the AIDS cohort after HAART, the incidence was higher than those reported in the United States AIDS patients. Poor TE prophylaxis compliance might explain the lack of impact of this intervention. Strengthening the diagnostic and opportune TE diagnosis and prompt initiation of HAART in susceptible patients is important to control this opportunistic infection.

  7. A Case of Proliferative Diabetic Retinopathy with HIV Infection in Which HAART Possibly Influenced the Prognosis of Visual Function

    PubMed Central

    Kitagaki, Takakuni; Sato, Takaki; Hirai, Junko; Kimura, Daisaku; Kakurai, Keigo; Fukumoto, Masanori; Tajiri, Kensuke; Kobayashi, Takatoshi; Kida, Teruyo; Kojima, Shota; Ikeda, Tsunehiko

    2016-01-01

    Background We report on a patient with proliferative diabetic retinopathy (PDR) and human immunodeficiency virus (HIV) infection who exhibited extremely active PDR followed by a rapid onset of blindness in the right eye. The progression of visual disturbance in the patient's left eye was slowed after starting highly active anti-retroviral therapy (HAART), and vision in that eye was rescued after vitrectomy. Case Report A 72-year-old male developed pneumocystis carinii pneumonia stemming from an HIV infection and began HAART at the Department of Hematology, Osaka Medical College, Takatsuki City, Japan. Prior to HAART, the patient had shown rapidly progressing retinopathy in the right eye accompanied by vitreous hemorrhage, tractional retinal detachment, and neovascular glaucoma, ultimately leading to early-onset blindness. After starting HAART, the progression of the retinopathy in the left eye became slower compared to the right eye, with corrected visual acuity improving to 0.6 after vitrectomy, despite being accompanied by vitreous hemorrhage. The patient's overall condition has remained stable following the operation, and the condition of the ocular fundus in the left eye has also settled. Conclusion Significant differences were found in the progression rate of PDR with HIV infection between before and after starting HAART. Our findings suggest that early administration of HAART to HIV patients with diabetic retinopathy is crucial for maintaining visual function. PMID:27990117

  8. Randomized Control Trial of Peer-Delivered, Modified Directly Observed Therapy for HAART in Mozambique

    PubMed Central

    Pearson, Cynthia R.; Micek, Mark A.; Simoni, Jane M.; Hoff, Peter D.; Matediana, Eduardo; Martin, Diane P.; Gloyd, Stephen S.

    2014-01-01

    Objective To assess the efficacy of a peer-delivered intervention to promote short-term (6-month) and long-term (12-month) adherence to HAART in a Mozambican clinic population. Design A 2-arm randomized controlled trial was conducted between October 2004 and June 2006. Participants Of 350 men and women (≥18 years) initiating HAART, 53.7% were female, and 97% were on 1 fixed-dose combination pill twice a day. Intervention Participants were randomly assigned to receive 6 weeks (Monday through Friday; 30 daily visits) of peer-delivered, modified directly observed therapy (mDOT) or standard care. Peers provided education about treatment and adherence and sought to identify and mitigate adherence barriers. Outcome Participants' self-reported medication adherence was assessed 6 months and 12 months after starting HAART. Adherence was defined as the proportion of prescribed doses taken over the previous 7 days. Statistical analyses were performed using intention-to-treat (missing = failure). Results Intervention participants, compared to those in standard care, showed significantly higher mean medication adherence at 6 months (92.7% vs. 84.9%, difference 7.8, 95% confidence interval [CI]: 0.0.02, 13.0) and 12 months (94.4% vs. 87.7%, difference 6.8, 95% CI: 0.9, 12.9). There were no between-arm differences in chart-abstracted CD4 counts. Conclusions A peer-delivered mDOT program may be an effective strategy to promote long-term adherence among persons initiating HAART in resource-poor settings. PMID:17693890

  9. Effectiveness of Highly Active Antiretroviral Therapy (HAART) Among HIV-Infected Patients in Mexico

    PubMed Central

    Villasís-Keever, Angelina; Galindo-Fraga, Arturo; del Río, Carlos; Sierra-Madero, Juan

    2010-01-01

    Abstract The National Government HAART Program (NGP) for the provision of HAART to uninsured HIV-infected persons in Mexico began in 2001. The objective was to describe the virologic outcome of patients enrolled in the NGP in a large HIV treatment center in Mexico City. HIV-infected persons, naive or ≤6 months on HAART, who entered the NGP from 2001 to 2005 were included. Patients with virological suppression were compared to those with virologic failure (VF) during follow-up. Of 377 patients enrolled, 191 where eligible for analysis. The median age was 35.9 (18–75 years) and 85% were male. The median baseline CD4+ T cell count was 183 cells/mm3; 63.9% had <200 cells/mm3 and/or an AIDS-defining event. During follow-up (median: 17.77 months), 55 patients (28.7%) changed their first regimen: 8.3% because of VF and the remaining due to toxicity. The probability of VF at 48 months was 20%. VF was associated with age <30 years (p = 0.003, RR 4.7, IC 95% 1.5–14.4). The use of NNRTI was associated with lower risk of VF (p = 0.042, RR 0.3, IC 95% 0.12–0.99). Nadir CD4+ and AIDS-defining at baseline were not associated with VF. Implementation of NGP for HAART access in a specialized care setting in Mexico resulted in an excellent virologic response. Younger age was a significant risk factor for VF. PMID:20377418

  10. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  11. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  12. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  13. Mutations Related to Antiretroviral Resistance Identified by Ultra-Deep Sequencing in HIV-1 Infected Children under Structured Interruptions of HAART

    PubMed Central

    Vazquez-Guillen, Jose Manuel; Palacios-Saucedo, Gerardo C.; Rivera-Morales, Lydia G.; Garcia-Campos, Jorge; Ortiz-Lopez, Rocio; Noguera-Julian, Marc; Paredes, Roger; Vielma-Ramirez, Herlinda J.; Ramirez, Teresa J.; Chavez-Garcia, Marcelino; Lopez-Guillen, Paulo; Briones-Lara, Evangelina; Sanchez-Sanchez, Luz M.; Vazquez-Martinez, Carlos A.; Rodriguez-Padilla, Cristina

    2016-01-01

    Although Structured Treatment Interruptions (STI) are currently not considered an alternative strategy for antiretroviral treatment, their true benefits and limitations have not been fully established. Some studies suggest the possibility of improving the quality of life of patients with this strategy; however, the information that has been obtained corresponds mostly to studies conducted in adults, with a lack of knowledge about its impact on children. Furthermore, mutations associated with antiretroviral resistance could be selected due to sub-therapeutic levels of HAART at each interruption period. Genotyping methods to determine the resistance profiles of the infecting viruses have become increasingly important for the management of patients under STI, thus low-abundance antiretroviral drug-resistant mutations (DRM’s) at levels under limit of detection of conventional genotyping (<20% of quasispecies) could increase the risk of virologic failure. In this work, we analyzed the protease and reverse transcriptase regions of the pol gene by ultra-deep sequencing in pediatric patients under STI with the aim of determining the presence of high- and low-abundance DRM’s in the viral rebounds generated by the STI. High-abundance mutations in protease and high- and low-abundance mutations in reverse transcriptase were detected but no one of these are directly associated with resistance to antiretroviral drugs. The results could suggest that the evaluated STI program is virologically safe, but strict and carefully planned studies, with greater numbers of patients and interruption/restart cycles, are still needed to evaluate the selection of DRM’s during STI. PMID:26807922

  14. Pattern of cancer risk in persons with AIDS in Italy in the HAART era

    PubMed Central

    Dal Maso, L; Polesel, J; Serraino, D; Lise, M; Piselli, P; Falcini, F; Russo, A; Intrieri, T; Vercelli, M; Zambon, P; Tagliabue, G; Zanetti, R; Federico, M; Limina, R M; Mangone, L; De Lisi, V; Stracci, F; Ferretti, S; Piffer, S; Budroni, M; Donato, A; Giacomin, A; Bellù, F; Fusco, M; Madeddu, A; Vitarelli, S; Tessandori, R; Tumino, R; Suligoi, B; Franceschi, S

    2009-01-01

    A record-linkage study was carried out between the Italian AIDS Registry and 24 Italian cancer registries to compare cancer excess among persons with HIV/AIDS (PWHA) before and after the introduction of highly active antiretroviral therapy (HAART) in 1996. Standardised incidence ratios (SIR) were computed in 21951 AIDS cases aged 16–69 years reported between 1986 and 2005. Of 101 669 person-years available, 45 026 were after 1996. SIR for Kaposi sarcoma (KS) and non-Hodgkin lymphoma greatly decreased in 1997–2004 compared with 1986–1996, but high SIRs for KS persisted in the increasingly large fraction of PWHA who had an interval of <1 year between first HIV-positive test and AIDS diagnosis. A significant excess of liver cancer (SIR=6.4) emerged in 1997–2004, whereas the SIRs for cancer of the cervix (41.5), anus (44.0), lung (4.1), brain (3.2), skin (non-melanoma, 1.8), Hodgkin lymphoma (20.7), myeloma (3.9), and non-AIDS-defining cancers (2.2) were similarly elevated in the two periods. The excess of some potentially preventable cancers in PWHA suggests that HAART use must be accompanied by cancer-prevention strategies, notably antismoking and cervical cancer screening programmes. Improvements in the timely identification of HIV-positive individuals are also a priority in Italy to avoid the adverse consequences of delayed HAART use. PMID:19223894

  15. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  16. Impact of HCV treatment and depressive symptoms on adherence to HAART among coinfected HIV-HCV patients: results from the ANRS-CO13-HEPAVIH cohort

    PubMed Central

    Roux, Perrine; Lions, Caroline; Cohen, Julien; Winnock, Maria; Salmon-Céron, Dominique; Bani-Sadr, Firouzé; Sogni, Philippe; Spire, Bruno; Dabis, François; Carrieri, Maria Patrizia

    2014-01-01

    Background The additional burden of HCV infection in HIV-HCV coinfected individuals may have some consequences on adherence to highly active antiretroviral therapy (HAART). Few studies have explored the pattern of correlates of non-adherence to HAART while simultaneously considering the impact of HCV treatment and depressive symptoms on adherence to HAART. We used longitudinal data to assess factors associated with non-adherence to HAART. Methods The French national prospective cohort ANRS-CO-13-HEPAVIH is a multi-center cohort which recruited 1175 HIV-HCV coinfected patients in 17 hospital outpatient units delivering HIV and HCV care in France between October 2006 and June 2008. For this analysis, we selected participants on HAART with self-reported data for adherence to HAART (n = 727 patients, 1190 visits). Data were collected using self-administered questionnaires and medical records. A mixed logistic regression model based on an exchangeable correlation matrix was used to identify factors associated with non-adherence to HAART. Results Patients reported non-adherence to HAART in 808 (68%) of the 1190 visits. Four variables remained associated with non-adherence to HAART after multivariate analysis: hazardous alcohol consumption, cocaine use and depressive symptoms, regardless of whether treatment for depression was being received. Finally, patients being treated for HCV infection were less likely to be non-adherent to HAART. Conclusions Besides the problem of polydrug use, two other dimensions deserve special attention when considering adherence to HAART in HIV-HCV coinfected patients. Access to HCV treatment should be encouraged as well adequate treatment for depression in this population to improve adherence and response to HAART. PMID:24166726

  17. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  18. [Successful treatment with hyper-CVAD and highly active anti-retroviral therapy (HAART) for AIDS-related Burkitt lymphoma].

    PubMed

    Suzuki, Kazuhito; Nakazato, Tomonori; Sanada, Yukinari; Mihara, Ai; Tachikawa, Natsuo; Kurai, Hanako; Yoshimura, Yukihiro; Hayashi, Hiroyuki; Yoshida, Sachiko; Kakimoto, Tsunayuki

    2010-03-01

    A 38-year-old man was admitted to our hospital because of continuous fever and right facial palsy. He was diagnosed as HIV positive. Abdominal CT scan showed a large mass in the ascending colon. Gallium scintigraphy demonstrated increased uptake in the ascending colon. Colonoscopy was performed and histological examination of the colon tumor revealed Burkitt's lymphoma (BL). He received highly active anti-retroviral therapy (HAART) and his facial palsy improved. Because CD4 count was significantly low at 31/microl, he was treated with dose-adjusted EPOCH (DA-EPOCH) combined with HAART. Although the tumor was decreased in size by DA-EPOCH, we changed to the combination of hyper-CVAD/MTX-Ara-C alternating therapy with HAART in order to increase dose intensity. Six cycles of hyper-CVAD/MTX-Ara-C were performed and complete remission was obtained. In the HAART era, the survival of patients with AIDS-related diffuse large cell lymphoma (DLCL) improved dramatically, whereas the survival of similarly treated patients with AIDS-related BL remained poor. Our case suggests that intensive chemotherapy with hyper-CVAD/MTX-Ara-C combined with HAART may be well tolerated and effective in AIDS-related BL.

  19. Community-based treatment of advanced HIV disease: introducing DOT-HAART (directly observed therapy with highly active antiretroviral therapy).

    PubMed Central

    Farmer, P.; Léandre, F.; Mukherjee, J.; Gupta, R.; Tarter, L.; Kim, J. Y.

    2001-01-01

    In 2000, acquired immunodeficiency syndrome (AIDS) overtook tuberculosis (TB) as the world's leading infectious cause of adult deaths. In affluent countries, however, AIDS mortality has dropped sharply, largely because of the use of highly active antiretroviral therapy (HAART). Antiretroviral agents are not yet considered essential medications by international public health experts and are not widely used in the poor countries where human immunodeficiency virus (HIV) takes its greatest toll. Arguments against the use of HAART have mainly been based on the high cost of medications and the lack of the infrastructure necessary for using them wisely. We re- examine these arguments in the setting of rising AIDS mortality in developing countries and falling drug prices, and describe a small community-based treatment programme based on lessons gained in TB control. With the collaboration of Haitian community health workers experienced in the delivery of home-based and directly observed treatment for TB, an AIDS-prevention project was expanded to deliver HAART to a subset of HIV patients deemed most likely to benefit. The inclusion criteria and preliminary results are presented. We conclude that directly observed therapy (DOT) with HAART, "DOT-HAART", can be delivered effectively in poor settings if there is an uninterrupted supply of high-quality drugs. PMID:11799447

  20. Main partner factors associated with worse adherence to HAART among women in Baltimore, U.S.: A preliminary study

    PubMed Central

    Knowlton, Amy R.; Yang, Cui; Bohnert, Amy; Wissow, Lawrence; Chander, Geetanjali; Arnsten, Julia A.

    2011-01-01

    U.S. women have worse HAART and HIV health outcomes compared to U.S. men. The study examined main partner factors associated with women's HAART adherence. The community sample comprised 85% African Americans; 63% had a main partner and 32% relied on their partner for emotional support. Adherence was highest (92%) among those without a main partner, and lowest (57%) among those with an HIV seropositive main partner. In adjusted analysis, adherence was 75% less likely among women with an HIV seropositive main partner, and 78% less likely among those relying on their partner for emotional support. Furthermore, HIV seropositive versus other serostatus main partners were most likely to provide medication taking assistance and to be preferred in helping participants deal with HIV, yet were no more likely to be nominated as the most helpful to them. Findings reveal women's perceived unmet support needs from HIV seropositive main partners in this population, and the need for interventions to promote their HAART adherence. Seroconcordant couples-focused intervention that enhances mutual support of HAART adherence may be an effective approach to improving women's HAART adherence and reducing US gender disparities in HIV health outcomes. PMID:21476149

  1. Successful simplification of HAART in patients with acute primary HIV infection.

    PubMed

    Sinicco, A; Bonora, S; Arnaudo, I; Zeme, D A; Audagnotto, S; Raiteri, R; Di Perri, G

    2002-01-01

    Aggressive treatment has been advocated for the management of primary HIV infection (PHI), but the composition and the optimal duration of therapy are still to be determined. In addition, time to undetectable viral load (VL), rate and duration of VL suppression as well as subsequent therapeutic choices remain issues widely debated. We evaluated the rate and duration of VL suppression in 12 consecutive patients with PHI given triple-drug treatment with zidovudine, lamivudine and indinavir (highly active antiretroviral therapy, HAART) at onset of the acute illness and subsequently switched to a simplified 2-NRTI-based regimen once VL suppression was maintained for at least 6 months. Throughout the study, no patient discontinued treatment because of symptoms attributed to the study medications. In the study population, undetectable VL was achieved after a median of 84 days (range: 67-135) on HAART and was maintained for a median of 194 days (range: 179-205) before simplification. After switching to simplified maintenace, undetectable VL was maintained in all patients for at least 6 months. Only one patient experienced virological failure, plasma HIV-RNA remaining suppressed for a median foliow-up of 33 months (15-54) and T-CD4+ being steadily higher than 500/mL in the remaining patients. Our results suggest that simplification of HAART in patients promptly treated during PHI and maintaining undetectable VL for at least 6 months before simplification may be a valid option capable of controlling viral replication and maintaining an optimal immunological profile for a prolonged time.

  2. Prevalence of Depressive Symptoms Amongst Highly Active Antiretroviral Therapy (HAART) Patients in AIDSRelief Uganda

    PubMed Central

    Atukunda, Ruth; Imakit, Richard; Memiah, Peter

    2013-01-01

    There is limited data on the prevalence of depression in HIV and AIDS patients in Sub-Saharan Africa and little resources have been allocated to address this issue. Depression affects patient adherence to treatment and predisposes patients to resistance which poses a public health threat. It also affects quality of life and productivity of patients. From August 2008 to March 2009, 731 patient adherence surveys were administered to assess disease, treatment knowledge and services received. The primary variable of interest was patients’ level of depressive symptoms score, constructed using factor analysis from five survey questions relating to: sadness, need to be alone, hopelessness and confusion and was categorized as no depressive symptoms (score 0), low depressive symptoms (score 1-2), moderate depressive symptoms (score 3-4) and high depressive symptoms (score 5-10). Majority of the patients on highly active antiretroviral therapy (HAART) (59%) were found to have depressive symptoms and this was more among women than men (66% vs 43%). There was some association of depressive symptoms with non-disclosure (70% of those who had not disclosed had depressive symptoms compared to 53% among those who had disclosed). There is a high prevalence of depressive symptoms among adult patients on HAART. There is need for in-depth evaluation to find out the root causes of depressive symptoms among HAART patients in AIDSRelief clinics. There is need to integrate mental health management in HIV care and treatment as well as training the existing health workers on mental health management. PMID:28299108

  3. Intensive Lifestyle Modification Reduces Lp-PLA2 in Dyslipidemic HIV/HAART Patients

    PubMed Central

    Wooten, Joshua S.; Nambi, Preethi; Gillard, Baiba K.; Pownall, Henry J.; Coraza, Ivonne; Scott, Lynne W.; Nambi, Vijay; Ballantyne, Christie M.; Balasubramanyam, Ashok

    2013-01-01

    Patients with dyslipidemia associated with HIV-1 infection and highly active antiretroviral therapy (HAART) have elevated levels of Lp-PLA2 and CCL5/RANTES, which may increase risk of cardiovascular disease. Purpose This study aimed to determine whether an intensive diet and exercise (D/E) program, independently or combined with fenofibrate or niacin, could reduce Lp-PLA2 or RANTES. Methods Hypertriglyceridemic HIV patients on stable HAART (n=107) were randomized to one of five interventions: 1) Usual Care (UC); 2) D/E with placebos; 3) D/E with fenofibrate and placebo; 4) D/E with niacin and placebo; or 5) D/E with fenofibrate and niacin for 24 weeks. Lp-PLA2 and RANTES concentrations were measured in fasting plasma samples at baseline and post-intervention. General linear models were used to compare Lp-PLA2 and RANTES levels between the five groups post-intervention, controlling for baseline levels, age, BMI, CD4+ T-cell count, viral load, duration of infection, and HAART. Results At baseline, fasting plasma Lp-PLA2 (388.5 ± 127.5 ng/mL) and RANTES (43.8 ± 25.5 ng/mL) levels were elevated when compared to healthy controls. Post-treatment Lp-PLA2 mass was lower in patients who received D/E only (323.0 ± 27.2 ng/mL), D/E plus fenofibrate (327.2 ± 25.9 ng/mL) and D/E plus niacin (311.1 ± 27.8 ng/mL) when compared to patients receiving UC (402.2 ± 25.3 ng/mL). RANTES concentrations were not significantly affected by any intervention. Conclusions Elevated plasma Lp-PLA2 mass can be reduced by an intensive diet and exercise program in patients with HIV/HAART-associated dyslipidemia. RANTES is elevated but is not reduced by lifestyle modification, fenofibrate or niacin. PMID:23299761

  4. Social grants, welfare, and the incentive to trade-off health for income among individuals on HAART in South Africa.

    PubMed

    Venkataramani, Atheendar S; Maughan-Brown, Brendan; Nattrass, Nicoli; Ruger, Jennifer Prah

    2010-12-01

    South Africa's government disability grants are considered important in providing income support to low-income AIDS patients. Indeed, anecdotal evidence suggests that some individuals may opt to compromise their health by foregoing Highly Active Antiretroviral Treatment (HAART) to remain eligible for the grant. In this study, we examined the disability grant's importance to individual and household welfare, and the impact of its loss using a unique longitudinal dataset of HAART patients in Khayelitsha, Cape Town. We found that grant loss was associated with sizeable declines in income and changes in household composition. However, we found no evidence of individuals choosing poor health over grant loss. Our analysis also suggested that though the grants officially target those too sick to work, some people were able to keep grants longer than expected, and others received grants while employed. This has helped cushion people on HAART, but other welfare measures need consideration.

  5. Relationship of ethnicity and CD4 Count with glucose metabolism among HIV patients on Highly-Active Antiretroviral Therapy (HAART)

    PubMed Central

    2013-01-01

    Background HIV patients on HAART are prone to metabolic abnormalities, including insulin resistance, lipodystrophy and diabetes. This study purports to investigate the relationship of ethnicity and CD4+ T cell count attained after stable highly-active antiretroviral treatment (HAART) with glucose metabolism in hyperrtriglyceridemic HIV patients without a history of diabetes. Methods Demographic, anthropometric, clinical, endocrinologic, energy expenditure and metabolic measures were obtained in 199 multiethnic, healthy but hypertriglyceridemic HIV-infected patients [46% Hispanic, 17% African-American, 37% Non-Hispanic White (NHW)] on stable HAART without a history of diabetes. The relationship of glucose and insulin responses to ethnicity, CD4 strata (low (<300/cc) or moderate-to-high (≥ 300/cc)), and their interaction was determined. Results African-Americans had significantly greater impairment of glucose tolerance (P < 0.05) and HbA1c levels (P < .001) than either Hispanics or NHWs. In multivariate models, after adjusting for confounders (age, sex, HIV/HAART duration, smoking, obesity, glucose, insulin and lipids), African-Americans and Hispanics had significantly higher HbA1c and 2-hour glucose levels than NHW’s. Demonstrating a significant interaction between ethnicity and CD4 count (P = 0.023), African Americans with CD4 <300/cc and Hispanics with CD4 ≥300/cc had the most impaired glucose response following oral glucose challenge. Conclusions Among hypertriglyceridemic HIV patients on HAART, African-Americans and Hispanics are at increased risk of developing diabetes. Ethnicity also interacts with CD4+ T cell count attained on stable HAART to affect post-challenge glycemic response. PMID:23607267

  6. Impact of HAART and CNS-penetrating antiretroviral regimens on HIV encephalopathy among perinatally infected children and adolescents

    PubMed Central

    Patel, Kunjal; Ming, Xue; Williams, Paige L.; Robertson, Kevin R.; Oleske, James M.; Seage, George R.

    2010-01-01

    Objectives Prior to antiretroviral treatment, HIV-infected children frequently developed encephalopathy, resulting in debilitating morbidity and mortality. This is the first large study to evaluate the impact of HAART and central nervous system (CNS)-penetrating antiretroviral regimens on the incidence of HIV encephalopathy and survival after diagnosis of HIV encephalopathy among perinatally infected children. Design A total of 2398 perinatally HIV-infected children with at least one neurological examination were followed in a US-based prospective cohort study conducted from 1993 to 2007. Methods Trends in incidence rates over calendar time were described and Cox regression models were used to estimate the effects of time-varying HAART and CNS-penetrating antiretroviral regimens on HIV encephalopathy and on survival after diagnosis of HIV encephalopathy. Results During a median of 6.4 years of follow-up, 77 incident cases of HIV encephalopathy occurred [incidence rate 5.1 cases per 1000 person-years, 95% confidence interval (CI) 4.0–6.3]. A 10-fold decline in incidence was observed beginning in 1996, followed by a stable incidence rate after 2002. HAART regimens were associated with a 50% decrease (95% CI 14–71%) in the incidence of HIV encephalopathy compared with non-HAART regimens. High CNS-penetrating regimens were associated with a substantial survival benefit (74% reduction in the risk of death, 95% CI 39–89%) after HIV encephalopathy diagnosis compared with low CNS-penetrating regimens. Conclusion A dramatic decrease in the incidence of HIV encephalopathy occurred after the introduction of HAART. The use of HAART was highly effective in reducing the incidence of HIV encephalopathy among perinatally infected children and adolescents. Effective CNS-penetrating antiretroviral regimens are important in affecting survival after diagnosis of HIV encephalopathy. PMID:19644348

  7. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  8. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  9. AIDS-defining opportunistic illnesses in the HAART era in New York City.

    PubMed

    Hanna, D B; Gupta, L S; Jones, L E; Thompson, D M; Kellerman, S E; Sackoff, J E

    2007-02-01

    Despite widespread availability of HAART, opportunistic illnesses (OIs) still occur and result in an increased risk of mortality among persons with AIDS. We estimated the incidence of OIs among all new adult AIDS cases in New York City in 2000 overall and in demographic and clinical subgroups and identified factors associated with occurrence of an AIDS-defining OI versus AIDS diagnosis based on low CD4+ values only. In 2000, 5,451 new AIDS cases were reported to the New York City Department of Health and Mental Hygiene. Of these 27.4% (95% CI: 22.8-32.6) had at least one OI, most frequent being Pneumocystis jiroveci pneumonia (12.2%) and M. tuberculosis (5.3%); 47.1% (41.7-52.5) had a late HIV diagnosis (i.e.< or =6 months before AIDS diagnosis). Persons with a late HIV diagnosis not in recent care had a 3.5-fold increased odds (1.29-9.63) of an OI, compared to non-late testers in care. Other predictors of an OI were injection drug use and older age. We conclude that OIs remain prevalent in the HAART era and late testers not in care are especially likely to develop an OI. Our results support comprehensive HIV programs promoting early HIV testing and linkage to care to prevent OI-related morbidity and mortality.

  10. Design, Synthesis, Biological and Structural Evaluations of Novel HIV-1 Protease Inhibitors to Combat Drug Resistance

    PubMed Central

    Parai, Maloy Kumar; Huggins, David J.; Cao, Hong; Nalam, Madhavi N. L.; Ali, Akbar; Schiffer, Celia A.; Tidor, Bruce; Rana, Tariq M.

    2012-01-01

    A series of new HIV-1 protease inhibitors (PIs) were designed using a general strategy that combines computational structure-based design with substrate-envelope constraints. The PIs incorporate various alcohol-derived P2 carbamates with acyclic and cyclic heteroatomic functionalities into the (R)-hydroxyethylamine isostere. Most of the new PIs show potent binding affinities against wild-type HIV-1 protease and three multidrug resistant (MDR) variants, in particular inhibitors containing 2,2-dichloroacetamide, pyrrolidinone, imidazolidinone, and oxazolidinone moieties at P2 are the most potent with Ki values in the picomolar range. Several new PIs exhibit nanomolar antiviral potencies against patient-derived wild-type viruses from HIV-1 clades A, B, and C and two MDR variants. Crystal structure analyses of four potent inhibitors revealed that carbonyl groups of the new P2 moieties promote extensive hydrogen bond interactions with the invariant Asp-29 residue of the protease. These structure-activity relationship findings can be utilized to design new PIs with enhanced enzyme inhibitory and antiviral potencies. PMID:22708897

  11. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  12. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  13. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  14. People with HIV in HAART-era Russia: transmission risk behavior prevalence, antiretroviral medication-taking, and psychosocial distress.

    PubMed

    Amirkhanian, Yuri A; Kelly, Jeffrey A; Kuznetsova, Anna V; DiFranceisco, Wayne J; Musatov, Vladimir B; Pirogov, Dmitry G

    2011-05-01

    Russia has seen one of the world's fastest-growing HIV epidemics. Transmission risk behavior, HAART-taking, and psychosocial distress of the growing population of Russian people living with HIV (PLH) in the HAART era are understudied. Participants of a systematically-recruited cross-sectional sample of 492 PLH in St. Petersburg completed measures of sexual and drug injection practices, adherence, perceived discrimination, and psychosocial distress. Since learning of their status, 58% of participants had partners of HIV-negative or unknown serostatus (mean = 5.8). About 52% reported unprotected intercourse with such partners, with 30% of acts unprotected. Greater perceived discrimination predicted lower condom use. A 47% of IDU PLH still shared needles, predicted by having no primary partner, lower education, and more frequently-encountered discrimination. Twenty-five percentage of PLH had been refused general health care, 11% refused employment, 7% fired, and 6% forced from family homes. Thirty-nine percentage of participants had probable clinical depression, 37% had anxiety levels comparable to psychiatric inpatients, and social support was low. Of the 54% of PLH who were offered HAART, 16% refused HAART regimens, and 5% of those on the therapy took less than 90% of their doses. Comprehensive community services for Russian PLH are needed to reduce AIDS-related psychosocial distress and continued HIV transmission risk behaviors. Social programs should reduce stigma and discrimination, and promote social integration of affected persons and their families.

  15. The pathophysiology of HIV-/HAART-related metabolic syndrome leading to cardiovascular disorders: the emerging role of adipokines.

    PubMed

    Palios, John; Kadoglou, Nikolaos P E; Lampropoulos, Stylianos

    2012-01-01

    Individuals infected with human immunodeficiency virus (HIV) frequently demonstrate metabolic syndrome (MS) associated with increased incidence of cardiovascular disorders. Characteristics of HIV infection, such as immunodeficiency, viral load, and duration of the disease, in addition to the highly active antiretroviral therapy (HAART) have been suggested to induce MS in these patients. It is well documented that MS involves a number of traditional cardiovascular risk factors, like glucose, lipids, and arterial blood pressure abnormalities, leading to extensive atherogenic arterial wall changes. Nevertheless, the above traditional cardiovascular risk factors merely explain the exacerbated cardiovascular risk in MS. Nowadays, the adipose-tissue derivatives, known as adipokines, have been suggested to contribute to chronic inflammation and the MS-related cardiovascular disease. In view of a novel understanding on how adipokines affect the pathogenesis of HIV/HAART-related MS and cardiovascular complications, this paper focuses on the interaction of the metabolic pathways and the potential cardiovascular consequences. Based on the current literature, we suggest adipokines to have a role in the pathogenesis of the HIV/HAART-related MS. It is crucial to understand the pathophysiology of the HIV/HAART-related MS and apply therapeutic strategies in order to reduce cardiovascular risk in HIV patients.

  16. Cross-Sectional Analysis of Late HAART Initiation in Latin America and the Caribbean: Late Testers and Late Presenters

    PubMed Central

    Crabtree-Ramírez, Brenda; Caro-Vega, Yanink; Shepherd, Bryan E.; Wehbe, Firas; Cesar, Carina; Cortés, Claudia; Padgett, Denis; Koenig, Serena; Gotuzzo, Eduardo; Cahn, Pedro; McGowan, Catherine; Masys, Daniel; Sierra-Madero, Juan

    2011-01-01

    Background Starting HAART in a very advanced stage of disease is assumed to be the most prevalent form of initiation in HIV-infected subjects in developing countries. Data from Latin America and the Caribbean is still lacking. Our main objective was to determine the frequency, risk factors and trends in time for being late HAART initiator (LHI) in this region. Methodology Cross-sectional analysis from 9817 HIV-infected treatment-naïve patients initiating HAART at 6 sites (Argentina, Chile, Haiti, Honduras, Peru and Mexico) from October 1999 to July 2010. LHI had CD4+ count ≤200cells/mm3 prior to HAART. Late testers (LT) were those LHI who initiated HAART within 6 months of HIV diagnosis. Late presenters (LP) initiated after 6 months of diagnosis. Prevalence, risk factors and trends over time were analyzed. Principal Findings Among subjects starting HAART (n = 9817) who had baseline CD4+ available (n = 8515), 76% were LHI: Argentina (56%[95%CI:52–59]), Chile (80%[95%CI:77–82]), Haiti (76%[95%CI:74–77]), Honduras (91%[95%CI:87–94]), Mexico (79%[95%CI:75–83]), Peru (86%[95%CI:84–88]). The proportion of LHI statistically changed over time (except in Honduras) (p≤0.02; Honduras p = 0.7), with a tendency towards lower rates in recent years. Males had increased risk of LHI in Chile, Haiti, Peru, and in the combined site analyses (CSA). Older patients were more likely LHI in Argentina and Peru (OR 1.21 per +10-year of age, 95%CI:1.02–1.45; OR 1.20, 95%CI:1.02–1.43; respectively), but not in CSA (OR 1.07, 95%CI:0.94–1.21). Higher education was associated with decreased risk for LHI in Chile (OR 0.92 per +1-year of education, 95%CI:0.87–0.98) (similar trends in Mexico, Peru, and CSA). LHI with date of HIV-diagnosis available, 55% were LT and 45% LP. Conclusion LHI was highly prevalent in CCASAnet sites, mostly due to LT; the main risk factors associated were being male and older age. Earlier HIV-diagnosis and earlier treatment initiation

  17. Nonorgan-specific autoantibodies in HIV-infected patients in the HAART era

    PubMed Central

    Iordache, Laura; Bengoufa, Djaouida; Taulera, Olivier; Rami, Agathe; Lascoux-Combe, Caroline; Day, Nesrine; Parrinello, Maguy; Sellier, Pierre-Olivier; Molina, Jean-Michel; Mahr, Alfred

    2017-01-01

    Abstract Nonorgan-specific autoantibodies (AAbs) are used for diagnosing autoimmune diseases but can also be detected in other conditions. We carried out a cross-sectional study with the aim to screen HIV1-infected patients in the era of highly active antiretroviral therapy (HAART) for AAbs and to analyze the association of their presence with hypergammaglobulinemia and immunovirological status. Blood samples from HIV1-infected patients without major concomitant illnesses followed in 2 hospitals in Paris, France were tested for immunovirological status, serum immunoglobulin G (IgG) level, antinuclear antibodies (ANAs), anti-double-stranded DNA (anti-dsDNA), anti-extractable nuclear antigens (anti-ENAs), anticardiolipin (aCL), anti-β2glycoprotein1 (anti-β2GP1), and antineutrophil cytoplasmic antibodies (ANCAs). Clinically relevant AAbs were defined as ANAs with titers ≥1:160, anti-dsDNA or anti-ENA antibodies; aCL or anti-β2GP1 antibodies with a level ≥40 U/ml; and ANCAs reacting with proteinase 3 or myeloperoxidase. We included 92 patients (mean age 47 years, men 55%, sub-Saharan African background 55%, HAART 85%, mean CD4 lymphocyte count 611/mm3, viral load < 40 copies/mL 74%). At least 1 AAb was detected in 45% of patients, mostly ANAs (33%) and ANCAs (13%); 12% had ≥1 clinically relevant AAb. Above-normal IgG levels were found in 71% of patients. We found an inverse association between the presence of ≥1 AAb and CD4 lymphocyte count (P = 0.03) and between above-normal IgG levels and duration of virological control (P = 0.02) and non-sub-Saharan African background (P = 0.001). In sum, in HIV1-infected patients without any major concomitant illness in the HAART era, the prevalence of AAbs remains high but AAb patterns leading to high suspicion of autoimmune diseases are rather uncommon. AAb presence is associated with reduced CD4 lymphocyte count but not hypergammaglobulinemia. PMID:28272216

  18. Current use of statins reduces risk of HIV rebound on suppressive HAART

    PubMed Central

    Ayers, Colby; Cutrell, James; Maalouf, Naim; Tebas, Pablo; Bedimo, Roger

    2017-01-01

    Background Despite compelling evidence for activity against HIV-1 in vitro, a virologic effect of statins has not been shown in clinical studies. Given their short plasma half-lives, such an effect may be transient and only apparent during ongoing exposure. Methods We studied all HIV infected US-Veterans who started HAART 1995–2011, had a documented HIV viral load (VL) >1000 copies/mL, reached an undetectable VL on HAART, and had ≥1 follow-up VL within 13 months. We defined virologic failure (VF) as the first VL >1,000 copies/mL or the first of 2 consecutive VL >200 copies/mL. We built a time-updated drug exposure model for antiretrovirals (ARVs), statins, and other cardiovascular drugs (CVMs), investigating current use (yes/no), recent use (proportion of days used), and categorical use (ever/never). We used both multiply adjusted and inverse-probability-weighted (IPW) Cox models to explore the association between statin and CVM use and VF. Results 19,324 veterans met inclusion criteria. Median follow-up was 13 months (IQR: 5–32 months); 63% experienced VF after a median time of 9 months (IQR 4–21 months). Almost 1/3 patients ever used statins but exposure comprised only 41% of follow-up time covered after initial prescription. Unadjusted, current statin use was associated with a hazard ratio (HR) for VF of 0.60 (CI: 0.56–0.65). This remained statistically significant after multivariate adjustment (MVA) for demographics, HIV and HAART parameters [HR 0.81 (CI: 0.75–0.88), p<0.001] and IPW (truncation <1%/>99%) HR: 0.83 (CI: 0.75–0.92), p<0.001]. No independent association was observed for other CVMs. The association between categorical-statin use and VF after MVA was much weaker: HR 0.94 (CI: 0.88–1.00, p = 0.04). Conclusion Current statin exposure was associated with reduced risk of VF in univariate, multivariate, and inverse-probability-weighted models. Our results highlight the importance of time-updated medication exposure models for

  19. Nonorgan-specific autoantibodies in HIV-infected patients in the HAART era.

    PubMed

    Iordache, Laura; Bengoufa, Djaouida; Taulera, Olivier; Rami, Agathe; Lascoux-Combe, Caroline; Day, Nesrine; Parrinello, Maguy; Sellier, Pierre-Olivier; Molina, Jean-Michel; Mahr, Alfred

    2017-03-01

    Nonorgan-specific autoantibodies (AAbs) are used for diagnosing autoimmune diseases but can also be detected in other conditions. We carried out a cross-sectional study with the aim to screen HIV1-infected patients in the era of highly active antiretroviral therapy (HAART) for AAbs and to analyze the association of their presence with hypergammaglobulinemia and immunovirological status.Blood samples from HIV1-infected patients without major concomitant illnesses followed in 2 hospitals in Paris, France were tested for immunovirological status, serum immunoglobulin G (IgG) level, antinuclear antibodies (ANAs), anti-double-stranded DNA (anti-dsDNA), anti-extractable nuclear antigens (anti-ENAs), anticardiolipin (aCL), anti-β2glycoprotein1 (anti-β2GP1), and antineutrophil cytoplasmic antibodies (ANCAs). Clinically relevant AAbs were defined as ANAs with titers ≥1:160, anti-dsDNA or anti-ENA antibodies; aCL or anti-β2GP1 antibodies with a level ≥40 U/ml; and ANCAs reacting with proteinase 3 or myeloperoxidase.We included 92 patients (mean age 47 years, men 55%, sub-Saharan African background 55%, HAART 85%, mean CD4 lymphocyte count 611/mm, viral load < 40 copies/mL 74%). At least 1 AAb was detected in 45% of patients, mostly ANAs (33%) and ANCAs (13%); 12% had ≥1 clinically relevant AAb. Above-normal IgG levels were found in 71% of patients. We found an inverse association between the presence of ≥1 AAb and CD4 lymphocyte count (P = 0.03) and between above-normal IgG levels and duration of virological control (P = 0.02) and non-sub-Saharan African background (P = 0.001).In sum, in HIV1-infected patients without any major concomitant illness in the HAART era, the prevalence of AAbs remains high but AAb patterns leading to high suspicion of autoimmune diseases are rather uncommon. AAb presence is associated with reduced CD4 lymphocyte count but not hypergammaglobulinemia.

  20. The impact of highly active antiretroviral therapy (HAART) on visceral leishmaniasis in Spanish patients who are co-infected with HIV.

    PubMed

    López-Vélez, R

    2003-10-01

    Clinicians in Madrid have been observing and treating HIV-positive patients with visceral leishmaniasis (VL) for over a decade. As their records cover some of the co-infection cases that occurred before and after highly active antiretroviral therapy (HAART) was introduced into Spain, retrospective analysis of the records has allowed some of the effects of HAART on local VL to be determined. Encouragingly, HAART appears to have decreased the annual incidence of VL among local AIDS cases, from 4.81 cases/100 to just 0.8 case/100 (P <0.0005), a first episode of VL now appearing only when there is obvious HAART failure. Unfortunately, it does not seem to be very good at preventing VL relapses; within 24 months of antileishmanial treatment, 70% of patients who were receiving HAART had such relapses. The mean time between antileishmanial treatment and VL relapse was, however, longer when HAART was used than when it was not (20 v. 13 months). In those receiving HAART, relapses of the VL often occurred despite increasing CD4+ cell counts and undetectable HIV loads, indicating that successful treatment of the viral infection is insufficient to prevent the relapse of the leishmaniasis. These results are in general agreement with other observations made in Spain. VL relapses are possible and even frequent in HIV-positives who have no more than 200 CD4+ cells/microl, but secondary prophylaxis to prevent VL relapses may be safely suspended if a CD4+ count of >200 cells/microl can be maintained using HAART. VL also seems to hamper the immunological recovery of the HIV-positive, although HAART appears to have little effect on the clinical manifestations of VL.

  1. Periodontal disease in HIV-infected adults in the HAART era: Clinical, immunological, and microbiological aspects.

    PubMed

    Gonçalves, Lucio Souza; Gonçalves, Barbara Mulatinho Lopo; Fontes, Tatiana Vasconcellos

    2013-10-01

    The introduction of highly active antiretroviral therapy (HAART) has decreased the incidence and prevalence of several oral manifestations such as oral candidiasis, hairy leukoplakia, and Kaposi's sarcoma in HIV-infected patients. Regarding periodontal disease the findings are not clear. This disease represents a group of chronic oral diseases characterized by infection and inflammation of the periodontal tissues. These tissues surround the teeth and provide periodontal protection (the gingival tissue) and periodontal support (periodontal ligament, root cementum, alveolar bone). Clinical, immunological, and microbiological aspects of these diseases, such as linear gingival erythema (LGE), necrotizing periodontal diseases (NPD) (necrotizing ulcerative gingivitis [NUG], necrotizing ulcerative periodontitis [NUP] and necrotizing stomatitis), and chronic periodontitis, have been widely studied in HIV-infected individuals, but without providing conclusive results. The purpose of this review was to contribute to a better overall understanding of the probable impact of HIV-infection on the characteristics of periodontal infections.

  2. BK virus associated meningoencephalitis in an AIDS patient treated with HAART

    PubMed Central

    Vidal, José E; Fink, Maria C; Cedeno-Laurent, Filiberto; Delbue, Serena; Ferrante, Pasquale; Dauar, Rafi F; Filho, Francisco Bonasser; Nogueira, Roberta Schiavon; Calore, Eduardo E; Pannuti, Claudio S; Trujillo, J Roberto; de Oliveira, Augusto C Penalva

    2007-01-01

    A severely immune-suppressed AIDS patient was suspected of suffering from BK virus (BKV) meningoencephalitis, after being studied for common causes of neurological complications of co-infectious origin. Polymerase chain reaction (PCR) and sequence analysis of cerebrospinal fluid and brain samples, confirmed the presence of BKV. His clinical condition improved along with the regression of brain lesions, after modifications on his antiretroviral regime. Five months after discharge, the patient was readmitted because of frequent headaches, and a marked inflammatory reaction was evidenced by a new magnetic resonance imaging (MRI). The symptoms paralleled a rising CD4+ lymphocyte count, and immune reconstitution syndrome was suspected. This is the first non-postmortem report of BKV meningoencephalitis in an AIDS patient, showing clinical and radiographic improvement solely under HAART. PMID:17559655

  3. Hybrid data capture for monitoring patients on highly active antiretroviral therapy (HAART) in urban Botswana.

    PubMed Central

    Bussmann, Hermann; Wester, C. William; Ndwapi, Ndwapi; Vanderwarker, Chris; Gaolathe, Tendani; Tirelo, Geoffrey; Avalos, Ava; Moffat, Howard; Marlink, Richard G.

    2006-01-01

    Individual patient care and programme evaluation are pivotal for the success of antiretroviral treatment programmes in resource-limited countries. While computer-aided documentation and data storage are indispensable for any large programme, several important issues need to be addressed including which data are to be collected, who collects it and how it is entered into an electronic database. We describe a patient-monitoring approach, which uses patient encounter forms (in hybrid paper + electronic format) based on optical character recognition, piloted at Princess Marina Hospital in Gaborone, Botswana's first public highly active antiretroviral therapy (HAART) outpatient clinic. Our novel data capture approach collects "key" data for tracking patient and programme outcomes. It saves physician time and does not detract from clinical care. PMID:16501730

  4. Immunologic basis for revaccination of HIV-infected children receiving HAART

    PubMed Central

    Rainwater-Lovett, Kaitlin; Moss, William J

    2011-01-01

    With increasing access to antiretroviral therapy for children infected with HIV, especially in sub-Saharan Africa, better understanding of the development and maintenance of memory T- and B-cell responses to pathogens after immune reconstitution is needed to assess the risk of infection. Knowledge of long-term immune responses after starting HAART is of particular importance for policies on revaccination of HIV-infected children, who may lose protective immunity to prior infections and immunizations. We review normal development of T- and B-cell memory responses to viruses and vaccines against viral pathogens, and contrast the immunological effects of perinatal HIV transmission with HIV infection acquired later in life. We then explore the potential benefits of antiretroviral therapy and revaccination, using measles virus as a model. PMID:21339832

  5. PPARgamma Pro12Ala polymorphism in HIV-1-infected patients with HAART-related lipodystrophy.

    PubMed

    Saumoy, Maria; Veloso, Sergi; Alonso-Villaverde, Carlos; Domingo, Pere; Chacón, Matilde R; Miranda, Merce; Aragonès, Gerard; Gutiérrez, Maria Mar; Viladés, Consuelo; Peraire, Joaquim; Sirvent, Joan-Josep; López-Dupla, Miguel; Aguilar, Carmen; Richart, Cristóbal; Vidal, Francesc

    2009-09-01

    Peroxisome proliferator-activated receptor gamma (PPARgamma) is involved in obesity and in some components of the metabolic syndrome in unselected population. To determine whether PPARgamma genetic variants are associated with the risk of developing lipodystrophy and its associated metabolic disturbances in HIV-1-infected patients treated with HAART and to assess PPARgamma mRNA expression in subcutaneous adipose tissue (SAT). The study group comprised 278 patients infected with HIV-1 and treated with antiretroviral drugs (139 with lipodystrophy and 139 without) and 105 uninfected controls (UC). The PPARgamma Pro12Ala (C%>G) single nucleotide polymorphism (SNP) was assessed using PCR-RFLPs on white cell DNA. PPARgamma mRNA expression in SAT was assessed in 38 patients (25 with lipodystrophy and 13 without) and in 21 UC by real-time PCR. Statistical analysis was based on Student's T tests, Chi(2) tests, Spearman's correlations tests and logistic regression tests. PPARgamma Pro12Ala genotype distribution and allele frequencies were non-significantly different between both HIV-1-infected categories, lipodystrophy vs non-lipodystrophy (p=0.9 and p=0.87, respectively). Lipodystrophic patients harbouring the rare X/Ala genotype (Ala/Ala plus Pro/Ala) had significantly greater plasma total and LDL cholesterol levels compared with carriers of the common Pro/Pro genotype (p=0.029 and p=0.016, respectively) at univariate analyses. At multivariate analyses these associations were no longer significant. There was a near-significant decreased SAT PPARgamma mRNA expression in patients with lipodystrophy compared to UC (p=0.054). PPARgamma Pro12Ala SNP has no effect on the risk of developing lipodystrophy in HIV-1-infected patients treated with HAART. PPARgamma mRNA SAT expression appears decreased in lipodystrophy.

  6. Simplification of HAART therapy on ambulatory HIV patients in Malaysia:a randomized controlled trial

    PubMed Central

    Velvanathan, Tineshwaran; Islahudin, Farida; Sim, Benedict L.; Taha, Nur A.

    2016-01-01

    Objective: Evaluate the impact of fixed-dose combination (FDC) containing emtricitabine (FTC), tenofovir (TDF), and efavirenz (EFV) versus a free-dose combination (FRC) of the same three drugs on clinical outcomes, adherence and quality of life in Malaysian outpatients with HIV. Methods: HIV patients (n=120) on highly active antiretroviral therapy (HAART) in the infectious disease clinic of Hospital Sungai Buloh were randomized to either FDC (n=60) or FRC (n=60). Morisky scores, health-related quality of life scores and clinical outcomes such as CD4 count and viral load were assessed in both groups at baseline and six months. Result: Patients on FDC (108 SD=1.1) had a significantly higher CD4 count increase compared to the FRC group (746.1 SD=36.3 vs 799.8 SD=33.8) (p <0.001). The viral load profile was unchanged and remained undetectable in both groups. The quality of life EQ-5D scores showed a positive correlation with CD4 counts in the FDC group (ρ=0.301, p=0.019) at six months. On the other hand, quality of life EQ-VAS scores was significantly associated with medication adherence in the FDC group at six months (ρ=0.749, p=0.05). However, no significant changes or associations were observed in the FRC group. Conclusion: Management of HAART using an FDC demonstrated a positive clinical outcome, adherence and quality of life within six months in local HIV patients. PMID:28042354

  7. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  8. Effect of GB virus C co-infection on response to generic HAART in African patients with HIV-1 clade C infection.

    PubMed

    Mosam, Anisa; Sathar, Mahomed A; Dawood, Halima; Cassol, Edana; Esterhuizen, Tonya M; Coovadia, Hoosen M

    2007-06-19

    In 38 African AIDS patients initiating generic HAART, GB virus C (GBV-C) RNA-positive patients retained GBV-C viraemia during 52 weeks of HAART, had a faster decline in HIV viral load (P = 0.03), fewer opportunistic infections (14.3 versus 50%, P = 0.18), and suffered no serious adverse events (none versus 61%, P = 0.008) compared with patients without GBV-C. GBV-C co-infection may be associated with a beneficial effect on African AIDS patients treated with generic HAART.

  9. Molecular mechanisms of tolerance to cyanobacterial protease inhibitors revealed by clonal differences in Daphnia magna.

    PubMed

    Schwarzenberger, Anke; Kuster, Christian J; Von Elert, Eric

    2012-10-01

    Protease inhibitors of primary producers are a major food quality constraint for herbivores. In nutrient-rich freshwater ecosystems, the interaction between primary producers and herbivores is mainly represented by Daphnia and cyanobacteria. Protease inhibitors have been found in many cyanobacterial blooms. These inhibitors have been shown (both in vitro and in situ) to inhibit the most important group of digestive proteases in the daphnid's gut, that is, trypsins and chymotrypsins. In this study, we fed four different Daphnia magna genotypes with the trypsin-inhibitor-containing cyanobacterial strain Microcystis aeruginosa PCC 7806 Mut. Upon exposure to dietary trypsin inhibitors, all D. magna genotypes showed increased gene expression of digestive trypsins and chymotrypsins. Exposure to dietary trypsin inhibitors resulted in increased activity of chymotrypsins and reduced activity of trypsin. Strong intraspecific differences in tolerance of the four D. magna genotypes to the dietary trypsin inhibitors were found. The degree of tolerance depended on the D. magna genotype. The genotypes' tolerance was positively correlated with the residual trypsin activity and the different IC(50) values of the trypsins. On the genetic level, the different trypsin loci varied between the D. magna genotypes. The two tolerant Daphnia genotypes that both originate from the same lake, which frequently produces cyanobacterial blooms, clustered in a neighbour-joining phylogenetic tree based on the three trypsin loci. This suggests that the genetic variability of trypsin loci was an important cause for the observed intraspecific variability in tolerance to cyanobacterial trypsin inhibitors. Based on these findings, it is reasonable to assume that such genetic variability can also be found in natural populations and thus constitutes the basis for local adaptation of natural populations to dietary protease inhibitors.

  10. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  11. Active protease mapping in 2DE gels.

    PubMed

    Zhao, Zhenjun; Russell, Pamela J

    2009-01-01

    Proteases act as the molecular mediators of many vital biological processes. To understand the function of each protease, it needs to be separated from other proteins and characterized in its natural, biologically active form. In the method described in this chapter, proteases in a biological sample are separated under nonreducing conditions in 2DE gels. A specific small protease substrate, tagged with a fluorescent dye, is copolymerized into the SDS gel in the second dimension. After electrophoresis, the proteins are renatured by washing the gel with Triton X-100 solution or Milli Q water to remove SDS. The gel is then incubated in a protease assay buffer. The hydrolysis of the tagged specific substrate by the renatured protease releases the free fluorescent dye, which fluoresces in situ. The fluorescent spots indicate the location of the specific proteases in the gel and the specificity of the proteases.

  12. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  13. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  14. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  15. Predictors of serostatus disclosure to partners among young people living with HIV in the pre- and post-HAART eras.

    PubMed

    Batterham, Philip; Rice, Eric; Rotheram-Borus, Mary Jane

    2005-09-01

    Predictors of serostatus disclosure were identified among youth living with HIV pre- and post-introduction of highly active antiretroviral therapy (HAART). Two cohorts of HIV-positive youth, aged 13-24, in 1994-1996 (n = 351) and 1999-2000 (n = 253) in Los Angeles, New York, San Francisco, and Miami were sampled through medical providers and a variety of social service agencies. Data were collected on demographic, social, medical, and behavioral topics. Men who had sex with men were more likely to disclose serostatus to their partners. Moreover, a positive association with length of time since diagnosis and the likelihood of disclosure exists; across time, youth were less likely to disclose serostatus to casual partners or HIV-negative partners. Post-HAART, number of sex acts with a partner was associated with increased likelihood of disclosure. Interventions for HIV-positive youth must improve disclosure to casual and serodiscordant sexual partners.

  16. Targeted therapies to treat Non-AIDS Defining Cancers in patients with HIV on HAART therapy – treatment considerations and research outlook

    PubMed Central

    Deeken, John F.; Pantanowitz, Liron; Dezube, Bruce J.

    2012-01-01

    Purpose of review Highly active antiretroviral therapy (HAART) has led to a dramatic improvement in the prognosis of patients diagnosed with HIV and AIDS. This includes a significant decline in the rates of AIDS-related cancers, including Kaposi Sarcoma and Non-Hodgkin's Lymphoma. Unfortunately, rates of Non-AIDS Defining Cancers (NADCs) are on the rise, and now exceed the rates of AIDS-related cancers in patients with HIV. Treating NADCs in patients who are on HAART therapy is an open and complicated clinical question. Recent findings Newer targeted therapies are now available to treat cancers which were historically refractory to traditional cytotoxic chemotherapy. HAART agents are notorious for causing drug-drug interactions. The co-administration of targeted chemotherapies with HAART could well impede the efficacy or increase the toxicity of these targeted therapies. Unfortunately little is known about possible drug-drug interactions because HIV patients are typically excluded from clinical trials. Summary We highlight what is known about how and why HAART agents can affect drug metabolism. We then present the clinical and pharmacological data for nine recently approved targeted therapies – imatinib, dasatinib, nilotinib, erlotinib, sunitinib, lapatinib, bortezomib, sorafenib, and temsirolimus. We conclude with considerations on how to use these new agents to treat NADCs, and discuss a future research agenda to better understand and predict potential HAART-targeted therapy interactions. PMID:19606034

  17. Assessing the impact of HAART on the incidence of defining and non-defining AIDS cancers among patients with HIV/AIDS: a systematic review.

    PubMed

    Cobucci, Ricardo Ney Oliveira; Lima, Paulo Henrique; de Souza, Pollyana Carvalho; Costa, Vanessa Viana; Cornetta, Maria da Conceição de Mesquita; Fernandes, José Veríssimo; Gonçalves, Ana Katherine

    2015-01-01

    After highly active antiretroviral therapy (HAART) became widespread, several studies demonstrated changes in the incidence of defining and non-defining AIDS cancers among HIV/AIDS patients. We conducted a systematic review of observational studies evaluating the incidence of malignancies before and after the introduction of HAART in people with HIV/AIDS. Eligible studies were searched up to December 2012 in the following databases: Pubmed, Embase, Scielo, Cancerlit and Google Scholar. In this study, we determined the cancer risk ratio by comparing the pre- and post-HAART eras. Twenty-one relevant articles were found, involving more than 600,000 people with HIV/AIDS and 10,891 new cases of cancers. The risk for the development of an AIDS-defining cancer decreased after the introduction of HAART: Kaposi's sarcoma (RR=0.30, 95% CI: 0.28-0.33) and non-Hodgkin's lymphoma (RR=0.52, 95% CI: 0.48-0.56), in contrast to invasive cervical cancer (RR=1.46, 95% CI: 1.09-1.94). Among the non-AIDS-defining cancers, the overall risk increased after the introduction of HAART (RR=2.00, 95% CI: 1.79-2.23). The incidence of AIDS-defining cancers decreased and the incidence of non-AIDS-defining cancers increased after the early use of HAART, probably due to better control of viral replication, increased immunity and increased survival provided by new drugs.

  18. Differential survival benefit of universal HAART access in Brazil: A Nation-wide Comparison of Injecting Drug Users versus Men who Have Sex with Men

    PubMed Central

    Malta, Monica; Bastos, Francisco I.; da Silva, Cosme MFP; Pereira, Gerson Fernando Mendes; Lucena, Francisca FA; Fonseca, Maria GP; Strathdee, Steffanie A.

    2009-01-01

    Objective Brazil accounts for ∼70% of injection drug users (IDU) receiving HAART in low/middle income countries. We evaluated the impact of HAART availability/access on AIDS-related mortality among IDU versus men who have sex with men (MSM). Design Nationwide analysis on Brazilian IDU and MSM diagnosed with AIDS in 2000-2006. Methods Four national information systems were linked and Cox regression was used to assess impact of HAART availability/access on differential AIDS-related mortality. Results Among 28,426 patients, 6,777 died during 87,792 person-years of follow-up. Compared to MSM, IDU were significantly less likely to be receiving HAART, to have ever had determinations for CD4 or viral load. After controlling for confounders, IDU had a significantly higher risk of death (AHR: 1.94; 95% CI: 1.84-2.05). Among the subset that had at least one CD4 and viral load determination, higher risk of death among IDU persisted (HR: 1.82; 95% CI: 1.58-2.11). Non-white ethnicity significantly increased this risk, while prompt HAART uptake after AIDS diagnosis reduced the risk of death. After controlling for spatially-correlated survival data, AIDS-related mortality remained higher in IDU than in MSM. Conclusions Despite free/universal HAART access, differential AIDS-related mortality exists in Brazil. Efforts are needed to identify and eliminate these health disparities. PMID:19675464

  19. Highly Active Antiretroviral Therapy (HAART)-Related Hypertriglyceridemia Is Associated With Failure of Recovery of CD14lowCD16+ Monocyte Subsets in AIDS Patients.

    PubMed

    Han, Junyan; Zhao, Hongxin; Ma, Yaluan; Zhou, Haiwei; Hao, Yu; Li, Yanmei; Song, Chuan; Han, Ning; Liu, Xiangyi; Zeng, Hui; Qin, Mingzhao

    2015-07-01

    As cellular reservoirs, CD16 monocyte subsets play important roles in the progression of HIV infection. Previous studies have shown that highly active antiretroviral therapy (HAART) reduced the percentages of CD14CD16 monocyte subsets, but did not recover the percentages of CD14CD16 subsets. Eighty-four chronic HIV-infected, HAART-naïve individuals and 55 HIV-negative subjects (31 without hyperlipidemia and 24 with hypertriglyceridemia) were enrolled. Plasma HIV-1 RNA levels, CD4 T-cell counts, triglycerides, total cholesterol, high-density lipoprotein, and low-density lipoprotein were followed up for 48 weeks during HAART treatment in the longitudinal study. We found that mild hypertriglyceridemia in HIV-negative subjects and HIV-infected patients, naïve to HAART, did not affect the percentage of monocyte subsets. However, a failure of CD14CD16 subset recovery was observed in patients with HAART-related hypertriglyceridemia at 48 weeks. Thus, HAART-related hypertriglyceridemia altered homeostasis of monocyte subsets to antiviral therapy, which might further affect immune reconstitution.

  20. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  1. Cerebral toxoplasmosis in HIV-positive patients in Brazil: clinical features and predictors of treatment response in the HAART era.

    PubMed

    Vidal, José E; Hernandez, Adrian V; de Oliveira, Augusto C Penalva; Dauar, Rafi F; Barbosa, Silas Pereira; Focaccia, Roberto

    2005-10-01

    A prospective study of 55 confirmed or presumptive cases of cerebral toxoplasmosis in HIV positive patients in Brazil was performed to describe clinical characteristics and to identify predictive factors for clinical response to the anti-Toxoplasma treatment. Cerebral toxoplasmosis led to the diagnosis of HIV infection in 19 (35%) patients, whereas it was the AIDS defining disease in 41 (75%) patients. Of these, 22 (54%) patients were previously know to be HIV-positive. At diagnosis of cerebral toxoplasmosis, only 4 (7%) patients were on highly active antiretroviral therapy (HAART), and 6 (11%) were receiving primary cerebral toxoplasmosis prophylaxis. The mean CD4+ cell count was 64.2 (+/- 69.1) cells per microliter. Forty-nine patients (78%) showed alterations consistent with toxoplasmosis on brain computed tomography. At 6 weeks of treatment, 23 (42%) patients had complete clinical response, 25 (46%) partial response, and 7 (13%) died. Alteration of consciousness, Karnofsky score less than 70, psychomotor slowing, hemoglobin less than 12 mg/dL, mental confusion, Glasgow Coma Scale less than 12 were the main predictors of partial clinical response. All patients were placed on HAART within the first 4 weeks of diagnosis of cerebral toxoplasmosis. One year after the diagnosis, all available patients were on HAART and toxoplasmosis prophylaxis, and only 2 patients had relapse of cerebral toxoplasmosis. In Brazilian patients with AIDS, cerebral toxoplasmosis mainly occurs as an AIDS-defining disease, and causes significant morbidity and mortality. Signs of neurologic deterioration predict an unfavorable response to the treatment. Early start of HAART seems to be related to better survival and less relapses.

  2. Delayed diagnosis of HIV infection in a multicenter cohort: prevalence, risk factors, response to HAART and impact on mortality.

    PubMed

    Sobrino-Vegas, Paz; García-San Miguel, Lucía; Caro-Murillo, Ana M; Miró, José M; Viciana, Pompeyo; Tural, Cristina; Saumoy, Maria; Santos, Ignacio; Sola, Julio; del Amo, Julia; Moreno, Santiago

    2009-03-01

    To study the prevalence of Delayed HIV Diagnosis (DHD) and its associated risk factors, to evaluate the effect of DHD on virological and immunological responses to HAART and to estimate the impact of DHD on all-causes mortality. Prospective cohort of 2, 564 HIV-positive HAART-naïve subjects attending 19 hospitals in Spain, 2004-2006. Estimations were made by logistic regression and survival analyses by Cox regression models. Prevalence of DHD was 37.3% (35.0-39.6). DHD was related to low educational level (OR:1.31, 95% CI:1.0-1.7). Compared to men who have sex with men (MSM), DHD was more frequent in heterosexuals (OR:1.9 95% CI:1.5-2.5) and injection drug users (IDUs) (OR:2.0 95% CI:1.5-2.8). An interaction between age and sex was found. Although risk of having DHD did not increase after age 30 in women, it increased linearly with age in men. No differences in virological (OR 1.2 95% CI: 0.8-1.8) and CD4 T cell (OR 1.1 95% CI: 0.7-1.8) responses to HAART were seen. The adjusted hazard ratio for death in patients with DHD was 5.2, (95% CI: 1.9-14.5). DHD is very common, especially in older men, heterosexuals and IDUs. Although we did not find differences in virological and immunological responses to HAART, we did observe higher mortality in people with DHD. Increased efforts to early diagnose HIV infection are urgently needed.

  3. Analysis of survival in HIV-infected subjects according to socio-economic resources in the HAART era.

    PubMed

    Liotta, G; Caleo, G M; Mancinelli, S

    2008-01-01

    Availability of Highly Active Anti-Retroviral Treatment (HAART) has modified the natural history of HIV infection, resulting in increase of seropositive subjects survival. The aim of the study was to assess patients' survival in relation to socio-economic status in HAART era using Functional Multidimensional Evaluation questionnaire. A three-level Socio-Economic Index (SEI) combining results from self-perception of unmet needs and objective data from the assessment of the two dimensions has been set up by the authors. Of the 382 subjects interviewed, 102 had been lost to follow-up. SEI showed that 66.4% of the sample faced unmet social or economic needs and 17.1% had unmet needs in both areas. There was a significant relationship between the self-sufficiency in performing Activities of Daily Living (ADL), Clinical Staging, CD4 cell count, SEI and risk of death. The lowest level of SEI was associated with a doubled risk of death compared to SEI upper level. Availability of social and economics support have a positive effect upon survival in patients with HIV infection, also in case of availability of HAART. The combination of subjective and objective assessment of socio-economic resources allows a better understanding of their impact on survival.

  4. Characteristics and prognosis of B-cell lymphoma in HIV-infected children in the HAART era.

    PubMed

    Godot, Cécile; Patte, Catherine; Blanche, Stéphane; Rohrlich, Pierre; Dollfus, Catherine; Tabone, Marie-Dominique

    2012-10-01

    Chronic HIV infection leads to increased risk of non-Hodgkin B-cell lymphoma. However, only few recent data are available about their current management and prognosis in HIV-infected children since the advent highly active antiretroviral therapy (HAART). This multicenter retrospective study describes the 12 cases of B-cell non-Hodgkin lymphoma diagnosed in HIV-infected children in France between 1996 and 2009. All children had moderate to severe immunosuppression and high viral load at the time of diagnosis. Nine children had extracerebral primary sites and 3 had a primary central nervous system lymphoma. Eight patients had Burkitt lymphoma; 4 had diffuse large B-cell lymphoma. Concomitantly with HAART, all children with extracerebral lymphoma received intensive chemotherapy according to LMB protocol, those with primary central nervous system lymphoma received high-dose methotrexate. No toxicity-related deaths occurred. Ten patients entered complete remission (CR), 2 died of tumor progression despite a second line of therapy. No relapses occurred after CR (median follow-up, 72 mo). Thus, prognosis of patients unresponsive to first-line lymphoma treatment remains poor, but relapse seems to be rare when CR is achieved. Children without severe comorbidities can tolerate intensive chemotherapy with a mandatory HAART treatment, taking into account drug interactions.

  5. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  6. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  7. Design, Synthesis, and Biological and Structural Evaluations of Novel HIV-1 Protease Inhibitors To Combat Drug Resistance

    SciTech Connect

    Parai, Maloy Kumar; Huggins, David J.; Cao, Hong; Nalam, Madhavi N.L.; Ali, Akbar; Schiffer, Celia A.; Tidor, Bruce; Rana, Tariq M.

    2012-09-11

    A series of new HIV-1 protease inhibitors (PIs) were designed using a general strategy that combines computational structure-based design with substrate-envelope constraints. The PIs incorporate various alcohol-derived P2 carbamates with acyclic and cyclic heteroatomic functionalities into the (R)-hydroxyethylamine isostere. Most of the new PIs show potent binding affinities against wild-type HIV-1 protease and three multidrug resistant (MDR) variants. In particular, inhibitors containing the 2,2-dichloroacetamide, pyrrolidinone, imidazolidinone, and oxazolidinone moieties at P2 are the most potent with Ki values in the picomolar range. Several new PIs exhibit nanomolar antiviral potencies against patient-derived wild-type viruses from HIV-1 clades A, B, and C and two MDR variants. Crystal structure analyses of four potent inhibitors revealed that carbonyl groups of the new P2 moieties promote extensive hydrogen bond interactions with the invariant Asp29 residue of the protease. These structure-activity relationship findings can be utilized to design new PIs with enhanced enzyme inhibitory and antiviral potencies.

  8. Rates and Reasons for Early Change of First HAART in HIV-1-Infected Patients in 7 Sites throughout the Caribbean and Latin America

    PubMed Central

    Cesar, Carina; Shepherd, Bryan E.; Krolewiecki, Alejandro J.; Fink, Valeria I.; Schechter, Mauro; Tuboi, Suely H.; Wolff, Marcelo; Pape, Jean W.; Leger, Paul; Padgett, Denis; Madero, Juan Sierra; Gotuzzo, Eduardo; Sued, Omar; McGowan, Catherine C.; Masys, Daniel R.; Cahn, Pedro E.

    2010-01-01

    Background HAART rollout in Latin America and the Caribbean has increased from approximately 210,000 in 2003 to 390,000 patients in 2007, covering 62% (51%–70%) of eligible patients, with considerable variation among countries. No multi-cohort study has examined rates of and reasons for change of initial HAART in this region. Methodology Antiretroviral-naïve patients > = 18 years who started HAART between 1996 and 2007 and had at least one follow-up visit from sites in Argentina, Brazil, Chile, Haiti, Honduras, Mexico and Peru were included. Time from HAART initiation to change (stopping or switching any antiretrovirals) was estimated using Kaplan-Meier techniques. Cox proportional hazards modeled the associations between change and demographics, initial regimen, baseline CD4 count, and clinical stage. Principal Findings Of 5026 HIV-infected patients, 35% were female, median age at HAART initiation was 37 years (interquartile range [IQR], 31–44), and median CD4 count was 105 cells/uL (IQR, 38–200). Estimated probabilities of changing within 3 months and one year of HAART initiation were 16% (95% confidence interval (CI) 15–17%) and 28% (95% CI 27–29%), respectively. Efavirenz-based regimens and no clinical AIDS at HAART initiation were associated with lower risk of change (hazard ratio (HR) = 1.7 (95% CI 1.1–2.6) and 2.1 (95% CI 1.7–2.5) comparing neverapine-based regimens and other regimens to efavirenz, respectively; HR = 1.3 (95% CI 1.1–1.5) for clinical AIDS at HAART initiation). The primary reason for change among HAART initiators were adverse events (14%), death (5.7%) and failure (1.3%) with specific toxicities varying among sites. After change, most patients remained in first line regimens. Conclusions Adverse events were the leading cause for changing initial HAART. Predictors for change due to any reason were AIDS at baseline and the use of a non-efavirenz containing regimen. Differences between participant sites were observed

  9. Neurobehavioral Effects in HIV-Positive Individuals Receiving Highly Active Antiretroviral Therapy (HAART) in Gaborone, Botswana

    PubMed Central

    Lawler, Kathy; Jeremiah, Kealeboga; Mosepele, Mosepele; Ratcliffe, Sarah J.; Cherry, Catherine; Seloilwe, Esther; Steenhoff, Andrew P.

    2011-01-01

    Objective To explore the prevalence and features of HIV-associated neurocognitive disorders (HANDS) in Botswana, a sub-Saharan country at the center of the HIV epidemic. Design and Methods A cross sectional study of 60 HIV-positive individuals, all receiving highly active antiretroviral therapy (HAART), and 80 demographically matched HIV-seronegative control subjects. We administered a comprehensive neuropsychological test battery and structured psychiatric interview. The lowest 10th percentile of results achieved by control subjects was used to define the lower limit of normal performance on cognitive measures. Subjects who scored abnormal on three or more measures were classified as cognitively impaired. To determine the clinical significance of any cognitive impairment, we assessed medication adherence, employment, and independence in activities of daily living (ADL). Results HIV+ subjects were impaired for all cognitive-motor ability areas compared with matched, uninfected control subjects. Thirty seven percent of HIV+ patients met criteria for cognitive impairment. Conclusion These findings indicate that neurocognitive impairment is likely to be an important feature of HIV infection in resource-limited countries; underscoring the need to develop effective treatments for subjects with, or at risk of developing, cognitive impairment. PMID:21365002

  10. Compatibility studies of nevirapine in physical mixtures with excipients for oral HAART.

    PubMed

    de Oliveira, G G G; Ferraz, H G; Severino, P; Souto, E B

    2013-03-01

    Nevirapine is a hydrophobic non-nucleoside reverse transcriptase inhibitor, used in first line regimens of highly active antiretroviral therapy (HAART). The drug has more than one crystalline form, which may have implications for its behaviour during production and also for its in vivo performance. This study was aimed at exploring the suitability of thermoanalytical methods for the solid-state characterization of commercial crystalline forms of nevirapine. The drug powder was characterized by ultraviolet spectrophotometry, stereoscopy, scanning electron microscopy, wide-angle X-ray diffraction, measurements of density, flowability, solubility and intrinsic dissolution rate (IDR), differential scanning calorimetry, thermogravimetric analysis, and photostability measurements. The results showed that nevirapine has high stability and is not susceptible to degradation under light exposure. The drug showed compatibility with the excipients tested (lactose, microcrystalline cellulose, polyvinylpyrrolidone and polyvinyl acetate copolymer (PVP/PVA), and hydroxypropylmethylcellulose (HPMC)). Nevirapine has low solubility, an acid medium being the most appropriate medium for assessing the release of the drug from dosage forms. However, the data obtained from IDR testing indicate that dissolution is the critical factor for the bioavailability of this drug.

  11. Psychosocial aspects of human immunodeficiency virus (HIV) infection in a pre-HAART sample.

    PubMed

    Skydsbjerg, M; Lunn, S; Hutchings, B

    2001-09-01

    The psychosocial consequences of HLV-infection were studied using a semi-structured interview and the psychiatric questionnaire SCL-90-R, in 3 matched groups of homosexual men: 20 patients with Aids, 20 asymptomatic HIV-infected and 20 non-infected controls. The data was collected before the HAART (Highly Active Anti-retroviral Therapy) era. The results showed that the infected subjects more often concealed their homosexuality, engaged in more risky sexual behavior and were less inclined to regard AIDS as a serious problem. The infected subjects also revealed more psychopathology on 5 of the 9 indexes on the SCL-90. Across all 3 groups, contact ability was correlated to being open about homosexuality and to psychological well-being. These results indicate that HIV has considerable impact on psychological well-being among the infected and point to the need for health-care workers to be especially attentive to those HIV-infected who have difficulty in talking to others about their situation.

  12. Monitoring of HAART regime antiretrovirals in serum of acquired immunodeficiency syndrome patients by micellar liquid chromatography.

    PubMed

    Casas-Breva, I; Peris-Vicente, J; Rambla-Alegre, M; Carda-Broch, S; Esteve-Romero, J

    2012-09-21

    A methodology based on micellar liquid chromatography to monitor five antiretroviral drugs (lamivudine, stavudine, tenofovir, zidovudine and efavirenz) was proposed. Antiretrovirals were studied in sets of three, corresponding to each highly active antiretroviral therapy (HAART) regime, prescribed to acquired immunodeficiency syndrome (AIDS)-infected patients. Four aqueous micellar mobile phases buffered at pH 7 were optimized to separate these compounds, using sodium dodecyl sulfate as the tensioactive, and 1-propanol or 1-pentanol as the organic modifier. The composition of each mobile phase was optimized for each antiretroviral. The common separation conditions were: C18 apolar column (125 × 4.6 mm, 5 μm particle size), UV detection set at 214 nm, and mobile phase running at 1 mL min(-1) without controlling the temperature. The finally suggested method was validated for five analysed antiretroviral drugs following the US Food and Drug Administration guidelines in terms of: linearity between 0.5 and 50 ppm (r(2) > 0.9995), sensitivity (LOD lower than 0.25 ppm), intra- and inter-day precision (<7.1 and <5.2%, respectively) and accuracy (recovery 88.5-105.3% and 93.5-101.3%, respectively), as well as robustness (<6.5%). The proposed method was used to monitor the level of antiretrovirals in the serum of AIDS patients. The suggested methodology was found to be useful in the routine analysis of antiretrovirals in serum samples.

  13. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  14. Protease Profiling in Prostate Cancer

    DTIC Science & Technology

    2004-05-01

    acid synthase, which contains a serine hydrolase domain. We identified a lead inhibitor of this domain of fatty acid synthase, called Orlistat, which...SUBJECT TERMS 15. NUMBER OF PAGES Prostate cancer, tumor biology, protease, proteomics, transgenic, 20 animal model, fatty acid synthase, orlistat 16...the enzymes we identified is fatty acid synthase. Fatty acid synthase is the sole enzyme responsible for the cellular synthesis of fatty acids . This

  15. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  16. Peptide-based inhibitors of the hepatitis C virus NS3 protease: structure-activity relationship at the C-terminal position.

    PubMed

    Rancourt, Jean; Cameron, Dale R; Gorys, Vida; Lamarre, Daniel; Poirier, Martin; Thibeault, Diane; Llinàs-Brunet, Montse

    2004-05-06

    The structure-activity relationship at the C-terminal position of peptide-based inhibitors of the hepatitis C virus NS3 protease is presented. The observation that the N-terminal cleavage product (DDIVPC-OH) of a substrate derived from the NS5A/5B cleavage site was a competitive inhibitor of the NS3 protease was previously described. The chemically unstable cysteine residue found at the P1 position of these peptide-based inhibitors could be replaced with a norvaline residue, at the expense of a substantial drop in the enzymatic activity. The fact that an aminocyclopropane carboxylic acid (ACCA) residue at the P1 position of a tetrapeptide such as 1 led to a significant gain in the inhibitory enzymatic activity, as compared to the corresponding norvaline derivative 2, prompted a systematic study of substituent effects on the three-membered ring. We report herein that the incorporation of a vinyl group with the proper configuration onto this small cycle produced inhibitors of the protease with much improved in vitro potency. The vinyl-ACCA is the first reported carboxylic acid containing a P1 residue that produced NS3 protease inhibitors that are significantly more active than inhibitors containing a cysteine at the same position.

  17. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  18. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents.

  19. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  20. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  1. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  2. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  3. Vets, denialists and rememberers: social typologies of patient adherence and non-adherence to HAART from the perspective of HIV care providers.

    PubMed

    Orchard, Treena; Salters, Kate; Palmer, Alexis; Michelow, Warren; Lepik, Katherine J; Hogg, Robert

    2015-01-01

    For many people living with HIV/AIDS taking highly active antiretroviral therapy (HAART) is difficult due to various individual and social factors, including the side effects of these medications, HIV/AIDS stigma and poor patient-provider relationships. Most studies that examine barriers to and facilitators of adherence to HAART have been conducted with people on these medications, which is critical to improving adherence among various HIV-affected groups. Less attention has been paid to the experiences of HIV care providers, which is an important gap in the literature considering the key role they play in the delivery of HAART and the management of patient treatment plans. This paper presents findings from a qualitative pilot study that explored how HIV care providers assess adherence and non-adherence to HAART among their HIV-positive patients in Vancouver, British Columbia. Drawing upon individual interviews conducted with HIV physicians (n = 3), social service providers (n = 3) and pharmacists (n = 2), this discussion focuses on the social typologies our participants use to assess patient success and failure related to adherence. Eleven unique categories are featured and the diversity within and across these categories illustrate a broad spectrum of adherence-related behaviours among patients and the social meanings providers attribute to these behaviours. As one of the first explorations of the social typologies used by HIV care providers to assess patient performance on HAART, these data contribute valuable insights into the experiences of providers within the context of adherence-related care delivery.

  4. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  5. Cancer risk in HIV-infected individuals on HAART is largely attributed to oncogenic infections and state of immunocompetence

    PubMed Central

    2011-01-01

    Objectives To estimate the cancer risk of HIV-infected patients in the HAART era with respect to a general reference population and to determine risk factors for malignancy. Methods Long term (1996-2009) cancer incidence of the Bonn single centre HIV cohort was compared to the incidence of the reference population of Saarland using standardized incidence ratios (SIR). Poisson regression analysis was used to identify predictors of cancer risk. Results 1,476 patients entered the cohort, enabling 8,772 person years of observation. 121 tumours in 114 patients, 7 in-situ and 114 invasive cancers, were identified. Malignancies associated with infectious agents such as Kaposi sarcoma (SIRs: male: 5,683; female: 277), non-Hodgkin lymphoma (SIRs male: 35; female: 18), anal cancer (SIRs male: 88; female: 115) as well a cervical carcinoma (SIR female: 4) and Hodgkin's disease (SIR male: 39) and liver cancer (SIR male: 18) were substantially more frequent in HIV-infected patients than in the general population (p < 0.001, each), whereas all other types of cancer were not increased. Poisson regression identified HAART (incidence rate ratio IRR (95% CI): 0.28 (0.19-0.41), p < 0.001), CD4 count (IRR per 100 cells/μl increase: 0.66 (0.57-0.76), p < 0.001), hepatitis B (IRR: 2.15 (1.10-4.20), p = 0.046) and age (IRR per 10 year increase: 1.23 (1.03 - 1.46), p = 0.023) as independent predictors for the occurrence of any type of cancer. Conclusions HAART and preserved CD4 cells preferentially reduce the risk of malignancies associated with oncogenic infections. PMID:21486722

  6. High prevalence of food insecurity among HIV-infected individuals receiving HAART in a resource-rich setting.

    PubMed

    Anema, A; Weiser, S D; Fernandes, K A; Ding, E; Brandson, E K; Palmer, A; Montaner, J S G; Hogg, R S

    2011-02-01

    This study aimed to assess the prevalence and correlates of food insecurity in a cohort of HIV-infected individuals on highly active antiretroviral therapy (HAART) in British Columbia (BC), Canada. Adults receiving HAART voluntarily enrolled into the Longitudinal Investigations into Supportive and Ancillary Health Services (LISA) cohort. Individual food insecurity was measured using a modified version of the Radimer/Cornell Questionnaire. We performed bivariate analyses to determine differences between explanatory variables for individuals who were food secure and food insecure. We performed logistic regression to determine independent predictors of food insecurity. Of the 457 individuals enrolled in the LISA cohort, 324 (71.0%) were found to be food insecure. Multivariate analysis indicated that individuals who had an annual incomes less than $15,000 (odds ratio [OR] 3.15, 95% confidence interval [CI] 1.83, 5.44), used illicit drugs (OR 1.85, 95% CI 1.03, 3.33), smoked tobacco (OR 2.30, 95% CI 1.30, 4.07), had depressive symptoms (OR 2.34, 95% CI 1.38, 3.96), and were younger (OR 0.95, 95% CI, 0.92, 0.98) were more likely to be food insecure. Our results demonstrated a high (71%) prevalence of food insecurity among HIV-infected individuals receiving HAART in this resource-rich setting, and that food insecurity is associated with a compendium of environmental and behavioral factors. More research is needed to understand the biological and social pathways linking food insecurity to these variables in order to identify program strategies that can effectively improve food security among HIV-infected populations.

  7. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  8. Abuse and resilience in relation to HAART medication adherence and HIV viral load among women with HIV in the United States.

    PubMed

    Dale, Sannisha; Cohen, Mardge; Weber, Kathleen; Cruise, Ruth; Kelso, Gwendolyn; Brody, Leslie

    2014-03-01

    Abuse is highly prevalent among HIV+ women, leading to behaviors, including lower adherence to highly active antiretroviral therapy (HAART) that result in poor health outcomes. Resilience (functioning competently despite adversity) may buffer the negative effects of abuse. This study investigated how resilience interacted with abuse history in relation to HAART adherence, HIV viral load (VL), and CD4+ cell count among a convenience sample of 138 HIV+ women from the Ruth M. Rothstein CORE Center/Cook County Health and Hospital Systems site of the Women's Interagency HIV Study (WIHS). Resilience was measured by the 10-item Connor-Davidson Resilience Scale (CD-RISC). HAART adherence (≥95% vs. <95% self reported usage of prescribed medication) and current or prior sexual, physical, or emotional/domestic abuse, were reported during structured interviews. HIV viral load (≥20 vs. <20 copies/mL) and CD4+ count (200 vs. <200 cells/mm) were measured with blood specimens. Multiple logistic regressions, controlling for age, race, income, enrollment wave, substance use, and depressive symptoms, indicated that each unit increase in resilience was significantly associated with an increase in the odds of having ≥95% HAART adherence and a decrease in the odds of having a detectable viral load. Resilience-Abuse interactions showed that only among HIV+ women with sexual abuse or multiple abuses did resilience significantly relate to an increase in the odds of ≥95% HAART adherence. Interventions to improve coping strategies that promote resilience among HIV+ women may be beneficial for achieving higher HAART adherence and viral suppression.

  9. Abuse and Resilience in Relation to HAART Medication Adherence and HIV Viral Load Among Women with HIV in the United States

    PubMed Central

    Cohen, Mardge; Weber, Kathleen; Cruise, Ruth; Kelso, Gwendolyn

    2014-01-01

    Abstract Abuse is highly prevalent among HIV+ women, leading to behaviors, including lower adherence to highly active antiretroviral therapy (HAART) that result in poor health outcomes. Resilience (functioning competently despite adversity) may buffer the negative effects of abuse. This study investigated how resilience interacted with abuse history in relation to HAART adherence, HIV viral load (VL), and CD4+ cell count among a convenience sample of 138 HIV+ women from the Ruth M. Rothstein CORE Center/Cook County Health and Hospital Systems site of the Women's Interagency HIV Study (WIHS). Resilience was measured by the 10-item Connor-Davidson Resilience Scale (CD-RISC). HAART adherence (≥95% vs. <95% self reported usage of prescribed medication) and current or prior sexual, physical, or emotional/domestic abuse, were reported during structured interviews. HIV viral load (≥20 vs. <20 copies/mL) and CD4+ count (200 vs. <200 cells/mm) were measured with blood specimens. Multiple logistic regressions, controlling for age, race, income, enrollment wave, substance use, and depressive symptoms, indicated that each unit increase in resilience was significantly associated with an increase in the odds of having ≥95% HAART adherence and a decrease in the odds of having a detectable viral load. Resilience-Abuse interactions showed that only among HIV+ women with sexual abuse or multiple abuses did resilience significantly relate to an increase in the odds of ≥95% HAART adherence. Interventions to improve coping strategies that promote resilience among HIV+ women may be beneficial for achieving higher HAART adherence and viral suppression. PMID:24568654

  10. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  11. Bone mineral density in human immunodeficiency virus-1 infected men with hypogonadism prior to highly-active-antiretroviral-therapy (HAART)

    PubMed Central

    2009-01-01

    Alterations of bone metabolism have been observed in numerous studies of HIV-infected patients. Sex steroids are known to profoundly influence bone mass and bone turnover. Hypogonadism is common in HIV-infection. Therefore, we performed a cross sectional study of 80 male HIV-infected patients without wasting syndrome, and 20 healthy male controls, in whom we analyzed urine and serum samples for both calciotropic hormones and markers of bone metabolism and of endocrine testicular function. Bone mineral density (BMD) was assessed by dual-energy X-ray absorptiometry both in the lumbar spine and Ward's triangle of the left hip. None of the patients received highly-active-antiretroviral-therapy (HAART). Compared to eugonadal HIV-infected patients, subjects with hypogonadism (n = 32; 40%) showed statistically significant decrease of serum osteocalcin (p < 0.05) and elevated urinary excretion of crosslinks (p < 0.05). However, we found 13 and 15, respectively, patients with osteopenia (t-score -1.0 to -2.5 SD below normal) of the lumbar spine. The dissociation between bone formation and resorption and the reduction of of BMD (p < 0.05) is stronger expressed in patients with hypogonadism. Habitual hypogonadism appears to be of additional relevance for bone metabolism of male HIV-positive patients prior to HAART. PMID:19258214

  12. Viral persistence, latent reservoir, and blips: a review on HIV-1 dynamics and modeling during HAART and related treatment implications

    SciTech Connect

    Rong, Libin; Perelson, Alan

    2008-01-01

    HIV-1 eradication from infected individuals has not been achieved with the use of highly active antiretroviral therapy (HAART) for a prolonged period of time. The cellular reservoir for HIV-1 in resting memory CD4{sup +} T cells remains a major obstacle to viral elimination. The reservoir does not decay significantly over long periods of time as is able to release replication competent HIV-1 upon cell activation. Residual ongoing viral replication may likely occur in many patients because low levels of virus can be detected in plasma by sensitive assays and transient episodes of viremia, or HIV-1 blips, are often observed in patients even with successful viral suppression for many years. Here we review our current knowledge of the factors contributing to viral persistence, the latent reservoir, and blips, and mathematical models developed to explore them and their relationships. We show how mathematical modeling can help improve our understanding of HIV-1 dynamics in patients on HAART and the quantitative events underlying HIV-1 latency, reservoir stability, low-level viremic persistence, and emergence of intermittent viral blips. We also discuss treatment implications related to these studies.

  13. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  14. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  15. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  16. A biotechnology perspective of fungal proteases.

    PubMed

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira Filho, Edivaldo Ximenes; Pessoa Junior, Adalberto; Magalhães, Pérola Oliveira

    2015-06-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  17. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  18. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  19. Effect of co-administration of Hypoxis hemerocallidea extract and antiretroviral therapy (HAART) on the histomorphology and seminal parameters in Sprague Dawley rats.

    PubMed

    Jegede, A I; Offor, U; Onanuga, I O; Naidu, E C S; Azu, O O

    2017-03-01

    Although the successful introduction and rollout of antiretroviral therapy has impacted positively on morbidity and mortality of HIV-positive patients, its interaction with plant-based adjuvants remain sparsely investigated. We report the interaction and effects of adjuvant treatment with highly active antiretroviral therapy (HAART) and Hypoxis hemeocallidea (HH) extracts on testicular structure of rats. A total of 63 pathogen-free adult male Sprague Dawley rats were divided into nine groups and treated according to protocols. HAART cocktail predisposed to significant negative testicular parameters of sperm count, motility and seminiferous tubular epithelial height (quantitatively) (p < .03) and also altered the histomorphology of tubules with diffuse hypoplasia in seminiferous tubules. The higher dose of HH showed a better ability to mitigate the altered parameters and compares favourably with vitamin C in this protocol. While HH did not show any deleterious impact on morphometric data, its role as adjuvant did not significantly reduce the negative impact of HAART on morphometric indices especially with the lower dosage. Further investigations are warranted on the interactions between HAART and Hypoxis.

  20. HIV cause-specific deaths, mortality, risk factors, and the combined influence of HAART and late diagnosis in Zhejiang, China, 2006–2013

    PubMed Central

    Chen, Lin; Pan, Xiaohong; Ma, Qiaoqin; Yang, Jiezhe; Xu, Yun; Zheng, Jinlei; Wang, Hui; Zhou, Xin; Jiang, Tingting; Jiang, Jun; He, Lin; Jiang, Jianmin

    2017-01-01

    To examine patterns of human immunodeficiency virus (HIV) cause-specific deaths, risk factors, and the effect of interactions on mortality, we conducted a retrospective cohort study in Zhejiang, China, from 2006 to 2013. All data were downloaded from the acquired immune deficiency syndrome (AIDS) Prevention and Control Information System. The Cox proportional hazards model was used to assess predictors of cause-specific death. The relative excess risk due to interaction and ratio of hazard ratios (RHR) were calculated for correlations between HAART, late diagnosis, and age. A total of 13,812 HIV/AIDS patients were enrolled with 31,553 person-years (PY) of follow-up. The leading causes of death of HIV patients were accidental death and suicide (21.5%), and the leading cause of death for those with AIDS was AIDS-defining disease (76.4%). Both additive and multiplicative scale correlations were found between receiving HAART and late diagnosis, with RERI of 5.624 (95% CI: 1.766–9.482) and RHR of 2.024 (95% CI: 1.167–2.882). The effects of HAART on AIDS-related mortalities were affected by late diagnosis. Early detection of HIV infection and increased uptake of HAART are important for greater benefits in terms of lives saved. PMID:28198390

  1. Early HAART Initiation May Not Reduce Actual Reproduction Number and Prevalence of MSM Infection: Perspectives from Coupled within- and between-Host Modelling Studies of Chinese MSM Populations

    PubMed Central

    Sun, Xiaodan; Xiao, Yanni; Tang, Sanyi; Peng, Zhihang; Wu, Jianhong; Wang, Ning

    2016-01-01

    Having a thorough understanding of the infectivity of HIV, time of initiating treatment and emergence of drug resistant virus variants is crucial in mitigating HIV infection. There are many challenges to evaluating the long-term effect of the Highly Active Antiretroviral Therapy (HAART) on disease transmission at the population level. We proposed an individual based model by coupling within-host dynamics and between-host dynamics and conduct stochastic simulation in the group of men who have sex with men (MSM). The mean actual reproduction number is estimated to be 3.6320 (95% confidence interval: [3.46, 3.80]) for MSM group without treatment. Stochastic simulations show that given relatively high (low) level of drug efficacy after emergence of drug resistant variants, early initiation of treatment leads to a less (greater) actual reproduction number, lower (higher) prevalence and less (more) incidences, compared to late initiation of treatment. This implies early initiation of HAART may not always lower the actual reproduction number and prevalence of infection, depending on the level of treatment efficacy after emergence of drug resistant virus variants, frequency of high-risk behaviors and etc. This finding strongly suggests early initiation of HAART should be implemented with great care especially in the settings where the effective drugs are limited. Coupling within-host dynamics with between-host dynamics can provide critical information about impact of HAART on disease transmission and thus help to assist treatment strategy design and HIV/AIDS prevention and control. PMID:26930406

  2. Causes of Death among People Living with AIDS in the Pre- and Post-HAART Eras in the City of São Paulo, Brazil

    PubMed Central

    Domingues, Carmen-Silvia Bruniera; Waldman, Eliseu Alves

    2014-01-01

    Objective We examine the trend in causes of death among people living with AIDS in the city of São Paulo, Brazil, in the periods before and after the introduction of highly active antiretroviral therapy (HAART), and we investigate potential disparities across districts of residence. Methods Descriptive study of three periods: pre-HAART (1991–1996); early post-HAART (1997–1999); and late post-HAART (2000–2006). The data source was the São Paulo State STD/AIDS Program and São Paulo State Data Analysis Foundation. Causes of death were classified by the ICD-9 (1991–1995) and ICD-10 (1996–2006). We estimated age-adjusted mortality rates for leading underlying causes of death and described underlying and associated causes of death according to sociodemographic characteristics and area of residence. We used Pearson's chi-square test or Fisher's exact test to compare categorical variables. Areas of residence were categorized using a socioeconomic index. To analyze trends we apply generalized linear model with Poisson regression. Results We evaluated 32,808 AIDS-related deaths. Between the pre- and late post-HAART periods, the proportion of deaths whose underlying causes were non-AIDS-related diseases increased from 0.2% to 9.6% (p<0.001): from 0.01% to 1.67% (p<0.001) for cardiovascular diseases; 0.01% to 1.62% (p<0.001) for bacterial/unspecified pneumonia; and 0.03% to 1.46% (p<0.001) for non-AIDS-defining cancers. In the late post-HAART period, the most common associated causes of death were bacterial/unspecified pneumonia (35.94%), septicemia (33.46%), cardiovascular diseases (10.11%) and liver diseases (8.0%); and common underlying causes, besides AIDS disease, included non-AIDS-defining cancers in high-income areas, cardiovascular diseases in middle-income areas and assault in low-income areas. Conclusions The introduction of HAART has shifted the mortality profile away from AIDS-related conditions, suggesting changes in the pattern of morbidity, but

  3. Association of self-reported race with AIDS death in continuous HAART users in a cohort of HIV-infected women in the United States

    PubMed Central

    Murphy, Kerry; Hoover, Donald R.; Shi, Qiuhu; Cohen, Mardge; Gandhi, Monica; Golub, Elizabeth T.; Gustafson, Deborah R.; Pearce, Celeste Leigh; Young, Mary; Anastos, Kathryn

    2013-01-01

    Objective: To assess the association of race with clinical outcomes in HIV-positive women on continuous HAART. Design: Prospective study that enrolled women from 1994 to 1995 and 2001 to 2002. Setting: Women's Interagency HIV Study, a community-based cohort in five US cities. Participants: One thousand, four hundred and seventy-one HIV-positive continuous HAART users. Main outcome measures: Times to AIDS and non-AIDS death and incident AIDS-defining illness (ADI) after HAART initiation. Results: In adjusted analyses, black vs. white women had higher rates of AIDS death [adjusted hazard ratio (aHR) 2.14, 95% confidence interval (CI) 1.30, 3.50; P = 0.003] and incident ADI (aHR 1.58, 95% CI 1.08, 2.32; P = 0.02), but not non-AIDS death (aHR 0.91, 95% CI 0.59, 1.39; P = 0.65). Cumulative AIDS death incidence at 10 years was 17.3 and 8.3% for black and white women, respectively. Other significant independent pre-HAART predictors of AIDS death included peak viral load (aHR 1.70 per log10, 95% CI 1.34, 2.16; P < 0.001), nadir CD4+ cell count (aHR 0.65 per 100 cells/μl, 95% CI 0.56, 0.76; P < 0.001), depressive symptoms by Center for Epidemiology Studies Depression score at least 16 (aHR 2.10, 95% CI 1.51, 2.92; P < 0.001), hepatitis C virus infection (aHR 1.57, 95% CI 1.02, 2.40; P = 0.04), and HIV acquisition via transfusion (aHR 2.33, 95% CI 1.21, 4.49; P = 0.01). In models with time-updated HAART adherence, association of race with AIDS death remained statistically significant (aHR 3.09, 95% CI 1.38, 6.93; P = 0.006). Conclusion: In continuous HAART-using women, black women more rapidly died from AIDS or experienced incident ADI than their white counterparts after adjusting for confounders. Future studies examining behavioral and biologic factors in these women may further the understanding of HAART prognosis. PMID:24037210

  4. Flexible Cyclic Ethers/Polyethers as Novel P2-Ligands for HIV-1 Protease Inhibitors: Design, Synthesis, Biological Evaluation, and Protein-Ligand X-Ray Studies

    SciTech Connect

    Ghosh, Arun; Gemma, Sandra; Baldridge, Abigal; Wang, Yuan-Fang; Kovalevsky, Andrey; Koh, Yashiro; Weber, Irene; Mitsuya, Hiroaki

    2008-12-05

    We report the design, synthesis, and biological evaluation of a series of novel HIV-1 protease inhibitors. The inhibitors incorporate stereochemically defined flexible cyclic ethers/polyethers as high affinity P2-ligands. Inhibitors containing small ring 1,3-dioxacycloalkanes have shown potent enzyme inhibitory and antiviral activity. Inhibitors 3d and 3h are the most active inhibitors. Inhibitor 3d maintains excellent potency against a variety of multi-PI-resistant clinical strains. Our structure-activity studies indicate that the ring size, stereochemistry, and position of oxygens are important for the observed activity. Optically active synthesis of 1,3-dioxepan-5-ol along with the syntheses of various cyclic ether and polyether ligands have been described. A protein-ligand X-ray crystal structure of 3d-bound HIV-1 protease was determined. The structure revealed that the P2-ligand makes extensive interactions including hydrogen bonding with the protease backbone in the S2-site. In addition, the P2-ligand in 3d forms a unique water-mediated interaction with the NH of Gly-48.

  5. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  6. Development of Broad-Spectrum Halomethyl Ketone Inhibitors Against Coronavirus Main Protease 3CL(pro)

    SciTech Connect

    Bacha,U.; Barilla, J.; Gabelli, S.; Kiso, Y.; Amzel, L.; Freire, E.

    2008-01-01

    Coronaviruses comprise a large group of RNA viruses with diverse host specificity. The emergence of highly pathogenic strains like the SARS coronavirus (SARS-CoV), and the discovery of two new coronaviruses, NL-63 and HKU1, corroborates the high rate of mutation and recombination that have enabled them to cross species barriers and infect novel hosts. For that reason, the development of broad-spectrum antivirals that are effective against several members of this family is highly desirable. This goal can be accomplished by designing inhibitors against a target, such as the main protease 3CLpro (Mpro), which is highly conserved among all coronaviruses. Here 3CLpro derived from the SARS-CoV was used as the primary target to identify a new class of inhibitors containing a halomethyl ketone warhead. The compounds are highly potent against SARS 3CLpro with Ki's as low as 300 nm. The crystal structure of the complex of one of the compounds with 3CLpro indicates that this inhibitor forms a thioether linkage between the halomethyl carbon of the warhead and the catalytic Cys 145. Furthermore, Structure Activity Relationship (SAR) studies of these compounds have led to the identification of a pharmacophore that accurately defines the essential molecular features required for the high affinity.

  7. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application.

  8. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  9. Epstein-Barr virus and human immunodeficiency virus serological responses and viral burdens in HIV-infected patients treated with HAART

    NASA Technical Reports Server (NTRS)

    O'Sullivan, Cathal E.; Peng, RongSheng; Cole, Kelly Stefano; Montelaro, Ronald C.; Sturgeon, Timothy; Jenson, Hal B.; Ling, Paul D.; Butel, J. S. (Principal Investigator)

    2002-01-01

    Epstein-Barr virus (EBV) associated non-Hodgkin lymphoma is recognized as a complication of human immunodeficiency virus (HIV) infection. Little is known regarding the influence of highly active antiretroviral therapy (HAART) on the biology of EBV in this population. To characterize the EBV- and HIV-specific serological responses together with EBV DNA levels in a cohort of HIV-infected adults treated with HAART, a study was conducted to compare EBV and HIV serologies and EBV DNA copy number (DNAemia) over a 12-month period after the commencement of HAART. All patients were seropositive for EBV at baseline. Approximately 50% of patients had detectable EBV DNA at baseline, and 27/30 had detectable EBV DNA at some point over the follow-up period of 1 year. Changes in EBV DNA copy number over time for any individual were unpredictable. Significant increases in the levels of Epstein-Barr nuclear antigen (EBNA) and Epstein-Barr early antigen (EA) antibodies were demonstrated in the 17 patients who had a good response to HAART. Of 29 patients with paired samples tested, four-fold or greater increases in titers were detected for EA in 12/29 (41%), for EBNA in 7/29 (24%), for VCA-IgG in 4/29 (14%); four-fold decreases in titers were detected in 2/29 (7%) for EA and 12/29 (41%) for EBNA. A significant decline in the titer of anti-HIV antibodies was also demonstrated. It was concluded that patients with advanced HIV infection who respond to HAART have an increase in their EBV specific antibodies and a decrease in their HIV-specific antibodies. For the cohort overall, there was a transient increase in EBV DNA levels that had declined by 12 months. Copyright 2002 Wiley-Liss, Inc.

  10. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  11. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  12. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  13. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  14. Evaluation of virulence factors of Candida albicans isolated from HIV-positive individuals using HAART.

    PubMed

    de Paula Menezes, Ralciane; de Melo Riceto, Érika Bezerra; Borges, Aércio Sebastião; de Brito Röder, Denise Von Dolingër; dos Santos Pedroso, Reginaldo

    2016-06-01

    The colonization by Candida species is one of the most important factors related to the development of oral candidiasis in HIV-infected individuals. The aim of the study was to evaluate and discuss the phospholipase, proteinase, DNAse and haemolytic activities of Candida albicans isolated from the oral cavity of HIV individuals with high efficiency antiretroviral therapy. Seventy-five isolates of C. albicans obtained from saliva samples of patients with HIV and 41 isolates from HIV-negative individuals were studied. Haemolytic activity was determined in Sabouraud dextrose agar plates containing 3% glucose and 7% sheep red cells. Culture medium containing DNA base-agar, egg yolk, and bovine albumin were used to determine DNase, phospholipase and proteinase activities, respectively. All isolates from the HIV patients group had haemolytic activity, 98% showed phospholipase activity, 92% were positive for proteinase and 32% DNAse activity. Regarding the group of indivídios HIV negative, all 41 isolates presented hemolytic activity, 90.2% showed phospholipase and proteinase activity and 12.2% were positive for DNAse. The phospholipase activity was more intense for the group of HIV positive individuals. DNase production was more frequently observed in the group of HIV-positive individuals. The percentage of isolates having DNAse activity was also significantly different between the groups of patients not using any antiretroviral therapy, those using transcriptase inhibitors and those using transcriptase inhibitor and protease inhibitor in combination.

  15. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  16. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  17. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  18. Changing Patterns in the Neuropathogenesis of HIV During the HAART Era

    PubMed Central

    Langford, T. D.; Letendre, S. L.; Larrea, G. J.; Masliah, E.

    2015-01-01

    Rapid progress in the development of highly active antiretroviral therapy has changed the observed patterns in HIV encephalitis and AIDS-related CNS opportunistic infections. Early in the AIDS epidemic, autopsy studies pointed to a high prevalence of these conditions. With the advent of nucleoside reverse transcriptase inhibitors, the prevalence at autopsy of opportunistic infections, such as toxoplasmosis and progressive multifocal leukoencephalopathy, declined while that of HIV encephalitis increased. After the introduction of protease inhibitors, a decline in both HIV encephalitis and CNS opportunistic infections was observed. However, with the increasing resistance of HIV strains to anti-retrovirals, there has been a resurgence in the frequency of HIV encephalitis and HIV leukoencephalopathy. HIV leukoencephalopathy in AIDS patients failing highly active antiretroviral therapy is characterized by massive infiltration of HIV infected monocytes/macrophages into the brain and extensive white matter destruction. This condition may be attributable to interactions of anti-retrovirals with cerebrovascular endothelium, astroglial cells and white matter of the brain. These interactions may lead to cerebral ischemia, increased blood-brain barrier permeability and demyelination. Potential mechanisms of such interactions include alterations in host cell signaling that may result in trophic factor dysregulation and mitochondrial injury. We conclude that despite the initial success of combined anti-retroviral therapy, more severe forms of HIV encephalitis appear to be emerging as the epidemic matures. Factors that may contribute to this worsening include the prolonged survival of HIV-infected patients, thereby prolonging the brain’s exposure to HIV virions and proteins, the use of increasingly toxic combinations of poorly penetrating drugs in highly antiretroviral-experienced AIDS patients, and selection of more virulent HIV strains with higher replication rates and

  19. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  20. Bacterial proteases, untapped antimicrobial drug targets.

    PubMed

    Culp, Elizabeth; Wright, Gerard D

    2017-04-01

    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  1. Lysosomal protease expression in mature enamel.

    PubMed

    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D

    2009-01-01

    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  2. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  3. The impact of integrating food supplementation, nutritional education and HAART (Highly Active Antiretroviral Therapy) on the nutritional status of patients living with HIV/AIDS in Mozambique: results from the DREAM Programme.

    PubMed

    Scarcella, P; Buonomo, E; Zimba, I; Doro Altan, A M; Germano, P; Palombi, L; Marazzi, M C

    2011-01-01

    DREAM (Drug Resources Enhancement against AIDS and Malnutrition) is a multiregional health program active in Mozambique since 2002 and provides free of charge an integrating package of care consisting of peer to peer nutritional and health education, food supplementation, voluntary counseling and testing, immunological, virological, clinical assessment and HAART (Highly Active AntiRetroviral Treatment). The main goals of this paper are to describe the state of health and nutrition and the adequacy of the diet of a sample of HIV/AIDS patients in Mozambique on HAART and not. A single-arm retrospective cohort study was conducted. 106 HIV/AIDS adult patients (84 in HAART), all receiving food supplementation and peer-to-peer nutritional education, were randomly recruited in Mozambique in two public health centres where DREAM is running. The programme is characterized by: provision of HAART, clinical and laboratory monitoring, peer to peer health and nutritional education and food supplementation. We measured BMI, haemoglobin, viral load, CD4 count at baseline (T0) and after at least 1 year (T1). Dietary intake was estimated using 24h food recall and dietary diversity was assessed by using the Dietary Diversity Score (DDS) at T1. Overall, the patients'diet appeared to be quite balanced in nutrients. In the cohort not in HAART the mean BMI values showed an increases but not significant (initial value: 21.9 ± 2.9; final value: 22.5 ± 3.3 ) and the mean haemoglobin values (g/dl) showed a significant increases (initial value: 10.5+ 2.1; final value: 11.5 ± 1.7 p< 0.024) . In the cohort in HAART, both the mean of BMI value (initial value: 20.7 ± 3.9; final value: 21.9 ± 3.3 p< 0.001) and of haemoglobin (initial value: 9.9 ± 2.2; final value: 10.8 ± 1.7 p< 0.001) showed a higher significant increase. The increase in BMI was statistically associated with the DDS in HAART patients. In conclusion nutritional status improvement was observed in both cohorts. The improvement

  4. Decreased CD95 expression on naive T cells from HIV-infected persons undergoing highly active anti-retroviral therapy (HAART) and the influence of IL-2 low dose administration

    PubMed Central

    Amendola, A; Poccia, F; Martini, F; Gioia, C; Galati, V; Pierdominici, M; Marziali, M; Pandolfi, F; Colizzi, V; Piacentini, M; Girardi, E; D'Offizi, G

    2000-01-01

    The functional recovery of the immune system in HIV-infected persons receiving HAART and the role of adjuvant immune therapy are still matters of intensive investigation. We analysed the effects of HAART combined with cytokines in 22 naive asymptomatic individuals, randomized to receive HAART (n = 6), HAART plus a low dose (1000 000 U/daily) of rIL-2 (n = 8), and HAART plus rIL-2 after previous administration of granulocyte colony-stimulating factor (n = 8). After 3 months of therapy, increased CD4+ T cell counts and diminished viral loads were observed in all patients, independently of cytokine addition. A decreased expression of CD95 (Apo 1/Fas) was evident in all groups when compared with values before therapy. The percentages of peripheral blood mononuclear cells (PBMC) expressing CD95 after therapy decreased by 15%, 22% and 18% in the three treatment groups, respectively (P < 0·05). Analysis of PBMC subsets demonstrated that CD95 expression was significantly reduced on CD45RA+CD62L+ naive T cells (25·3%, 22·4%, and 18·6%, respectively; P < 0·05) in each group, after therapy. Accordingly, all patients showed a reduced rate of in vitro spontaneous apoptosis (P < 0·05). Another effect induced by HAART was a significant increase in IL-2Rα expression on total PBMC (P < 0·05), independently of cytokine addition. Altogether, our results suggest that very low dose administration of rIL-2 (1000 000 U/daily) may be not enough to induce a significant improvement in the immune system as regards HAART alone. The employment of higher doses of recombinant cytokines and/or different administration protocols in clinical trials might however contribute to ameliorate the immune reconstitution in patients undergoing HAART. PMID:10792383

  5. Mutations in the Reverse Transcriptase and Protease Genes of Human Immunodeficiency Virus-1 from Antiretroviral Naïve and Treated Pediatric Patients

    PubMed Central

    Bure, Dinesh; Makhdoomi, Muzamil A.; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A.; Singh, Ravinder; Kabra, Sushil K.; Luthra, Kalpana

    2015-01-01

    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis. PMID:25674767

  6. Mutations in the reverse transcriptase and protease genes of human immunodeficiency virus-1 from antiretroviral naïve and treated pediatric patients.

    PubMed

    Bure, Dinesh; Makhdoomi, Muzamil A; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A; Singh, Ravinder; Kabra, Sushil K; Luthra, Kalpana

    2015-02-10

    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis.

  7. Cleavage Entropy as Quantitative Measure of Protease Specificity

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Margreiter, Michael A.; Spitzer, Gudrun M.; Wallnoefer, Hannes G.; Liedl, Klaus R.

    2013-01-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity. PMID:23637583

  8. Cleavage entropy as quantitative measure of protease specificity.

    PubMed

    Fuchs, Julian E; von Grafenstein, Susanne; Huber, Roland G; Margreiter, Michael A; Spitzer, Gudrun M; Wallnoefer, Hannes G; Liedl, Klaus R

    2013-04-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity.

  9. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  10. Current and Novel Inhibitors of HIV Protease

    PubMed Central

    Pokorná, Jana; Machala, Ladislav; Řezáčová, Pavlína; Konvalinka, Jan

    2009-01-01

    The design, development and clinical success of HIV protease inhibitors represent one of the most remarkable achievements of molecular medicine. This review describes all nine currently available FDA-approved protease inhibitors, discusses their pharmacokinetic properties, off-target activities, side-effects, and resistance profiles. The compounds in the various stages of clinical development are also introduced, as well as alternative approaches, aiming at other functional domains of HIV PR. The potential of these novel compounds to open new way to the rational drug design of human viruses is critically assessed. PMID:21994591

  11. Seminal and colostral protease inhibitors on leukocytes.

    PubMed

    Veselský, L; Cechová, D; Hruban, V; Klaudy, J

    1982-01-01

    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  12. Risk factors, CD4 long-term evolution and mortality of HIV-infected patients who persistently maintain low CD4 counts, despite virological response to HAART.

    PubMed

    Pacheco, Yolanda M; Jarrín, Inmaculada; Del Amo, Julia; Moreno, Santiago; Iribarren, José A; Viciana, Pompeyo; Parra, Jorge; Gomez-Sirvent, Juan L; Gutierrez, Félix; Blanco, José R; Vidal, Francesc; Leal, Manuel

    2009-11-01

    A proportion of HIV-patients does not normally restore their CD4 counts despite virological response to HAART. Those whose CD4 counts persistently remain closed to the critical threshold for opportunistic infections deserve special interest. To study the risk factors, the long-term CD4 counts evolution, and the risk of death of patients who persistently maintain low CD4 counts, despite virological response to HAART, within a multicenter, hospital-based cohort study. A total of 147 patients were selected from CoRIS-MD and classified into a "Low-Group" or a "High-Group", depending on their CD4 counts after two-years of effective HAART (threshold 250 cells/microL). Associated risk factors were analysed by logistic regression, the CD4 dynamics were evaluated over a total period of 7.70 years (IQR, 6.70-9.00), and mortality was estimated by Cox proportional hazard. A total of 40 patients (27%) were classified into the "Low-Group". The odds ratio for this group increased with age, being 4.56 (2.23-9.33) for over 40, and was also higher among IDU, 3.63 (1.04-12.68). Six years thereafter, among these patients, only a 30% exceeded 350 CD4 cells/microL and a 12% exceeded 500 CD4 cells/microL. Furthermore, the "Low-Group" had a death rate of 2.42 per 100 persons/year (95%CI, 1.01-5.81), although once adjusted by age the estimates were no longer significant [4.14 (0.87-19.72)]. Our results suggest that those HIV patients who have not overcome the critical threshold of 250 CD4 cells/microL after a two years period of virologically effective HAART do persist with the aforementioned failure of CD4 restoration for a much longer time.

  13. Regulatory T cells generated during cytomegalovirus in vitro stimulation of mononuclear cells from HIV-infected individuals on HAART correlate with decreased lymphocyte proliferation

    SciTech Connect

    Jesser, Renee D.; Li, Shaobing; Weinberg, Adriana . E-mail: Adriana.Weinberg@uchsc.edu

    2006-09-01

    HIV-infected patients fail to fully recover cell-mediated immunity despite HAART. To identify regulatory factors, we studied the phenotype and function of in vitro cytomegalovirus (CMV)-stimulated T cells from HAART recipients. CFSE-measured proliferation showed CD4{sup +} and CD8{sup +} cells dividing in CMV-stimulated cultures. Compared with healthy controls, CMV-stimulated lymphocytes from HAART recipients had lower {sup 3}H-thymidine incorporation; lower IFN{gamma} and TNF{alpha} production; higher CD4{sup +}CD27{sup -}CD28{sup -} and CD8{sup +}CD27{sup -}CD28{sup -} frequencies; lower CD4{sup +}CD25{sup hi}; and higher FoxP3 expression in CD8{sup +}CD25{sup hi} cells. CMV-specific proliferation correlated with higher IFN{gamma}, TNF{alpha} and IL10 levels and higher CD4{sup +}perforin{sup +} and CD8{sup +}perforin{sup +} frequencies. Decreased proliferation correlated with higher CD4{sup +}CD27{sup -}CD28{sup -} frequencies and TGF{beta}1 production, which also correlated with each other. Anti-TGF{beta}1 neutralizing antibodies restored CMV-specific proliferation in a dose-dependent fashion. In HIV-infected subjects, decreased proliferation correlated with higher CMV-stimulated CD8{sup +}CD25{sup hi} frequencies and their FoxP3 expression. These data indicate that FoxP3- and TGF{beta}1-expressing regulatory T cells contribute to decreased immunity in HAART recipients.

  14. Selected micronutrient levels and response to highly active antiretroviral therapy (HAART) among HIV/AIDS patients attending a teaching Hospital in Addis Ababa, Ethiopia.

    PubMed

    Eshetu, Amare; Tsegaye, Aster; Petros, Beyene

    2014-12-01

    Poor micronutrient levels are associated with an increased risk of progression to AIDS and are also suggested to influence outcome of highly active antiretroviral therapy (HAART), though existing data are inconclusive to support the latter. Few published data are available on micronutrient levels in Ethiopian HIV/AIDS patients taking HAART. The objective of the study was to determine the association of micronutrient levels and response to HAART (CD4(+) T cell count) among adult HIV/AIDS patients attending a teaching Hospital in Addis Ababa. CD4(+) T cell counts and micronutrient (retinol, zinc, and iron) levels for 171 subjects were determined using standard procedures. Some proportions of the study participants were found deficient for retinol (14.03 %), zinc (47.3 %), and iron (2.8 %). Patients who were deficient in retinol had a significantly lower median CD4(+) T cell counts (P = 0.002) compared to non-deficient subjects. Association of micronutrient quartiles with CD4+ T cell count was assessed using adjusted multivariate regression by taking quartile 4 as a reference category. Accordingly, patients who had retinol levels in quartile 4 had a significantly lower mean CD4(+) T cell count compared to quartile 3 (P = 0.02). The significantly higher CD4(+) T cell counts in patients who were non-deficient in retinol imply the role of retinol in improving the production of CD4(+) T cells. However, both lower and higher retinol levels were associated with suppressed immunity (CD4 < 200 cells/mm(3)), suggesting an adverse effect of higher retinol levels. Thus, retinol may be potentially harmful depending on the dose, emphasizing the need for optimized level of retinol in nutrient supplements in patients taking HAART.

  15. Detection of protease and protease activity using a single nanoscrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2013-01-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  16. Cardio-Metabolic Effects of HIV Protease Inhibitors (Lopinavir/Ritonavir)

    PubMed Central

    Reyskens, Kathleen M. S. E.; Fisher, Tarryn-Lee; Schisler, Jonathan C.; O'Connor, Wendi G.; Rogers, Arlin B.; Willis, Monte S.; Planesse, Cynthia; Boyer, Florence; Rondeau, Philippe; Bourdon, Emmanuel; Essop, M. Faadiel

    2013-01-01

    Although antiretroviral treatment decreases HIV-AIDS morbidity/mortality, long-term side effects may include the onset of insulin resistance and cardiovascular diseases. However, the underlying molecular mechanisms responsible for highly active antiretroviral therapy (HAART)-induced cardio-metabolic effects are poorly understood. In light of this, we hypothesized that HIV protease inhibitor (PI) treatment (Lopinavir/Ritonavir) elevates myocardial oxidative stress and concomitantly inhibits the ubiquitin proteasome system (UPS), thereby attenuating cardiac function. Lopinavir/Ritonavir was dissolved in 1% ethanol (vehicle) and injected into mini-osmotic pumps that were surgically implanted into Wistar rats for 8 weeks vs. vehicle and sham controls. We subsequently evaluated metabolic parameters, gene/protein markers and heart function (ex vivo Langendorff perfusions). PI-treated rats exhibited increased serum LDL-cholesterol, higher tissue triglycerides (heart, liver), but no evidence of insulin resistance. In parallel, there was upregulation of hepatic gene expression, i.e. acetyl-CoA carboxylase β and 3-hydroxy-3-methylglutaryl-CoA-reductase, key regulators of fatty acid oxidation and cholesterol synthesis, respectively. PI-treated hearts displayed impaired cardiac contractile function together with attenuated UPS activity. However, there was no significant remodeling of hearts exposed to PIs, i.e. lack of ultrastructural changes, fibrosis, cardiac hypertrophic response, and oxidative stress. Western blot analysis of PI-treated hearts revealed that perturbed calcium handling may contribute to the PI-mediated contractile dysfunction. Here chronic PI administration led to elevated myocardial calcineurin, nuclear factor of activated T-cells 3 (NFAT3), connexin 43, and phosphorylated phospholamban, together with decreased calmodulin expression levels. This study demonstrates that early changes triggered by PI treatment include increased serum LDL-cholesterol levels

  17. Failure to Restore the Vγ2-Jγ1.2 Repertoire in HIV-infected Men Receiving Highly Active Antiretroviral Therapy (HAART)

    PubMed Central

    Hebbeler, Andrew M.; Propp, Nadia; Cairo, Cristiana; Li, Haishan; Cummings, Jean Saville; Jacobson, Lisa P.; Margolick, Joseph B.; Pauza, C. David

    2008-01-01

    Gammadelta (γδ) T cells expressing the Vγ2-Jγ1.2Vδ2 (Vγ9-JPVδ2, alternate nomenclature) T cell receptor (TCR) constitute the major peripheral blood population of γδ T cells in adult humans and are specifically depleted during human immunodeficiency virus (HIV) disease. Vγ2-Jγ1.2Vδ2 T cells provide a convenient model for assessing the impact of antiretroviral therapy on cell populations that are not susceptible to direct infection because they do not express CD4 and depletion occurs by indirect mechanisms. We obtained longitudinal PBMC samples from 16 HIV-infected individuals who were enrolled in the Multicenter AIDS Cohort Study (MACS) and starting highly active antiretroviral therapy (HAART). Vγ2-Jγ1.2Vδ2 T cells were depleted in these individuals as a result of HIV infection. Despite evidence for clinical benefits of HAART, the Vγ2-Jγ1.2Vδ2 T cell repertoire did not recover after HAART initiation irrespective of treatment duration. These studies highlight important defects among cell subsets lost due to indirect effects of HIV. PMID:18606571

  18. Timing of HAART defines the integrity of memory B cells and the longevity of humoral responses in HIV-1 vertically-infected children

    PubMed Central

    Pensieroso, Simone; Cagigi, Alberto; Palma, Paolo; Nilsson, Anna; Capponi, Claudia; Freda, Elio; Bernardi, Stefania; Thorstensson, Rigmor; Chiodi, Francesca; Rossi, Paolo

    2009-01-01

    HIV-1 infection induces a progressive disruption of the B cell compartment impairing long-term immune responses to routine immunizations. Depletion of specific memory B cell pools occurs during the 1st stages of the infection and cannot be reestablished by antiretroviral treatment. We reasoned that an early control of viral replication through treatment could preserve the normal development of the memory B cell compartment and responses to routine childhood vaccines. Accordingly, we evaluated the effects of different highly-active antiretroviral therapy (HAART) schedules in 70 HIV-1 vertically-infected pediatric subjects by B cell phenotypic analyses, antigen-specific B cell enzyme-linked immunosorbent spot (ELISpot) and ELISA for common vaccination and HIV-1 antigens. Initiation of HAART within the 1st year of life permits the normal development and maintenance of the memory B cell compartment. On the contrary, memory B cells from patients treated later in time are remarkably reduced and their function is compromised regardless of viral control. A cause for concern is that both late-treated HIV-1 controllers and noncontrollers loose protective antibody titers against common vaccination antigens. Timing of HAART initiation is the major factor predicting the longevity of B cell responses in vaccinated HIV-1-infected children. PMID:19416836

  19. Non-AIDS definings malignancies among human immunodeficiency virus-positive subjects: Epidemiology and outcome after two decades of HAART era

    PubMed Central

    Brugnaro, Pierluigi; Morelli, Erika; Cattelan, Francesca; Petrucci, Andrea; Panese, Sandro; Eseme, Franklyn; Cavinato, Francesca; Barelli, Andrea; Raise, Enzo

    2015-01-01

    Highly active antiretroviral therapy (HAART) for human immunodeficiency virus (HIV) infection has been widely available in industrialized countries since 1996; its widespread use determined a dramatic decline in acquired immunodeficiency syndrome (AIDS)-related mortality, and consequently, a significant decrease of AIDS-defining cancers. However the increased mean age of HIV-infected patients, prolonged exposure to environmental and lifestyle cancer risk factors, and coinfection with oncogenic viruses contributed to the emergence of other malignancies that are considered non-AIDS-defining cancers (NADCs) as a relevant fraction of morbidity and mortality among HIV-infected people twenty years after HAART introduction. The role of immunosuppression in the pathogenesis of NADCs is not well defined, and future researches should investigate the etiology of NADCs. In the last years there is a growing evidence that intensive chemotherapy regimens and radiotherapy could be safely administrated to HIV-positive patients while continuing HAART. This requires a multidisciplinary approach and a close co-operation of oncologists and HIV-physicians in order to best manage compliance of patients to treatment and to face drug-related side effects. Here we review the main epidemiological features, risk factors and clinical behavior of the more common NADCs, such as lung cancer, hepatocellular carcinoma, colorectal cancer and anal cancer, Hodgkin’s lymphoma and some cutaneous malignancies, focusing also on the current therapeutic approaches and preventive screening strategies. PMID:26279983

  20. It's not just what you say: relationships of HIV dislosure and risk reduction among MSM in the post-HAART era.

    PubMed

    Klitzman, R; Exner, T; Correale, J; Kirshenbaum, S B; Remien, R; Ehrhardt, A A; Lightfoot, M; Catz, S L; Weinhardt, L S; Johnson, M O; Morin, S F; Rotheram-Borus, M J; Kelly, J A; Charlebois, E

    2007-07-01

    In the post-HAART era, critical questions arise as to what factors affect disclosure decisions and how these decisions are associated with factors such as high-risk behaviors and partner variables. We interviewed 1,828 HIV-positive men who have sex with men (MSM), of whom 46% disclosed to all partners. Among men with casual partners, 41.8% disclosed to all of these partners and 21.5% to none. Disclosure was associated with relationship type, perceived partner HIV status and sexual behaviors. Overall, 36.5% of respondents had unprotected anal sex (UAS) with partners of negative/unknown HIV status. Of those with only casual partners, 80.4% had >1 act of UAS and 58% of these did not disclose to all partners. This 58% were more likely to self-identify as gay (versus bisexual), be aware of their status for <5 years and have more partners. Being on HAART, viral load and number of symptoms were not associated with disclosure. This study - the largest conducted to date of disclosure among MSM and one of the few conducted post-HAART - indicates that almost 1/5th reported UAS with casual partners without disclosure, highlighting a public health challenge. Disclosure needs to be addressed in the context of relationship type, partner status and broader risk-reduction strategies.

  1. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  2. Transient ECM protease activity promotes synaptic plasticity

    PubMed Central

    Magnowska, Marta; Gorkiewicz, Tomasz; Suska, Anna; Wawrzyniak, Marcin; Rutkowska-Wlodarczyk, Izabela; Kaczmarek, Leszek; Wlodarczyk, Jakub

    2016-01-01

    Activity-dependent proteolysis at a synapse has been recognized as a pivotal factor in controlling dynamic changes in dendritic spine shape and function; however, excessive proteolytic activity is detrimental to the cells. The exact mechanism of control of these seemingly contradictory outcomes of protease activity remains unknown. Here, we reveal that dendritic spine maturation is strictly controlled by the proteolytic activity, and its inhibition by the endogenous inhibitor (Tissue inhibitor of matrix metalloproteinases-1 – TIMP-1). Excessive proteolytic activity impairs long-term potentiation of the synaptic efficacy (LTP), and this impairment could be rescued by inhibition of protease activity. Moreover LTP is altered persistently when the ability of TIMP-1 to inhibit protease activity is abrogated, further demonstrating the role of such inhibition in the promotion of synaptic plasticity under well-defined conditions. We also show that dendritic spine maturation involves an intermediate formation of elongated spines, followed by their conversion into mushroom shape. The formation of mushroom-shaped spines is accompanied by increase in AMPA/NMDA ratio of glutamate receptors. Altogether, our results identify inhibition of protease activity as a critical regulatory mechanism for dendritic spines maturation. PMID:27282248

  3. HIV-1/HAART-Related Lipodystrophy Syndrome (HALS) Is Associated with Decreased Circulating sTWEAK Levels

    PubMed Central

    López-Dupla, Miguel; Maymó-Masip, Elsa; Martínez, Esteban; Domingo, Pere; Leal, Manuel; Peraire, Joaquim; Viladés, Consuelo; Veloso, Sergi; Arnedo, Mireia; Ferrando-Martínez, Sara; Beltrán-Debón, Raúl; Alba, Verónica; Gatell, Josep Mª; Vendrell, Joan; Vidal, Francesc; Chacón, Matilde R.

    2015-01-01

    Background and Objectives Obesity and HIV-1/HAART–associated lipodystrophy syndrome (HALS) share clinical, pathological and mechanistic features. Tumor necrosis factor-like weak inducer of apoptosis (TWEAK) is a multifunctional cytokine that plays an important role in obesity and related diseases. We sought to explore the relationship between HALS and circulating levels of soluble (s) TWEAK and its scavenger receptor sCD163. Methods This was a cross-sectional multicenter study of 120 HIV-1-infected patients treated with a stable HAART regimen; 56 with overt HALS and 64 without HALS. Epidemiological and clinical variables were determined. Serum levels of sTWEAK and sCD163 levels were measured by ELISA. Results were analyzed with Student’s t-test, Mann-Whitney U and χ2 test. Pearson and Spearman correlation were used to estimate the strength of association between variables. Results Circulating sTWEAK was significantly decreased in HALS patients compared with non-HALS patients (2.81±0.2 vs. 2.94±0.28 pg/mL, p = 0.018). No changes were observed in sCD163 levels in the studied cohorts. On multivariate analysis, a lower log sTWEAK concentration was independently associated with the presence of HALS (OR 0.027, 95% CI 0.001–0.521, p = 0.027). Conclusions HALS is associated with decreased sTWEAK levels. PMID:26658801

  4. Socio-economic impact of antiretroviral treatment in HIV patients. An economic review of cost savings after introduction of HAART.

    PubMed

    Gonzalo, Teresa; García Goñi, Manuel; Muñoz-Fernández, María Angeles

    2009-01-01

    Star celebrities such as Rock Hudson, Freddie Mercury, Magic Johnson, and Isaac Asimov have unfortunately something in common: they were all victims of the HIV global pandemic. Since then HIV infection has become considered a pandemic disease, and it is regarded as a priority in healthcare worldwide. It is ranked as the first cause of death among young people in industrialized countries, and it is recognized as a public healthcare problem due to its human, social, mass media, and economic impact. Incorporation of new and highly active antiretroviral treatment, available since 1996 for HIV/AIDS treatment, has provoked a radical change in the disease pattern, as well as in the impact on patient survival and quality of life. The pharmaceutical industry's contribution, based on the research for more active new drugs, has been pivotal. Mortality rates have decreased significantly in 20 years by 50% and now AIDS is considered a chronic and controlled disease. In this review we have studied the impact of HAART treatment on infected patients, allowing them to maintain their status as active workers and the decreased absenteeism from work derived from this, contributing ultimately to overall social wealth and, thus, to economic growth. Furthermore, an analysis of the impact on healthcare costs, quality of life per year, life per year gained, cost economic savings and cost opportunity among other parameters has shown that society and governments are gaining major benefits from the inclusion of antiretroviral therapies in HIV/AIDS patients.

  5. 18O proteomics reveal increased Human Apolipoprotein CIII in Hispanic HIV-1 positive women with HAART that use cocaine

    PubMed Central

    Zenón, Frances; Jorge, Inmaculada; Cruz, Ailed; Suarez, Erick; Segarra, Annabell C.; Vázquez, Jesús; Meléndez, Loyda M.; Serrano, Horacio

    2016-01-01

    Purpose Drug abuse is a major risk factor in the development and progression of HIV-1. This study defines the alterations in the plasma proteome of HIV-1 infected women that use cocaine. Experimental Design Plasma samples from 12 HIV-seropositive Hispanic women under antiretroviral therapy were selected for this study. Six sample pairs were matched between non-drug users and cocaine users. After IgG and albumin depletion, SDS-PAGE, and in-gel digestion, peptides from non-drug users and cocaine users were labeled with 16O and 18O respectively and subjected to LC-MS/MS and quantitation using Proteome Discover and QuiXoT softwares and validated by ELISA. Results A total of 1,015 proteins were identified at 1% FDR. Statistical analyses revealed 13 proteins with significant changes between the two groups, cocaine and non-cocaine users (p<0.05). The great majority pertained to protection defense function and the rest pertained to transport, homeostatic, regulation, and binding of ligands. Apolipoprotein CIII was increased in plasma of HIV+ Hispanic women positive for cocaine compared to HIV+ non-drug users (p<0.05). Conclusions and clinical relevance Increased human Apolipoprotein CIII warrants that these patients be carefully monitored to avoid the increased risk of cardiovascular events associated with HIV, HAART and cocaine use. PMID:26255783

  6. Relationship between Younger Age, Autoimmunity, Cardiometabolic Risk, Oxidative Stress, HAART, and Ischemic Stroke in Africans with HIV/AIDS.

    PubMed

    Longo-Mbenza, Benjamin; Longokolo Mashi, Murielle; Lelo Tshikwela, Michel; Mokondjimobe, Etienne; Gombet, Thierry; Ellenga-Mbolla, Bertrand; Nge Okwe, Augustin; Kangola Kabangu, Nelly; Mbungu Fuele, Simon

    2011-01-01

    Background and Purpose. It now appears clear that both HIV/AIDS and antiretroviral therapy (HAART) use are associated with higher risk of cardiovascular disease such as stroke. In this study, we evaluated the prevalence, the risk factors, and the cardiometabolic comorbidities of stroke in HIV/AIDS Central African patients. Methods. This hospital-based cross-sectional study collected clinical, laboratory, and imaging data of black Central African heterosexual, intravenous drug nonuser, and HIV/AIDS patients. Results. There were 54 men and 62 women, with a female to male ratio of 1.2 : 1. All were defined by hypercoagulability and oxidative stress. Hemorrhagic stroke was reported in 1 patient, ischemic stroke in 17 patients, and all stroke subtypes in 18 patients (15%). Younger age <45 years (P = .003), autoimmunity (P < .0001), and metabolic syndrome defined by IDF criteria (P < .0001) were associated with ischemic stroke. Conclusions. Clustering of several cardiometabolic factors, autoimmunity, oxidative stress, and lifestyle changes may explain accelerated atherosclerosis and high risk of stroke in these young black Africans with HIV/AIDS. Prevention and intervention programs are needed.

  7. HIV-Protease Inhibitors Suppress Skeletal Muscle Fatty Acid Oxidation by Reducing CD36 and CPT-I Fatty Acid Transporters

    PubMed Central

    Richmond, Scott R.; Carper, Michael J.; Lei, Xiaoyong; Zhang, Sheng; Yarasheski, Kevin E.; Ramanadham, Sasanka

    2010-01-01

    Infection with human immunodeficiency virus (HIV) and treatment with HIV-protease inhibitor (PI)-based highly active antiretroviral therapies (HAART) is associated with dysregulated fatty acid and lipid metabolism. Enhanced lipolysis, increased circulating fatty acid levels, and hepatic and intramuscular lipid accumulation appear to contribute to insulin resistance in HIV-infected people treated with PI-based HAART. However, it is unclear whether currently prescribed HIV-PIs directly alter skeletal muscle fatty acid transport, oxidation, and storage. We find that ritonavir (r, 5 μmol/l) plus 20 μmol/l of atazanavir (ATV), lopinavir (LPV), or darunavir (DRV) reduce palmitate oxidation(16-21%) in differentiated C2C12 myotubes. Palmitate oxidation was increased following exposure to high fatty acid media but this effect was blunted when myotubes were pre-exposed to the HIV-PIs. However, LPV/r and DRV/r, but not ATV/r suppressed palmitate uptake into myotubes. We found no effect of the HIV-PIs on FATP1, FATP4, or FABPpm but both CD36/FAT and carnitine palmitoyltransferase I (CPTI) were reduced by all three regimens though ATV/r caused only a small decrease in CPT1, relative to LPV/r or DRV/r. In contrast, sterol regulatory element binding protein-1 was increased by all 3 HIV-PIs. These findings suggest that HIV-PIs suppress fatty acid oxidation in murine skeletal muscle cells and that this may be related to decreases in cytosolic- and mitochondrial-associated fatty acid transporters. HIV-PIs may also directly impair fatty acid handling and partitioning in skeletal muscle, and this may contribute to the cluster of metabolic complications that occur in people living with HIV. PMID:20117238

  8. Altered relationship of plasma triglycerides to HDL cholesterol in patients with HIV/HAART-associated dyslipidemia: further evidence for a unique form of Metabolic Syndrome in HIV patients

    PubMed Central

    Vu, Catherine N.; Ruiz-Esponda, Raul; Yang, Eric; Chang, Evelyn; Gillard, Baiba; Pownall, Henry J.; Hoogeveen, Ron C.; Coraza, Ivonne; Balasubramanyam, Ashok

    2013-01-01

    Introduction Plasma triglycerides (TG) and HDL-C are inversely related in Metabolic Syndrome (MetS), due to exchange of VLDL-TG for HDL-cholesteryl esters catalyzed by cholesteryl ester transfer protein (CETP). We investigated the relationship of TG to HDL-C in highly-active antiretroviral drug (HAART)-treated HIV patients. Methods Fasting plasma TG and HDL-C levels were compared in 179 hypertriglyceridemic HIV/HAART patients and 71 HIV-negative persons (31 normotriglyceridemic (NL) and 40 hypertriglyceridemic due to type IV hyperlipidemia (HTG)). CETP mass and activity were compared in 19 NL and 87 HIV/HAART subjects. Results Among the three groups, a plot of HDL-C vs. TG gave similar slopes but significantly different y-intercepts (9.24 ± 0.45, 8.16 ± 0.54, 6.70 ± 0.65, sqrt(HDL-C) for NL, HIV and HTG respectively; P<0.001); this difference persisted after adjusting HDL-C for TG, age, BMI, gender, glucose, CD4 count, viral load and HAART strata (7.18 ± 0.20, 6.20 ± 0.05 and 4.55 ± 0.15 sqrt(HDL-C) for NL, HIV and HTG, respectively, P <0.001). CETP activity was not different between NL and HIV, but CETP mass was significantly higher in HIV (1.47 ± 0.53 compared to 0.93 ± 0.27 μg/mL, P<0.0001), hence CETP specific activity was lower in HIV (22.67 ± 13.46 compared to 28.46 ± 8.24 nmol/μg/h, P=0.001). Conclusions Dyslipidemic HIV/HAART patients have a distinctive HDL-C plasma concentration adjusted for TG. The weak inverse relationship between HDL-C and TG is not explained by altered total CETP activity; it could result from a non-CETP-dependent mechanism or a decrease in CETP function due to inhibitors of CETP activity in HIV patients’ plasma. PMID:23522788

  9. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry

    2015-01-01

    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  10. Discovery of MK-8831, A Novel Spiro-Proline Macrocycle as a Pan-Genotypic HCV-NS3/4a Protease Inhibitor

    PubMed Central

    2015-01-01

    We have been focused on identifying a structurally different next generation inhibitor to MK-5172 (our Ns3/4a protease inhibitor currently under regulatory review), which would achieve superior pangenotypic activity with acceptable safety and pharmacokinetic profile. These efforts have led to the discovery of a novel class of HCV NS3/4a protease inhibitors containing a unique spirocyclic-proline structural motif. The design strategy involved a molecular-modeling based approach, and the optimization efforts on the series to obtain pan-genotypic coverage with good exposures on oral dosing. One of the key elements in this effort was the spirocyclization of the P2 quinoline group, which rigidified and constrained the binding conformation to provide a novel core. A second focus of the team was also to improve the activity against genotype 3a and the key mutant variants of genotype 1b. The rational application of structural chemistry with molecular modeling guided the design and optimization of the structure–activity relationships have resulted in the identification of the clinical candidate MK-8831 with excellent pan-genotypic activity and safety profile. PMID:26819676

  11. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central

    2011-01-01

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  12. Comparative study on the protease inhibitors from fish eggs

    NASA Astrophysics Data System (ADS)

    Ustadi; Kim, K. Y.; Kim, S. M.

    2005-07-01

    The protease inhibitor was purified from five different fish eggs. The molecular weights of Pacific herring, chum salmon, pond smelt, glassfish, and Alaska pollock egg protease inhibitors were 120, 89, 84.5, 17, and l6.8kDa, respectively. The specific inhibitory activity of glassfish egg protease inhibitor was the highest followed by those of Pacific herring and Alaska pollock in order. The specific inhibitory activity and purity of glassfish egg protease inhibitor were 19.70 Umg-1 protein and 164.70 folds of purification, respectively. Glassfish egg protease inhibitor was reasonably stable at 50-65°C and pH 8, which was more stable at high temperature and pH than protease inhibitors from the other fish species. Glassfish egg protease inhibitor was noncompetitive with inhibitor constant ( K i) of 4.44 nmolL-1.

  13. Reversible Cysteine Protease Inhibitors Show Promise for a Chagas Disease Cure

    PubMed Central

    Beaulieu, Christian; Black, W. Cameron; Isabel, Elise; Vasquez-Camargo, Fabio; Nath-Chowdhury, Milli; Massé, Frédéric; Mellon, Christophe; Methot, Nathalie

    2014-01-01

    The cysteine protease cruzipain is essential for the viability, infectivity, and virulence of Trypanosoma cruzi, the causative agent of Chagas disease. Thus, inhibitors of cruzipain are considered promising anti-T. cruzi chemotherapeutic agents. Reversible cruzipain inhibitors containing a nitrile “warhead” were prepared and demonstrated 50% inhibitory concentrations (IC50s) as potent as 1 nM in baculovirus-generated cruzipain enzyme assays. In epimastigote and intracellular amastigote in vitro assays, the most potent compounds demonstrated antiparasitic behavior in the 5 to 10 μM IC50 range; however, trypomastigote production from the amastigote form was ∼90 to 95% inhibited at 2 μM. Two key compounds, Cz007 and Cz008, with IC50s of 1.1 and 1.8 nM, respectively, against the recombinant enzyme were tested in a murine model of acute T. cruzi infection, with oral dosing in chow for 28 days at doses from 3 to 50 mg/kg of body weight. At 3 mg/kg of Cz007 and 3 mg/kg of Cz008, the blood parasitemia areas under the concentration-time curves were 16% and 25% of the untreated group, respectively. At sacrifice, 24 days after immunosuppression with cyclophosphamide, parasite presence in blood, heart, and esophagus was evaluated. Based on negative quantitative PCR results in all three tissues, cure rates in surviving animals were 90% for Cz007 at 3 mg/kg, 78% for Cz008 at 3 mg/kg, and 71% for benznidazole, the control compound, at 50 mg/kg. PMID:24323474

  14. Management of protease inhibitor-associated hyperlipidemia.

    PubMed

    Penzak, Scott R; Chuck, Susan K

    2002-01-01

    Dyslipidemia, characterized by elevated serum levels of triglycerides and reduced levels of total cholesterol, low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol, has been recognized in patients with human immunodeficiency virus (HIV) infection. It is thought that elevated levels of circulating cytokines, such as tumor necrosis factor-alpha and interferon-alpha, may alter lipid metabolism in patients with HIV infection. Protease inhibitors, such as saquinavir, indinavir and ritonavir, have been found to decrease mortality and improve quality of life in patients with HIV infection. However, these drugs have been associated with a syndrome of fat redistribution, insulin resistance, and hyperlipidemia. Elevations in serum total cholesterol and triglyceride levels, along with dyslipidemia that typically occurs in patients with HIV infection, may predispose patients to complications such as premature atherosclerosis and pancreatitis. It has been estimated that hypercholesterolemia and hypertriglyceridemia occur in greater than 50% of protease inhibitor recipients after 2 years of therapy, and that the risk of developing hyperlipidemia increases with the duration of treatment with protease inhibitors. In general, treatment of hyperlipidemia should follow National Cholesterol Education Program guidelines; efforts should be made to modify/control coronary heart disease risk factors (i.e. smoking; hypertension; diabetes mellitus) and maximize lifestyle modifications, primarily dietary intervention and exercise, in these patients. Where indicated, treatment usually consists of either pravastatin or atorvastatin for patients with elevated serum levels of LDL-C and/or total cholesterol. Atorvastatin is more potent in lowering serum total cholesterol and triglycerides compared with other hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, but it is also associated with more drug interactions compared with pravastatin. Simvastatin

  15. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-01-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  16. Enteropeptidase, a type II transmembrane serine protease.

    PubMed

    Zheng, X Long; Kitamoto, Yasunori; Sadler, J Evan

    2009-06-01

    Enteropeptidase, a type II transmembrane serine protease, is localized to the brush border of the duodenal and jejunal mucosa. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. Trypsin, in turn, activates other digestive zymogens such as chymotrypsinogen, proelastase, procarboxypeptidase and prolipase in the lumen of the gut. The important biological function of enteropeptidase is highlighted by the manifestation of severe diarrhea, failure to thrive, hypoproteinemia and edema as a result of congenital deficiency of enteropeptidase activity in the gut. Conversely, duodenopancreatic reflux of proteolytically active enteropeptidase may cause acute and chronic pancreatitis.

  17. Functional interplay between tetraspanins and proteases.

    PubMed

    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos

    2011-10-01

    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  18. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  19. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  20. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  1. Extracellular proteases from eight psychrotolerant Antarctic strains.

    PubMed

    Vazquez, Susana C; Coria, Silvia H; MacCormack, Walter P

    2004-01-01

    Extracellular proteases from 8 Antarctic psychrotolerant Pseudomonas sp. strains were purified and characterised. All of them are neutral metalloproteases, have an apparent molecular mass of 45kDa, optimal activity at 40 degrees C and pH 7-9, retaining significant activity at pH 5-11. With the exception of P96-18, which is less stable, all retain more than 50% activity after 3 h of incubation at pH 5-9 and show low thermal stability (their half-life times range from 20 to 60 min at 40 degrees C and less than 5 min at 50 degrees C). These proteases can be used in commercial processes carried out at neutral pH and moderate temperatures, and are of special interest for their application in mixtures of enzymes where final thermal selective inactivation is needed. Results also highlight the relevance of Antarctic biotopes for the isolation of protease-producing enzymes active at low temperatures.

  2. Corruption of Innate Immunity by Bacterial Proteases

    PubMed Central

    Potempa, Jan; Pike, Robert N.

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host’s innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections. PMID:19756242

  3. Effect of lanthanides on Porphyromonas gingivalis proteases.

    PubMed

    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T

    2010-01-01

    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  4. Corruption of innate immunity by bacterial proteases.

    PubMed

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  5. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  6. Structural determinants of tobacco vein mottling virus protease substrate specificity.

    PubMed

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-11-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1' position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k(cat) and K(m) for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  7. Structural determinants of tobacco vein mottling virus protease substrate specificity

    SciTech Connect

    Sun, Ping; Austin, Brian P.; Tozer, Jozsef; Waugh, David

    2010-10-28

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-{angstrom} resolution. As observed in several crystal structures of TEV protease, the C-terminus ({approx}20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by {approx}10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1{prime} position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k{sub cat} and K{sub m} for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  8. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.

    2000-01-01

    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  9. Evolution of Framingham cardiovascular risk score in HIV-infected patients initiating EFV- and LPV/r-based HAART in a Latin American cohort

    PubMed Central

    Cecchini, Diego; Ines Mattioli, Maria; Cassetti, Julia; Chan, Debora; Cassetti, Isabel

    2014-01-01

    Introduction Epidemiological studies suggest that some antiretroviral drugs may contribute to increase cardiovascular risk in HIV-infected patients. However, data from Latin American countries are limited, as impact of HAART on cardiovascular risk remains understudied. In this context, we aimed to evaluate if 10-year Framingham Cardiovascular Risk Score (FCRS) increases in patients following exposure to EFV- and LPV/r-based HAART in a Latin American cohort. Materials and Methods Retrospective 48-week cohort study. We reviewed clinical charts of randomly selected samples of patients initiating (according to national guidelines) EFV first-line HAART and LPV/r first- or second-line (but first PI-based) HAART assisted at a reference HIV centre in Buenos Aires, Argentina (period 2004–2012). Each patient could only be included in one arm. FCRS was calculated according to National Institutes of Health risk assessment tool (http://cvdrisk.nhlbi.nih.gov/). Results A total of 357 patients were included: 249 in EFV arm and 108 in LPV/r arm (80 as first line and 28 as second line, but first PI-based HAART). Baseline characteristics (median, interquartile range): age, 38 (33–45) years; male, 247 (69%); viral load, 98200 (20550–306000) copies/mL; CD4 T-cell count, 115 (60–175) cel/µL; total cholesterol, 159 (135–194) mg/dL; HDL: 39 (31–41) mg/dL; LDL: 94 (72–123) mg/dL; current smoker, 29%; on antihypertensive drugs: 14 (4%), diabetic: 4 (1%). Most frequent accompanying nucleoside reverse transcriptase inhibitors (NRTIs) were 3TC (92%) and zidovudine (AZT; 76%). Baseline FCRS was low, moderate and high for 93%, 7% and 0% of patients on EFV arm and 96.7%, 1.7% and 1.7% on LPV/r arm. On EFV arm, an increase in FCRS category (low to moderate or moderate to high) was observed in 1 patient (0.9%) at 24 weeks and 6 (5,6%) at 48 weeks; 5 (4.7%) decreased category. On LPV/r arm no one varied FCRS category at 24 weeks and 2 (3.4%) increased from low to moderate at 48 weeks

  10. Persistence of Pathological Distribution of NK Cells in HIV-Infected Patients with Prolonged Use of HAART and a Sustained Immune Response

    PubMed Central

    Frias, Mario; Rivero-Juarez, Antonio; Gordon, Ana; Camacho, Angela; Cantisan, Sara; Cuenca-Lopez, Francisca; Torre-Cisneros, Julian; Peña, Jose; Rivero, Antonio

    2015-01-01

    Objective A prospective analysis of the distribution of NK subsets and natural cytotoxicity receptors (NKp30/NKp46) in HIV patients with long-term HAART use and sustained virological and immunological response. Methods The main inclusion criteria were: at least 3 years’ receipt of HAART; current CD4+ count ≥ 500 cells/mm3; undetectable viral load for at least 24 months; no hepatotropic virus co-infection. Percentages of CD56dim, CD56bright NK cells and CD56neg CD16+ cells were obtained. Expression of the NCRs, NKp30 and NKp46 was analysed in CD56+ cells. Thirty-nine infected patients and sixteen healthy donors were included in the study. Results The percentages of total CD56+ and CD56dim NK cells were significantly lower in HIV-infected patients than in healthy donors (70.4 vs. 50.3 and 80.9 vs. 66.1 respectively). The percentage of total CD56+ NK cells expressing NCR receptors was lower in HIV patients than in healthy donors (NKp30: 25.20 vs. 58.63; NKp46: 24.8 vs. 50.59). This was also observed for CD56dim and CD56bright NK cells. Length of time with undetectable HIV viral load was identified as an independent factor associated with higher expression of NKp30 and NKp46. Conclusion Despite the prolonged and effective use of HAART, HIV-infected patients do not fully reconstitute the distribution of NK cells. Length of time with an undetectable viral load was related to greater recovery of NKp30/NKp46 receptors. PMID:25811634

  11. Prevalence of Hypertension and Its Associated Risk Factors among 34,111 HAART Naïve HIV-Infected Adults in Dar es Salaam, Tanzania

    PubMed Central

    Aveika, Akum; Spiegelman, Donna; Hawkins, Claudia; Armstrong, Catharina; Liu, Enju; Okuma, James; Chalamila, Guerino; Kaaya, Sylvia; Mugusi, Ferdinand; Fawzi, Wafaie

    2016-01-01

    Background. Elevated blood pressure has been reported among treatment naïve HIV-infected patients. We investigated prevalence of hypertension and its associated risk factors in a HAART naïve HIV-infected population in Dar es Salaam, Tanzania. Methods. A cross-sectional analysis was conducted among HAART naïve HIV-infected patients. Hypertension was defined as systolic blood pressure (SBP) ≥ 140 mmHg and/or diastolic blood pressure (DBP) ≥ 90 mmHg. Overweight and obesity were defined as body mass index (BMI) between 25.0–29.9 kg/m2 and ≥30 kg/m2, respectively. We used relative risks to examine factors associated with hypertension. Results. Prevalence of hypertension was found to be 12.5%. After adjusting for possible confounders, risk of hypertension was 10% more in male than female patients. Patients aged ≥50 years had more than 2-fold increased risk for hypertension compared to 30–39-years-old patients. Overweight and obesity were associated with 51% and 94% increased risk for hypertension compared to normal weight patients. Low CD4+ T-cell count, advanced WHO clinical disease stage, and history of TB were associated with 10%, 42%, and 14% decreased risk for hypertension. Conclusions. Older age, male gender, and overweight/obesity were associated with hypertension. Immune suppression and history of TB were associated with lower risk for hypertension. HIV treatment programs should screen and manage hypertension even in HAART naïve individuals. PMID:27872756

  12. Candida species from oral cavity of HIV-infected children exhibit reduced virulence factors in the HAART era.

    PubMed

    Portela, Maristela Barbosa; Lima de Amorim, Elaine; Santos, Adrielle Mangabeira; Alexandre da Rocha Curvelo, José; de Oliveira Martins, Karol; Capillé, Cauli Lima; Maria de Araújo Soares, Rosangela; Barbosa de Araújo Castro, Gloria Fernanda

    2017-01-01

    This study aimed to assess, in vitro, the biofilm viability and the phospholipase and protease production of Candida spp. from the saliva of HIV infected children and healthy controls, and to correlate the results with the use of medical data. A total of 79 isolates were analyzed: 48 Candida albicans isolates (33/15) and 20 Candida parapsilosis sensu lato complex isolates (12/8) (from HIV/control patients, respectively), and 8 Candida krusei, 1 Candida tropicalis, 1 Candida dubliniensis and 1 Candida guilliermondii from HIV patients. The XTT (2, 3-bis (2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-Carboxanilide) reduction assay analyzed the biofilm viability. Phospholipase and protease assays were performed using the egg yolk and Bovine Serum Albumin agar plate methods, respectively. All isolates were able to form biofilm with cell viability. Quantitatively, Candida isolates from both groups presented a similar ability to form biofilm (p > 0.05). The biofilm viability activity was higher in C. albicans isolates than in non-albicans Candida isolates (p < 0.05) for both groups. Phospholipase activity was detected in 32 isolates (40.5%) and it was significantly higher in the HIV group (p = 0.006). Protease activity was detected in 66 isolates (84.8%) and most of them were relatively/very strong producers. No statistical association with medical data was found in the HIV group. Although Candida spp. isolates from HIV-positive children presented higher phospholipase production, in vitro they exhibited reduced virulence factors compared to isolates from healthy individuals. This finding may enlighten the role played by immunosuppression in the modulation of Candida virulence attributes.

  13. Effect of Nadir CD4+ T Cell Count on Clinical Measures of Periodontal Disease in HIV+ Adults before and during Immune Reconstitution on HAART

    PubMed Central

    Vernon, Lance T.; Demko, Catherine A.; Babineau, Denise C.; Wang, Xuelei; Toossi, Zahra; Weinberg, Aaron; Rodriguez, Benigno

    2013-01-01

    Background The contribution of HIV-infection to periodontal disease (PD) is poorly understood.  We proposed that immunological markers would be associated with improved clinical measures of PD. Methods We performed a longitudinal cohort study of HIV-infected adults who had started highly active antiretroviral therapy (HAART) <2 years. PD was characterized clinically as the percent of teeth with ≥1 site with periodontal probing depth (PPD) ≥5.0mm, recession (REC) >0mm, clinical attachment level (CAL) ≥4.0mm, and bleeding on probing (BOP) at ≥4 sites/tooth and microbiologically as specific periodontopathogen concentration. Linear mixed-effects models were used to assess the associations between immune function and PD. Results Forty (40) subjects with median 2.7 months on HAART and median nadir CD4+ T-cell count of 212 cells/μl completed a median 3 visits. Over 24 months, CD4+ T-cell count increased by a mean 173 cells/µl (p<0.001) and HIV RNA decreased by 0.5 log10 copies/ml (p<0.001); concurrently, PPD, CAL and BOP decreased by a mean 11.7%, 12.1%, and 14.7% respectively (all p<0.001). Lower nadir CD4+ T-cell count was associated with worse baseline REC (-6.72%; p=0.04) and CAL (9.06%; p<0.001). Further, lower nadir CD4+ T-cell count was associated with a greater relative longitudinal improvement in PPD in subjects with higher baseline levels of Porphyromonas gingivalis (p=0.027), and BOP in subjects with higher baseline levels of Porphyromonas gingivalis or Treponema denticola (p=0.001 and p=0.006 respectively). Longitudinal changes from baseline in CD4+ T-cell count and level of HIV RNA were not independently associated with longitudinal changes in any clinical markers of PD. Conclusion Degree of immunosuppression was associated with baseline gingival recession. After HAART initiation, measures of active PD improved most in those with lower nadir CD4+ T-cell counts and higher baseline levels of specific periodontopathogens. Nadir CD4+ T-cell count

  14. Cystatins, serpins and other families of protease inhibitors in plants.

    PubMed

    Volpicella, Mariateresa; Leoni, Claudia; Costanza, Alessandra; De Leo, Francesca; Gallerani, Raffaele; Ceci, Luigi R

    2011-08-01

    Plant protease inhibitors (PIs) are generally small proteins present in high concentrations in storage tissues (tubers and seeds), and to a lower level in leaves. Even if most of them are active against serine and cysteine proteases, PIs active against aspartic proteases and carboxypeptidases have also been identified. Inhibitors of serine proteases are further classifiable in several families on the basis of their structural features. They comprise the families known as Bowman-Birk, Kunitz, Potato I and Potato II, which are the subject of review articles included in this special issue. In the present article we aim to give an overview of other families of plant PIs, active either against serine proteases or other class of proteases, describing their distribution, activity and main structural characteristics.

  15. Diversity of both the cultivable protease-producing bacteria and bacterial extracellular proteases in the coastal sediments of King George Island, Antarctica.

    PubMed

    Zhou, Ming-Yang; Wang, Guang-Long; Li, Dan; Zhao, Dian-Li; Qin, Qi-Long; Chen, Xiu-Lan; Chen, Bo; Zhou, Bai-Cheng; Zhang, Xi-Ying; Zhang, Yu-Zhong

    2013-01-01

    Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5) cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%), Flavobacterium (21.0%) and Lacinutrix (16.2%). Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.

  16. Economic Methods of Ginger Protease'sextraction and Purification

    NASA Astrophysics Data System (ADS)

    Qiao, Yuanyuan; Tong, Junfeng; Wei, Siqing; Du, Xinyong; Tang, Xiaozhen

    This article reports the ginger protease extraction and purification methods from fresh ginger rhizome. As to ginger protease extraction, we adapt the steps of organic solvent dissolving, ammonium sulfate depositing and freeze-drying, and this method can attain crude enzyme powder 0.6% weight of fresh ginger rhizome. The purification part in this study includes two steps: cellulose ion exchange (DEAE-52) and SP-Sephadex 50 chromatography, which can purify crude ginger protease through ion and molecular weight differences respectively.

  17. Engineering Environmentally-Stable Proteases to Specifically Neutralize Protein Toxins

    DTIC Science & Technology

    2013-10-01

    agents , such as Soman and Sarin . 2. Linkage to binding molecules Conjugating an antibody (or any other binding module) with an initiating protease...to develop the tools and principles necessary to engineer subtilisin proteases which specifically target and deactivate biological warfare agent (BWA...warfare agent (BWA) toxins. We have engineered and evolved subtilisin proteases to specifically target and deactivate BoNT, SEB, ricin, and B

  18. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  19. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed Central

    Suleman, Louise

    2016-01-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes. PMID:27785379

  20. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae

    2011-09-01

    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  1. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed

    Suleman, Louise

    2016-10-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes.

  2. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  3. Reversible Unfolding of Rhomboid Intramembrane Proteases

    PubMed Central

    Panigrahi, Rashmi; Arutyunova, Elena; Panwar, Pankaj; Gimpl, Katharina; Keller, Sandro; Lemieux, M. Joanne

    2016-01-01

    Denaturant-induced unfolding of helical membrane proteins provides insights into their mechanism of folding and domain organization, which take place in the chemically heterogeneous, anisotropic environment of a lipid membrane. Rhomboid proteases are intramembrane proteases that play key roles in various diseases. Crystal structures have revealed a compact helical bundle with a buried active site, which requires conformational changes for the cleavage of transmembrane substrates. A dimeric form of the rhomboid protease has been shown to be important for activity. In this study, we examine the mechanism of refolding for two distinct rhomboids to gain insight into their secondary structure-activity relationships. Although helicity is largely abolished in the unfolded states of both proteins, unfolding is completely reversible for HiGlpG but only partially reversible for PsAarA. Refolding of both proteins results in reassociation of the dimer, with a 90% regain of catalytic activity for HiGlpG but only a 70% regain for PsAarA. For both proteins, a broad, gradual transition from the native, folded state to the denatured, partly unfolded state was revealed with the aid of circular dichroism spectroscopy as a function of denaturant concentration, thus arguing against a classical two-state model as found for many globular soluble proteins. Thermal denaturation has irreversible destabilizing effects on both proteins, yet reveals important functional details regarding substrate accessibility to the buried active site. This concerted biophysical and functional analysis demonstrates that HiGlpG, with a simple six-transmembrane-segment organization, is more robust than PsAarA, which has seven predicted transmembrane segments, thus rendering HiGlpG amenable to in vitro studies of membrane-protein folding. PMID:27028647

  4. Multiple Proteases to Localize Oxidation Sites

    PubMed Central

    Gu, Liqing; Robinson, Renã A. S.

    2015-01-01

    Proteins present in cellular environments with high levels of reactive oxygen and nitrogen species and/or low levels of antioxidants are highly susceptible to oxidative post-translational modification (PTM). Irreversible oxidative PTMs can generate a complex distribution of modified protein molecules, recently termed as proteoforms. Using ubiquitin as a model system, we mapped oxidative modification sites using trypsin, Lys-C, and Glu-C peptides. Several M+16 Da proteoforms were detected as well as proteoforms that include other previously unidentified oxidative modifications. This work highlights the use of multiple protease digestions to give insights to the complexity of oxidative modifications possible in bottom-up analyses. PMID:25775238

  5. Rapid Release of Protease Inhibitors from Soybeans

    PubMed Central

    Hwang, David L.; Yang, Wen-Kuang; Foard, Donald E.; Lin, K.-T. -Davis

    1978-01-01

    Specific antisera were prepared against the Bowman-Birk trypsin inhibitor and four other trypsin inhibitors of low molecular weight isolated from soybeans (Glycine max L. cv. Tracy). These antisera were used to detect the presence and amount of the inhibitors in: (a) seeds and protein extracts of soybean meal; (b) seedlings; and (c) the water surrounding the seeds and roots of seedlings. Lectin activities in seeds, seedlings, and water were also determined at the same time as the protease inhibitor activities. By competitive inhibition of immunoprecipitation, the combined five low molecular weight protease inhibitors were found to constitute the following percentages of proteins (w/w): 6.3% in defatted soybean meal; 8.1% of the protein extracted from the meal by a buffer of pH 8.6; 8.3, 14.7, 15.2, 16.1, 17.2, and 18.9% of the protein in a lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, respectively; 8.2% in a lyophilisate of water in which roots of seedlings grew for 20 days; 1.5% in cotyledons; and less than 0.1% in epicotyls, hypocotyls, and roots of 12-day-old seedlings. Hemagglutination activities, expressed as the lowest amount of protein required to give a positive agglutination of 0.2 ml of 2% rabbit red blood cells, were as follows: purified soybean lectin, 0.08 μg; lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, 10, 2.5, 5, 5, and 2.5 μg, respectively; lyophilisate of water in which roots grew for 20 days, 5 μg; 12-day-old cotyledons, roots, epicotyls, and hypocotyls, 12.5, 100, >1,000, and >500 μg, respectively. The results indicate that a large amount of protease inhibitors as well as lectins are released from seeds during the first 8 hours of imbibition. Neither lima bean trypsin inhibitor (mol wt, 10,000) nor Kunitz soybean trypsin inhibitor (mol wt, 21,500) showed competitive inhibition in tests with antisera against low molecular weight soybean protease inhibitors

  6. A Phase I Randomized Therapeutic MVA-B Vaccination Improves the Magnitude and Quality of the T Cell Immune Responses in HIV-1-Infected Subjects on HAART

    PubMed Central

    Gómez, Carmen Elena; Perdiguero, Beatriz; García-Arriaza, Juan; Cepeda, Victoria; Sánchez-Sorzano, Carlos Óscar; Mothe, Beatriz; Jiménez, José Luis; Muñoz-Fernández, María Ángeles; Gatell, Jose M.; López Bernaldo de Quirós, Juan Carlos; Brander, Christian; García, Felipe; Esteban, Mariano

    2015-01-01

    Trial Design Previous studies suggested that poxvirus-based vaccines might be instrumental in the therapeutic HIV field. A phase I clinical trial was conducted in HIV-1-infected patients on highly active antiretroviral therapy (HAART), with CD4 T cell counts above 450 cells/mm3 and undetectable viremia. Thirty participants were randomized (2:1) to receive either 3 intramuscular injections of MVA-B vaccine (coding for clade B HIV-1 Env, Gag, Pol and Nef antigens) or placebo, followed by interruption of HAART. Methods The magnitude, breadth, quality and phenotype of the HIV-1-specific T cell response were assayed by intracellular cytokine staining (ICS) in 22 volunteers pre- and post-vaccination. Results MVA-B vaccine induced newly detected HIV-1-specific CD4 T cell responses and expanded pre-existing responses (mostly against Gag, Pol and Nef antigens) that were high in magnitude, broadly directed and showed an enhanced polyfunctionality with a T effector memory (TEM) phenotype, while maintaining the magnitude and quality of the pre-existing HIV-1-specific CD8 T cell responses. In addition, vaccination also triggered preferential CD8+ T cell polyfunctional responses to the MVA vector antigens that increase in magnitude after two and three booster doses. Conclusion MVA-B vaccination represents a feasible strategy to improve T cell responses in individuals with pre-existing HIV-1-specific immunity. Trial Registration ClinicalTrials.gov NCT01571466 PMID:26544853

  7. Distinctive in vitro effects of T-cell growth cytokines on cytomegalovirus-stimulated T-cell responses of HIV-infected HAART recipients

    SciTech Connect

    Patterson, Julie; Jesser, Renee; Weinberg, Adriana

    2008-08-15

    Functional immune reconstitution is limited after HAART, maintaining the interest in adjunctive immune-modulators. We compared in vitro the effects of the {gamma}-chain T-cell growth cytokines IL-2, IL-4, IL-7 and IL-15 on cytomegalovirus-stimulated cell-mediated immunity. IL-2 and IL-15 increased cytomegalovirus-specific lymphocyte proliferation in HAART recipients, whereas IL-4 and IL-7 did not. The boosting effect of IL-2 and IL-15 on proliferation correlated with their ability to prevent late apoptosis. However, IL-2 increased the frequency of cells in early apoptosis, whereas IL-15 increased the frequency of fully viable cells. Both IL-2 and IL-15 increased cytomegalovirus-induced CD4{sup +} and CD8{sup +} T-cell proliferation and the synthesis of Th1 and pro-inflammatory cytokines and chemokines. However, only IL-2 increased the frequency of regulatory T cells and Th2 cytokine production, both of which have the potential to attenuate antiviral immune responses. Overall, compared to other {gamma}-chain cytokines, IL-15 had the most favorable profile for boosting antiviral cell-mediated immunity.

  8. Increased activity of unlinked Zika virus NS2B/NS3 protease compared to linked Zika virus protease.

    PubMed

    Kuiper, Benjamin D; Slater, Kristin; Spellmon, Nicholas; Holcomb, Joshua; Medapureddy, Prasanna; Muzzarelli, Kendall M; Yang, Zhe; Ovadia, Reuben; Amblard, Franck; Kovari, Iulia A; Schinazi, Raymond F; Kovari, Ladislau C

    2017-03-22

    Zika virus (ZIKV) is a flavivirus spread by daytime-active Aedes spp. mosquitoes such as A. aegypti and A. albopictus. Previously thought to be a mild infection, the latest ZIKV outbreak in the Americas is causally associated with more severe symptoms as well as severe birth defects, such as microcephaly. Currently no vaccine or antiviral exists. However, recent progress has demonstrated the viral NS2B/NS3 protease may be a suitable target for the development of small-molecule antiviral agents. To better understand the ZIKV protease, we expressed, purified, and characterized unlinked and linked NS2B/NS3 protease corresponding to an isolate from the recent outbreak in Puerto Rico. Unlinked ZIKV protease is more active and binds substrate with greater affinity than linked ZIKV protease. Therefore, we propose that unlinked ZIKV protease be used when evaluating or designing ZIKV protease inhibitors. Additionally, potent inhibitors of related viral proteases, like West Nile Virus and Dengue virus, may serve as advanced starting points to identify and develop ZIKV protease inhibitors.

  9. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-06-30

    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  10. Regulated proteolysis by cortical granule serine protease 1 at fertilization.

    PubMed

    Haley, Sheila A; Wessel, Gary M

    2004-05-01

    Cortical granules are specialized organelles whose contents interact with the extracellular matrix of the fertilized egg to form the block to polyspermy. In sea urchins, the granule contents form a fertilization envelope (FE), and this construction is critically dependent upon protease activity. An autocatalytic serine protease, cortical granule serine protease 1 (CGSP1), has been identified in the cortical granules of Strongylocentrotus purpuratus eggs, and here we examined the regulation of the protease activity and tested potential target substrates of CGSP1. We found that CGSP1 is stored in its full-length, enzymatically quiescent form in the granule, and is inactive at pH 6.5 or below. We determined the pH of the cortical granule by fluorescent indicators and micro-pH probe measurements and found the granules to be pH 5.5, a condition inhibitory to CGSP1 activity. Exposure of the protease to the pH of seawater (pH 8.0) at exocytosis immediately activates the protease. Activation of eggs at pH 6.5 or lower blocks activation of the protease and the resultant FE phenotypes are indistinguishable from a protease-null phenotype. We find that native cortical granule targets of the protease are beta-1,3 glucanase, ovoperoxidase, and the protease itself, but the structural proteins of the granule are not proteolyzed by CGSP1. Whole mount immunolocalization experiments demonstrate that inhibition of CGSP1 activity affects the localization of ovoperoxidase but does not alter targeting of structural proteins to the FE. The mistargeting of ovoperoxidase may lead to spurious peroxidative cross-linking activity and contribute to the lethality observed in protease-null cells. Thus, CGSP1 is proteolytically active only when secreted, due to the low pH of the cortical granules, and it has a small population of targets for cleavage within the cortical granules.

  11. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum

    PubMed Central

    Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5–75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases. PMID:28060882

  12. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum.

    PubMed

    Han, Zhiping; Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5-75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases.

  13. Structural determinants of MALT1 protease activity.

    PubMed

    Wiesmann, Christian; Leder, Lukas; Blank, Jutta; Bernardi, Anna; Melkko, Samu; Decock, Arnaud; D'Arcy, Allan; Villard, Frederic; Erbel, Paulus; Hughes, Nicola; Freuler, Felix; Nikolay, Rainer; Alves, Juliano; Bornancin, Frederic; Renatus, Martin

    2012-05-25

    The formation of the CBM (CARD11-BCL10-MALT1) complex is pivotal for antigen-receptor-mediated activation of the transcription factor NF-κB. Signaling is dependent on MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1), which not only acts as a scaffolding protein but also possesses proteolytic activity mediated by its caspase-like domain. It remained unclear how the CBM activates MALT1. Here, we provide biochemical and structural evidence that MALT1 activation is dependent on its dimerization and show that mutations at the dimer interface abrogate activity in cells. The unliganded protease presents itself in a dimeric yet inactive state and undergoes substantial conformational changes upon substrate binding. These structural changes also affect the conformation of the C-terminal Ig-like domain, a domain that is required for MALT1 activity. Binding to the active site is coupled to a relative movement of caspase and Ig-like domains. MALT1 binding partners thus may have the potential of tuning MALT1 protease activity without binding directly to the caspase domain.

  14. Effect of proteases on the. beta. -thromboglobulin radioimmunoassay

    SciTech Connect

    Donlon, J.A.; Helgeson, E.A.; Donlon, M.A.

    1985-02-11

    Rat peritoneal mast cells and mast cell granules were evaluated by radioimmunoassay for the presence of ..beta..-thromboglobulin and platelet factor 4. The initial assays indicated that a ..beta..-thromboglobulin cross reacting material was released from mast cells by compound 48/80 in a similar dose-dependent manner as histamine release. The material was also found to be associated with purified granules. However, the use of protease inhibitors in the buffers completely abolished the positive assays. Further evaluation of the effects of various proteases on the ..beta..-thromboglobulin assay indicated that elastase would also generate a false positive assay which could then be neutralized by the use of ..cap alpha../sub 1/-antitrypsin as a protease inhibitor. There was no protease effect on the platelet factor 4 radioimmunoassay which always showed no detectable amounts with mast cells, granules or proteases. These results clearly indicate the artifactual positive assays which can arise when using certain radioimmunoassay tests in the presence of cell proteases. The use of protease inhibitors is a necessary control when applying a radioimmunoassay to a system with potentially active proteases. 24 references, 2 figures, 4 tables.

  15. Serine protease activities in Leishmania (Leishmania) chagasi promastigotes.

    PubMed

    da Silva-López, Raquel Elisa; dos Santos, Tatiana Resende; Morgado-Díaz, José Andrés; Tanaka, Marcelo Neves; de Simone, Salvatore Giovanni

    2010-10-01

    The present work reports the isolation, biochemical characterization, and subcellular location of serine proteases from aqueous, detergent soluble, and culture supernatant of Leishmania chagasi promastigote extracts, respectively, LCSII, LCSI, and LCSIII. The active enzyme molecular masses of LCSII were about 105, 66, and 60 kDa; of LCSI, 60 and 58 kDa; and of LCSIII, approximately 76 and 68 kDa. Optimal pH for the enzymes was 7.0 for LCSI and LCSIII and 8.5 for LCSII, and the optimal temperature for all enzymes was 37°C, using α-N-ρ-tosyl-L: -arginine methyl ester as substrate. Assay of thermal stability indicated that LCSIII is the more stable enzyme. Hemoglobin, bovine serum albumin, and ovalbumin were hydrolyzed by LCSII and LCSI but not by LCSIII. Inhibition studies suggested that enzymes belong to the serine protease class modulated by divalent cations. Rabbit antiserum against 56-kDa serine protease of Leishmania amazonensis identified proteins in all extracts of L. chagasi. Furthermore, immunocytochemistry demonstrated that serine proteases are located in flagellar pocket region and cytoplasmic vesicles of L. chagasi promastigotes. These findings indicate that L. chagasi serine proteases differ from L. amazonensis proteases and all known flagellate proteases, but display some similarities with serine proteases from other Leishmania species, suggesting a conservation of this enzymatic activity in the genus.

  16. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  17. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.

    PubMed

    Panigrahi, Rashmi; Lemieux, M Joanne

    2015-01-01

    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  18. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma

    2006-07-01

    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  19. Poliovirus protease 3C(pro) kills cells by apoptosis.

    PubMed

    Barco, A; Feduchi, E; Carrasco, L

    2000-01-20

    The tetracycline-based Tet-Off expression system has been used to analyze the effects of poliovirus protease 3C(pro) on human cells. Stable HeLa cell clones that express this poliovirus protease under the control of an inducible, tightly regulated promoter were obtained. Tetracycline removal induces synthesis of 3C protease, followed by drastic morphological alterations and cellular death. Degradation of cellular DNA in nucleosomes and generation of apoptotic bodies are observed from the second day after 3C(pro) induction. The cleavage of poly(ADP-ribose) polymerase, an enzyme involved in DNA repair, occurs after induction of 3C(pro), indicating caspase activation by this poliovirus protease. The 3C(pro)-induced apoptosis is blocked by the caspase inhibitor z-VAD-fmk. Our findings suggest that the protease 3C is responsible for triggering apoptosis in poliovirus-infected cells by a mechanism that involves caspase activation.

  20. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin

    2005-07-01

    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  1. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1988-10-16

    Tenebria molitor MIDGUT PROTEASES; LOCUST CAECAL PROTEASES; BOWMAN-BIRK TRYPSIN-CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN...and Kunitz (STI) from soybeans, CI from chickpeas , chicken ovomucoid and turkey ovomucoid. It was Jnactivated by phenylemthvsulfonyl fluoride (PMSF...soybeans and Cl from chickpeas , by chicken ovomucoid and turkey overmucoid, as well as by the Kunitz (STI) soybean trypsin inhibitor that hardly

  2. Mapping chemical structure-activity information of HAART-drug cocktails over complex networks of AIDS epidemiology and socioeconomic data of U.S. counties.

    PubMed

    Herrera-Ibatá, Diana María; Pazos, Alejandro; Orbegozo-Medina, Ricardo Alfredo; Romero-Durán, Francisco Javier; González-Díaz, Humberto

    2015-06-01

    Using computational algorithms to design tailored drug cocktails for highly active antiretroviral therapy (HAART) on specific populations is a goal of major importance for both pharmaceutical industry and public health policy institutions. New combinations of compounds need to be predicted in order to design HAART cocktails. On the one hand, there are the biomolecular factors related to the drugs in the cocktail (experimental measure, chemical structure, drug target, assay organisms, etc.); on the other hand, there are the socioeconomic factors of the specific population (income inequalities, employment levels, fiscal pressure, education, migration, population structure, etc.) to study the relationship between the socioeconomic status and the disease. In this context, machine learning algorithms, able to seek models for problems with multi-source data, have to be used. In this work, the first artificial neural network (ANN) model is proposed for the prediction of HAART cocktails, to halt AIDS on epidemic networks of U.S. counties using information indices that codify both biomolecular and several socioeconomic factors. The data was obtained from at least three major sources. The first dataset included assays of anti-HIV chemical compounds released to ChEMBL. The second dataset is the AIDSVu database of Emory University. AIDSVu compiled AIDS prevalence for >2300 U.S. counties. The third data set included socioeconomic data from the U.S. Census Bureau. Three scales or levels were employed to group the counties according to the location or population structure codes: state, rural urban continuum code (RUCC) and urban influence code (UIC). An analysis of >130,000 pairs (network links) was performed, corresponding to AIDS prevalence in 2310 counties in U.S. vs. drug cocktails made up of combinations of ChEMBL results for 21,582 unique drugs, 9 viral or human protein targets, 4856 protocols, and 10 possible experimental measures. The best model found with the original

  3. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  4. Novel pseudosymmetric inhibitors of HIV-1 protease

    SciTech Connect

    Faessler, A.; Roesel, J.; Gruetter, M.; Tintelnot-Blomley, M.; Alteri, E.; Bold, G.; Lang, M.

    1993-12-31

    Taking into account the unique C-2 symmetric nature of the HIV-1 protease homodimer, the authors have designed and synthesized novel inhibitors featuring an almost symmetric structure. Compounds containing the easily accessible Phe[CH(OH)CH{sub 2}N(NH)]Cha dipeptide isostere as a nonhydrolyzable replacement of the scissile amide bond of the natural substrate are potent inhibitors in vitro with IC{sub 50} values of 9 to 50 nM. The antiviral activity depends mainly on the nature of the anylated valine residues linked to the dipeptide mimic. In this series, CGP 53820 combines both high potency and excellent specificity. Its predicted symmetric binding pattern is illustrated by the X-ray structure analysis performed with the corresponding enzyme-inhibitor complex.

  5. Highly potent fibrinolytic serine protease from Streptomyces.

    PubMed

    Uesugi, Yoshiko; Usuki, Hirokazu; Iwabuchi, Masaki; Hatanaka, Tadashi

    2011-01-05

    We introduce a highly potent fibrinolytic serine protease from Streptomyces omiyaensis (SOT), which belongs to the trypsin family. The fibrinolytic activity of SOT was examined using in vitro assays and was compared with those of known fibrinolytic enzymes such as plasmin, tissue-type plasminogen activator (t-PA), urokinase, and nattokinase. Compared to other enzymes, SOT showed remarkably higher hydrolytic activity toward mimic peptides of fibrin and plasminogen. The fibrinolytic activity of SOT is about 18-fold higher than that of plasmin, and is comparable to that of t-PA by fibrin plate assays. Furthermore, SOT had some plasminogen activator-like activity. Results show that SOT and nattokinase have very different fibrinolytic and fibrinogenolytic modes, engendering significant synergetic effects of SOT and nattokinase on fibrinolysis. These results suggest that SOT presents important possibilities for application in the therapy of thrombosis.

  6. Effects of detergents on the West Nile virus protease activity.

    PubMed

    Ezgimen, Manolya D; Mueller, Niklaus H; Teramoto, Tadahisa; Padmanabhan, R

    2009-05-01

    Detergents such as Triton X-100 are often used in drug discovery research to weed out small molecule promiscuous and non-specific inhibitors which act by aggregation in solution and undesirable precipitation in aqueous assay buffers. We evaluated the effects of commonly used detergents, Triton X-100, Tween-20, Nonidet-40 (NP-40), Brij-35, and CHAPS, on the enzymatic activity of West Nile virus (WNV) protease. Unexpectedly, Triton X-100, Tween-20, and NP-40 showed an enhancement of in vitro WNV protease activity from 2 to 2.5-fold depending on the detergent and its concentration. On the other hand, Brij-35, at 0.001% enhanced the protease activity by 1.5-fold and CHAPS had the least enhancing effect. The kinetic analysis showed that the increase in protease activity by Triton X-100 was dose-dependent. Furthermore, at Triton X-100 and Tween-20 concentrations higher than 0.001%, the inhibition of compound B, one of the lead compounds against WNV protease identified in a high throughput screen (IC(50) value of 5.7+/-2.5 microM), was reversed. However, in the presence of CHAPS, compound B still showed good inhibition of WNV protease. Our results, taken together, indicate that nonionic detergents, Triton X-100, Tween, and NP-40 are unsuitable for the purpose of discrimination of true versus promiscuous inhibitors of WNV protease in high throughput assays.

  7. Exploring a new serine protease from Cucumis sativus L.

    PubMed

    Nafeesa, Zohara; Shivalingu, B R; Vivek, H K; Priya, B S; Swamy, S Nanjunda

    2015-03-01

    Coagulation is an important physiological process in hemostasis which is activated by sequential action of proteases. This study aims to understand the involvement of aqueous fruit extract of Cucumis sativus L. (AqFEC) European burp less variety in blood coagulation cascade. AqFEC hydrolyzed casein in a dose-dependent manner. The presence of protease activity was further confirmed by casein zymography which revealed the possible presence of two high molecular weight protease(s). The proteolytic activity was inhibited only by phenyl methyl sulphonyl fluoride suggesting the presence of serine protease(s). In a dose-dependent manner, AqFEC also hydrolysed Aα and Bβ subunits of fibrinogen, whereas it failed to degrade the γ subunit of fibrinogen even at a concentration as high as 100 μg and incubation time up to 4 h. AqFEC reduced the clotting time of citrated plasma by 87.65%. The protease and fibrinogenolytic activity of AqFEC suggests its possible role in stopping the bleeding and ensuing wound healing process.

  8. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  9. Screening and characterization of protease producing actinomycetes from marine saltern.

    PubMed

    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva

    2014-10-01

    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries.

  10. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.

    PubMed

    Hughes, Valerie S; Page, Kristen

    2007-01-01

    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  11. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.

    PubMed

    Banik, Rathindra Mohan; Prakash, Monika

    2004-01-01

    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  12. Rabbit endogenous retrovirus-H encodes a functional protease.

    PubMed

    Voisset, Cécile; Myers, Richard E; Carne, Alex; Kellam, Paul; Griffiths, David J

    2003-01-01

    Recent studies have revealed that 'human retrovirus-5' sequences found in human samples belong to a rabbit endogenous retrovirus family named RERV-H. A part of the gag-pro region of the RERV-H genome was amplified by PCR from DNA in human samples and several forms of RERV-H protease were expressed in bacteria. The RERV-H protease was able to cleave itself from a precursor protein and was also able to cleave the RERV-H Gag polyprotein precursor in vitro whereas a form of the protease with a mutation engineered into the active site was inactive. Potential N- and C-terminal autocleavage sites were characterized. The RERV-H protease was sensitive to pepstatin A, showing it to be an aspartic protease. Moreover, it was strongly inhibited by PYVPheStaAMT, a pseudopeptide inhibitor specific for Mason-Pfizer monkey virus and avian myeloblastosis-associated virus. A structural model of the RERV-H protease was constructed that, together with the activity data, confirms that this is a retroviral aspartic protease.

  13. The CCL3L1-CCR5 genotype influences the development of AIDS, but not HIV susceptibility or the response to HAART

    SciTech Connect

    Bhattacharya, Tanmoy; Stanton, Jennifer; Kim, Eun - Young; Kunstman, Kevin; Phair, John; Jacobson, Lisa P; Wolinsky, Steven M

    2008-01-01

    A selective advantage against infectious diseases such as HIV/AIDS is associated with differences in the genes relevant to immunity and virus replication. The CC chemokine receptor 5 (CCR5), the principal coreceptor for HIV, and its chemokine ligands, including CCL3L1, influences the CD4+ target cells susceptibility to infection. The CCL3L1 gene is in a region of segmental duplication on the q-arm of human chromosome 17. Increased numbers of CCL3L1 gene copies that affect the gene expression phenotype might have substantial protective effects. Here we show that the population-specific CCL3L1 gene copy number and the CCR5 {Delta}32 protein-inactivating deletion that categorizes the CCL3L1-CCR5 genotype do not influence HIV/AIDS susceptibility or the robustness of immune recovery after the initiation of highly active antiretroviral therapy (HAART).

  14. Incidence of Non-AIDS-Defining Malignancies in HIV-Infected Vs. Non-Infected Patients in the HAART Era: Impact of Immunosuppression

    PubMed Central

    Bedimo, Roger J.; McGinnis, Kathleen A.; Dunlap, Melinda; Rodriguez-Barradas, Maria C.; Justice, Amy C.

    2009-01-01

    Background The incidence of non-AIDS-defining malignancies (non-ADM) is reported as unchanged or increasing in the HAART era. Whether incidence of non-ADM is significantly higher in HIV-infected than in HIV-uninfected patients remains unclear. Methods Incidence rates of malignancies were calculated in a cohort of veterans in care for HIV-infected and age, race, and gender-matched uninfected patients from 1997 to 2004. For HIV-infected patients CD4 counts closest to first observation date were compared between those with and without cancer. Results 33,420 HIV-infected and 66,840 HIV-uninfected patients were followed for a median of 5.1 and 6.4 years. The Incidence rate ratio [IRR] of HIV-infected to HIV-uninfected was 1.6 (1260 vs. 841/100,000 person-years; 95% CI: 1.5–1.7). IRR for individual cancers was highest for anal cancer (14.9; CI: 10.1–22.1). Among HIV-infected patients, median CD4 counts were lower for those with non-ADM (249 vs. 270, p=0.02), anal cancer (154 vs. 270; p<0.001), and Hodgkin’s (217 vs. 270; p=0.03). Prostate cancer was associated with a higher CD4 count (310 vs. 270; p<0.001). Conclusions In the HAART era, the incidence of non-ADMs is higher among HIV-infected than HIV-uninfected patients, adjusting for age, race, and gender. Some non-ADMs do not appear to be associated with significantly lower CD4 counts. PMID:19617846

  15. Vγ9Vδ2 T-Cell Polyfunctionality Is Differently Modulated in HAART-Treated HIV Patients according to CD4 T-Cell Count

    PubMed Central

    Casetti, Rita; De Simone, Gabriele; Sacchi, Alessandra; Rinaldi, Alessandra; Viola, Domenico; Agrati, Chiara; Bordoni, Veronica; Cimini, Eleonora; Tumino, Nicola; Besi, Francesca; Martini, Federico

    2015-01-01

    Alteration of γδ T-cell distribution and function in peripheral blood is among the earliest defects during HIV-infection. We asked whether the polyfunctional response could also be affected, and how this impairment could be associated to CD4 T-cell count. To this aim, we performed a cross-sectional study on HIV-infected individuals. In order to evaluate the polyfunctional-Vγ9Vδ2 T-cell response after phosphoantigen-stimulation, we assessed the cytokine/chemokine production and cytotoxicity by flow-cytometry in HAART-treated-HIV+ persons and healthy-donors. During HIV-infection Vγ9Vδ2-polyfunctional response quality is affected, since several Vγ9Vδ2 T-cell subsets resulted significantly lower in HIV+ patients in respect to healthy donors. Interestingly, we found a weak positive correlation between Vγ9Vδ2 T-cell-response and CD4 T-cell counts. By dividing the HIV+ patients according to CD4 T-cell count, we found that Low-CD4 patients expressed a lower number of two Vγ9Vδ2 T-cell subsets expressing MIP-1β in different combinations with other molecules (CD107a/IFNγ) in respect to High-CD4 individuals. Our results show that the Vγ9Vδ2 T-cell-response quality in Low-CD4 patients is specifically affected, suggesting a direct link between innate Vγ9Vδ2 T-cells and CD4 T-cell count. These findings suggest that Vγ9Vδ2 T-cell quality may be indirectly influenced by HAART therapy and could be included in a new therapeutical strategy which would perform an important role in fighting HIV infection. PMID:26161861

  16. Vγ9Vδ2 T-Cell Polyfunctionality Is Differently Modulated in HAART-Treated HIV Patients according to CD4 T-Cell Count.

    PubMed

    Casetti, Rita; De Simone, Gabriele; Sacchi, Alessandra; Rinaldi, Alessandra; Viola, Domenico; Agrati, Chiara; Bordoni, Veronica; Cimini, Eleonora; Tumino, Nicola; Besi, Francesca; Martini, Federico

    2015-01-01

    Alteration of γδ T-cell distribution and function in peripheral blood is among the earliest defects during HIV-infection. We asked whether the polyfunctional response could also be affected, and how this impairment could be associated to CD4 T-cell count. To this aim, we performed a cross-sectional study on HIV-infected individuals. In order to evaluate the polyfunctional-Vγ9Vδ2 T-cell response after phosphoantigen-stimulation, we assessed the cytokine/chemokine production and cytotoxicity by flow-cytometry in HAART-treated-HIV+ persons and healthy-donors. During HIV-infection Vγ9Vδ2-polyfunctional response quality is affected, since several Vγ9Vδ2 T-cell subsets resulted significantly lower in HIV+ patients in respect to healthy donors. Interestingly, we found a weak positive correlation between Vγ9Vδ2 T-cell-response and CD4 T-cell counts. By dividing the HIV+ patients according to CD4 T-cell count, we found that Low-CD4 patients expressed a lower number of two Vγ9Vδ2 T-cell subsets expressing MIP-1β in different combinations with other molecules (CD107a/IFNγ) in respect to High-CD4 individuals. Our results show that the Vγ9Vδ2 T-cell-response quality in Low-CD4 patients is specifically affected, suggesting a direct link between innate Vγ9Vδ2 T-cells and CD4 T-cell count. These findings suggest that Vγ9Vδ2 T-cell quality may be indirectly influenced by HAART therapy and could be included in a new therapeutical strategy which would perform an important role in fighting HIV infection.

  17. Characterization of the protease activity of detergents: laboratory practicals for studying the protease profile and activity of various commercial detergents.

    PubMed

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-07-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body fluids, and food soils. This article describes two easy and cheap laboratory exercises to study the presence, profile, and basic enzymology of detergent proteases. These laboratory practicals are based on the determination of the detergent protease activity of various commercial detergents using the N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide method and the bovine serum albumin degradation capacity. Students are also required to elucidate the enzymatic subtype of detergent proteases by studying the inhibitory potential of several types of protease inhibitors revealed by the same experimental methodology. Additionally, the results of the exercises can be used to provide additional insights on elementary enzymology by studying the influence of several important parameters on protease activity such as temperature (in this article) and the influence of pH and effects of surfactants and oxidizers (proposed). Students also develop laboratory skills, problem-solving capacities, and the ability to write a laboratory report. The exercises are mainly designed for an advanced undergraduate project in the biochemistry and biotechnology sciences. Globally, these laboratory practicals show students the biotechnological applications of proteases in the detergent industry and also reinforce important enzymology concepts.

  18. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Mixed carbohydrase and protease enzyme product... Substances Affirmed as GRAS § 184.1027 Mixed carbohydrase and protease enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes carbohydrase and protease...

  19. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  20. Potent Antiviral HIV-1 Protease Inhibitor GRL-02031 Adapts to the Structures of Drug Resistant Mutants with Its P1;#8242;-Pyrrolidinone Ring

    SciTech Connect

    Chang, Yu-Chung E.; Yu, XiaXia; Zhang, Ying; Tie, Yunfeng; Wang, Yuan-Fang; Yashchuk, Sofiya; Ghosh, Arun K.; Harrison, Robert W.; Weber, Irene T.

    2012-11-14

    GRL-02031 (1) is an HIV-1 protease (PR) inhibitor containing a novel P1' (R)-aminomethyl-2-pyrrolidinone group. Crystal structures at resolutions of 1.25-1.55 {angstrom} were analyzed for complexes of 1 with the PR containing major drug resistant mutations, PR{sub I47V}, PR{sub L76V}, PR{sub V82A}, and PR{sub N88D}. Mutations of I47V and V82A alter residues in the inhibitor-binding site, while L76V and N88D are distal mutations having no direct contact with the inhibitor. Substitution of a smaller amino acid in PR{sub I47V} and PR{sub L76V} and the altered charge of PR{sub N88D} are associated with significant local structural changes compared to the wild-type PR{sub WT}, while substitution of alanine in PR{sub V82A} increases the size of the S1' subsite. The P1' pyrrolidinone group of 1 accommodates to these local changes by assuming two different conformations. Overall, the conformation and interactions of 1 with PR mutants resemble those of PR{sub WT} with similar inhibition constants in good agreement with the antiviral potency on multidrug resistant HIV-1.

  1. The role of proteases in regulating Eph/ephrin signaling

    PubMed Central

    Atapattu, Lakmali; Lackmann, Martin; Janes, Peter W

    2014-01-01

    Proteases regulate a myriad of cell functions, both in normal and disease states. In addition to protein turnover, they regulate a range of signaling processes, including those mediated by Eph receptors and their ephrin ligands. A variety of proteases is reported to directly cleave Ephs and/or ephrins under different conditions, to promote receptor and/or ligand shedding, and regulate receptor/ligand internalisation and signaling. They also cleave other adhesion proteins in response to Eph-ephrin interactions, to indirectly facilitate Eph-mediated functions. Proteases thus contribute to Eph/ephrin mediated changes in cell-cell and cell-matrix interactions, in cell morphology and in cell migration and invasion, in a manner which appears to be tightly regulated by, and co-ordinated with, Eph signaling. This review summarizes the current literature describing the function and regulation of protease activities during Eph/ephrin-mediated cell signaling. PMID:25482632

  2. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.

    2016-01-01

    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  3. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan

    2014-01-01

    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  4. Photoactivated Spatiotemporally-Responsive Nanosensors of in Vivo Protease Activity.

    PubMed

    Dudani, Jaideep S; Jain, Piyush K; Kwong, Gabriel A; Stevens, Kelly R; Bhatia, Sangeeta N

    2015-12-22

    Proteases play diverse and important roles in physiology and disease, including influencing critical processes in development, immune responses, and malignancies. Both the abundance and activity of these enzymes are tightly regulated and highly contextual; thus, in order to elucidate their specific impact on disease progression, better tools are needed to precisely monitor in situ protease activity. Current strategies for detecting protease activity are focused on functionalizing synthetic peptide substrates with reporters that emit detection signals following peptide cleavage. However, these activity-based probes lack the capacity to be turned on at sites of interest and, therefore, are subject to off-target activation. Here we report a strategy that uses light to precisely control both the location and time of activity-based sensing. We develop photocaged activity-based sensors by conjugating photolabile molecules directly onto peptide substrates, thereby blocking protease cleavage by steric hindrance. At sites of disease, exposure to ultraviolet light unveils the nanosensors to allow proteases to cleave and release a reporter fragment that can be detected remotely. We apply this spatiotemporally controlled system to probe secreted protease activity in vitro and tumor protease activity in vivo. In vitro, we demonstrate the ability to dynamically and spatially measure metalloproteinase activity in a 3D model of colorectal cancer. In vivo, veiled nanosensors are selectively activated at the primary tumor site in colorectal cancer xenografts to capture the tumor microenvironment-enriched protease activity. The ability to remotely control activity-based sensors may offer a valuable complement to existing tools for measuring biological activity.

  5. Effects of cultural conditions on protease production by Aeromonas hydrophila.

    PubMed Central

    O'Reilly, T; Day, D F

    1983-01-01

    Production of extracellular proteolytic activity by Aeromonas hydrophila was influenced by temperature, pH, and aeration. Conditions which produced maximal growth also resulted in maximal protease production. Enzyme production appeared to be modulated by an inducer catabolite repression system whereby NH4+ and glucose repressed enzyme production and complex nitrogen and nonglucose, carbon energy sources promoted it. Under nutritional stress, protease production was high, despite poor growth. PMID:6342534

  6. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  7. Factors Associated with Lack of Viral Suppression at Delivery among HAART-Naïve HIV-Positive Women in the International Maternal Pediatric Adolescent AIDS Clinical Trials Group (IMPAACT) P1025 Study

    PubMed Central

    Katz, Ingrid T.; Leister, Erin; Kacanek, Deborah; Hughes, Michael D.; Bardeguez, Arlene; Livingston, Elizabeth; Stek, Alice; Shapiro, David E.; Tuomala, Ruth

    2014-01-01

    Background High delivery maternal plasma HIV-1 RNA level (viral load, VL) is a risk factor for mother to child transmission and poor maternal health. Objective To identify factors associated with detectable VL at delivery despite initiation of highly active antiretroviral therapy (HAART) during pregnancy. Design Multicenter observational study. Setting 67 US AIDS clinical research sites. Patients HIV-1-positive pregnant women who initiated HAART during pregnancy. Measurements Descriptive summaries and associations between socio-demographic, HIV disease, treatment and pregnancy-related risk factors and detectable VL (>400copies/mL) at delivery. Results Between October 2002 and December 2011, 671 women met inclusion criteria and 13% had detectable VL at delivery. Factors associated with detectable VL included multiparity (16.4% vs 8% nulliparous, p=0.002), black non-Hispanic ethnicity (17.6% vs 6.6% Hispanic and 6.6% white/non-Hispanic, p<0.001), 11th grade or less education (17.6% vs.12.1% high school graduate and 6.7% some college or higher, p=0.013), and initiation of HAART in third trimester (23.9% vs 12.3% second and 8.6% first, p=0.002), timing of HIV diagnosis prior to current pregnancy (16.1% vs 11% during current pregnancy, p=0.051), and timing of first prenatal visit in 3rd trimester (33.3% vs 14.3% second and 10.5% first, p=0.002). Women who experienced treatment interruptions or reported poor medication adherence during pregnancy were more likely to have detectable VL at delivery than women with no interruptions or who reported better adherence. Limitations Women entered the study at varying times during pregnancy and for this and other reasons there was incomplete data on many covariates. Conclusions In this large U.S.-based cohort of HIV-1 positive women, 13% of women who initiated HAART during pregnancy had detectable VL at delivery. The timing of HAART initiation and prenatal care along with medication adherence during pregnancy appear to be

  8. The roles of intramembrane proteases in protozoan parasites.

    PubMed

    Sibley, L David

    2013-12-01

    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases.

  9. Insights into the Cyanobacterial Deg/HtrA Proteases

    PubMed Central

    Cheregi, Otilia; Wagner, Raik; Funk, Christiane

    2016-01-01

    Proteins are the main machinery for all living processes in a cell; they provide structural elements, regulate biochemical reactions as enzymes, and are the interface to the outside as receptors and transporters. Like any other machinery proteins have to be assembled correctly and need maintenance after damage, e.g., caused by changes in environmental conditions, genetic mutations, and limitations in the availability of cofactors. Proteases and chaperones help in repair, assembly, and folding of damaged and misfolded protein complexes cost-effective, with low energy investment compared with neo-synthesis. Despite their importance for viability, the specific biological role of most proteases in vivo is largely unknown. Deg/HtrA proteases, a family of serine-type ATP-independent proteases, have been shown in higher plants to be involved in the degradation of the Photosystem II reaction center protein D1. The objective of this review is to highlight the structure and function of their cyanobacterial orthologs. Homology modeling was used to find specific features of the SynDeg/HtrA proteases of Synechocystis sp. PCC 6803. Based on the available data concerning their location and their physiological substrates we conclude that these Deg proteases not only have important housekeeping and chaperone functions within the cell, but also are needed for remodeling the cell exterior. PMID:27252714

  10. Temporal dependence of cysteine protease activation following excitotoxic hippocampal injury.

    PubMed

    Berry, J N; Sharrett-Field, L J; Butler, T R; Prendergast, M A

    2012-10-11

    Excitotoxic insults can lead to intracellular signaling cascades that contribute to cell death, in part by activation of proteases, phospholipases, and endonucleases. Cysteine proteases, such as calpains, are calcium (Ca(2+))-activated enzymes which degrade cytoskeletal proteins, including microtubule-associated proteins, tubulin, and spectrin, among others. The current study used the organotypic hippocampal slice culture model to examine whether pharmacologic inhibition of cysteine protease activity inhibits N-methyl-D-aspartate- (NMDA-) induced excitotoxic (20 μM NMDA) cell death and changes in synaptophysin immunoreactivity. Significant NMDA-induced cytotoxicity (as measured by propidium iodide [PI] uptake) was found in the CA1 region of the hippocampus at all timepoints examined (24, 72, 120 h), an effect significantly attenuated by co-exposure to the selective NMDA receptor antagonist DL-2-Amino-5-phosphonopentanoic acid (APV), but not MDL-28170, a potent cysteine protease inhibitor. Results indicated sparing of NMDA-induced loss of the synaptic vesicular protein synaptophysin in all regions of the hippocampus by MDL-28170, though only at early timepoints after injury. These results suggest Ca(2+)-dependent recruitment of cysteine proteases within 24h of excitotoxic insult, but activation of alternative cellular degrading mechanisms after 24h. Further, these data suggest that synaptophysin may be a substrate for calpains and related proteases.

  11. Pnserpin: A Novel Serine Protease Inhibitor from Extremophile Pyrobaculum neutrophilum

    PubMed Central

    Zhang, Huan; Fei, Rui; Xue, Baigong; Yu, Shanshan; Zhang, Zuoming; Zhong, Sheng; Gao, Yuanqi; Zhou, Xiaoli

    2017-01-01

    Serine protease inhibitors (serpins) are native inhibitors of serine proteases, constituting a large protein family with members spread over eukaryotes and prokaryotes. However, only very few prokaryotic serpins, especially from extremophiles, have been characterized to date. In this study, Pnserpin, a putative serine protease inhibitor from the thermophile Pyrobaculum neutrophilum, was overexpressed in Escherichia coli for purification and characterization. It irreversibly inhibits chymotrypsin-, trypsin-, elastase-, and subtilisin-like proteases in a temperature range from 20 to 100 °C in a concentration-dependent manner. The stoichiometry of inhibition (SI) of Pnserpin for proteases decreases as the temperature increases, indicating that the inhibitory activity of Pnserpin increases with the temperature. SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) showed that Pnserpin inhibits proteases by forming a SDS-resistant covalent complex. Homology modeling and molecular dynamic simulations predicted that Pnserpin can form a stable common serpin fold. Results of the present work will help in understanding the structural and functional characteristics of thermophilic serpin and will broaden the current knowledge about serpins from extremophiles. PMID:28067849

  12. The Inflammatory Actions of Coagulant and Fibrinolytic Proteases in Disease

    PubMed Central

    Schuliga, Michael

    2015-01-01

    Aside from their role in hemostasis, coagulant and fibrinolytic proteases are important mediators of inflammation in diseases such as asthma, atherosclerosis, rheumatoid arthritis, and cancer. The blood circulating zymogens of these proteases enter damaged tissue as a consequence of vascular leak or rupture to become activated and contribute to extravascular coagulation or fibrinolysis. The coagulants, factor Xa (FXa), factor VIIa (FVIIa), tissue factor, and thrombin, also evoke cell-mediated actions on structural cells (e.g., fibroblasts and smooth muscle cells) or inflammatory cells (e.g., macrophages) via the proteolytic activation of protease-activated receptors (PARs). Plasmin, the principle enzymatic mediator of fibrinolysis, also forms toll-like receptor-4 (TLR-4) activating fibrin degradation products (FDPs) and can release latent-matrix bound growth factors such as transforming growth factor-β (TGF-β). Furthermore, the proteases that convert plasminogen into plasmin (e.g., urokinase plasminogen activator) evoke plasmin-independent proinflammatory actions involving coreceptor activation. Selectively targeting the receptor-mediated actions of hemostatic proteases is a strategy that may be used to treat inflammatory disease without the bleeding complications of conventional anticoagulant therapies. The mechanisms by which proteases of the coagulant and fibrinolytic systems contribute to extravascular inflammation in disease will be considered in this review. PMID:25878399

  13. The Crystal Structure of GXGD Membrane Protease FlaK

    SciTech Connect

    J Hu; Y Xue; S Lee; Y Ha

    2011-12-31

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  14. The crystal structure of GXGD membrane protease FlaK

    SciTech Connect

    Hu, Jian; Xue, Yi; Lee, Sangwon; Ha, Ya

    2011-09-20

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  15. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed

    Schauperl, Michael; Fuchs, Julian E; Waldner, Birgit J; Huber, Roland G; Kramer, Christian; Liedl, Klaus R

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4') with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design.

  16. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y

    2017-01-01

    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases.

  17. Protease inhibitors and proteolytic signalling cascades in insects.

    PubMed

    Gubb, David; Sanz-Parra, Arantza; Barcena, Laura; Troxler, Laurent; Fullaondo, Ane

    2010-12-01

    Proteolytic signalling cascades control a wide range of physiological responses. In order to respond rapidly, protease activity must be maintained at a basal level: the component zymogens must be sequentially activated and actively degraded. At the same time, signalling cascades must respond precisely: high target specificity is required. The insects have a wide range of trapping- and tight-binding protease inhibitors, which can regulate the activity of individual proteases. In addition, the interactions between component proteases of a signalling cascade can be modified by serine protease homologues. The suicide-inhibition mechanism of serpin family inhibitors gives rapid turnover of both protease and inhibitor, but target specificity is inherently broad. Similarly, the TEP/macroglobulins have extremely broad target specificity, which suits them for roles as hormone transport proteins and sensors of pathogenic virulence factors. The tight-binding inhibitors, on the other hand, have a lock-and-key mechanism capable of high target specificity. In addition, proteins containing multiple tight-binding inhibitory domains may act as scaffolds for the assembly of signalling complexes. Proteolytic cascades regulated by combinations of different types of inhibitor could combine the rapidity of suicide-inhibitors with the specificity lock-and-key inhibitors. This would allow precise control of physiological responses and may turn out to be a general rule.

  18. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed Central

    Schauperl, Michael; Fuchs, Julian E.; Waldner, Birgit J.; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4’) with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design. PMID:26559682

  19. Protease inhibitors from several classes work synergistically against Callosobruchus maculatus.

    PubMed

    Amirhusin, Bahagiawati; Shade, Richard E; Koiwa, Hisashi; Hasegawa, Paul M; Bressan, Ray A; Murdock, Larry L; Zhu-Salzman, Keyan

    2007-07-01

    Targeting multiple digestive proteases may be more effective in insect pest control than inhibition of a single enzyme class. We therefore explored possible interactions of three antimetabolic protease inhibitors fed to cowpea bruchids in artificial diets, using a recombinant soybean cysteine protease inhibitor scN, an aspartic protease inhibitor pepstatin A, and soybean Kunitz trypsin inhibitor KI. scN and pepstatin, inhibiting major digestive cysteine and aspartic proteases, respectively, significantly prolonged the developmental time of cowpea bruchids individually. When combined, the anti-insect effect was synergistic, i.e., the toxicity of the mixture was markedly greater than that of scN or pepstatin alone. KI alone did not impact insect development even at relatively high concentrations, but its anti-insect properties became apparent when acting jointly with scN or scN plus pepstatin. Incubating KI with bruchid midgut extract showed that it was partially degraded. This instability may explain its lack of anti-insect activity. However, this proteolytic degradation was inhibited by scN and/or pepstatin. Protection of KI from proteolysis in the insect digestive tract thus could be the basis for the synergistic effect. These observations support the concept that cowpea bruchid gut proteases play a dual role; digesting protein for nutrient needs and protecting insects by inactivating dietary proteins that may otherwise be toxic. Our results also suggest that transgenic resistance strategies that involve multigene products are likely to have enhanced efficacy and durability.

  20. 2-D zymographic analysis of Broccoli (Brassica oleracea L. var. Italica) florets proteases: follow up of cysteine protease isotypes in the course of post-harvest senescence.

    PubMed

    Rossano, Rocco; Larocca, Marilena; Riccio, Paolo

    2011-09-01

    Zymographic analysis of Broccoli florets (Brassica oleracea L. var. Italica) revealed the presence of acidic metallo-proteases, serine proteases and cysteine proteases. Under conditions which were denaturing for the other proteases, the study was restricted to cysteine proteases. 2-D zymography, a technique that combines IEF and zymography was used to show the presence of 11 different cysteine protease spots with molecular mass of 44 and 47-48kDa and pIs ranging between 4.1 and 4.7. pI differences could be ascribed to different degrees of phosphorylation that partly disappeared in the presence of alkaline phosphatase. Post-harvest senescence of Broccoli florets was characterized by decrease in protein and chlorophyll contents and increase of protease activity. In particular, as determined by 2-D zymography, the presence of cysteine protease clearly increased during senescence, a finding that may represent a useful tool for the control of the aging process.

  1. Dual origin of gut proteases in Formosan subterranean termites (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae).

    PubMed

    Sethi, Amit; Xue, Qing-Gang; La Peyre, Jerome F; Delatte, Jennifer; Husseneder, Claudia

    2011-07-01

    Cellulose digestion in lower termites, mediated by carbohydrases originating from both termite and endosymbionts, is well characterized. In contrast, limited information exists on gut proteases of lower termites, their origins and roles in termite nutrition. The objective of this study was to characterize gut proteases of the Formosan subterranean termite (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae). The protease activity of extracts from gut tissues (fore-, mid- and hindgut) and protozoa isolated from hindguts of termite workers was quantified using hide powder azure as a substrate and further characterized by zymography with gelatin SDS-PAGE. Midgut extracts showed the highest protease activity followed by the protozoa extracts. High level of protease activity was also detected in protozoa culture supernatants after 24 h incubation. Incubation of gut and protozoa extracts with class-specific protease inhibitors revealed that most of the proteases were serine proteases. All proteolytic bands identified after gelatin SDS-PAGE were also inhibited by serine protease inhibitors. Finally, incubation with chromogenic substrates indicated that extracts from fore- and hindgut tissues possessed proteases with almost exclusively trypsin-like activity while both midgut and protozoa extracts possessed proteases with trypsin-like and subtilisin/chymotrypsin-like activities. However, protozoa proteases were distinct from midgut proteases (with different molecular mass). Our results suggest that the Formosan subterranean termite not only produces endogenous proteases in its gut tissues, but also possesses proteases originating from its protozoan symbionts.

  2. Protease Production by Different Thermophilic Fungi

    NASA Astrophysics Data System (ADS)

    Macchione, Mariana M.; Merheb, Carolina W.; Gomes, Eleni; da Silva, Roberto

    A comparative study was carried out to evaluate protease production in solid-state fermentation (SSF) and submerged fermentation (SmF) by nine different thermophilic fungi — Thermoascus aurantiacus Miehe, Thermomyces lanuginosus, T. lanuginosus TO.03, Aspergillus flavus 1.2, Aspergillus sp. 13.33, Aspergillus sp. 13.34, Aspergillus sp. 13.35, Rhizomucor pusillus 13.36 and Rhizomucor sp. 13.37 — using substrates containing proteins to induce enzyme secretion. Soybean extract (soybean milk), soybean flour, milk powder, rice, and wheat bran were tested. The most satisfactory results were obtained when using wheat bran in SSF. The fungi that stood out in SSF were T. lanuginosus, T. lanuginosus TO.03, Aspergillus sp. 13.34, Aspergillus sp. 13.35, and Rhizomucor sp. 13.37, and those in SmF were T. aurantiacus, T. lanuginosus TO.03, and 13.37. In both fermentation systems, A. flavus 1.2 and R. pusillus 13.36 presented the lowest levels of proteolytic activity.

  3. German cockroach frass proteases modulate the innate immune response via activation of protease-activated receptor-2.

    PubMed

    Day, Scottie B; Zhou, Ping; Ledford, John R; Page, Kristen

    2010-01-01

    Allergen exposure can induce an early innate immune response; however, the mechanism by which this occurs has not been addressed. In this report, we demonstrate a role for the active serine proteases in German cockroach (GC) feces (frass) and protease-activated receptor (PAR)-2 in modulating the innate immune response. A single exposure of GC frass induced inflammatory cytokine production and cellular infiltration in the airways of mice. In comparison, exposure to protease-depleted GC frass resulted in diminution of inflammatory cytokine production and airway neutrophilia, but had no effect on macrophage infiltration. Selective activation of PAR-2 confirmed that PAR-2 was sufficient to induce airway inflammation. Exposure of GC frass to PAR-2-deficient mice led to decreased immune responses to GC frass compared to wild-type mice. Using the macrophage as an early marker of the innate immune response, we found that GC frass induced significant release of tumor necrosis factor-alpha from primary alveolar macrophages. This effect was dependent on the intrinsic proteases in GC frass. We confirmed GC frass-induced cytokine expression was mediated by activation of NF-kappaB and ERK in a macrophage cell line. Collectively, these data suggest a central role for GC frass protease-PAR-2 activation in regulating the innate immune response through the activation of alveolar macrophages. Understanding the potential role of protease-PAR-2 activation as a danger signal or adjuvant could yield attractive therapeutic targets.

  4. Protease induced plasticity: matrix metalloproteinase-1 promotes neurostructural changes through activation of protease activated receptor 1

    PubMed Central

    Allen, Megan; Ghosh, Suhasini; Ahern, Gerard P.; Villapol, Sonia; Maguire-Zeiss, Kathleen A.; Conant, Katherine

    2016-01-01

    Matrix metalloproteinases (MMPs) are a family of secreted endopeptidases expressed by neurons and glia. Regulated MMP activity contributes to physiological synaptic plasticity, while dysregulated activity can stimulate injury. Disentangling the role individual MMPs play in synaptic plasticity is difficult due to overlapping structure and function as well as cell-type specific expression. Here, we develop a novel system to investigate the selective overexpression of a single MMP driven by GFAP expressing cells in vivo. We show that MMP-1 induces cellular and behavioral phenotypes consistent with enhanced signaling through the G-protein coupled protease activated receptor 1 (PAR1). Application of exogenous MMP-1, in vitro, stimulates PAR1 dependent increases in intracellular Ca2+ concentration and dendritic arborization. Overexpression of MMP-1, in vivo, increases dendritic complexity and induces biochemical and behavioral endpoints consistent with increased GPCR signaling. These data are exciting because we demonstrate that an astrocyte-derived protease can influence neuronal plasticity through an extracellular matrix independent mechanism. PMID:27762280

  5. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.

    PubMed

    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal

    2016-08-09

    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  6. Lipid Peroxidation and Total Cholesterol in HAART-Naïve Patients Infected with Circulating Recombinant Forms of Human Immunodeficiency Virus Type-1 in Cameroon

    PubMed Central

    Teto, Georges; Kanmogne, Georgette D.; Torimiro, Judith N.; Alemnji, George; Nguemaim, Flore N.; Takou, Désiré; Nanfack, Aubin; Tazoacha, Asonganyi

    2013-01-01

    Background HIV infection has commonly been found to affect lipid profile and antioxidant defense. Objectives To determine the effects of Human Immunodeficiency Virus (HIV) infection and viral subtype on patient’s cholesterol and oxidative stress markers, and determine whether in the absence of Highly Active Antiretroviral Therapy (HAART), these biochemical parameters could be useful in patient’s management and monitoring disease progression in Cameroon. For this purpose, we measured total cholesterol (TC), LDL cholesterol (LDLC), HDL cholesterol (HDLC), total antioxidant ability (TAA), lipid peroxidation indices (LPI), and malondialdehyde (MDA) in HIV negative persons and HIV positive HAART-naïve patients infected with HIV-1 group M subtypes. Methods We measured serum TC, LDLC, HDLC, plasma MDA, and TAA concentrations, and calculated LPI indices in 151 HIV-positive HAART-naïve patients and 134 seronegative controls. We also performed gene sequence analysis on samples from 30 patients to determine the effect of viral genotypes on these biochemical parameters. We also determined the correlation between CD4 cell count and the above biochemical parameters. Results We obtained the following controls/patients values for TC (1.96±0.54/1. 12±0. 48 g/l), LDLC (0. 67±0. 46/0. 43±0. 36 g/l), HDLC (105. 51±28. 10/46. 54±23. 36 mg/dl) TAA (0. 63±0. 17/0. 16±0. 16 mM), MDA (0. 20±0. 07/0. 41±0. 10 µM) and LPI (0. 34±0. 14/26. 02±74. 40). In each case, the difference between the controls and patients was statistically significant (p<0.05). There was a positive and statistically significant Pearson correlation between CD4 cell count and HDLC (r = +0.272; p<0.01), TAA (r = +0.199; p<0.05) and a negative and statistically significant Pearson correlation between CD4 cell count and LPI (r = −0.166; p<0.05). Pearson correlation between CD4 cell count and TC, CD4cell count and LDLC was positive but not statistically significant while it was negative but

  7. Characterization of a chemostable serine alkaline protease from Periplaneta americana

    PubMed Central

    2013-01-01

    Background Proteases are important enzymes involved in numerous essential physiological processes and hold a strong potential for industrial applications. The proteolytic activity of insects’ gut is endowed by many isoforms with diverse properties and specificities. Thus, insect proteases can act as a tool in industrial processes. Results In the present study, purification and properties of a serine alkaline protease from Periplaneta americana and its potential application as an additive in various bio-formulations are reported. The enzyme was purified near to homogeneity by using acetone precipitation and Sephadex G-100 gel filtration chromatography. Enzyme activity was increased up to 4.2 fold after gel filtration chromatography. The purified enzyme appeared as single protein-band with a molecular mass of ~ 27.8 kDa in SDS-PAGE. The optimum pH and temperature for the proteolytic activity for purified protein were found around pH 8.0 and 60°C respectively. Complete inhibition of the purified enzyme by phenylmethylsulfonyl fluoride confirmed that the protease was of serine-type. The purified enzyme revealed high stability and compatibility towards detergents, oxidizing, reducing, and bleaching agents. In addition, enzyme also showed stability towards organic solvents and commercial detergents. Conclusion Several important properties of a serine protease from P. Americana were revealed. Moreover, insects can serve as excellent and alternative source of industrially important proteases with unique properties, which can be utilized as additives in detergents, stain removers and other bio-formulations. Properties of the P. americana protease accounted in the present investigation can be exploited further in various industrial processes. As an industrial prospective, identification of enzymes with varying essential properties from different insect species might be good approach and bioresource. PMID:24229392

  8. Kinetics of alkaline protease production by Streptomyces griseoflavus PTCC1130

    PubMed Central

    Hosseini, Seyed Vesal; Saffari, Zahra; Farhanghi, Ali; Atyabi, Seyed Mohammad; Norouzian, Dariush

    2016-01-01

    Background and Objectives: Proteases are a group of enzymes that catalyze the degradation of proteins resulting in the production of their amino acid constituents. They are the most important group of industrial enzymes which account for about 60% of total enzymes in the market and produced mainly by microorganisms. The attempts were made to study the kinetic parameters of protease produced by Streptomyces griseoflavus PTCC1130. Materials and Methods: Streptomyces griseoflavus PTCC1130 was grown on casein agar. Different media such as BM1, BM2, BM3 and BM4 were prepared. Data obtained from growth and protease production were subjected to kinetics evaluation. Casein was used as substrate for protease activity and the released soluble peptide bearing aromatic amino acid were quantified by Folin Cioclateaue reagent. Protein content of the enzyme and the sugar utilized by the organism were estimated by Bradford and Miller’s methods respectively. Results: Basal Medium named as BM1, BM2, BM3 and BM4(50 mL in 250 mL Erlen Meyer flasks) were screened out to evaluate protease production by Streptomyces griseoflavus PTCC1130. They were inoculated with known amount of seed culture and kept on rotary shaker. To obtain the specific growth rate, wet weight of biomass was plotted against the time. The clarified supernatant was used for the analysis of protease by measuring the soluble peptide containing aromatic amino acid residues employing Folin Cioclateaue reagent. Our results showed that maximum level of enzyme production (14035 U/L) was occurred at late exponential phase using Basal Medium supplemented with zinc sulfate (0.5g/L), casein (10g/L) at pH 6.5. Conclusions: A kinetic study of protease production by Streptomyces griseoflavus PTCC1130 provided highly quantitative information regarding the behavior of a system, which is essential to study the fermentation process. Exploitation of such kinetics analysis would be useful in commercialization of microbial enzyme

  9. Protease increases fermentation rate and ethanol yield in dry-grind ethanol production.

    PubMed

    Johnston, David B; McAloon, Andrew J

    2014-02-01

    The effects of acid protease and urea addition during the fermentation step were evaluated. The fermentations were also tested with and without the addition of urea to determine if protease altered the nitrogen requirements of the yeast. Results show that the addition of the protease had a statistically significant effect on the fermentation rate and yield. Fermentation rates and yields were improved with the addition of the protease over the corresponding controls without protease. Protease addition either with or with added urea resulted in a higher final ethanol yield than without the protease addition. Urea addition levels >1200 ppm of supplemental nitrogen inhibited ethanol production. The economic effects of the protease addition were evaluated by using process engineering and economic models developed at the Eastern Regional Research Center. The decrease in overall processing costs from protease addition was as high as $0.01/L (4 ¢/gal) of denatured ethanol produced.

  10. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.

    PubMed

    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R

    2013-01-01

    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  11. The structure of a universally employed enzyme: V8 protease from Staphylococcus aureus

    SciTech Connect

    Prasad, Lata; Leduc, Yvonne; Hayakawa, Koto; Delbaere, Louis T.J.

    2008-06-27

    V8 protease, an extracellular protease of Staphylococcus aureus, is related to the pancreatic serine proteases. The enzyme cleaves peptide bonds exclusively on the carbonyl side of aspartate and glutamate residues. Unlike the pancreatic serine proteases, V8 protease possesses no disulfide bridges. This is a major evolutionary difference, as all pancreatic proteases have at least two disulfide bridges. The structure of V8 protease shows structural similarity with several other serine proteases, specifically the epidermolytic toxins A and B from S. aureus and trypsin, in which the conformation of the active site is almost identical. V8 protease is also unique in that the positively charged N-terminus is involved in determining the substrate-specificity of the enzyme.

  12. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases.

    PubMed

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang; Chen, Xiu-Lan

    2015-09-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed.

  13. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases

    PubMed Central

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang

    2015-01-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed. PMID:26150451

  14. HIV-1 protease-induced apoptosis

    PubMed Central

    2014-01-01

    Background Apoptosis is one of the presumptive causes of CD4+ T cell depletion during HIV infection and progression to AIDS. However, the precise role of HIV-1 in this process remains unexplained. HIV-1 protease (PR) has been suggested as a possible factor, but a direct link between HIV-1 PR enzymatic activity and apoptosis has not been established. Results Here, we show that expression of active HIV-1 PR induces death in HeLa and HEK-293 cells via the mitochondrial apoptotic pathway. This conclusion is based on in vivo observations of the direct localization of HIV-1 PR in mitochondria, a key player in triggering apoptosis. Moreover, we observed an HIV-1 PR concentration-dependent decrease in mitochondrial membrane potential and the role of HIV-1 PR in activation of caspase 9, PARP cleavage and DNA fragmentation. In addition, in vitro data demonstrated that HIV-1 PR mediates cleavage of mitochondrial proteins Tom22, VDAC and ANT, leading to release of AIF and Hsp60 proteins. By using yeast two-hybrid screening, we also identified a new HIV-1 PR interaction partner, breast carcinoma-associated protein 3 (BCA3). We found that BCA3 accelerates p53 transcriptional activity on the bax promoter, thus elevating the cellular level of pro-apoptotic Bax protein. Conclusion In summary, our results describe the involvement of HIV-1 PR in apoptosis, which is caused either by a direct effect of HIV-1 PR on mitochondrial membrane integrity or by its interaction with cellular protein BCA3. PMID:24886575

  15. Protease inhibitor from Moringa oleifera with potential for use as therapeutic drug and as seafood preservative

    PubMed Central

    Bijina, B.; Chellappan, Sreeja; Krishna, Jissa G.; Basheer, Soorej M.; Elyas, K.K.; Bahkali, Ali H.; Chandrasekaran, M.

    2011-01-01

    Protease inhibitors are well known to have several applications in medicine and biotechnology. Several plant sources are known to return potential protease inhibitors. In this study plants belonging to different families of Leguminosae, Malvaceae, Rutaceae, Graminae and Moringaceae were screened for the protease inhibitor. Among them Moringa oleifera, belonging to the family Moringaceae, recorded high level of protease inhibitor activity after ammonium sulfate fractionation. M. oleifera, which grows throughout most of the tropics and having several industrial and medicinal uses, was selected as a source of protease inhibitor since so far no reports were made on isolation of the protease inhibitor. Among the different parts of M. oleifera tested, the crude extract isolated from the mature leaves and seeds showed the highest level of inhibition against trypsin. Among the various extraction media evaluated, the crude extract prepared in phosphate buffer showed maximum recovery of the protease inhibitor. The protease inhibitor recorded high inhibitory activity toward the serine proteases thrombin, elastase, chymotrypsin and the cysteine proteases cathepsin B and papain which have more importance in pharmaceutical industry. The protease inhibitor also showed complete inhibition of activities of the commercially available proteases of Bacillus licheniformis and Aspergillus oryzae. However, inhibitory activities toward subtilisin, esperase, pronase E and proteinase K were negligible. Further, it was found that the protease inhibitor could prevent proteolysis in a commercially valuable shrimp Penaeus monodon during storage indicating the scope for its application as a seafood preservative. This is the first report on isolation of a protease inhibitor from M. oleifera. PMID:23961135

  16. Incidences and risk factors of first-line HAART discontinuation: a limitation to the success of the "seek, test, treat, and retain" strategy?

    PubMed

    Keita, Momory; Perbost, Isabelle; Pugliese-Wehrlen, Sylvia; Abel, Sylvie; Pugliese, Pascal; Enel, Patricia; Cuzin, Lise; Lang, Thierry; Delpierre, Cyrille

    2014-01-01

    To evaluate the incidence and risk factors of first-highly active antiretroviral therapy (HAART) modifications/interruptions and their causes in a cohort of newly-treated patients by using a competing risk model. In nine centers of the French cohort Dat'AIDS, in 1 year and 2 years of censorship, a competing risk analysis was implemented in HIV1 patients aged 18 years or older first-treated between September 2002 and March 2012. In 4669 patients, 3628 modifications (77.7%) were observed (median: 13.5 months). Cumulative incidence in 1 year: 46.8% [45.4-48.3]; in 2 years: 65.3% [63.8-66.8]. Intolerance (n = 1167; 32.3%): in 1 year, except first-treated from 2002 to 2005, modifications were not different: 2002-2003 (24.6%) 2004-2005 (26.1%), 2006-2007 (19.4%), 2008-2009 (18.8%) and 2010-2011 (15.7%). Women, AIDS patients, and those aged 50 years and older had an excess risk. Therapeutic simplification (n = 1037; 28.6%): in 1 year, except first-treated from 2002 to 2003, modifications were not different: 2002-2003 (9.0%), 2004-2005 (16.0%), 2006-2007 (11.0%), 2008-2009 (15.7%) and 2010-2011 (10.0%). Conversely to injecting-drug-users and AIDS patients, women and first-treated with non-nucleosides had an excess risk. Therapeutic failure (n = 189; 5.2%): contrary to first-treated between 2002 and 2003 or 2008 and 2009, in 1 year as in 2 years, modifications were not different. In 1 year, 1.9% for 2004-2005, 1.6% for 2006-2007 and 1.2% for 2010-2011. Maximum viral load ≥5.0 log10 copies/ml and CD4 <200 cells/mm(3) had a high probability. The study of first-HAART modifications suggests that in 1-year follow-up, intolerance incidence in the recent calendar year is still as frequent as the previous period which may constitute a limitation to the success of the seek, test, treat, and retain.

  17. Measures of site resourcing predict virologic suppression, immunologic response and HIV disease progression following highly active antiretroviral therapy (HAART) in the TREAT Asia HIV Observational Database (TAHOD)

    PubMed Central

    Oyomopito, R; Lee, MP; Phanuphak, P; Lim, PL; Ditangco, R; Zhou, J; Sirisanthana, T; Chen, YMA; Pujari, S; Kumarasamy, N; Sungkanuparph, S; Lee, CKC; Kamarulzaman, A; Oka, S; Zhang, FJ; Mean, CV; Merati, T; Tau, G; Smith, J; Li, PCK

    2010-01-01

    Objectives Surrogate markers of HIV disease progression are HIV RNA in plasma viral load (VL) and CD4 cell count (immune function). Despite improved international access to antiretrovirals, surrogate marker diagnostics are not routinely available in resource-limited settings. Therefore, the objective was to assess effects of economic and diagnostic resourcing on patient treatment outcomes. Methods Analyses were based on 2333 patients initiating highly active antiretroviral therapy (HAART) from 2000 onwards. Sites were categorized by World Bank country income criteria (high/low) and annual frequency of VL (≥ 3, 1–2 or <1) or CD4 (≥ 3 or <3) testing. Endpoints were time to AIDS/death and change in CD4 cell count and VL suppression (<400 HIV-1 RNA copies/mL) at 12 months. Demographics, Centers for Disease Control and Prevention (CDC) classification, baseline VL/CD4 cell counts, hepatitis B/C coinfections and HAART regimen were covariates. Time to AIDS/death was analysed by proportional hazards models. CD4 and VL endpoints were analysed using linear and logistic regression, respectively. Results Increased disease progression was associated with site-reported VL testing less than once per year [hazard ratio (HR)=1.4; P=0.032], severely symptomatic HIV infection (HR=1.4; P=0.003) and hepatitis C virus coinfection (HR=1.8; P=0.011). A total of 1120 patients (48.2%) had change in CD4 cell count data. Smaller increases were associated with older age (P<0.001) and `Other' HIV source exposures, including injecting drug use and blood products (P=0.043). A total of 785 patients (33.7%) contributed to the VL suppression analyses. Patients from sites with VL testing less than once per year [odds ratio (OR)=0.30; P<0.001] and reporting `Other' HIV exposures experienced reduced suppression (OR=0.28; P<0.001). Conclusion Low measures of site resourcing were associated with less favourable patient outcomes, including a 35% increase in disease progression in patients from sites

  18. Alkaline protease from Thermoactinomyces sp. RS1 mitigates industrial pollution.

    PubMed

    Verma, Amit; Ansari, Mohammad W; Anwar, Mohmmad S; Agrawal, Ruchi; Agrawal, Sanjeev

    2014-05-01

    Proteases have found a wide application in the several industrial processes, such as laundry detergents, protein recovery or solubilization, prion degradation, meat tenderizations, and in bating of hides and skins in leather industries. But the main hurdle in industrial application of proteases is their economical production on a large scale. The present investigation aimed to exploit the locally available inexpensive agricultural and household wastes for alkaline protease production using Thermoactinomyces sp. RS1 via solid-state fermentation (SSF) technique. The alkaline enzyme is potentially useful as an additive in commercial detergents to mitigate pollution load due to extensive use of caustic soda-based detergents. Thermoactinomyces sp. RS1 showed good protease production under SSF conditions of 55 °C, pH 9, and 50 % moisture content with potato peels as solid substrate. The presented findings revealed that crude alkaline protease produced by Thermoactinomyces sp. RS1 via SSF is of potential application in silver recovery from used X-ray films.

  19. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  20. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-01-01

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  1. Mitochondrial cereblon functions as a Lon-type protease.

    PubMed

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-07-15

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  2. Hydrophobic Core Flexibility Modulates Enzyme Activity in HIV-1 Protease

    SciTech Connect

    Mittal, Seema; Cai, Yufeng; Nalam, Madhavi N.L.; Bolon, Daniel N.A.; Schiffer, Celia A.

    2012-09-11

    Human immunodeficiency virus Type-1 (HIV-1) protease is crucial for viral maturation and infectivity. Studies of protease dynamics suggest that the rearrangement of the hydrophobic core is essential for enzyme activity. Many mutations in the hydrophobic core are also associated with drug resistance and may modulate the core flexibility. To test the role of flexibility in protease activity, pairs of cysteines were introduced at the interfaces of flexible regions remote from the active site. Disulfide bond formation was confirmed by crystal structures and by alkylation of free cysteines and mass spectrometry. Oxidized and reduced crystal structures of these variants show the overall structure of the protease is retained. However, cross-linking the cysteines led to drastic loss in enzyme activity, which was regained upon reducing the disulfide cross-links. Molecular dynamics simulations showed that altered dynamics propagated throughout the enzyme from the engineered disulfide. Thus, altered flexibility within the hydrophobic core can modulate HIV-1 protease activity, supporting the hypothesis that drug resistant mutations distal from the active site can alter the balance between substrate turnover and inhibitor binding by modulating enzyme activity.

  3. A Tunable, Modular Approach to Fluorescent Protease-Activated Reporters

    PubMed Central

    Wu, Peng; Nicholls, Samantha B.; Hardy, Jeanne A.

    2013-01-01

    Proteases are one of the most important and historically utilized classes of drug targets. To effectively interrogate this class of proteins, which encodes nearly 2% of the human proteome, it is necessary to develop effective and cost-efficient methods that report on their activity both in vitro and in vivo. We have developed a robust reporter of caspase proteolytic activity, called caspase-activatable green fluorescent protein (CA-GFP). The caspases play central roles in homeostatic regulation, as they execute programmed cell death, and in drug design, as caspases are involved in diseases ranging from cancer to neurodegeneration. CA-GFP is a genetically encoded dark-to-bright fluorescent reporter of caspase activity in in vitro, cell-based, and animal systems. Based on the CA-GFP platform, we developed reporters that can discriminate the activities of caspase-6 and -7, two highly related proteases. A second series of reporters, activated by human rhinovirus 3C protease, demonstrated that we could alter the specificity of the reporter by reengineering the protease recognition sequence. Finally, we took advantage of the spectrum of known fluorescent proteins to generate green, yellow, cyan, and red reporters, paving the way for multiplex protease monitoring. PMID:23561537

  4. Plant proteases for bioactive peptides release: A review.

    PubMed

    Mazorra-Manzano, M A; Ramírez-Suarez, J C; Yada, R Y

    2017-04-10

    Proteins are a potential source of health promoting biomolecules with medical, nutraceutical and food applications. Nowadays, bioactive peptides production, its isolation, characterization and strategies for its delivery to target sites are a matter of intensive research. In vitro and in vivo studies regarding the bioactivity of peptides has generated strong evidence of their health benefits. Dairy proteins are considered the richest source of bioactive peptides, however proteins from animal and vegetable origin also have been shown to be important sources. Enzymatic hydrolysis has been the process most commonly used for bioactive peptide production. Most commercial enzymatic preparations frequently used are from animal (e.g., trypsin and pepsin) and microbial (e.g., Alcalase® and Neutrase®) sources. Although the use of plant proteases is still relatively limited to papain and bromelain from papaya and pineapple, respectively, the application of new plant proteases is increasing. This review presents the latest knowledge in the use and diversity of plant proteases for bioactive peptides release from food-proteins including both available commercial plant proteases as well as new potential plant sources. Furthermore, the properties of peptides released by plant proteases and health benefits associated in the control of disorders such as hypertension, diabetes, obesity, and cancer are reviewed.

  5. Non-proteolytic functions of microbial proteases increase pathological complexity.

    PubMed

    Jarocki, Veronica M; Tacchi, Jessica L; Djordjevic, Steven P

    2015-03-01

    Proteases are enzymes that catalyse hydrolysis of peptide bonds thereby controlling the shape, size, function, composition, turnover and degradation of other proteins. In microbes, proteases are often identified as important virulence factors and as such have been targets for novel drug design. It is emerging that some proteases possess additional non-proteolytic functions that play important roles in host epithelia adhesion, tissue invasion and in modulating immune responses. These additional "moonlighting" functions have the potential to obfuscate data interpretation and have implications for therapeutic design. Moonlighting enzymes comprise a subcategory of multifunctional proteins that possess at least two distinct biological functions on a single polypeptide chain. Presently, identifying moonlighting proteins relies heavily on serendipitous empirical data with clues arising from proteins lacking signal peptides that are localised to the cell surface. Here, we describe examples of microbial proteases with additional non-proteolytic functions, including streptococcal pyrogenic exotoxin B, PepO and C5a peptidases, mycoplasmal aminopeptidases, mycobacterial chaperones and viral papain-like proteases. We explore how these non-proteolytic functions contribute to host cell adhesion, modulate the coagulation pathway, assist in non-covalent folding of proteins, participate in cell signalling, and increase substrate repertoire. We conclude by describing how proteomics has aided in moonlighting protein discovery, focusing attention on potential moonlighters in microbial exoproteomes.

  6. Microbial aspartic proteases: current and potential applications in industry.

    PubMed

    Theron, Louwrens W; Divol, Benoit

    2014-11-01

    Aspartic proteases are a relatively small group of proteolytic enzymes that are active in acidic environments and are found across all forms of life. Certain microorganisms secrete such proteases as virulence agents and/or in order to break down proteins thereby liberating assimilable sources of nitrogen. Some of the earlier applications of these proteolytic enzymes are found in the manufacturing of cheese where they are used as milk-clotting agents. Over the last decade, they have received tremendous research interest because of their involvement in human diseases. Furthermore, there has also been a growing interest on these enzymes for their applications in several other industries. Recent research suggests in particular that they could be used in the wine industry to prevent the formation of protein haze while preserving the wines' organoleptic properties. In this mini-review, the properties and mechanisms of action of aspartic proteases are summarized. Thereafter, a brief overview of the industrial applications of this specific class of proteases is provided. The use of aspartic proteases as alternatives to clarifying agents in various beverage industries is mentioned, and the potential applications in the wine industry are thoroughly discussed.

  7. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.

    PubMed

    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2009-10-01

    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  8. The impact of highly active antiretroviral therapy on obstetric conditions: A review.

    PubMed

    Sebitloane, Hannah M; Moodley, Dhayendre

    2016-12-09

    been associated with HIV infection, where most studies point towards a reduced risk in HIV infected women. There is increasing evidence that this reduced risk is reversed in the presence of HAART, with women accessing HAART having almost the same risk as HIV uninfected women. HIV or its treatment may be associated with increased risk of obstetric haemorrhage, and an increasing trend of obstetric haemorrhage as a cause of maternal deaths has been recently reported, proportionally in line with the introduction and increasing availability of HAART for pregnant women The mechanism by which this may occur remains elusive since pregnancy is a pro-thrombotic state, however, HIV-related thrombocytopenia or vasculitis could account for the association, if found. HAART would then be expected to reverse this. HAART especially protease inhibitor containing combinations, have been associated with preterm deliveries and low birth weight, particularly when initiated prior to the index pregnancy. With these overall findings of the effect of HAART on obstetric conditions, this review is intended to encourage heightened surveillance of adverse events associated with HAART use in pregnant women.

  9. Continuous Proteolysis with a stabilized stabilized protease. I. Chemical stabilization of an alkaline protease.

    PubMed

    Boudrant, J; Cuq, J L; Cheftel, C

    1976-12-01

    Due to the loss of enzymatic activity as a function of time, an alkaline protease, selected for the continuous preparation of protein hydrolysates (J. Boudrant and C. Cheftel, Biotechnol. Bioeng., 18,1735, 1976), was chemically stabilized by a simple treatment with glutaraldehyde. Two fractions, soluble and insoluble, were obtained. The activities of these two fractions were measured with casein and N-benzoyl-L-arginine ethyl ester (BAEE) as a function of glutaraldehyde concentration used. It was noted that the insoluble fraction was practically inactive with the first substrate and that the heat stability of the soluble form was likewise enhanced. Molecular weights of these two forms were unchanged, but the uv-spectrum of the soluble form was modified. From amino acid analysis, it appears that this treatment mainly provokes a decrease in lysine content.

  10. Dynamic models for estimating the effect of HAART on CD4 in observational studies: application to the Aquitaine Cohort and the Swiss HIV Cohort Study

    PubMed Central

    PRAGUE, M.; COMMENGES, D.; GRAN, J.M.; LEDERGERBER, B.; YOUNG, J.; FURRER, H.; THIEBAUT, R.

    2016-01-01

    Summary Highly active antiretroviral therapy (HAART) has proved efficient in increasing CD4 counts in many randomized clinical trials. Because randomized trials have some limitations (e.g., short duration, highly selected subjects), it is interesting to assess the effect of treatments using observational studies. This is challenging because treatment is started preferentially in subjects with severe conditions. This general problem had been treated using Marginal Structural Models (MSM) relying on the counterfactual formulation. Another approach to causality is based on dynamical models. We present three discrete-time dynamic models based on linear increments models (LIM): the first one based on one difference equation for CD4 counts, the second with an equilibrium point, and the third based on a system of two difference equations, which allows jointly modeling CD4 counts and viral load. We also consider continuous-time models based on ordinary differential equations with non-linear mixed effects (ODE-NLME). These mechanistic models allow incorporating biological knowledge when available, which leads to increased statistical evidence for detecting treatment effect. Because inference in ODE-NLME is numerically challenging and requires specific methods and softwares, LIM are a valuable intermediary option in terms of consistency, precision and complexity. We compare the different approaches in simulation and in illustration on the ANRS CO3 Aquitaine Cohort and the Swiss HIV Cohort Study. PMID:27461460

  11. Dynamic models for estimating the effect of HAART on CD4 in observational studies: Application to the Aquitaine Cohort and the Swiss HIV Cohort Study.

    PubMed

    Prague, Mélanie; Commenges, Daniel; Gran, Jon Michael; Ledergerber, Bruno; Young, Jim; Furrer, Hansjakob; Thiébaut, Rodolphe

    2016-07-26

    Highly active antiretroviral therapy (HAART) has proved efficient in increasing CD4 counts in many randomized clinical trials. Because randomized trials have some limitations (e.g., short duration, highly selected subjects), it is interesting to assess the effect of treatments using observational studies. This is challenging because treatment is started preferentially in subjects with severe conditions. This general problem had been treated using Marginal Structural Models (MSM) relying on the counterfactual formulation. Another approach to causality is based on dynamical models. We present three discrete-time dynamic models based on linear increments models (LIM): the first one based on one difference equation for CD4 counts, the second with an equilibrium point, and the third based on a system of two difference equations, which allows jointly modeling CD4 counts and viral load. We also consider continuous-time models based on ordinary differential equations with non-linear mixed effects (ODE-NLME). These mechanistic models allow incorporating biological knowledge when available, which leads to increased statistical evidence for detecting treatment effect. Because inference in ODE-NLME is numerically challenging and requires specific methods and softwares, LIM are a valuable intermediary option in terms of consistency, precision, and complexity. We compare the different approaches in simulation and in illustration on the ANRS CO3 Aquitaine Cohort and the Swiss HIV Cohort Study.

  12. The Therapeutic Potential of Adenosine Triphosphate as an Immune Modulator in the Treatment of HIV/AIDS: A Combination Approach with HAART

    PubMed Central

    Wagner, Marc C.E.

    2011-01-01

    Extracellular adenosine triphosphate (eATP) is a potent molecule that has the capacity to modulate various aspects of cell functions including gene expression. This element of modulation is essential to the role of ATP as a therapeutic agent. The hypothesis presented is that ATP can have an important impact on the treatment of HIV infection. This is supported in part by published research, although a much greater role for ATP is suggested than prior authors ever thought possible. ATP has the ability to enhance the immune system and could thus improve the host’s own defense mechanisms to eradicate the virus-infected cells and restore normal immune function. This could provide effective therapy when used in conjunction with highly active antiretroviral therapies (HAART) to eliminate the latently infected cells. The key lies in applying ATP through the methodology described. This article presents a strategy for using ATP therapeutically along with background evidence to substantiate the importance of using ATP in the treatment of HIV infection. PMID:21675943

  13. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  14. New therapeutic strategies in HCV: second-generation protease inhibitors.

    PubMed

    Clark, Virginia C; Peter, Joy A; Nelson, David R

    2013-02-01

    Telaprevir and boceprevir are the first direct-acting antiviral agents approved for use in HCV treatment and represent a significant advance in HCV therapy. However, these first-generation drugs also have significant limitations related to thrice-daily dosing, clinically challenging side-effect profiles, low barriers to resistance and a lack of pan-genotype activity. A second wave of protease inhibitors are in phase II and III trials and promise to provide a drug regimen with a better dosing schedule and improved tolerance. These second-wave protease inhibitors will probably be approved in combination with PEG-IFN and Ribavirin (RBV), as well as future all-oral regimens. The true second-generation protease inhibitors are in earlier stages of development and efficacy data are anxiously awaited as they may provide pan-genotypic antiviral activity and a high genetic barrier to resistance.

  15. Membrane-anchored serine proteases in health and disease

    PubMed Central

    Bugge, Thomas; Wu, Qingyu

    2013-01-01

    Serine proteases of the trypsin-like family have long been recognized to be critical effectors of biological processes as diverse as digestion, blood coagulation, fibrinolysis, and immunity. In recent years, a subgroup of these enzymes has been identified that are anchored directly to plasma membranes, either by a carboxy-terminal transmembrane domain (Type I), an amino-terminal transmembrane domain with a cytoplasmic extension (Type II or TTSP), or through a glycosyl-phosphatidylinositol (GPI) linkage. Recent biochemical, cellular, and in vivo analyses have now established that membrane-anchored serine proteases are key pericellular contributors to processes vital for development and the maintenance of homeostasis. This chapter will review our current knowledge of the biological and physiological functions of these proteases, their molecular substrates, and their contributions to disease. PMID:21238933

  16. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  17. Peptide synthesis in neat organic solvents with novel thermostable proteases.

    PubMed

    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B

    2015-06-01

    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  18. Tobacco Etch Virus protease: A shortcut across biotechnologies.

    PubMed

    Cesaratto, Francesca; Burrone, Oscar R; Petris, Gianluca

    2016-08-10

    About thirty years ago, studies on the RNA genome of Tobacco Etch Virus revealed the presence of an efficient and specific protease, called Tobacco Etch Virus protease (TEVp), that was part of the Nuclear Inclusion a (NIa) enzyme. TEVp is an efficient and specific protease of 27kDa that has become a valuable biotechnological tool. Nowadays TEVp is a unique endopeptidase largely exploited in biotechnology from industrial applications to in vitro and in vivo cellular studies. A number of TEVp mutants with different rate of cleavage, stability and specificity have been reported. Similarly, a panel of different target cleavage sites, derived from the canonical ENLYFQ-G/S site, has been established. In this review we describe these aspects of TEVp and some of its multiple applications. A particular focus is on the use and molecular biology of TEVp in living cells and organisms.

  19. Cleaning protocols for crystallization robots: preventing protease contamination.

    PubMed

    Naschberger, Andreas; Fürnrohr, Barbara G; Dunzendorfer-Matt, Theresia; Bonagura, Christopher A; Wright, David; Scheffzek, Klaus; Rupp, Bernhard

    2015-01-01

    The protease in the commonly used commercial low-foam enzyme cleaner Zymit cannot be completely blocked by EDTA, a widely used inhibitor of metalloproteases, at concentrations of up to 5 mM. Severe protein degradation was observed in crystallization drops after EDTA-containing wash steps unless residual Zymit protease was removed with NaOH at a concentration of at least 0.1 M. Wash steps with 0.1% SDS were also ineffective in completely removing the remaining Zymit activity. Protocols including wash steps with at least 0.1 M NaOH, as for example specified in the original ZENM protocol, are recommended to completely deactivate Zymit protease activity.

  20. Lvserpin3 is involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

    PubMed

    Liu, Yongjie; Liu, Tao; Hou, Fujun; Wang, Xianzong; Liu, Xiaolin

    2016-01-01

    Serine protease inhibitor, represented by serpin, plays an important inhibitory role on proteases involved in the immune responses. To clarify the immune characterizations of serpin, a novel serpin (Lvserpin3) encoding for 410 amino acids with a 23-amino acid signal peptide and a serpin domain was identified from the Pacific white shrimp Litopenaeus vannamei. Lvserpin3 expressed strongest in hepatopancreas, and was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Suppression of Lvserpin3 by dsRNA led to a significant increase in the transcripts of LvPPAF, LvproPO and phenoloxidase (PO) activity, and also led to the high cumulative mortality. The recombinant Lvserpin3 protein (rLvserpin3) inhibited the proteases secreted by M. lysodeikticus and Bacillus subtilis, and further exhibited inhibitory role on the growth of B. subtilis and M. lysodeikticu. Moreover, rLvserpin3 was found to be able to block the activation of prophenoloxidase system. Taken together, the results imply that Lvserpin3 may be involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

  1. Plasma micronutrient concentrations are altered by antiretroviral therapy and lipid-based nutrient supplements in lactating HIV-infected Malawian women

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Methods: Plasma micronutrient concentrations were measured in a subsample (n = 690) of Breastfeeding, Antiretrovirals, and Nutrition (BAN) study participants who were randomly assigned at delivery to receive HAART, LNS, HAART+LNS, or no HAART/no LNS (control). HAART consisted of protease inhibitor–b...

  2. Taspase1: a 'misunderstood' protease with translational cancer relevance.

    PubMed

    Wünsch, D; Hahlbrock, A; Jung, S; Schirmeister, T; van den Boom, J; Schilling, O; Knauer, S K; Stauber, R H

    2016-06-30

    Proteolysis is not only a critical requirement for life, but the executing enzymes also play important roles in numerous pathological conditions, including cancer. Therefore, targeting proteases is clearly relevant for improving cancer patient care. However, to effectively control proteases, a profound knowledge of their mechanistic function as well as their regulation and downstream signalling in health and disease is required. The highly conserved protease Threonine Aspartase1 (Taspase1) is overexpressed in numerous liquid and solid malignancies and was characterized as a 'non-oncogene addiction' protease. Although Taspase1 was shown to cleave various regulatory proteins in humans as well as leukaemia provoking mixed lineage leukaemia fusions, our knowledge on its detailed functions and the underlying mechanisms contributing to cancer is still incomplete. Despite superficial similarity to type 2 asparaginases as well as Ntn proteases, such as the proteasome, Taspase1-related research so far gives us the picture of a unique protease exhibiting special features. Moreover, neither effective genetic nor chemical inhibitors for this enzyme are available so far, thus hampering not only to further dissect Taspase1's pathobiological functions but also precluding the assessment of its clinical impact. Based on recent insights, we here critically review the current knowledge of Taspase1's structure-function relationship and its mechanistic relevance for tumorigenesis obtained from in vitro and in vivo cancer models. We provide a comprehensive overview of tumour entities for which Taspase1 might be of predictive and therapeutic value, and present the respective experimental evidence. To stimulate progress in the field, a comprehensive overview of Taspase1 targeting approaches is presented, including coverage of Taspase1-related patents. We conclude by discussing future inhibition strategies and relevant challenges, which need to be resolved by the field.

  3. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  4. Association of a protease with polytene chromosomes of Drosophila melanogaster.

    PubMed

    Cavagnaro, J; Pierce, D A; Lucchesi, J C; Chae, C B

    1980-11-01

    Incubation of Drosophila salivary glands with radioactive diisopropyl fluorophosphate results in the uniform labeling of polytene chromosomes. Extensive labeling is seen only when chromosome squashes are prepared by a formaldehyde fixation procedure and not by standard acetic acid techniques. The labeling is inhibited in the presence of tosylphenylalanine chloromethyl ketone and phenylmethane sulfonylfluoride but not by tosyllysine chloromethyl ketone, suggesting that a chymotrypsin-like serine protease is associated with the chromosomes. Protease inhibitors show no apparent effect on heat-shock specific puffing.

  5. [Cytokines and proteases involved in pathogenesis of COPD].

    PubMed

    Yamaya, Atsuyo; Osanai, Kazuhiro

    2011-10-01

    COPD is characterized by persistence of chronic inflammation in small airways and alveoli. Macrophages, neutrophils, and a specialized subset of T lymphocytes orchestrate the mild inflammation. This article focuses on humoral factors such as cytokines and chemokines that recruit these inflammatory and immune cells to the lungs, and proteases/antiproteases that ultimately cause structural derangement in the terminal respiratory zones. In addition to the classical protease and antiprotease imbalance hypothesis, alveolar homeostasis abnormality that comes from imbalance of lung constitutional cell apoptosis and regeneration may play a role in emphysema development. Also, autoimmunity to elastin degradation products may take part in the disease.

  6. The chlamydial protease CPAF: important or not, important for what?

    PubMed

    Häcker, Georg

    2014-05-01

    The protease CPAF is only found in Chlamydiales and in at least most bacteria that share with Chlamydia the biphasic life-style in a cytosolic inclusion. CPAF is intriguing: it appears to be secreted from the inclusion across the inclusion membrane into the cytosol. A bacterial protease ravaging in the cytosol of a human cell may cause a plethora of effects. Curiously, very few are known. The current discussion is bogged down by a focus on experimental artifact, while proposed functions of CPAF remain speculative. I here make the attempt to summarize what we know about CPAF.

  7. Regulation by proteolysis: energy-dependent proteases and their targets.

    PubMed Central

    Gottesman, S; Maurizi, M R

    1992-01-01

    A number of critical regulatory proteins in both prokaryotic and eukaryotic cells are subject to rapid, energy-dependent proteolysis. Rapid degradation combined with control over biosynthesis provides a mechanism by which the availability of a protein can be limited both temporally and spatially. Highly unstable regulatory proteins are involved in numerous biological functions, particularly at the commitment steps in developmental pathways and in emergency responses. The proteases involved in energy-dependent proteolysis are large proteins with the ability to use ATP to scan for appropriate targets and degrade complete proteins in a processive manner. These cytoplasmic proteases are also able to degrade many abnormal proteins in the cell. PMID:1480111

  8. Identification of Genotypic Changes in Human Immunodeficiency Virus Protease That Correlate with Reduced Susceptibility to the Protease Inhibitor Lopinavir among Viral Isolates from Protease Inhibitor-Experienced Patients

    PubMed Central

    Kempf, Dale J.; Isaacson, Jeffrey D.; King, Martin S.; Brun, Scott C.; Xu, Yi; Real, Kathryn; Bernstein, Barry M.; Japour, Anthony J.; Sun, Eugene; Rode, Richard A.

    2001-01-01

    The association of genotypic changes in human immunodeficiency virus (HIV) protease with reduced in vitro susceptibility to the new protease inhibitor lopinavir (previously ABT-378) was explored using a panel of viral isolates from subjects failing therapy with other protease inhibitors. Two statistical tests showed that specific mutations at 11 amino acid positions in protease (L10F/I/R/V, K20M/R, L24I, M46I/L, F53L, I54L/T/V, L63P, A71I/L/T/V, V82A/F/T, I84V, and L90M) were associated with reduced susceptibility. Mutations at positions 82, 54, 10, 63, 71, and 84 were most closely associated with relatively modest (4- and 10-fold) changes in phenotype, while the K20M/R and F53L mutations, in conjunction with multiple other mutations, were associated with >20- and >40-fold-reduced susceptibility, respectively. The median 50% inhibitory concentrations (IC50) of lopinavir against isolates with 0 to 3, 4 or 5, 6 or 7, and 8 to 10 of the above 11 mutations were 0.8-, 2.7-, 13.5-, and 44.0-fold higher, respectively, than the IC50 against wild-type HIV. On average, the IC50 of lopinavir increased by 1.74-fold per mutation in isolates containing three or more mutations. Each of the 16 viruses that displayed a >20-fold change in susceptibility contained mutations at residues 10, 54, 63, and 82 and/or 84, along with a median of three mutations at residues 20, 24, 46, 53, 71, and 90. The number of protease mutations from the 11 identified in these analyses (the lopinavir mutation score) may be useful for the interpretation of HIV genotypic resistance testing with respect to lopinavir-ritonavir (Kaletra) regimens and may provide insight into the genetic barrier to resistance to lopinavir-ritonavir in both antiretroviral therapy-naive and protease inhibitor-experienced patients. PMID:11462018

  9. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases.

    PubMed

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers.

  10. A New Subtilase-Like Protease Deriving from Fusarium equiseti with High Potential for Industrial Applications.

    PubMed

    Juntunen, Kari; Mäkinen, Susanna; Isoniemi, Sari; Valtakari, Leena; Pelzer, Alexander; Jänis, Janne; Paloheimo, Marja

    2015-09-01

    A gene encoding a novel extracellular subtilisin-like protease was cloned from the ascomycete Fusarium equiseti and expressed in Trichoderma reesei. The F. equiseti protease (Fe protease) showed excellent performance in stain removal and good compatibility with several commercial laundry detergent formulations, suggesting that it has high potential for use in various industrial applications. The recombinant enzyme was purified and characterized. The temperature optimum of the Fe protease was 60 °C and it showed high activity in the pH range of 6-10, with a sharp decline in activity at pH above 10. The amino acid specificity of the Fe protease was studied using casein, cytochrome c, and ubiquitin as substrates. The Fe protease had broad substrate specificity: almost all amino acid residues were accepted at position P1, even though it showed some preference for cleavage at the C-terminal side of asparagine and histidine residues. The S4 subsite of Fe protease favors aspartic acid and threonine. The other well-characterized proteases from filamentous fungi, Proteinase K from Engyodontium album, Thermomycolin from Malbranchea sulfurea, and alkaline subtilisins from Bacillus species prefer hydrophobic amino acids in both the S1 and S4 subsites. Due to its different specificity compared to the members of the S8 family of clan SB of proteases, we consider that the Fe protease is a new protease. It does not belong to any previously defined IUBMB groups of proteases.

  11. The effects of bioprocess parameters on extracellular proteases in a recombinant Aspergillus niger B1-D.

    PubMed

    Li, Qiang; Harvey, Linda M; McNeil, Brian

    2008-02-01

    Although host proteases are often considered to have a negative impact upon heterologous protein production by filamentous fungi, relatively little is known about the pattern of their appearance in recombinant fungal bioprocesses. In the present study, we investigated extracellular proteases from a filamentous fungus, Aspergillus niger B1-D, genetically modified to secrete hen egg white lysozyme (HEWL). Our findings indicate that extracellular protease activity is only detected after the carbon source is completely utilised in batch cultures. The proteases are predominantly acid proteases and have optimal temperature for activity at around 45 degrees C. Their activity could be partially inhibited by protease inhibitors, indicating the existence of at least four kinds of proteases in these culture fluids, aspartic-, serine-, cysteine-, and metallo-proteases. Oxygen enrichment does not have any noticeable effects on extracellular protease activity except that the onset of protease activity appears earlier in oxygen enrichment runs. Oxygen enrichment stimulates HEWL production substantially, and we propose that it is related to fungal morphology. Thermal stress imposed by raising process temperature (from 25 to 30 and 35 degrees C) in early exponential phase, led to appearance of protease activity in the medium following the heat shock. Continued cultivation at high temperatures significantly reduced HEWL production, which was associated with increased activity of the extracellular proteases in these cultures.

  12. Teaching Foundational Topics and Scientific Skills in Biochemistry within the Conceptual Framework of HIV Protease

    ERIC Educational Resources Information Center

    Johnson, R. Jeremy

    2014-01-01

    HIV protease has served as a model protein for understanding protein structure, enzyme kinetics, structure-based drug design, and protein evolution. Inhibitors of HIV protease are also an essential part of effective HIV/AIDS treatment and have provided great societal benefits. The broad applications for HIV protease and its inhibitors make it a…

  13. Emerging technologies for protease engineering: New tools to clear out disease.

    PubMed

    Guerrero, Jennifer L; Daugherty, Patrick S; O'Malley, Michelle A

    2017-01-01

    Proteases regulate many biological processes through their ability to activate or inactive their target substrates. Because proteases catalytically turnover proteins and peptides, they present unique opportunities for use in biotechnological and therapeutic applications. However, many proteases are capable of cleaving multiple physiological substrates. Therefore their activity, expression, and localization are tightly controlled to prevent unwanted proteolysis. Currently, the use of protease therapeutics has been limited to a handful of proteases with narrow substrate specificities, which naturally limits their toxicity. Wider application of proteases is contingent upon the development of methods for engineering protease selectivity, activity, and stability. Recent advances in the development of high-throughput, bacterial and yeast-based methods for protease redesign have yielded protease variants with novel specificities, reduced toxicity, and increased resistance to inhibitors. Here, we highlight new tools for protease engineering, including methods suitable for the redesign of human secreted proteases, and future opportunities to exploit the catalytic activity of proteases for therapeutic benefit. Biotechnol. Bioeng. 2017;114: 33-38. © 2016 Wiley Periodicals, Inc.

  14. A novel serine protease inhibitor from Bungarus fasciatus venom.

    PubMed

    Lu, Jia; Yang, Hailong; Yu, Haining; Gao, Weikai; Lai, Ren; Liu, Jingze; Liang, Xingcai

    2008-03-01

    By Sephadex G-50 gel filtration, cation-exchange CM-Sephadex C-25 chromatography and reversed phase high-performance liquid chromatography (HPLC), a novel serine protease inhibitor named bungaruskunin was purified and characterized from venom of Bungarus fasciatus. Its cDNA was also cloned from the cDNA library of B. fasciatus venomous glands. The predicted precursor is composed of 83 amino acid (aa) residues including a 24-aa signal peptide and a 59-aa mature bungaruskunin. Bungaruskunin showed maximal similarity (64%) with the predicted serine protease inhibitor blackelin deduced from the cDNA sequence of the red-bellied black snake Pseudechis porphyriacus. Bungaruskunin is a Kunitz protease inhibitor with a conserved Kunitz domain and could exert inhibitory activity against trypsin, chymotrypsin, and elastase. By screening the cDNA library, two new B chains of beta-bungarotoxin are also identified. The overall structures of bungaruskunin and beta-bungarotoxin B chains are similar; especially they have highly conserved signal peptide sequences. These findings strongly suggest that snake Kunitz/BPTI protease inhibitors and neurotoxic homologs may have originated from a common ancestor.

  15. The non-death role of metacaspase proteases.

    PubMed

    Shrestha, Amit; Megeney, Lynn A

    2012-01-01

    The activation of caspase proteases and the targeting of protein substrates act as key steps in the engagement and conduct of apoptosis/programmed cell death. However, the discovery of caspase involvement in diverse non-apoptotic cellular functions strongly suggests that these proteins may have evolved from a core behavior unrelated to the induction of cell death. The presence of similar proteases, termed metacaspases, in single cell organisms supports the contention that such proteins may have co-evolved or derived from a critical non-death function. Indeed, the benefit(s) for single cell life forms to retain proteins solely dedicated to self destruction would be countered by a strong selection pressure to curb or eliminate such processes. Examination of metacaspase biology provides evidence that these ancient protease forerunners of the caspase family also retain versatility in function, i.e., death and non-death cell functions. Here, we provide a critical review that highlights the non-death roles of metacaspases that have been described thus far, and the impact that these observations have for our understanding of the evolution and cellular utility of this protease family.

  16. Design, synthesis, and activity of nanocellulosic protease sensors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Here we contrast the molecular assembly, and biochemical utility of nanocellulosic materials prepared from cotton and wood as protease sensors. The cotton-based nanocellulosic substrates were prepared in a variety of ways to produce nanocrystals, films and aerogels, which were derivatized with eithe...

  17. Protease inhibitors interfere with the necessary factors of carcinogenesis.

    PubMed

    Troll, W

    1989-05-01

    Many tumor promoters are inflammatory agents that stimulate the formation of oxygen radicals (.O2-) and hydrogen peroxide (H2O2) in phagocytic neutrophils. The neutrophils use the oxygen radicals to kill bacteria, which are recognized by the cell membrane of phagocytic cells causing a signal to mount the oxygen response. The tumor promoter isolated from croton oil, 12-O-tetradecanoylphorbol-13-acetate (TPA), mimics the signal, causing an oxygen radical release that is intended to kill bacteria; instead, it injures cells in the host. Oxygen radicals cause single strand breaks in DNA and modify DNA bases. These damaging reactions appear to be related to tumor promotion, as three types of chemopreventive agents, retinoids, onion oil, and protease inhibitors, suppress the induction of oxygen radicals in phagocytic neutrophils and suppress tumor promotion in skin cancer in mice. Protease inhibitors also suppress breast and colon cancers in mice. Protease inhibitors capable of inhibiting chymotrypsin show a greater suppression of the oxygen effect and are better suppressors of tumor promotion. In addition, oxygen radicals may be one of the many agents that cause activation of oncogenes. Since retinoids and protease inhibitors suppress the expression of the ras oncogene in NIH 3T3 cells, NIH 3T3 cells may serve as a relatively facile model for finding and measuring chemopreventive agents that interfere with the carcinogenic process.

  18. Botulinum neurotoxin: a deadly protease with applications to human medicine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Botulinum neurotoxins (BoNTs) are some of the most potent biological toxins to humans. They are synthesized by the gram-positive, spore-forming bacterium Clostridium botulinum. BoNT is secreted from the bacterium as a ~150 kDa polypeptide which is cleaved by bacterial or host proteases into a ~50 kD...

  19. Processing and targeting of the thiol protease aleurain: Progress report

    SciTech Connect

    Rogers, J.C.

    1988-01-01

    This study addresses the processing and targeting of the thiol protease aleurain in monocots. A probe derived from the aleurain cDNA specific for the 5'-most 400 bp (a region encoding the first 140 amino acids of the preprotein hybridized to at least 3 separate elements in the barley genome; only one represented the aleurain gene. In contrast, a probe specific for the remaining 2/23 of the cDNA (representing the protease domain) hybridized to only a single copy sequence. To know if this pattern pertained in other, closely related, monocots, we probed Southern blots of genomic DNA from maize, rye, oats, sorghum, and pearl millet with each probe. In each instance except for maize DNA, the 5' domain probe hybridizes to several fragments in addition to those identified by the protease domain probe. Presumable the darkest hybridization in each represents the fragment carrying the sequences homologous to barley aleurain. The fragments from a given restriction enzyme identified by the protease domain probe in sorghum, millet, and maize, were indistinguishable in size indicating that the gene sequences, as well as flanking DNA, are so well conserved among the group that the location of the hexanucleotide sequences have not diverged. (3 refs., 3 figs.)

  20. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.

    PubMed

    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui

    2017-02-27

    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  1. Post-translational control of genetic circuits using Potyvirus proteases

    PubMed Central

    Fernandez-Rodriguez, Jesus; Voigt, Christopher A.

    2016-01-01

    Genetic engineering projects often require control over when a protein is degraded. To this end, we use a fusion between a degron and an inactivating peptide that can be added to the N-terminus of a protein. When the corresponding protease is expressed, it cleaves the peptide and the protein is degraded. Three protease:cleavage site pairs from Potyvirus are shown to be orthogonal and active in exposing degrons, releasing inhibitory domains and cleaving polyproteins. This toolbox is applied to the design of genetic circuits as a means to control regulator activity and degradation. First, we demonstrate that a gate can be constructed by constitutively expressing an inactivated repressor and having an input promoter drive the expression of the protease. It is also shown that the proteolytic release of an inhibitory domain can improve the dynamic range of a transcriptional gate (200-fold repression). Next, we design polyproteins containing multiple repressors and show that their cleavage can be used to control multiple outputs. Finally, we demonstrate that the dynamic range of an output can be improved (8-fold to 190-fold) with the addition of a protease-cleaved degron. Thus, controllable proteolysis offers a powerful tool for modulating and expanding the function of synthetic gene circuits. PMID:27298256

  2. Mast Cell Proteases as Protective and Inflammatory Mediators

    PubMed Central

    Caughey, George H.

    2014-01-01

    Proteases are the most abundant class of proteins produced by mast cells. Many of these are stored in membrane-enclosed intracellular granules until liberated by degranulating stimuli, which include cross-linking of high affinity IgE receptor FcεRI by IgE bound to multivalent allergen. Understanding and separating the functions of the proteases is important because expression differs among mast cells in different tissue locations. Differences between laboratory animals and humans in protease expression also influence the degree of confidence with which results obtained in animal models of mast cell function can be extrapolated to humans. The inflammatory potential of mast cell proteases was the first aspect of their biology to be explored and has received the most attention, in part because some of them—notably tryptases and chymases—are biomarkers of local and systemic mast cell degranulation and anaphylaxis. Although some of the proteases indeed augment allergic inflammation and are potential targets for inhibition to treat asthma and related allergic disorders, they are protective and even anti-inflammatory in some settings. For example, mast cell tryptases may protect from serious bacterial lung infections and may limit the “rubor” component of inflammation caused by vasodilating neuropeptides in the skin. Chymases help to maintain intestinal barrier function and to expel parasitic worms, and may support blood pressure during anaphylaxis by generating angiotensin II. In other life-or-death examples, carboxypeptidase A3 and other mast cell peptidases limit systemic toxicity of endogenous peptides like endothelin and neurotensin during septic peritonitis, and inactivate venom-associated peptides. On the other hand, mast cell peptidase-mediated destruction of protective cytokines, like IL-6, can enhance mortality from sepsis. Peptidases released from mast cells also influence non-mast cell proteases, such as by activating matrix metalloproteinase cascades

  3. Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

    SciTech Connect

    Fischer, Katja; Langendorf, Christopher G.; Irving, James A.; Reynolds, Simone; Willis, Charlene; Beckham, Simone; Law, Ruby H.P.; Yang, Sundy; Bashtannyk-Puhalovich, Tanya A.; McGowan, Sheena; Whisstock, James C.; Pike, Robert N.; Kemp, David J.; Buckle, Ashley M.

    2009-08-07

    The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalytically inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.

  4. Highly efficient and easy protease-mediated protein purification.

    PubMed

    Last, Daniel; Müller, Janett; Dawood, Ayad W H; Moldenhauer, Eva J; Pavlidis, Ioannis V; Bornscheuer, Uwe T

    2016-02-01

    As both research on and application of proteins are rarely focused on the resistance towards nonspecific proteases, this property remained widely unnoticed, in particular in terms of protein purification and related fields. In the present study, diverse aspects of protease-mediated protein purification (PMPP) were explored on the basis of the complementary proteases trypsin and proteinase K as well as the model proteins green fluorescent protein (GFP) from Aequorea victoria, lipase A from Candida antarctica (CAL-A), a transaminase from Aspergillus fumigatus (AspFum), quorum quenching lactonase AiiA from Bacillus sp., and an alanine dehydrogenase from Thermus thermophilus (AlaDH). While GFP and AiiA were already known to be protease resistant, the thermostable enzymes CAL-A, AspFum, and AlaDH were selected due to the documented correlation between thermostability and protease resistance. As proof of principle for PMPP, recombinant GFP remained unaffected whereas most Escherichia coli (E. coli) host proteins were degraded by trypsin. PMPP was highly advantageous compared to the widely used heat-mediated purification of commercial CAL-A. The resistance of AspFum towards trypsin was improved by rational protein design introducing point mutation R20Q. Trypsin also served as economical and efficient substitute for site-specific endopeptidases for the removal of a His-tag fused to AiiA. Moreover, proteolysis of host enzymes with interfering properties led to a strongly improved sensitivity and accuracy of the NADH assay in E. coli cell lysate for AlaDH activity measurements. Thus, PMPP is an attractive alternative to common protein purification methods and facilitates also enzyme characterization in cell lysate.

  5. Nematicidal Bacteria Associated to Pinewood Nematode Produce Extracellular Proteases

    PubMed Central

    Francisco, Romeu; Verissimo, Paula; Santos, Susana S.; Fonseca, Luís; Abrantes, Isabel M. O.; Morais, Paula V.

    2013-01-01

    Bacteria associated with the nematode Bursaphelenchus xylophilus, a pathogen of trees and the causal agent of pine wilt disease (PWD) may play a role in the disease. In order to evaluate their role (positive or negative to the tree), strains isolated from the track of nematodes from infected Pinus pinaster trees were screened, in vitro, for their nematicidal potential. The bacterial products, from strains more active in killing nematodes, were screened in order to identify and characterize the nematicidal agent. Forty-seven strains were tested and, of these, 21 strains showed capacity to produce extracellular products with nematicidal activity. All Burkholderia strains were non-toxic. In contrast, all Serratia strains except one exhibited high toxicity. Nematodes incubated with Serratia strains showed, by SEM observation, deposits of bacteria on the nematode cuticle. The most nematicidal strain, Serratia sp. A88copa13, produced proteases in the supernatant. The use of selective inhibitors revealed that a serine protease with 70 kDa was majorly responsible for the toxicity of the supernatant. This extracellular serine protease is different phylogenetically, in size and biochemically from previously described proteases. Nematicidal assays revealed differences in nematicidal activity of the proteases to different species of Bursaphelenchus, suggesting its usefulness in a primary screen of the nematodes. This study offers the basis for further investigation of PWD and brings new insights on the role bacteria play in the defense of pine trees against B. xylophilus. Understanding all the factors involved is important in order to develop strategies to control B. xylophilus dispersion. PMID:24244546

  6. Crystal structure of Clostridium botulinum neurotoxin protease in a product-bound state: Evidence for noncanonical zinc protease activity.

    PubMed

    Segelke, Brent; Knapp, Mark; Kadkhodayan, Saloumeh; Balhorn, Rod; Rupp, Bernhard

    2004-05-04

    Clostridium botulinum neurotoxins (BoNTs), the most potent toxins known, disrupt neurotransmission through proteolysis of proteins involved in neuroexocytosis. The light chains of BoNTs are unique zinc proteases that have stringent substrate specificity and require exceptionally long substrates. We have determined the crystal structure of the protease domain from BoNT serotype A (BoNT/A). The structure reveals a homodimer in a product-bound state, with loop F242-V257 from each monomer deeply buried in its partner's catalytic site. The loop, which acts as a substrate, is oriented in reverse of the canonical direction for other zinc proteases. The Y249-Y250 peptide bond of the substrate loop is hydrolyzed, leaving the Y249 product carboxylate coordinated to the catalytic zinc. From the crystal structure of the BoNT/A protease, detailed models of noncanonical binding and proteolysis can be derived which we propose are also consistent with BoNT/A binding and proteolysis of natural substrate synaptosome-associated protein of 25 kDa (SNAP-25). The proposed BoNT/A substrate-binding mode and catalytic mechanism are markedly different from those previously proposed for the BoNT serotype B.

  7. Characterization of the Protease Activity of Detergents: Laboratory Practicals for Studying the Protease Profile and Activity of Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-01-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body…

  8. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  9. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  10. Proteases of Wood Rot Fungi with Emphasis on the Genus Pleurotus

    PubMed Central

    Inácio, Fabíola Dorneles; Ferreira, Roselene Oliveira; de Araujo, Caroline Aparecida Vaz; Brugnari, Tatiane; Castoldi, Rafael; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

    2015-01-01

    Proteases are present in all living organisms and they play an important role in physiological conditions. Cell growth and death, blood clotting, and immune defense are all examples of the importance of proteases in maintaining homeostasis. There is growing interest in proteases due to their use for industrial purposes. The search for proteases with specific characteristics is designed to reduce production costs and to find suitable properties for certain industrial sectors, as well as good producing organisms. Ninety percent of commercialized proteases are obtained from microbial sources and proteases from macromycetes have recently gained prominence in the search for new enzymes with specific characteristics. The production of proteases from saprophytic basidiomycetes has led to the identification of various classes of proteases. The genus Pleurotus has been extensively studied because of its ligninolytic enzymes. The characteristics of this genus are easy cultivation techniques, high yield, low nutrient requirements, and excellent adaptation. There are few studies in the literature about proteases of Pleurotus spp. This review gathers together information about proteases, especially those derived from basidiomycetes, and aims at stimulating further research about fungal proteases because of their physiological importance and their application in various industries such as biotechnology and medicine. PMID:26180792

  11. Identification and characterization of a chymotrypsin-like serine protease from periodontal pathogen, Tannerella forsythia.

    PubMed

    Hockensmith, K; Dillard, K; Sanders, B; Harville, B A

    2016-11-01

    Tannerella forsythia is a bacteria associated with severe periodontal disease. This study reports identification and characterization of a membrane-associated serine protease from T. forsythia. The protease was isolated from T. forsythia membrane fractions and shown to cleave both gelatin and type I collagen. The protease was able to cleave both substrates over a wide range of pH values, however optimal cleavage occurred at pH 7.5 for gelatin and 8.0 for type I collagen. The protease was also shown to cleave both gelatin and type I collagen at the average reported temperature for the gingival sulcus however it showed a lack of thermal stability with a complete loss of activity by 60 °C. When treated with protease inhibitors the enzyme's activity could only be completely inhibited by serine protease inhibitors antipain and phenylmethanesulfonyl fluoride (PMSF). Further characterization of the protease utilized serine protease synthetic peptides. The protease cleaved N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide but not Nα-benzoyl-dl-arginine p-nitroanilide (BAPNA) or N-methoxysuccinyl-Ala-Ala-Pro-Val p-nitroanilide indicating that the protease is a chymotrypsin-like serine protease. Since type I collagen is a major component in the gingival tissues and periodontal ligament, identification and characterization of this enzyme provides important information regarding the role of T. forsythia in periodontal disease.

  12. Fungal fermentation of whey incorporated with certain supplements for the production of proteases.

    PubMed

    Ashour, S A; el-Shora, H M; Metwally, M; Habib, S A

    1996-01-01

    The pattern and the extent of formation of proteases and secretion varied with the fungus, age and/or the nature of the co-supplement. Addition of yeast extract induced the best yield of proteases from both Aspergillus niger and A. terreus. Proteases from A. niger were highly induced by glutamic acid, alanine or albumin, with minor differences, whereas gelatin, peptone, aspartic acid, casein or acetamide stimulated the accumulation of proteases in the culture medium of A. terreus. Galactose stimulated the yield of the enzyme particularly with A. terreus while most C-supplements inhibited such processes, more prominently in the presence of cellulose or starch. Incorporation of nicotinic acid and wheat bran initiated the maximum productivity of proteases from A. niger and A. terreus, respectively. Co+2 and Cu+2 highly stimulated the output of proteases from A. niger and A. terreus, respectively. Co+2 and Ca+2 stimulated the enzyme activity of alkaline and acid proteases from A. terreus and acid proteases from A. niger. The other six cations and DTT inhibited variably the three proteases particularly alkaline proteases from A. terreus indicating that proteases from various sources even from closely related species showed different properties.

  13. Purification and biochemical characterization of an alkaline protease from marine bacteria Pseudoalteromonas sp. 129-1.

    PubMed

    Wu, Shimei; Liu, Ge; Zhang, Dechao; Li, Chaoxu; Sun, Chaomin

    2015-12-01

    An extracellular alkaline protease produced by marine bacteria strain Pseudoalteromonas sp. 129-1 was purified by ammonium sulphate precipitation, anion exchange chromatography, and gel filtration. The purity of the protease was confirmed by SDS-PAGE and molecular mass was estimated to be 35 kDa. The protease maintained considerable activity and stability at a wide temperature range of 10-60 °C and pH range of 6-11, and optimum activity was detected at temperature of 50 °C and pH of 8. Metallo-protease inhibitor, EDTA, had no inhibitory effect on protease activity even at concentration up to 15 mM, whereas 15 mM PMSF, a common serine protease inhibitor, greatly inactivated the protease. The high stability of the protease in the presence of surfactants (SDS, Tween 80, and Triton X-100), oxidizing agent H(2)O(2), and commercial detergents was observed. Moreover, the protease was tolerant to most of the tested organic solvents, and saline tolerant up to 30%. Interestingly, biofilm of Pseudomonas aeruginosa PAO1 was greatly reduced by 0.01 mg ml(-1) of the protease, and nearly completely abolished with the concentration of 1 mg ml(-1). Collectively, the protease showed valuable feathers as an additive in laundry detergent and non-toxic anti-biofilm agent.

  14. Copper inhibits the HIV-1 protease by both oxygen-dependent and oxygen-independent mechanisms

    SciTech Connect

    Karlstroem, A.R.; Levine, R.L. )

    1991-03-11

    The protease encoded by HIV-1 is essential for the processing of the viral polyproteins encoded by the gag and pol genes into mature viral proteins. Mutation or deletion of the protease gene blocks replication of the virus, making the protease an attractive target for antiviral therapy. The authors found that the HIV-1 protease is inhibited by micromolar concentrations of Cu{sup 2+}. Protease was 50% inhibited by exposure to 5 {mu}M copper for 5 min while exposure to 25 {mu}M caused complete inhibition. This inhibition was not oxygen-dependent and was not reversed by treatment with EDTA, presumably due to the slow off-rate of copper from the protease. Consistent with this interpretation, enzyme activity was recovered after denaturation and refolding of the copper exposed protease. Titration of the inactivated enzyme with Ellman's reagent demonstrated a loss of one of the two sulfhydryl groups present in the molecule, suggesting that copper inhibition was mediated through binding to a cysteine. This was confirmed in studies with a chemically synthesize, mutant protease in which the two cysteine residues were replaced by {alpha}-amino butyrate: The mutant protease was not inhibited by copper. However, both the wild-type and mutant protease were inactivated when exposed to copper, oxygen, and dithiothreitol. This inactivation required oxygen. Thus, the protease can also be inactivated by metal catalyzed oxidation (MCO), a presumably irreversible covalent modification.

  15. Development of marine biotechnology as a resource for novel proteases and their role in modern biotechnology.

    PubMed

    Homaei, Ahmad; Lavajoo, Fatemeh; Sariri, Reyhaneh

    2016-07-01

    Marine environment consists of the largest sources diversified genetic pool of material with an enormous potential for a wide variety of enzymes including proteases. A protease hydrolyzes the peptide bond and most of proteases possess many industrial applications. Marine proteases differ considerably from those found in internal or external organs of invertebrates and vertebrates. In common with all enzymes, external factors such as temperature, pH and type of media are important for the activity, catalytic efficiency, stability and proper functioning of proteases. In this review valuable characteristics of proteases in marine organisms and their applications are gathered from a wide literature survey. Considering their biochemical significance and their increasing importance in biotechnology, a thorough understanding of marine proteases functioning could be of prime importance.

  16. Production of plant proteases in vivo and in vitro--a review.

    PubMed

    González-Rábade, Nuria; Badillo-Corona, Jesús Agustín; Aranda-Barradas, Juan Silvestre; Oliver-Salvador, María Del Carmen

    2011-01-01

    In the latest two decades, the interest received by plant proteases has increased significantly. Plant enzymes such as proteases are widely used in medicine and the food industry. Some proteases, like papain, bromelain and ficin are used in various processes such as brewing, meat softening, milk-clotting, cancer treatment, digestion and viral disorders. These enzymes can be obtained from their natural source or through in vitro cultures, in order to ensure a continuous source of plant enzymes. The focus of this review will be the production of plant proteases both in vivo and in vitro, with particular emphasis on the different types of commercially important plant proteases that have been isolated and characterized from naturally grown plants. In vitro approaches for the production of these proteases is also explored, focusing on the techniques that do not involve genetic transformation of the plants and the attempts that have been made in order to enhance the yield of the desired proteases.

  17. Robust substrate profiling method reveals striking differences in specificities of serum and lung fluid proteases.

    PubMed

    Watson, Douglas S; Jambunathan, Kalyani; Askew, David S; Kodukula, Krishna; Galande, Amit K

    2011-08-01

    Proteases are candidate biomarkers and therapeutic targets for many diseases. Sensitive and robust techniques are needed to quantify proteolytic activities within the complex biological milieu. We hypothesized that a combinatorial protease substrate library could be used effectively to identify similarities and differences between serum and bronchoalveolar lavage fluid (BALF), two body fluids that are clinically important for developing targeted therapies and diagnostics. We used a concise library of fluorogenic probes to map the protease substrate specificities of serum and BALF from guinea pigs. Differences in the proteolytic fingerprints of the two fluids were striking: serum proteases cleaved substrates containing cationic residues and proline, whereas BALF proteases cleaved substrates containing aliphatic and aromatic residues. Notably, cleavage of proline-containing substrates dominated all other protease activities in both human and guinea pig serum. This substrate profiling approach provides a foundation for quantitative comparisons of protease specificities between complex biological samples.

  18. Protease Substrate Profiling by N-Terminal COFRADIC.

    PubMed

    Staes, An; Van Damme, Petra; Timmerman, Evy; Ruttens, Bart; Stes, Elisabeth; Gevaert, Kris; Impens, Francis

    2017-01-01

    Detection of (neo-)N-terminal peptides is essential for identifying protease cleavage sites . We here present an update of a well-established and efficient selection method for enriching N-terminal peptides out of peptide mixtures: N-terminal COFRADIC (COmbined FRActional DIagonal Chromatography). This method is based on the old concept of diagonal chromatography, which involves a peptide modification step in between otherwise identical chromatographic separations, with this modification step finally allowing for the isolation of N-terminal peptides by longer retention of non-N-terminal peptides on the resin. N-terminal COFRADIC has been successfully applied in many protease-centric studies, as well as for studies on protein alpha-N-acetylation and on characterizing alternative translation initiation events.

  19. Acquisition of accurate data from intramolecular quenched fluorescence protease assays.

    PubMed

    Arachea, Buenafe T; Wiener, Michael C

    2017-04-01

    The Intramolecular Quenched Fluorescence (IQF) protease assay utilizes peptide substrates containing donor-quencher pairs that flank the scissile bond. Following protease cleavage, the dequenched donor emission of the product is subsequently measured. Inspection of the IQF literature indicates that rigorous treatment of systematic errors in observed fluorescence arising from inner-filter absorbance (IF) and non-specific intermolecular quenching (NSQ) is incompletely performed. As substrate and product concentrations vary during the time-course of enzyme activity, iterative solution of the kinetic rate equations is, generally, required to obtain the proper time-dependent correction to the initial velocity fluorescence data. Here, we demonstrate that, if the IQF assay is performed under conditions where IF and NSQ are approximately constant during the measurement of initial velocity for a given initial substrate concentration, then a simple correction as a function of initial substrate concentration can be derived and utilized to obtain accurate initial velocity data for analysis.

  20. A high molecular weight protease in liver cytosol.

    PubMed

    Rose, I A; Warms, J V; Hershko, A

    1979-09-10

    A high molecular weight (greater than 400,000) protease active with [3H]leucine-labeled globin has been found in the postmicrosomal fraction of mouse kidney, brain, heart, spleen, and tumor cells and is most active in liver. The presence in liver was unexpected because liver cytosol is very ineffective in the breakdown of endogenous, labeled proteins. The enzyme has a number of properties that distinguish it from known cathepsins in addition to its high molecular weight. It is most active at pH approximately 7.5. When purified, it is unstable above 20 degrees C and is stabilized by metal chelating agents such as citrate, creatine-P, and glycerate-3-P. It is an -SH protease, but its thermal instability is not affected by 1 mM dithiothreitol. The enzyme is not lysosomal.

  1. Cold Denaturation of the HIV-1 Protease Monomer.

    PubMed

    Rösner, Heike I; Caldarini, Martina; Prestel, Andreas; Vanoni, Maria A; Broglia, Ricardo A; Aliverti, Alessandro; Tiana, Guido; Kragelund, Birthe B

    2017-02-28

    The human immunodeficiency virus-1 (HIV-1) protease is a complex protein that in its active form adopts a homodimer dominated by β-sheet structures. We have discovered a cold-denatured state of the monomeric subunit of HIV-1 protease that is populated above 0 °C and therefore directly accessible to various spectroscopic approaches. Using nuclear magnetic resonance secondary chemical shifts, temperature coefficients, and protein dynamics, we suggest that the cold-denatured state populates a compact wet globule containing transient non-native-like α-helical elements. From the linearity of the temperature coefficients and the hydrodynamic radii, we propose that the overall architecture of the cold-denatured state is maintained over the temperature range studied.

  2. Neural ECM proteases in learning and synaptic plasticity.

    PubMed

    Tsilibary, Effie; Tzinia, Athina; Radenovic, Lidija; Stamenkovic, Vera; Lebitko, Tomasz; Mucha, Mariusz; Pawlak, Robert; Frischknecht, Renato; Kaczmarek, Leszek

    2014-01-01

    Recent studies implicate extracellular proteases in synaptic plasticity, learning, and memory. The data are especially strong for such serine proteases as thrombin, tissue plasminogen activator, neurotrypsin, and neuropsin as well as matrix metalloproteinases, MMP-9 in particular. The role of those enzymes in the aforementioned phenomena is supported by the experimental results on the expression patterns (at the gene expression and protein and enzymatic activity levels) and functional studies, including knockout mice, specific inhibitors, etc. Counterintuitively, the studies have shown that the extracellular proteolysis is not responsible mainly for an overall degradation of the extracellular matrix (ECM) and loosening perisynaptic structures, but rather allows for releasing signaling molecules from the ECM, transsynaptic proteins, and latent form of growth factors. Notably, there are also indications implying those enzymes in the major neuropsychiatric disorders, probably by contributing to synaptic aberrations underlying such diseases as schizophrenia, bipolar, autism spectrum disorders, and drug addiction.

  3. Intestinal proteases of free-living and parasitic astigmatid mites.

    PubMed

    Holt, Deborah C; Burgess, Stewart T G; Reynolds, Simone L; Mahmood, Wajahat; Fischer, Katja

    2013-02-01

    Among arthropod pests, mites are responsible for considerable damage to crops, humans and other animals. However, detailed physiological data on these organisms remain sparse, mainly because of their small size but possibly also because of their extreme diversity. Focusing on intestinal proteases, we draw together information from three distinct mite species that all feed on skin but have separately adapted to a free-living, a strictly ecto-parasitic and a parasitic lifestyle. A wide range of studies involving immunohistology, molecular biology, X-ray crystallography and enzyme biochemistry of mite gut proteases suggests that these creatures have diverged considerably as house dust mites, sheep scab mites and scabies mites. Each species has evolved a particular variation of a presumably ancestral repertoire of digestive enzymes that have become specifically adapted to their individual environmental requirements.

  4. Mitochondrial proteases and protein quality control in ageing and longevity.

    PubMed

    Hamon, Marie-Paule; Bulteau, Anne-Laure; Friguet, Bertrand

    2015-09-01

    Mitochondria have been implicated in the ageing process and the lifespan modulation of model organisms. Mitochondria are the main providers of energy in eukaryotic cells but also represent both a major source of reactive oxygen species and targets for protein oxidative damage. Since protein damage can impair mitochondrial function, mitochondrial proteases are critically important for protein maintenance and elimination of oxidized protein. In the mitochondrial matrix, protein quality control is mainly achieved by the Lon and Clp proteases which are also key players in damaged mitochondrial proteins degradation. Accumulation of damaged macromolecules resulting from oxidative stress and failure of protein maintenance constitutes a hallmark of cellular and organismal ageing and is believed to participate to the age-related decline of cellular function. Hence, age-related impairment of mitochondrial protein quality control may therefore contribute to the age-associated build-up of oxidized protein and alterations of mitochondrial redox and protein homeostasis.

  5. Cockroach induces inflammatory responses through protease-dependent pathways.

    PubMed

    Wada, Kota; Matsuwaki, Yoshinori; Moriyama, Hiroshi; Kita, Hirohito

    2011-01-01

    Exposure to cockroaches is a major risk factor for asthma. Products from cockroaches may contain proteases and ligands for pattern recognition receptors. These molecules may activate airway inflammatory cells, such as eosinophils, that are involved in asthma. Among inner-city children, cockroach allergens play an especially important role in increasing asthma morbidity. The molecular mechanism for this association between cockroach exposure and asthma is not fully understood. Enzymatic activities from cockroaches activate inflammatory cells in the airways and may also exacerbate certain human airway diseases, such as asthma. We recently reported that cockroach extracts contain pepstatin A-sensitive proteases that activate PAR-2 and induce activation and degranulation of human eosinophils. This review focuses on the effects of cockroach on various inflammatory cells, including eosinophils, epithelial cells, fibroblasts, dendritic cells, and T cells, in allergic reactions.

  6. Design and Validation of Novel Chikungunya Virus Protease Inhibitors.

    PubMed

    Das, Pratyush Kumar; Puusepp, Laura; Varghese, Finny S; Utt, Age; Ahola, Tero; Kananovich, Dzmitry G; Lopp, Margus; Merits, Andres; Karelson, Mati

    2016-12-01

    Chikungunya virus (CHIKV; genus Alphavirus) is the causative agent of chikungunya fever. CHIKV replication can be inhibited by some broad-spectrum antiviral compounds; in contrast, there is very little information about compounds specifically inhibiting the enzymatic activities of CHIKV replication proteins. These proteins are translated in the form of a nonstructural (ns) P1234 polyprotein precursor from the CHIKV positive-strand RNA genome. Active forms of replicase enzymes are generated using the autoproteolytic activity of nsP2. The available three-dimensional (3D) structure of nsP2 protease has made it a target for in silico drug design; however, there is thus far little evidence that the designed compounds indeed inhibit the protease activity of nsP2 and/or suppress CHIKV replication. In this study, a set of 12 compounds, predicted to interact with the active center of nsP2 protease, was designed using target-based modeling. The majority of these compounds were shown to inhibit the ability of nsP2 to process recombinant protein and synthetic peptide substrates. Furthermore, all compounds found to be active in these cell-free assays also suppressed CHIKV replication in cell culture, the 50% effective concentration (EC50) of the most potent inhibitor being ∼1.5 μM. Analysis of stereoisomers of one compound revealed that inhibition of both the nsP2 protease activity and CHIKV replication depended on the conformation of the inhibitor. Combining the data obtained from different assays also indicates that some of the analyzed compounds may suppress CHIKV replication using more than one mechanism.

  7. Botulinum neurotoxin A protease: discovery of natural product exosite inhibitors.

    PubMed

    Silhár, Peter; Capková, Katerina; Salzameda, Nicholas T; Barbieri, Joseph T; Hixon, Mark S; Janda, Kim D

    2010-03-10

    A new mechanistic class of BoNT/A zinc metalloprotease inhibitors, from Echinacea, exemplified by the natural product d-chicoric acid (I1) is disclosed. A detailed evaluation of chicoric acid's mechanism of inhibition reveals that the inhibitor binds to an exosite, displays noncompetitive partial inhibition, and is synergistic with a competitive active site inhibitor when used in combination. Other components found in Echinacea, I3 and I4, were also inhibitors of the protease.

  8. Enhanced Thermostability of a Fungal Alkaline Protease by Different Additives

    PubMed Central

    Nirmal, Nilesh P.; Laxman, R. Seeta

    2014-01-01

    A fungal strain (Conidiobolus brefeldianus MTCC 5184) isolated from plant detritus secreted a high activity alkaline protease. Thermostability studies of the fungal alkaline protease (FAP) revealed that the protease is stable up to 50°C with 40% residual activity after one hour. Effect of various additives such as sugars, sugar alcohols, polyols, and salts, on the thermostability of FAP was evaluated. Among the additives tested, glycerol, mannitol, xylitol, sorbitol, and trehalose were found to be very effective in increasing the stability of FAP, which was found to be concentration dependent. Fivefold increase in residual activity of FAP was observed in the presence of trehalose (50%) and sorbitol (50%) at 50°C for 4 h, compared to FAP without additive. Other additives like calcium at 20 mM and 10–15% ammonium sulphate showed lower stability improvement than trehalose and sorbitol. NaCl, MgCl2, K2HPO4, and glycine were found to be poor stabilizers and showed only a marginal improvement. PEG 6000 did not show any increase in stability but was found to be slightly inhibitory. PMID:25105022

  9. New roles for perforins and proteases in apicomplexan egress.

    PubMed

    Roiko, Marijo S; Carruthers, Vern B

    2009-10-01

    Egress is a pivotal step in the life cycle of intracellular pathogens initiating the transition from an expiring host cell to a fresh target cell. While much attention has been focused on understanding cell invasion by intracellular pathogens, recent work is providing a new appreciation of mechanisms and therapeutic potential of microbial egress. This review highlights recent insight into cell egress by apicomplexan parasites and emerging contributions of membranolytic and proteolytic secretory products, along with host proteases. New findings suggest that Toxoplasma gondii secretes a pore-forming protein, TgPLP1, during egress that facilitates parasite escape from the cell by perforating the parasitophorous membrane. Also, in a cascade of proteolytic events, Plasmodium falciparum late-stage schizonts activate and secrete a subtilisin, PfSUB1, which processes enigmatic putative proteases called serine-repeat antigens that contribute to merozoite egress. A new report also suggests that calcium-activated host proteases called calpains aid parasite exit, possibly by acting upon the host cytoskeleton. Together these discoveries reveal important new molecular players involved in the principal steps of egress by apicomplexans.

  10. Luminal Cathepsin G and Protease-Activated Receptor 4

    PubMed Central

    Dabek, Marta; Ferrier, Laurent; Roka, Richard; Gecse, Krisztina; Annahazi, Anita; Moreau, Jacques; Escourrou, Jean; Cartier, Christel; Chaumaz, Gilles; Leveque, Mathilde; Ait-Belgnaoui, Afifa; Wittmann, Tibor; Theodorou, Vassilia; Bueno, Lionel

    2009-01-01

    Impairment of the colonic epithelial barrier and neutrophil infiltration are common features of inflammatory bowel disease. Luminal proteases affect colonic permeability through protease-activated receptors (PARs). We evaluated: (i) whether fecal supernatants from patients with ulcerative colitis (UC) trigger alterations of colonic paracellular permeability and inflammation, and (ii) the roles of cathepsin G (Cat-G), a neutrophil serine protease, and its selective receptor, PAR4, in these processes. Expression levels of both PAR4 and Cat-G were determined in colonic biopsies from UC and healthy subjects. The effects of UC fecal supernatants on colonic paracellular permeability were measured in murine colonic strips. Involvement of Cat-G and PAR4 was evaluated using pepducin P4pal-10 and specific Cat-G inhibitor (SCGI), respectively. In addition, the effect of PAR4-activating peptide was assessed. UC fecal supernatants, either untreated or pretreated with SCGI, were infused into mice, and myeloperoxidase activity was determined. PAR4 was found to be overexpressed in UC colonic biopsies. Increased colonic paracellular permeability that was triggered by UC fecal supernatants was blocked by both SCGI (77%) and P4pal-10 (85%). Intracolonic infusion of UC fecal supernatants into mice increased myeloperoxidase activity. This effect was abolished by SCGI. These observations support that both Cat-G and PAR4 play key roles in generating and/or amplifying relapses in UC and provide a rationale for the development of new therapeutic agents in the treatment of this disease. PMID:19528350

  11. Functional Divergence of Two Secreted Immune Proteases of Tomato.

    PubMed

    Ilyas, Muhammad; Hörger, Anja C; Bozkurt, Tolga O; van den Burg, Harrold A; Kaschani, Farnusch; Kaiser, Markus; Belhaj, Khaoula; Smoker, Matthew; Joosten, Matthieu H A J; Kamoun, Sophien; van der Hoorn, Renier A L

    2015-08-31

    Rcr3 and Pip1 are paralogous secreted papain-like proteases of tomato. Both proteases are inhibited by Avr2 from the fungal pathogen Cladosporium fulvum, but only Rcr3 acts as a co-receptor for Avr2 recognition by the tomato Cf-2 immune receptor. Here, we show that Pip1-depleted tomato plants are hyper-susceptible to fungal, bacterial, and oomycete plant pathogens, demonstrating that Pip1 is an important broad-range immune protease. By contrast, in the absence of Cf-2, Rcr3 depletion does not affect fungal and bacterial infection levels but causes increased susceptibility only to the oomycete pathogen Phytophthora infestans. Rcr3 and Pip1 reside on a genetic locus that evolved over 36 million years ago. These proteins differ in surface-exposed residues outside the substrate-binding groove, and Pip1 is 5- to 10-fold more abundant than Rcr3. We propose a model in which Rcr3 and Pip1 diverged functionally upon gene duplication, possibly driven by an arms race with pathogen-derived inhibitors or by coevolution with the Cf-2 immune receptor detecting inhibitors of Rcr3, but not of Pip1.

  12. Pathogen-secreted proteases activate a novel plant immune pathway.

    PubMed

    Cheng, Zhenyu; Li, Jian-Feng; Niu, Yajie; Zhang, Xue-Cheng; Woody, Owen Z; Xiong, Yan; Djonović, Slavica; Millet, Yves; Bush, Jenifer; McConkey, Brendan J; Sheen, Jen; Ausubel, Frederick M

    2015-05-14

    Mitogen-activated protein kinase (MAPK) cascades play central roles in innate immune signalling networks in plants and animals. In plants, however, the molecular mechanisms of how signal perception is transduced to MAPK activation remain elusive. Here we report that pathogen-secreted proteases activate a previously unknown signalling pathway in Arabidopsis thaliana involving the Gα, Gβ, and Gγ subunits of heterotrimeric G-protein complexes, which function upstream of an MAPK cascade. In this pathway, receptor for activated C kinase 1 (RACK1) functions as a novel scaffold that binds to the Gβ subunit as well as to all three tiers of the MAPK cascade, thereby linking upstream G-protein signalling to downstream activation of an MAPK cascade. The protease-G-protein-RACK1-MAPK cascade modules identified in these studies are distinct from previously described plant immune signalling pathways such as that elicited by bacterial flagellin, in which G proteins function downstream of or in parallel to an MAPK cascade without the involvement of the RACK1 scaffolding protein. The discovery of the new protease-mediated immune signalling pathway described here was facilitated by the use of the broad host range, opportunistic bacterial pathogen Pseudomonas aeruginosa. The ability of P. aeruginosa to infect both plants and animals makes it an excellent model to identify novel immunoregulatory strategies that account for its niche adaptation to diverse host tissues and immune systems.

  13. Proteases at work: cues for understanding neural development and degeneration

    PubMed Central

    Saftig, Paul; Bovolenta, Paola

    2015-01-01

    Proteolytical processing of membrane bound molecules is a fundamental mechanism for the degradation of these proteins as well as for controlling cell-to-cell communication, which is at the basis of tissue development and homeostasis. Members of families of metalloproteinases and intra-membrane proteases are major effectors of these events. A recent workshop in Baeza, Spain, was devoted to discuss how this mechanism coordinates brain development and how its dysfunction leads to brain pathologies. Herein we summarize the findings presented during this workshop, which illuminate the role of metalloproteinases, including matrix metalloproteinase, A Disintegrin and Metalloproteinase-proteases and intra-membrane proteases, in the regulation of neurogenesis, axon guidance, and synaptogenesis as well as in neurodegeneration. Indeed, there is increasing evidence that proteolysis at the membrane is directly linked to neuropathologies such as Alzheimer Disease and autism spectrum or prion disorders. These proteolytic events are tightly regulated and we are just at the beginning of understanding how these processes could be exploited to design therapeutic treatments aimed at alleviating psychiatric and neurodegenerative pathologies. PMID:25999813

  14. Evolution of the protease-activated receptor family in vertebrates

    PubMed Central

    JIN, MIN; YANG, HAI-WEI; TAO, AI-LIN; WEI, JI-FU

    2016-01-01

    Belonging to the G protein-coupled receptor (GPcr) family, the protease-activated receptors (Pars) consist of 4 members, PAR1-4. PARs mediate the activation of cells via thrombin, serine and other proteases. Such protease-triggered signaling events are thought to be critical for hemostasis, thrombosis and other normal pathological processes. In the present study, we examined the evolution of PARs by analyzing phylogenetic trees, chromosome location, selective pressure and functional divergence based on the 169 functional gene alignment sequences from 57 vertebrate gene sequences. We found that the 4 PARs originated from 4 invertebrate ancestors by phylogenetic trees analysis. The selective pressure results revealed that only PAR1 appeared by positive selection during its evolution, while the other PAR members did not. In addition, we noticed that although these PARs evolved separately, the results of functional divergence indicated that their evolutional rates were similar and their functions did not significantly diverge. The findings of our study provide valuable insight into the evolutionary history of the vertebrate PAR family. PMID:26820116

  15. [Extracellular proteases of mycelial fungi as participants of pathogenic processes].

    PubMed

    Dunaevskiĭ, Ia E; Matveeva, A R; Fatkhullina, G N; Beliakova, G A; Kolomiets, T M; Kovalenko, E D; Belozerskiĭ, M A

    2008-01-01

    The interest in proteases secreted by mycelial fungi is due to several reasons of which one of the most important is their involvement in the initiation and development of the pathogenic process. A comparison of saprophytic and phytopathogenic mycelial fungi revealed one characteristic feature, namely, the appearance of a new trypsin-like activity in phytopathogens that is absent in saprophytes. To clear up the question of whether the degree of pathogenicity of a fungus is related to the activity of secreted trypsin-like protease, several species of Fusarium of various pathogenicity were compared. In two species, F. sporotrichioides (which causes ear fusa-riosis of rye) and F. heterosporum (the causative agent of root rot in wheat), a clear correlation between the activity and pathogenicity was revealed: the more pathogenetic F. sporotrichioides exhibited a higher extracellular trypsin-like activity than the less pathogenetic species F. heterosporum. Thus, the presence of trypsin-like activity in a saprotroph-pathogen pair may be an indicator of the pathogenicity of a fungus; in some cases, the value of this activity may indicate the degree of its pathogenicity. This suggests that trypsin-like proteases specific to phytopathogens are directly involved in the pathogenetic process, probably, through interaction with the "sentry" protein or the product of the resistance gene.

  16. Optimum production and characterization of an acid protease from marine yeast Metschnikowia reukaufii W6b

    NASA Astrophysics Data System (ADS)

    Li, Jing; Peng, Ying; Wang, Xianghong; Chi, Zhenming

    2010-12-01

    The marine yeast strain W6b isolated from sediment of the South China Sea was found to produce a cell-bound acid protease. The crude acid protease produced by this marine yeast showed the highest activity at pH 3.5 and 40 °C. The optimal pH and temperature for the crude acid protease were in agreement with those for acid protease produced by the terrestrial yeasts. The optimal medium of the acid protease production was seawater containing 1.0% glucose, 1.5% casein, and 0.5% yeast extract, and the optimal cultivation conditions of the acid protease production were pH 4.0, a temperature of 25 °C and a shaking speed of 140 rmin-1. Under the optimal conditions, 72.5 UmL-1 of acid protease activity could be obtained in cell suspension within 48 h of fermentation at shake flask level. The acid protease production was induced by high-molecular-weight nitrogen sources and repressed by low-molecular-weight nitrogen sources. Skimmed-milk-clotting test showed that the crude acid protease from the cell suspension of the yeast W6b had high skimmed milk coagulability. The acid protease produced by M. reukaufii W6b may have highly potential applications in cheese, food and fermentation industries.

  17. Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

    PubMed Central

    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

    2013-01-01

    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

  18. A Culture-Based Method for Determining the Production of Secreted Protease Inhibitors

    PubMed Central

    Quintero, David; Bermudes, David

    2014-01-01

    We have developed a culture-based method for determining the production of secreted protease inhibitors. The assay utilizes standard proteolysis detection plates to support microbial growth followed by infiltrating the plate with a protease and subsequently detecting the remaining protein by trichloroacetic acid (TCA) precipitation, or by bromocreosol green (BCG) or Ponseau S (PS) staining. The presence of a protease inhibitor can be observed in the form of a protected zone of protein around the protease inhibitor-producing strain. Using the protease inhibitors α-2-macroglobulin, aprotinin, leupeptin, and bestatin and the primary and secondary forms of Photorhabdus luminescens in combination with the protease trypsin, we were able to demonstrate that the assay is specific for the cognate inhibitor of the protease and for bacteria secreting protease inhibitors. In addition, when casein-containing plates were used, the size of the diffusion zone was inversely correlated with the molecular weight of the inhibitor allowing a relative estimation of the protease inhibitor molecular weight. This assay is useful for detecting the presence of microbial secreted protease inhibitors and may reveal their production by microorganisms that were not previously recognized to produce them. PMID:24632514

  19. Enteric bacterial proteases in inflammatory bowel disease- pathophysiology and clinical implications.

    PubMed

    Carroll, Ian M; Maharshak, Nitsan

    2013-01-01

    Numerous reports have identified a dysbiosis in the intestinal microbiota in patients suffering from inflammatory bowel diseases (IBD), yet the mechanism(s) in which this complex microbial community initiates or perpetuates inflammation remains unclear. The purpose of this review is to present evidence for one such mechanism that implicates enteric microbial derived proteases in the pathogenesis of IBD. We highlight and discuss studies demonstrating that proteases and protease receptors are abundant in the digestive system. Additionally, we investigate studies demonstrating an association between increased luminal protease activity and activation of protease receptors, ultimately resulting in increased intestinal permeability and exacerbation of colitis in animal models as well as in human IBD. Proteases are essential for the normal functioning of bacteria and in some cases can serve as virulence factors for pathogenic bacteria. Although not classified as traditional virulence factors, proteases originating from commensal enteric bacteria also have a potential association with intestinal inflammation via increased enteric permeability. Reports of increased protease activity in stools from IBD patients support a possible mechanism for a dysbiotic enteric microbiota in IBD. A better understanding of these pathways and characterization of the enteric bacteria involved, their proteases, and protease receptors may pave the way for new therapeutic approaches for these diseases.

  20. Detergent-compatible proteases: microbial production, properties, and stain removal analysis.

    PubMed

    Niyonzima, Francois Niyongabo; More, Sunil

    2015-01-01

    Proteases are one of the most important commercial enzymes used in various industrial domains such as detergent and leather industries. The alkaline proteases as well as other detergent-compatible enzymes such as lipases and amylases serve now as the key components in detergent formulations. They break down various stains during fabric washing. The search for detergent-compatible proteases with better properties is a continuous exercise. The current trend is to use detergent-compatible proteases that are stable over a wide temperature range. Although the proteases showing stability at elevated pH have the capacity to be used in detergent formulations, their usage can be significant if they are also stable and compatible with detergent and detergent ingredients, and also able to remove protein stains. Despite the existence of some reviews on alkaline proteases, there is no specification for the use of alkaline proteases as detergent additives. The present review describes the detergent-compatible proteases tested as detergent additives. An overview was provided for screening, optimization, purification, and properties of detergent compatible proteases, with an emphasis on the stability and compatibility of the alkaline proteases with the detergent and detergent compounds, as well as stain removal examination methods.

  1. In vivo sequence diversity of the protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant variants in untreated subjects.

    PubMed Central

    Lech, W J; Wang, G; Yang, Y L; Chee, Y; Dorman, K; McCrae, D; Lazzeroni, L C; Erickson, J W; Sinsheimer, J S; Kaplan, A H

    1996-01-01

    We have evaluated the sequence diversity of the protease human immunodeficiency virus type 1 in vivo. Our analysis of 246 protease coding domain sequences obtained from 12 subjects indicates that amino acid substitutions predicted to give rise to protease inhibitor resistance may be present in patients who have not received protease inhibitors. In addition, we demonstrated that amino acid residues directly involved in enzyme-substrate interactions may be varied in infected individuals. Several of these substitutions occurred in combination either more or less frequently than would be expected if their appearance was independent, suggesting that one substitution may compensate for the effects of another. Taken together, our analysis indicates that the human immunodeficiency virus type 1 protease has flexibility sufficient to vary critical subsites in vivo, thereby retaining enzyme function and viral pathogenicity. PMID:8627733

  2. Contribution of Gag and protease to variation in susceptibility to protease inhibitors between different strains of subtype B human immunodeficiency virus type 1.

    PubMed

    Sutherland, Katherine A; Mbisa, Jean L; Cane, Patricia A; Pillay, Deenan; Parry, Chris M

    2014-01-01

    Recent reports have shown that human immunodeficiency virus type 1 (HIV-1) Gag can directly affect susceptibility to protease inhibitors (PIs) in the absence of known resistance mutations in protease. Inclusion of co-evolved Gag alongside protease in phenotypic drug susceptibility assays can alter PI susceptibility in comparison with protease with a WT Gag. Using a single-replication-cycle assay encompassing full-length Gag together with protease we demonstrated significant variation in PI susceptibility between a number of PI-naïve subtype B viruses. Six publicly available subtype B molecular clones, namely HXB2, NL4-3, SF2, YU2, JRFL and 89.6, displayed up to nine-fold reduced PI susceptibility in comparison with the assay reference strain. For two molecular clones, YU2 and JRFL, Gag contributed solely to the observed reduction in susceptibility, with the N-terminal region of Gag contributing significantly. Gag and protease from treatment-naïve, patient-derived viruses also demonstrated significant variation in susceptibility, with up to a 17-fold reduction to atazanavir in comparison with the assay reference strain. In contrast to the molecular clones, protease was the main determinant of the reduced susceptibility. Common polymorphisms in protease, including I13V, L63P and A71T, were shown to contribute to this reduction in PI susceptibility, in the absence of major resistance mutations. This study demonstrated significant variation in PI susceptibility of treatment-naïve patient viruses, and provided further evidence of the independent role of Gag, the protease substrate and in particular the N-terminus of Gag in PI susceptibility. It also highlighted the importance of considering co-evolved Gag and protease when assessing PI susceptibility.

  3. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-01-31

    CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT...could be fully inhibited at a 1:1 molar ratio by the naturally-occuring proteinaceous trypsin inhibitors BBI from soybeans and CI from chickpeas ...substrates. These activities were fully inhibited by the proteinaceous trypsin-chymotrypsin inhibitors BBI from soybeans and CI from chickpeas when assayed

  4. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain.

    DTIC Science & Technology

    1987-06-30

    CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT (Coninue, on reverse aide It necessary...CI from chickpeas . Attempts are now in progress to separate and isolate these trypsin-and chymotrypsin-like enzymes. (3) Locust proteinases...and from chickpeas (CI). In addition, a specific Tribolium proteinase inhibitor from soybeans was separated. SIGNIFICANT FINDINGS A. The detection of

  5. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain.

    DTIC Science & Technology

    1988-01-31

    PROTEASES; INSECT TRYPSINS and CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBLTOR; SOYBEAN...inhibitors from legume .seeds, such as the Bowman-Birk inhibitor (BBI) from soybeans and CI from chickpeas . The purified and partially-characterized insect DD...inhibited by the trypsin - chymotrypsin inhibitors BBI from soybeans and CI from chickpeas . Separation and purification of these enzymes by gel

  6. Identification of novel malarial cysteine protease inhibitors using structure-based virtual screening of a focused cysteine protease inhibitor library.

    PubMed

    Shah, Falgun; Mukherjee, Prasenjit; Gut, Jiri; Legac, Jennifer; Rosenthal, Philip J; Tekwani, Babu L; Avery, Mitchell A

    2011-04-25

    Malaria, in particular that caused by Plasmodium falciparum , is prevalent across the tropics, and its medicinal control is limited by widespread drug resistance. Cysteine proteases of P. falciparum , falcipain-2 (FP-2) and falcipain-3 (FP-3), are major hemoglobinases, validated as potential antimalarial drug targets. Structure-based virtual screening of a focused cysteine protease inhibitor library built with soft rather than hard electrophiles was performed against an X-ray crystal structure of FP-2 using the Glide docking program. An enrichment study was performed to select a suitable scoring function and to retrieve potential candidates against FP-2 from a large chemical database. Biological evaluation of 50 selected compounds identified 21 diverse nonpeptidic inhibitors of FP-2 with a hit rate of 42%. Atomic Fukui indices were used to predict the most electrophilic center and its electrophilicity in the identified hits. Comparison of predicted electrophilicity of electrophiles in identified hits with those in known irreversible inhibitors suggested the soft-nature of electrophiles in the selected target compounds. The present study highlights the importance of focused libraries and enrichment studies in structure-based virtual screening. In addition, few compounds were screened against homologous human cysteine proteases for selectivity analysis. Further evaluation of structure-activity relationships around these nonpeptidic scaffolds could help in the development of selective leads for antimalarial chemotherapy.

  7. Using C. elegans to Identify the Protease Targets of Serpins In Vivo

    PubMed Central

    Bhatia, Sangeeta R.; Miedel, Mark T.; Chotoo, Cavita K.; Graf, Nathan J.; Hood, Brian L.; Conrads, Thomas P.; Silverman, Gary A.; Luke, Cliff J.

    2015-01-01

    Most serpins inhibit serine and/or cysteine proteases, and their inhibitory activities are usually defined in vitro. However, the physiological protease targets of most serpins are unknown despite many years of research. This may be due to the rapid degradation of the inactive serpin:protease complexes and/or the conditions under which the serpin inhibits the protease. The model organism Caenorhabditis elegans is an ideal system for identifying protease targets due to powerful forward and reverse genetics, as well as the ease of creating transgenic animals. Using combinatorial approaches of genetics and biochemistry in C. elegans, the true in vivo protease targets of the endogenous serpins can be elucidated. PMID:21683259

  8. Recent developments in production and biotechnological applications of cold-active microbial proteases.

    PubMed

    Kuddus, Mohammed; Ramteke, Pramod W

    2012-11-01

    Microbial proteases that occupy a pivotal position with respect to their commercial applications are most important hydrolytic enzymes and have been studied extensively since the advent of enzymology. Cold-adapted microorganisms are potential source of cold-active proteases and they have been isolated from the cold regions. Although there are many microbial sources available for producing proteases, only few are recognized as commercial producer. Cold-active proteases along with their producing microbes are of commercial value and find multiple applications in various industrial and biotechnological sectors such as additives in detergents, additives in food industries, environmental bioremediations, biotransformation and molecular biology applications. Therefore, cold-active proteases are the enzymes of choice for many biotechnologists, microbiologists, biochemists, environmentalists and biochemical engineers. In the present review, we discuss some novel sources along with recent developments in production and biotechnological applications of cold-active microbial proteases.

  9. A tobacco etch virus protease with increased substrate tolerance at the P1' position.

    PubMed

    Renicke, Christian; Spadaccini, Roberta; Taxis, Christof

    2013-01-01

    Site-specific proteases are important tools for in vitro and in vivo cleavage of proteins. They are widely used for diverse applications, like protein purification, assessment of protein-protein interactions or regulation of protein localization, abundance or activity. Here, we report the development of a procedure to select protease variants with altered specificity based on the well-established Saccharomyces cerevisiae adenine auxotrophy-dependent red/white colony assay. We applied this method on the tobacco etch virus (TEV) protease to obtain a protease variant with altered substrate specificity at the P1' Position. In vivo experiments with tester substrates showed that the mutated TEV protease still efficiently recognizes the sequence ENLYFQ, but has almost lost all bias for the amino acid at the P1' Position. Thus, we generated a site-specific protease for synthetic approaches requiring in vivo generation of proteins or peptides with a specific N-terminal amino acid.

  10. A survey of IgA protease production among clinical isolates of Proteeae.

    PubMed

    Senior, B W; Albrechtsen, M; Kerr, M A

    1988-01-01

    A collection of 100 strains of Proteeae, in which all species within the tribe were represented, was examined for IgA protease production. The strains were isolated from various clinical specimens from sick and healthy persons in several countries. IgA protease-producing strains were not found amongst species of Providencia and Morganella but were common in Proteus spp. All the strains of P. mirabilis and P. penneri and many of the strains of P. vulgaris examined produced an EDTA-sensitive protease that cleaved the IgA heavy chain outside the hinge region. The proteus enzyme was different in this respect from the EDTA-sensitive, hinge-cutting proteases of other bacteria. The ability to produce IgA protease was unrelated to the O antigenicity, biotype or bacteriocin type of the strain. IgA protease production may be an important virulence mechanism for Proteus strains.

  11. Targeting Proteases in Cardiovascular Diseases by Mass Spectrometry-Based Proteomics

    PubMed Central

    Klingler, Diana; Hardt, Markus

    2012-01-01

    Proteases hydrolyze peptide bonds, thereby controlling the function of proteins and peptides on the posttranslational level. In the cardiovascular system, proteases play pivotal roles in the regulation of blood pressure, coagulation and other essential physiological processes. Accordingly, proteases are prime targets for therapeutic interventions and diagnostics. Proteases are part of complex proteolytic networks comprised of enzymes, inhibitors, activators, substrates and cleavage products. Analyzing these networks on a system-wide level is essential to understanding cardiovascular function and how dysregulation can lead to pathological conditions. Mass spectrometry-based quantitative and dynamic proteomics approaches are leading the way to enhance our knowledge of proteolytic networks such as the renin-angiotensin-system. Here, we critically review proteomics tools utilized in protease biology and provide an overview on how these methods can be used to characterize and validate protease function. PMID:22511707

  12. Purification, characterization and identification of a senescence related serine protease in dark-induced senescent wheat leaves.

    PubMed

    Wang, Renxian; Liu, Shaowei; Wang, Jin; Dong, Qiang; Xu, Langlai; Rui, Qi

    2013-11-01

    Senescence-related proteases play important roles in leaf senescence by regulating protein degradation and nutrient recycling. A 98.9kDa senescence-related protease EP3 in wheat leaves was purified by ammonium sulfate precipitation, Q-Sepharose fast flow anion exchange chromatography and gel slicing after gel electrophoresis. Due to its relatively high thermal stability, its protease activity did not decrease after incubation at 40°C for 1-h. EP3 protease was suggested to be a metal-dependent serine protease, because its activity was inhibited by serine protease inhibitors PMSF and AEBSF and metal related protease inhibitor EGTA. It was identified as a subtilisin-like serine protease of the S8A family based on data from both mass spectrometry and the cloned cDNA sequence. Therefore, these data suggest that a serine protease of the S8A subfamily with specific biochemical properties is involved in senescence-associated protein degradation.

  13. Purification and characterization of organic solvent stable serine alkaline protease from newly isolated Bacillus circulans M34.

    PubMed

    Sari, Esma; Loğoğlu, Elif; Öktemer, Atilla

    2015-09-01

    A protease from newly isolated Bacillus circulans M34 was purified by Q-Sepharose anion exchange chromatography and Sepharose-bacitracin affinity chromatography followed by (NH4)2SO4 precipitation. The molecular mass of the purified enzyme was determined using SDS-PAGE. The optimum pH and temperature for protease activity were 11 and 50°C, respectively. The effect of various metal ions on protease activity was investigated. Alkaline protease from Bacillus circulans M34 wase activated by Zn(2+), Cu(2+) and Co(2+) up to 31%. The purified protease was found to be stable in the organic solvents, surfactants and oxidizing agent. The substrate specificity of purified protease was investigated towards different substrates. The protease was almost completely inhibited by the serine protease inhibitor phenylmethanesulfonyl fluoride. The kinetic parameters of the purified protease, maximum rate (Vmax) and Michaelis constant (Km), were determined using a Lineweaver-Burk plot.

  14. A New Class of Serine and Cysteine Protease Inhibitor with Chemotherapeutic Potential

    DTIC Science & Technology

    1999-06-01

    also be used to produce a serine protease inhibitor. Similar to the cysteine inhibitors, a dipeptide side chain is attached to the ring which is...which relieves the 7 strain (Figure 3). Serine and cysteine proteases use a mechanism to cleave peptide bonds which involves addition of a catalytic...serine and cysteine proteases share a similar mechanism for hydrolyzing amide bonds , we expect that 4-heterocyclohexanones should be good inhibitors

  15. Development of activity-based probes for trypsin-family serine proteases.

    PubMed

    Pan, Zhengying; Jeffery, Douglas A; Chehade, Kareem; Beltman, Jerlyn; Clark, James M; Grothaus, Paul; Bogyo, Matthew; Baruch, Amos

    2006-06-01

    A series of diphenylphosphonate-based probes were developed for the trypsin-like serine proteases. These probes selectively target serine proteases rather than general serine hydrolases that are targets for fluorophosphonate-based probes. This increased selectivity allows detection of low abundance serine proteases in complex proteomes using simple SDS-PAGE methods. We present here the application of multiple probes in enzyme activity profiling of intact mast cells, a type of inflammatory cell implicated in allergy and autoimmune diseases.

  16. MALT1 Protease Activity Is Required for Innate and Adaptive Immune Responses.

    PubMed

    Yu, Jong W; Hoffman, Sandy; Beal, Allison M; Dykon, Angela; Ringenberg, Michael A; Hughes, Anna C; Dare, Lauren; Anderson, Amber D; Finger, Joshua; Kasparcova, Viera; Rickard, David; Berger, Scott B; Ramanjulu, Joshi; Emery, John G; Gough, Peter J; Bertin, John; Foley, Kevin P

    2015-01-01

    CARMA-BCL10-MALT1 signalosomes play important roles in antigen receptor signaling and other pathways. Previous studies have suggested that as part of this complex, MALT1 functions as both a scaffolding protein to activate NF-κB through recruitment of ubiquitin ligases, and as a protease to cleave and inactivate downstream inhibitory signaling proteins. However, our understanding of the relative importance of these two distinct MALT1 activities has been hampered by a lack of selective MALT1 protease inhibitors with suitable pharmacologic properties. To fully investigate the role of MALT1 protease activity, we generated mice homozygous for a protease-dead mutation in MALT1. We found that some, but not all, MALT1 functions in immune cells were dependent upon its protease activity. Protease-dead mice had defects in the generation of splenic marginal zone and peritoneal B1 B cells. CD4+ and CD8+ T cells displayed decreased T cell receptor-stimulated proliferation and IL-2 production while B cell receptor-stimulated proliferation was partially dependent on protease activity. In dendritic cells, stimulation of cytokine production through the Dectin-1, Dectin-2, and Mincle C-type lectin receptors was also found to be partially dependent upon protease activity. In vivo, protease-dead mice had reduced basal immunoglobulin levels, and showed defective responses to immunization with T-dependent and T-independent antigens. Surprisingly, despite these decreased responses, MALT1 protease-dead mice, but not MALT1 null mice, developed mixed inflammatory cell infiltrates in multiple organs, suggesting MALT1 protease activity plays a role in immune homeostasis. These findings highlight the importance of MALT1 protease activity in multiple immune cell types, and in integrating immune responses in vivo.

  17. A Novel Apoptotic Protease Activated in Human Breast Cancer Cells After Poisoning Topoisomerase I

    DTIC Science & Technology

    1999-10-01

    tocopherol, N- acetyl -L- cysteine ( NAC ) or pyrrolidinedithiocarbamate (PDTC)) did not significantly affect lethality caused by B-lap exposure (data not...will be required for the cloning of this novel noncaspase cysteine protease. The new hypothesis being tested is that B- lap activates calpain, which...caspase cysteine protease was activated within 4-8 hours, concomitant with the appearance of DNA fragmentation, measured by TUNEL assays; (e) protease

  18. Algae -- a poor man's HAART?

    PubMed

    Teas, Jane; Hebert, James R; Fitton, J Helen; Zimba, Paul V

    2004-01-01

    Drawing inferences from epidemiologic studies of HIV/AIDS and in vivo and in vitro HIV inhibition by algae, we propose algal consumption as one unifying characteristic of countries with anomalously low rates. HIV/AIDS incidence and prevalence in Eastern Asia ( approximately 1/10000 adults in Japan and Korea), compared to Africa ( approximately 1/10 adults), strongly suggest that differences in IV drug use and sexual behavior are insufficient to explain the 1000-fold variation. Even in Africa, AIDS/HIV rates vary. Chad has consistently reported low rates of HIV/AIDS (2-4/100). Possibly not coincidentally, most people in Japan and Korea eat seaweed daily and the Kanemba, one of the major tribal groups in Chad, eat a blue green alga (Spirulina) daily. Average daily algae consumption in Asia and Africa ranges between 1 and 2 tablespoons (3-13 g). Regular consumption of dietary algae might help prevent HIV infection and suppress viral load among those infected.

  19. Cysteine Proteases: Modes of Activation and Future Prospects as Pharmacological Targets

    PubMed Central

    Verma, Sonia; Dixit, Rajnikant; Pandey, Kailash C.

    2016-01-01

    Proteolytic enzymes are crucial for a variety of biological processes in organisms ranging from lower (virus, bacteria, and parasite) to the higher organisms (mammals). Proteases cleave proteins into smaller fragments by catalyzing peptide bonds hydrolysis. Proteases are classified according to their catalytic site, and distributed into four major classes: cysteine proteases, serine proteases, aspartic proteases, and metalloproteases. This review will cover only cysteine proteases, papain family enzymes which are involved in multiple functions such as extracellular matrix turnover, antigen presentation, processing events, digestion, immune invasion, hemoglobin hydrolysis, parasite invasion, parasite egress, and processing surface proteins. Therefore, they are promising drug targets for various diseases. For preventing unwanted digestion, cysteine proteases are synthesized as zymogens, and contain a prodomain (regulatory) and a mature domain (catalytic). The prodomain acts as an endogenous inhibitor of the mature enzyme. For activation of the mature enzyme, removal of the prodomain is necessary and achieved by different modes. The pro-mature domain interaction can be categorized as protein–protein interactions (PPIs) and may be targeted in a range of diseases. Cysteine protease inhibitors are available that can block the active site but no such inhibitor available yet that can be targeted to block the pro-mature domain interactions and prevent it activation. This review specifically highlights the modes of activation (processing) of papain family enzymes, which involve auto-activation, trans-activation and also clarifies the future aspects of targeting PPIs to prevent the activation of cysteine proteases. PMID:27199750

  20. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  1. A primitive enzyme for a primitive cell: the protease required for excystation of Giardia.

    PubMed

    Ward, W; Alvarado, L; Rawlings, N D; Engel, J C; Franklin, C; McKerrow, J H

    1997-05-02

    Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells. To initiate infection, trophozoites emerge from a cyst in the host. Excystation is blocked by specific cysteine protease inhibitors. Using a biotinylated inhibitor, the target protease was identified and its corresponding gene cloned. The protease was localized to vesicles that release their contents just prior to excystation. The Giardia protease is the earliest known branch of the cathepsin B family. Its phylogeny confirms that the cathepsin B lineage evolved in primitive eukaryotic cells, prior to the divergence of plant and animal kingdoms, and underscores the diversity of cellular functions that this enzyme family facilitates.

  2. Characterization of bacterial proteases with a panel of fluorescent peptide substrates.

    PubMed

    Wildeboer, Dirk; Jeganathan, Fiona; Price, Robert G; Abuknesha, Ramadan A

    2009-01-15

    Bacteria produce a range of proteolytic enzymes. In an attempt to detect and identify bacteria on the basis of their protease activity, a panel of protease substrates was investigated. Peptides conjugated to the fluorophore 7-amino-4-methylcoumarin (AMC) are well-established substrates for measuring protease activity. Although peptide-AMC substrates are generally not specific for a single protease, a unique pattern can be achieved for both highly specific enzymes and those with a broader substrate range by comparing different peptide substrates. The panel of 7 peptide-AMC substrates chosen exhibited a unique pattern for nine microbial proteases. The selected peptides were used to determine protease activity in cultured strains of Pseudomonas aeruginosa and Staphylococcus aureus. A signal pattern obtained with peptides with arginine, lysine, and tyrosine in the P1 position characterized the bacterial protease activities in these samples. The kinetic parameters for the three best substrates for the P. aeruginosa sample were calculated. Further information about substrate specificity was gained by the selective use of protease inhibitors. The results presented show that peptide-AMC substrates provide a simple and sensitive tool to characterize protease activity in microbiological samples and that they have the potential to identify and distinguish different bacterial species.

  3. Proteochemometrics mapping of the interaction space for retroviral proteases and their substrates.

    PubMed

    Kontijevskis, Aleksejs; Petrovska, Ramona; Yahorava, Sviatlana; Komorowski, Jan; Wikberg, Jarl E S

    2009-07-15

    Understanding the complex interactions of retroviral proteases with their ligands is an important scientific challenge in efforts to achieve control of retroviral infections. Development of drug resistance because of high mutation rates and extensive polymorphisms causes major problems in treating the deadly diseases these viruses cause, and prompts efforts to identify new strategies. Here we report a comprehensive analysis of the interaction of 63 retroviral proteases from nine different viral species with their substrates and inhibitors based on publicly available data from the past 17years of retroviral research. By correlating physico-chemical descriptions of retroviral proteases and substrates to their biological activities we constructed a highly statistically valid 'proteochemometric' model for the interactome of retroviral proteases. Analysis of the model indicated amino acid positions in retroviral proteases with the highest influence on ligand activity and revealed general physicochemical properties essential for tight binding of substrates across multiple retroviral proteases. Hexapeptide inhibitors developed based on the discovered general properties effectively inhibited HIV-1 proteases in vitro, and some exhibited uniformly high inhibitory activity against all HIV-1 proteases mutants evaluated. A generalized proteochemometric model for retroviral proteases interactome has been created and analysed in this study. Our results demonstrate the feasibility of using the developed general strategy in the design of inhibitory peptides that can potentially serve as templates for drug resistance-improved HIV retardants.

  4. Immobilized protease on the magnetic nanoparticles used for the hydrolysis of rapeseed meals

    NASA Astrophysics Data System (ADS)

    Jin, Xin; Li, Ju-Fang; Huang, Ping-Ying; Dong, Xu-Yan; Guo, Lu-Lu; Yang, Liang; Cao, Yuan-Cheng; Wei, Fang; Zhao, Yuan-Di; Chen, Hong

    2010-07-01

    (3-aminopropl) triethoxysilaneand modified magnetic nanoparticles with the average diameter of 25.4 nm were synthesized in water-phase co-precipitation method. And then these nanoparticles were covalently coupled with alkaline protease as enzyme carrier by using 1,4-phenylene diisothlocyanate as coupling agent. Experiments showed that the immobilized protease can keep the catalytic bioactivity, which can reach to 47.8% when casein was served as substrate. Results showed that the catalytic activity of immobilized protease on these magnetic nanoparticles could retain 98.63±2.37% after 60 days. And it is more stable than the free protease during the shelf-life test. The enzyme reaction conditions such as optimum reaction temperature and pH are the same as free protease. Furthermore, mix-and-separate experiments showed that the immobilized protease could be recycled through the magnetic nanoparticles after the biocatalysis process. When the rapeseed meals were used as substrate, the degree of hydrolysis of immobilized alkaline protease achieved 9.86%, while it was 10.41% for the free protease. The macromolecular proteins of rapeseed meals were hydrolyzed by immobilized protease into small molecules such as polypeptides or amino acids. Thus, a novel efficient and economic way for the recycling of enzymes in the application of continuous production of active peptides was provided based on these magnetic nanoparticles.

  5. Potent inhibition of feline coronaviruses with peptidyl compounds targeting coronavirus 3C-like protease.

    PubMed

    Kim, Yunjeong; Mandadapu, Sivakoteswara Rao; Groutas, William C; Chang, Kyeong-Ok

    2013-02-01

    Feline coronavirus infection is common among domestic and exotic felid species and usually associated with mild or asymptomatic enteritis; however, feline infectious peritonitis (FIP) is a fatal disease of cats that is caused by systemic infection with a feline infectious peritonitis virus (FIPV), a variant of feline enteric coronavirus (FECV). Currently, there is no specific treatment approved for FIP despite the importance of FIP as the leading infectious cause of death in young cats. During the replication process, coronavirus produces viral polyproteins that are processed into mature proteins by viral proteases, the main protease (3C-like [3CL] protease) and the papain-like protease. Since the cleavages of viral polyproteins are an essential step for virus replication, blockage of viral protease is an attractive target for therapeutic intervention. Previously, we reported the generation of broad-spectrum peptidyl inhibitors against viruses that possess a 3C or 3CL protease. In this study, we further evaluated the antiviral effects of the peptidyl inhibitors against feline coronaviruses, and investigated the interaction between our protease inhibitor and a cathepsin B inhibitor, an entry blocker, against a feline coronavirus in cell culture. Herein we report that our compounds behave as reversible, competitive inhibitors of 3CL protease, potently inhibited the replication of feline coronaviruses (EC(50) in a nanomolar range) and, furthermore, combination of cathepsin B and 3CL protease inhibitors led to a strong synergistic interaction against feline coronaviruses in a cell culture system.

  6. Scouring Potential of Mesophile Acidic Proteases of Pseudomonas aeruginosa for Grey Cotton Fabrics

    NASA Astrophysics Data System (ADS)

    Saravanan, D.

    2013-04-01

    Mesophile, acidic proteases were produced using the microbial source, Pseudomonas aeruginosa, with wider thermal tolerances. Process conditions of scouring treatment were optimized using Taguchi method for optimum temperature, time, pH and concentration of protease. Treatment with the protease lower weight loss values compared to the alkali scouring, however, significant improvement in the absorbency compared to the grey samples was observed. Large amounts of pectin left out in the samples resulted in higher extractable impurities, substantiated by the FTIR results. Relatively, lower reduction in the tear strengths was observed in both warp and weft directions after protease treatment of the cotton fabrics.

  7. A metagenomic alkaline protease from saline habitat: cloning, over-expression and functional attributes.

    PubMed

    Purohit, Megha K; Singh, Satya P

    2013-02-01

    Metagenomics has opened new horizon to unlock the biotechnological potential for novel enzymes. An alkaline protease gene was obtained from the total environmental DNA extracted from a saline habitat. After cloning and sequencing, it was identified that the protease gene related to uncultivable bacteria (HM219181). The protease was over expressed at 6h of induction with optimum induction at 1mM IPTG and 27°C. The purified enzyme was characterized with respect to various factors; temperature, pH, NaCl and chemical denaturant. The sequence analysis indicated a hydrophobic tendency of the protein, while the predicted 3D structure indicated the enzyme as a serine protease.

  8. Synthesis and herbicidal evaluation of novel benzothiazole derivatives as potential inhibitors of D1 protease.

    PubMed

    Huang, Tonghui; Sun, Jie; An, Lin; Zhang, Lixian; Han, Cuiping

    2016-04-01

    D1 protease is a C-terminal processing protease that has been predicted to be an ideal herbicidal target. Three novel series of benzothiazole derivatives were synthesized and evaluated for their herbicidal activities against Brassica napus (rape) and Echinochloa crusgalli (barnyard grass). The preliminary bioassay indicated that most of the synthesized compounds possess promising D1 protease inhibitory activities and considerable herbicidal activities. Molecular docking was performed to position representative compounds into the active site of D1 protease to determine a probable binding model.

  9. Purification and characterization of an alkaline protease from Micrococcus sp. isolated from the South China Sea

    NASA Astrophysics Data System (ADS)

    Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao

    2017-04-01

    Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.

  10. Nine Crystal Structures Determine the Substrate Envelope of the MDR HIV-1 Protease

    SciTech Connect

    Liu, Zhigang; Wang, Yong; Brunzelle, Joseph; Kovari, Iulia A.; Kovari, Ladislau C.

    2012-03-27

    Under drug selection pressure, emerging mutations render HIV-1 protease drug resistant, leading to the therapy failure in anti-HIV treatment. It is known that nine substrate cleavage site peptides bind to wild type (WT) HIV-1 protease in a conserved pattern. However, how the multidrug-resistant (MDR) HIV-1 protease binds to the substrate cleavage site peptides is yet to be determined. MDR769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, and 90) was selected for present study to understand the binding to its natural substrates. MDR769 HIV-1 protease was co-crystallized with nine substrate cleavage site hepta-peptides. Crystallographic studies show that MDR769 HIV-1 protease has an expanded substrate envelope with wide open flaps. Furthermore, ligand binding energy calculations indicate weaker binding in MDR769 HIV-1 protease-substrate complexes. These results help in designing the next generation of HIV-1 protease inhibitors by targeting the MDR HIV-1 protease.

  11. The encephalomyocarditis virus 3C protease is a substrate for the ubiquitin-mediated proteolytic system.

    PubMed

    Lawson, T G; Gronros, D L; Werner, J A; Wey, A C; DiGeorge, A M; Lockhart, J L; Wilson, J W; Wintrode, P L

    1994-11-11

    The encephalomyocarditis virus 3C protease has been shown to be rapidly degraded in infected cells and in vitro in rabbit reticulocyte lysate. The in vitro degradation, at least, is accomplished by a virus-independent, ATP-dependent proteolytic system. Here we identify this proteolytic system as the ubiquitin-mediated system. Incubation of the 3C protease in rabbit reticulocyte or cultured mouse cell lysate preparations, alone or in the presence of added ubiquitin or methylated ubiquitin, resulted in the generation of new higher molecular weight species. These new products were shown to be 3C protease-ubiquitin conjugates by their ability to bind antibodies against both the 3C protease and ubiquitin. Supplemental ubiquitin also stimulated the degradation of the 3C protease in these preparations. Large 3C protease-polyubiquitin conjugates were observed to accumulate in reticulocyte lysate in the presence of adenosine 5'-O-(3-thiotriphosphate), an inhibitor of the 26 S multicatalytic protease. This, combined with the fact that the proteolytic activity could be removed from the lysate by sedimentation, implicates the multicatalytic protease in the degradation of the 3C protease-ubiquitin conjugates. It was also found that the slow rate of degradation of a model polyprotein, which resembles the stable viral 3CD diprotein produced in vivo, is likely due to the fact that the polyprotein is a poor substrate for the ubiquitin-conjugating system.

  12. A biochemical comparison of proteases from pathogenic naegleria fowleri and non-pathogenic Naegleria gruberi.

    PubMed

    Serrano-Luna, Jesús; Cervantes-Sandoval, Isaac; Tsutsumi, Victor; Shibayama, Mineko

    2007-01-01

    Naegleria fowleri is the etiologic agent of primary amoebic meningoencephalitis (PAM). Proteases have been suggested to be involved in tissue invasion and destruction during infection. We analyzed and compared the complete protease profiles of total crude extract and conditioned medium of both pathogenic N. fowleri and non-pathogenic Naegleria gruberi trophozoites. Using SDS-PAGE, we found differences in the number and molecular weight of proteolytic bands between the two strains. The proteases showed optimal activity at pH 7.0 and 35 degrees C for both strains. Inhibition assays showed that the main proteolytic activity in both strains is due to cysteine proteases although serine proteases were also detected. Both N. fowleri and N. gruberi have a variety of different protease activities at different pH levels and temperatures. These proteases may allow the amoebae to acquire nutrients from different sources, including those from the host. Although, the role of the amoebic proteases in the pathogenesis of PAM is not clearly defined, it seems that proteases and other molecules of the parasite as well as those from the host, could be participating in the damage to the human central nervous system.

  13. Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein

    PubMed Central

    Azarnezhad, Asaad; Sharifi, Zohreh; Seyedabadi, Rahmatollah; Hosseini, Arshad; Johari, Behrooz; Sobhani Fard, Mahsa

    2016-01-01

    Background: As a drug target and an antigenic agent, HIV-1 protease (HIV-1 PR) is at the center of attention for designing anti-AIDS inhibitors and diagnostic tests. In previous studies, the production of the recombinant protease has been faced with several difficulties; therefore, the aims of this study were the easy production, purification of the soluble form of protease in E. coli and investigation of its immunoreactivity. Methods: Protease coding region was isolated from the serum of an infected individual, amplified by RT-PCR and cloned into PTZ57R using TA-cloning. Protease coding frame was isolated by PCR and cloned in pET102/D. TOPO expression vector and cloned protease was expressed in Escherichia coli (E. coli) BL21. Produced recombinant protein was purified by affinity Ni-NTA column and protein concentration was checked by BCA protein assay kit. Subsequently, immunoreactivity of recombinant protease (rPR) was assayed by Western blotting and ELISA. Results: Cloning of the HIV protease by TOPO cloning system in pET102/D.TOPO was confirmed with PCR and sequencing. The concentration range of purified recombinant protein was 85 to 100 μg/ml. Immunogenicity of rPR was confirmed by Western blotting and ELISA. Conclusion: Soluble production of recombinant HIV-1 protease (HIV-1 rPR) was performed successfully. This recombinant protein disclosed 86% specificity and 90% sensitivity in immunoassay tests. PMID:27920885

  14. Visceral hypersensitivity in inflammatory bowel diseases and irritable bowel syndrome: The role of proteases

    PubMed Central

    Ceuleers, Hannah; Van Spaendonk, Hanne; Hanning, Nikita; Heirbaut, Jelena; Lambeir, Anne-Marie; Joossens, Jurgen; Augustyns, Koen; De Man, Joris G; De Meester, Ingrid; De Winter, Benedicte Y

    2016-01-01

    Proteases, enzymes catalyzing the hydrolysis of peptide bonds, are present at high concentrations in the gastrointestinal tract. Besides their well-known role in the digestive process, they also function as signaling molecules through the activation of protease-activated receptors (PARs). Based on their chemical mechanism for catalysis, proteases can be classified into several classes: serine, cysteine, aspartic, metallo- and threonine proteases represent the mammalian protease families. In particular, the class of serine proteases will play a significant role in this review. In the last decades, proteases have been suggested to play a key role in the pathogenesis of visceral hypersensitivity, which is a major factor contributing to abdominal pain in patients with inflammatory bowel diseases and/or irritable bowel syndrome. So far, only a few preclinical animal studies have investigated the effect of protease inhibitors specifically on visceral sensitivity while their effect on inflammation is described in more detail. In our accompanying review we describe their effect on gastrointestinal permeability. On account of their promising results in the field of visceral hypersensitivity, further research is warranted. The aim of this review is to give an overview on the concept of visceral hypersensitivity as well as on the physiological and pathophysiological functions of proteases herein. PMID:28058009

  15. Pseudomonas aeruginosa protease IV degrades surfactant proteins and inhibits surfactant host defense and biophysical functions.

    PubMed

    Malloy, Jaret L; Veldhuizen, Ruud A W; Thibodeaux, Brett A; O'Callaghan, Richard J; Wright, Jo Rae

    2005-02-01

    Pulmonary surfactant has two distinct functions within the lung: reduction of surface tension at the air-liquid interface and participation in innate host defense. Both functions are dependent on surfactant-associated proteins. Pseudomonas aeruginosa is primarily responsible for respiratory dysfunction and death in cystic fibrosis patients and is also a leading pathogen in nosocomial pneumonia. P. aeruginosa secretes a number of proteases that contribute to its virulence. We hypothesized that P. aeruginosa protease IV degrades surfactant proteins and results in a reduction in pulmonary surfactant host defense and biophysical functions. Protease IV was isolated from cultured supernatant of P. aeruginosa by gel chromatography. Incubation of cell-free bronchoalveolar lavage fluid with protease IV resulted in degradation of surfactant proteins (SP)-A, -D, and -B. SPs were degraded in a time- and dose-dependent fashion by protease IV, and degradation was inhibited by the trypsin-like serine protease inhibitor Nalpha-p-tosyl-L-lysine-chloromethyl ketone (TLCK). Degradation by protease IV inhibited SP-A- and SP-D-mediated bacterial aggregation and uptake by macrophages. Surfactant treated with protease IV was unable to reduce surface tension as effectively as untreated surfactant, and this effect was inhibited by TLCK. We speculate that protease IV may be an important contributing factor to the development and propagation of acute lung injury associated with P. aeruginosa via loss of surfactant function within the lung.

  16. Determination of the protease cleavage site repertoire—The RNase H but not the RT domain is essential for foamy viral protease activity

    SciTech Connect

    Spannaus, Ralf; Bodem, Jochen

    2014-04-15

    In contrast to orthoretroviruses, the foamy virus protease is only active as a protease-reverse transcriptase fusion protein and requires viral RNA for activation. Maturation of foamy viral proteins seems to be restricted to a single cleavage site in Gag and Pol. We provide evidence that unprocessed Gag is required for optimal infectivity, which is unique among retroviruses. Analyses of the cleavage site sequences of the Gag and Pol cleavage sites revealed a high similarity compared to those of Lentiviruses. We show that positions P2' and P2 are invariant and that Gag and Pol cleavage sites are processed with similar efficiencies. The RNase H domain is essential for protease activity, but can functionally be substituted by RNase H domains of other retroviruses. Thus, the RNase H domain might be involved in the stabilization of the protease dimer, while the RT domain is essential for RNA dependent protease activation. - Highlights: • Unprocessed Gag is required for optimal infectivity of foamy viruses. • Positions P2 and P2' are invariant in the foamy viral cleavage sites. • The RNaseH domain is essential for protease activity. • The RNaseH domains of other retroviruses support foamy viral protease activity.

  17. Membrane-protease interactions. III: A consideration of the difference in binding potential of pancreatic proteases to erythrocytes and erythrocyte ghosts.

    PubMed

    Brecher, A S; Rosen, M; Burkholder, D E

    1999-09-01

    Trypsin and chymotrypsin readily bind to human erythrocyte ghosts and to resealed right-side-out ghosts, but not to intact erythrocytes, as followed with [3H]trypsin and [3H]chymotrypsin and with cold proteases in a caseinolytic assay. The proteases freely reacted with casein in the presence of intact cells. Trypsin activated trypsinogen over an 8-hr time course at a faster rate in the presence of erythrocytes than in the absence thereof, after a slight initial delay. Trypsinogen did not bind to intact erythrocytes, thereby behaving comparably to trypsin. These results suggest that different microenvironments exist about the erythrocyte ghosts and the intact erythrocytes, thereby permitting the proteases to bind to the former but not to the latter. Hence, in the absence of considerable ghosts in circulating blood, which may mask the binding site of the proteases, the proteases may be more readily accessible for interaction with circulating serpins, leading to inactivation of the proteases and protection from their degradative potential. The presence of the serpins in circulating blood may assist in the control of the degradative power of the pancreatic proteases in pancreatitis and may negatively modulate such processes as thrombosis, activation of the complement system, and vascular remodeling.

  18. MOLECULAR IDENTIFICATION OF CYSTEINE AND TRYPSIN PROTEASE, EFFECT OF DIFFERENT HOSTS ON PROTEASE EXPRESSION, AND RNAI MEDIATED SILENCING OF CYSTEINE PROTEASE GENE IN THE SUNN PEST.

    PubMed

    Amiri, Azam; Bandani, Ali Reza; Alizadeh, Houshang

    2016-04-01

    Sunn pest, Eurygaster integriceps, is a serious pest of cereals in the wide area of the globe from Near and Middle East to East and South Europe and North Africa. This study described for the first time, identification of E. integriceps trypsin serine protease and cathepsin-L cysteine, transcripts involved in digestion, which might serve as targets for pest control management. A total of 478 and 500 base pair long putative trypsin and cysteine gene sequences were characterized and named Tryp and Cys, respectively. In addition, the tissue-specific relative gene expression levels of these genes as well as gluten hydrolase (Gl) were determined under different host kernels feeding conditions. Result showed that mRNA expression of Cys, Tryp, and Gl was significantly affected after feeding on various host plant species. Transcript levels of these genes were most abundant in the wheat-fed E. integriceps larvae compared to other hosts. The Cys transcript was detected exclusively in the gut, whereas the Gl and Tryp transcripts were detectable in both salivary glands and gut. Also possibility of Sunn pest gene silencing was studied by topical application of cysteine double-stranded RNA (dsRNA). The results indicated that topically applied dsRNA on fifth nymphal stage can penetrate the cuticle of the insect and induce RNA interference. The Cys gene mRNA transcript in the gut was reduced to 83.8% 2 days posttreatment. Also, it was found that dsRNA of Cys gene affected fifth nymphal stage development suggesting the involvement of this protease in the insect growth, development, and molting.

  19. A multifaceted analysis of HIV-1 protease multidrug resistance phenotypes

    PubMed Central

    2011-01-01

    Background Great strides have been made in the effective treatment of HIV-1 with the development of second-generation protease inhibitors (PIs) that are effective against historically multi-PI-resistant HIV-1 variants. Nevertheless, mutation patterns that confer decreasing susceptibility to available PIs continue to arise within the population. Understanding the phenotypic and genotypic patterns responsible for multi-PI resistance is necessary for developing PIs that are active against clinically-relevant PI-resistant HIV-1 variants. Results In this work, we use globally optimal integer programming-based clustering techniques to elucidate multi-PI phenotypic resistance patterns using a data set of 398 HIV-1 protease sequences that have each been phenotyped for susceptibility toward the nine clinically-approved HIV-1 PIs. We validate the information content of the clusters by evaluating their ability to predict the level of decreased susceptibility to each of the available PIs using a cross validation procedure. We demonstrate the finding that as a result of phenotypic cross resistance, the considered clinical HIV-1 protease isolates are confined to ~6% or less of the clinically-relevant phenotypic space. Clustering and feature selection methods are used to find representative sequences and mutations for major resistance phenotypes to elucidate their genotypic signatures. We show that phenotypic similarity does not imply genotypic similarity, that different PI-resistance mutation patterns can give rise to HIV-1 isolates with similar phenotypic profiles. Conclusion Rather than characterizing HIV-1 susceptibility toward each PI individually, our study offers a unique perspective on the phenomenon of PI class resistance by uncovering major multidrug-resistant phenotypic patterns and their often diverse genotypic determinants, providing a methodology that can be applied to understand clinically-relevant phenotypic patterns to aid in the design of novel inhibitors that

  20. Serine Proteases Enhance Immunogenic Antigen Presentation on Lung Cancer Cells.

    PubMed

    Peters, Haley L; Tripathi, Satyendra C; Kerros, Celine; Katayama, Hiroyuki; Garber, Haven R; St John, Lisa S; Federico, Lorenzo; Meraz, Ismail M; Roth, Jack A; Sepesi, Boris; Majidi, Mourad; Ruisaard, Kathryn; Clise-Dwyer, Karen; Roszik, Jason; Gibbons, Don L; Heymach, John V; Swisher, Stephen G; Bernatchez, Chantale; Alatrash, Gheath; Hanash, Samir; Molldrem, Jeffrey J

    2017-03-02

    Immunotherapies targeting immune checkpoints have proven efficacious in reducing the burden of lung cancer in patients; however, the antigenic targets of these reinvigorated T cells remain poorly defined. Lung cancer tumors contain tumor-associated macrophages (TAM) and neutrophils, which release the serine proteases neutrophil elastase (NE) and proteinase 3 (P3) into the tumor microenvironment. NE and P3 shape the antitumor adaptive immune response in breast cancer and melanoma. In this report, we demonstrate that lung cancer cells cross-presented the tumor-associated antigen PR1, derived from NE and P3. Additionally, NE and P3 enhanced the expression of human leukocyte antigen (HLA) class I molecules on lung cancer cells and induced unique, endogenous peptides in the immunopeptidome, as detected with mass spectrometry sequencing. Lung cancer patient tissues with high intratumoral TAMs were enriched for MHC class I genes and T-cell markers, and patients with high TAM and cytotoxic T lymphocyte (CTL) infiltration had improved overall survival. We confirmed the immunogenicity of unique, endogenous peptides with cytotoxicity assays against lung cancer cell lines, using CTLs from healthy donors that had been expanded against select peptides. Finally, CTLs specific for serine proteases-induced endogenous peptides were detected in lung cancer patients using peptide/HLA-A2 tetramers and were elevated in tumor-infiltrating lymphocytes. Thus, serine proteases in the tumor microenvironment of lung cancers promote the presentation of HLA class I immunogenic peptides that are expressed by lung cancer cells, thereby increasing the antigen repertoire that can be targeted in lung cancer. Cancer Immunol Res; 5(4); 1-11. ©2017 AACR.

  1. Biased signaling by peptide agonists of protease activated receptor 2.

    PubMed

    Jiang, Yuhong; Yau, Mei-Kwan; Kok, W Mei; Lim, Junxian; Wu, Kai-Chen; Liu, Ligong; Hill, Timothy A; Suen, Jacky Y; Fairlie, David P

    2017-02-07

    Protease activated receptor 2 (PAR2) is associated with metabolism, obesity, inflammatory, respiratory and gastrointestinal disorders, pain, cancer and other diseases. The extracellular N-terminus of PAR2 is a common target for multiple proteases, which cleave it at different sites to generate different N-termini that activate different PAR2-mediated intracellular signaling pathways. There are no synthetic PAR2 ligands that reproduce the same signaling profiles and potencies as proteases. Structure-activity relationships here for 26 compounds spanned a signaling bias over 3 log units, culminating in three small ligands as biased agonist tools for interrogating PAR2 functions. DF253 (2f-LAAAAI-NH2) triggered PAR2-mediated calcium release (EC50 2 μM) but not ERK1/2 phosphorylation (EC50 > 100 μM) in CHO cells transfected with hPAR2. AY77 (Isox-Cha-Chg-NH2) was a more potent calcium-biased agonist (EC50 40 nM, Ca2+; EC50 2 μM, ERK1/2), while its analogue AY254 (Isox-Cha-Chg-A-R-NH2) was an ERK-biased agonist (EC50 2 nM, ERK1/2; EC50 80 nM, Ca2+). Signaling bias led to different functional responses in human colorectal carcinoma cells (HT29). AY254, but not AY77 or DF253, attenuated cytokine-induced caspase 3/8 activation, promoted scratch-wound healing and induced IL-8 secretion, all via PAR2-ERK1/2 signaling. Different ligand components were responsible for different PAR2 signaling and functions, clues that can potentially lead to drugs that modulate different pathway-selective cellular and physiological responses.

  2. Functional protease profiling for laboratory based diagnosis of invasive aspergillosis.

    PubMed

    Sabbagh, Bassel; Costina, Victor; Buchheidt, Dieter; Reinwald, Mark; Neumaier, Michael; Findeisen, Peter

    2015-07-01

    Invasive aspergillosis (IA) remains difficult to diagnose in immunocompromised patients, because diagnostic criteria according to EORTC/MSG guidelines are often not met and have low sensitivity. Hence there is an urgent need to improve diagnostic procedures by developing novel approaches. In the present study, we present a proof of concept experiment for the monitoring of Aspergillus associated protease activity in serum specimens for diagnostic purpose. Synthetic peptides that are selectively cleaved by proteases secreted from Aspergillus species were selected from our own experiments and published data. These so called reporter peptides (RP, n=5) were added to serum specimens from healthy controls (HC, n=101) and patients with proven (IA, n=9) and possible (PIA, n=144) invasive aspergillosis. Spiked samples were incubated ex vivo under strictly standardized conditions. Proteolytic fragments were analyzed using MALDI-TOF mass spectrometry. Spiked specimens of IA patients had highest concentrations of RP-fragments followed by PIA and HC. The median signal intensity was 116.546 (SD, 53.063) for IA and 5.009 (SD, 8.432) for HC. A cut-off >36.910 was chosen that performed with 100% specificity and sensitivity. Patients with PIA had either values above [53% (76/144)] or below [47% (67/144)] this chosen cut-off. The detection of respective reporter peptide fragments can easily be performed by MALDI TOF mass spectrometry. In this proof of concept study we were able to demonstrate that serum specimens of patients with IA have increased proteolytic activity towards selected reporter peptides. However, the diagnostic value of functional protease profiling has to be validated in further prospective studies. It is likely that a combination of existing and new methods will be required to achieve optimal performance for diagnosis of IA in the future.

  3. Plant Protease Inhibitors in Therapeutics-Focus on Cancer Therapy

    PubMed Central

    Srikanth, Sandhya; Chen, Zhong

    2016-01-01

    Plants are known to have many secondary metabolites and phytochemical compounds which are highly explored at biochemical and molecular genetics level and exploited enormously in the human health care sector. However, there are other less explored small molecular weight proteins, which inhibit proteases/proteinases. Plants are good sources of protease inhibitors (PIs) which protect them against diseases, insects, pests, and herbivores. In the past, proteinaceous PIs were considered primarily as protein-degrading enzymes. Nevertheless, this view has significantly changed and PIs are now treated as very important signaling molecules in many biological activities such as inflammation, apoptosis, blood clotting and hormone processing. In recent years, PIs have been examined extensively as therapeutic agents, primarily to deal with various human cancers. Interestingly, many plant-based PIs are also found to be effective against cardiovascular diseases, osteoporosis, inflammatory diseases and neurological disorders. Several plant PIs are under further evaluation in in vitro clinical trials. Among all types of PIs, Bowman-Birk inhibitors (BBI) have been studied extensively in the treatment of many diseases, especially in the field of cancer prevention. So far, crops such as beans, potatoes, barley, squash, millet, wheat, buckwheat, groundnut, chickpea, pigeonpea, corn, and pineapple have been identified as good sources of PIs. The PI content of such foods has a significant influence on human health disorders, particularly in the regions where people mostly depend on these kind of foods. These natural PIs vary in concentration, protease specificity, heat stability, and sometimes several PIs may be present in the same species or tissue. However, it is important to carry out individual studies to identify the potential effects of each PI on human health. PIs in plants make them incredible sources to determine novel PIs with specific pharmacological and therapeutic effects due

  4. The protease cathepsin L regulates Th17 cell differentiation.

    PubMed

    Hou, Lifei; Cooley, Jessica; Swanson, Richard; Ong, Poh Chee; Pike, Robert N; Bogyo, Matthew; Olson, Steven T; Remold-O'Donnell, Eileen

    2015-12-01

    Previously we reported that IL-17(+) T cells, primarily IL-17(+) γδ cells, are increased in mice lacking the protease inhibitor serpinB1 (serpinb1(-/-) mice). Here we show that serpinB1-deficient CD4 cells exhibit a cell-autonomous and selective deficiency in suppressing T helper 17 (Th17) cell differentiation. This suggested an opposing role for one or more protease in promoting Th17 differentiation. We found that several SerpinB1-inhibitable cysteine cathepsins are induced in Th17 cells, most prominently cathepsin L (catL); this was verified by peptidase assays, active site labeling and Western blots. Moreover, Th17 differentiation was suppressed by both broad cathepsin inhibitors and catL selective inhibitors. CatL is present in Th17 cells as single chain (SC)- and two-chain (TC)-forms. Inhibiting asparagine endopeptidase (AEP) blocked conversion of SC-catL to TC-catL and increased generation of serpinb1(-/-) Th17 cells, but not wild-type Th17 cells. These findings suggest that SC-catL is biologically active in promoting Th17 generation and is counter-regulated by serpinB1 and secondarily by AEP. Thus, in addition to regulation by cytokines and transcription factors, differentiation of CD4 cells to Th17 cells is actively regulated by a catL-serpinB1-AEP module. Targeting this protease regulatory module could be an approach to treating Th17 cell-driven autoimmune disorders.

  5. Plant Protease Inhibitors in Therapeutics-Focus on Cancer Therapy.

    PubMed

    Srikanth, Sandhya; Chen, Zhong

    2016-01-01

    Plants are known to have many secondary metabolites and phytochemical compounds which are highly explored at biochemical and molecular genetics level and exploited enormously in the human health care sector. However, there are other less explored small molecular weight proteins, which inhibit proteases/proteinases. Plants are good sources of protease inhibitors (PIs) which protect them against diseases, insects, pests, and herbivores. In the past, proteinaceous PIs were considered primarily as protein-degrading enzymes. Nevertheless, this view has significantly changed and PIs are now treated as very important signaling molecules in many biological activities such as inflammation, apoptosis, blood clotting and hormone processing. In recent years, PIs have been examined extensively as therapeutic agents, primarily to deal with various human cancers. Interestingly, many plant-based PIs are also found to be effective against cardiovascular diseases, osteoporosis, inflammatory diseases and neurological disorders. Several plant PIs are under further evaluation in in vitro clinical trials. Among all types of PIs, Bowman-Birk inhibitors (BBI) have been studied extensively in the treatment of many diseases, especially in the field of cancer prevention. So far, crops such as beans, potatoes, barley, squash, millet, wheat, buckwheat, groundnut, chickpea, pigeonpea, corn, and pineapple have been identified as good sources of PIs. The PI content of such foods has a significant influence on human health disorders, particularly in the regions where people mostly depend on these kind of foods. These natural PIs vary in concentration, protease specificity, heat stability, and sometimes several PIs may be present in the same species or tissue. However, it is important to carry out individual studies to identify the potential effects of each PI on human health. PIs in plants make them incredible sources to determine novel PIs with specific pharmacological and therapeutic effects due

  6. Endothelial Progenitor Cells in Sprouting Angiogenesis: Proteases Pave the Way.

    PubMed

    Laurenzana, A; Fibbi, G; Margheri, F; Biagioni, A; Luciani, C; Del Rosso, M; Chillà, A

    2015-01-01

    Sprouting angiogenesis consists of the expansion and remodelling of existing vessels, where the vascular sprouts connect each other to form new vascular loops. Endothelial Progenitor Cells (EPCs) are a subtype of stem cells, with high proliferative potential, able to differentiate into mature Endothelial Cells (ECs) during the neovascularization process. In addition to this direct structural role EPCs improve neovascularization, also secreting numerous pro-angiogenic factors able to enhance the proliferation, survival and function of mature ECs, and other surrounding progenitor cells. While sprouting angiogenesis by mature ECs involves resident ECs, the vasculogenic contribution of EPCs is a high hurdle race. Bone marrowmobilized EPCs have to detach from the stem cell niche, intravasate into bone marrow vessels, reach the hypoxic area or tumour site, extravasate and incorporate into the new vessel lumen, thus complementing the resident mature ECs in sprouting angiogenesis. The goal of this review is to highlight the role of the main protease systems able to control each of these steps. The pivotal protease systems here described, involved in vascular patterning in sprouting angiogenesis, are the matrix-metalloproteinases (MMPs), the serineproteinases urokinase-type plasminogen activator (uPA) associated with its receptor (uPAR) and receptorassociated plasminogen/plasmin, the neutrophil elastase and the cathepsins. Since angiogenesis plays a critical role not only in physiological but also in pathological processes, such as in tumours, controlling the contribution of EPCs to the angiogenic process, through the regulation of the protease systems involved, could yield new opportunities for the therapeutic prospect of efficient control of pathological angiogenesis.

  7. Conformational transition of the lid helix covering the protease active site is essential for the ATP-dependent protease activity of FtsH.

    PubMed

    Suno, Ryoji; Shimoyama, Masakazu; Abe, Akiko; Shimamura, Tatsuro; Shimodate, Natsuka; Watanabe, Yo-hei; Akiyama, Yoshinori; Yoshida, Masasuke

    2012-09-21

    When bound to ADP, ATP-dependent protease FtsH subunits adopt either an "open" or "closed" conformation. In the open state, the protease catalytic site is located in a narrow space covered by a lidlike helix. This space disappears in the closed form because the lid helix bends at Gly448. Here, we replaced Gly448 with various residues that stabilize helices. Most mutants retained low ATPase activity and bound to the substrate protein, but lost protease activity. However, a mutant proline substitution lost both activities. Our study shows that the conformational transition of the lid helix is essential for the function of FtsH.

  8. Lung vascular injury with protease infusion. Relationship to plasma fibronectin.

    PubMed Central

    Cohler, L F; Saba, T M; Lewis, E P

    1985-01-01

    Fibronectin exists in a soluble form in plasma and in an insoluble form in tissues. Plasma fibronectin can modulate phagocytic function as well as incorporate into the tissue matrix where it is believed to influence microvascular integrity and tissue repair. The temporal alterations in plasma and lung lymph fibronectin were studied in relation to increased pulmonary vascular permeability induced by protease infusion. The acute sheep lung lymph fistula model was used. A 39% decrease in plasma fibronectin (control = 421 +/- 67 micrograms/ml) was observed 2.5 hours (255 +/- 43 micrograms/ml) after protease infusion. There was an elevation of lymph fibronectin early after protease infusion, followed by a progressive decline. Concomitant with the decrease in plasma fibronectin, an increase in lymph flow (QL) of greater than 200% (from a control of 6.7 +/- 1.0 ml/hr to 13.9 +/- 1.4 ml/hr) was observed within 2.5 hours. Also, there was a sustained elevation in the total protein lymph/plasma concentration (L/P) ratio, which was maximal at 2.5 hours. The transvascular protein clearance (TVPC = QL X L/P) was 4.5 +/- 0.7 ml/hr at the control period and 13.1 +/- 2.0 ml/hr by 2.5 hours. This was indicative of increased flux of protein-rich fluid across the pulmonary endothelial barrier. Lung vascular permeability stabilized after 2.5 hours as manifested by a slowly declining L/P ratio. Thus, plasma fibronectin deficiency may contribute to the etiology of increased lung vascular permeability with protease infusion. Since the progressive decline in plasma fibronectin was not reflected in a proportional increase in lymph fibronectin, plasma fibronectin may have sequestered in tissues such as the lung, or perhaps in reticuloendothelial cells during the injury phase. Whether the progressive decrease in plasma fibronectin reflects its incorporation into the endothelial barrier matrix where it may mediate stabilization of the pulmonary microvascular barrier remains to be determined

  9. Lysosomal cysteine proteases: structure, function and inhibition of cathepsins.

    PubMed

    Roberts, Rebecca

    2005-12-01

    Lysosomal cysteine proteases, a subgroup of the cathepsin family, are critical for normal cellular functions such as general protein turnover, antigen processing and bone remodeling. In the past decade, the number of identified human cathepsins has more than doubled and their known role in several pathologies has expanded rapidly. Increased understanding of the structure and mechanism of this class of enzymes has brought on a new fervor in the design of small molecule inhibitors with the hope of producing specific, therapeutic drugs for diseases such as arthritis, allergy, multiple sclerosis, atherosclerosis, Alzheimer's disease and cancer.

  10. Functional analysis of rhomboid proteases during Toxoplasma invasion.

    PubMed

    Shen, Bang; Buguliskis, Jeffrey S; Lee, Tobie D; Sibley, L David

    2014-10-21

    Host cell invasion by Toxoplasma gondii and other apicomplexan parasites requires transmembrane adhesins that mediate binding to receptors on the substrate and host cell to facilitate motility and invasion. Rhomboid proteases (ROMs) are thought to cleave adhesins within their transmembrane segments, thus allowing the parasite to disengage from receptors and completely enter the host cell. To examine the specific roles of individual ROMs during invasion, we generated single, double, and triple knockouts for the three ROMs expressed in T. gondii tachyzoites. Analysis of these mutants demonstrated that ROM4 is the primary protease involved in adhesin processing and host cell invasion, whereas ROM1 or ROM5 plays negligible roles in these processes. Deletion of ROM4 blocked the shedding of adhesins such as MIC2 (microneme protein 2), causing them to accumulate on the surface of extracellular parasites. Increased surface adhesins led to nonproductive attachment, altered gliding motility, impaired moving junction formation, and reduced invasion efficiency. Despite the importance of ROM4 for efficient invasion, mutants lacking all three ROMs were viable and MIC2 was still efficiently removed from the surface of invaded mutant parasites, implying the existence of ROM-independent mechanisms for adhesin removal during invasion. Collectively, these results suggest that although ROM processing of adhesins is not absolutely essential, it is important for efficient host cell invasion by T. gondii. Importance: Apicomplexan parasites such as Toxoplasma gondii express surface proteins that bind host cell receptors to aid invasion. Many of these adhesins are subject to cleavage by rhomboid proteases (ROMs) within their transmembrane segments during invasion. Previous studies have demonstrated the importance of adhesin cleavage for parasite invasion and proposed that the ROMs responsible for processing would be essential for parasite survival. In T. gondii, ROM5 was thought to be the

  11. Ergotism associated with HIV antiviral protease inhibitor therapy.

    PubMed

    Baldwin, Zachary K; Ceraldi, Chris C

    2003-03-01

    Ergotism is a rare condition of acute vasospasm found classically in young and middle-aged women taking ergot alkaloid agents to treat migraine headache. We report the case of a young man with human immunodeficiency virus (HIV) positivity and describe the drug interaction between protease inhibitors and ergot alkaloid agents, which most likely predisposed to development of ergot toxicity. The HIV-positive population receiving antiviral therapy may be an under-recognized group at risk for ergotism through decreased hepatic metabolism of ergot preparations.

  12. Expression and activation of proteases in co-cultures.

    PubMed

    Paduch, Roman; Kandefer-Szerszeń, Martyna

    2011-01-01

    The present study concerned the expression and activation of metalloproteinase-2 (MMP-2), metalloproteinase-9 (MMP-9) and the urokinase plasminogen activator/urokinase plasminogen activator receptor (uPA/uPAR) system in co-cultures of human colon carcinoma cell spheroids (HT29, LS180, SW948) with human normal colon epithelium (CCD 841 CoTr), myofibroblasts (CCD-18Co) and endothelial cells (HUVEC). Additionally, the influence of monensin on the production and function of the proteases was tested. Tumor cells expressed small amounts of MMP-2, MMP-9 and uPA. Normal cells generally produced proportionally higher concentrations of these proteases (especially MMP-2, compared with significantly smaller yields of MMP-9 and significantly lower amounts of uPAR than tumors. In co-cultures of tumor spheroids with normal cell monolayers, the concentration of the proteases was equal to the sum of the enzymes produced in monocultures of both types of cells. The highest activity of uPA, measured as the reduction of the chromogenic substrate (S-2444), was detected in supernatants and lysates of endothelial cells. Interestingly, in normal cells, the higher expression of proteases, mainly uPA, measured as the level of protein concentration, was closely linked with their lower activity and inversely, in tumor cells, the low level of the expression of the enzymes correlated with their high enzymatic activity. In zymography analysis, mainly pro-MMPs were detected both in culture supernatants and cell lysates. The highest amounts of active forms of the MMPs were detected in tumor spheroids co-cultured with endothelial cells. Monensin inhibited MMPs and uPA secretion but significantly increased uPAR release, mainly from normal cells. In conclusion, during direct interactions of tumor cells with normal cells, MMPs and the uPA/uPAR system play an important role in the degradation of ECM and tumor development, but as we found, there is a reverse relationship between the concentration and the

  13. Structures of a bi-functional Kunitz-type STI family inhibitor of serine and aspartic proteases: Could the aspartic protease inhibition have evolved from a canonical serine protease-binding loop?

    PubMed

    Guerra, Yasel; Valiente, Pedro A; Pons, Tirso; Berry, Colin; Rudiño-Piñera, Enrique

    2016-08-01

    Bi-functional inhibitors from the Kunitz-type soybean trypsin inhibitor (STI) family are glycosylated proteins able to inhibit serine and aspartic proteases. Here we report six crystal structures of the wild-type and a non-glycosylated mutant of the bifunctional inhibitor E3Ad obtained at different pH values and space groups. The crystal structures show that E3Ad adopts the typical β-trefoil fold of the STI family exhibiting some conformational changes due to pH variations and crystal packing. Despite the high sequence identity with a recently reported potato cathepsin D inhibitor (PDI), three-dimensional structures obtained in this work show a significant conformational change in the protease-binding loop proposed for aspartic protease inhibition. The E3Ad binding loop for serine protease inhibition is also proposed, based on structural similarity with a novel non-canonical conformation described for the double-headed inhibitor API-A from the Kunitz-type STI family. In addition, structural and sequence analyses suggest that bifunctional inhibitors of serine and aspartic proteases from the Kunitz-type STI family are more similar to double-headed inhibitor API-A than other inhibitors with a canonical protease-binding loop.

  14. Inhibition of CYP2B6 by Medicinal Plant Extracts: Implication for Use of Efavirenz and Nevirapine-Based Highly Active Anti-Retroviral Therapy (HAART) in Resource-Limited Settings.

    PubMed

    Thomford, Nicholas E; Awortwe, Charles; Dzobo, Kevin; Adu, Faustina; Chopera, Denis; Wonkam, Ambroise; Skelton, Michelle; Blackhurst, Dee; Dandara, Collet

    2016-02-16

    Highly active antiretroviral therapy (HAART) has greatly improved health parameters of HIV infected individuals. However, there are several challenges associated with the chronic nature of HAART administration. For populations in health transition, dual use of medicinal plant extracts and conventional medicine poses a significant challenge. There is need to evaluate interactions between commonly used medicinal plant extracts and antiretroviral drugs used against HIV/AIDS. Efavirenz (EFV) and nevirapine (NVP) are the major components of HAART both metabolized by CYP2B6, an enzyme that can potentially be inhibited or induced by compounds found in medicinal plant extracts. The purpose of this study was to evaluate the effects of extracts of selected commonly used medicinal plants on CYP2B6 enzyme activity. Recombinant human CYP2B6 was used to evaluate inhibition, allowing the assessment of herb-drug interactions (HDI) of medicinal plants Hyptis suaveolens, Myrothamnus flabellifolius, Launaea taraxacifolia, Boerhavia diffusa and Newbouldia laevis. The potential of these medicinal extracts to cause HDI was ranked accordingly for reversible inhibition and also classified as potential time-dependent inhibitor (TDI) candidates. The most potent inhibitor for CYP2B6 was Hyptis suaveolens extract (IC50 = 19.09 ± 1.16 µg/mL), followed by Myrothamnus flabellifolius extract (IC50 = 23.66 ± 4.86 µg/mL), Launaea taraxacifolia extract (IC50 = 33.87 ± 1.54 µg/mL), and Boerhavia diffusa extract (IC50 = 34.93 ± 1.06 µg/mL). Newbouldia laevis extract, however, exhibited weak inhibitory effects (IC50 = 100 ± 8.71 µg/mL) on CYP2B6. Launaea taraxacifolia exhibited a TDI (3.17) effect on CYP2B6 and showed a high concentration of known CYP450 inhibitory phenolic compounds, chlorogenic acid and caffeic acid. The implication for these observations is that drugs that are metabolized by CYP2B6 when co-administered with these herbal medicines and when adequate amounts of the extracts

  15. Opportunistic Infections in HIV-Infected Patients Differ Strongly in Frequencies and Spectra between Patients with Low CD4+ Cell Counts Examined Postmortem and Compensated Patients Examined Antemortem Irrespective of the HAART Era

    PubMed Central

    Powell, Marta K.; Benková, Kamila; Selinger, Pavel; Dogoši, Marek; Kinkorová Luňáčková, Iva; Koutníková, Hana; Laštíková, Jarmila; Roubíčková, Alena; Špůrková, Zuzana; Laclová, Lucie; Eis, Václav; Šach, Josef

    2016-01-01

    Objective AIDS-related mortality has changed dramatically with the onset of highly active antiretroviral therapy (HAART), which has even allowed compensated HIV-infected patients to withdraw from secondary therapy directed against opportunistic pathogens. However, in recently autopsied HIV-infected patients, we observed that associations with a broad spectrum of pathogens remain, although detailed analyses are lacking. Therefore, we focused on the possible frequency and spectrum shifts in pathogens associated with autopsied HIV-infected patients. Design We hypothesized that the pathogens frequency and spectrum changes found in HIV-infected patients examined postmortem did not recapitulate the changes found previously in HIV-infected patients examined antemortem in both the pre- and post-HAART eras. Because this is the first comprehensive study originating from Central and Eastern Europe, we also compared our data with those obtained in the West and Southwest Europe, USA and Latin America. Methods We performed autopsies on 124 HIV-infected patients who died from AIDS or other co-morbidities in the Czech Republic between 1985 and 2014. The pathological findings were retrieved from the full postmortem examinations and autopsy records. Results We collected a total of 502 host-pathogen records covering 82 pathogen species, a spectrum that did not change according to patients’ therapy or since the onset of the epidemics, which can probably be explained by the fact that even recently deceased patients were usually decompensated (in 95% of the cases, the last available CD4+ cell count was falling below 200 cells*μl-1) regardless of the treatment they received. The newly identified pathogen taxa in HIV-infected patients included Acinetobacter calcoaceticus, Aerococcus viridans and Escherichia hermannii. We observed a very limited overlap in both the spectra and frequencies of the pathogen species found postmortem in HIV-infected patients in Europe, the USA and Latin

  16. Optimisation of the detection of bacterial proteases using adsorbed immunoglobulins as universal substrates.

    PubMed

    Abuknesha, Ram A; Jeganathan, Fiona; Wildeboer, Dirk; Price, Robert G

    2010-06-15

    Bacterial proteases, Type XXIV from Bacillus licheniformens and Type XIV from Streptomyces griseus, were used to investigate the utility and optimisation of a solid phase assay for proteases, using immunoglobulin proteins as substrates. Immunoglobulins IgA and IgG were adsorbed on to surfaces of ELISA plates and exposed to various levels of the bacterial proteases which led to digestion and desorption of proportional amounts of the immunoglobulins. The assay signal was developed by measuring the remaining proteins on the polystyrene surface with appropriate enzyme-labelled anti-immunoglobulin reagents. The assay was fully optimised in terms of substrate levels employing ELISA techniques to titrate levels of adsorbed substrates and protease analytes. The critical factor which influences assay sensitivity was found to be the substrate concentration, the levels of adsorbed immunoglobulins. The estimated detection limits for protease XXIV and XIV were 10micro units/test and 9micro units/test using IgA as a substrate. EC(50) values were calculated as 213 and 48micro units/test for each protease respectively. Using IgG as a substrate, the estimated detection limits were 104micro units/test for protease XXIV and 9micro units/test for protease XIV. EC(50) values were calculated at 529micro units/test and 28micro units/test for protease XXIV and XIV respectively. The solid phase protease assay required no modification of the substrates and the adsorption step is merely simple addition of immunoglobulins to ELISA plates. Adsorption of the immunoglobulins to polystyrene enabled straightforward separation of reaction mixtures prior to development of assay signal. The assay exploits the advantages of the technical facilities of ELISA technology and commercially available reagents enabling the detection and measurement of a wide range of proteases. However, the key issue was found to be that in order to achieve the potential performance of the simple assay, optimisation of the

  17. Understanding the specificity of serpin-protease complexes through interface analysis.

    PubMed

    Rashid, Qudsia; Kapil, Charu; Singh, Poonam; Kumari, Vineeta; Jairajpuri, Mohamad Aman

    2015-01-01

    Serpins such as antithrombin, heparin cofactor II, plasminogen activator inhibitor, antitrypsin, antichymotrypsin, and neuroserpin are involved in important biological processes by inhibiting specific serine proteases. Initially, the protease recognizes the mobile reactive loop of the serpin eliciting conformational changes, where the cleaved loop together with the protease inserts into β-sheet A, translocating the protease to the opposite side of inhibitor leading to its inactivation. Serpin interaction with proteases is governed mainly by the reactive center loop residues (RCL). However, in some inhibitory serpins, exosite residues apart from RCL have been shown to confer protease specificity. Further, this forms the basis of multi-specificity of some serpins, but the residues and their dimension at interface in serpin-protease complexes remain elusive. Here, we present a comprehensive structural analysis of the serpin-protease interfaces using bio COmplexes COntact MAPS (COCOMAPS), PRotein Interface Conservation and Energetics (PRICE), and ProFace programs. We have carried out interface, burial, and evolutionary analysis of different serpin-protease complexes. Among the studied complexes, non-inhibitory serpins exhibit larger interface region with greater number of residue involvement as compared to the inhibitory serpins. On comparing the multi-specific serpins (antithrombin and antitrypsin), a difference in the interface area and residue number was observed, suggestive of a differential mechanism of action of these serpins in regulating their different target proteases. Further, detailed study of these multi-specific serpins listed few essential residues (common in all the complexes) and certain specificity (unique to each complex) determining residues at their interfaces. Structural mapping of interface residues suggested that individual patches with evolutionary conserved residues in specific serpins determine their specificity towards a particular protease.

  18. Kunitz-type protease inhibitors group B from Solanum palustre.

    PubMed

    Speransky, Anna S; Cimaglia, Fabio; Krinitsina, Anastasya A; Poltronieri, Palmiro; Fasano, Pasqua; Bogacheva, Anna M; Valueva, Tatiana A; Halterman, Dennis; Shevelev, Alexei B; Santino, Angelo

    2007-11-01

    Five Kunitz protease inhibitor group B genes were isolated from the genome of the diploid non-tuber-forming potato species Solanum palustre. Three of five new genes share 99% identity to the published KPI-B genes from various cultivated potato accessions, while others exhibit 96% identity. Spls-KPI-B2 and Spls-KPI-B4 proteins contain unique substitutions of the most conserved residues usually involved to trypsin and chymotrypsin-specific binding sites of Kunitz-type protease inhibitor (KPI)-B, respectively. To test the inhibition of trypsin and chymotrypsin by Spls-KPI proteins, five of them were produced in E. coli purified using a Ni-sepharose resin and ion-exchange chromatography. All recombinant Spls-KPI-B inhibited trypsin; K(i) values ranged from 84.8 (Spls-KPI-B4), 345.5 (Spls-KPI-B1), and 1310.6 nM (Spls-KPI-B2) to 3883.5 (Spls-KPI-B5) and 8370 nM (Spls-KPI-B3). In addition, Spls-KPI-B1 and Spls-KPI-B4 inhibited chymotrypsin. These data suggest that regardless of substitutions of key active-center residues both Spls-KPI-B4 and Spls-KPI-B1 are functional trypsin-chymotrypsin inhibitors.

  19. MOFzyme: Intrinsic protease-like activity of Cu-MOF

    NASA Astrophysics Data System (ADS)

    Li, Bin; Chen, Daomei; Wang, Jiaqiang; Yan, Zhiying; Jiang, Liang; Deliang Duan; He, Jiao; Luo, Zhongrui; Zhang, Jinping; Yuan, Fagui

    2014-10-01

    The construction of efficient enzyme mimetics for the hydrolysis of peptide bonds in proteins is challenging due to the high stability of peptide bonds and the importance of proteases in biology and industry. Metal-organic frameworks (MOFs) consisting of infinite crystalline lattices with metal clusters and organic linkers may provide opportunities for protease mimic which has remained unknown. Herein, we report that Cu2(C9H3O6)4/3 MOF (which is well known as HKUST-1 and denoted as Cu-MOF here), possesses an intrinsic enzyme mimicking activity similar to that found in natural trypsin to bovine serum albumin (BSA) and casein. The Michaelis constant (Km) of Cu-MOF is about 26,000-fold smaller than that of free trypsin indicating a much higher affinity of BSA for Cu-MOF surface. Cu-MOF also exhibited significantly higher catalytic efficiency than homogeneous artificial metalloprotease Cu(II) complexes and could be reused for ten times without losing in its activity. Moreover, Cu-MOF was successfully used to simulate trypsinization in cell culture since it dissociated cells in culture even without EDTA.

  20. Preliminary crystallographic analysis of avian infectious bronchitis virus main protease

    SciTech Connect

    Li, Jun; Shen, Wei; Liao, Ming; Bartlam, Mark

    2007-01-01

    The avian infectious bronchitis virus main protease has been crystallized; crystals diffract to 2.7 Å resolution. Infectious bronchitis virus (IBV) is the prototype of the genus Coronavirus. It causes a highly contagious disease which affects the respiratory, reproductive, neurological and renal systems of chickens, resulting great economic losses in the poultry industry worldwide. The coronavirus (CoV) main protease (M{sup pro}), which plays a pivotal role in viral gene expression and replication through a highly complex cascade involving the proteolytic processing of replicase polyproteins, is an attractive target for antiviral drug design. In this study, IBV M{sup pro} was overexpressed in Escherichia coli. Crystals suitable for X-ray crystallography have been obtained using microseeding techniques and belong to space group P6{sub 1}22. X-ray diffraction data were collected in-house to 2.7 Å resolution from a single crystal. The unit-cell parameters were a = b = 119.1, c = 270.7 Å, α = β = 90, γ = 120°. Three molecules were predicted to be present in the asymmetric unit from a calculated self-rotation function.

  1. Sphingosine-induced apoptosis is dependent on lysosomal proteases.

    PubMed Central

    Kågedal, K; Zhao, M; Svensson, I; Brunk, U T

    2001-01-01

    We propose a new mechanism for sphingosine-induced apoptosis, involving relocation of lysosomal hydrolases to the cytosol. Owing to its lysosomotropic properties, sphingosine, which is also a detergent, especially when protonated, accumulates by proton trapping within the acidic vacuolar apparatus, where most of its action as a detergent would be exerted. When sphingosine was added in low-to-moderate concentrations to Jurkat and J774 cells, partial lysosomal rupture occurred dose-dependently, starting within a few minutes. This phenomenon preceded caspase activation, as well as changes of mitochondrial membrane potential. High sphingosine doses rapidly caused extensive lysosomal rupture and ensuing necrosis, without antecedent apoptosis or caspase activation. The sphingosine effect was prevented by pre-treatment with another, non-toxic, lysosomotropic base, ammonium chloride, at 10 mM. The lysosomal protease inhibitors, pepstatin A and epoxysuccinyl-L-leucylamido-3-methyl-butane ethyl ester ('E-64d'), inhibited markedly sphingosine-induced caspase activity to almost the same degree as the general caspase inhibitor benzyloxycarbonyl-Val-Ala-DL-Asp-fluoromethylketone ('Z-VAD-FMK'), although they did not by themselves inhibit caspases. We conclude that cathepsin D and one or more cysteine proteases, such as cathepsins B or L, are important mediators of sphingosine-induced apoptosis, working upstream of the caspase cascade and mitochondrial membrane-potential changes. PMID:11583579

  2. Recent patents on microbial proteases for the dairy industry.

    PubMed

    Feijoo-Siota, Lucía; Blasco, Lucía; Rodríguez-Rama, José Luis; Barros-Velázquez, Jorge; Miguel, Trinidad de; Sánchez-Pérez, Angeles; Villa, Tomás G

    2014-01-01

    This paper reviews the general characteristics of exo and endopeptidases of microbial origin currently used in the milk industry. It also includes recent patents developed either to potentiate the enzymatic activity or to improve the resulting milk derivatives. The main application of these proteases is in the cheese-making industry. Although this industry preferentially uses animal rennets, and in particular genetically engineered chymosins, it also utilizes milk coagulants of microbial origin. Enzymes derived from Rhizomucor miehei, Rhizomucor pusillus and Cryphonectria parasitica are currently used to replace the conventional milk-clotting enzymes. In addition, the dairy industry uses microbial endo and exoproteases for relatively new applications, such as debittering and flavor generation in cheese, accelerated cheese ripening, manufacture of protein hydrolysates with improved functional properties, and production of enzyme-modified cheeses. Lactic acid bacteria play an essential role in these processes, hence these bacteria and the proteases they produce are currently being investigated by the dairy industry and are the subject of many of their patent applications.

  3. The Early Years of Retroviral Protease Crystal Structures

    PubMed Central

    Miller, Maria

    2010-01-01

    Soon after its discovery, the attempts to develop anti-AIDS therapeutics focused on the retroviral protease (PR) — an enzyme used by lentiviruses to process the precursor polypeptide into mature viral proteins. An urgent need for the three-dimensional structure of PR to guide rational drug design prompted efforts to produce milligram quantities of this enzyme. However, only minute amounts of PR were present in the HIV-1 and HIV-2 viruses, and initial attempts to express this protein in bacteria were not successful. This review describes X-ray crystallographic studies of the retroviral proteases carried out at NCI-Frederick in the late 1980s and early 1990s and puts into perspective the crucial role that the total protein chemical synthesis played in unraveling the structure, mechanism of action, and inhibition of HIV-1 PR. Notably, the first fully correct structure of HIV-1 PR and the first cocrystal structure of its complex with an inhibitor (a substrate-derived, reduced isostere hexapeptide MVT-101) were determined using chemically synthesized protein. Most importantly, these sets of coordinates were made freely available to the research community and were used worldwide to solve X-ray structures of HIV-1 PR complexes with an array of inhibitors and set in motion a variety of theoretical studies. Publication of the structure of chemically synthesized HIV-1 PR complexed with MVT-101 preceded only by six years the approval of the first PR inhibitor as an anti-AIDS drug. PMID:20593466

  4. Design of HIV Protease Inhibitors Based on Inorganic Polyhedral Metallacarboranes

    SciTech Connect

    Rezacova, Pavlina; Pokorna, Jana; Brynda, Ji; Kozisek, Milan; Cigler, Petr; Lesik, Martin; Fanfrlik, Jindrich; Rezac, Jan; Saskova, Klara Grantz; Sieglova, Irena; Plesek, Jaromir; Sicha, Vaclav; Gruner, Bohumir; Oberwinkler, Heike; Sedlacek, Juraj; Krausslich, Hans-Georg; Hobza, Pavel; Kral, Vladimir; Konvalinka, Jan

    2010-04-19

    HIV protease (HIV PR) is a primary target for anti-HIV drug design. We have previously identified and characterized substituted metallacarboranes as a new class of HIV protease inhibitors. In a structure-guided drug design effort, we connected the two cobalt bis(dicarbollide) clusters with a linker to substituted ammonium group and obtained a set of compounds based on a lead formula [H{sub 2}N-(8-(C{sub 2}H{sub 4}O){sub 2}-1,2-C{sub 2}B{sub 9}H{sub 10})(1',2'-C{sub 2}B{sub 9}H{sub 11})-3,3'-Co){sub 2}]Na. We explored inhibition properties of these compounds with various substitutions, determined the HIV PR:inhibitor crystal structure, and computationally explored the conformational space of the linker. Our results prove the capacity of linker-substituted dual-cage cobalt bis(dicarbollides) as lead compounds for design of more potent inhibitors of HIV PR.

  5. MOFzyme: Intrinsic protease-like activity of Cu-MOF.

    PubMed

    Li, Bin; Chen, Daomei; Wang, Jiaqiang; Yan, Zhiying; Jiang, Liang; Deliang Duan; He, Jiao; Luo, Zhongrui; Zhang, Jinping; Yuan, Fagui

    2014-10-24

    The construction of efficient enzyme mimetics for the hydrolysis of peptide bonds in proteins is challenging due to the high stability of peptide bonds and the importance of proteases in biology and industry. Metal-organic frameworks (MOFs) consisting of infinite crystalline lattices with metal clusters and organic linkers may provide opportunities for protease mimic which has remained unknown. Herein, we report that Cu₂(C₉H₃O₆)₄/₃ MOF (which is well known as HKUST-1 and denoted as Cu-MOF here), possesses an intrinsic enzyme mimicking activity similar to that found in natural trypsin to bovine serum albumin (BSA) and casein. The Michaelis constant (Km) of Cu-MOF is about 26,000-fold smaller than that of free trypsin indicating a much higher affinity of BSA for Cu-MOF surface. Cu-MOF also exhibited significantly higher catalytic efficiency than homogeneous artificial metalloprotease Cu(II) complexes and could be reused for ten times without losing in its activity. Moreover, Cu-MOF was successfully used to simulate trypsinization in cell culture since it dissociated cells in culture even without EDTA.

  6. Extracellular trypsin-like proteases produced by Cordyceps militaris.

    PubMed

    Hattori, Maki; Isomura, Shigeki; Yokoyama, Eiji; Ujita, Minoru; Hara, Akira

    2005-12-01

    A trypsin-like protease, P-1-1, was purified from the culture supernatant of the fungus Cordyceps militaris by (NH(4))(2)SO(4) precipitation, chromatography on DEAE Bio-Gel Agarose, TSKgel CM-5PW, and gel-filtration with HiLoad 26/60 Superdex 75 pg, and its properties were examined. Purified P-1-1 showed a single band by SDS-PAGE and was estimated to have a molecular mass of 23,405 by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS). The optimum pH of the enzyme was between 8.5 and 12.0. It was inhibited strongly by leupeptin and diisopropyl fluorophosphate (DFP), and definitely did by N(alpha)-tosyl-L-lysine chloromethyl ketone hydrochloride (TLCK), phenylmethanesulfonyl fluoride (PMSF) and chymostatin. The carbonyl group sides of Arg and Lys were confirmed as the sites of cleavage by the enzyme toward cecropin B. These results indicate that P-1-1 is a trypsin-type serine protease. The N-terminal amino acid sequence of P-1-1 showed a high homology with those of trypsins or chymotrypsin derived from Diptera insects.

  7. Targeting the AKT pathway: Repositioning HIV protease inhibitors as radiosensitizers.

    PubMed

    Goda, Jayant S; Pachpor, Tejaswini; Basu, Trinanjan; Chopra, Supriya; Gota, Vikram

    2016-02-01

    Cellular resistance in tumour cells to different therapeutic approaches has been a limiting factor in the curative treatment of cancer. Resistance to therapeutic radiation is a common phenomenon which significantly reduces treatment options and impacts survival. One of the mechanisms of acquiring resistance to ionizing radiation is the overexpression or activation of various oncogenes like the EGFR (epidermal growth factor receptor), RAS (rat sarcoma) oncogene or loss of PTEN (phosphatase and tensin homologue) which in turn activates the phosphatidyl inositol 3-kinase/protein kinase B (PI3-K)/AKT pathway responsible for radiation resistance in various tumours. Blocking the pathway enhances the radiation response both in vitro and in vivo. Due to the differential activation of this pathway (constitutively activated in tumour cells and not in the normal host cells), it is an excellent candidate target for molecular targeted therapy to enhance radiation sensitivity. In this regard, HIV protease inhibitors (HPIs) known to interfere with PI3-K/AKT signaling in tumour cells, have been shown to sensitize various tumour cells to radiation both in vitro and in vivo. As a result, HPIs are now being investigated as possible radiosensitizers along with various chemotherapeutic drugs. This review describes the mechanisms by which PI3-K/AKT pathway causes radioresistance and the role of HIV protease inhibitors especially nelfinavir as a potential candidate drug to target the AKT pathway for overcoming radioresistance and its use in various clinical trials for different malignancies.

  8. Targeting the AKT pathway: Repositioning HIV protease inhibitors as radiosensitizers

    PubMed Central

    Goda, Jayant S.; Pachpor, Tejaswini; Basu, Trinanjan; Chopra, Supriya; Gota, Vikram

    2016-01-01

    Cellular resistance in tumour cells to different therapeutic approaches has been a limiting factor in the curative treatment of cancer. Resistance to therapeutic radiation is a common phenomenon which significantly reduces treatment options and impacts survival. One of the mechanisms of acquiring resistance to ionizing radiation is the overexpression or activation of various oncogenes like the EGFR (epidermal growth factor receptor), RAS (rat sarcoma) oncogene or loss of PTEN (phosphatase and tensin homologue) which in turn activates the phosphatidyl inositol 3-kinase/protein kinase B (PI3-K)/AKT pathway responsible for radiation resistance in various tumours. Blocking the pathway enhances the radiation response both in vitro and in vivo. Due to the differential activation of this pathway (constitutively activated in tumour cells and not in the normal host cells), it is an excellent candidate target for molecular targeted therapy to enhance radiation sensitivity. In this regard, HIV protease inhibitors (HPIs) known to interfere with PI3-K/AKT signaling in tumour cells, have been shown to sensitize various tumour cells to radiation both in vitro and in vivo. As a result, HPIs are now being investigated as possible radiosensitizers along with various chemotherapeutic drugs. This review describes the mechanisms by which PI3-K/AKT pathway causes radioresistance and the role of HIV protease inhibitors especially nelfinavir as a potential candidate drug to target the AKT pathway for overcoming radioresistance and its use in various clinical trials for different malignancies. PMID:27121513

  9. Botulinum neurotoxin devoid of receptor binding domain translocates active protease.

    PubMed

    Fischer, Audrey; Mushrush, Darren J; Lacy, D Borden; Montal, Mauricio

    2008-12-01

    Clostridium botulinum neurotoxin (BoNT) causes flaccid paralysis by disabling synaptic exocytosis. Intoxication requires the tri-modular protein to undergo conformational changes in response to pH and redox gradients across endosomes, leading to the formation of a protein-conducting channel. The approximately 50 kDa light chain (LC) protease is translocated into the cytosol by the approximately 100 kDa heavy chain (HC), which consists of two modules: the N-terminal translocation domain (TD) and the C-terminal Receptor Binding Domain (RBD). Here we exploited the BoNT modular design to identify the minimal requirements for channel activity and LC translocation in neurons. Using the combined detection of substrate proteolysis and single-channel currents, we showed that a di-modular protein consisting only of LC and TD was sufficient to translocate active protease into the cytosol of target cells. The RBD is dispensable for cell entry, channel activity, or LC translocation; however, it determined a pH threshold for channel formation. These findings indicate that, in addition to its individual functions, each module acts as a chaperone for the others, working in concert to achieve productive intoxication.

  10. Sparse Representation for Prediction of HIV-1 Protease Drug Resistance.

    PubMed

    Yu, Xiaxia; Weber, Irene T; Harrison, Robert W

    2013-01-01

    HIV rapidly evolves drug resistance in response to antiviral drugs used in AIDS therapy. Estimating the specific resistance of a given strain of HIV to individual drugs from sequence data has important benefits for both the therapy of individual patients and the development of novel drugs. We have developed an accurate classification method based on the sparse representation theory, and demonstrate that this method is highly effective with HIV-1 protease. The protease structure is represented using our newly proposed encoding method based on Delaunay triangulation, and combined with the mutated amino acid sequences of known drug-resistant strains to train a machine-learning algorithm both for classification and regression of drug-resistant mutations. An overall cross-validated classification accuracy of 97% is obtained when trained on a publically available data base of approximately 1.5×10(4) known sequences (Stanford HIV database http://hivdb.stanford.edu/cgi-bin/GenoPhenoDS.cgi). Resistance to four FDA approved drugs is computed and comparisons with other algorithms demonstrate that our method shows significant improvements in classification accuracy.

  11. Regulation of neurotoxin and protease formation in Clostridium botulinum Okra B and Hall A by arginine.

    PubMed Central

    Patterson-Curtis, S I; Johnson, E A

    1989-01-01

    Supplementation of a minimal medium with high levels of arginine (20 g/liter) markedly decreased neurotoxin titers and protease activities in cultures of Clostridium botulinum Okra B and Hall A. Nitrogenous nutrients that are known to be derived from arginine, including proline, glutamate, and ammonia, also decreased protease and toxin but less so than did arginine. Proteases synthesized during growth were rapidly inactivated after growth stopped in media containing high levels of arginine. Separation of extracellular proteins by electrophoresis and immunoblots with antibodies to toxin showed that the decrease in toxin titers in media containing high levels of arginine was caused by both reduced synthesis of protoxin and impaired proteolytic activation. In contrast, certain other nutritional conditions stimulated protease and toxin formation in C. botulinum and counteracted the repression by arginine. Supplementation of the minimal medium with casein or casein hydrolysates increased protease activities and toxin titers. Casein supplementation of a medium containing high levels of arginine prevented protease inactivation. High levels of glucose (50 g/liter) also delayed the inactivation of proteases in both the minimal medium and a medium containing high levels of arginine. These observations suggest that the availability of nitrogen and energy sources, particularly arginine, affects the production and proteolytic processing of toxins and proteases in C. botulinum. Images PMID:2669631

  12. Purification and characterization of Bacillus cereus protease suitable for detergent industry.

    PubMed

    Prakash, Monika; Banik, Rathindra Mohan; Koch-Brandt, Claudia

    2005-12-01

    An extracellular alkaline protease from an alkalophilic bacterium, Bacillus cereus, was produced in a large amount by the method of extractive fermentation. The protease is thermostable, pH tolerant, and compatible with commercial laundry detergents. The protease purified and characterized in this study was found to be superior to endogenous protease already present in commercial laundry detergents. The enzyme was purified to homogeneity by ammonium sulfate precipitation, concentration by ultrafiltration, anion-exchange chromatography, and gel filtration. The purified enzyme had a specific activity of 3256.05 U/mg and was found to be a monomeric protein with a molecular mass of 28 and 31 kDa, as estimated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and nondenaturing PAGE, respectively. Its maximum protease activity against casein was found to be at pH 10.5 and 50 degrees C. Proteolytic activity of the enzyme was detected by casein and gelatin zymography, which gave a very clear protease activity zone on gel that corresponded to the band obtained on SDS-PAGE and nondenaturing PAGE with a molecular mass of nearly 31 kDa. The purified enzyme was analyzed through matrix-assisted laser desorption ionization-time-of-flight-mass spectrometry (MALDI-TOF-MS) and identified as a subtilisin class of protease. Specific serine protease inhibitors, suggesting the presence of serine residues at the active site, inhibited the enzyme significantly.

  13. Biochemical analysis and investigation on the prospective applications of alkaline protease from a Bacillus cereus strain.

    PubMed

    Saleem, Mahjabeen; Rehman, Atiqa; Yasmin, Riffat; Munir, Bushra

    2012-06-01

    Proteases have prospective financial and environment-friendly applications; hence attention is focused currently on the finding of new protease producing microorganism so as to meet the requirements of industry. A thermophilic bacterial strain producing extracellular protease activity was isolated from soil and identified as Bacillus cereus by analysis of 16S rRNA. Protease production by the microorganism was improved by studying the impact of the type of nitrogen and carbon source, fermentation period, growth temperature and initial pH of the culture medium in cultivation optimization experiments. The enzyme was purified to homogeneity in two step procedure involving Sephadex G-75 and Q-Sepharose chromatography. The molecular weight of purified enzyme was found to be 58 kDa by SDS-PAGE. Protease exhibited a pH and temperature optima of 7.5 and 60°, respectively. The enzyme was active in the pH range of 6.0-9.0 and stable up to 70°C. Histological analysis of protease treated goat and cow skin pelts showed complete removal of non leather forming structures such as hair shaft, hair follicles and glandular structures. The protease showed the stain removing property from blood stained cotton cloth and found to be compatible with six commercially available detergents. The protease could release peptides from natural proteins after digestion of coagulated egg albumin and blood clot.

  14. Crystal Structure of a Novel Viral Protease with a Serine/Lysine Catalytic Dyad Mechanism

    SciTech Connect

    Feldman,A.; Lee, J.; Delmas, B.; Paetzel, M.

    2006-01-01

    The blotched snakehead virus (BSNV), an aquatic birnavirus, encodes a polyprotein (NH2-pVP2-X-VP4-VP3-COOH) that is processed through the proteolytic activity of its own protease (VP4) to liberate itself and the viral proteins pVP2, X and VP3. The protein pVP2 is further processed by VP4 to give rise to the capsid protein VP2 and four structural peptides. We report here the crystal structure of a VP4 protease from BSNV, which displays a catalytic serine/lysine dyad in its active site. This is the first crystal structure of a birnavirus protease and the first crystal structure of a viral protease that utilizes a lysine general base in its catalytic mechanism. The topology of the VP4 substrate binding site is consistent with the enzymes substrate specificity and a nucleophilic attack from the si-face of the substrates scissile bond. Despite low levels of sequence identity, VP4 shows similarities in its active site to other characterized Ser/Lys proteases such as signal peptidase, LexA protease and Lon protease. Together, the structure of VP4 provides insights into the mechanism of a recently characterized clan of serine proteases that utilize a lysine general base and reveals the structure of potential targets for antiviral therapy, especially for other related and economically important viruses, such as infectious bursal disease virus in poultry and infectious pancreatic necrosis virus in aquaculture.

  15. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Mixed carbohydrase and protease enzyme product... enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes... current good manufacturing practice conditions of use: (1) The ingredient is used as an enzyme, as...

  16. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Mixed carbohydrase and protease enzyme product... enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes... current good manufacturing practice conditions of use: (1) The ingredient is used as an enzyme, as...

  17. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Mixed carbohydrase and protease enzyme product... enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes... current good manufacturing practice conditions of use: (1) The ingredient is used as an enzyme, as...

  18. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Mixed carbohydrase and protease enzyme product. 184... enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes... current good manufacturing practice conditions of use: (1) The ingredient is used as an enzyme, as...

  19. Full quantum mechanical study of binding of HIV-1 protease drugs

    NASA Astrophysics Data System (ADS)

    Zhang, Da W.; Zhang, John Z. H.

    Fully quantum mechanical studies of detailed binding interactions between HIV-1 protease and six FDA (Food and Drug Administration)-approved drugs (saquinavir, indinavir, ritonavir, nelfinavir, amprenavir, and lopinavir) are carried out using a recently developed MFCC (molecular fractionation with conjugate caps) method. The MFCC calculation produces a quantum mechanical interaction spectrum for any protease drug binding complex. Detailed quantitative analysis on binding of lopinavir to specific residues of the protease is given from the current study. The present calculation shows that the dominant binding of lopinavir to the protease is through the formation of a strong hydrogen bond between the central hydroxyl group of the drug to the aspartate oxygen of Asp25 in one of the two chains of the protease (A chain). This is closely followed by hydrogen binding of the drug to Asp29 in the B chain and somewhat weak hydrogen bonding to Asp30, Gly27, Gly48, and Ile50 in both chains. By partitioning all six drugs into four building blocks besides the central component containing the hydroxyl group, MFCC calculation finds that block III has essentially no binding interaction with the protease and the major binding interactions of these drugs are from blocks II and IV, in addition to the dominant central hydroxyl group. This det